WorldWideScience

Sample records for g-quadruplex dna ligands

  1. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  2. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  3. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  4. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  5. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  6. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  7. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  9. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  10. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  11. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  12. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  13. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  14. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  15. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  16. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  17. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  18. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  20. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  1. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  2. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  3. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  4. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  5. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  6. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  7. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  8. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  9. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  10. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  11. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  12. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  13. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  14. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  16. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  17. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  18. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  19. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  1. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  2. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  3. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  6. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  7. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  8. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  9. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  10. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  11. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  12. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  14. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  16. Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.

    Science.gov (United States)

    Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro

    2012-04-14

    The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012

  17. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  18. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  19. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  20. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  1. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  2. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  3. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  5. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  6. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  7. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  8. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  9. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  10. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  11. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  12. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  13. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  14. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  18. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  19. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  2. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  4. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  5. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  6. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  8. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  9. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  10. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  11. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  12. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  13. The estimation of H-bond and metal ion-ligand interaction energies in the G-Quadruplex ⋯ Mn+ complexes

    Science.gov (United States)

    Mostafavi, Najmeh; Ebrahimi, Ali

    2018-06-01

    In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.

  14. Circular Dichroism of G-Quadruplex: A Laboratory Experiment for the Study of Topology and Ligand Binding

    Science.gov (United States)

    Carvalho, Josue´; Queiroz, João A.; Cruz, Carla

    2017-01-01

    Circular dichroism (CD) has emerged as one of the standard biophysical techniques for the study of guaninequadruplex (G4) folding, cation effect, and ligand binding. The utility of this technique is based on its robustness, ease of use, and requirement of only small quantities of nucleic acid. This experiment is also extendable to the classroom…

  15. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  16. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  18. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  19. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  20. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  1. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  2. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  3. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  4. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  5. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  6. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  8. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  10. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  11. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  12. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  13. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  14. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc00361g Click here for additional data file.

    Science.gov (United States)

    Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei

    2017-01-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564

  15. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  16. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  17. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  18. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  19. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  20. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  1. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  3. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  4. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  7. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  8. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  9. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  10. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  13. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  14. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015

  15. Radiobiology with DNA ligands

    International Nuclear Information System (INIS)

    Weinreich, R.; Argentini, M.; Guenther, I.; Koziorowski, J.; Larsson, B.; Nievergelt-Egido, M.C.; Salt, C.; Wyer, L.; Dos Santos, D.F.; Hansen, H.J.

    1997-01-01

    The paper deals with the following topics: labelling of DNA ligands and other tumour-affinic compounds with 4.15-d 124 I, radiotoxicity of Hoechst 33258 and 33342 and of iodinated Hoechst 33258 in cell cultures, preparation of 76 Br-, 123 I-, and 221 At-labelled 5-halo-2'-deoxyuridine, chemical syntheses of boron derivatives of Hoechst 33258.III., Gadolinium neutron capture therapy

  16. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  18. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  20. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  1. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  2. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  3. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  4. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  6. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  8. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  9. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  10. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  12. p53 binds human telomeric G-quadruplex in vitro

    Czech Academy of Sciences Publication Activity Database

    Adámik, Matěj; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 128, SEPT2016 (2016), s. 83-91 ISSN 0300-9084 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP14-33947P Institutional support: RVO:68081707 Keywords : crystal-structure * human-chromosomes * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2016

  13. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  14. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  15. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  16. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  18. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

    Science.gov (United States)

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

    2017-11-29

    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  19. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  20. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  1. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  2. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  3. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  5. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  6. Targeting C-Myc Promoter: Helquats As Novel G-Quadruplex Stabilizing Ligands

    Czech Academy of Sciences Publication Activity Database

    Kužmová, Erika; Kozák, Jaroslav; Komárková, Veronika; Pytlík, R.; Teplý, Filip; Hájek, Miroslav

    2014-01-01

    Roč. 124, č. 21 (2014) ISSN 0006-4971. [Annual Meeting of the American Society of Hematology /56./. 06.12.2014-09.12.2014, San Francisco] Institutional support: RVO:61388963 Keywords : helquats * C-Myc * leukemia Subject RIV: CE - Biochemistry

  7. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  9. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  10. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

    Science.gov (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

    2014-09-03

    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  11. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  12. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  13. Molecular recognition of naphthalene diimide ligands by telomeric quadruplex-DNA: the importance of the protonation state and mediated hydrogen bonds.

    Science.gov (United States)

    Spinello, A; Barone, G; Grunenberg, J

    2016-01-28

    In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.

  14. Radiation sensitization by an iodine-labelled DNA ligand

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R F; Murray, V; D' Cunha, G; Pardee, M; Haigh, A; Hodgson, G S [Peter MacCallum Cancer Inst., Melbourne (Australia); Kampouris, E; Kelly, D P [Melbourne Univ., Parkville (Australia)

    1990-05-01

    An iodinated DNA ligand, iodoHoechst 33258, which binds in the minor groove of DNA, enhances DNA strand breakage and cell killing by UV-A irradiation. The sites of UV-induced strand breaks reflect the known sequence specificity of the ligand. (author).

  15. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  16. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  17. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...

  18. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  19. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  20. Oligomer formation and G-quadruplex binding by purified murine Rif1 protein, a key organizer of higher-order chromatin architecture.

    Science.gov (United States)

    Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao

    2018-03-09

    Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Delineation of G-Quadruplex Alkylation Sites Mediated by 3,6-Bis(1-methyl-4-vinylpyridinium iodide)carbazole-Aniline Mustard Conjugates.

    Science.gov (United States)

    Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen

    2015-11-23

    A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Cytotoxicity of an 125I-labelled DNA ligand

    International Nuclear Information System (INIS)

    Karagiannis, T.C.; Lobachevsky, P.N.; Martin, R.F.

    2000-01-01

    The subcellular distribution and cytotoxicity of a DNA-binding ligand [ 125 I]-Hoechst 33258 following incubation of K562 cells with the drug was investigated. The ability of a radical scavenger, dimethyl sulphoxide, to protect cells from the 125 I-decay induced cell death was also studied. Three different concentrations and specific activities of the drug were used to provide different ligand : DNA binding ratios. The results demonstrated a trend toward improved delivery of the ligand to the nucleus and to chromatin at higher ligand concentrations, with concomitant increased sensitivity to 125 I-decay induced cytotoxicity and decreased protection by dimethyl sulphoxide. This correlation of radiobiological parameters with subcellular drug distribution is consistent with the classical dogma that attributes cytotoxicity to DNA double-stranded breakage in the vicinity of the site of decay, where the high LET nature of the damage confers minimal sensitivity to radical scavenging

  3. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  4. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    DEFF Research Database (Denmark)

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  6. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  7. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents

    Czech Academy of Sciences Publication Activity Database

    Belmonte-Reche, E.; Martínez-García, M.; Guédin, A.; Zuffo, M.; Arevalo-Ruiz, M.; Doria, F.; Campos-Salinas, J.; Maynadier, M.; Lopez-Rubio, J.J.; Freccero, M.; Mergny, Jean-Louis; Maria Perez-Victoria, J.; Carlos Morales, J.

    2018-01-01

    Roč. 61, č. 3 (2018), s. 1231-1240 ISSN 0022-2623 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : terminal repeat promoter * plasmodium-falciparum Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 6.259, year: 2016

  8. Ultrasensitive photoelectrochemical aptasensor for lead ion detection based on sensitization effect of CdTe QDs on MoS2-CdS:Mn nanocomposites by the formation of G-quadruplex structure.

    Science.gov (United States)

    Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie

    2018-06-01

    An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  10. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes

    NARCIS (Netherlands)

    van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M

    2018-01-01

    Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing

  11. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

  12. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  13. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  14. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  15. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  16. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  17. Human telomeric G-quadruplex formation and highly selective fluorescence detection of toxic strontium ions.

    Science.gov (United States)

    Qu, Konggang; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2012-03-01

    Strontium ions play important roles in biological systems. The inhalation of strontium can cause severe respiratory difficulties, anaphylactic reaction and extreme tachycardia. Strontium can replace calcium in organisms, inhibit normal calcium absorption and induce strontium "rickets" in childhood. Thus, the development of sensitive and selective methods for the determination of trace amounts of Sr(2+) in aqueous media is of considerable importance for environmental and human health protection. A number of methodologies, such as X-ray energy dispersive spectrometry, inductively coupled argon plasma atomic emission spectroscopy (ICP-AES), atomic absorption spectrometry (AAS) and instrumental thermal neutron activation analysis, have been reported. However, these methods are somewhat complex, costly, time consuming and, especially, need special instruments. Thus, the design of convenient and inexpensive approaches for the sensitive and selective detection of Sr(2+) with rapid, easy manipulation is in ever-increasing demand. To the best of our knowledge, using DNA conformational change to detect Sr(2+) has not yet been reported. Herein we utilized thiazole orange (TO) as a signal reporter to devise a simple Sr(2+) detection assay based on Sr(2+) induced human telomeric DNA conformational change in the presence of SWNTs. The limit of detection is 10 nM Sr(2+) (0.87 μg L(-1)), far below 4 mg L(-1), the U.S. Federal threshold in drinking water defined by the U.S. EPA.

  18. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  19. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs

    DEFF Research Database (Denmark)

    Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I

    2014-01-01

    Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...

  1. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  2. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    Science.gov (United States)

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  4. Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

    Science.gov (United States)

    Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

    2015-03-28

    Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

  5. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  6. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  9. Nucleotide-mimetic synthetic ligands for DNA-recognizing enzymes One-step purification of Pfu DNA polymerase.

    Science.gov (United States)

    Melissis, S; Labrou, N E; Clonis, Y D

    2006-07-28

    The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.

  10. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  11. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    Energy Technology Data Exchange (ETDEWEB)

    Fagan, Patricia A. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1 ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.

  12. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    Science.gov (United States)

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  14. Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers

    KAUST Repository

    Sun, Lu; Frykholm, Karolin; Fornander, Louise H.; Svedhem, Sofia; Westerlund, Fredrik; Å kerman, Bjö rn

    2014-01-01

    © 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions

  15. Improved Inhibition of Telomerase by Short Twisted Intercalating Nucleic Acids under Molecular Crowding Conditions

    DEFF Research Database (Denmark)

    Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich

    2012-01-01

    Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...

  16. Influence of CCR7 ligand DNA preexposure on the magnitude and duration of immunity

    International Nuclear Information System (INIS)

    Lee, Yunsang; Seong, Kug Eo; Rouse, Richard J.D.; Rouse, Barry T.

    2003-01-01

    The CC chemokine receptor (CCR) 7 ligands CCL21 and CCL19 were recently described as essential elements for establishing the microenvironment needed to initiate optimal immune responses in secondary lymphoid tissues. In the present study we have kinetically investigated the primary responses of naive DO11.10 TCR-transgenic CD4+ T cells (OVA323-339 peptide specific) adoptively transferred into normal BALB/c mice given plasmid DNA encoding CCR7 ligands. The primary responses of CD4+ Tg-T cells in CCR7 ligand DNA recipients occurred more promptly, reaching levels higher than those observed in vector controls. In line with enhanced specific immunity, the T-cell population in CCR7 ligand recipients underwent more in vivo cell division following Ag stimulation, and a higher percentage of Ag-specific T cells expressed an activation phenotype. Moreover, the enhanced primary responses of naive CD4+ T cells appeared to act via affects on migration and maturation of CD11c+ dendritic cells in the draining lymph nodes. In addition following mucosal challenge of herpes simplex virus-immune mice with virus, those that had received CCL21 or CCL19 during priming contained a higher frequency of responding CD4 T cells in lymph nodes and the site of infection. Moreover, CCL21- and CCL19-treated mice showed less severe disease and better survival following challenge. Our results are discussed in terms of the relevance of CCR7 ligand preimmunization to improve vaccine

  17. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  18. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    Science.gov (United States)

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  19. Effects of a piperidine ligand on DNA modification by antitumor cisplatin analogues

    Czech Academy of Sciences Publication Activity Database

    Kašpárková, Jana; Nováková, Olga; Najajreh, Y.; Gibson, D.; Perez, J.M.; Brabec, Viktor

    2003-01-01

    Roč. 16, č. 11 (2003), s. 1424-1432 ISSN 0893-228X R&D Projects: GA ČR GA305/02/1552; GA AV ČR KJB5004301; GA AV ČR IBS5004009 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * piperidine ligand * antitumor cisplatin analogues Subject RIV: BO - Biophysics Impact factor: 3.332, year: 2003

  20. Structural revisions of small molecules reported to cross-link G-quadruplex DNA in vivo reveal a repetitive assignment error in the literature

    Czech Academy of Sciences Publication Activity Database

    Reyes Gutierrez, Paul Eduardo; Kapal, Tomáš; Klepetářová, Blanka; Šaman, David; Pohl, Radek; Zawada, Zbigniew; Kužmová, Erika; Hájek, Miroslav; Teplý, Filip

    2016-01-01

    Roč. 6, Mar 23 (2016), č. článku 23499. ISSN 2045-2322 R&D Projects: GA ČR GA13-19213S; GA MŠk LO1302 Grant - others:AV ČR(CZ) M200551208 Institutional support: RVO:61388963 Keywords : 1,2-disubstituted benzimidazoles * chemical synthesis * promoter region Subject RIV: CC - Organic Chemistry Impact factor: 4.259, year: 2016 http://www.nature.com/articles/srep23499

  1. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-01-01

    Roč. 12, č. 4 (2016), s. 2000-2016 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * quantum-chemical computations * continuum solvation models Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  2. A Ligand Structure-Activity Study of DNA-Based Catalytic Asymmetric Hydration and Diels-Alder Reactions

    NARCIS (Netherlands)

    Rosati, F.; Roelfes, J.G.

    A structure-activity relationship study of the first generation ligands for the DNA-based asymmetric hydration of enones and Diels-Alder reaction in water is reported. The design of the ligand was optimized resulting in a maximum ee of 83% in the hydration reaction and 75% in the Diels-Alder

  3. Dynamic translocation of ligand-complexed DNA through solid-state nanopores with optical tweezers

    International Nuclear Information System (INIS)

    Sischka, Andy; Spiering, Andre; Anselmetti, Dario; Khaksar, Maryam; Laxa, Miriam; Koenig, Janine; Dietz, Karl-Josef

    2010-01-01

    We investigated the threading and controlled translocation of individual lambda-DNA (λ-DNA) molecules through solid-state nanopores with piconewton force sensitivity, millisecond time resolution and picoampere ionic current sensitivity with a set-up combining quantitative 3D optical tweezers (OT) with electrophysiology. With our virtually interference-free OT set-up the binding of RecA and single peroxiredoxin protein molecules to λ-DNA was quantitatively investigated during dynamic translocation experiments where effective forces and respective ionic currents of the threaded DNA molecule through the nanopore were measured during inward and outward sliding. Membrane voltage-dependent experiments of reversible single protein/DNA translocation scans yield hysteresis-free, asymmetric single-molecule fingerprints in the measured force and conductance signals that can be attributed to the interplay of optical trap and electrostatic nanopore potentials. These experiments allow an exact localization of the bound protein along the DNA strand and open fascinating applications for label-free detection of DNA-binding ligands, where structural and positional binding phenomena can be investigated at a single-molecule level.

  4. Lanthanide mixed ligand chelates for DNA profiling and latent fingerprint detection

    Science.gov (United States)

    Menzel, E. R.; Allred, Clay

    1997-02-01

    It is our aim to develop a universally applicable latent fingerprint detection method using lanthanide (rare-earth) complexes as a source of luminescence. Use of these lanthanide complexes offers advantages on several fronts, including benefits from large Stokes shifts, long luminescence lifetimes, narrow emissions, ability of sequential assembly of complexes, and chemical variability of the ligands. Proper exploitation of these advantages would lead to a latent fingerprint detection method superior to any currently available. These same characteristics also lend themselves to many of the problems associated with DNA processing in the forensic science context.

  5. Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

    Science.gov (United States)

    Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

    2017-12-15

    Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Synthesis, Characterization, DNA Interaction, and Antitumor Activities of La (III) Complex with Schiff Base Ligand Derived from Kaempferol and Diethylenetriamine.

    Science.gov (United States)

    Wang, Qin; Huang, Yu; Zhang, Jin-Sheng; Yang, Xin-Bin

    2014-01-01

    A novel La (III) complex, [LaL(H2O)3]NO3 ·3H2O, with Schiff base ligand L derived from kaempferol and diethylenetriamine, has been synthesized and characterized by elemental analysis, IR, UV-visible, (1)H NMR, thermogravimetric analysis, and molar conductance measurements. The fluorescence spectra, circular dichroism spectra, and viscosity measurements and gel electrophoresis experiments indicated that the ligand L and La (III) complex could bind to CT-DNA presumably via intercalative mode and the La (III) complex showed a stronger ability to bind and cleave DNA than the ligand L alone. The binding constants (K b ) were evaluated from fluorescence data and the values ranged from 0.454 to 0.659 × 10(5) L mol(-1) and 1.71 to 17.3 × 10(5) L mol(-1) for the ligand L and La (III) complex, respectively, in the temperature range of 298-310 K. It was also found that the fluorescence quenching mechanism of EB-DNA by ligand L and La (III) complex was a static quenching process. In comparison to free ligand L, La (III) complex exhibited enhanced cytotoxic activities against tested tumor cell lines HL-60 and HepG-2, which may correlate with the enhanced DNA binding and cleaving abilities of the La (III) complex.

  7. Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers

    KAUST Repository

    Sun, Lu

    2014-10-16

    © 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film

  8. Evaluation of DNA binding, DNA cleavage, protein binding, radical scavenging and in vitro cytotoxic activities of ruthenium(II) complexes containing 2,4-dihydroxy benzylidene ligands

    Energy Technology Data Exchange (ETDEWEB)

    Mohanraj, Maruthachalam; Ayyannan, Ganesan; Raja, Gunasekaran; Jayabalakrishnan, Chinnasamy, E-mail: drcjbstar@gmail.com

    2016-12-01

    The new ruthenium(II) complexes with hydrazone ligands, 4-Methyl-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 1}), 4-Methoxy-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 2}), 4-Bromo-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 3}), were synthesized and characterized by various spectro analytical techniques. The molecular structures of the ligands were confirmed by single crystal X-ray diffraction technique. The DNA binding studies of the ligands and complexes were examined by absorption, fluorescence, viscosity and cyclic voltammetry methods. The results indicated that the ligands and complexes could interact with calf thymus DNA (CT-DNA) through intercalation. The DNA cleavage activity of the complexes was evaluated by gel electrophoresis assay, which revealed that the complexes are good DNA cleaving agents. The binding interaction of the ligands and complexes with bovine serum albumin (BSA) was investigated using fluorescence spectroscopic method. Antioxidant studies showed that the complexes have a strong radical scavenging properties. Further, the cytotoxic effect of the complexes examined on cancerous cell lines showed that the complexes exhibit significant anticancer activity. - Highlights: • Synthesis of ruthenium(II) hydrazone complexes • Molecular structure of the ligands was elucidated by single crystal X-ray diffraction method. • The ligands and complexes interact with CT-DNA via intercalation. • The complexes possess significant antioxidant activity against DPPH, OH and NO radicals. • The complex 6 shows higher IC{sub 50} value than the other complexes against cancer cells.

  9. Shedding lights on the flexible-armed porphyrins: Human telomeric G4 DNA interaction and cell photocytotoxicity research.

    Science.gov (United States)

    Sun, Xiang-Yu; Zhao, Ping; Jin, Shu-Fang; Liu, Min-Chao; Wang, Xia-Hong; Huang, Yu-Min; Cheng, Zhen-Feng; Yan, Si-Qi; Li, Yan-Yu; Chen, Ya-Qing; Zhong, Yan-Mei

    2017-08-01

    DNA polymorphism exerts a fascination on a large scientific community. Without crystallographic structural data, clarification of the binding modes between G-quadruplex (G4) and ligand (complex) is a challenging job. In the present work, three porphyrin compounds with different flexible carbon chains (arms) were designed, synthesized and characterized. Their binding, folding and stabilizing abilities to human telomeric G4 DNA structures were comparatively researched. Positive charges at the end of the flexible carbon chains seem to be favorable for the DNA-porphyrin interactions, which were evidenced by the spectral results and further confirmed by the molecular docking calculations. Biological function analysis demonstrated that these porphyrins show no substantial inhibition to Hela, A549 and BEL 7402 cancer cell lines under dark while exhibit broad inhibition under visible light. This significantly enhanced photocytotoxicity relative to the dark control is an essential property of photochemotherapeutic agents. The feature of the flexible arms emerges as critical influencing factors in the cell photocytotoxicity. Moreover, an ROS-mediated mitochondrial dysfunction pathway was suggested for the cell apoptosis induced by these flexible-armed porphyrins. It is found that the porphyrins with positive charges located at the end of the flexible arms represent an exciting opportunity for photochemotherapeutic anti-cancer drug design. Copyright © 2017. Published by Elsevier B.V.

  10. The thermodynamic effects of ligand structure on the molecular recognition of mononuclear ruthenium polypyridyl complexes with B-DNA

    Science.gov (United States)

    The ruthenium(II) polypyridyl complexes (RPCs), [(phen)2Ru(tatpp)]Cl2 (3Cl2) and [(phen)2Ru (tatpp)Ru(phen)2]Cl4 (4Cl4), containing the large planar and redox-active tetraazatetrapyrido- pentacene (tatpp) ligand, cleave DNA in the presence of reducing agents in cell-free assays and show significant...

  11. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  12. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  13. Coarse-Grained Simulations Complemented by Atomistic Molecular Dynamics Provide New Insights into Folding and Unfolding of Human Telomeric G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Mazzanti, L.; Cragnolini, T.; Wales, D.J.; Derreumaux, P.; Pasquali, C.; Sponer, Jiri

    2016-01-01

    Roč. 12, č. 12 (2016), s. 6077-6097 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : particle mesh ewald * amber force-field * free-energy profiles * binding dna aptamer Subject RIV: BO - Biophysics Impact factor: 5.245, year: 2016

  14. On the interaction between [Ru(NH3)(6)](3+) and the G-quadruplex forming thrombin binding aptamer sequence

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Doneux, T.; Kejnovská, Iva; Buess-Herman, C.

    2013-01-01

    Roč. 126, SEP 2013 (2013), s. 84-90 ISSN 0162-0134 Institutional support: RVO:68081707 Keywords : SELF-ASSEMBLED MONOLAYERS * DNA-MODIFIED SURFACES * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  15. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  16. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase

    Directory of Open Access Journals (Sweden)

    Yusuke Takezawa

    2016-06-01

    Full Text Available A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT, a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H–CuII–H. In this study, we investigated the effects of a metal cofactor, MgII ion, on the TdT-catalyzed polymerization of H nucleotides. At a high MgII concentration (10 mM, the reaction was halted after several H nucleotides were appended. In contrast, at lower MgII concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the MgII concentration. In the presence of excess MgII ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with MgII ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands.

  17. Synthesis and characterization of 6,6'-bis(2-hydroxyphenyl)-2,2'-bipyridine ligand and its interaction with ct-DNA

    Science.gov (United States)

    Selamat, Norhidayah; Heng, Lee Yook; Hassan, Nurul Izzaty; Karim, Nurul Huda Abd

    2015-09-01

    The tetradentate ligand with four donor atoms OONN was synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6'-dibromo-2,2'-bipyridyl and 2-hydroxyphenylboronic acid with presence of palladium (II) acetate. Bis(phenoxy)bipyridine ligand was also synthesized by demethylating of 6,6'-bis(2-methoxyphenyl)-2,2'-bipyridyl ligand through solvent free reaction using pyridine hydrocloride. The formation of both phenoxy and methoxy ligands was confirmed by 1H, 2D cosy and 13C NMR spectroscopy, ESI-MS spectrometry, FTIR spectroscopy. The purity of the ligand was confirmed by melting point. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for the application and design of new and more efficient drugs targeted to DNA. In this study, the binding interaction between the synthesized ligand with calf thymus-DNA (ct-DNA) has been investigated by UV/Vis DNA titration study. From the UV/Vis DNA study, it shows that bis(phenoxy)bipyridine ligand bind with ct-DNA via outside binding with binding contant Kb = 1.19 × 103 ± 0.08 M-1.

  18. Synthesis and characterization of 6,6’-bis(2-hydroxyphenyl)-2,2’-bipyridine ligand and its interaction with ct-DNA

    International Nuclear Information System (INIS)

    Selamat, Norhidayah; Heng, Lee Yook; Hassan, Nurul Izzaty; Karim, Nurul Huda Abd

    2015-01-01

    The tetradentate ligand with four donor atoms OONN was synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6’-dibromo-2,2’-bipyridyl and 2-hydroxyphenylboronic acid with presence of palladium (II) acetate. Bis(phenoxy)bipyridine ligand was also synthesized by demethylating of 6,6’-bis(2-methoxyphenyl)-2,2’-bipyridyl ligand through solvent free reaction using pyridine hydrocloride. The formation of both phenoxy and methoxy ligands was confirmed by 1 H, 2D cosy and 13 C NMR spectroscopy, ESI-MS spectrometry, FTIR spectroscopy. The purity of the ligand was confirmed by melting point. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for the application and design of new and more efficient drugs targeted to DNA. In this study, the binding interaction between the synthesized ligand with calf thymus-DNA (ct-DNA) has been investigated by UV/Vis DNA titration study. From the UV/Vis DNA study, it shows that bis(phenoxy)bipyridine ligand bind with ct-DNA via outside binding with binding contant K b = 1.19 × 10 3 ± 0.08 M −1

  19. Synthesis and characterization of 6,6’-bis(2-hydroxyphenyl)-2,2’-bipyridine ligand and its interaction with ct-DNA

    Energy Technology Data Exchange (ETDEWEB)

    Selamat, Norhidayah; Heng, Lee Yook; Hassan, Nurul Izzaty; Karim, Nurul Huda Abd [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43650 Bangi, Selangor (Malaysia)

    2015-09-25

    The tetradentate ligand with four donor atoms OONN was synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6’-dibromo-2,2’-bipyridyl and 2-hydroxyphenylboronic acid with presence of palladium (II) acetate. Bis(phenoxy)bipyridine ligand was also synthesized by demethylating of 6,6’-bis(2-methoxyphenyl)-2,2’-bipyridyl ligand through solvent free reaction using pyridine hydrocloride. The formation of both phenoxy and methoxy ligands was confirmed by {sup 1}H, 2D cosy and {sup 13}C NMR spectroscopy, ESI-MS spectrometry, FTIR spectroscopy. The purity of the ligand was confirmed by melting point. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for the application and design of new and more efficient drugs targeted to DNA. In this study, the binding interaction between the synthesized ligand with calf thymus-DNA (ct-DNA) has been investigated by UV/Vis DNA titration study. From the UV/Vis DNA study, it shows that bis(phenoxy)bipyridine ligand bind with ct-DNA via outside binding with binding contant K{sub b} = 1.19 × 10{sup 3} ± 0.08 M{sup −1}.

  20. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  1. Synthesis, structure, DNA binding and anticancer activity of mixed ligand ruthenium(II) complex

    Science.gov (United States)

    Gilewska, Agnieszka; Masternak, Joanna; Kazimierczuk, Katarzyna; Trynda, Justyna; Wietrzyk, Joanna; Barszcz, Barbara

    2018-03-01

    In order to obtain a potential chemotherapeutic which is not affected on the normal BALB/3T3 cell line, a new arene ruthenium(II) complex {[RuCl(L1)(η6-p-cymene)]PF6}2 · H2O has been synthesized by a direct reaction of precursor, [{(η6-p-cymene)Ru(μ-Cl)}2Cl2], with N,N-chelating ligand (L1 - 2,2‧-bis(4,5-dimethylimidazole). The compound has been fully characterized by elemental analysis, X-ray diffraction, IR, UV-Vis and 1H, 13C NMR spectroscopies. X-ray analysis have confirmed that the compound crystallized in the monoclinic group Cc as an inversion twin. The asymmetric unit contains two symmetrically independent cationic complexes [RuCl(L1)(η6-p-cymene)]+ whose charge is balanced by two PF6- counterions. The shape of each cationic coordination polyhedral can be described as a distorted dodecahedron and shows a typical piano-stool geometry. In addition, an analysis of the crystal structure and the Hirshfeld surface analysis were used to detect and visualize important hydrogen bonds and intermolecular interaction. Moreover, the antiproliferative behavior of the obtained complex was assayed against three human cells: MV-4-11, LoVo, MCF-7 and BALB/3T3 - normal mice fibroblast cells. To predict a binding mode, a potential interaction of ruthenium complex with calf thymus DNA (CT-DNA) has been explored using UV absorption and circular dichroism (CD).

  2. DNA binding and biological activity of mixed ligand complexes of Cu(II, Ni(II and Co(II with quinolones and N donor ligand

    Directory of Open Access Journals (Sweden)

    S.M M Akram

    2015-10-01

    Full Text Available  AbstractMixed ligand complexes of  Cu(II, Ni(II and Co(II have been synthesized by using levofloxacin and bipyridyl and characterized using spectral and analytical techniques. The binding behavior of the Ni(II and Cu(II complexes with herring sperm DNA(Hs-DNA were determined using electronic absorption titration, viscometric measurements and cyclic voltammetry measurements. The binding constant calculated  for Cu(II and Ni(II complexes are 2.0 x 104 and 4.0 x 104 M-1 respectively. Detailed analysis reveals that these metal complexes interact with DNA through intercalative binding mode. The nuclease activity of  Cu(II and Ni(II complexes with ct-DNA was carried out using agarose gel electrophoresis technique. The antioxidant activities for the synthesized complexes have been tested and the antibacterial activity for Ni(II complex was also checked.Key words: Intercalation, hypochromism, red shift and  peak potential.

  3. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    DEFF Research Database (Denmark)

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

    2016-01-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

  4. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    Science.gov (United States)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.

    2016-05-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  5. Synthesis and Characterization of thermo/pH-responsive Supramolecular G-Quadruplexes for the Construction of Supramolecular Hacky Sacks for Biorelevant Applications

    Science.gov (United States)

    Negron Rios, Luis M.

    The impact of size, shape, and distribution of lipophilic regions on the surfaces of nanoscopic objects that are amphiphilic or patchy (such as proteins) are yet to be fully understood. One of the reasons for this is the lack of an appropriate model systems in which to probe this question. Our group has previously reported 2'-deoxyguanosine (8ArG) derivatives that self-assemble in aqueous media into discrete supramolecular hexadecamers that show the lower critical solution temperature (LCST) phenomenon. The LCST phenomenon is a convenient and rigorous strategy to measure the hydrophobicity of a system. Although these SGQs are potentially attractive for biomedical applications like drug-delivery, the narrow window of physiological temperatures complicates their implementation. This moved us to redesign the constituent 8ArG subunits to incorporate imidazole moieties that would lead to pH-responsive SGQs, working isothermally. Upon reaching a threshold temperature (Lower Critical Solution Temperature, LCST) at pH 7, these dual-responsive SGQs further self-assemble to form nano/micro hydrogel globules that we called them supramolecular hacky sacks (SHS). However, we can isolate kinetically stable versions of these SHS by lowering the ionic strength of the medium (i.e., from the molar to the millimolar range) in a process that we term "fixing the SHS", in which these SHS maintain their integrity (size and shape) and stability without the requirement of crosslinking agents. After structural characterization and in vitro studies of SHS, we performed encapsulation studies of DOX, rhodamine, dsDNA (F26T), thrombin binding aptamer (TBA) and dextran (3 kDa) Texas Red conjugate. Then we performed in vivo studies of cell internalization and drug delivery with neuroblastoma SY-SH5Y. The performed studies will bring new approaches for the development of new biotechnology for fundamental applications and the emerging of novel therapeutic agents for biomedical applications.

  6. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    Science.gov (United States)

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  8. Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells

    Czech Academy of Sciences Publication Activity Database

    Dzatko, S.; Krafčíková, M.; Haensel-Hertsch, R.; Fessl, T.; Fiala, R.; Loja, T.; Krafčík, D.; Mergny, Jean-Louis; Foldynova-Trantirkova, Silvie; Trantírek, L.

    2018-01-01

    Roč. 57, č. 8 (2018), s. 2165-2169 ISSN 1433-7851 R&D Projects: GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : g-quadruplex * telomeric dna * base-pairs * molecular switch Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 11.994, year: 2016

  9. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  10. DNA and protein binding, double-strand DNA cleavage and cytotoxicity of mixed ligand copper(II) complexes of the antibacterial drug nalidixic acid.

    Science.gov (United States)

    Loganathan, Rangasamy; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Muruganantham, Amsaveni; Ghosh, Swapan K; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

    2017-09-01

    The water soluble mixed ligand complexes [Cu(nal)(diimine)(H 2 O)](ClO 4 ) 1-4, where H(nal) is nalidixic acid and diimine is 2,2'-bipyridine (1), 1,10-phenanthroline (2), 5,6-dimethyl-1,10-phenanthroline (3), and 3,4,7,8-tetramethyl-1,10-phenanthroline (4), have been isolated. The coordination geometry around Cu(II) in 1 and that in the Density Functional Theory optimized structures of 1-4 has been assessed as square pyramidal. The trend in DNA binding constants (K b ) determined using absorption spectral titration (K b : 1, 0.79±0.1base pair. In contrast, 3 and 4 are involved in intimate hydrophobic interaction with DNA through the methyl substituents on phen ring, which is supported by viscosity and protein binding studies. DNA docking studies imply that 4 is involved preferentially in DNA major groove binding while 1-3 in minor groove binding and that all the complexes, upon removing the axially coordinated water molecule, bind in the major groove. Interestingly, 3 and 4 display prominent double-strand DNA cleavage while 1 and 2 effect only single-strand DNA cleavage in the absence of an activator. The complexes 3 and 4 show cytotoxicity higher than 1 and 2 against human breast cancer cell lines (MCF-7). The complex 4 induces apoptotic mode of cell death in cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  12. Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

    Science.gov (United States)

    Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

    2011-05-03

    Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011

  13. Structure of uracil-DNA glycosylase from Mycobacterium tuberculosis: insights into interactions with ligands

    International Nuclear Information System (INIS)

    Kaushal, Prem Singh; Talawar, Ramappa K.; Varshney, Umesh; Vijayan, M.

    2010-01-01

    The molecule of uracil-DNA glycosylase from M. tuberculosis exhibits domain motion on binding to DNA or a proteinaceous inhibitor. The highly conserved DNA-binding region interacts with a citrate ion in the structure. Uracil N-glycosylase (Ung) is the most thoroughly studied of the group of uracil DNA-glycosylase (UDG) enzymes that catalyse the first step in the uracil excision-repair pathway. The overall structure of the enzyme from Mycobacterium tuberculosis is essentially the same as that of the enzyme from other sources. However, differences exist in the N- and C-terminal stretches and some catalytic loops. Comparison with appropriate structures indicate that the two-domain enzyme closes slightly when binding to DNA, while it opens slightly when binding to the proteinaceous inhibitor Ugi. The structural changes in the catalytic loops on complexation reflect the special features of their structure in the mycobacterial protein. A comparative analysis of available sequences of the enzyme from different sources indicates high conservation of amino-acid residues in the catalytic loops. The uracil-binding pocket in the structure is occupied by a citrate ion. The interactions of the citrate ion with the protein mimic those of uracil, in addition to providing insights into other possible interactions that inhibitors could be involved in

  14. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    International Nuclear Information System (INIS)

    Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

    2015-01-01

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA

  15. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    Energy Technology Data Exchange (ETDEWEB)

    Matsushita, Y., E-mail: kurita@cs.tut.ac.jp; Murakawa, T., E-mail: kurita@cs.tut.ac.jp; Shimamura, K., E-mail: kurita@cs.tut.ac.jp; Oishi, M., E-mail: kurita@cs.tut.ac.jp; Ohyama, T., E-mail: kurita@cs.tut.ac.jp; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Tempaku-cho, Toyohashi, Aichi, 441-8580 (Japan)

    2015-02-27

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  16. Rhenium complexes of chromophore-appended dipicolylamine ligands: syntheses, spectroscopic properties, DNA binding and X-ray crystal structure

    International Nuclear Information System (INIS)

    Mullice, L.A.; Buurma, N.J.; Pope, S.J.A.; Laye, R.H.; Harding, L.P.

    2008-01-01

    The syntheses of two chromophore-appended dipicolylamine-derived ligands and their reactivity with penta-carbonyl-chloro-rhenium have been studied. The resultant complexes each possess the fac-Re(CO) 3 core. The ligands L 1 1-[bis(pyridine-2-yl-methyl)amino]methyl-pyrene and L 2 2-[bis(pyridine-2-yl-methyl)amino]methyl-quinoxaline were isolated via a one-pot reductive amination in moderate yield. The corresponding rhenium complexes were isolated in good yields and characterised by 1 H NMR, MS, IR and UV-Vis studies. X-Ray crystallographic data were obtained for fac-{Re(CO) 3 (L 1 )}(BF 4 ), C 34 H 26 BF 4 N 4 O 3 Re: monoclinic, P2(1)/c, a 18.327(2) Angstroms, α = 90.00 degrees, b 14.1537(14) Angstroms, β96.263(6) degrees, c = 23.511(3) Angstroms, γ 90.00 Angstroms, 6062.4(11) (Angstroms) 3 , Z=8. The luminescence properties of the ligands and complexes were also investigated, with the emission attributed to the appended chromophore in each case. Isothermal titration calorimetry suggests that fac-{Re(CO) 3 (L 1 )}(BF 4 ) self-aggregates cooperatively in aqueous solution, probably forming micelle-like aggregates with a cmc of 0.18 mM. Investigations into the DNA-binding properties of fac-{Re(CO) 3 (L 1 )}(BF 4 ) were undertaken and revealed that fac-{Re(CO) 3 (L 1 )}(BF 4 ) binding to fish sperm DNA (binding constant 1.5 ± 0.2 * 10 5 M -1 , binding site size 3.2 ± 0.3 base pairs) is accompanied by changes in the UV-Vis spectrum as typically observed for pyrene-based intercalators while the calorimetrically determined binding enthalpy (-14 ± 2 kcal mol -1 ) also agrees favourably with values as typically found for intercalators. (authors)

  17. Synthesis, characterization, DNA interaction and antimicrobial screening of isatin-based polypyridyl mixed-ligand Cu(II and Zn(II complexes

    Directory of Open Access Journals (Sweden)

    NATARAJAN RAMAN

    2010-06-01

    Full Text Available Several mixed ligand Cu(II/Zn(II complexes using 3-(phenyl-imino-1,3-dihydro-2H-indol-2-one (obtained by the condensation of isatin and aniline as the primary ligand and 1,10-phenanthroline (phen/2,2’-bipyridine (bpy as an additional ligand were synthesized and characterized analytically and spectroscopically by elemental analyses, magnetic susceptibility and molar conductance measurements, as well as by UV–Vis, IR, NMR and FAB mass spectroscopy. The interaction of the complexes with calf thymus (CT DNA was studied using absorption spectra, cyclic voltammetric and viscosity measurements. They exhibit absorption hypochromicity, and the specific viscosity increased during the binding of the complexes to calf thymus DNA. The shifts in the oxidation–reduction potential and changes in peak current on addition of DNA were shown by CV measurements. The Cu(II/Zn(II complexes were found to promote cleavage of pUC19 DNA from the supercoiled form I to the open circular form II and linear form III. The complexes show enhanced antifungal and antibacterial activities compared with the free ligand.

  18. Synthesis, characterization, DNA/protein interaction and cytotoxicity studies of Cu(II) and Co(II) complexes derived from dipyridyl triazole ligands

    Science.gov (United States)

    Zhang, Wei; Yao, Di; Wei, Yi; Tang, Jie; Bian, He-Dong; Huang, Fu-Ping; Liang, Hong

    2016-06-01

    Four different transition metal complexes containing dipyridyl triazole ligands, namely [Cu(abpt)2Cl2]·2H2O (1), [Cu(abpt)2(ClO4)2] (2), [Co2(abpt)2(H2O)2Cl2]·Cl2·4H2O (3) and [Co2(Hbpt)2(CH3OH)2(NO3)2] (4) have been designed, synthesized and further structurally characterized by X-ray crystallography, ESI-MS, elemental analysis, IR and Raman spectroscopy. In these complexes, the both ligands act as bidentate ligands with N, N donors. DNA binding interactions with calf thymus DNA (ct-DNA) of the ligand and its complexes 1 ~ 4 were investigated via electronic absorption, fluorescence quenching, circular dichroism and viscosity measurements as well as confocal Laser Raman spectroscopy. The results show these complexes are able to bind to DNA via the non-covalent mode i.e. intercalation and groove binding or electrostatic interactions. The interactions with bovine serum albumin (BSA) were also studied using UV-Vis and fluorescence spectroscopic methods which indicated that fluorescence quenching of BSA by these compounds was the presence of both static and dynamic quenching. Moreover, the in vitro cytotoxic effects of the complexes against four cell lines SK-OV-3, HL-7702, BEL7404 and NCI-H460 showed the necessity of the coordination action on the biological properties on the respective complex and that all four complexes exhibited substantial cytotoxic activity.

  19. Effects on normal tissues during radiosensitization of Dalton's Lymphoma by the DNA ligand Hoechst 33342 in Balb/c mice

    International Nuclear Information System (INIS)

    Kalra, Namita; Sampath, Swapna; Adhikari, J.S.; Dwarakanath, B.S.

    2014-01-01

    Hoechst 33342 is a bisbenzimidazole derivative with AT specific minor groove DNA binding ability. Scavenging of free radicals and stabilization of macromolecular structure resulting in reduced induction of DNA damage contributes to radioprotection afforded by the ligand. Their ability to inhibit topoisomerases I and II, which play important roles in damage response pathways including DNA repair has been shown to sensitize tumor cells in vitro and in vivo. Due to its mutagenic and clastogenic potentials, damage to vital normal tissues are a matter of concern in deploying the ligand as adjuvant in radiotherapy. Therefore, we investigated the effects of the ligand in Dalton's Lymphoma (DL) bearing Balb/c mice by studying the local tumor control and animal survival, besides damage to normal tissues like bone marrow, kidney and testis. Hoechst 33342 (10 mg/kg b wt) was administered (i.v.) 1 h before focal irradiation (10 Gy) of the tumor (∼ 500 mm 3 ) grown on the hind leg of the mice. Partial response with a growth delay of 16 days (3 x initial volume) was seen following irradiation, while a complete response (cure; tumor-free survival) was observed in 88% mice following the combined treatment (Hoechst 33342+radiation); ligand alone had no significant effect. Although the ligand induced marginal degree of chromosomal aberrations in the bone marrow, it did not enhance aberrations induced by radiation further. In testes, the proportions of diploid, haploid and hypo-haploid cells as well as resting primary spermatocytes (RPS) were not significantly altered by either. In kidney, Hoechst 33342 alone or in combination with radiation did not cause significant damage to the proximal tubules and glomeruli. These observations suggest that radiosensitization of tumor by the DNA ligand Hoechst 33342 may not be associated with enhanced toxicity to bone marrow as well as proximal normal tissues. (author)

  20. Ubiquinol decreases monocytic expression and DNA methylation of the pro-inflammatory chemokine ligand 2 gene in humans

    Directory of Open Access Journals (Sweden)

    Fischer Alexandra

    2012-10-01

    Full Text Available Abstract Background Coenzyme Q10 is an essential cofactor in the respiratory chain and serves in its reduced form, ubiquinol, as a potent antioxidant. Studies in vitro and in vivo provide evidence that ubiquinol reduces inflammatory processes via gene expression. Here we investigate the putative link between expression and DNA methylation of ubiquinol sensitive genes in monocytes obtained from human volunteers supplemented with 150 mg/ day ubiquinol for 14 days. Findings Ubiquinol decreases the expression of the pro-inflammatory chemokine (C-X-C motif ligand 2 gene (CXCL2 more than 10-fold. Bisulfite-/ MALDI-TOF-based analysis of regulatory regions of the CXCL2 gene identified six adjacent CpG islands which showed a 3.4-fold decrease of methylation status after ubiquinol supplementation. This effect seems to be rather gene specific, because ubiquinol reduced the expression of two other pro-inflammatory genes (PMAIP1, MMD without changing the methylation pattern of the respective gene. Conclusion In conclusion, ubiquinol decreases monocytic expression and DNA methylation of the pro-inflammatory CXCL2 gene in humans. Current Controlled Trials ISRCTN26780329.

  1. Synthesis, characterization, DNA binding and cleavage studies of mixed-ligand copper (II complexes

    Directory of Open Access Journals (Sweden)

    M. Sunita

    2017-05-01

    Full Text Available New two copper complexes of type [Cu(Bzimpy(LH2O]SO4 (where L = 2,2′ bipyridine (bpy, and ethylene diamine (en, Bzimpy = 2,6-bis(benzimidazole-2ylpyridine have been synthesized and characterized by elemental analyses, molar conductance measurements, magnetic susceptibility measurements, mass, IR, electronic and EPR spectral studies. Based on elemental and spectral studies six coordinated geometries were assigned to the two complexes. DNA-binding properties of these metal complexes were investigated using absorption spectroscopy, fluorescence spectroscopy, viscosity measurements and thermal denaturation methods. Experimental studies suggest that the complexes bind to DNA through intercalation. These complexes also promote the cleavage of plasmid pBR322, in the presence of H2O2.

  2. Structure-Based Virtual Ligand Screening on the XRCC4/DNA Ligase IV Interface

    Science.gov (United States)

    Menchon, Grégory; Bombarde, Oriane; Trivedi, Mansi; Négrel, Aurélie; Inard, Cyril; Giudetti, Brigitte; Baltas, Michel; Milon, Alain; Modesti, Mauro; Czaplicki, Georges; Calsou, Patrick

    2016-03-01

    The association of DNA Ligase IV (Lig4) with XRCC4 is essential for repair of DNA double-strand breaks (DSBs) by Non-homologous end-joining (NHEJ) in humans. DSBs cytotoxicity is largely exploited in anticancer therapy. Thus, NHEJ is an attractive target for strategies aimed at increasing the sensitivity of tumors to clastogenic anticancer treatments. However the high affinity of the XRCC4/Lig4 interaction and the extended protein-protein interface make drug screening on this target particularly challenging. Here, we conducted a pioneering study aimed at interfering with XRCC4/Lig4 assembly. By Molecular Dynamics simulation using the crystal structure of the complex, we first delineated the Lig4 clamp domain as a limited suitable target. Then, we performed in silico screening of ~95,000 filtered molecules on this Lig4 subdomain. Hits were evaluated by Differential Scanning Fluorimetry, Saturation Transfer Difference - NMR spectroscopy and interaction assays with purified recombinant proteins. In this way we identified the first molecule able to prevent Lig4 binding to XRCC4 in vitro. This compound has a unique tripartite interaction with the Lig4 clamp domain that suggests a starting chemotype for rational design of analogous molecules with improved affinity.

  3. Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

    Science.gov (United States)

    Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

    2017-11-01

    In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

  4. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    Science.gov (United States)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang

    2013-01-01

    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  5. Synthesis And Characterization Of 6,6'-Bis (2-Hydroxyphenyl)-2,2'-Bipyridyl Ligand And Its Platinum Complex for the Interaction with CT-DNA

    International Nuclear Information System (INIS)

    Norhidayah Selamat; Heng, L.Y.; Nurul Izzaty Hassan; Nurul Huda Abd Karim

    2016-01-01

    A tetradentate ligand with four donor atoms OONN and its platinum metal complex were synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6 ' -dibromo-2,2 ' -bipyridyl and 2-hydroxy phenylboronic acid with the presence of palladium (II) acetate. The formation of platinum complex was done by introducing the ligand with platinum (II) chloride in benzonitrile. Both ligand and complex structures were confirmed by 1 H, 2D cosy and 13 C NMR spectroscopy, ESIMS spectrometry and FTIR spectroscopy. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for the application and design of new and more efficient drugs or sensors targeted on DNA. In this study, the binding interaction between the synthesized ligand and complex with calf thymus DNA (CT-DNA) has been investigated using UV-Visible and emission DNA titration. From the UV-Visible DNA study, it showed that platinum (II) bipyridine complex had higher affinity towards CT-DNA with binding constant K b =(3.1 ± 0.02 x 10 5 ) ± 0.02 M -1 compared to that of bis(phenoxy) bipyridine ligand with binding constant (K b ) = (1.19 ± 0.08) x 10 3 M -1 . These findings will be valuable for the potential use of platinum (II) bipyridine complex as a phosphorescent probe in optical sensor DNA. (author)

  6. Platinum(II Complexes with Tetradentate Schiff Bases as Ligands: Synthesis, Characterization and Detection of DNA Interaction by Differential Pulse Voltammetry

    Directory of Open Access Journals (Sweden)

    Lijun Li

    2012-01-01

    Full Text Available Five sterically hindered platinum(II complexes with tetradentate schiff bases as ligands, [Pt(L] (L= N,N′-bisalicylidene-1,2-ethylenediamine (L1, N,N′-bisalicylidene-1,2-cyclohexanediamine (L2, N,N′-bis(5-hydroxyl-salicylidene-1,2-cyclohexanediamine (L3, N,N′-bisalicylidene-1,2-diphenyl-ethylenediamine (L4 and N,N′-bis(3-tert-butyl-5-methyl-salicylidene-1,2-diphenylethylenediamine (L5 have been synthesized and characterized by IR spectroscopy and elemental analysis. The sterical hindrance of antitumor drug candidates potentially makes them less susceptible to deactivation by sulphur containing proteins and helping to overcome resistance mechanisms. The interaction of these metal complexes with fish sperm single-stranded DNA (ssDNA was studied electrochemically based on the oxidation signals of guanine and adenine. Differential pulse voltammetry was employed to monitor the DNA interaction in solution by using renewable pencil graphite electrode. The results indicate that ligands with different groups can strongly affect the interaction between [Pt(L] complexes and ssDNA due to sterical hindrances and complex [Pt(L1] has the best interaction with DNA among the five complexes.

  7. Multispectroscopic DNA-Binding studies and antimicrobial evaluation of new mixed-ligand Silver(I) complex and nanocomplex: A comparative study

    Science.gov (United States)

    Movahedi, Elaheh; Rezvani, Ali Reza

    2018-05-01

    A novel mixed-ligand Ag(I) complex, , has been synthesized and characterized by the elemental analysis, IR spectroscopy and 1HNMR. In the formula, dian and phen are N-(4,5-diazafluoren-9-ylidene)aniline and 1,10-phenanthroline, respectively. This complex also has been prepared at nano size by sonochemical technique and characterized by the FTIR and scanning electron microscopy (SEM). To evaluate the biological preferences of the Ag(I) complex and nanocomplex and verify the relationships between the structure and biological function, in vitro DNA binding and antibacterial experiments have been carried out. DNA-complex interaction has been pursued by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation and circular dichroism spectroscopy in the physiological pH. Each compound displays significant binding trend to the CT-DNA. The mode of binding to the CT-DNA probably is a moderate intercalation mode with the partial insertion of the planar ligands between the base stacks of double-stranded DNA. The relative viscosities and circular dichroism spectra of the CT-DNA with the complex solutions, confirm the intense interactions of the Ag(I) complex and nanocomplex with DNA. An in vitro antibacterial test of the complex and nanocomplex on a series of the Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and the Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) shows a remarkable antibacterial feature of the Ag(I) complex. The MIC values (minimum inhibitory concentration) of the compounds compare with silver nitrate and silver sulfadiazine. The bacterial inhibitions of the Ag(I) complex and nanocomplex are agreed to their DNA binding affinities.

  8. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  9. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. DNA binding, cytotoxicity and apoptosis induction activity of a mixed-ligand copper(II) complex with taurine Schiff base and imidazole

    Science.gov (United States)

    Li, Mei; kong, Lin Lin; Gou, Yi; Yang, Feng; Liang, Hong

    2014-07-01

    A novel binuclear copper(II) complex (complex 1) with taurine Schiff base and imidazole has been synthesized and structurally characterized by single crystal X-ray diffraction, elemental analysis, ESI-MS spectrometry, UV-vis and IR spectroscopy. Single-crystal analysis revealed that 1 displays the sulfonate-bridged dinuclear copper(II) centers. Both copper atoms are five-coordinated and exhibit slightly distorted square pyramidal geometries. Each of copper atom is surrounded by three oxygen atoms and one nitrogen atom from different taurine Schiff base ligands, and one nitrogen atom from one imidazole ligand. The interaction between 1 and calf thymus DNA (CT-DNA) was investigated by UV-vis, fluorescence, circular dichroism (CD) spectra and agarose gel electrophoresis. The experimental results indicated that 1 could bind to CT-DNA via an intercalative mode and show efficient cleavage activity. In addition, 1 showed an antitumor effect on cell cycle and apoptosis. Flow cytometric analysis revealed that MGC-803 cells were arrested in the S phase after treatment with 1. Fluorescence microscopic observation indicated that 1 could induce apoptosis of MGC-803 cells.

  11. Understanding DNA GyraseB ATPase inhibition in the light of structure and ligand-based modelling techniques.

    OpenAIRE

    Saiz Urra, Liane

    2012-01-01

    The alarming antibiotic resistance spread is the main reasonthat demands the continued investigation to search for new antimicrobialagents. DNA Gyrase is a validated antibacterial target that can be used forthis purpose. This essential prokaryotic type II topoisomerase enzyme isinvolved in DNA replication, transcription and recombination by introducingnegative supercoiling in DNA at the expenses of ATP hydrolysis. It consists of twosubunits Gyrase A (GyrA) which participate in DNA breakage an...

  12. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  13. Cellular uptake, nuclear localization and cytotoxicity of 125I-labelled DNA minor groove binding ligands in K562, human erythroleukaemia cells

    International Nuclear Information System (INIS)

    Karagiannis, T.C.; Lobachevsky, P.N.; Martin, R.F.

    2000-01-01

    Full text: Iodine-125 decays by orbital electron capture and internal conversion resulting in the emission of numerous Auger electrons which produce a highly localised radiochemical damage in the immediate vicinity of the site of decay. Given the requirement to deliver 125 I to the nuclear DNA, a minor groove binding bibenzimidazole, 125 I-iodoHoechst 33258 was investigated. It has been noted that this analogue may be prone to de-iodination in vitro and in vivo, given the presence of an orthoiodophenol moiety which is analogous to that in thyroxins. Therefore, an 125 I -iodoHoechst analogue without the hydroxyl group was also studied. The 125 I -iodoHoechst 33258 analogue was prepared by direct iodination of Hoechst 33258 and 125 I iodoHoechst was prepared by demetallation of a trimethylstannyl precursor. DNA binding studies indicated that both iodo-analogues bind to calf thymus DNA, K D = 89 ± 30nM, n = 0.018 bp - 1 for iodoHoechst 33258 and K D = 121 ± 31nM, n = 0.024 bp -1 for iodoHoechst. Similarly, nuclear localization following incubation with 5μM of either ligand at 37 deg C was observed in K562 cells by fluorescence microscopy. Flow cytometry was used to investigate the kinetics of drug uptake and efflux in K562 cells. The results indicated that when 10 6 cells were incubated with 5μM ligand at 37 deg C, the uptake reached a plateau at approximately 43 minutes for iodoHoechst 33258 and approximately 52 minutes for iodoHoechst. Ligand efflux results indicated two-phase kinetics. The initial phase which involves 50-60% of drug was characterised by a half-life time (t 1/2 ) of 55.4 minutes for efflux of iodoHoechst 33258 and a t 1/2 of 10.3 minutes for efflux of iodoHoechst, at 37 deg C. Furthermore, the results suggested that the DNA binding sites in a 10 6 cell/ml suspension were saturated by incubation with 3μM iodoHoechst 33258 and 5μM iodoHoechst. In the initial cytotoxicity experiments using 125 I-iodoHoechst 33258, K562 cells were incubated for 1

  14. DNA barcoding via counterstaining with AT/GC sensitive ligands in injection-molded all-polymer nanochannel devices

    DEFF Research Database (Denmark)

    Østergaard, Peter Friis; Matteucci, Marco; Reisner, Walter

    2013-01-01

    Nanochannel technology, coupled with a suitable DNA labeling chemistry, is a powerful approach for performing high-throughput single-molecule mapping of genomes. Yet so far nanochannel technology has remained inaccessible to the broader research community due to high fabrication cost and/or requi......Nanochannel technology, coupled with a suitable DNA labeling chemistry, is a powerful approach for performing high-throughput single-molecule mapping of genomes. Yet so far nanochannel technology has remained inaccessible to the broader research community due to high fabrication cost and...... AT and GC variation along DNA sequences....

  15. Synthesis, spectral characterization, theoretical, antimicrobial, DNA interaction and in vitro anticancer studies of Cu(II and Zn(II complexes with pyrimidine-morpholine based Schiff base ligand

    Directory of Open Access Journals (Sweden)

    M. Sankarganesh

    2018-05-01

    Full Text Available Novel Cu(II (1 and Zn(II (2 complexes with 4-(1-(4-morpholinophenylethylideneaminopyrimidine-5-carbonitrile (L have been synthesized and characterized by various spectroscopic and analytical techniques. DFT (density functional theory studies result confirms that, LMCT mechanism have been done between L and M(II ions. The antimicrobial studies indicate that the ligand L and complexes 1 & 2 exhibit higher activity against the E. coli bacteria and C. albicans fungi. The groove binding mode of ligand L and complexes 1 & 2 with CT-DNA have been confirmed by electronic absorption, competitive binding, viscometric and cyclic voltammetric studies. The electronic absorption titration of ligand L and complexes 1 & 2 with DNA have been carried out in different buffer solutions (pH 4.0, 7.0 & 10.0. The Kb values of ligand L and complexes 1 & 2 are higher in acidic buffer at pH 4.0 (Kb = 2.42 × 105, L; 2.8 × 105, 1; 2.65 × 105, 2 and the results revealed that, the interaction of synthesized compounds with DNA were higher in the acidic medium than basic and neutral medium. Furthermore, CT-DNA cleavage studies of ligand L and complexes 1 & 2 have been studied. The in vitro anticancer activities results show that complexes 1 & 2 have moderate cytotoxicity against cancer cell lines and low toxicity on normal cell line than ligand L. Keywords: Pyrimidine, Morpholine, DFT, Antimicrobial, DNA binding, Anticancer studies

  16. DNA-directed alkylating ligands as potential antitumor agents: sequence specificity of alkylation by intercalating aniline mustards.

    Science.gov (United States)

    Prakash, A S; Denny, W A; Gourdie, T A; Valu, K K; Woodgate, P D; Wakelin, L P

    1990-10-23

    The sequence preferences for alkylation of a series of novel parasubstituted aniline mustards linked to the DNA-intercalating chromophore 9-aminoacridine by an alkyl chain of variable length were studied by using procedures analogous to Maxam-Gilbert reactions. The compounds alkylate DNA at both guanine and adenine sites. For mustards linked to the acridine by a short alkyl chain through a para O- or S-link group, 5'-GT sequences are the most preferred sites at which N7-guanine alkylation occurs. For analogues with longer chain lengths, the preference of 5'-GT sequences diminishes in favor of N7-adenine alkylation at the complementary 5'-AC sequence. Magnesium ions are shown to selectively inhibit alkylation at the N7 of adenine (in the major groove) by these compounds but not the alkylation at the N3 of adenine (in the minor groove) by the antitumor antibiotic CC-1065. Effects of chromophore variation were also studied by using aniline mustards linked to quinazoline and sterically hindered tert-butyl-9-aminoacridine chromophores. The results demonstrate that in this series of DNA-directed mustards the noncovalent interactions of the carrier chromophores with DNA significantly modify the sequence selectivity of alkylation by the mustard. Relationships between the DNA alkylation patterns of these compounds and their biological activities are discussed.

  17. Synthesis, characterization, DNA-binding study and anticancer properties of ternary metal(II) complexes of edda and an intercalating ligand.

    Science.gov (United States)

    Ng, Chew Hee; Kong, King Chow; Von, Sze Tin; Balraj, Pauline; Jensen, Paul; Thirthagiri, Eswary; Hamada, Hirokazu; Chikira, Makoto

    2008-01-28

    A series of ternary metal(ii) complexes {M(phen)(edda); 1a (Cu), 1b (Co), 1c (Zn), 1d (Ni); H(2)edda = N,N(')-ethylenediaminediacetic acid} of N,N'-ethylene-bridged diglycine and 1,10-phenanthroline were synthesized and characterized by elemental analysis, FTIR, UV-visible spectroscopy and magnetic susceptibility measurement. The interaction of these complexes with DNA was investigated using CD and EPR spectroscopy. MTT assay results of 1a-1c , screened on MCF-7 cancer cell lines, show that synergy between the metal and ligands results in significant enhancement of their antiproliferative properties. Preliminary results from apoptosis and cell cycle analyses with flow cytometry are reported. seems to be able to induce cell cycle arrest at G(0)/G(1). The crystal structure of 1a is also included.

  18. Synthesis of nucleoside mono- and triphosphates bearing oligopyridine ligands, their incorporation into DNA and complexation with transition metals

    Czech Academy of Sciences Publication Activity Database

    Kalachová, Lubica; Pohl, Radek; Hocek, Michal

    2012-01-01

    Roč. 10, č. 1 (2012), s. 49-55 ISSN 1477-0520 R&D Projects: GA ČR GA203/09/0317; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotides * terpyridine * DNA Subject RIV: CC - Organic Chemistry Impact factor: 3.568, year: 2012

  19. Anticancer potential of a photoactivated transplatin derivative containing the methylazaindole ligand mediated by ROS generation and DNA cleavage

    Czech Academy of Sciences Publication Activity Database

    Prachařová, J.; Muchová, T.; Tomaštíková, Eva; Intini, F. P.; Pacifico, C.; Natile, G.; Kašpárková, Jana; Brabec, Viktor

    2016-01-01

    Roč. 45, č. 33 (2016), s. 13179-13186 ISSN 1477-9226 R&D Projects: GA ČR(CZ) GA14-21053S; GA MŠk(CZ) LO1204 Institutional support: RVO:68081707 ; RVO:61389030 Keywords : PLATINUM-DIIMINE COMPLEX * SINGLET OXYGEN * SUPERCOILED DNA Subject RIV: CE - Biochemistry Impact factor: 4.029, year: 2016

  20. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  1. Correlation between DNA interactions and cytotoxic activity of four new ternary compounds of copper(II) with N-donor heterocyclic ligands.

    Science.gov (United States)

    Silva, Priscila P; Guerra, Wendell; Dos Santos, Geandson Coelho; Fernandes, Nelson G; Silveira, Josiane N; da Costa Ferreira, Ana M; Bortolotto, Tiago; Terenzi, Hernán; Bortoluzzi, Adailton João; Neves, Ademir; Pereira-Maia, Elene C

    2014-03-01

    Four new ternary complexes of copper(II) were synthesized and characterized: [Cu(hyd)(bpy)(acn)(ClO4)](ClO4)] (1), [Cu(hyd)(phen)(acn)(ClO4)](ClO4)] (2), [Cu(Shyd)(bpy)(acn)(ClO4)](ClO4)] (3) and [Cu(Shyd)(phen)(acn)(ClO4)](ClO4)] (4), in which acn=acetonitrile; hyd=2-furoic acid hydrazide, bpy=2,2-bipyridine; phen=1,10-phenanthroline and Shyd=2-thiophenecarboxylic acid hydrazide. The cytotoxic activity of the complexes in a chronic myelogenous leukemia cell line was investigated. All complexes are able to enter cells and inhibit cellular growth in a concentration-dependent manner, with an activity higher than that of the corresponding free ligands. The substitution of Shyd for hyd increases the activity, while the substitution of bpy for phen renders the complex less active. Therefore, the most potent complex is 4 with an IC50 value of 1.5±0.2μM. The intracellular copper concentration needed to inhibit 50% of cell growth is approximately 7×10(-15)mol/cell. It is worth notifying that a correlation between cytotoxic activity, DNA binding affinity and DNA cleavage was found: 1<3<2<4. © 2013.

  2. Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

    Science.gov (United States)

    Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

    2015-02-15

    In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. DNA-histone complexes as ligands amplify cell penetration and nuclear targeting of anti-DNA antibodies via energy-independent mechanisms.

    Science.gov (United States)

    Zannikou, Markella; Bellou, Sofia; Eliades, Petros; Hatzioannou, Aikaterini; Mantzaris, Michael D; Carayanniotis, George; Avrameas, Stratis; Lymberi, Peggy

    2016-01-01

    We have generated three monoclonal cell-penetrating antibodies (CPAbs) from a non-immunized lupus-prone (NZB × NZW)F1 mouse that exhibited high anti-DNA serum titres. These CPAbs are polyreactive because they bind to DNA and other cellular components, and localize mainly in the nucleus of HeLa cells, albeit with a distinct nuclear labelling profile. Herein, we have examined whether DNA-histone complexes (DHC) binding to CPAbs, before cell entry, could modify the cell penetration of CPAbs or their nuclear staining properties. By applying confocal microscopy and image analysis, we found that extracellular binding of purified CPAbs to DHC significantly enhanced their subsequent cell-entry, both in terms of percentages of positively labelled cells and fluorescence intensity (internalized CPAb amount), whereas there was a variable effect on their nuclear staining profile. Internalization of CPAbs, either alone or bound to DHC, remained unaltered after the addition of endocytosis-specific inhibitors at 37° or assay performance at 4°, suggesting the involvement of energy-independent mechanisms in the internalization process. These findings assign to CPAbs a more complex pathogenetic role in systemic lupus erythematosus where both CPAbs and nuclear components are abundant. © 2015 John Wiley & Sons Ltd.

  4. Structural characterization, DNA interactions, and cytotoxicity of new transplatin analogues containing one aliphatic and one planar heterocyclic amine ligand

    Czech Academy of Sciences Publication Activity Database

    Ramos-Lima, F.J.; Vrána, Oldřich; Quiroga, Q.; Navarro-Ranninger, C.; Halámiková, Anna; Rybníčková, Hana; Hejmalová, Lenka; Brabec, Viktor

    2006-01-01

    Roč. 49, č. 8 (2006), s. 2640-2651 ISSN 0022-2623 R&D Projects: GA ČR(CZ) GD204/03/H016; GA ČR(CZ) GA305/05/2030; GA ČR(CZ) GA203/05/2032; GA AV ČR(CZ) 1QS500040581 Institutional research plan: CEZ:AV0Z50040507 Keywords : platinum drugs * DNA * cancer Subject RIV: BO - Biophysics Impact factor: 5.115, year: 2006

  5. DNA based identification of medicinal materials in Chinese patent medicines

    Science.gov (United States)

    Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo

    2012-12-01

    Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.

  6. New pyrimidine based ligand capped gold and platinum nano particles: Synthesis, characterization, antimicrobial, antioxidant, DNA interaction and in vitro anticancer activities.

    Science.gov (United States)

    Sankarganesh, M; Adwin Jose, P; Dhaveethu Raja, J; Kesavan, M P; Vadivel, M; Rajesh, J; Jeyamurugan, R; Senthil Kumar, R; Karthikeyan, S

    2017-11-01

    In this research work, we have synthesized new pyrimidine based Schiff base ligand, 2-((4,6-dimethoxypyrimidine-2-yl)methyleneenamino)-6-methoxyphenol (DPMM) capped gold (Au) and platinum (Pt) nanoparticles (NPs) by modified Brust-Schiffrin method. The characteristics of DPMM-Au NPs and DPMM-Pt NPs have been examined by UV-Visible, FTIR, SEM, TEM and powder XRD analysis. SEM analysis result shows that surface morphology of the DPMM-Au NPs and DPMM-Pt NPs are in granular and spherical shape, correspondingly. The size of the DPMM-Au NPs and DPMM-Pt NPs are approximately 38.14±4.5 and 58.64±3.0nm respectively, which confirmed by TEM analysis. The DPMM-Au NPs and DPMM-Pt NPs have potent antimicrobial against Escherichia coli, Klebsiella pneumonia, Pseudomonas fluorescens, Shigella sonnei, Staphylococcus aureus and Aspergillus niger, Candida albicans, Candida tropicalis, Mucor indicus, Rhizopus strains. The DPMM-Au NPs and DPMM-Pt NPs have good antioxidant activities than the free ligand (DPMM). The spectroscopic and viscometric measurement confirms the hydrophobic DNA binding abilities of the newly prepared DPMM capped metal NPs. Moreover, the in vitro anticancer activity of DPMM, DPMM-Au NPs and DPMM-Pt NPs against cancer (MCF-7, HeLa & HEp2) and normal (NHDF) cell lines have performed using MTT assay. These results reveals that, DPMM-Au NPs and DPMM-Pt NPs having significant cytotoxic activity against the cancer cell lines and least toxic effect on normal cell line as compared to standard drug cisplatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Copper(II) Complexes of Phenanthroline and Histidine Containing Ligands: Synthesis, Characterization and Evaluation of their DNA Cleavage and Cytotoxic Activity.

    Science.gov (United States)

    Leite, Sílvia M G; Lima, Luís M P; Gama, Sofia; Mendes, Filipa; Orio, Maylis; Bento, Isabel; Paulo, António; Delgado, Rita; Iranzo, Olga

    2016-11-21

    Copper(II) complexes have been intensely investigated in a variety of diseases and pathological conditions due to their therapeutic potential. The development of these complexes requires a good knowledge of metal coordination chemistry and ligand design to control species distribution in solution and tailor the copper(II) centers in the right environment for the desired biological activity. Herein we present the synthesis and characterization of two ligands HL1 and H 2 L2 containing a phenanthroline unit (phen) attached to the amino group of histidine (His). Their copper(II) coordination properties were studied using potentiometry, spectroscopy techniques (UV-vis and EPR), mass spectrometry (ESI-MS) and DFT calculations. The data showed the formation of single copper complexes, [CuL1] + and [CuL2], with high stability within a large pH range (from 3.0 to 9.0 for [CuL1] + and from 4.5 to 10.0 for [CuL2]). In both complexes the Cu 2+ ion is bound to the phen unit, the imidazole ring and the deprotonated amide group, and displays a distorted square pyramidal geometry as confirmed by single crystal X-ray crystallography. Interestingly, despite having similar structures, these copper complexes show different redox potentials, DNA cleavage properties and cytotoxic activity against different cancer cell lines (human ovarian (A2780), its cisplatin-resistant variant (A2780cisR) and human breast (MCF7) cancer cell lines). The [CuL2] complex has lower reduction potential (E pc = -0.722 V vs -0.452 V for [CuL1] + ) but higher biological activity. These results highlight the effect of different pendant functional groups (carboxylate vs amide), placed out of the coordination sphere, in the properties of these copper complexes.

  8. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

    Science.gov (United States)

    Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

    2015-04-01

    Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

  10. A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

    Science.gov (United States)

    Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario

    2018-06-01

    A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. High-Resolution Profiling of Drosophila Replication Start Sites Reveals a DNA Shape and Chromatin Signature of Metazoan Origins

    Directory of Open Access Journals (Sweden)

    Federico Comoglio

    2015-05-01

    Full Text Available At every cell cycle, faithful inheritance of metazoan genomes requires the concerted activation of thousands of DNA replication origins. However, the genetic and chromatin features defining metazoan replication start sites remain largely unknown. Here, we delineate the origin repertoire of the Drosophila genome at high resolution. We address the role of origin-proximal G-quadruplexes and suggest that they transiently stall replication forks in vivo. We dissect the chromatin configuration of replication origins and identify a rich spatial organization of chromatin features at initiation sites. DNA shape and chromatin configurations, not strict sequence motifs, mark and predict origins in higher eukaryotes. We further examine the link between transcription and origin firing and reveal that modulation of origin activity across cell types is intimately linked to cell-type-specific transcriptional programs. Our study unravels conserved origin features and provides unique insights into the relationship among DNA topology, chromatin, transcription, and replication initiation across metazoa.

  12. Interaction of the phosphorylated DNA-binding domain in nuclear receptor CAR with its ligand-binding domain regulates CAR activation.

    Science.gov (United States)

    Shizu, Ryota; Min, Jungki; Sobhany, Mack; Pedersen, Lars C; Mutoh, Shingo; Negishi, Masahiko

    2018-01-05

    The nuclear protein constitutive active/androstane receptor (CAR or NR1I3) regulates several liver functions such as drug and energy metabolism and cell growth or death, which are often involved in the development of diseases such as diabetes and hepatocellular carcinoma. CAR undergoes a conversion from inactive homodimers to active heterodimers with retinoid X receptor α (RXRα), and phosphorylation of the DNA-binding domain (DBD) at Thr-38 in CAR regulates this conversion. Here, we uncovered the molecular mechanism by which this phosphorylation regulates the intramolecular interaction between CAR's DBD and ligand-binding domain (LBD), enabling the homodimer-heterodimer conversion. Phosphomimetic substitution of Thr-38 with Asp increased co-immunoprecipitation of the CAR DBD with CAR LBD in Huh-7 cells. Isothermal titration calorimetry assays also revealed that recombinant CAR DBD-T38D, but not nonphosphorylated CAR DBD, bound the CAR LBD peptide. This DBD-LBD interaction masked CAR's dimer interface, preventing CAR homodimer formation. Of note, EGF signaling weakened the interaction of CAR DBD T38D with CAR LBD, converting CAR to the homodimer form. The DBD-T38D-LBD interaction also prevented CAR from forming a heterodimer with RXRα. However, this interaction opened up a CAR surface, allowing interaction with protein phosphatase 2A. Thr-38 dephosphorylation then dissociated the DBD-LBD interaction, allowing CAR heterodimer formation with RXRα. We conclude that the intramolecular interaction of phosphorylated DBD with the LBD enables CAR to adapt a transient monomer configuration that can be converted to either the inactive homodimer or the active heterodimer.

  13. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  14. An experimental and theoretical study on the interaction of DNA and BSA with novel Ni2 +, Cu2 + and VO2 + complexes derived from vanillin bidentate Schiff base ligand

    Science.gov (United States)

    Dostani, Morteza; Kianfar, Ali Hossein; Mahmood, Wan Ahmad Kamil; Dinari, Mohammad; Farrokhpour, Hossein; Sabzalian, Mohammad R.; Abyar, Fatemeh; Azarian, Mohammad Hossein

    2017-06-01

    In this investigation, the structure of bidentate N,N-Schiff base ligand of vanillin, (E)-4-(((2-amino-5-nitrophenyl)imino)methyl)-2-methoxyphenol (HL) was determined by single crystal X-ray diffraction. The interaction of new [CuL2], [NiL2] and [VOL2] complexes with DNA and BSA was explored through UV-Vis and fluorescence spectroscopy. The electronic spectra changes displayed an isosbestic point for the complexes upon titration with DNA. The Kb values for the complexes [CuL2], [NiL2] and [VOL2] were 2.4 × 105, 1.9 × 105 and 4.2 × 104, respectively. [CuL2] complex was bound more toughly than [NiL2] and [VOL2] complexes. These complexes had a significant interaction with Bovine Serum Albumin (BSA) and the results demonstrated that the quenching mechanism was a static procedure. Also, the complexes interacted with BSA by more than one binding site (n > 1). Finally, the theoretical studies were performed using the docking method to calculate the binding constants and recognize the binding site of the DNA and BSA with the complexes. The ligand and complexes including Ni2 +, Cu2 + and VO2 + ions were colonized by fungal growth.

  15. DNA origami nanorobot fiber optic genosensor to TMV.

    Science.gov (United States)

    Torelli, Emanuela; Manzano, Marisa; Srivastava, Sachin K; Marks, Robert S

    2018-01-15

    In the quest of greater sensitivity and specificity of diagnostic systems, one continually searches for alternative DNA hybridization methods, enabling greater versatility and where possible field-enabled detection of target analytes. We present, herein, a hybrid molecular self-assembled scaffolded DNA origami entity, intimately immobilized via capture probes linked to aminopropyltriethoxysilane, onto a glass optical fiber end-face transducer, thus producing a novel biosensor. Immobilized DNA nanorobots with a switchable flap can then be actuated by a specific target DNA present in a sample, by exposing a hemin/G-quadruplex DNAzyme, which then catalyzes the generation of chemiluminescence, once the specific fiber probes are immersed in a luminol-based solution. Integrating organic nanorobots to inorganic fiber optics creates a hybrid system that we demonstrate as a proof-of-principle can be utilized in specific DNA sequence detection. This system has potential applications in a wide range of fields, including point-of-care diagnostics or cellular in vivo biosensing when using ultrathin fiber optic probes for research purposes. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Label-Free Ag+ Detection by Enhancing DNA Sensitized Tb3+ Luminescence

    Directory of Open Access Journals (Sweden)

    Kimberly Kleinke

    2016-08-01

    Full Text Available In this work, the effect of Ag+ on DNA sensitized Tb3+ luminescence was studied initially using the Ag+-specific RNA-cleaving DNAzyme, Ag10c. While we expected to observe luminescence quenching by Ag+, a significant enhancement was produced. Based on this observation, simple DNA oligonucleotide homopolymers were used with systematically varied sequence and length. We discovered that both poly-G and poly-T DNA have a significant emission enhancement by Ag+, while the absolute intensity is stronger with the poly-G DNA, indicating that a G-quadruplex DNA is not required for this enhancement. Using the optimized length of the G7 DNA (an oligo constituted with seven guanines, Ag+ was measured with a detection limit of 57.6 nM. The signaling kinetics, G7 DNA conformation, and the binding affinity of Tb3+ to the DNA in the presence or absence of Ag+ are also studied to reveal the mechanism of emission enhancement. This observation is useful not only for label-free detection of Ag+, but also interesting for the rational design of new biosensors using Tb3+ luminescence.

  17. Nanocarriers for DNA Vaccines: Co-Delivery of TLR-9 and NLR-2 Ligands Leads to Synergistic Enhancement of Proinflammatory Cytokine Release

    Directory of Open Access Journals (Sweden)

    Johanna Poecheim

    2015-12-01

    Full Text Available Adjuvants enhance immunogenicity of vaccines through either targeted antigen delivery or stimulation of immune receptors. Three cationic nanoparticle formulations were evaluated for their potential as carriers for a DNA vaccine, and muramyl dipeptide (MDP as immunostimulatory agent, to induce and increase immunogenicity of Mycobacterium tuberculosis antigen encoding plasmid DNA (pDNA. The formulations included (1 trimethyl chitosan (TMC nanoparticles, (2 a squalene-in-water nanoemulsion, and (3 a mineral oil-in-water nanoemulsion. The adjuvant effect of the pDNA-nanocomplexes was evaluated by serum antibody analysis in immunized mice. All three carriers display a strong adjuvant effect, however, only TMC nanoparticles were capable to bias immune responses towards Th1. pDNA naturally contains immunostimulatory unmethylated CpG motifs that are recognized by Toll-like receptor 9 (TLR-9. In mechanistic in vitro studies, activation of TLR-9 and the ability to enhance immunogenicity by simultaneously targeting TLR-9 and NOD-like receptor 2 (NLR-2 was determined by proinflammatory cytokine release in RAW264.7 macrophages. pDNA in combination with MDP was shown to significantly increase proinflammatory cytokine release in a synergistic manner, dependent on NLR-2 activation. In summary, novel pDNA-Ag85A loaded nanoparticle formulations, which induce antigen specific immune responses in mice were developed, taking advantage of the synergistic combinations of TLR and NLR agonists to increase the adjuvanticity of the carriers used.

  18. MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication.

    Science.gov (United States)

    Kumagai, Akiko; Dunphy, William G

    2017-11-01

    Treslin, which is essential for incorporation of Cdc45 into the replicative helicase, possesses a partner called MTBP (Mdm2-binding protein). We have analyzed Xenopus and human MTBP to assess its role in DNA replication. Depletion of MTBP from Xenopus egg extracts, which also removes Treslin, abolishes DNA replication. These extracts be can rescued with recombinant Treslin-MTBP but not Treslin or MTBP alone. Thus, Treslin-MTBP is collectively necessary for replication. We have identified a C-terminal region of MTBP (the CTM domain) that binds efficiently to both double-stranded DNA and G-quadruplex (G4) DNA. This domain also exhibits homology with budding yeast Sld7. Mutants of MTBP without a functional CTM domain are defective for DNA replication in Xenopus egg extracts. These mutants display an impaired localization to chromatin and the inability to support loading of Cdc45. Human cells harboring such a mutant also display severe S-phase defects. Thus, the CTM domain of MTBP plays a critical role in localizing Treslin-MTBP to the replication apparatus for initiation. © 2017 Kumagai and Dunphy. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  19. Concatenated logic circuits based on a three-way DNA junction: a keypad-lock security system with visible readout and an automatic reset function.

    Science.gov (United States)

    Chen, Junhua; Zhou, Shungui; Wen, Junlin

    2015-01-07

    Concatenated logic circuits operating as a biocomputing keypad-lock security system with an automatic reset function have been successfully constructed on the basis of toehold-mediated strand displacement and three-way-DNA-junction architecture. In comparison with previously reported keypad locks, the distinctive advantage of the proposed security system is that it can be reset and cycled spontaneously a large number of times without an external stimulus, thus making practical applications possible. By the use of a split-G-quadruplex DNAzyme as the signal reporter, the output of the keypad lock can be recognized readily by the naked eye. The "lock" is opened only when the inputs are introduced in an exact order. This requirement provides defense against illegal invasion to protect information at the molecular scale. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.

    Science.gov (United States)

    Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J

    2012-05-11

    T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. (Carboxydiamine)Pt(II) complexes of a combretastatin A-4 analogous chalcone: the influence of the diamine ligand on DNA binding and anticancer effects

    Czech Academy of Sciences Publication Activity Database

    Zoldakova, M.; Biersack, B.; Kostrhunová, Hana; Ahmad, A.; Padhye, S.; Sarkar, F.H.; Schobert, R.; Brabec, Viktor

    2011-01-01

    Roč. 2, č. 6 (2011), s. 493-499 ISSN 2040-2503 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : platinum * DNA binding * anticancer effects Subject RIV: BO - Biophysics Impact factor: 2.800, year: 2011

  2. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  3. Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

    Science.gov (United States)

    Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

    2017-10-18

    G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  4. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  5. Synthesis, spectroscopic and DNA binding ability of CoII, NiII, CuII and ZnII complexes of Schiff base ligand (E)-1-(((1H-benzo[d]imidazol-2-yl)methylimino)methyl)naphthalen-2-ol. X-ray crystal structure determination of cobalt (II) complex.

    Science.gov (United States)

    Yarkandi, Naeema H; El-Ghamry, Hoda A; Gaber, Mohamed

    2017-06-01

    A novel Schiff base ligand, (E)-1-(((1H-benzo[d]imidazol-2-yl)methylimino)methyl)naphthalen-2-ol (HL), has been designed and synthesized in addition to its metal chelates [Co(L) 2 ]·l2H 2 O, [Ni(L)Cl·(H 2 O) 2 ].5H 2 O, [Cu(L)Cl] and [Zn(L)(CH 3 COO)]. The structures of the isolated compounds have been confirmed and identified by means of different spectral and physicochemical techniques including CHN analysis, 1 H & 13 C NMR, mass spectral analysis, molar conductivity measurement, UV-Vis, infrared, magnetic moment in addition to TGA technique. The infrared spectral results ascertained that the ligand acts as monobasic tridentate binding to the metal centers via deprotonated hydroxyl oxygen, azomethine and imidazole nitrogen atoms. The UV-Vis, magnetic susceptibility and molar conductivity data implied octahedral geometry for Co(II) & Ni(II) complexes, tetrahedral for Zn(II) complex and square planar for Cu(II) complex. X-ray structural analysis of Co(II) complex 1 has been reported and discussed. Moreover, the type of interaction between the ligand & its complexes towards salmon sperm DNA (SS-DNA) has been examined by the measurement of absorption spectra and viscosity which confirmed that the ligand and its complexes interact with DNA via intercalation interaction as concluded from the values of binding constants (K b ). Copyright © 2017 Elsevier B.V. All rights reserved.

  6. A DNA origami nanorobot controlled by nucleic acid hybridization

    KAUST Repository

    Torelli, Emanuela

    2014-03-20

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A DNA origami nanorobot controlled by nucleic acid hybridization.

    Science.gov (United States)

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  9. R-loops and initiation of DNA replication in human cells: a missing link?

    Directory of Open Access Journals (Sweden)

    Rodrigo eLombraña

    2015-04-01

    Full Text Available The unanticipated widespread occurrence of stable hybrid DNA/RNA structures (R-loops in human cells and the increasing evidence of their involvement in several human malignancies have invigorated the research on R-loop biology in recent years. Here we propose that physiological R-loop formation at CpG island promoters can contribute to DNA replication origin specification at these regions, the most efficient replication initiation sites in mammalian cells. Quite likely, this occurs by the strand-displacement reaction activating the formation of G-quadruplex structures that target the Origin Recognition Complex (ORC in the single-stranded conformation. In agreement with this, we found that R-loops co-localize with the ORC within the same CpG island region in a significant fraction of these efficient replication origins, precisely at the position displaying the highest density of G4 motifs. This scenario builds on the connection between transcription and replication in human cells and suggests that R-loop dysregulation at CpG island promoter-origins might contribute to the phenotype of DNA replication abnormalities and loss of genome integrity detected in cancer cells.

  10. Synthesis, spectroscopic and DNA binding ability of Co{sup II}, Ni{sup II}, Cu{sup II} and Zn{sup II} complexes of Schiff base ligand (E)-1-(((1H-benzo[d]imidazol-2-yl)methylimino)methyl)naphthalen-2-ol. X-ray crystal structure determination of cobalt (II) complex

    Energy Technology Data Exchange (ETDEWEB)

    Yarkandi, Naeema H. [Chemistry Department, Faculty of Applied Science, Umm Al–Qura University, Makkah (Saudi Arabia); El-Ghamry, Hoda A., E-mail: helghamrymo@yahoo.com [Chemistry Department, Faculty of Applied Science, Umm Al–Qura University, Makkah (Saudi Arabia); Chemistry Department, Faculty of Science, Tanta University, Tanta (Egypt); Gaber, Mohamed [Chemistry Department, Faculty of Science, Tanta University, Tanta (Egypt)

    2017-06-01

    A novel Schiff base ligand, (E)-1-(((1H-benzo[d]imidazol-2-yl)methylimino)methyl)naphthalen-2-ol (HL), has been designed and synthesized in addition to its metal chelates [Co(L){sub 2}]·l2H{sub 2}O, [Ni(L)Cl·(H{sub 2}O){sub 2}].5H{sub 2}O, [Cu(L)Cl] and [Zn(L)(CH{sub 3}COO)]. The structures of the isolated compounds have been confirmed and identified by means of different spectral and physicochemical techniques including CHN analysis, {sup 1}H &{sup 13}C NMR, mass spectral analysis, molar conductivity measurement, UV–Vis, infrared, magnetic moment in addition to TGA technique. The infrared spectral results ascertained that the ligand acts as monobasic tridentate binding to the metal centers via deprotonated hydroxyl oxygen, azomethine and imidazole nitrogen atoms. The UV–Vis, magnetic susceptibility and molar conductivity data implied octahedral geometry for Co(II) & Ni(II) complexes, tetrahedral for Zn(II) complex and square planar for Cu(II) complex. X-ray structural analysis of Co(II) complex 1 has been reported and discussed. Moreover, the type of interaction between the ligand & its complexes towards salmon sperm DNA (SS-DNA) has been examined by the measurement of absorption spectra and viscosity which confirmed that the ligand and its complexes interact with DNA via intercalation interaction as concluded from the values of binding constants (K{sub b}). - Highlights: • Synthesis of Co{sup II}, Ni{sup II}, Cu{sup II} and Zn{sup II} complexes of the Schiff base ligand based on 2-(aminomethyl)benzimidazole moiety. • The constitutions and structures of the ligand and complexes were elucidated. • Molecular structure of Co{sup II} complex was confirmed by single crystal X-ray diffraction method. • The ligand and its complexes interact with SS-DNA via intercalation mods.

  11. TERRA mimicking ssRNAs prevail over the DNA substrate for telomerase in vitro due to interactions with the alternative binding site.

    Science.gov (United States)

    Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga

    2016-06-01

    Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  12. Highly sensitive and selective detection of Pb2+ using a turn-on fluorescent aptamer DNA silver nanoclusters sensor.

    Science.gov (United States)

    Zhang, Baozhu; Wei, Chunying

    2018-05-15

    A novel turn-on fluorescent biosensor has been constructed using C-PS2.M-DNA-templated silver nanoclusters (Ag NCs) with an average diameter of about 1 nm. The proposed approach presents a low-toxic, simple, sensitive, and selective detection for Pb 2+ . The fluorescence intensity of C-PS2.M-DNA-Ag NCs enhances significantly in the presence of Pb 2+ , which is attributed to the special interaction between Pb 2+ and its aptamer DNA PS2.M. Pb 2+ induces the aptamer to form G-quadruplex and makes two darkish DNA/Ag NCs located at the 3' and 5' terminus close, resulting in the fluorescence light-up. Moreover, Pb 2+ can be detected as low as 3.0 nM within a good linear range from 5 to 50 nM (R = 0.9862). Furthermore, the application for detection of Pb 2+ in real water samples further demonstrates the reliability of the sensor. Thus, this sensor system shows a potential application for monitoring Pb 2+ in environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    Science.gov (United States)

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Reduction of dinitrogen ligands

    International Nuclear Information System (INIS)

    Richards, R.L.

    1983-01-01

    Processes of dinitrogen ligand reduction in complexes of transition metals are considered. The basic character of the dinitrogen ligand is underlined. Data on X-ray photoelectronic spectroscopy and intensities of bands ν (N 2 ) in IR-spectra of nitrogen complexes are given. The mechanism of protonation of an edge dinitrogen ligand is discussed. Model systems and mechanism of nitrogenogenase are compared

  15. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  16. Reversible Modulation of DNA-Based Hydrogel Shapes by Internal Stress Interactions.

    Science.gov (United States)

    Hu, Yuwei; Kahn, Jason S; Guo, Weiwei; Huang, Fujian; Fadeev, Michael; Harries, Daniel; Willner, Itamar

    2016-12-14

    We present the assembly of asymmetric two-layer hybrid DNA-based hydrogels revealing stimuli-triggered reversibly modulated shape transitions. Asymmetric, linear hydrogels that include layer-selective switchable stimuli-responsive elements that control the hydrogel stiffness are designed. Trigger-induced stress in one of the layers results in the bending of the linear hybrid structure, thereby minimizing the elastic free energy of the systems. The removal of the stress by a counter-trigger restores the original linear bilayer hydrogel. The stiffness of the DNA hydrogel layers is controlled by thermal, pH (i-motif), K + ion/crown ether (G-quadruplexes), chemical (pH-doped polyaniline), or biocatalytic (glucose oxidase/urease) triggers. A theoretical model relating the experimental bending radius of curvatures of the hydrogels with the Young's moduli and geometrical parameters of the hydrogels is provided. Promising applications of shape-regulated stimuli-responsive asymmetric hydrogels include their use as valves, actuators, sensors, and drug delivery devices.

  17. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  18. Logic gates and antisense DNA devices operating on a translator nucleic Acid scaffold.

    Science.gov (United States)

    Shlyahovsky, Bella; Li, Yang; Lioubashevski, Oleg; Elbaz, Johann; Willner, Itamar

    2009-07-28

    A series of logic gates, "AND", "OR", and "XOR", are designed using a DNA scaffold that includes four "footholds" on which the logic operations are activated. Two of the footholds represent input-recognition strands, and these are blocked by complementary nucleic acids, whereas the other two footholds are blocked by nucleic acids that include the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The logic gates are activated by either nucleic acid inputs that hybridize to the respective "footholds", or by low-molecular-weight inputs (adenosine monophosphate or cocaine) that yield the respective aptamer-substrate complexes. This results in the respective translocation of the blocking nucleic acids to the footholds carrying the HRP-mimicking DNAzyme sequence, and the concomitant release of the respective DNAzyme. The released product-strands then self-assemble into the hemin/G-quadruplex-HRP-mimicking DNAzyme that biocatalyzes the formation of a colored product and provides an output signal for the different logic gates. The principle of the logic operation is, then, implemented as a possible paradigm for future nanomedicine. The nucleic acid inputs that bind to the blocked footholds result in the translocation of the blocking nucleic acids to the respective footholds carrying the antithrombin aptamer. The released aptamer inhibits, then, the hydrolytic activity of thrombin. The system demonstrates the regulation of a biocatalytic reaction by a translator system activated on a DNA scaffold.

  19. Ligands in PSI structures

    International Nuclear Information System (INIS)

    Kumar, Abhinav; Chiu, Hsiu-Ju; Axelrod, Herbert L.; Morse, Andrew; Elsliger, Marc-André; Wilson, Ian A.; Deacon, Ashley

    2010-01-01

    A survey of the types and frequency of ligands that are bound to PSI structures is analyzed as well as their utility in functional annotation of previously uncharacterized proteins. Approximately 65% of PSI structures report some type of ligand(s) that is bound in the crystal structure. Here, a description is given of how such ligands are handled and analyzed at the JCSG and a survey of the types, variety and frequency of ligands that are observed in the PSI structures is also compiled and analyzed, including illustrations of how these bound ligands have provided functional clues for annotation of proteins with little or no previous experimental characterization. Furthermore, a web server was developed as a tool to mine and analyze the PSI structures for bound ligands and other identifying features

  20. Carbohydrates/nucleosides/RNA-DNA-ligand interactions

    International Nuclear Information System (INIS)

    Kaptein, R.; McConnell, B.; Serianni, A.S.; Silks, L.A. III.

    1994-01-01

    Carbohydrate and nucleotide structural determination using modern spectroscopic techniques is dependent on our ability to label oligonucleotides and oligosaccharides with stable isotopes. Uniform Carbon 13 and Nitrogen 15 labeling of oligonucleotides is important to present-day efforts, which are focused on determining the structure of relatively small oligosaccharides and oligonucleotides, which form the elements of larger structures. Because of the relatively recent interest in three-dimensional structure, the development of techniques used to label them has lagged behind parallel techniques used to label peptides and proteins. Therefore, this group's discussion focused primarily on problems faced today in obtaining oligonucleotides labeled uniformly with carbon 13 and nitrogen 15

  1. Carbohydrates/nucleosides/RNA-DNA-ligand interactions

    Energy Technology Data Exchange (ETDEWEB)

    Kaptein, R.; McConnell, B.; Serianni, A.S.; Silks, L.A. III

    1994-12-01

    Carbohydrate and nucleotide structural determination using modern spectroscopic techniques is dependent on our ability to label oligonucleotides and oligosaccharides with stable isotopes. Uniform Carbon 13 and Nitrogen 15 labeling of oligonucleotides is important to present-day efforts, which are focused on determining the structure of relatively small oligosaccharides and oligonucleotides, which form the elements of larger structures. Because of the relatively recent interest in three-dimensional structure, the development of techniques used to label them has lagged behind parallel techniques used to label peptides and proteins. Therefore, this group`s discussion focused primarily on problems faced today in obtaining oligonucleotides labeled uniformly with carbon 13 and nitrogen 15.

  2. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  3. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  4. Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

    Science.gov (United States)

    Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

    2017-12-01

    Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

    Science.gov (United States)

    Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

    2016-04-05

    Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery.

  6. Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.J.; Xu, C.X.; Di Felice, R.; Šponer, Jiří; Islam, B.; Stadlbauer, Petr; Ding, Y.; Mao, L.; Mao, Z.W.; Qin, P.Z.

    2016-01-01

    Roč. 55, č. 2 (2016), s. 360-372 ISSN 0006-2960 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : PARAMAGNETIC-RESONANCE SPECTROSCOPY * AMBER FORCE-FIELD * NUCLEIC-ACIDS Subject RIV: BO - Biophysics Impact factor: 2.938, year: 2016

  7. Wild-type p53 binds to MYC promoter G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejci, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matěj; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    Roč. 36, OCT2016 (2016), č. článku e00397. ISSN 0144-8463 R&D Projects: GA ČR GA13-36108S; GA ČR GAP205/12/0466 Institutional support: RVO:68081707 Keywords : nuclease-hypersensitive element * c-terminal domain * gene-expression Subject RIV: BO - Biophysics Impact factor: 2.906, year: 2016

  8. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  9. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  10. Stephen Neidle on cancer therapy and G-quadruplex inhibitors. Interview by Joanna De Souza.

    Science.gov (United States)

    Neidle, Stephen

    2004-09-15

    Stephen Neidle was educated at Imperial College, London, where he graduated in chemistry and then proceeded to do a PhD in crystallography. After a period as an ICI Fellow, he joined the Biophysics Department at King's College, which ignited his interest in nucleic acid structural studies. He was appointed as one of the first Cancer Research Campaign Career Development Awardees, becoming a Life Fellow on moving to the Institute of Cancer Research. He was appointed to the Chair of Biophysics at the Institute of Cancer Research in 1990, and moved to the new Chair of Chemical Biology at the School of Pharmacy in the University of London in 2002, where he also directs the Cancer Research UK Biomolecular Structure Group. He is currently Chairman of the Chemical Biology Forum of the Royal Society of Chemistry, which is involved in developing the interface between chemistry and the life sciences. He will shortly assume the Directorship of the newly-established Centre for Cancer Medicines at the School. Stephen Neidle has received several awards for his work on drug-nucleic acid recognition and drug design, including the 2000 prize of the Biological and Medicinal Chemistry Sector of the Royal Society of Chemistry, and its 2002 Interdisciplinary Award. He was the 2004 Paul Ehrlich Lecturer of the French Societé de Chimie Therapeutique, and was recently awarded the 2004 Aventis Prize in Medicinal Chemistry.

  11. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Yodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), 11528–11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation(US) 1430124 Institutional support: RVO:68378050 Keywords : Bloom helicase * ATP * Gquadruplex (GQ) structure * GQ destabilization Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  12. Bloom’s syndrome protein unfolding G-quadruplexes in two pathways

    Science.gov (United States)

    Zhao, Zhen-Ye; Xu, Chun-Hua; Shi, Jing; Li, Jing-Hua; Ma, Jian-Bing; Jia, Qi; Ma, Dong-Fei; Li, Ming; Lu, Ying

    2017-08-01

    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674382, 11574381, and 11574382) and the Key Research Program of Frontier Sciences, Chinese Academy of Sciences (Grant No. QYZDJ-SSW-SYS014).

  13. DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

    Science.gov (United States)

    Thys, Ryan Griffin; Wang, Yuh-Hwa

    2015-11-27

    DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    Science.gov (United States)

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

    2015-11-15

    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Toehold-mediated strand displacement reaction-dependent fluorescent strategy for sensitive detection of uracil-DNA glycosylase activity.

    Science.gov (United States)

    Wu, Yushu; Wang, Lei; Jiang, Wei

    2017-03-15

    Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. A novel microfluidic mixer based on dual-hydrodynamic focusing for interrogating the kinetics of DNA-protein interaction.

    Science.gov (United States)

    Li, Ying; Xu, Fei; Liu, Chao; Xu, Youzhi; Feng, Xiaojun; Liu, Bi-Feng

    2013-08-21

    Kinetic measurement of biomacromolecular interaction plays a significant role in revealing the underlying mechanisms of cellular activities. Due to the small diffusion coefficient of biomacromolecules, it is difficult to resolve the rapid kinetic process with traditional analytical methods such as stopped-flow or laminar mixers. Here, we demonstrated a unique continuous-flow laminar mixer based on microfluidic dual-hydrodynamic focusing to characterize the kinetics of DNA-protein interactions. The time window of this mixer for kinetics observation could cover from sub-milliseconds to seconds, which made it possible to capture the folding process with a wide dynamic range. Moreover, the sample consumption was remarkably reduced to <0.55 μL min⁻¹, over 1000-fold saving in comparison to those reported previously. We further interrogated the interaction kinetics of G-quadruplex and the single-stranded DNA binding protein, indicating that this novel micromixer would be a useful approach for analyzing the interaction kinetics of biomacromolecules.

  17. Schiff base ligand

    Indian Academy of Sciences (India)

    Unknown

    Low-temperature stoichiometric Schiff base reaction in air in 3 : 1 mole ratio between benz- aldehyde and triethylenetetramine (trien) in methanol yields a novel tetraaza µ-bis(bidentate) acyclic ligand L. It was .... electrochemical work was performed as reported in ..... change in ligand shape through change in oxidation.

  18. Orthogonal Operation of Constitutional Dynamic Networks Consisting of DNA-Tweezer Machines.

    Science.gov (United States)

    Yue, Liang; Wang, Shan; Cecconello, Alessandro; Lehn, Jean-Marie; Willner, Itamar

    2017-12-26

    Overexpression or down-regulation of cellular processes are often controlled by dynamic chemical networks. Bioinspired by nature, we introduce constitutional dynamic networks (CDNs) as systems that emulate the principle of the nature processes. The CDNs comprise dynamically interconvertible equilibrated constituents that respond to external triggers by adapting the composition of the dynamic mixture to the energetic stabilization of the constituents. We introduce a nucleic acid-based CDN that includes four interconvertible and mechanically triggered tweezers, AA', BB', AB' and BA', existing in closed, closed, open, and open configurations, respectively. By subjecting the CDN to auxiliary triggers, the guided stabilization of one of the network constituents dictates the dynamic reconfiguration of the structures of the tweezers constituents. The orthogonal and reversible operations of the CDN DNA tweezers are demonstrated, using T-A·T triplex or K + -stabilized G-quadruplex as structural motifs that control the stabilities of the constituents. The implications of the study rest on the possible applications of input-guided CDN assemblies for sensing, logic gate operations, and programmed activation of molecular machines.

  19. High-resolution AFM structure of DNA G-wires in aqueous solution.

    Science.gov (United States)

    Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân

    2018-05-17

    We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.

  20. Mycobacterium tuberculosis DinG is a structure-specific helicase that unwinds G4 DNA: implications for targeting G4 DNA as a novel therapeutic approach.

    Science.gov (United States)

    Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh

    2014-09-05

    The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Lentivector Integration Sites in Ependymal Cells From a Model of Metachromatic Leukodystrophy: Non-B DNA as a New Factor Influencing Integration

    Science.gov (United States)

    McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D

    2014-01-01

    The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091

  2. Ligand modeling and design

    Energy Technology Data Exchange (ETDEWEB)

    Hay, B.P. [Pacific Northwest National Lab., Richland, WA (United States)

    1997-10-01

    The purpose of this work is to develop and implement a molecular design basis for selecting organic ligands that would be used in the cost-effective removal of specific radionuclides from nuclear waste streams. Organic ligands with metal ion specificity are critical components in the development of solvent extraction and ion exchange processes that are highly selective for targeted radionuclides. The traditional approach to the development of such ligands involves lengthy programs of organic synthesis and testing, which in the absence of reliable methods for screening compounds before synthesis, results in wasted research effort. The author`s approach breaks down and simplifies this costly process with the aid of computer-based molecular modeling techniques. Commercial software for organic molecular modeling is being configured to examine the interactions between organic ligands and metal ions, yielding an inexpensive, commercially or readily available computational tool that can be used to predict the structures and energies of ligand-metal complexes. Users will be able to correlate the large body of existing experimental data on structure, solution binding affinity, and metal ion selectivity to develop structural design criteria. These criteria will provide a basis for selecting ligands that can be implemented in separations technologies through collaboration with other DOE national laboratories and private industry. The initial focus will be to select ether-based ligands that can be applied to the recovery and concentration of the alkali and alkaline earth metal ions including cesium, strontium, and radium.

  3. EGFR Activation by Spatially Restricted Ligands

    Science.gov (United States)

    2006-06-01

    the level of ligand production, that result in human breast cancer. We have integrated genetic and biochemical methods to study (1) the effects of a...and spindle-B encode components of the RAD52 DNA repair pathway and affect meiosis and patterning in Drosophila oogenesis. Genes Dev 12, 2711-2723...findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army position, policy or decision

  4. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    Science.gov (United States)

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Principles of DNA architectonics: design of DNA-based nanoobjects

    International Nuclear Information System (INIS)

    Vinogradova, O A; Pyshnyi, D V

    2012-01-01

    The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

  6. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    Science.gov (United States)

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Glutamate receptor ligands

    DEFF Research Database (Denmark)

    Guldbrandt, Mette; Johansen, Tommy N; Frydenvang, Karla Andrea

    2002-01-01

    Homologation and substitution on the carbon backbone of (S)-glutamic acid [(S)-Glu, 1], as well as absolute stereochemistry, are structural parameters of key importance for the pharmacological profile of (S)-Glu receptor ligands. We describe a series of methyl-substituted 2-aminoadipic acid (AA...

  8. Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

    Science.gov (United States)

    Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

    2018-01-22

    An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. AMPA receptor ligands

    DEFF Research Database (Denmark)

    Strømgaard, Kristian; Mellor, Ian

    2004-01-01

    Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (AMPAR), subtype of the ionotropic glutamate receptors (IGRs), mediate fast synaptic transmission in the central nervous system (CNS), and are involved in many neurological disorders, as well as being a key player in the f......Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (AMPAR), subtype of the ionotropic glutamate receptors (IGRs), mediate fast synaptic transmission in the central nervous system (CNS), and are involved in many neurological disorders, as well as being a key player...... in the formation of memory. Hence, ligands affecting AMPARs are highly important for the study of the structure and function of this receptor, and in this regard polyamine-based ligands, particularly polyamine toxins, are unique as they selectively block Ca2+ -permeable AMPARs. Indeed, endogenous intracellular...

  10. Effects of electrostatic interactions on ligand dissociation kinetics

    Science.gov (United States)

    Erbaş, Aykut; de la Cruz, Monica Olvera; Marko, John F.

    2018-02-01

    We study unbinding of multivalent cationic ligands from oppositely charged polymeric binding sites sparsely grafted on a flat neutral substrate. Our molecular dynamics simulations are suggested by single-molecule studies of protein-DNA interactions. We consider univalent salt concentrations spanning roughly a 1000-fold range, together with various concentrations of excess ligands in solution. To reveal the ionic effects on unbinding kinetics of spontaneous and facilitated dissociation mechanisms, we treat electrostatic interactions both at a Debye-Hückel (DH) (or implicit ions, i.e., use of an electrostatic potential with a prescribed decay length) level and by the more precise approach of considering all ionic species explicitly in the simulations. We find that the DH approach systematically overestimates unbinding rates, relative to the calculations where all ion pairs are present explicitly in solution, although many aspects of the two types of calculation are qualitatively similar. For facilitated dissociation (FD) (acceleration of unbinding by free ligands in solution) explicit-ion simulations lead to unbinding at lower free-ligand concentrations. Our simulations predict a variety of FD regimes as a function of free-ligand and ion concentrations; a particularly interesting regime is at intermediate concentrations of ligands where nonelectrostatic binding strength controls FD. We conclude that explicit-ion electrostatic modeling is an essential component to quantitatively tackle problems in molecular ligand dissociation, including nucleic-acid-binding proteins.

  11. Is photocleavage of DNA by YOYO-1 using a synchrotron radiation light source sequence dependent?

    DEFF Research Database (Denmark)

    Gilroy, Emma L.; Hoffmann, Søren Vrønning; Jones, Nykola C.

    2011-01-01

    ) throughout the irradiation period. The dependence of LD signals on DNA sequences and on time in the intense light beam was explored and quantified for single-stranded poly(dA), poly[(dA-dT)2], calf thymus DNA (ctDNA) and Micrococcus luteus DNA (mlDNA). The DNA and ligand regions of the spectrum showed...

  12. DNA binding mode of the cis and trans geometries of new antitumor nonclassical platinum complexes containing piperidine, piperazine or 4-picoline ligand in cell-free media. Relations to their activity in cancer cell lines

    Czech Academy of Sciences Publication Activity Database

    Kašpárková, Jana; Marini, Victoria; Najajreh, Y.; Gibson, D.; Brabec, Viktor

    2003-01-01

    Roč. 42, č. 20 (2003), s. 6321-6332 ISSN 0006-2960 R&D Projects: GA AV ČR IAA5004101; GA AV ČR KJB5004301; GA ČR GA305/01/0418 Institutional research plan: CEZ:AV0Z5004920 Keywords : cross links * DNA * nonclassical platinum complexes Subject RIV: BO - Biophysics Impact factor: 3.922, year: 2003

  13. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  14. Bexarotene ligand pharmaceuticals.

    Science.gov (United States)

    Hurst, R E

    2000-12-01

    Bexarotene (LGD-1069), from Ligand, was the first retinoid X receptor (RXR)-selective, antitumor retinoid to enter clinical trials. The company launched the drug for the treatment of cutaneous T-cell lymphoma (CTCL), as Targretin capsules, in the US in January 2000 [359023]. The company filed an NDA for Targretin capsules in June 1999, and for topical gel in December 1999 [329011], [349982] specifically for once-daily oral administration for the treatment of patients with early-stage CTCL who have not tolerated other therapies, patients with refractory or persistent early stage CTCL and patients with refractory advanced stage CTCL. The FDA approved Targretin capsules at the end of December 1999 for once-daily oral treatment of all stages of CTCL in patients refractory to at least one prior systemic therapy, at an initial dose of 300 mg/m2/day. After an NDA was submitted in December 1999 for Targretin gel, the drug received Priority Review status for use as a treatment of cutaneous lesions in patients with stage IA, IB or IIA CTCL [354836]. The FDA issued an approvable letter in June 2000, and granted marketing clearance for CTCL in the same month [370687], [372768], [372769], [373279]. Ligand had received Orphan Drug designation for this indication [329011]. At the request of the FDA, Ligand agreed to carry out certain post-approval phase IV and pharmacokinetic studies [351604]. The company filed an MAA with the EMEA for Targretin Capsules to treat lymphoma in November 1999 [348944]. The NDA for Targretin gel is based on a multicenter phase III trial that was conducted in the US, Canada, Europe and Australia involving 50 patients and a multicenter phase I/II clinical program involving 67 patients. Targretin gel was evaluated for the treatment of patients with early stage CTCL (IA-IIA) who were refractory to, intolerant to, or reached a response plateau for at least 6 months on at least two prior therapies. Efficacy results exceeded the protocol-defined response

  15. Strong preference of BRCA1 protein to topologically constrained non-B DNA structures

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fridrichova, Helena; Jagelská, Eva

    2016-01-01

    Roč. 17, JAN2016 (2016), č. článku 14. ISSN 1471-2199 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : double-strand breaks * g-quadruplexes * c-myc Subject RIV: BO - Biophysics Impact factor: 1.939, year: 2016

  16. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

    Science.gov (United States)

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

    2014-09-15

    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Singular Value Decomposition and Ligand Binding Analysis

    Directory of Open Access Journals (Sweden)

    André Luiz Galo

    2013-01-01

    Full Text Available Singular values decomposition (SVD is one of the most important computations in linear algebra because of its vast application for data analysis. It is particularly useful for resolving problems involving least-squares minimization, the determination of matrix rank, and the solution of certain problems involving Euclidean norms. Such problems arise in the spectral analysis of ligand binding to macromolecule. Here, we present a spectral data analysis method using SVD (SVD analysis and nonlinear fitting to determine the binding characteristics of intercalating drugs to DNA. This methodology reduces noise and identifies distinct spectral species similar to traditional principal component analysis as well as fitting nonlinear binding parameters. We applied SVD analysis to investigate the interaction of actinomycin D and daunomycin with native DNA. This methodology does not require prior knowledge of ligand molar extinction coefficients (free and bound, which potentially limits binding analysis. Data are acquired simply by reconstructing the experimental data and by adjusting the product of deconvoluted matrices and the matrix of model coefficients determined by the Scatchard and McGee and von Hippel equation.

  19. Discovery of DNA repair inhibitors by combinatorial library profiling

    Science.gov (United States)

    Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih

    2011-01-01

    Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400

  20. Ligand Depot: a data warehouse for ligands bound to macromolecules.

    Science.gov (United States)

    Feng, Zukang; Chen, Li; Maddula, Himabindu; Akcan, Ozgur; Oughtred, Rose; Berman, Helen M; Westbrook, John

    2004-09-01

    Ligand Depot is an integrated data resource for finding information about small molecules bound to proteins and nucleic acids. The initial release (version 1.0, November, 2003) focuses on providing chemical and structural information for small molecules found as part of the structures deposited in the Protein Data Bank. Ligand Depot accepts keyword-based queries and also provides a graphical interface for performing chemical substructure searches. A wide variety of web resources that contain information on small molecules may also be accessed through Ligand Depot. Ligand Depot is available at http://ligand-depot.rutgers.edu/. Version 1.0 supports multiple operating systems including Windows, Unix, Linux and the Macintosh operating system. The current drawing tool works in Internet Explorer, Netscape and Mozilla on Windows, Unix and Linux.

  1. Metal-ligand interactions

    Science.gov (United States)

    Ervin, Kent M.

    Experimental studies of the interactions of small transition-metal cluster anions with carbonyl ligands are reviewed and compared with neutral and cationic clusters. Under thermal conditions, the reaction rates of transition-metal clusters with carbon monoxide are measured as a function of cluster size. Saturation limits for carbon monoxide addition can be related to the geometric structures of the clusters. Both energy-resolved threshold collision-induced dissociation experiments and time-resolved photodissociation experiments are used to measure metal-carbonyl binding energies. For platinum and palladium trimer anions, the carbonyl binding energies are assigned to different geometric binding sites. Platinum and palladium cluster anions catalyse the oxidation of carbon monoxide to carbon dioxide in a full catalytic cycle at thermal energies.

  2. Melatonin: functions and ligands.

    Science.gov (United States)

    Singh, Mahaveer; Jadhav, Hemant R

    2014-09-01

    Melatonin is a chronobiotic substance that acts as synchronizer by stabilizing bodily rhythms. Its synthesis occurs in various locations throughout the body, including the pineal gland, skin, lymphocytes and gastrointestinal tract (GIT). Its synthesis and secretion is controlled by light and dark conditions, whereby light decreases and darkness increases its production. Thus, melatonin is also known as the 'hormone of darkness'. Melatonin and analogs that bind to the melatonin receptors are important because of their role in the management of depression, insomnia, epilepsy, Alzheimer's disease (AD), diabetes, obesity, alopecia, migraine, cancer, and immune and cardiac disorders. In this review, we discuss the mechanism of action of melatonin in these disorders, which could aid in the design of novel melatonin receptor ligands. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. HPV18 Persistence Impairs Basal and DNA Ligand-Mediated IFN-β and IFN-λ1 Production through Transcriptional Repression of Multiple Downstream Effectors of Pattern Recognition Receptor Signaling.

    Science.gov (United States)

    Albertini, Silvia; Lo Cigno, Irene; Calati, Federica; De Andrea, Marco; Borgogna, Cinzia; Dell'Oste, Valentina; Landolfo, Santo; Gariglio, Marisa

    2018-03-15

    Although it is clear that high-risk human papillomaviruses (HPVs) can selectively infect keratinocytes and persist in the host, it still remains to be unequivocally determined whether they can escape antiviral innate immunity by interfering with pattern recognition receptor (PRR) signaling. In this study, we have assessed the innate immune response in monolayer and organotypic raft cultures of NIKS cells harboring multiple copies of episomal HPV18 (NIKSmcHPV18), which fully recapitulates the persistent state of infection. We show for the first time, to our knowledge, that NIKSmcHPV18, as well as HeLa cells (a cervical carcinoma-derived cell line harboring integrated HPV18 DNA), display marked downregulation of several PRRs, as well as other PRR downstream effectors, such as the adaptor protein stimulator of IFN genes and the transcription factors IRF1 and 7. Importantly, we provide evidence that downregulation of stimulator of IFN genes, cyclic GMP-AMP synthase, and retinoic acid-inducible gene I mRNA levels occurs at the transcriptional level through a novel epigenetic silencing mechanism, as documented by the accumulation of repressive heterochromatin markers seen at the promoter region of these genes. Furthermore, stimulation of NIKSmcHPV18 cells with salmon sperm DNA or poly(deoxyadenylic-deoxythymidylic) acid, two potent inducers of PRR signaling, only partially restored PRR protein expression. Accordingly, the production of IFN-β and IFN-λ 1 was significantly reduced in comparison with the parental NIKS cells, indicating that HPV18 exerts its immunosuppressive activity through downregulation of PRR signaling. Altogether, our findings indicate that high-risk human papillomaviruses have evolved broad-spectrum mechanisms that allow simultaneous depletion of multiple effectors of the innate immunity network, thereby creating an unreactive cellular milieu suitable for viral persistence. Copyright © 2018 by The American Association of Immunologists, Inc.

  4. Photocleavage of DNA by copper (II) complexes

    Indian Academy of Sciences (India)

    The chemistry of ternary and binary copper(II) complexes showing efficient visible lightinduced DNA cleavage activity is summarized in this article. The role of the metal in photo-induced DNA cleavage reactions is explored by designing complex molecules having a variety of ligands. Ternary copper(II) complexes with amino ...

  5. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    OpenAIRE

    Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...

  6. Urate is a ligand for the transcriptional regulator PecS.

    Science.gov (United States)

    Perera, Inoka C; Grove, Anne

    2010-09-24

    PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nelson Laura D

    2012-06-01

    Full Text Available Abstract Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024. EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated

  8. Two novel mixed-ligand complexes containing organosulfonate ligands.

    Science.gov (United States)

    Li, Mingtian; Huang, Jun; Zhou, Xuan; Fang, Hua; Ding, Liyun

    2008-07-01

    The structures reported herein, viz. bis(4-aminonaphthalene-1-sulfonato-kappaO)bis(4,5-diazafluoren-9-one-kappa(2)N,N')copper(II), [Cu(C(10)H(8)NO(3)S)(2)(C(11)H(6)N(2)O)(2)], (I), and poly[[[diaquacadmium(II)]-bis(mu-4-aminonaphthalene-1-sulfonato)-kappa(2)O:N;kappa(2)N:O] dihydrate], {[Cd(C(10)H(8)NO(3)S)(2)(H(2)O)(2)].2H(2)O}(n), (II), are rare examples of sulfonate-containing complexes where the anion does not fulfill a passive charge-balancing role, but takes an active part in coordination as a monodentate and/or bridging ligand. Monomeric complex (I) possesses a crystallographic inversion center at the Cu(II) atom, and the asymmetric unit contains one-half of a Cu atom, one complete 4-aminonaphthalene-1-sulfonate (ans) ligand and one 4,5-diazafluoren-9-one (DAFO) ligand. The Cu(II) atom has an elongated distorted octahedral coordination geometry formed by two O atoms from two monodentate ans ligands and by four N atoms from two DAFO molecules. Complex (II) is polymeric and its crystal structure is built up by one-dimensional chains and solvent water molecules. Here also the cation (a Cd(II) atom) lies on a crystallographic inversion center and adopts a slightly distorted octahedral geometry. Each ans anion serves as a bridging ligand linking two Cd(II) atoms into one-dimensional infinite chains along the [010] direction, with each Cd(II) center coordinated by four ans ligands via O and N atoms and by two aqua ligands. In both structures, there are significant pi-pi stacking interactions between adjacent ligands and hydrogen bonds contribute to the formation of two- and three-dimensional networks.

  9. Correcting ligands, metabolites, and pathways

    NARCIS (Netherlands)

    Ott, M.A.; Vriend, G.

    2006-01-01

    BACKGROUND: A wide range of research areas in bioinformatics, molecular biology and medicinal chemistry require precise chemical structure information about molecules and reactions, e.g. drug design, ligand docking, metabolic network reconstruction, and systems biology. Most available databases,

  10. Control of DNA hybridization by photoswitchable molecular glue.

    Science.gov (United States)

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  11. Ligand-Modified Human Serum Albumin Nanoparticles for Enhanced Gene Delivery.

    Science.gov (United States)

    Look, Jennifer; Wilhelm, Nadine; von Briesen, Hagen; Noske, Nadja; Günther, Christine; Langer, Klaus; Gorjup, Erwin

    2015-09-08

    The development of nonviral gene delivery systems is a great challenge to enable safe gene therapy. In this study, ligand-modified nanoparticles based on human serum albumin (HSA) were developed and optimized for an efficient gene therapy. Different glutaraldehyde cross-linking degrees were investigated to optimize the HSA nanoparticles for gene delivery. The peptide sequence arginine-glycine-aspartate (RGD) and the HIV-1 transactivator of transduction sequence (Tat) are well-known as promising targeting ligands. Plasmid DNA loaded HSA nanoparticles were covalently modified on their surface with these different ligands. The transfection potential of the obtained plasmid DNA loaded RGD- and Tat-modified nanoparticles was investigated in vitro, and optimal incubation conditions for these preparations were studied. It turned out that Tat-modified HSA nanoparticles with the lowest cross-linking degree of 20% showed the highest transfection potential. Taken together, ligand-functionalized HSA nanoparticles represent promising tools for efficient and safe gene therapy.

  12. Screening the efficient biological prospects of triazole allied mixed ligand metal complexes

    Science.gov (United States)

    Utthra, Ponnukalai Ponya; Kumaravel, Ganesan; Raman, Natarajan

    2017-12-01

    Triazole appended mixed ligand complexes (1-8) of the general formula [ML (bpy/phen)2]Cl2, where M = Cu(II), Co(II), Ni(II) and Zn(II), L = triazole appended Schiff base (E)sbnd N-(4-nitrobenzylidene)-1H-1,2,4-triazol-3-amine and bpy/phen = 2,2‧-bipyridine/1,10-phenanthroline, have been synthesized. The design and synthesis of this elaborate ligand has been performed with the aim of increasing stability and conjugation of 1,2,4 triazole, whose Schiff base derivatives are known as biologically active compounds thereby exploring their DNA binding affinity and other biological applications. The compounds have been comprehensively characterized by elemental analysis, spectroscopic methods (IR, UV-Vis, EPR, 1H and 13C NMR spectroscopy), ESI mass spectrometry and magnetic susceptibility measurements. The complexes were found to exhibit octahedral geometry. The complexes 1-8 were subjected to DNA binding techniques evaluated using UV-Vis absorption, CV, CD, Fluorescence spectroscopy and hydrodynamic measurements. Complex 5 showed a Kb value of 3.9 × 105 M-1. The DNA damaging efficacy for the complexes was observed to be high compared to the ligand. The antimicrobial screening of the compounds against bacterial and fungal strains indicates that the complexes possess excellent antimicrobial activity than the ligand. The overall biological activity of the complexes with phen as a co-ligand possessed superior potential than the ligand.

  13. Sequence specificity and biological consequences of drugs that bind covalently in the minor groove of DNA

    International Nuclear Information System (INIS)

    Hurley, L.H.; Needham-VanDevanter, D.R.

    1986-01-01

    DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs

  14. LigandRFs: random forest ensemble to identify ligand-binding residues from sequence information alone

    KAUST Repository

    Chen, Peng; Huang, Jianhua Z; Gao, Xin

    2014-01-01

    Protein-ligand binding is important for some proteins to perform their functions. Protein-ligand binding sites are the residues of proteins that physically bind to ligands. Despite of the recent advances in computational prediction

  15. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  16. Synthesis, Characterization and DNA Binding Activity of a Potential DNA Intercalator

    International Nuclear Information System (INIS)

    Siti Norain Harun; Yaakob Razak; Haslina Ahmad

    2016-01-01

    A novel complex, (Ru(dppz) 2 (p-MOPIP)) 2+ (dppz = dipyrido-(3,2-a:20,30-c]phenazine, p-MOPIP = 2-(4-methoxyphenyl) imidazo(4,5-f)(1,10]phenanthroline) has been synthesized and characterized by elemental analysis, 1 H Nuclear Magnetic Resonance spectroscopy, mass spectrometry, Fourier Transform Infrared analysis, Ultra Violet visible and fluorescence spectroscopy. Herein, the complex was designed by adding p-MOPIP as an intercalating ligand and dppz as the ancillary ligand. The DNA binding properties of the complex with Calf Thymus DNA (CT-DNA) were investigated using spectroscopic methods. The UV-visible absorption band observed at 460 nm corresponded to the metal-to-ligand charge transfer (MLCT) while bands at 358 and 281 nm corresponded to intra-ligand (IL) π-π * transitions of the ligand scaffold in p-MOPIP and dppz. The intrinsic binding constant, K b for this complex was 1.67x10 6 M -1 and this suggested that this complex, (Ru(dppz) 2 (p-MOPIP)) 2+ bound to DNA via the intercalative mode. Interestingly, the interaction of this complex with CT-DNA also had a molecular light switch effect. (author)

  17. Rosetta Ligand docking with flexible XML protocols.

    Science.gov (United States)

    Lemmon, Gordon; Meiler, Jens

    2012-01-01

    RosettaLigand is premiere software for predicting how a protein and a small molecule interact. Benchmark studies demonstrate that 70% of the top scoring RosettaLigand predicted interfaces are within 2Å RMSD from the crystal structure [1]. The latest release of Rosetta ligand software includes many new features, such as (1) docking of multiple ligands simultaneously, (2) representing ligands as fragments for greater flexibility, (3) redesign of the interface during docking, and (4) an XML script based interface that gives the user full control of the ligand docking protocol.

  18. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  19. Pulse radiolysis studies on DNA-Binding radioprotectors

    International Nuclear Information System (INIS)

    Anderson, R.F.

    1996-01-01

    Full text: Hoechst 33342 and newly-synthesised analogues exhibit radioprotective activity in cultured cells and in vivo, as described in accompanying abstracts. These minor groove binding ligands bind at discreet sites in DNA, characterised by 3 to 4 consecutive AT base pairs, and DNA sequencing studies have shown focussed radioprotection at these binding sites. There is evidence that the bound ligands also confer more 'global' protection including the intervening DNA between the binding sites. The observed focussed radioprotection could be explained by H-atom donation from the ligand to radiation-induced carbon-centred deoxyribosyl radicals, but this mechanism is unlikely to account for the global radioprotection. We now report pulse radiolysis studies on another possible mechanism, namely reduction of transient radiation-induced oxidising species on DNA by the ligand, which is consistent with the report of reduction of G + by TMPD. Oxidation of deoxyguanosine (dG) by Br 2 - , produced by radiolysis of Br- in N 2 0-saturated solutions, in the presence of Hoechst 33342 results in the appearance of a transient ligand species which is kinetically resolvable from that obtained from direct oxidation of Hoechst 33342 by Br 2 - . A plot of reaction rate versus ligand concentration indicates that the rate constant for reduction of G + is approximately 3 x 10 8 dm 3 M -1 sec -1 . Similar experiments with DNA, rather than dG, also revealed a transient species corresponding to oxidation of the ligand, but the absolute rate of oxidation was considerably slower for the DNA-bound ligand compared to that for oxidation of the free ligand by G+. These results are clearly consistent with the proposed mechanism of radioprotection by Hoechst 33342 and its analogues, moreover, pulse radiolysis may provide a very useful endpoint for screening new analogues, as a preliminary to radiobiological evaluation

  20. Free energy calculations offer insights into the influence of receptor flexibility on ligand-receptor binding affinities.

    Science.gov (United States)

    Dolenc, Jožica; Riniker, Sereina; Gaspari, Roberto; Daura, Xavier; van Gunsteren, Wilfred F

    2011-08-01

    Docking algorithms for computer-aided drug discovery and design often ignore or restrain the flexibility of the receptor, which may lead to a loss of accuracy of the relative free enthalpies of binding. In order to evaluate the contribution of receptor flexibility to relative binding free enthalpies, two host-guest systems have been examined: inclusion complexes of α-cyclodextrin (αCD) with 1-chlorobenzene (ClBn), 1-bromobenzene (BrBn) and toluene (MeBn), and complexes of DNA with the minor-groove binding ligands netropsin (Net) and distamycin (Dist). Molecular dynamics simulations and free energy calculations reveal that restraining of the flexibility of the receptor can have a significant influence on the estimated relative ligand-receptor binding affinities as well as on the predicted structures of the biomolecular complexes. The influence is particularly pronounced in the case of flexible receptors such as DNA, where a 50% contribution of DNA flexibility towards the relative ligand-DNA binding affinities is observed. The differences in the free enthalpy of binding do not arise only from the changes in ligand-DNA interactions but also from changes in ligand-solvent interactions as well as from the loss of DNA configurational entropy upon restraining.

  1. DNA-Protected Silver Clusters for Nanophotonics

    Directory of Open Access Journals (Sweden)

    Elisabeth Gwinn

    2015-02-01

    Full Text Available DNA-protected silver clusters (AgN-DNA possess unique fluorescence properties that depend on the specific DNA template that stabilizes the cluster. They exhibit peak emission wavelengths that range across the visible and near-IR spectrum. This wide color palette, combined with low toxicity, high fluorescence quantum yields of some clusters, low synthesis costs, small cluster sizes and compatibility with DNA are enabling many applications that employ AgN-DNA. Here we review what is known about the underlying composition and structure of AgN-DNA, and how these relate to the optical properties of these fascinating, hybrid biomolecule-metal cluster nanomaterials. We place AgN-DNA in the general context of ligand-stabilized metal clusters and compare their properties to those of other noble metal clusters stabilized by small molecule ligands. The methods used to isolate pure AgN-DNA for analysis of composition and for studies of solution and single-emitter optical properties are discussed. We give a brief overview of structurally sensitive chiroptical studies, both theoretical and experimental, and review experiments on bringing silver clusters of distinct size and color into nanoscale DNA assemblies. Progress towards using DNA scaffolds to assemble multi-cluster arrays is also reviewed.

  2. Study on Electrochemical Insulin Sensing Utilizing a DNA Aptamer-Immobilized Gold Electrode

    Directory of Open Access Journals (Sweden)

    Izumi Kubo

    2015-07-01

    Full Text Available We investigated an insulin-sensing method by utilizing an insulin-binding aptamer IGA3, which forms an anti-parallel G-quadruplex with folded single strands. Spectroscopic observation indicates that some anti-parallel G-quadruplex bind hemin and show peroxidase activity. In this study, the peroxidase activity of IGA3 with hemin was confirmed by spectrophotometric measurements, i.e., the activity was three-times higher than hemin itself. IGA3 was then immobilized onto a gold electrode to determine its electrochemical activity. The peroxidase activity of the immobilized IGA3-hemin complex was determined by cyclic voltammetry, and a cathodic peak current of the electrode showed a dependence on the concentration of H2O2. The cathodic peak current of the IGA3-hemin complex decreased by binding it to insulin, and this decrease depended on the concentration of insulin.

  3. A unique dual recognition hairpin probe mediated fluorescence amplification method for sensitive detection of uracil-DNA glycosylase and endonuclease IV activities.

    Science.gov (United States)

    Wu, Yushu; Yan, Ping; Xu, Xiaowen; Jiang, Wei

    2016-03-07

    Uracil-DNA glycosylase (UDG) and endonuclease IV (Endo IV) play cooperative roles in uracil base-excision repair (UBER) and inactivity of either will interrupt the UBER to cause disease. Detection of UDG and Endo IV activities is crucial to evaluate the UBER process in fundamental research and diagnostic application. Here, a unique dual recognition hairpin probe mediated fluorescence amplification method was developed for sensitively and selectively detecting UDG and Endo IV activities. For detecting UDG activity, the uracil base in the probe was excised by the target enzyme to generate an apurinic/apyrimidinic (AP) site, achieving the UDG recognition. Then, the AP site was cleaved by a tool enzyme Endo IV, releasing a primer to trigger rolling circle amplification (RCA) reaction. Finally, the RCA reaction produced numerous repeated G-quadruplex sequences, which interacted with N-methyl-mesoporphyrin IX to generate an enhanced fluorescence signal. Alternatively, for detecting Endo IV activity, the uracil base in the probe was first converted into an AP site by a tool enzyme UDG. Next, the AP site was cleaved by the target enzyme, achieving the Endo IV recognition. The signal was then generated and amplified in the same way as those in the UDG activity assay. The detection limits were as low as 0.00017 U mL(-1) for UDG and 0.11 U mL(-1) for Endo IV, respectively. Moreover, UDG and Endo IV can be well distinguished from their analogs. This method is beneficial for properly evaluating the UBER process in function studies and disease prognoses.

  4. Crystallization of protein–ligand complexes

    International Nuclear Information System (INIS)

    Hassell, Anne M.; An, Gang; Bledsoe, Randy K.; Bynum, Jane M.; Carter, H. Luke III; Deng, Su-Jun J.; Gampe, Robert T.; Grisard, Tamara E.; Madauss, Kevin P.; Nolte, Robert T.; Rocque, Warren J.; Wang, Liping; Weaver, Kurt L.; Williams, Shawn P.; Wisely, G. Bruce; Xu, Robert; Shewchuk, Lisa M.

    2007-01-01

    Methods presented for growing protein–ligand complexes fall into the categories of co-expression of the protein with the ligands of interest, use of the ligands during protein purification, cocrystallization and soaking the ligands into existing crystals. Obtaining diffraction-quality crystals has long been a bottleneck in solving the three-dimensional structures of proteins. Often proteins may be stabilized when they are complexed with a substrate, nucleic acid, cofactor or small molecule. These ligands, on the other hand, have the potential to induce significant conformational changes to the protein and ab initio screening may be required to find a new crystal form. This paper presents an overview of strategies in the following areas for obtaining crystals of protein–ligand complexes: (i) co-expression of the protein with the ligands of interest, (ii) use of the ligands during protein purification, (iii) cocrystallization and (iv) soaks

  5. -Pincer Ligand Family through Ligand Post-Modification

    KAUST Repository

    Huang, Mei-Hui; Hu, Jinsong; Huang, Kuo-Wei

    2017-01-01

    A series of air-stable nickel complexes containing triazine-based PN3P-pincer ligands were synthesized and fully characterized. Complex 3 contains a de-aromatized central triazine ring from the deprotonation of one of the N–H arms. With a post-modification strategy, the Me-PN3P*NiCl complex (3) could be converted into a new class of diimine–traizine PN3P-pincer nickel complexes.

  6. -Pincer Ligand Family through Ligand Post-Modification

    KAUST Repository

    Huang, Mei-Hui

    2017-10-02

    A series of air-stable nickel complexes containing triazine-based PN3P-pincer ligands were synthesized and fully characterized. Complex 3 contains a de-aromatized central triazine ring from the deprotonation of one of the N–H arms. With a post-modification strategy, the Me-PN3P*NiCl complex (3) could be converted into a new class of diimine–traizine PN3P-pincer nickel complexes.

  7. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    Czech Academy of Sciences Publication Activity Database

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, R.; Vorlíčková, Michaela; Trantírek, L.

    2015-01-01

    Roč. 43, č. 9 (2015), s. 4733-4745 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA13-28310S; GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : NUCLEASE HYPERSENSITIVE ELEMENT * G-QUADRUPLEX STRUCTURES * I-MOTIF Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  8. Reactivity of halide and pseudohalide ligands

    International Nuclear Information System (INIS)

    Kukushkin, Yu.N.

    1987-01-01

    Reactivity of halide and pseudohalide (cyanide, azide, thiocyanate, cyanate) ligands tending to form bridge bonds in transition metal (Re, Mo, W) complexes is considered. Complexes where transition metal salts are ligands of other, complex-forming ion, are described. Transformation of innerspheric pseudohalide ligands is an important way of directed synthesis of these metal coordination compounds

  9. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  10. DNA damage by Auger emitters

    International Nuclear Information System (INIS)

    Martin, R.F.; d'Cunha, Glenn; Gibbs, Richard; Murray, Vincent; Pardee, Marshall; Allen, B.J.

    1988-01-01

    125 I atoms can be introduced at specific locations along a defined DNA target molecule, either by site-directed incorporation of an 125 I-labelled deoxynucleotide or by binding of an 125 I-labelled sequence-selective DNA ligand. After allowing accumulation of 125 I decay-induced damage to the DNA, application of DNA sequencing techniques enables positions of strand breaks to be located relative to the site of decay, at a resolution corresponding to the distance between adjacent nucleotides [0.34 nm]. Thus, DNA provides a molecular framework to analyse the extent of damage following [averaged] individual decay events. Results can be compared with energy deposition data generated by computer-simulation methods developed by Charlton et al. The DNA sequencing technique also provides information about the chemical nature of the termini of the DNA chains produced following Auger decay-induced damage. In addition to reviewing the application of this approach to the analysis of 125 I decay induced DNA damage, some more recent results obtained by using 67 Ga are also presented. (author)

  11. Ligand-regulated peptide aptamers.

    Science.gov (United States)

    Miller, Russell A

    2009-01-01

    The peptide aptamer approach employs high-throughput selection to identify members of a randomized peptide library displayed from a scaffold protein by virtue of their interaction with a target molecule. Extending this approach, we have developed a peptide aptamer scaffold protein that can impart small-molecule control over the aptamer-target interaction. This ligand-regulated peptide (LiRP) scaffold, consisting of the protein domains FKBP12, FRB, and GST, binds to the cell-permeable small-molecule rapamycin and the binding of this molecule can prevent the interaction of the randomizable linker region connecting FKBP12 with FRB. Here we present a detailed protocol for the creation of a peptide aptamer plasmid library, selection of peptide aptamers using the LiRP scaffold in a yeast two-hybrid system, and the screening of those peptide aptamers for a ligand-regulated interaction.

  12. Ligand binding by PDZ domains

    DEFF Research Database (Denmark)

    Chi, Celestine N.; Bach, Anders; Strømgaard, Kristian

    2012-01-01

    , for example, are particularly rich in these domains. The general function of PDZ domains is to bring proteins together within the appropriate cellular compartment, thereby facilitating scaffolding, signaling, and trafficking events. The many functions of PDZ domains under normal physiological as well...... as pathological conditions have been reviewed recently. In this review, we focus on the molecular details of how PDZ domains bind their protein ligands and their potential as drug targets in this context....

  13. Bitopic Ligands and Metastable Binding Sites

    DEFF Research Database (Denmark)

    Fronik, Philipp; Gaiser, Birgit I; Sejer Pedersen, Daniel

    2017-01-01

    of orthosteric binding sites. Bitopic ligands have been employed to address the selectivity problem by combining (linking) an orthosteric ligand with an allosteric modulator, theoretically leading to high-affinity subtype selective ligands. However, it remains a challenge to identify suitable allosteric binding...... that have been reported to date, this type of bitopic ligands would be composed of two identical pharmacophores. Herein, we outline the concept of bitopic ligands, review metastable binding sites, and discuss their potential as a new source of allosteric binding sites....

  14. Radioiodinated ligands for dopamine receptors

    International Nuclear Information System (INIS)

    Kung, H.F.

    1994-01-01

    The dopamine receptor system is important for normal brain function; it is also the apparent action site for various neuroleptic drugs for the treatment of schizophrenia and other metal disorders. In the past few years radioiodinated ligands for single photon emission tomography (SPECT) have been successfully developed and tested in humans: [ 123 I]TISCH for D1 dopamine receptors; [ 123 I]IBZM, epidepride, IBF and FIDA2, four iodobenzamide derivatives, for D2/D3 dopamine receptors. In addition, [ 123 I]β-CIT (RTI-55) and IPT, cocaine derivatives, for the dopamine reuptake site are potentially useful for diagnosis of loss of dopamine neurons. The first iodinated ligand, (R)trans-7-OH-PIPAT, for D3 dopamine receptors, was synthesized and characterized with cloned cell lines (Spodoptera frugiperda, Sf9) expressing the D2 and D3 dopamine receptors and with rat basal forebrain membrane preparations. Most of the known iodobenzamides displayed similar potency in binding to both D2 and D3 dopamine receptors expressed in the cell lines. Initial studies appear to suggest that by fine tuning the structures it may be possible to develop agents specific for D2 and D3 dopamine receptors. It is important to investigate D2/D3 selectivity for this series of potent ligands

  15. Photocleavage of DNA by copper(II) complexes

    Indian Academy of Sciences (India)

    The chemistry of ternary and binary copper(II) complexes showing efficient visible lightinduced DNA cleavage activity is summarized in this article. The role of the metal in photo-induced DNA cleavage reactions is explored by designing complex molecules having a variety of ligands. Ternary copper(II) complexes with amino ...

  16. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  17. Complex DNA structures and structures of DNA complexes

    International Nuclear Information System (INIS)

    Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.

    1994-01-01

    Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful

  18. Complex DNA structures and structures of DNA complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)

    1994-12-01

    Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.

  19. Insights into an original pocket-ligand pair classification: a promising tool for ligand profile prediction.

    Directory of Open Access Journals (Sweden)

    Stéphanie Pérot

    Full Text Available Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely

  20. Insights into an original pocket-ligand pair classification: a promising tool for ligand profile prediction.

    Science.gov (United States)

    Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude

    2013-01-01

    Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket

  1. Ligand photo-isomerization triggers conformational changes in iGluR2 ligand binding domain.

    Directory of Open Access Journals (Sweden)

    Tino Wolter

    Full Text Available Neurological glutamate receptors bind a variety of artificial ligands, both agonistic and antagonistic, in addition to glutamate. Studying their small molecule binding properties increases our understanding of the central nervous system and a variety of associated pathologies. The large, oligomeric multidomain membrane protein contains a large and flexible ligand binding domains which undergoes large conformational changes upon binding different ligands. A recent application of glutamate receptors is their activation or inhibition via photo-switchable ligands, making them key systems in the emerging field of optochemical genetics. In this work, we present a theoretical study on the binding mode and complex stability of a novel photo-switchable ligand, ATA-3, which reversibly binds to glutamate receptors ligand binding domains (LBDs. We propose two possible binding modes for this ligand based on flexible ligand docking calculations and show one of them to be analogues to the binding mode of a similar ligand, 2-BnTetAMPA. In long MD simulations, it was observed that transitions between both binding poses involve breaking and reforming the T686-E402 protein hydrogen bond. Simulating the ligand photo-isomerization process shows that the two possible configurations of the ligand azo-group have markedly different complex stabilities and equilibrium binding modes. A strong but slow protein response is observed after ligand configuration changes. This provides a microscopic foundation for the observed difference in ligand activity upon light-switching.

  2. DNA Binding Hydroxyl Radical Probes.

    Science.gov (United States)

    Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

    2012-01-01

    The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA.

  3. Development of immobilized ligands for actinide separations

    International Nuclear Information System (INIS)

    Paine, R.T.

    1994-01-01

    Primary goals during this grant period were to (1) synthesize new bifunctional chelating ligands, (2) characterize the structural features of the Ln and An coordination complexes formed by these ligands, (3) use structural data to iteratively design new classes of multifunctional ligands, and (4) explore additional routes for attachment of key ligands to solid supports that could be useful for chromatographic separations. Some highlights of recently published work as well as a summary of submitted, unpublished and/or still in progress research are outlined

  4. A Fluid Membrane-Based Soluble Ligand Display System for Live CellAssays

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Jwa-Min; Nair, Pradeep N.; Neve, Richard M.; Gray, Joe W.; Groves, Jay T.

    2005-10-14

    Cell communication modulates numerous biological processes including proliferation, apoptosis, motility, invasion and differentiation. Correspondingly, there has been significant interest in the development of surface display strategies for the presentation of signaling molecules to living cells. This effort has primarily focused on naturally surface-bound ligands, such as extracellular matrix components and cell membranes. Soluble ligands (e.g. growth factors and cytokines) play an important role in intercellular communications, and their display in a surface-bound format would be of great utility in the design of array-based live cell assays. Recently, several cell microarray systems that display cDNA, RNAi, or small molecules in a surface array format were proven to be useful in accelerating high-throughput functional genetic studies and screening therapeutic agents. These surface display methods provide a flexible platform for the systematic, combinatorial investigation of genes and small molecules affecting cellular processes and phenotypes of interest. In an analogous sense, it would be an important advance if one could display soluble signaling ligands in a surface assay format that allows for systematic, patterned presentation of soluble ligands to live cells. Such a technique would make it possible to examine cellular phenotypes of interest in a parallel format with soluble signaling ligands as one of the display parameters. Herein we report a ligand-modified fluid supported lipid bilayer (SLB) assay system that can be used to functionally display soluble ligands to cells in situ (Figure 1A). By displaying soluble ligands on a SLB surface, both solution behavior (the ability to become locally enriched by reaction-diffusion processes) and solid behavior (the ability to control the spatial location of the ligands in an open system) could be combined. The method reported herein benefits from the naturally fluid state of the supported membrane, which allows

  5. Macrocyclic ligands for uranium complexation

    International Nuclear Information System (INIS)

    Potts, K.T.

    1991-04-01

    A highly preorganized 24-macrocycle containing biuret, thiobiuret and pyridine subunits has been prepared by high dilution ring-closure procedures. Intermediate products to this macrocycle have been utilized to extend this synthetic route to include further representatives where solubility and stability will be influenced by substituent variation. A 1:1 complex has been formed from uranyl acetate and a quinquepyridine derivative, this representing a new type of ligand for the uranyl ion. A very convenient synthetic procedure that will allow the incorporation of these macrocycles into polymeric systems has been developed for the introduction of a vinyl substituent into the 4-position of the pyridine ring. Using triflate, vinyltributyltin and Pd 0 chemistry, this procedure should make a variety of substituted 4-vinylpyridines available for the first time. 3 refs

  6. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  7. CXCR4 Ligands : The Next Big Hit?

    NARCIS (Netherlands)

    Walenkamp, Annemiek M. E.; Lapa, Constantin; Herrmann, Ken; Wester, Hans-Juergen

    2017-01-01

    The G protein-coupled protein receptor C-X-C chemokine receptor 4 (CXCR4) is an attractive target for cancer diagnosis and treatment, as it is overexpressed in many solid and hematologic cancers. Binding of its ligand, C-X-C chemokine ligand 12 (CXCL12), results in receptor internalization and

  8. Ligand-receptor Interactions by NMR Spectroscopy

    Directory of Open Access Journals (Sweden)

    Novak. P.

    2008-04-01

    Full Text Available Today NMR spectroscopy is a method of choice for elucidation of interactions between biomolecules and the potential ligands. Knowledge on these interactions is an essential prerequisite for the rational drug design. The most important contribution of NMR to drug design a few years ago was the 3D structure determination of proteins. Besides delivering the 3D structures of the free proteins as a raw material for the modeling studies on ligand binding, NMR can directly yield valuable experimental data on the biologically important protein-ligand complexes. In addition to X-ray diffraction, NMR spectroscopy can provide information on the internal protein dynamics ordynamics of intermolecular interactions. Changes in NMR parameters allow us to detect ("SAR by NMR" and quantitatively determine binding affinities (titration, diffusion NMR experiments, etc. of potential ligands. Also, it is possible to determine the binding site and conformations of ligands, receptors and receptor-ligand complexes with the help of NMR methods such as tr-NOESY. Epitopes or functional groups responsible for binding of ligands to the receptor can be identified by employing STD or WaterLOGSY experiments. In this review are described some of the most frequent NMR methods for the characterization of the interactions between biomolecules and ligands, together with their advantages and disadvantages.

  9. Autocrine signal transmission with extracellular ligand degradation

    Science.gov (United States)

    Muratov, C B; Posta, F; Shvartsman, S Y

    2009-03-01

    Traveling waves of cell signaling in epithelial layers orchestrate a number of important processes in developing and adult tissues. These waves can be mediated by positive feedback autocrine loops, a mode of cell signaling where binding of a diffusible extracellular ligand to a cell surface receptor can lead to further ligand release. We formulate and analyze a biophysical model that accounts for ligand-induced ligand release, extracellular ligand diffusion and ligand-receptor interaction. We focus on the case when the main mode for ligand degradation is extracellular and analyze the problem with the sharp threshold positive feedback nonlinearity. We derive expressions that link the speed of propagation and other characteristics of traveling waves to the parameters of the biophysical processes, such as diffusion rates, receptor expression level, etc. Analyzing the derived expressions we found that traveling waves in such systems can exhibit a number of unusual properties, e.g. non-monotonic dependence of the speed of propagation on ligand diffusivity. Our results for the fully developed traveling fronts can be used to analyze wave initiation from localized perturbations, a scenario that frequently arises in the in vitro models of epithelial wound healing, and guide future modeling studies of cell communication in epithelial layers.

  10. Organotellurium ligands – designing and complexation reactions

    Indian Academy of Sciences (India)

    Unknown

    membered rings it is negative and ~30 ppm only. Keywords. Organotellurium ligands; hybrid telluroether; platinum metal complexes; tellurium-125 NMR. 1. Introduction. Tellurium is the noblest metalloid which may act as a Lewis acid as well as Lewis base. The ligand chemistry of tellurium, which acts as a 'soft' donor, was ...

  11. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  12. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  13. Radiation damage to DNA in DNA-protein complexes.

    Science.gov (United States)

    Spotheim-Maurizot, M; Davídková, M

    2011-06-03

    The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.

  14. Correcting ligands, metabolites, and pathways

    Directory of Open Access Journals (Sweden)

    Vriend Gert

    2006-11-01

    Full Text Available Abstract Background A wide range of research areas in bioinformatics, molecular biology and medicinal chemistry require precise chemical structure information about molecules and reactions, e.g. drug design, ligand docking, metabolic network reconstruction, and systems biology. Most available databases, however, treat chemical structures more as illustrations than as a datafield in its own right. Lack of chemical accuracy impedes progress in the areas mentioned above. We present a database of metabolites called BioMeta that augments the existing pathway databases by explicitly assessing the validity, correctness, and completeness of chemical structure and reaction information. Description The main bulk of the data in BioMeta were obtained from the KEGG Ligand database. We developed a tool for chemical structure validation which assesses the chemical validity and stereochemical completeness of a molecule description. The validation tool was used to examine the compounds in BioMeta, showing that a relatively small number of compounds had an incorrect constitution (connectivity only, not considering stereochemistry and that a considerable number (about one third had incomplete or even incorrect stereochemistry. We made a large effort to correct the errors and to complete the structural descriptions. A total of 1468 structures were corrected and/or completed. We also established the reaction balance of the reactions in BioMeta and corrected 55% of the unbalanced (stoichiometrically incorrect reactions in an automatic procedure. The BioMeta database was implemented in PostgreSQL and provided with a web-based interface. Conclusion We demonstrate that the validation of metabolite structures and reactions is a feasible and worthwhile undertaking, and that the validation results can be used to trigger corrections and improvements to BioMeta, our metabolite database. BioMeta provides some tools for rational drug design, reaction searches, and

  15. Autocrine signal transmission with extracellular ligand degradation

    International Nuclear Information System (INIS)

    Muratov, C B; Posta, F; Shvartsman, S Y

    2009-01-01

    Traveling waves of cell signaling in epithelial layers orchestrate a number of important processes in developing and adult tissues. These waves can be mediated by positive feedback autocrine loops, a mode of cell signaling where binding of a diffusible extracellular ligand to a cell surface receptor can lead to further ligand release. We formulate and analyze a biophysical model that accounts for ligand-induced ligand release, extracellular ligand diffusion and ligand–receptor interaction. We focus on the case when the main mode for ligand degradation is extracellular and analyze the problem with the sharp threshold positive feedback nonlinearity. We derive expressions that link the speed of propagation and other characteristics of traveling waves to the parameters of the biophysical processes, such as diffusion rates, receptor expression level, etc. Analyzing the derived expressions we found that traveling waves in such systems can exhibit a number of unusual properties, e.g. non-monotonic dependence of the speed of propagation on ligand diffusivity. Our results for the fully developed traveling fronts can be used to analyze wave initiation from localized perturbations, a scenario that frequently arises in the in vitro models of epithelial wound healing, and guide future modeling studies of cell communication in epithelial layers

  16. Radiation induced ligand loss from cobalt complexes

    International Nuclear Information System (INIS)

    Funston, A. M.; McFadyen, W.D.; Tregloan, P.A.

    2000-01-01

    Full text: Due to the rapid nature of ligand dissociation from cobalt(II) complexes the study of the rate of ligand dissociation necessitates the use of a technique such as pulse radiolysis. This allows the rapid reduction of the corresponding cobalt(III) complex by a reducing radical, such as the aquated electron, to form the cobalt(II) complex. However, to date, no systematic study of either the mechanism of reduction or the influence of the electronic structure on the rate of ligand dissociation has been carried out. In order to understand these processes more fully the mechanism of reduction of a range of related cobalt(III) complexes by the aquated electron and the subsequent rate of ligand dissociation from the resulting cobalt(II) complexes is being investigated. It has been found that a number of processes are observed following the initial rapid reaction of the cobalt(III) complex with the aquated electron. Ultimately ligand loss is observed. Depending upon the complex, the initial processes observed may include the formation of coordinated radicals and electron transfer within the complex. For complexes containing aromatic ligands such as 2,2'-bipyridine, 1,10-phenanthroline and dipyrido[3,2-a:2',3'-c]phenazine the formation of a coordinated radical is observed as the initial reduction step. The kinetics of ligand dissociation of these complexes has been determined. The loss of monodentate ligands is fast and has been indistinguishable from the reduction processes when aromatic ligands are also present in the complex. However, for diamine chelates and diimine chelates spectra of the transient species can be resolved

  17. Labeled receptor ligands for spect

    International Nuclear Information System (INIS)

    Kung, H.F.

    1989-01-01

    Receptor specific imaging agents for single photon emission computed tomography (SPECT) can potentially be useful in the understanding of basic biochemistry and pharmacology of receptors. SPECT images may also provide tools for evaluation of density and binding kinetics of a specific receptor, information important for diagnosis and patient management. Basic requirements for receptor imaging agents are: (a) they are labeled with short-lived isotopes, (b) they show high selectivity and specific uptake, (c) they exhibit high target/background ratio, and (d) they can be modeled to obtain quantitative information. Several good examples of CNS receptor specific ligands labeled with I-123 have been developed, including iodoQNB, iodoestrogen iodobenzadiazepine, iodobenazepine, iodobenzamides for muscarinic, estrogen benzadiazepine, D-1 and D-2 dopamine receptors. With the advent of newer and faster SPECT imaging devices, it may be feasible to quantitate the receptor density by in vivo imaging techniques. These new brain imaging agents can provide unique diagnostic information, which may not be available through other imaging modalities, such as CT and MRI

  18. Synthesis, Characterization and Biological Evaluation of Transition Metal Complexes Derived from N, S Bidentate Ligands

    Directory of Open Access Journals (Sweden)

    Enis Nadia Md Yusof

    2015-05-01

    Full Text Available Two bidentate NS ligands were synthesized by the condensation reaction of S-2-methylbenzyldithiocarbazate (S2MBDTC with 2-methoxybenzaldehyde (2MB and 3-methoxybenzaldehyde (3MB. The ligands were reacted separately with acetates of Cu(II, Ni(II and Zn(II yielding 1:2 (metal:ligand complexes. The metal complexes formed were expected to have a general formula of [M(NS2] where M = Cu2+, Ni2+, and Zn2+. These compounds were characterized by elemental analysis, molar conductivity, magnetic susceptibility and various spectroscopic techniques. The magnetic susceptibility measurements and spectral results supported the predicted coordination geometry in which the Schiff bases behaved as bidentate NS donor ligands coordinating via the azomethine nitrogen and thiolate sulfur. The molecular structures of the isomeric S2M2MBH (1 and S2M3MBH (2 were established by X-ray crystallography to have very similar l-shaped structures. The Schiff bases and their metal complexes were evaluated for their biological activities against estrogen receptor-positive (MCF-7 and estrogen receptor-negative (MDA-MB-231 breast cancer cell lines. Only the Cu(II complexes showed marked cytotoxicity against the cancer cell lines. Both Schiff bases and other metal complexes were found to be inactive. In concordance with the cytotoxicity studies, the DNA binding studies indicated that Cu(II complexes have a strong DNA binding affinity.

  19. Bifunctional Rhodium Intercalator Conjugates as Mismatch-Directing DNA Alkylating Agents

    OpenAIRE

    Schatzschneider, Ulrich; Barton, Jacqueline K.

    2004-01-01

    A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covale...

  20. A Versatile Dinucleating Ligand Containing Sulfonamide Groups

    DEFF Research Database (Denmark)

    Sundberg, Jonas; Witt, Hannes; Cameron, Lisa

    2014-01-01

    ligand can be prepared in aqueous solutions using only divalent metal ions. Two of the copper(II) complexes, [Cu2(psmp)(OH)] and [Cu2(psmp)(OAc)2]-, demonstrate the anticipated 1:2 ligand/metal stoichiometry and show that the dimetallic binding site created for exogenous ligands possesses high inherent...... of antiferromagnetic coupling. This is corroborated computationally by broken-symmetry density functional theory, which for isotropic modeling of the coupling predicts an antiferromagnetic coupling strength of J = 70.5 cm-1....

  1. The selenium metabolite methylselenol regulates the expression of ligands that trigger immune activation through the lymphocyte receptor NKG2D

    DEFF Research Database (Denmark)

    Hagemann-Jensen, Michael Henrik; Uhlenbrock, Franziska Katharina; Kehlet, Stephanie

    2014-01-01

    For decades Selenium (Se) research has been focused on the identification of active metabolites, which are crucial for Se chemoprevention of cancer. In this context, the metabolite methylselenol (CH3SeH) is known for its action to selectively kill transformed cells through mechanisms that include...... ligands. A balanced cell-surface expression of NKG2D ligands is considered as an innate barrier against tumor development. Our work therefore indicates that the application of selenium compounds, which are metabolized to CH3SeH, could improve NKG2D-based immune therapy.......: Increased formation of reactive oxygen species (ROS), induction of DNA damage, triggering of apoptosis and the inhibition of angiogenesis. Here, we revealed that CH3SeH modulates cell surface expression of NKG2D ligands. The expression of NKG2D ligands is induced by stress-associated pathways, which occur...

  2. Activation of trans geometry in bifunctional mononuclear platinum complexes by a non-bulky methylamine ligand

    Czech Academy of Sciences Publication Activity Database

    Frýbortová, M.; Nováková, Olga; Štěpánková, Jana; Novohradský, Vojtěch; Gibson, D.; Kašpárková, Jana; Brabec, Viktor

    2013-01-01

    Roč. 126, SEP2013 (2013), s. 46-54 ISSN 0162-0134 R&D Projects: GA ČR(CZ) GAP301/10/0598; GA ČR(CZ) GA13-08273S Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : HETEROCYCLIC AMINE LIGAND * INTERSTRAND CROSS-LINKS * DNA-BINDING MODE Subject RIV: BO - Biophysics Impact factor: 3.274, year: 2013

  3. Activation of peroxisome proliferator-activated receptors (PPARs) by their ligands and protein kinase A activators

    Science.gov (United States)

    Lazennec, Gwendal; Canaple, Laurence; Saugy, Damien; Wahli, Walter

    2000-01-01

    The nuclear peroxisome proliferator-activated receptors (PPARs) α, β and γ activate the transcription of multiple genes involved in lipid metabolism. Several natural and synthetic ligands have been identified for each PPAR isotype but little is known about the phosphorylation state of these receptors. We show here that activators of protein kinase A (PKA) can enhance mouse PPAR activity in the absence and the presence of exogenous ligands in transient transfection experiments. The activation function 1 (AF-1) of PPARs was dispensable for transcriptional enhancement, whereas the activation function 2 (AF-2) was required for this effect. We also show that several domains of PPAR can be phosphorylated by PKA in vitro. Moreover, gel experiments suggest that PKA stabilizes binding of the liganded PPAR to DNA. PKA inhibitors decreased not only the kinase dependent induction of PPARs but also their ligand-dependent induction, suggesting that the ligands may also mobilize the PKA pathway to lead to maximal transcriptional induction by PPARs. Moreover, comparing PPARα KO with PPARα wild-type mice, we show that the expression of the ACO gene can be regulated by PKA-activated PPARα in liver. These data demonstrate that the PKA pathway is an important modulator of PPAR activity and we propose a model associating this pathway in the control of fatty acid β-oxidation under conditions of fasting, stress and exercise. PMID:11117527

  4. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  5. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  6. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  7. Ligand based pharmacophore modelling of anticancer histone ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... The study was carried out using the software Ligand Scout (version .... Computer Science, for his great help and support. We are also grateful to Faculty of Engineering and applied. Sciences, Mohammad .... Aided Mol. Design ...

  8. Synthesis and characterization β-ketoamine ligands

    Science.gov (United States)

    Zaid, Nurzati Amani Mohamed; Hassan, Nur Hasyareeda; Karim, Nurul Huda Abd

    2018-04-01

    β-ketoamine ligands are important members of heterodonor ligand because of their ease of preparation and modification of both steric and/or electronic effects. Complexes with β-ketoamine has received much less attention and there has been no study about this complex with β-ketoamine in ionic liquid reported. Two type of β-ketoamine ligands which are 4-amino-3-pentene-2-onato (A) and 3-amino-2-butenoic acid methyl ester (B) have been synthesized in this work. The resulting compound formed was characterized using standard spectroscopic and structural techniques which includes 1H and 13C, NMR spectroscopy and FTIR spectroscopy. The 1H and 13C NMR spectrum displayed all the expected signals with correct integration and multiplicity. And it is proved that there are some differences between two ligands as observed in NMR and FTIR spectrum.

  9. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Clouse, Katherine N; Goodrich, Jennifer S

    2006-01-01

    ...) activity has been associated with an increased prognosis of breast cancer. During cogenesis in Drosophila melanogaster local Egfr activation by the spatially-restricted TGFalpha-like ligand Gurken (Grk...

  10. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Goodrich, Jennifer S

    2005-01-01

    ...) activity has been associated with an increased prognosis of breast cancer. During oogenesis in Drosophila melanogaster, local EGFR activation by the spatially restricted TGF alpha-like ligand, Gurken (Grk...

  11. Binding mechanisms for histamine and agmatine ligands in plasmid deoxyribonucleic acid purifications.

    Science.gov (United States)

    Sousa, Ângela; Pereira, Patrícia; Sousa, Fani; Queiroz, João A

    2014-10-31

    Histamine and agmatine amino acid derivatives were immobilized into monolithic disks, in order to combine the specificity and selectivity of the ligand with the high mass transfer and binding capacity offered by monolithic supports, to purify potential plasmid DNA biopharmaceuticals. Different elution strategies were explored by changing the type and salt concentration, as well as the pH, in order to understand the retention pattern of different plasmids isoforms The pVAX1-LacZ supercoiled isoform was isolated from a mixture of pDNA isoforms by using NaCl increasing stepwise gradient and also by ammonium sulfate decreasing stepwise gradient, in both histamine and agmatine monoliths. Acidic pH in the binding buffer mainly strengthened ionic interactions with both ligands in the presence of sodium chloride. Otherwise, for histamine ligand, pH values higher than 7 intensified hydrophobic interactions in the presence of ammonium sulfate. In addition, circular dichroism spectroscopy studies revealed that the binding and elution chromatographic conditions, such as the combination of high ionic strength with extreme pH values can reversibly influence the structural stability of the target nucleic acid. Therefore, ascending sodium chloride gradients with pH manipulation can be preferable chromatographic conditions to be explored in the purification of plasmid DNA biopharmaceuticals, in order to avoid the environmental impact of ammonium sulfate. Copyright © 2014. Published by Elsevier B.V.

  12. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  13. Cell-specific targeting by heterobivalent ligands.

    Science.gov (United States)

    Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J

    2011-07-20

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.

  14. Semiconductor Quantum Dots with Photoresponsive Ligands.

    Science.gov (United States)

    Sansalone, Lorenzo; Tang, Sicheng; Zhang, Yang; Thapaliya, Ek Raj; Raymo, Françisco M; Garcia-Amorós, Jaume

    2016-10-01

    Photochromic or photocaged ligands can be anchored to the outer shell of semiconductor quantum dots in order to control the photophysical properties of these inorganic nanocrystals with optical stimulations. One of the two interconvertible states of the photoresponsive ligands can be designed to accept either an electron or energy from the excited quantum dots and quench their luminescence. Under these conditions, the reversible transformations of photochromic ligands or the irreversible cleavage of photocaged counterparts translates into the possibility to switch luminescence with external control. As an alternative to regulating the photophysics of a quantum dot via the photochemistry of its ligands, the photochemistry of the latter can be controlled by relying on the photophysics of the former. The transfer of excitation energy from a quantum dot to a photocaged ligand populates the excited state of the species adsorbed on the nanocrystal to induce a photochemical reaction. This mechanism, in conjunction with the large two-photon absorption cross section of quantum dots, can be exploited to release nitric oxide or to generate singlet oxygen under near-infrared irradiation. Thus, the combination of semiconductor quantum dots and photoresponsive ligands offers the opportunity to assemble nanostructured constructs with specific functions on the basis of electron or energy transfer processes. The photoswitchable luminescence and ability to photoinduce the release of reactive chemicals, associated with the resulting systems, can be particularly valuable in biomedical research and can, ultimately, lead to the realization of imaging probes for diagnostic applications as well as to therapeutic agents for the treatment of cancer.

  15. Designer TGFβ superfamily ligands with diversified functionality.

    Directory of Open Access Journals (Sweden)

    George P Allendorph

    Full Text Available Transforming Growth Factor--beta (TGFβ superfamily ligands, including Activins, Growth and Differentiation Factors (GDFs, and Bone Morphogenetic Proteins (BMPs, are excellent targets for protein-based therapeutics because of their pervasiveness in numerous developmental and cellular processes. We developed a strategy termed RASCH (Random Assembly of Segmental Chimera and Heteromer, to engineer chemically-refoldable TGFβ superfamily ligands with unique signaling properties. One of these engineered ligands, AB208, created from Activin-βA and BMP-2 sequences, exhibits the refolding characteristics of BMP-2 while possessing Activin-like signaling attributes. Further, we find several additional ligands, AB204, AB211, and AB215, which initiate the intracellular Smad1-mediated signaling pathways more strongly than BMP-2 but show no sensitivity to the natural BMP antagonist Noggin unlike natural BMP-2. In another design, incorporation of a short N-terminal segment from BMP-2 was sufficient to enable chemical refolding of BMP-9, without which was never produced nor refolded. Our studies show that the RASCH strategy enables us to expand the functional repertoire of TGFβ superfamily ligands through development of novel chimeric TGFβ ligands with diverse biological and clinical values.

  16. LigandRFs: random forest ensemble to identify ligand-binding residues from sequence information alone

    KAUST Repository

    Chen, Peng

    2014-12-03

    Background Protein-ligand binding is important for some proteins to perform their functions. Protein-ligand binding sites are the residues of proteins that physically bind to ligands. Despite of the recent advances in computational prediction for protein-ligand binding sites, the state-of-the-art methods search for similar, known structures of the query and predict the binding sites based on the solved structures. However, such structural information is not commonly available. Results In this paper, we propose a sequence-based approach to identify protein-ligand binding residues. We propose a combination technique to reduce the effects of different sliding residue windows in the process of encoding input feature vectors. Moreover, due to the highly imbalanced samples between the ligand-binding sites and non ligand-binding sites, we construct several balanced data sets, for each of which a random forest (RF)-based classifier is trained. The ensemble of these RF classifiers forms a sequence-based protein-ligand binding site predictor. Conclusions Experimental results on CASP9 and CASP8 data sets demonstrate that our method compares favorably with the state-of-the-art protein-ligand binding site prediction methods.

  17. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  18. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  19. DNA Damage Response and Immune Defence: Links and Mechanisms

    Directory of Open Access Journals (Sweden)

    Björn Schumacher

    2016-08-01

    Full Text Available DNA damage plays a causal role in numerous human pathologies including cancer, premature aging and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signalling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signalling. We highlight evidence gained into (i which molecular and cellular pathways of DDR activate immune signalling, (ii how DNA damage drives chronic inflammation, and (iii how chronic inflammation causes DNA damage and pathology in humans.

  20. Synthesis and characterization of mixed ligand chiral nanoclusters

    KAUST Repository

    Guven, Zekiye P.

    2016-06-22

    Chiral mixed ligand silver nanoclusters were synthesized in the presence of a chiral and an achiral ligand. While the chiral ligand led mostly to the formation of nanoparticles, the presence of the achiral ligand drastically increased the yield of nanoclusters with enhanced chiral properties. © 2016 The Royal Society of Chemistry.

  1. Synthesis and characterization of mixed ligand chiral nanoclusters

    KAUST Repository

    Guven, Zekiye P.; Ustbas, Burcin; Harkness, Kellen M.; Coskun, Hikmet; Joshi, Chakra Prasad; Besong, Tabot M.D.; Stellacci, Francesco; Bakr, Osman; Akbulut, Ozge

    2016-01-01

    Chiral mixed ligand silver nanoclusters were synthesized in the presence of a chiral and an achiral ligand. While the chiral ligand led mostly to the formation of nanoparticles, the presence of the achiral ligand drastically increased the yield of nanoclusters with enhanced chiral properties. © 2016 The Royal Society of Chemistry.

  2. Impact of protein and ligand impurities on ITC-derived protein-ligand thermodynamics.

    Science.gov (United States)

    Grüner, Stefan; Neeb, Manuel; Barandun, Luzi Jakob; Sielaff, Frank; Hohn, Christoph; Kojima, Shun; Steinmetzer, Torsten; Diederich, François; Klebe, Gerhard

    2014-09-01

    The thermodynamic characterization of protein-ligand interactions by isothermal titration calorimetry (ITC) is a powerful tool in drug design, giving valuable insight into the interaction driving forces. ITC is thought to require protein and ligand solutions of high quality, meaning both the absence of contaminants as well as accurately determined concentrations. Ligands synthesized to deviating purity and protein of different pureness were titrated by ITC. Data curation was attempted also considering information from analytical techniques to correct stoichiometry. We used trypsin and tRNA-guanine transglycosylase (TGT), together with high affinity ligands to investigate the effect of errors in protein concentration as well as the impact of ligand impurities on the apparent thermodynamics. We found that errors in protein concentration did not change the thermodynamic properties obtained significantly. However, most ligand impurities led to pronounced changes in binding enthalpy. If protein binding of the respective impurity is not expected, the actual ligand concentration was corrected for and the thus revised data compared to thermodynamic properties obtained with the respective pure ligand. Even in these cases, we observed differences in binding enthalpy of about 4kJ⋅mol(-1), which is considered significant. Our results indicate that ligand purity is the critical parameter to monitor if accurate thermodynamic data of a protein-ligand complex are to be recorded. Furthermore, artificially changing fitting parameters to obtain a sound interaction stoichiometry in the presence of uncharacterized ligand impurities may lead to thermodynamic parameters significantly deviating from the accurate thermodynamic signature. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Expression of nociceptive ligands in canine osteosarcoma.

    Science.gov (United States)

    Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

    2015-01-01

    Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

  4. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  5. Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay

    Czech Academy of Sciences Publication Activity Database

    Noureini, S.K.; Esmaeili, H.; Abachi, F.; Khiali, S.; Islam, Barira; Kuta, M.; Saboury, A.A.; Hoffillann, M.; Šponer, Jiří; Parkinson, G.; Haider, S.

    2017-01-01

    Roč. 1861, č. 8 (2017), s. 2020-2030 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : prostate-cancer cells * amber force-field * nucleic-acids Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  6. Electrochemical and circular dichroism spectroscopic evidence of two types of interaction between [Ru(NH3)(6)](3+) and an elongated thrombin binding aptamer G-quadruplex

    Czech Academy of Sciences Publication Activity Database

    De Rache, A.; Kejnovská, Iva; Buess-Herman, C.; Doneux, T.

    2015-01-01

    Roč. 179, OCT 2015 (2015), s. 84-92 ISSN 0013-4686 Institutional support: RVO:68081707 Keywords : Biosensors * Thrombin binding aptamer * Hexaammineruthenium Subject RIV: BO - Biophysics Impact factor: 4.803, year: 2015

  7. Immobilisation of ligands by radio-derivatized polymers; Immobilisering av ligander med radioderiverte polymerer

    Energy Technology Data Exchange (ETDEWEB)

    Varga, J.M.; Fritsch, P.

    1995-01-30

    The invention relates to radio-derivatized polymers and a method of producing them by contacting non-polymerizable conjugands with radiolysable polymers in the presence of irradiation. The resulting radio-derivatized polymers can be further linked with ligand of organic or inorganic nature to immobilize such ligands. 2 figs., 5 tabs.

  8. Synthesis and DNA-interactions of new Co(III), Fe(II), Ni(II), Ru(II ...

    Indian Academy of Sciences (India)

    Administrator

    phen) or a modified phen, are particularly attractive species for developing new diagnostic and therapeutic agents that can recognise and cleave DNA. The ligands or the metal in these complexes can be varied in an easily controlled manner ...

  9. A General Ligand Design for Gold Catalysis allowing Ligand-Directed Anti Nucleophilic Attack of Alkynes

    Science.gov (United States)

    Wang, Yanzhao; Wang, Zhixun; Li, Yuxue; Wu, Gongde; Cao, Zheng; Zhang, Liming

    2014-01-01

    Most homogenous gold catalyses demand ≥0.5 mol % catalyst loading. Due to the high cost of gold, these reactions are unlikely to be applicable in medium or large scale applications. Here we disclose a novel ligand design based on the privileged biphenyl-2-phosphine framework that offers a potentially general approach to dramatically lowering catalyst loading. In this design, an amide group at the 3’ position of the ligand framework directs and promotes nucleophilic attack at the ligand gold complex-activated alkyne, which is unprecedented in homogeneous gold catalysis considering the spatial challenge of using ligand to reach antiapproaching nucleophile in a linear P-Au-alkyne centroid structure. With such a ligand, the gold(I) complex becomes highly efficient in catalyzing acid addition to alkynes, with a turnover number up to 99,000. Density functional theory calculations support the role of the amide moiety in directing the attack of carboxylic acid via hydrogen bonding. PMID:24704803

  10. A new class of PN3-pincer ligands for metal–ligand cooperative catalysis

    KAUST Repository

    Li, Huaifeng

    2014-12-01

    Work on a new class of PN3-pincer ligands for metal-ligand cooperative catalysis is reviewed. While the field of the pyridine-based PN3-transition metal pincer complexes is still relatively young, many important applications of these complexes have already emerged. In several cases, the PN3-pincer complexes for metal-ligand cooperative catalysis result in significantly improved or unprecedented activities. The synthesis and coordination chemistry of PN3-pincer ligands are briefly summarized first to cover the synthetic routes for their preparation, followed by a focus review on their applications in catalysis. A specific emphasis is placed on the later section about the role of PN3-pincer ligands\\' dearomatization-rearomatization steps during the catalytic cycles. The mechanistic insights from density functional theory (DFT) calculations are also discussed.

  11. A new class of PN3-pincer ligands for metal–ligand cooperative catalysis

    KAUST Repository

    Li, Huaifeng; Zheng, Bin; Huang, Kuo-Wei

    2014-01-01

    Work on a new class of PN3-pincer ligands for metal-ligand cooperative catalysis is reviewed. While the field of the pyridine-based PN3-transition metal pincer complexes is still relatively young, many important applications of these complexes have already emerged. In several cases, the PN3-pincer complexes for metal-ligand cooperative catalysis result in significantly improved or unprecedented activities. The synthesis and coordination chemistry of PN3-pincer ligands are briefly summarized first to cover the synthetic routes for their preparation, followed by a focus review on their applications in catalysis. A specific emphasis is placed on the later section about the role of PN3-pincer ligands' dearomatization-rearomatization steps during the catalytic cycles. The mechanistic insights from density functional theory (DFT) calculations are also discussed.

  12. Effects of PPARγ ligands on vascular tone.

    Science.gov (United States)

    Salomone, Salvatore; Drago, Filippo

    2012-06-01

    Peroxisome Proliferator-Activated Receptor γ (PPARγ), originally described as a transcription factor for genes of carbohydrate and lipid metabolism, has been more recently studied in the context of cardiovascular pathophysiology. Here, we review the available data on PPARγ ligands as modulator of vascular tone. PPARγ ligands include: thiazolidinediones (used in the treatment of type 2 diabetes mellitus), glitazars (bind and activate both PPARγ and PPARα), and other experimental drugs (still in development) that exploit the chemistry of thiazolidinediones as a scaffold for PPARγ-independent pharmacological properties. In this review, we examine both short (mostly from in vitro data)- and long (mostly from in vivo data)-term effects of PPARγ ligands that extend from PPARγ-independent vascular effects to PPARγ-dependent gene expression. Because endothelium is a master regulator of vascular tone, we have attempted to differentiate between endothelium-dependent and endothelium-independent effects of PPARγ ligands. Based on available data, we conclude that PPARγ ligands appear to influence vascular tone in different experimental paradigms, most often in terms of vasodilatation (potentially increasing blood flow to some tissues). These effects on vascular tone, although potentially beneficial, must be weighed against specific cardiovascular warnings that may apply to some drugs, such as rosiglitazone.

  13. LIBRA: LIgand Binding site Recognition Application.

    Science.gov (United States)

    Hung, Le Viet; Caprari, Silvia; Bizai, Massimiliano; Toti, Daniele; Polticelli, Fabio

    2015-12-15

    In recent years, structural genomics and ab initio molecular modeling activities are leading to the availability of a large number of structural models of proteins whose biochemical function is not known. The aim of this study was the development of a novel software tool that, given a protein's structural model, predicts the presence and identity of active sites and/or ligand binding sites. The algorithm implemented by ligand binding site recognition application (LIBRA) is based on a graph theory approach to find the largest subset of similar residues between an input protein and a collection of known functional sites. The algorithm makes use of two predefined databases for active sites and ligand binding sites, respectively, derived from the Catalytic Site Atlas and the Protein Data Bank. Tests indicate that LIBRA is able to identify the correct binding/active site in 90% of the cases analyzed, 90% of which feature the identified site as ranking first. As far as ligand binding site recognition is concerned, LIBRA outperforms other structure-based ligand binding sites detection tools with which it has been compared. The application, developed in Java SE 7 with a Swing GUI embedding a JMol applet, can be run on any OS equipped with a suitable Java Virtual Machine (JVM), and is available at the following URL: http://www.computationalbiology.it/software/LIBRAv1.zip. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Dockomatic - automated ligand creation and docking.

    Science.gov (United States)

    Bullock, Casey W; Jacob, Reed B; McDougal, Owen M; Hampikian, Greg; Andersen, Tim

    2010-11-08

    The application of computational modeling to rationally design drugs and characterize macro biomolecular receptors has proven increasingly useful due to the accessibility of computing clusters and clouds. AutoDock is a well-known and powerful software program used to model ligand to receptor binding interactions. In its current version, AutoDock requires significant amounts of user time to setup and run jobs, and collect results. This paper presents DockoMatic, a user friendly Graphical User Interface (GUI) application that eases and automates the creation and management of AutoDock jobs for high throughput screening of ligand to receptor interactions. DockoMatic allows the user to invoke and manage AutoDock jobs on a single computer or cluster, including jobs for evaluating secondary ligand interactions. It also automates the process of collecting, summarizing, and viewing results. In addition, DockoMatic automates creation of peptide ligand .pdb files from strings of single-letter amino acid abbreviations. DockoMatic significantly reduces the complexity of managing multiple AutoDock jobs by facilitating ligand and AutoDock job creation and management.

  15. Dockomatic - automated ligand creation and docking

    Directory of Open Access Journals (Sweden)

    Hampikian Greg

    2010-11-01

    Full Text Available Abstract Background The application of computational modeling to rationally design drugs and characterize macro biomolecular receptors has proven increasingly useful due to the accessibility of computing clusters and clouds. AutoDock is a well-known and powerful software program used to model ligand to receptor binding interactions. In its current version, AutoDock requires significant amounts of user time to setup and run jobs, and collect results. This paper presents DockoMatic, a user friendly Graphical User Interface (GUI application that eases and automates the creation and management of AutoDock jobs for high throughput screening of ligand to receptor interactions. Results DockoMatic allows the user to invoke and manage AutoDock jobs on a single computer or cluster, including jobs for evaluating secondary ligand interactions. It also automates the process of collecting, summarizing, and viewing results. In addition, DockoMatic automates creation of peptide ligand .pdb files from strings of single-letter amino acid abbreviations. Conclusions DockoMatic significantly reduces the complexity of managing multiple AutoDock jobs by facilitating ligand and AutoDock job creation and management.

  16. DNA exit ramps are revealed in the binding landscapes obtained from simulations in helical coordinates.

    Directory of Open Access Journals (Sweden)

    Ignacia Echeverria

    2015-02-01

    Full Text Available DNA molecules are highly charged semi-flexible polymers that are involved in a wide variety of dynamical processes such as transcription and replication. Characterizing the binding landscapes around DNA molecules is essential to understanding the energetics and kinetics of various biological processes. We present a curvilinear coordinate system that fully takes into account the helical symmetry of a DNA segment. The latter naturally allows to characterize the spatial organization and motions of ligands tracking the minor or major grooves, in a motion reminiscent of sliding. Using this approach, we performed umbrella sampling (US molecular dynamics (MD simulations to calculate the three-dimensional potentials of mean force (3D-PMFs for a Na+ cation and for methyl guanidinium, an arginine analog. The computed PMFs show that, even for small ligands, the free energy landscapes are complex. In general, energy barriers of up to ~5 kcal/mol were measured for removing the ligands from the minor groove, and of ~1.5 kcal/mol for sliding along the minor groove. We shed light on the way the minor groove geometry, defined mainly by the DNA sequence, shapes the binding landscape around DNA, providing heterogeneous environments for recognition by various ligands. For example, we identified the presence of dissociation points or "exit ramps" that naturally would terminate sliding. We discuss how our findings have important implications for understanding how proteins and ligands associate and slide along DNA.

  17. DNA-based asymmetric organometallic catalysis in water

    NARCIS (Netherlands)

    Oelerich, Jens; Roelfes, Gerard

    2013-01-01

    Here, the first examples of DNA-based organometallic catalysis in water that give rise to high enantioselectivities are described. Copper complexes of strongly intercalating ligands were found to enable the asymmetric intramolecular cyclopropanation of alpha-diazo-beta-keto sulfones in water. Up to

  18. Ligand identification using electron-density map correlations

    International Nuclear Information System (INIS)

    Terwilliger, Thomas C.; Adams, Paul D.; Moriarty, Nigel W.; Cohn, Judith D.

    2007-01-01

    An automated ligand-fitting procedure is applied to (F o − F c )exp(iϕ c ) difference density for 200 commonly found ligands from macromolecular structures in the Protein Data Bank to identify ligands from density maps. A procedure for the identification of ligands bound in crystal structures of macromolecules is described. Two characteristics of the density corresponding to a ligand are used in the identification procedure. One is the correlation of the ligand density with each of a set of test ligands after optimization of the fit of that ligand to the density. The other is the correlation of a fingerprint of the density with the fingerprint of model density for each possible ligand. The fingerprints consist of an ordered list of correlations of each the test ligands with the density. The two characteristics are scored using a Z-score approach in which the correlations are normalized to the mean and standard deviation of correlations found for a variety of mismatched ligand-density pairs, so that the Z scores are related to the probability of observing a particular value of the correlation by chance. The procedure was tested with a set of 200 of the most commonly found ligands in the Protein Data Bank, collectively representing 57% of all ligands in the Protein Data Bank. Using a combination of these two characteristics of ligand density, ranked lists of ligand identifications were made for representative (F o − F c )exp(iϕ c ) difference density from entries in the Protein Data Bank. In 48% of the 200 cases, the correct ligand was at the top of the ranked list of ligands. This approach may be useful in identification of unknown ligands in new macromolecular structures as well as in the identification of which ligands in a mixture have bound to a macromolecule

  19. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  20. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  1. Ligand sphere conversions in terminal carbide complexes

    DEFF Research Database (Denmark)

    Morsing, Thorbjørn Juul; Reinholdt, Anders; Sauer, Stephan P. A.

    2016-01-01

    Metathesis is introduced as a preparative route to terminal carbide complexes. The chloride ligands of the terminal carbide complex [RuC(Cl)2(PCy3)2] (RuC) can be exchanged, paving the way for a systematic variation of the ligand sphere. A series of substituted complexes, including the first...... example of a cationic terminal carbide complex, [RuC(Cl)(CH3CN)(PCy3)2]+, is described and characterized by NMR, MS, X-ray crystallography, and computational studies. The experimentally observed irregular variation of the carbide 13C chemical shift is shown to be accurately reproduced by DFT, which also...... demonstrates that details of the coordination geometry affect the carbide chemical shift equally as much as variations in the nature of the auxiliary ligands. Furthermore, the kinetics of formation of the sqaure pyramidal dicyano complex, trans-[RuC(CN)2(PCy3)2], from RuC has been examined and the reaction...

  2. Characteristic molecular vibrations of adenosine receptor ligands.

    Science.gov (United States)

    Chee, Hyun Keun; Yang, Jin-San; Joung, Je-Gun; Zhang, Byoung-Tak; Oh, S June

    2015-02-13

    Although the regulation of membrane receptor activation is known to be crucial for molecular signal transduction, the molecular mechanism underlying receptor activation is not fully elucidated. Here we study the physicochemical nature of membrane receptor behavior by investigating the characteristic molecular vibrations of receptor ligands using computational chemistry and informatics methods. By using information gain, t-tests, and support vector machines, we have identified highly informative features of adenosine receptor (AdoR) ligand and corresponding functional amino acid residues such as Asn (6.55) of AdoR that has informative significance and is indispensable for ligand recognition of AdoRs. These findings may provide new perspectives and insights into the fundamental mechanism of class A G protein-coupled receptor activation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. Supramolecular architectures constructed using angular bipyridyl ligands

    International Nuclear Information System (INIS)

    Barnett, Sarah Ann

    2003-01-01

    This work details the synthesis and characterization of a series of coordination frameworks that are formed using bidentate angular N-donor ligands. Pyrimidine was reacted with metal(ll) nitrate salts. Reactions using Cd(NO 3 ) 2 receive particular focus and the analogous reactions using the linear ligand, pyrazine, were studied for comparison. In all cases, two-dimensional coordination networks were prepared. Structural diversity is observed for the Cd(ll) centres including metal-nitrate bridging. In contrast, first row transition metal nitrates form isostructural one-dimensional chains with only the bridging N-donor ligands generating polymeric propagation. The angular ligand, 2,4-bis(4-pyridyl)-1,3,5-triazine (dpt), was reacted with Cd(NO 3 ) 2 and Zn(NO 3 ) 2 . Whereas Zn(NO 3 ) 2 compounds exhibit solvent mediated polymorphism, a range of structures were obtained for the reactions with Cd(NO 3 ) 2 , including the first example of a doubly parallel interpenetrated 4.8 2 net. 4,7-phenanthroline, was reacted with various metal(ll) nitrates as well as cobalt(ll) and copper(ll) halides. The ability of 4,7-phenanthroline to act as both a N-donor ligand and a hydrogen bond acceptor has been discussed. Reactions of CuSCN with pyrimidine yield an unusual three-dimensional structure in which polymeric propagation is not a result of ligand bridging. The reaction of CuSCN with dpt yielded structural supramolecular isomers. (author)

  4. Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2‧-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity

    Science.gov (United States)

    Hasan, Md. Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

    2016-01-01

    Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2 = 3-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2 = 4-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy = 2,2‧-bipyridine, Phen = 1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, 1H NMR, 13C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH ∼ 7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4 > 3 > 1 > 2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4‧,6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87 μM respectively.

  5. Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2'-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity.

    Science.gov (United States)

    Hasan, Md Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

    2016-01-05

    Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2=3-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2=4-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy=2,2'-bipyridine, Phen=1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, (1)H NMR, (13)C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH∼7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4>3>1>2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4',6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87μM respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Pharmacogenomic study using bio- and nanobioelectrochemistry: Drug-DNA interaction.

    Science.gov (United States)

    Hasanzadeh, Mohammad; Shadjou, Nasrin

    2016-04-01

    Small molecules that bind genomic DNA have proven that they can be effective anticancer, antibiotic and antiviral therapeutic agents that affect the well-being of millions of people worldwide. Drug-DNA interaction affects DNA replication and division; causes strand breaks, and mutations. Therefore, the investigation of drug-DNA interaction is needed to understand the mechanism of drug action as well as in designing DNA-targeted drugs. On the other hand, the interaction between DNA and drugs can cause chemical and conformational modifications and, thus, variation of the electrochemical properties of nucleobases. For this purpose, electrochemical methods/biosensors can be used toward detection of drug-DNA interactions. The present paper reviews the drug-DNA interactions, their types and applications of electrochemical techniques used to study interactions between DNA and drugs or small ligand molecules that are potentially of pharmaceutical interest. The results are used to determine drug binding sites and sequence preference, as well as conformational changes due to drug-DNA interactions. Also, the intention of this review is to give an overview of the present state of the drug-DNA interaction cognition. The applications of electrochemical techniques for investigation of drug-DNA interaction were reviewed and we have discussed the type of qualitative or quantitative information that can be obtained from the use of each technique. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    Science.gov (United States)

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  8. Investigation on biomolecular interactions of nickel(II) complexes with monoanionic bidentate ligands

    Science.gov (United States)

    Jayamani, Arumugam; Sethupathi, Murugan; Ojwach, Stephen O.; Sengottuvelan, Nallathambi

    2018-01-01

    Reactions of monoanionic bidentate ligands 5-methylsalicylaldehyde (5-msal), 5-bromosalicylaldehyde (5-brsal), 5-nitrosalicylaldehyde (5-nsal) and 2-hydroxy-1-naphthaldehyde (2-hnap) with nickel perchlorate hexahydrate produced nickel(II) complexes 1-4, respectively. Single crystal X-ray analyses of complexes 1 and 2 confirmed bidentate mode of the ligands with O˄O coordination to give square planar geometry around nickel atoms. Complexes 1-4 showed one quasi-reversible redox peak at cathodic region (-0.67 to -0.80 V) and one redox peak at anodic region (+1.08 to +1.44 V) assignable to the Ni(II)/Ni(I) and Ni(II)/Ni(III) redox couples, respectively. The complexes exhibited good bovine serum albumin (BSA) binding abilities with a maximum binding constant of 1.96 × 105 M-1. The binding of complexes with calf thymus DNA (ctDNA) showed that the binding affinity is consistent with an increase in steric bulk of the ligands. The nuclease activity of the complexes showed efficient oxidative cleavage in the presence of hydrogen peroxide as an oxidizing agent. The complexes showed higher zone of inhibition when screened for antimicrobial activity against bacteria and human pathogenic fungi.

  9. Interaction of calreticulin with CD40 ligand, TRAIL and Fas ligand

    DEFF Research Database (Denmark)

    Duus, K; Pagh, R T; Holmskov, U

    2007-01-01

    is utilized by many other functionally diverse molecules and in this work the interaction of calreticulin with C1q and structurally similar molecules was investigated. In addition to C1q and MBL, CD40 ligand (CD40L), tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas ligand (FasL) were...... found to bind calreticulin strongly. A low level or no binding was observed for adiponectin, tumour necrosis factor-alpha (TNF-alpha), CD30L, surfactant protein-A and -D and collagen VIII. The interaction with calreticulin required a conformational change in CD40L, TRAIL and FasL and showed the same...

  10. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  11. Divergent Ah Receptor Ligand Selectivity during Hominin Evolution.

    Science.gov (United States)

    Hubbard, Troy D; Murray, Iain A; Bisson, William H; Sullivan, Alexis P; Sebastian, Aswathy; Perry, George H; Jablonski, Nina G; Perdew, Gary H

    2016-10-01

    We have identified a fixed nonsynonymous sequence difference between humans (Val381; derived variant) and Neandertals (Ala381; ancestral variant) in the ligand-binding domain of the aryl hydrocarbon receptor (AHR) gene. In an exome sequence analysis of four Neandertal and Denisovan individuals compared with nine modern humans, there are only 90 total nucleotide sites genome-wide for which archaic hominins are fixed for the ancestral nonsynonymous variant and the modern humans are fixed for the derived variant. Of those sites, only 27, including Val381 in the AHR, also have no reported variability in the human dbSNP database, further suggesting that this highly conserved functional variant is a rare event. Functional analysis of the amino acid variant Ala381 within the AHR carried by Neandertals and nonhuman primates indicate enhanced polycyclic aromatic hydrocarbon (PAH) binding, DNA binding capacity, and AHR mediated transcriptional activity compared with the human AHR. Also relative to human AHR, the Neandertal AHR exhibited 150-1000 times greater sensitivity to induction of Cyp1a1 and Cyp1b1 expression by PAHs (e.g., benzo(a)pyrene). The resulting CYP1A1/CYP1B1 enzymes are responsible for PAH first pass metabolism, which can result in the generation of toxic intermediates and perhaps AHR-associated toxicities. In contrast, the human AHR retains the ancestral sensitivity observed in primates to nontoxic endogenous AHR ligands (e.g., indole, indoxyl sulfate). Our findings reveal that a functionally significant change in the AHR occurred uniquely in humans, relative to other primates, that would attenuate the response to many environmental pollutants, including chemicals present in smoke from fire use during cooking. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Ligand Exchange Kinetics of Environmentally Relevant Metals

    Energy Technology Data Exchange (ETDEWEB)

    Panasci, Adele Frances [Univ. of California, Davis, CA (United States)

    2014-07-15

    The interactions of ground water with minerals and contaminants are of broad interest for geochemists but are not well understood. Experiments on the molecular scale can determine reaction parameters (i.e. rates of ligand exchange, activation entropy, activation entropy, and activation volume) that can be used in computations to gain insight into reactions that occur in natural groundwaters. Experiments to determine the rate of isotopic ligand exchange for three environmentally relevant metals, rhodium (Rh), iron (Fe), and neptunium (Np), are described. Many environmental transformations of metals (e.g. reduction) in soil occur at trivalent centers, Fe(III) in particular. Contaminant ions absorb to mineral surfaces via ligand exchange, and the reversal of this reaction can be dangerous, releasing contaminants into the environment. Ferric iron is difficult to study spectroscopically because most of its complexes are paramagnetic and are generally reactive toward ligand exchange; therefore, Rh(III), which is diamagnetic and less reactive, was used to study substitution reactions that are analogous to those that occur on mineral oxide surfaces. Studies on both Np(V) and Np(VI) are important in their own right, as 237Np is a radioactive transuranic element with a half-life of 2 million years.

  13. Ligand iron catalysts for selective hydrogenation

    Science.gov (United States)

    Casey, Charles P.; Guan, Hairong

    2010-11-16

    Disclosed are iron ligand catalysts for selective hydrogenation of aldehydes, ketones and imines. A catalyst such as dicarbonyl iron hydride hydroxycyclopentadiene) complex uses the OH on the five member ring and hydrogen linked to the iron to facilitate hydrogenation reactions, particularly in the presence of hydrogen gas.

  14. Programmed Death-Ligand 1 Immunohistochemistry Testing

    DEFF Research Database (Denmark)

    Büttner, Reinhard; Gosney, John R; Skov, Birgit Guldhammer

    2017-01-01

    Purpose Three programmed death-1/programmed death-ligand 1 (PD-L1) inhibitors are currently approved for treatment of non-small-cell lung cancer (NSCLC). Treatment with pembrolizumab in NSCLC requires PD-L1 immunohistochemistry (IHC) testing. Nivolumab and atezolizumab are approved without PD-L1...

  15. Versatile phosphite ligands based on silsesquioxane backbones

    NARCIS (Netherlands)

    van der Vlugt, JI; Ackerstaff, J; Dijkstra, TW; Mills, AM; Kooijman, H; Spek, AL; Meetsma, A; Abbenhuis, HCL; Vogt, D

    Silsesquioxanes are employed as ligand backbones for the synthesis of novel phosphite compounds with 3,3'-5,5'-tetrakis(tert-butyl)-2,2'-di-oxa-1,1'-biphenyl substituents. Both mono- and bidentate phosphites are prepared in good yields. Two types of silsesquioxanes are employed as starting

  16. Ammonia formation by metal-ligand cooperative hydrogenolysis of a nitrido ligand

    Science.gov (United States)

    Askevold, Bjorn; Nieto, Jorge Torres; Tussupbayev, Samat; Diefenbach, Martin; Herdtweck, Eberhardt; Holthausen, Max C.; Schneider, Sven

    2011-07-01

    Bioinspired hydrogenation of N2 to ammonia at ambient conditions by stepwise nitrogen protonation/reduction with metal complexes in solution has experienced remarkable progress. In contrast, the highly desirable direct hydrogenation with H2 remains difficult. In analogy to the heterogeneously catalysed Haber-Bosch process, such a reaction is conceivable via metal-centred N2 splitting and unprecedented hydrogenolysis of the nitrido ligands to ammonia. We report the synthesis of a ruthenium(IV) nitrido complex. The high nucleophilicity of the nitrido ligand is demonstrated by unusual N-C coupling with π-acidic CO. Furthermore, the terminal nitrido ligand undergoes facile hydrogenolysis with H2 at ambient conditions to produce ammonia in high yield. Kinetic and quantum chemical examinations of this reaction suggest cooperative behaviour of a phosphorus-nitrogen-phosphorus pincer ligand in rate-determining heterolytic hydrogen splitting.

  17. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    Science.gov (United States)

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  18. Auto-assembly of nanometer thick, water soluble layers of plasmid DNA complexed with diamines and basic amino acids on graphite: Greatest DNA protection is obtained with arginine

    Energy Technology Data Exchange (ETDEWEB)

    Khalil, T.T.; Boulanouar, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France); Heintz, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6303Laboratoire Interdisciplinaire Carnot de Bourgogne, DTAI/Centre de micro/nano caractérisation, 9 Av. A. Savary, BP 47870, F-21078 DIJON Cedex (France); Fromm, M., E-mail: michel.fromm@univ-fcomte.fr [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France)

    2017-02-01

    We have investigated the ability of diamines as well as basic amino acids to condense DNA onto highly ordered pyrolytic graphite with minimum damage after re-dissolution in water. Based on a bibliographic survey we briefly summarize DNA binding properties with diamines as compared to basic amino acids. Thus, solutions of DNA complexed with these linkers were drop-cast in order to deposit ultra-thin layers on the surface of HOPG in the absence or presence of Tris buffer. Atomic Force Microscopy analyses showed that, at a fixed ligand-DNA mixing ratio of 16, the mean thickness of the layers can be statistically predicted to lie in the range 0–50 nm with a maximum standard deviation ± 6 nm, using a simple linear law depending on the DNA concentration. The morphology of the layers appears to be ligand-dependent. While the layers containing diamines present holes, those formed in the presence of basic amino acids, except for lysine, are much more compact and dense. X-ray Photoelectron Spectroscopy measurements provide compositional information indicating that, compared to the maximum number of DNA sites to which the ligands may bind, the basic amino acids Arg and His are present in large excess. Conservation of the supercoiled topology of the DNA plasmids was studied after recovery of the complex layers in water. Remarkably, arginine has the best protection capabilities whether Tris was present or not in the initial solution. - Highlights: • Characterization of nanometer scaled layers composed of pUC21 plasmid DNA • Relation between nature of the ligand and structure of the layers • Capacities of the ligands to protect plasmids from strand break depending on their nature.

  19. Dynamic ligand-based pharmacophore modeling and virtual ...

    Indian Academy of Sciences (India)

    Five ligand-based pharmacophore models were generated from 40 different .... the Phase module of the Schrodinger program.35 Each model consisted of six types of ... ligand preparation included the OPLS_2005 force field and to retain the ...

  20. Substrate coated with receptor and labelled ligand for assays

    International Nuclear Information System (INIS)

    1980-01-01

    Improvements in the procedures for assaying ligands are described. The assay consists of a polystyrene tube on which receptors are present for both the ligand to be assayed and a radioactively labelled form of the ligand. The receptors on the bottom portion of the tube are also coated with labelled ligands, thus eliminating the necessity for separate addition of the labelled ligand and sample during an assay. Examples of ligands to which this method is applicable include polypeptides, nucleotides, nucleosides and proteins. Specific examples are given in which the ligand to be assayed is digoxin, the labelled form of the ligand is 3-0-succinyl digoxyigenin tyrosine ( 125 I) and the receptor is digoxin antibody. (U.K.)

  1. Role of ligand-ligand vs. core-core interactions in gold nanoclusters.

    Science.gov (United States)

    Milowska, Karolina Z; Stolarczyk, Jacek K

    2016-05-14

    The controlled assembly of ligand-coated gold nanoclusters (NCs) into larger structures paves the way for new applications ranging from electronics to nanomedicine. Here, we demonstrate through rigorous density functional theory (DFT) calculations employing novel functionals accounting for van der Waals forces that the ligand-ligand interactions determine whether stable assemblies can be formed. The study of NCs with different core sizes, symmetry forms, ligand lengths, mutual crystal orientations, and in the presence of a solvent suggests that core-to-core van der Waals interactions play a lesser role in the assembly. The dominant interactions originate from combination of steric effects, augmented by ligand bundling on NC facets, and related to them changes in electronic properties induced by neighbouring NCs. We also show that, in contrast to standard colloidal theory approach, DFT correctly reproduces the surprising experimental trends in the strength of the inter-particle interaction observed when varying the length of the ligands. The results underpin the importance of understanding NC interactions in designing gold NCs for a specific function.

  2. DNA repair

    International Nuclear Information System (INIS)

    Van Zeeland, A.A.

    1984-01-01

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  3. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    Science.gov (United States)

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  4. A response calculus for immobilized T cell receptor ligands

    DEFF Research Database (Denmark)

    Andersen, P S; Menné, C; Mariuzza, R A

    2001-01-01

    determine the level of T cell activation. When fitted to T cell responses against purified ligands immobilized on plastic surfaces, the 2D-affinity model adequately simulated changes in cellular activation as a result of varying ligand affinity and ligand density. These observations further demonstrated...

  5. Fullerenes as a new type of ligands for transition metals

    International Nuclear Information System (INIS)

    Sokolov, V.I.

    2007-01-01

    Fullerenes are considered as ligands in transition metal π-complexes. The following aspects are discussed: metals able to form π-complexes with fullerenes (Zr, V, Ta, Mo, W, Re, Ru, etc.); haptic numbers; homo- and hetero ligand complexes; ligand compatibility with fullerenes for different metals, including fullerenes with a disturbed structure of conjugation [ru

  6. New pinene-derived pyridines as bidentate chiral ligands

    Czech Academy of Sciences Publication Activity Database

    Malkov, A. V.; Stewart-Liddon, A.; Teplý, Filip; Kobr, L.; Muir, K. W.; Haigh, D.; Kočovský, P.

    2008-01-01

    Roč. 64, č. 18 (2008), s. 4011-4025 ISSN 0040-4020 Institutional research plan: CEZ:AV0Z40550506 Keywords : chiral ligands * transition metal catalysis * asymmetric catalysis * pyridine ligands * oxazoline ligands Subject RIV: CC - Organic Chemistry Impact factor: 2.897, year: 2008

  7. Synthesis, characterization and DNA cleavage activity of nickel(II adducts with aromatic heterocyclic bases

    Directory of Open Access Journals (Sweden)

    G. H. PHILIP

    2010-01-01

    Full Text Available Mixed ligand complexes of nickel(II with 2,4-dihydroxyaceto-phenone oxime (DAPO and 2,4-dihydroxybenzophenone oxime (DBPO as primary ligands, and pyridine (Py and imidazole (Im as secondary ligands were synthesized and characterized by molar conductivity, magnetic moments measurements, as well as by electronic, IR, and 1H-NMR spectroscopy. Electrochemical studies were performed by cyclic voltammetry. The active signals are assignable to the NiIII/II and NiII/I redox couples. The binding interactions between the metal complexes and calf thymus DNA were investigated by absorption and thermal denaturation. The cleavage activity of the complexes was determined using double-stranded pBR322 circular plasmid DNA by gel electrophoresis. All complexes showed increased nuclease activity in the presence of the oxidant H2O2. The nuclease activities of mixed ligand complexes were compared with those of the parent copper(II complexes.

  8. Sigma-2 ligands and PARP inhibitors synergistically trigger cell death in breast cancer cells

    International Nuclear Information System (INIS)

    McDonald, Elizabeth S.; Mankoff, Julia; Makvandi, Mehran; Chu, Wenhua; Chu, Yunxiang; Mach, Robert H.; Zeng, Chenbo

    2017-01-01

    The sigma-2 receptor is overexpressed in proliferating cells compared to quiescent cells and has been used as a target for imaging solid tumors by positron emission tomography. Recent work has suggested that the sigma-2 receptor may also be an effective therapeutic target for cancer therapy. Poly (ADP-ribose) polymerase (PARP) is a family of enzymes involved in DNA damage response. In this study, we looked for potential synergy of cytotoxicity between PARP inhibitors and sigma-2 receptor ligands in breast cancer cell lines. We showed that the PARP inhibitor, YUN3-6, sensitized mouse breast cancer cell line, EMT6, to sigma-2 receptor ligand (SV119, WC-26, and RHM-138) induced cell death determined by cell viability assay and colony forming assay. The PARP inhibitor, olaparib, sensitized tumor cells to a different sigma-2 receptor ligand SW43-induced apoptosis and cell death in human triple negative cell line, MDA-MB-231. Olaparib inhibited PARP activity and cell proliferation, and arrested cells in G2/M phase of the cell cycle in MDA-MB-231 cells. Subsequently cells became sensitized to SW43 induced cell death. In conclusion, the combination of sigma-2 receptor ligands and PARP inhibitors appears to hold promise for synergistically triggering cell death in certain types of breast cancer cells and merits further investigation. - Highlights: • PARPi, YUN3-6 and olaparib, and σ2 ligands, SV119 and SW43, were evaluated. • Mouse and human breast cancer cells, EMT6 and MDA-MB-231 respectively, were used. • YUN3-6 and SV119 synergistically triggered cell death in EMT6 cells. • Olaparib and SW43 additively triggered cell death in MDA-MB-231 cells. • Olaparib arrested cells in G2/M in MDA-MB-231 cells.

  9. Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

    Science.gov (United States)

    Odell, M; Shuman, S

    1999-05-14

    The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

  10. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  11. Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

    Science.gov (United States)

    Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

    2010-06-01

    The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

  12. Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection.

    Science.gov (United States)

    Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang

    2011-01-28

    In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).

  13. Thermodynamic and biological evaluation of a thrombin binding aptamer modified with several unlocked nucleic acid (UNA) monomers and a 2′-C-piperazino-UNA monomer

    DEFF Research Database (Denmark)

    Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.

    2011-01-01

    Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...

  14. CARF and WYL domains: ligand-binding regulators of prokaryotic defense systems

    Directory of Open Access Journals (Sweden)

    Kira eMakarova

    2014-04-01

    Full Text Available CRISPR-Cas adaptive immunity systems of bacteria and archaea insert fragments of virus or plasmid DNA as spacer sequences into CRISPR repeat loci. Processed transcripts encompassing these spacers guide the cleavage of the cognate foreign DNA or RNA. Most CRISPR-Cas loci, in addition to recognized cas genes, also include genes that are not directly implicated in spacer acquisition, CRISPR transcript processing or interference. Here we comprehensively analyze sequences, structures and genomic neighborhoods of one of the most widespread groups of such genes that encode proteins containing a predicted nucleotide-binding domain with a Rossmann-like fold, which we denote CARF (CRISPR-associated Rossmann fold. Several CARF protein structures have been determined but functional characterization of these proteins is lacking. The CARF domain is most frequently combined with a C-terminal winged helix-turn-helix DNA-binding domain and effector domains most of which are predicted to possess DNase or RNase activity. Divergent CARF domains are also found in RtcR proteins, sigma-54 dependent regulators of the rtc RNA repair operon. CARF genes frequently co-occur with those coding for proteins containing the WYL domain with the Sm-like SH3 β-barrel fold, which is also predicted to bind ligands. CRISPR-Cas and possibly other defense systems are predicted to be transcriptionally regulated by multiple ligand-binding proteins containing WYL and CARF domains which sense modified nucleotides and nucleotide derivatives generated during virus infection. We hypothesize that CARF domains also transmit the signal from the bound ligand to the fused effector domains which attack either alien or self nucleic acids, resulting, respectively, in immunity complementing the CRISPR-Cas action or in dormancy/programmed cell death.

  15. Sigma-2 receptor ligands QSAR model dataset

    Directory of Open Access Journals (Sweden)

    Antonio Rescifina

    2017-08-01

    Full Text Available The data have been obtained from the Sigma-2 Receptor Selective Ligands Database (S2RSLDB and refined according to the QSAR requirements. These data provide information about a set of 548 Sigma-2 (σ2 receptor ligands selective over Sigma-1 (σ1 receptor. The development of the QSAR model has been undertaken with the use of CORAL software using SMILES, molecular graphs and hybrid descriptors (SMILES and graph together. Data here reported include the regression for σ2 receptor pKi QSAR models. The QSAR model was also employed to predict the σ2 receptor pKi values of the FDA approved drugs that are herewith included.

  16. Metal-ligand cooperative activation of nitriles by a ruthenium complex with a de-aromatized PNN pincer ligand

    NARCIS (Netherlands)

    Eijsink, Linda E; Perdriau, Sébastien C P; de Vries, Johannes G; Otten, Edwin

    2016-01-01

    The pincer complex (PNN)RuH(CO), with a de-aromatized pyridine in the ligand backbone, is shown to react with nitriles in a metal-ligand cooperative manner. This leads to the formation of a series of complexes with new Ru-N(nitrile) and C(ligand)-C(nitrile) bonds. The initial nitrile cycloaddition

  17. Selective oxoanion separation using a tripodal ligand

    Energy Technology Data Exchange (ETDEWEB)

    Custelcean, Radu; Moyer, Bruce A.; Rajbanshi, Arbin

    2016-02-16

    The present invention relates to urea-functionalized crystalline capsules self-assembled by sodium or potassium cation coordination and by hydrogen-bonding water bridges to selectively encapsulate tetrahedral divalent oxoanions from highly competitive aqueous alkaline solutions and methods using this system for selective anion separations from industrial solutions. The method involves competitive crystallizations using a tripodal tris(urea) functionalized ligand and, in particular, provides a viable approach to sulfate separation from nuclear wastes.

  18. Targeting Selectins and Their Ligands in Cancer

    Directory of Open Access Journals (Sweden)

    Alessandro eNatoni

    2016-04-01

    Full Text Available Aberrant glycosylation is a hallmark of cancer cells with increased evidence pointing to a role in tumor progression. In particular, aberrant sialylation of glycoproteins and glycolipids have been linked to increased immune cell evasion, drug evasion, drug resistance, tumor invasiveness, and vascular dissemination leading to metastases. Hypersialylation of cancer cells is largely the result of overexpression of sialyltransferases. Humans differentially express twenty different sialyltransferases in a tissue-specific manner, each of which catalyze the attachment of sialic acids via different glycosidic linkages (2-3; 2-6 or 2-8 to the underlying glycan chain. One important mechanism whereby overexpression of sialyltransferases contributes to an enhanced metastatic phenotype is via the generation of selectin ligands. Selectin ligand function requires the expression of sialyl-Lewis X and its structural-isomer sialyl-Lewis A, which are synthesized by the combined action of alpha 1-3-fucosyltransferases, 2-3-sialyltransferases, 1-4-galactosyltranferases, and N-acetyl--glucosaminyltransferases. The α2-3-sialyltransferases ST3Gal4 and ST3Gal6 are critical to the generation of functional E- and P-selectin ligands and overexpression of these sialyltransferases have been linked to increased risk of metastatic disease in solid tumors and poor outcome in multiple myeloma. Thus, targeting selectins and their ligands as well as the enzymes involved in their generation, in particular sialyltransferases, could be beneficial to many cancer patients. Potential strategies include sialyltransferase inhibition and the use of selectin antagonists, such as glycomimetic drugs and antibodies. Here, we review ongoing efforts to optimize the potency and selectivity of sialyltransferase inhibitors, including the potential for targeted delivery approaches, as well as evaluate the potential utility of selectin inhibitors, which are now in early clinical

  19. Experimental studies on the nature of bonding of DNA/bipyridyl-(ethylenediamine)platinum(II) and DNA/netropsin complexes in solution and oriented wet-spun films

    Science.gov (United States)

    Marlowe, R. L.; Szabo, A.; Lee, S. A.; Rupprecht, A.

    2002-03-01

    The stability of complexes of NaDNA with bipyridyl-(ethylenediamine)platinum(II) (abbreviated [(bipy)Pt(en)]) and with netropsin has been studied using two techniques: (i) ultraviolet melting experiments were done on NaDNA/[(bipy)Pt(en)], showing that the [(bipy)Pt(en)] ligand stabilizes the DNA double helix structure; and (ii) swelling measurements (via optical microscopy) as a function of relative humidity were done on wet-spun oriented films of NaDNA/[(bipy)Pt(en)] and of NaDNA/netropsin. The swelling data shows that an irreversible transition of the films occurs at high relative humidity, first for the NaDNA/netropsin, then for pure NaDNA, and lastly for the NaDNA/[(bipy)Pt(en)]. These results are indicative that the [(bipy)Pt(en)] complex stabilizes the intermolecular bonds which mediate the film swelling characteristics. A model is suggested for the binding of [(bipy)Pt(en)] to DNA to explain why the swelling experiments show this ligand as increasing the intermolecular bond strength between the DNA double helices, while netropsin decreases this degree of stabilization.

  20. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.