WorldWideScience

Sample records for functional ribosomes reveals

  1. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  2. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  3. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  4. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  5. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  6. Functional characterization of human RSK4, a new 90-kDa ribosomal S6 kinase, reveals constitutive activation in most cell types

    DEFF Research Database (Denmark)

    Dümmler, Bettina A; Hauge, Camilla; Silber, Joachim

    2005-01-01

    characterization of a predicted new human RSK homologue, RSK4. We showed that RSK4 is a predominantly cytosolic protein with very low expression and several characteristics of the RSK family kinases, including the presence of two functional kinase domains and a C-terminal docking site for ERK. Surprisingly......, however, in all cell types analyzed, endogenous RSK4 was maximally (constitutively) activated under serum-starved conditions where other RSKs are inactive due to their requirement for growth factor stimulation. Constitutive activation appeared to result from constitutive phosphorylation of Ser232, Ser372...

  7. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  8. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  9. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  11. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  12. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  13. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  14. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  15. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  16. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  17. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  18. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  19. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  20. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  1. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  2. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  3. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  4. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  5. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  6. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  8. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    Science.gov (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  10. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  11. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit

    2016-05-01

    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  12. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  13. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  14. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  15. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  16. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  17. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  18. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  19. Mutation of the key residue for extraribosomal function of ribosomal protein S19 cause increased grooming behaviors in mice.

    Science.gov (United States)

    Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro

    2016-08-26

    Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription

    International Nuclear Information System (INIS)

    Bergstralh, Daniel T.; Conti, Brian J.; Moore, Chris B.; Brickey, W. June; Taxman, Debra J.; Ting, Jenny P.-Y.

    2007-01-01

    Analysis of lung cancer response to chemotherapeutic agents showed the accumulation of a Taxol-induced protein that reacted with an anti-phospho-MEK1/2 antibody. Mass spectroscopy identified the protein as nucleophosmin/B23 (NPM), a multifunctional protein with diverse roles: ribosome biosynthesis, p53 regulation, nuclear-cytoplasmic shuttling, and centrosome duplication. Our work demonstrates that following cellular exposure to mitosis-arresting agents, NPM is phosphorylated and its chromatographic property is altered, suggesting changes in function during mitosis. To determine the functional relevance of NPM, its expression in tumor cells was reduced by siRNA. Cells with reduced NPM were treated with Taxol followed by microarray profiling accompanied by gene/protein pathway analyses. These studies demonstrate several expected and unexpected consequences of NPM depletion. The predominant downstream effectors of NPM are genes involved in cell proliferation, cancer, and the cell cycle. In congruence with its role in cancer, NPM is over-expressed in primary malignant lung cancer tissues. We also demonstrate a role for NPM in the expression of genes encoding SET (TAF1β) and the histone methylase SET8. Additionally, we show that NPM is required for a previously unobserved G2/M upregulation of TAF1A, which encodes the rDNA transcription factor TAF I 48. These results demonstrate multi-faceted functions of NPM that can affect cancer cells

  1. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Ribosomal protein NtRPL17 interacts with kinesin-12 family protein NtKRP and functions in the regulation of embryo/seed size and radicle growth.

    Science.gov (United States)

    Tian, Shujuan; Wu, Jingjing; Liu, Yuan; Huang, Xiaorong; Li, Fen; Wang, Zhaodan; Sun, Meng-Xiang

    2017-11-28

    We previously reported that a novel motor protein belonging to the kinesin-12 family, NtKRP, displays critical roles in regulating embryo and seed size establishment. However, it remains unknown exactly how NtKRP contributes to this developmental process. Here, we report that a 60S ribosomal protein NtRPL17 directly interacts with NtKRP. The phenotypes of NtRPL17 RNAi lines show notable embryo and seed size reduction. Structural observations of the NtRPL17-silenced embryos/seeds reveal that the embryo size reduction is due to a decrease in cell number. In these embryos, cell division cycle progression is delayed at the G2/M transition. These phenotypes are similar to that in NtKRP-silenced embryos/seeds, indicating that NtKRP and NtRPL17 function as partners in the same regulatory pathway during seed development and specifically regulate cell cycle progression to control embryo/seed size. This work reveals that NtRPL17, as a widely distributed ribosomal protein, plays a critical role in seed development and provides a new clue in the regulation of seed size. Confirmation of the interaction between NtKRP and NtRPL17 and their co-function in the control of the cell cycle also suggests that the mechanism might be conserved in both plants and animals. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  3. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  4. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  5. Bacterial effector binding to ribosomal protein s3 subverts NF-kappaB function.

    Directory of Open Access Journals (Sweden)

    Xiaofei Gao

    2009-12-01

    Full Text Available Enteric bacterial pathogens cause food borne disease, which constitutes an enormous economic and health burden. Enterohemorrhagic Escherichia coli (EHEC causes a severe bloody diarrhea following transmission to humans through various means, including contaminated beef and vegetable products, water, or through contact with animals. EHEC also causes a potentially fatal kidney disease (hemolytic uremic syndrome for which there is no effective treatment or prophylaxis. EHEC and other enteric pathogens (e.g., enteropathogenic E. coli (EPEC, Salmonella, Shigella, Yersinia utilize a type III secretion system (T3SS to inject virulence proteins (effectors into host cells. While it is known that T3SS effectors subvert host cell function to promote diarrheal disease and bacterial transmission, in many cases, the mechanisms by which these effectors bind to host proteins and disrupt the normal function of intestinal epithelial cells have not been completely characterized. In this study, we present evidence that the E. coli O157:H7 nleH1 and nleH2 genes encode T3SS effectors that bind to the human ribosomal protein S3 (RPS3, a subunit of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kappaB transcriptional complexes. NleH1 and NleH2 co-localized with RPS3 in the cytoplasm, but not in cell nuclei. The N-terminal region of both NleH1 and NleH2 was required for binding to the N-terminus of RPS3. NleH1 and NleH2 are autophosphorylated Ser/Thr protein kinases, but their binding to RPS3 is independent of kinase activity. NleH1, but not NleH2, reduced the nuclear abundance of RPS3 without altering the p50 or p65 NF-kappaB subunits or affecting the phosphorylation state or abundance of the inhibitory NF-kappaB chaperone IkappaBalpha NleH1 repressed the transcription of a RPS3/NF-kappaB-dependent reporter plasmid, but did not inhibit the transcription of RPS3-independent reporters. In contrast, NleH2 stimulated RPS3-dependent transcription, as well

  6. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  7. New localization and function of calpain-2 in nucleoli of colorectal cancer cells in ribosomal biogenesis: effect of KRAS status.

    Science.gov (United States)

    Telechea-Fernández, Marcelino; Rodríguez-Fernández, Lucia; García, Concha; Zaragozá, Rosa; Viña, Juan; Cervantes, Andrés; García-Trevijano, Elena R

    2018-02-06

    Calpain-2 belongs to a family of pleiotropic Cys-proteases with modulatory rather than degradative functions. Calpain (CAPN) overexpression has been controversially correlated with poor prognosis in several cancer types, including colorectal carcinoma (CRC). However, the mechanisms of substrate-recognition, calpain-2 regulation/deregulation and specific functions in CRC remain elusive. Herein, calpain subcellular distribution was studied as a key event for substrate-recognition and consequently, for calpain-mediated function. We describe a new localization for calpain-2 in the nucleoli of CRC cells. Calpain-2 nucleolar distribution resulted dependent on its enzymatic activity and on the mutational status of KRAS. In KRASWT/- cells serum-starvation induced CAPN2 expression, nucleolar accumulation and increased binding to the rDNA-core promoter and intergenic spacer (IGS), concomitant with a reduction in pre-rRNA levels. Depletion of calpain-2 by specific siRNA prevented pre-rRNA down-regulation after serum removal. Conversely, ribosomal biogenesis proceeded in the absence of serum in unresponsive KRASG13D/- cells whose CAPN2 expression, nucleolar localization and rDNA-occupancy remained unchanged during the time-course of serum starvation. We propose here that nucleolar calpain-2 might be a KRAS-dependent sensor to repress ribosomal biogenesis in growth limiting conditions. Under constitutive activation of the pathway commonly found in CRC, calpain-2 is deregulated and tumor cells become insensitive to the extracellular microenvironment.

  8. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function

    OpenAIRE

    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars

    2012-01-01

    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  9. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Porse, B T; Leviev, I; Mankin, A S

    1998-01-01

    A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...

  10. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  11. iTRAQ Protein Profile Differential Analysis of Dormant and Germinated Grassbur Twin Seeds Reveals that Ribosomal Synthesis and Carbohydrate Metabolism Promote Germination Possibly Through the PI3K Pathway.

    Science.gov (United States)

    Zhang, Guo-Liang; Zhu, Yue; Fu, Wei-Dong; Wang, Peng; Zhang, Rui-Hai; Zhang, Yan-Lei; Song, Zhen; Xia, Gui-Xian; Wu, Jia-He

    2016-06-01

    Grassbur is a destructive and invasive weed in pastures, and its burs can cause gastric damage to animals. The strong adaptability and reproductive potential of grassbur are partly due to a unique germination mechanism whereby twin seeds develop in a single bur: one seed germinates, but the other remains dormant. To investigate the molecular mechanism of seed germination in twin seeds, we used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a dynamic proteomic analysis of germination and dormancy. A total of 1,984 proteins were identified, 161 of which were considered to be differentially accumulated. The differentially accumulated proteins comprised 102 up-regulated and 59 down-regulated proteins. These proteins were grouped into seven functional categories, ribosomal proteins being the predominant group. The authenticity and accuracy of the results were confirmed by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time reverse transcription-PCR (qPCR). A dynamic proteomic analysis revealed that ribosome synthesis and carbohydrate metabolism affect seed germination possibly through the phosphoinositide 3-kinase (PI3K) pathway. As the PI3K pathway is generally activated by insulin, analyses of seeds treated with exogenous insulin by qPCR, ELISA and iTRAQ confirmed that the PI3K pathway can be activated, which suppresses dormancy and promotes germination in twin grassbur seeds. Together, these results show that the PI3K pathway may play roles in stimulating seed germination in grassbur by modulating ribosomal synthesis and carbohydrate metabolism. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  15. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  16. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  17. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  18. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  19. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  20. Antibodies to ribosomal P proteins of Trypanosoma cruzi in Chagas disease possess functional autoreactivity with heart tissue and differ from anti-P autoantibodies in lupus.

    Science.gov (United States)

    Kaplan, D; Ferrari, I; Bergami, P L; Mahler, E; Levitus, G; Chiale, P; Hoebeke, J; Van Regenmortel, M H; Levin, M J

    1997-09-16

    Anti-P antibodies present in sera from patients with chronic Chagas heart disease (cChHD) recognize peptide R13, EEEDDDMGFGLFD, which encompasses the C-terminal region of the Trypanosoma cruzi ribosomal P1 and P2 proteins. This peptide shares homology with the C-terminal region (peptide H13 EESDDDMGFGLFD) of the human ribosomal P proteins, which is in turn the target of anti-P autoantibodies in systemic lupus erythematosus (SLE), and with the acidic epitope, AESDE, of the second extracellular loop of the beta1-adrenergic receptor. Anti-P antibodies from chagasic patients showed a marked preference for recombinant parasite ribosomal P proteins and peptides, whereas anti-P autoantibodies from SLE reacted with human and parasite ribosomal P proteins and peptides to the same extent. A semi-quantitative estimation of the binding of cChHD anti-P antibodies to R13 and H13 using biosensor technology indicated that the average affinity constant was about 5 times higher for R13 than for H13. Competitive enzyme immunoassays demonstrated that cChHD anti-P antibodies bind to the acidic portions of peptide H13, as well as to peptide H26R, encompassing the second extracellular loop of the beta1 adrenoreceptor. Anti-P antibodies isolated from cChHD patients exert a positive chronotropic effect in vitro on cardiomyocytes from neonatal rats, which resembles closely that of anti-beta1 receptor antibodies isolated from the same patient. In contrast, SLE anti-P autoantibodies have no functional effect. Our results suggest that the adrenergic-stimulating activity of anti-P antibodies may be implicated in the induction of functional myocardial impairments observed in cChHD.

  1. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  2. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  3. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  4. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  5. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  6. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    genes between O. sativa and B. napus may have consistent function and control similar traits, which may be ..... acea chromosomes reveals islands of conserved organization. ... 1998 Conserved structure and function of the Arabidopsis flow-.

  7. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  8. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  9. Characterization of the diatomite binding domain in the ribosomal protein L2 from E. coli and functions as an affinity tag.

    Science.gov (United States)

    Li, Junhua; Zhang, Yang; Yang, Yanjun

    2013-03-01

    The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.

  10. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  11. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  12. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  13. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  14. Exclusion of mRNPs and ribosomal particles from a thin zone beneath the nuclear envelope revealed upon inhibition of transport

    International Nuclear Information System (INIS)

    Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil

    2010-01-01

    We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.

  15. Molecular cloning and functional analysis of a recombinant ribosome-inactivating protein (alpha-momorcharin) from Momordica charantia.

    Science.gov (United States)

    Wang, Shuzhen; Zhang, Yubo; Liu, Honggao; He, Ying; Yan, Junjie; Wu, Zhihua; Ding, Yi

    2012-11-01

    Alpha-momorcharin (α-MC), a member of the ribosome-inactivating protein (RIP) family, has been used not only as antiviral, antimicrobial, and antitumor agents, but also as toxicant to protozoa, insects, and fungi. In this study, we expressed the protein in Escherichia coli Rosetta (DE3) pLysS strain and purified it by nickel-nitrilotriacetic acid affinity chromatography. A total of 85 mg of homogeneous protein was obtained from 1 l culture supernatant of Rosetta (DE3) pLysS, showing a high recovery rate of 73.9%. Protein activity assay indicated that α-MC had both N-glycosidase activity and DNA-nuclease activity, the former releasing RIP diagnostic RNA fragment (Endo's fragment) from rice rRNAs and the latter converting supercoiled circular DNA of plasmid pET-32a(+) into linear conformations in a concentration-dependent manner. Specially, we found that α-MC could inhibit the mycelial growth of Fusarium solani and Fusarium oxysporum with IC(50) values of 6.23 and 4.15 μM, respectively. Results of optical microscopy and transmission electron microscopy demonstrated that α-MC caused extensive septum formation, loss of integrity of the cell wall, separation of the cytoplasm from the cell wall, deformation of cells with irregular budding sites, and apoptosis in F. solani. Moreover, α-MC was active against Pseudomonas aeruginosa with an IC(50) value of 0.59 μM. The α-MC protein carries a high potential for the design of new antifungal drugs or the development of transgenic crops resistant to pathogens.

  16. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  18. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  19. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  20. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  1. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  2. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  4. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  5. Baculovirus-mediated expression and isolation of human ribosomal phosphoprotein P0 carrying a GST-tag in a functional state

    International Nuclear Information System (INIS)

    Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao

    2004-01-01

    We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function

  6. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  7. Crystal structure analysis reveals functional flexibility in the selenocysteine-specific tRNA from mouse.

    Directory of Open Access Journals (Sweden)

    Oleg M Ganichkin

    Full Text Available Selenocysteine tRNAs (tRNA(Sec exhibit a number of unique identity elements that are recognized specifically by proteins of the selenocysteine biosynthetic pathways and decoding machineries. Presently, these identity elements and the mechanisms by which they are interpreted by tRNA(Sec-interacting factors are incompletely understood.We applied rational mutagenesis to obtain well diffracting crystals of murine tRNA(Sec. tRNA(Sec lacking the single-stranded 3'-acceptor end ((ΔGCCARNA(Sec yielded a crystal structure at 2.0 Å resolution. The global structure of (ΔGCCARNA(Sec resembles the structure of human tRNA(Sec determined at 3.1 Å resolution. Structural comparisons revealed flexible regions in tRNA(Sec used for induced fit binding to selenophosphate synthetase. Water molecules located in the present structure were involved in the stabilization of two alternative conformations of the anticodon stem-loop. Modeling of a 2'-O-methylated ribose at position U34 of the anticodon loop as found in a sub-population of tRNA(Secin vivo showed how this modification favors an anticodon loop conformation that is functional during decoding on the ribosome. Soaking of crystals in Mn(2+-containing buffer revealed eight potential divalent metal ion binding sites but the located metal ions did not significantly stabilize specific structural features of tRNA(Sec.We provide the most highly resolved structure of a tRNA(Sec molecule to date and assessed the influence of water molecules and metal ions on the molecule's conformation and dynamics. Our results suggest how conformational changes of tRNA(Sec support its interaction with proteins.

  8. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  9. Memory functions reveal structural properties of gene regulatory networks

    Science.gov (United States)

    Perez-Carrasco, Ruben

    2018-01-01

    Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492

  10. Polymorphisms in the mitochondrial ribosome recycling factor EF-G2mt/MEF2 compromise cell respiratory function and increase atorvastatin toxicity.

    Directory of Open Access Journals (Sweden)

    Sylvie Callegari

    Full Text Available Mitochondrial translation, essential for synthesis of the electron transport chain complexes in the mitochondria, is governed by nuclear encoded genes. Polymorphisms within these genes are increasingly being implicated in disease and may also trigger adverse drug reactions. Statins, a class of HMG-CoA reductase inhibitors used to treat hypercholesterolemia, are among the most widely prescribed drugs in the world. However, a significant proportion of users suffer side effects of varying severity that commonly affect skeletal muscle. The mitochondria are one of the molecular targets of statins, and these drugs have been known to uncover otherwise silent mitochondrial mutations. Based on yeast genetic studies, we identify the mitochondrial translation factor MEF2 as a mediator of atorvastatin toxicity. The human ortholog of MEF2 is the Elongation Factor Gene (EF-G 2, which has previously been shown to play a specific role in mitochondrial ribosome recycling. Using small interfering RNA (siRNA silencing of expression in human cell lines, we demonstrate that the EF-G2mt gene is required for cell growth on galactose medium, signifying an essential role for this gene in aerobic respiration. Furthermore, EF-G2mt silenced cell lines have increased susceptibility to cell death in the presence of atorvastatin. Using yeast as a model, conserved amino acid variants, which arise from non-synonymous single nucleotide polymorphisms (SNPs in the EF-G2mt gene, were generated in the yeast MEF2 gene. Although these mutations do not produce an obvious growth phenotype, three mutations reveal an atorvastatin-sensitive phenotype and further analysis uncovers a decreased respiratory capacity. These findings constitute the first reported phenotype associated with SNPs in the EF-G2mt gene and implicate the human EF-G2mt gene as a pharmacogenetic candidate gene for statin toxicity in humans.

  11. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  12. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  13. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  14. Identifying and annotating human bifunctional RNAs reveals their versatile functions.

    Science.gov (United States)

    Chen, Geng; Yang, Juan; Chen, Jiwei; Song, Yunjie; Cao, Ruifang; Shi, Tieliu; Shi, Leming

    2016-10-01

    Bifunctional RNAs that possess both protein-coding and noncoding functional properties were less explored and poorly understood. Here we systematically explored the characteristics and functions of such human bifunctional RNAs by integrating tandem mass spectrometry and RNA-seq data. We first constructed a pipeline to identify and annotate bifunctional RNAs, leading to the characterization of 132 high-confidence bifunctional RNAs. Our analyses indicate that bifunctional RNAs may be involved in human embryonic development and can be functional in diverse tissues. Moreover, bifunctional RNAs could interact with multiple miRNAs and RNA-binding proteins to exert their corresponding roles. Bifunctional RNAs may also function as competing endogenous RNAs to regulate the expression of many genes by competing for common targeting miRNAs. Finally, somatic mutations of diverse carcinomas may generate harmful effect on corresponding bifunctional RNAs. Collectively, our study not only provides the pipeline for identifying and annotating bifunctional RNAs but also reveals their important gene-regulatory functions.

  15. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  17. Reveal genes functionally associated with ACADS by a network study.

    Science.gov (United States)

    Chen, Yulong; Su, Zhiguang

    2015-09-15

    Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Functional metabolomics reveals novel active products in the DHA metabolome

    Directory of Open Access Journals (Sweden)

    Masakazu eShinohara

    2012-04-01

    Full Text Available Endogenous mechanisms for successful resolution of an acute inflammatory response and the local return to homeostasis are of interest because excessive inflammation underlies many human diseases. In this review, we provide an update and overview of functional metabolomics that identified a new bioactive metabolome of docosahexaenoic acid (DHA. Systematic studies revealed that DHA was converted to DHEA-derived novel bioactive products as well as aspirin-triggered (AT forms of protectins. The new oxygenated DHEA derived products blocked PMN chemotaxis, reduced P-selectin expression and platelet-leukocyte adhesion, and showed organ protection in ischemia/reperfusion injury. These products activated cannabinoid receptor (CB2 receptor and not CB1 receptors. The AT-PD1 reduced neutrophil (PMN recruitment in murine peritonitis. With human cells, AT-PD1 decreased transendothelial PMN migration as well as enhanced efferocytosis of apoptotic human PMN by macrophages. The recent findings reviewed here indicate that DHEA oxidative metabolism and aspirin-triggered conversion of DHA produce potent novel molecules with anti-inflammatory and organ-protective properties, opening the DHA metabolome functional roles.

  19. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  20. Construction of synthetic nucleoli in human cells reveals how a major functional nuclear domain is formed and propagated through cell division.

    Science.gov (United States)

    Grob, Alice; Colleran, Christine; McStay, Brian

    2014-02-01

    Human cell nuclei are functionally organized into structurally stable yet dynamic bodies whose cell cycle inheritance is poorly understood. Here, we investigate the biogenesis and propagation of nucleoli, sites of ribosome biogenesis and key regulators of cellular growth. Nucleolar and cell cycles are intimately connected. Nucleoli disappear during mitosis, reforming around prominent uncharacterized chromosomal features, nucleolar organizer regions (NORs). By examining the effects of UBF depletion on both endogenous NORs and synthetic pseudo-NORs, we reveal its essential role in maintaining competency and establishing a bookmark on mitotic NORs. Furthermore, we demonstrate that neo-NORs, UBF-binding site arrays coupled with rDNA transcription units, direct the de novo biogenesis of functional compartmentalized neonucleoli irrespective of their site of chromosomal integration. For the first time, we establish the sequence requirements for nucleolar biogenesis and provide proof that this is a staged process where UBF-dependent mitotic bookmarking precedes function-dependent nucleolar assembly.

  1. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  2. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  3. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  4. Heterogeneity in Neutrophil Microparticles Reveals Distinct Proteome and Functional Properties*

    Science.gov (United States)

    Dalli, Jesmond; Montero-Melendez, Trinidad; Norling, Lucy V; Yin, Xiaoke; Hinds, Charles; Haskard, Dorian; Mayr, Manuel; Perretti, Mauro

    2013-01-01

    Altered plasma neutrophil microparticle levels have recently been implicated in a number of vascular and inflammatory diseases, yet our understanding of their actions is very limited. Herein, we investigate the proteome of neutrophil microparticles in order to shed light on their biological actions. Stimulation of human neutrophils, either in suspension or adherent to an endothelial monolayer, led to the production of microparticles containing >400 distinct proteins with only 223 being shared by the two subsets. For instance, postadherent microparticles were enriched in alpha-2 macroglobulin and ceruloplasmin, whereas microparticles produced by neutrophils in suspension were abundant in heat shock 70 kDa protein 1. Annexin A1 and lactotransferrin were expressed in both microparticle subsets. We next determined relative abundance of these proteins in three types of human microparticle samples: healthy volunteer plasma, plasma of septic patients and skin blister exudates finding that these proteins were differentially expressed on neutrophil microparticles from these samples reflecting in part the expression profiles we found in vitro. Functional assessment of the neutrophil microparticles subsets demonstrated that in response to direct stimulation neutrophil microparticles produced reactive oxygen species and leukotriene B4 as well as locomoted toward a chemotactic gradient. Finally, we investigated the actions of the two neutrophil microparticles subsets described herein on target cell responses. Microarray analysis with human primary endothelial cells incubated with either microparticle subset revealed a discrete modulation of endothelial cell gene expression profile. These findings demonstrate that neutrophil microparticles are heterogenous and can deliver packaged information propagating the activation status of the parent cell, potentially exerting novel and fundamental roles both under homeostatic and disease conditions. PMID:23660474

  5. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  6. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  7. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  8. Revealing topological organization of human brain functional networks with resting-state functional near infrared spectroscopy.

    Science.gov (United States)

    Niu, Haijing; Wang, Jinhui; Zhao, Tengda; Shu, Ni; He, Yong

    2012-01-01

    The human brain is a highly complex system that can be represented as a structurally interconnected and functionally synchronized network, which assures both the segregation and integration of information processing. Recent studies have demonstrated that a variety of neuroimaging and neurophysiological techniques such as functional magnetic resonance imaging (MRI), diffusion MRI and electroencephalography/magnetoencephalography can be employed to explore the topological organization of human brain networks. However, little is known about whether functional near infrared spectroscopy (fNIRS), a relatively new optical imaging technology, can be used to map functional connectome of the human brain and reveal meaningful and reproducible topological characteristics. We utilized resting-state fNIRS (R-fNIRS) to investigate the topological organization of human brain functional networks in 15 healthy adults. Brain networks were constructed by thresholding the temporal correlation matrices of 46 channels and analyzed using graph-theory approaches. We found that the functional brain network derived from R-fNIRS data had efficient small-world properties, significant hierarchical modular structure and highly connected hubs. These results were highly reproducible both across participants and over time and were consistent with previous findings based on other functional imaging techniques. Our results confirmed the feasibility and validity of using graph-theory approaches in conjunction with optical imaging techniques to explore the topological organization of human brain networks. These results may expand a methodological framework for utilizing fNIRS to study functional network changes that occur in association with development, aging and neurological and psychiatric disorders.

  9. Genome-Wide Association and Functional Follow-Up Reveals New Loci for Kidney Function

    Science.gov (United States)

    Fuchsberger, Christian; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C.; O'Seaghdha, Conall M.; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V.; O'Connell, Jeffrey R.; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D.; Gierman, Hinco J.; Feitosa, Mary; Hwang, Shih-Jen; Atkinson, Elizabeth J.; Lohman, Kurt; Cornelis, Marilyn C.; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Chouraki, Vincent; Holliday, Elizabeth G.; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y.; Murgia, Federico; Trompet, Stella; Imboden, Medea; Kollerits, Barbara; Pistis, Giorgio; Harris, Tamara B.; Launer, Lenore J.; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D.; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank B.; Demirkan, Ayse; Oostra, Ben A.; de Andrade, Mariza; Turner, Stephen T.; Ding, Jingzhong; Andrews, Jeanette S.; Freedman, Barry I.; Koenig, Wolfgang; Illig, Thomas; Döring, Angela; Wichmann, H.-Erich; Kolcic, Ivana; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E.; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H.; Wright, Alan F.; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Endlich, Karlhans; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K.; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G.; Rivadeneira, Fernando; Aulchenko, Yurii S.; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Giulianini, Franco; Krämer, Bernhard K.; Portas, Laura; Ford, Ian; Buckley, Brendan M.; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Metzger, Marie; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K.; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J. Wouter; Probst-Hensch, Nicole M.; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S.; van Duijn, Cornelia M.; Borecki, Ingrid; Kardia, Sharon L. R.; Liu, Yongmei; Curhan, Gary C.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Franke, Andre; Pramstaller, Peter P.; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline C. M.; Hayward, Caroline; Ridker, Paul; Parsa, Afshin; Bochud, Murielle; Heid, Iris M.; Goessling, Wolfram; Chasman, Daniel I.; Kao, W. H. Linda; Fox, Caroline S.

    2012-01-01

    Chronic kidney disease (CKD) is an important public health problem with a genetic component. We performed genome-wide association studies in up to 130,600 European ancestry participants overall, and stratified for key CKD risk factors. We uncovered 6 new loci in association with estimated glomerular filtration rate (eGFR), the primary clinical measure of CKD, in or near MPPED2, DDX1, SLC47A1, CDK12, CASP9, and INO80. Morpholino knockdown of mpped2 and casp9 in zebrafish embryos revealed podocyte and tubular abnormalities with altered dextran clearance, suggesting a role for these genes in renal function. By providing new insights into genes that regulate renal function, these results could further our understanding of the pathogenesis of CKD. PMID:22479191

  10. Genome-wide association and functional follow-up reveals new loci for kidney function.

    Science.gov (United States)

    Pattaro, Cristian; Köttgen, Anna; Teumer, Alexander; Garnaas, Maija; Böger, Carsten A; Fuchsberger, Christian; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Chouraki, Vincent; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Kollerits, Barbara; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank B; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Koenig, Wolfgang; Illig, Thomas; Döring, Angela; Wichmann, H-Erich; Kolcic, Ivana; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Endlich, Karlhans; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Giulianini, Franco; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Metzger, Marie; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline C M; Hayward, Caroline; Ridker, Paul; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Goessling, Wolfram; Chasman, Daniel I; Kao, W H Linda; Fox, Caroline S

    2012-01-01

    Chronic kidney disease (CKD) is an important public health problem with a genetic component. We performed genome-wide association studies in up to 130,600 European ancestry participants overall, and stratified for key CKD risk factors. We uncovered 6 new loci in association with estimated glomerular filtration rate (eGFR), the primary clinical measure of CKD, in or near MPPED2, DDX1, SLC47A1, CDK12, CASP9, and INO80. Morpholino knockdown of mpped2 and casp9 in zebrafish embryos revealed podocyte and tubular abnormalities with altered dextran clearance, suggesting a role for these genes in renal function. By providing new insights into genes that regulate renal function, these results could further our understanding of the pathogenesis of CKD.

  11. Genome-wide association and functional follow-up reveals new loci for kidney function.

    Directory of Open Access Journals (Sweden)

    Cristian Pattaro

    Full Text Available Chronic kidney disease (CKD is an important public health problem with a genetic component. We performed genome-wide association studies in up to 130,600 European ancestry participants overall, and stratified for key CKD risk factors. We uncovered 6 new loci in association with estimated glomerular filtration rate (eGFR, the primary clinical measure of CKD, in or near MPPED2, DDX1, SLC47A1, CDK12, CASP9, and INO80. Morpholino knockdown of mpped2 and casp9 in zebrafish embryos revealed podocyte and tubular abnormalities with altered dextran clearance, suggesting a role for these genes in renal function. By providing new insights into genes that regulate renal function, these results could further our understanding of the pathogenesis of CKD.

  12. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  13. Functional imaging reveals movement preparatory activity in the vegetative state

    Directory of Open Access Journals (Sweden)

    Tristan A Bekinschtein

    2011-01-01

    Full Text Available The Vegetative State (VS is characterized by the absence of awareness of self or the environment and preserved autonomic functions. The diagnosis relies critically on the lack of consistent signs of purposeful behavior in response to external stimulation. Yet, given that patients with disorders of consciousness often exhibit fragmented movement patterns, voluntary actions may go unnoticed. Here we designed a simple motor paradigm that could potentially detect residual conscious awareness in VS patients with mild to severe brain damage by examining the neural correlates of motor preparation in response to verbal commands. Twenty-four patients who met the diagnostic criteria for VS were recruited for this study. Eleven of these patients showing preserved auditory evoked potentials underwent functional magnetic resonance imaging (fMRI to test for basic speech processing. Five of these patients, who showed word related activity, were included in a second fMRI study aimed at detecting functional changes in premotor cortex elicited by specific verbal instructions to move either their left or their right hand. Despite the lack of overt muscle activity, two patients out of five activated the dorsal premotor cortex contralateral to the instructed hand, consistent with movement preparation. Given that movement preparation in response to a motor command is a sign of purposeful behavior, our results are consistent with residual conscious awareness in these patients. We believe that the identification of positive results with fMRI using this simple task, may complement the clinical assessment by helping attain a more precise diagnosis in patients with disorders of consciousness.

  14. Remote synchronization reveals network symmetries and functional modules.

    Science.gov (United States)

    Nicosia, Vincenzo; Valencia, Miguel; Chavez, Mario; Díaz-Guilera, Albert; Latora, Vito

    2013-04-26

    We study a Kuramoto model in which the oscillators are associated with the nodes of a complex network and the interactions include a phase frustration, thus preventing full synchronization. The system organizes into a regime of remote synchronization where pairs of nodes with the same network symmetry are fully synchronized, despite their distance on the graph. We provide analytical arguments to explain this result, and we show how the frustration parameter affects the distribution of phases. An application to brain networks suggests that anatomical symmetry plays a role in neural synchronization by determining correlated functional modules across distant locations.

  15. Comparative genomics of Geobacter chemotaxis genes reveals diverse signaling function

    Directory of Open Access Journals (Sweden)

    Antommattei Frances M

    2008-10-01

    Full Text Available Abstract Background Geobacter species are δ-Proteobacteria and are often the predominant species in a variety of sedimentary environments where Fe(III reduction is important. Their ability to remediate contaminated environments and produce electricity makes them attractive for further study. Cell motility, biofilm formation, and type IV pili all appear important for the growth of Geobacter in changing environments and for electricity production. Recent studies in other bacteria have demonstrated that signaling pathways homologous to the paradigm established for Escherichia coli chemotaxis can regulate type IV pili-dependent motility, the synthesis of flagella and type IV pili, the production of extracellular matrix material, and biofilm formation. The classification of these pathways by comparative genomics improves the ability to understand how Geobacter thrives in natural environments and better their use in microbial fuel cells. Results The genomes of G. sulfurreducens, G. metallireducens, and G. uraniireducens contain multiple (~70 homologs of chemotaxis genes arranged in several major clusters (six, seven, and seven, respectively. Unlike the single gene cluster of E. coli, the Geobacter clusters are not all located near the flagellar genes. The probable functions of some Geobacter clusters are assignable by homology to known pathways; others appear to be unique to the Geobacter sp. and contain genes of unknown function. We identified large numbers of methyl-accepting chemotaxis protein (MCP homologs that have diverse sensing domain architectures and generate a potential for sensing a great variety of environmental signals. We discuss mechanisms for class-specific segregation of the MCPs in the cell membrane, which serve to maintain pathway specificity and diminish crosstalk. Finally, the regulation of gene expression in Geobacter differs from E. coli. The sequences of predicted promoter elements suggest that the alternative sigma factors

  16. Serial functional imaging poststroke reveals visual cortex reorganization.

    Science.gov (United States)

    Brodtmann, Amy; Puce, Aina; Darby, David; Donnan, Geoffrey

    2009-02-01

    Visual cortical reorganization following injury remains poorly understood. The authors performed serial functional magnetic resonance imaging (fMRI) on patients with visual cortex infarction to evaluate early and late striate, ventral, and dorsal extrastriate cortical activation. Patients were studied with fMRI within 10 days and at 6 months. The authors used a high-level visual activation task designed to activate the ventral extrastriate cortex. These data were compared to those of age-appropriate healthy control participants. The results from 24 healthy control individuals (mean age 65.7 +/- SE 3.6 years, range 32-89) were compared to those from 5 stroke patients (mean age 73.8 +/- SE 7 years, range 49-86). Patients had infarcts involving the striate and ventral extrastriate cortex. Patient activation patterns were markedly different to controls. Bilateral striate and ventral extrastriate activation was reduced at both sessions, but dorsal extrastriate activated voxel counts remained comparable to controls. Conversely, mean percent magnetic resonance signal change increased in dorsal sites. These data provide strong evidence of bilateral poststroke functional depression of striate and ventral extrastriate cortices. Possible utilization or surrogacy of the dorsal visual system was demonstrated following stroke. This activity could provide a target for novel visual rehabilitation therapies.

  17. Statistical universals reveal the structures and functions of human music.

    Science.gov (United States)

    Savage, Patrick E; Brown, Steven; Sakai, Emi; Currie, Thomas E

    2015-07-21

    Music has been called "the universal language of mankind." Although contemporary theories of music evolution often invoke various musical universals, the existence of such universals has been disputed for decades and has never been empirically demonstrated. Here we combine a music-classification scheme with statistical analyses, including phylogenetic comparative methods, to examine a well-sampled global set of 304 music recordings. Our analyses reveal no absolute universals but strong support for many statistical universals that are consistent across all nine geographic regions sampled. These universals include 18 musical features that are common individually as well as a network of 10 features that are commonly associated with one another. They span not only features related to pitch and rhythm that are often cited as putative universals but also rarely cited domains including performance style and social context. These cross-cultural structural regularities of human music may relate to roles in facilitating group coordination and cohesion, as exemplified by the universal tendency to sing, play percussion instruments, and dance to simple, repetitive music in groups. Our findings highlight the need for scientists studying music evolution to expand the range of musical cultures and musical features under consideration. The statistical universals we identified represent important candidates for future investigation.

  18. PET imaging reveals brain functional changes in internet gaming disorder

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Mei; Zhang, Ying; Du, Fenglei; Hou, Haifeng; Chao, Fangfang; Zhang, Hong [The Second Hospital of Zhejiang University School of Medicine, Department of Nuclear Medicine, Hangzhou, Zhejiang (China); Key Laboratory of Medical Molecular Imaging of Zhejiang Province, Hangzhou (China); Chen, Qiaozhen [The Second Hospital of Zhejiang University School of Medicine, Department of Nuclear Medicine, Hangzhou, Zhejiang (China); The Second Affiliated Hospital of Zhejiang University School of Medicine, Department of Psychiatry, Hangzhou (China)

    2014-07-15

    Internet gaming disorder is an increasing problem worldwide, resulting in critical academic, social, and occupational impairment. However, the neurobiological mechanism of internet gaming disorder remains unknown. The aim of this study is to assess brain dopamine D{sub 2} (D{sub 2})/Serotonin 2A (5-HT{sub 2A}) receptor function and glucose metabolism in the same subjects by positron emission tomography (PET) imaging approach, and investigate whether the correlation exists between D{sub 2} receptor and glucose metabolism. Twelve drug-naive adult males who met criteria for internet gaming disorder and 14 matched controls were studied with PET and {sup 11}C-N-methylspiperone ({sup 11}C-NMSP) to assess the availability of D{sub 2}/5-HT{sub 2A} receptors and with {sup 18}F-fluoro-D-glucose ({sup 18}F-FDG) to assess regional brain glucose metabolism, a marker of brain function. {sup 11}C-NMSP and {sup 18}F-FDG PET imaging data were acquired in the same individuals under both resting and internet gaming task states. In internet gaming disorder subjects, a significant decrease in glucose metabolism was observed in the prefrontal, temporal, and limbic systems. Dysregulation of D{sub 2} receptors was observed in the striatum, and was correlated to years of overuse. A low level of D{sub 2} receptors in the striatum was significantly associated with decreased glucose metabolism in the orbitofrontal cortex. For the first time, we report the evidence that D{sub 2} receptor level is significantly associated with glucose metabolism in the same individuals with internet gaming disorder, which indicates that D{sub 2}/5-HT{sub 2A} receptor-mediated dysregulation of the orbitofrontal cortex could underlie a mechanism for loss of control and compulsive behavior in internet gaming disorder subjects. (orig.)

  19. PET imaging reveals brain functional changes in internet gaming disorder

    International Nuclear Information System (INIS)

    Tian, Mei; Zhang, Ying; Du, Fenglei; Hou, Haifeng; Chao, Fangfang; Zhang, Hong; Chen, Qiaozhen

    2014-01-01

    Internet gaming disorder is an increasing problem worldwide, resulting in critical academic, social, and occupational impairment. However, the neurobiological mechanism of internet gaming disorder remains unknown. The aim of this study is to assess brain dopamine D 2 (D 2 )/Serotonin 2A (5-HT 2A ) receptor function and glucose metabolism in the same subjects by positron emission tomography (PET) imaging approach, and investigate whether the correlation exists between D 2 receptor and glucose metabolism. Twelve drug-naive adult males who met criteria for internet gaming disorder and 14 matched controls were studied with PET and 11 C-N-methylspiperone ( 11 C-NMSP) to assess the availability of D 2 /5-HT 2A receptors and with 18 F-fluoro-D-glucose ( 18 F-FDG) to assess regional brain glucose metabolism, a marker of brain function. 11 C-NMSP and 18 F-FDG PET imaging data were acquired in the same individuals under both resting and internet gaming task states. In internet gaming disorder subjects, a significant decrease in glucose metabolism was observed in the prefrontal, temporal, and limbic systems. Dysregulation of D 2 receptors was observed in the striatum, and was correlated to years of overuse. A low level of D 2 receptors in the striatum was significantly associated with decreased glucose metabolism in the orbitofrontal cortex. For the first time, we report the evidence that D 2 receptor level is significantly associated with glucose metabolism in the same individuals with internet gaming disorder, which indicates that D 2 /5-HT 2A receptor-mediated dysregulation of the orbitofrontal cortex could underlie a mechanism for loss of control and compulsive behavior in internet gaming disorder subjects. (orig.)

  20. Coherence and Coupling Functions Reveal Microvascular Impairment in Treated Hypertension

    Directory of Open Access Journals (Sweden)

    Valentina Ticcinelli

    2017-10-01

    Full Text Available The complex interactions that give rise to heart rate variability (HRV involve coupled physiological oscillators operating over a wide range of different frequencies and length-scales. Based on the premise that interactions are key to the functioning of complex systems, the time-dependent deterministic coupling parameters underlying cardiac, respiratory and vascular regulation have been investigated at both the central and microvascular levels. Hypertension was considered as an example of a globally altered state of the complex dynamics of the cardiovascular system. Its effects were established through analysis of simultaneous recordings of the electrocardiogram (ECG, respiratory effort, and microvascular blood flow [by laser Doppler flowmetry (LDF]. The signals were analyzed by methods developed to capture time-dependent dynamics, including the wavelet transform, wavelet-based phase coherence, non-linear mode decomposition, and dynamical Bayesian inference, all of which can encompass the inherent frequency and coupling variability of living systems. Phases of oscillatory modes corresponding to the cardiac (around 1.0 Hz, respiratory (around 0.25 Hz, and vascular myogenic activities (around 0.1 Hz were extracted and combined into two coupled networks describing the central and peripheral systems, respectively. The corresponding spectral powers and coupling functions were computed. The same measurements and analyses were performed for three groups of subjects: healthy young (Y group, 24.4 ± 3.4 y, healthy aged (A group, 71.1 ± 6.6 y, and aged treated hypertensive patients (ATH group, 70.3 ± 6.7 y. It was established that the degree of coherence between low-frequency oscillations near 0.1 Hz in blood flow and in HRV time series differs markedly between the groups, declining with age and nearly disappearing in treated hypertension. Comparing the two healthy groups it was found that the couplings to the cardiac rhythm from both respiration and

  1. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  3. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  4. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  5. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    Directory of Open Access Journals (Sweden)

    Alexander M. Brannan

    2015-12-01

    Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

  6. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  7. Inter-species activity correlations reveal functional correspondences between monkey and human brain areas

    Science.gov (United States)

    Mantini, Dante; Hasson, Uri; Betti, Viviana; Perrucci, Mauro G.; Romani, Gian Luca; Corbetta, Maurizio; Orban, Guy A.; Vanduffel, Wim

    2012-01-01

    Evolution-driven functional changes in the primate brain are typically assessed by aligning monkey and human activation maps using cortical surface expansion models. These models use putative homologous areas as registration landmarks, assuming they are functionally correspondent. In cases where functional changes have occurred in an area, this assumption prohibits to reveal whether other areas may have assumed lost functions. Here we describe a method to examine functional correspondences across species. Without making spatial assumptions, we assess similarities in sensory-driven functional magnetic resonance imaging responses between monkey (Macaca mulatta) and human brain areas by means of temporal correlation. Using natural vision data, we reveal regions for which functional processing has shifted to topologically divergent locations during evolution. We conclude that substantial evolution-driven functional reorganizations have occurred, not always consistent with cortical expansion processes. This novel framework for evaluating changes in functional architecture is crucial to building more accurate evolutionary models. PMID:22306809

  8. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  9. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  10. Reconstitution of Protein Translation of Mycobacterium Reveals Functional Conservation and Divergence with the Gram-Negative Bacterium Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Aashish Srivastava

    Full Text Available Protein translation is essential for all bacteria pathogens. It has also been a major focus of structural and functional studies and an important target of antibiotics. Here we report our attempts to biochemically reconstitute mycobacterial protein translation in vitro from purified components. This mycobacterial translation system consists of individually purified recombinant translation factors from Mycobacterium tuberculosis (M. tuberculosis, purified tRNAs and ribosomes from Mycobacterium smegmatis (M. smegmatis, and an aminoacyl-tRNA synthetase (AARS mixture from the cell-extract of M. smegmatis. We demonstrate that such mycobacterial translation system was efficient in in vitro protein synthesis, and enabled functional comparisons of translational components between the gram-positive Mycobacterium and the gram-negative E. coli. Although mycobacterial translation factors and ribosomes were highly compatible with their E. coli counterparts, M. smegmatis tRNAs were not properly charged by the E. coli AARSs to allow efficient translation of a reporter. In contrast, both E. coli and M. smegmatis tRNAs exhibited similar activity with the semi-purified M. smegmatis AARSs mixture for in vitro translation. We further demonstrated the use of both mycobacterial and E. coli translation systems as comparative in vitro assays for small-molecule antibiotics that target protein translation. While mycobacterial and E. coli translation were both inhibited at the same IC50 by the antibiotic spectinomycin, mycobacterial translation was preferentially inhibited by the antibiotic tetracycline, suggesting that there may be structural differences at the antibiotic binding sites between the ribosomes of Mycobacterium and E. coli. Our results illustrate an alternative approach for antibiotic discovery and functional studies of protein translation in mycobacteria and possibly other bacterial pathogens.

  11. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  12. Two Nucleolar Proteins, GDP1 and OLI2, Function As Ribosome Biogenesis Factors and Are Preferentially Involved in Promotion of Leaf Cell Proliferation without Strongly Affecting Leaf Adaxial–Abaxial Patterning in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Koji Kojima

    2018-01-01

    Full Text Available Leaf abaxial–adaxial patterning is dependent on the mutual repression of leaf polarity genes expressed either adaxially or abaxially. In Arabidopsis thaliana, this process is strongly affected by mutations in ribosomal protein genes and in ribosome biogenesis genes in a sensitized genetic background, such as asymmetric leaves2 (as2. Most ribosome-related mutants by themselves do not show leaf abaxialization, and one of their typical phenotypes is the formation of pointed rather than rounded leaves. In this study, we characterized two ribosome-related mutants to understand how ribosome biogenesis is linked to several aspects of leaf development. Previously, we isolated oligocellula2 (oli2 which exhibits the pointed-leaf phenotype and has a cell proliferation defect. OLI2 encodes a homolog of Nop2 in Saccharomyces cerevisiae, a ribosome biogenesis factor involved in pre-60S subunit maturation. In this study, we found another pointed-leaf mutant that carries a mutation in a gene encoding an uncharacterized protein with a G-patch domain. Similar to oli2, this mutant, named g-patch domain protein1 (gdp1, has a reduced number of leaf cells. In addition, gdp1 oli2 double mutants showed a strong genetic interaction such that they synergistically impaired cell proliferation in leaves and produced markedly larger cells. On the other hand, they showed additive phenotypes when combined with several known ribosomal protein mutants. Furthermore, these mutants have a defect in pre-rRNA processing. GDP1 and OLI2 are strongly expressed in tissues with high cell proliferation activity, and GDP1-GFP and GFP-OLI2 are localized in the nucleolus. These results suggest that OLI2 and GDP1 are involved in ribosome biogenesis. We then examined the effects of gdp1 and oli2 on adaxial–abaxial patterning by crossing them with as2. Interestingly, neither gdp1 nor oli2 strongly enhanced the leaf polarity defect of as2. Similar results were obtained with as2 gdp1 oli2

  13. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  14. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  15. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  16. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  17. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  18. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  19. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  20. Functional interactome of Aquaporin 1 sub-family reveals new physiological functions in Arabidopsis Thaliana

    Directory of Open Access Journals (Sweden)

    Mohamed Ragab Abdel Gawwad

    2013-09-01

    Full Text Available Aquaporins are channel proteins found in plasma membranes and intercellular membranes of different cellular compartments, facilitate the water flux, solutes and gases across the cellular plasma membranes. The present study highlights the sub-family plasma membrane intrinsic protein (PIP predicting the 3-D structure and analyzing the functional interactome of it homologs. PIP1 homologs integrate with many proteins with different plant physiological roles in Arabidopsis thaliana including; PIP1A and PIP1B: facilitate the transport of water, diffusion of amino acids and/or peptides from the vacuolar compartment to the cytoplasm, play a role in the control of cell turgor and cell expansion and involved in root water uptake respectively. In addition we found that PIP1B plays a defensive role against Pseudomonas syringae infection through the interaction with the plasma membrane Rps2 protein. Another substantial function of PIP1C via the interaction with PIP2E is the response to nematode infection. Generally, PIP1 sub-family interactome controlling many physiological processes in plant cell like; osmoregulation in plants under high osmotic stress such as under a high salt, response to nematode, facilitate the transport of water across cell membrane and regulation of floral initiation in Arabidopsis thaliana.

  1. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  2. Functional analysis of rice HOMEOBOX4 (Oshox4) gene reveals a negative function in gibberellin responses.

    Science.gov (United States)

    Dai, Mingqiu; Hu, Yongfeng; Ma, Qian; Zhao, Yu; Zhou, Dao-Xiu

    2008-02-01

    The homeodomain-leucine zipper (HD-Zip) putative transcription factor genes are divided into 4 families. In this work, we studied the function of a rice HD-Zip I gene, H OME O BO X4 (Oshox4). Oshox4 transcripts were detected in leaf and floral organ primordia but excluded from the shoot apical meristem and the protein was nuclear localized. Over-expression of Oshox4 in rice induced a semi-dwarf phenotype that could not be complemented by applied GA3. The over-expression plants accumulated elevated levels of bioactive GA, while the GA catabolic gene GA2ox3 was upregulated in the transgenic plants. In addition, over-expression of Oshox4 blocked GA-dependent alpha-amylase production. However, down-regulation of Oshox4 in RNAi transgenic plants induced no phenotypic alteration. Interestingly, the expression of YAB1 that is involved in the negative feedback regulation of the GA biosynthesis was upregulated in the Oshox4 over-expressing plants. One-hybrid assays showed that Oshox4 could interact with YAB1 promoter in yeast. In addition, Oshox4 expression was upregulated by GA. These data together suggest that Oshox4 may be involved in the negative regulation of GA signalling and may play a role to fine tune GA responses in rice.

  3. The radioimmunoassay in revealing preclinical disorders of the pituitary-thyroid system functioning

    International Nuclear Information System (INIS)

    Piven', N.V.; Pilatova, N.L.; Lukhverchik, L.N.; Kuz'menkova, E.I.; Solovej, V.V.; Mokhort, T.V.

    2001-01-01

    The main purpose of this research was to study the value of radioimmunoassay (RIA) for assessing the pituitary - thyroid function in healthy persons (aged 18-45). Quantitative criteria have been worked put for estimation of thyroid gland function for the population of Belarus in accordance with regional ecological situation. On this basis, concentrations of thyrotropin, thyroxine, triiodothyronine, thyroglobulin, thyroxine binding globulin were determined by RIA in blood samples. The analysis of the data obtained revealed latent forms of hyperthyroidism (42%) and hypothyroidism (21%), regarded by the authors as late medical consequences of Chernobyl accident. Subclinical stages were diagnosed in most cases. Thus RIA has proved useful for studying the functional state of the regulatory 'pituitary-thyroid gland' system and revealing prenosological disorders in it

  4. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  5. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    Science.gov (United States)

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

  6. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  7. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  8. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  9. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  10. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  11. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  12. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  13. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  14. Functional redundancy patterns reveal non-random assembly rules in a species-rich marine assemblage.

    Directory of Open Access Journals (Sweden)

    Nicolas Guillemot

    Full Text Available The relationship between species and the functional diversity of assemblages is fundamental in ecology because it contains key information on functional redundancy, and functionally redundant ecosystems are thought to be more resilient, resistant and stable. However, this relationship is poorly understood and undocumented for species-rich coastal marine ecosystems. Here, we used underwater visual censuses to examine the patterns of functional redundancy for one of the most diverse vertebrate assemblages, the coral reef fishes of New Caledonia, South Pacific. First, we found that the relationship between functional and species diversity displayed a non-asymptotic power-shaped curve, implying that rare functions and species mainly occur in highly diverse assemblages. Second, we showed that the distribution of species amongst possible functions was significantly different from a random distribution up to a threshold of ∼90 species/transect. Redundancy patterns for each function further revealed that some functions displayed fast rates of increase in redundancy at low species diversity, whereas others were only becoming redundant past a certain threshold. This suggested non-random assembly rules and the existence of some primordial functions that would need to be fulfilled in priority so that coral reef fish assemblages can gain a basic ecological structure. Last, we found little effect of habitat on the shape of the functional-species diversity relationship and on the redundancy of functions, although habitat is known to largely determine assemblage characteristics such as species composition, biomass, and abundance. Our study shows that low functional redundancy is characteristic of this highly diverse fish assemblage, and, therefore, that even species-rich ecosystems such as coral reefs may be vulnerable to the removal of a few keystone species.

  15. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  16. Genetic Interaction Maps in Escherichia coli Reveal Functional Crosstalk among Cell Envelope Biogenesis Pathways

    Science.gov (United States)

    Vlasblom, James; Gagarinova, Alla; Phanse, Sadhna; Graham, Chris; Yousif, Fouad; Ding, Huiming; Xiong, Xuejian; Nazarians-Armavil, Anaies; Alamgir, Md; Ali, Mehrab; Pogoutse, Oxana; Pe'er, Asaf; Arnold, Roland; Michaut, Magali; Parkinson, John; Golshani, Ashkan; Whitfield, Chris; Wodak, Shoshana J.; Moreno-Hagelsieb, Gabriel; Greenblatt, Jack F.; Emili, Andrew

    2011-01-01

    As the interface between a microbe and its environment, the bacterial cell envelope has broad biological and clinical significance. While numerous biosynthesis genes and pathways have been identified and studied in isolation, how these intersect functionally to ensure envelope integrity during adaptive responses to environmental challenge remains unclear. To this end, we performed high-density synthetic genetic screens to generate quantitative functional association maps encompassing virtually the entire cell envelope biosynthetic machinery of Escherichia coli under both auxotrophic (rich medium) and prototrophic (minimal medium) culture conditions. The differential patterns of genetic interactions detected among >235,000 digenic mutant combinations tested reveal unexpected condition-specific functional crosstalk and genetic backup mechanisms that ensure stress-resistant envelope assembly and maintenance. These networks also provide insights into the global systems connectivity and dynamic functional reorganization of a universal bacterial structure that is both broadly conserved among eubacteria (including pathogens) and an important target. PMID:22125496

  17. Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways.

    Directory of Open Access Journals (Sweden)

    Mohan Babu

    2011-11-01

    Full Text Available As the interface between a microbe and its environment, the bacterial cell envelope has broad biological and clinical significance. While numerous biosynthesis genes and pathways have been identified and studied in isolation, how these intersect functionally to ensure envelope integrity during adaptive responses to environmental challenge remains unclear. To this end, we performed high-density synthetic genetic screens to generate quantitative functional association maps encompassing virtually the entire cell envelope biosynthetic machinery of Escherichia coli under both auxotrophic (rich medium and prototrophic (minimal medium culture conditions. The differential patterns of genetic interactions detected among > 235,000 digenic mutant combinations tested reveal unexpected condition-specific functional crosstalk and genetic backup mechanisms that ensure stress-resistant envelope assembly and maintenance. These networks also provide insights into the global systems connectivity and dynamic functional reorganization of a universal bacterial structure that is both broadly conserved among eubacteria (including pathogens and an important target.

  18. The Chlamydomonas Genome Reveals the Evolution of Key Animal and Plant Functions

    Energy Technology Data Exchange (ETDEWEB)

    Merchant, Sabeeha S

    2007-04-09

    Chlamydomonas reinhardtii is a unicellular green alga whose lineage diverged from land plants over 1 billion years ago. It is a model system for studying chloroplast-based photosynthesis, as well as the structure, assembly, and function of eukaryotic flagella (cilia), which were inherited from the common ancestor of plants and animals, but lost in land plants. We sequenced the 120-megabase nuclear genome of Chlamydomonas and performed comparative phylogenomic analyses, identifying genes encoding uncharacterized proteins that are likely associated with the function and biogenesis of chloroplasts or eukaryotic flagella. Analyses of the Chlamydomonas genome advance our understanding of the ancestral eukaryotic cell, reveal previously unknown genes associated with photosynthetic and flagellar functions, and establish links between ciliopathy and the composition and function of flagella.

  19. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  20. Metatranscriptomic analysis of diverse microbial communities reveals core metabolic pathways and microbiome-specific functionality.

    Science.gov (United States)

    Jiang, Yue; Xiong, Xuejian; Danska, Jayne; Parkinson, John

    2016-01-12

    Metatranscriptomics is emerging as a powerful technology for the functional characterization of complex microbial communities (microbiomes). Use of unbiased RNA-sequencing can reveal both the taxonomic composition and active biochemical functions of a complex microbial community. However, the lack of established reference genomes, computational tools and pipelines make analysis and interpretation of these datasets challenging. Systematic studies that compare data across microbiomes are needed to demonstrate the ability of such pipelines to deliver biologically meaningful insights on microbiome function. Here, we apply a standardized analytical pipeline to perform a comparative analysis of metatranscriptomic data from diverse microbial communities derived from mouse large intestine, cow rumen, kimchi culture, deep-sea thermal vent and permafrost. Sequence similarity searches allowed annotation of 19 to 76% of putative messenger RNA (mRNA) reads, with the highest frequency in the kimchi dataset due to its relatively low complexity and availability of closely related reference genomes. Metatranscriptomic datasets exhibited distinct taxonomic and functional signatures. From a metabolic perspective, we identified a common core of enzymes involved in amino acid, energy and nucleotide metabolism and also identified microbiome-specific pathways such as phosphonate metabolism (deep sea) and glycan degradation pathways (cow rumen). Integrating taxonomic and functional annotations within a novel visualization framework revealed the contribution of different taxa to metabolic pathways, allowing the identification of taxa that contribute unique functions. The application of a single, standard pipeline confirms that the rich taxonomic and functional diversity observed across microbiomes is not simply an artefact of different analysis pipelines but instead reflects distinct environmental influences. At the same time, our findings show how microbiome complexity and availability of

  1. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  2. Core microbial functional activities in ocean environments revealed by global metagenomic profiling analyses.

    Directory of Open Access Journals (Sweden)

    Ari J S Ferreira

    Full Text Available Metagenomics-based functional profiling analysis is an effective means of gaining deeper insight into the composition of marine microbial populations and developing a better understanding of the interplay between the functional genome content of microbial communities and abiotic factors. Here we present a comprehensive analysis of 24 datasets covering surface and depth-related environments at 11 sites around the world's oceans. The complete datasets comprises approximately 12 million sequences, totaling 5,358 Mb. Based on profiling patterns of Clusters of Orthologous Groups (COGs of proteins, a core set of reference photic and aphotic depth-related COGs, and a collection of COGs that are associated with extreme oxygen limitation were defined. Their inferred functions were utilized as indicators to characterize the distribution of light- and oxygen-related biological activities in marine environments. The results reveal that, while light level in the water column is a major determinant of phenotypic adaptation in marine microorganisms, oxygen concentration in the aphotic zone has a significant impact only in extremely hypoxic waters. Phylogenetic profiling of the reference photic/aphotic gene sets revealed a greater variety of source organisms in the aphotic zone, although the majority of individual photic and aphotic depth-related COGs are assigned to the same taxa across the different sites. This increase in phylogenetic and functional diversity of the core aphotic related COGs most probably reflects selection for the utilization of a broad range of alternate energy sources in the absence of light.

  3. Core microbial functional activities in ocean environments revealed by global metagenomic profiling analyses.

    KAUST Repository

    Ferreira, Ari J S

    2014-06-12

    Metagenomics-based functional profiling analysis is an effective means of gaining deeper insight into the composition of marine microbial populations and developing a better understanding of the interplay between the functional genome content of microbial communities and abiotic factors. Here we present a comprehensive analysis of 24 datasets covering surface and depth-related environments at 11 sites around the world\\'s oceans. The complete datasets comprises approximately 12 million sequences, totaling 5,358 Mb. Based on profiling patterns of Clusters of Orthologous Groups (COGs) of proteins, a core set of reference photic and aphotic depth-related COGs, and a collection of COGs that are associated with extreme oxygen limitation were defined. Their inferred functions were utilized as indicators to characterize the distribution of light- and oxygen-related biological activities in marine environments. The results reveal that, while light level in the water column is a major determinant of phenotypic adaptation in marine microorganisms, oxygen concentration in the aphotic zone has a significant impact only in extremely hypoxic waters. Phylogenetic profiling of the reference photic/aphotic gene sets revealed a greater variety of source organisms in the aphotic zone, although the majority of individual photic and aphotic depth-related COGs are assigned to the same taxa across the different sites. This increase in phylogenetic and functional diversity of the core aphotic related COGs most probably reflects selection for the utilization of a broad range of alternate energy sources in the absence of light.

  4. Core microbial functional activities in ocean environments revealed by global metagenomic profiling analyses.

    KAUST Repository

    Ferreira, Ari J S; Siam, Rania; Setubal, Joã o C; Moustafa, Ahmed; Sayed, Ahmed; Chambergo, Felipe S; Dawe, Adam S; Ghazy, Mohamed A; Sharaf, Hazem; Ouf, Amged; Alam, Intikhab; Abdel-Haleem, Alyaa M; Lehvä slaiho, Heikki; Ramadan, Eman; Antunes, André ; Stingl, Ulrich; Archer, John A.C.; Jankovic, Boris R; Sogin, Mitchell; Bajic, Vladimir B.; El-Dorry, Hamza

    2014-01-01

    Metagenomics-based functional profiling analysis is an effective means of gaining deeper insight into the composition of marine microbial populations and developing a better understanding of the interplay between the functional genome content of microbial communities and abiotic factors. Here we present a comprehensive analysis of 24 datasets covering surface and depth-related environments at 11 sites around the world's oceans. The complete datasets comprises approximately 12 million sequences, totaling 5,358 Mb. Based on profiling patterns of Clusters of Orthologous Groups (COGs) of proteins, a core set of reference photic and aphotic depth-related COGs, and a collection of COGs that are associated with extreme oxygen limitation were defined. Their inferred functions were utilized as indicators to characterize the distribution of light- and oxygen-related biological activities in marine environments. The results reveal that, while light level in the water column is a major determinant of phenotypic adaptation in marine microorganisms, oxygen concentration in the aphotic zone has a significant impact only in extremely hypoxic waters. Phylogenetic profiling of the reference photic/aphotic gene sets revealed a greater variety of source organisms in the aphotic zone, although the majority of individual photic and aphotic depth-related COGs are assigned to the same taxa across the different sites. This increase in phylogenetic and functional diversity of the core aphotic related COGs most probably reflects selection for the utilization of a broad range of alternate energy sources in the absence of light.

  5. Modular organization of the white spruce (Picea glauca) transcriptome reveals functional organization and evolutionary signatures.

    Science.gov (United States)

    Raherison, Elie S M; Giguère, Isabelle; Caron, Sébastien; Lamara, Mebarek; MacKay, John J

    2015-07-01

    Transcript profiling has shown the molecular bases of several biological processes in plants but few studies have developed an understanding of overall transcriptome variation. We investigated transcriptome structure in white spruce (Picea glauca), aiming to delineate its modular organization and associated functional and evolutionary attributes. Microarray analyses were used to: identify and functionally characterize groups of co-expressed genes; investigate expressional and functional diversity of vascular tissue preferential genes which were conserved among Picea species, and identify expression networks underlying wood formation. We classified 22 857 genes as variable (79%; 22 coexpression groups) or invariant (21%) by profiling across several vegetative tissues. Modular organization and complex transcriptome restructuring among vascular tissue preferential genes was revealed by their assignment to coexpression groups with partially overlapping profiles and partially distinct functions. Integrated analyses of tissue-based and temporally variable profiles identified secondary xylem gene networks, showed their remodelling over a growing season and identified PgNAC-7 (no apical meristerm (NAM), Arabidopsis transcription activation factor (ATAF) and cup-shaped cotyledon (CUC) transcription factor 007 in Picea glauca) as a major hub gene specific to earlywood formation. Reference profiling identified comprehensive, statistically robust coexpressed groups, revealing that modular organization underpins the evolutionary conservation of the transcriptome structure. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  7. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  8. Neurodegenerative disease mutations in TREM2 reveal a functional surface and distinct loss-of-function mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Kober, Daniel L.; Alexander-Brett, Jennifer M.; Karch, Celeste M.; Cruchaga, Carlos; Colonna, Marco; Holtzman, Michael J.; Brett, Thomas J. (WU-MED)

    2016-12-20

    Genetic variations in the myeloid immune receptor TREM2 are linked to several neurodegenerative diseases. To determine how TREM2 variants contribute to these diseases, we performed structural and functional studies of wild-type and variant proteins. Our 3.1 Å TREM2 crystal structure revealed that mutations found in Nasu-Hakola disease are buried whereas Alzheimer’s disease risk variants are found on the surface, suggesting that these mutations have distinct effects on TREM2 function. Biophysical and cellular methods indicate that Nasu-Hakola mutations impact protein stability and decrease folded TREM2 surface expression, whereas Alzheimer’s risk variants impact binding to a TREM2 ligand. Additionally, the Alzheimer’s risk variants appear to epitope map a functional surface on TREM2 that is unique within the larger TREM family. These findings provide a guide to structural and functional differences among genetic variants of TREM2, indicating that therapies targeting the TREM2 pathway should be tailored to these genetic and functional differences with patient-specific medicine approaches for neurodegenerative disorders.

  9. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  10. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  11. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  12. Dynamic functional connectivity analysis reveals transient states of dysconnectivity in schizophrenia

    Directory of Open Access Journals (Sweden)

    E. Damaraju

    2014-01-01

    Full Text Available Schizophrenia is a psychotic disorder characterized by functional dysconnectivity or abnormal integration between distant brain regions. Recent functional imaging studies have implicated large-scale thalamo-cortical connectivity as being disrupted in patients. However, observed connectivity differences in schizophrenia have been inconsistent between studies, with reports of hyperconnectivity and hypoconnectivity between the same brain regions. Using resting state eyes-closed functional imaging and independent component analysis on a multi-site data that included 151 schizophrenia patients and 163 age- and gender matched healthy controls, we decomposed the functional brain data into 100 components and identified 47 as functionally relevant intrinsic connectivity networks. We subsequently evaluated group differences in functional network connectivity, both in a static sense, computed as the pairwise Pearson correlations between the full network time courses (5.4 minutes in length, and a dynamic sense, computed using sliding windows (44 s in length and k-means clustering to characterize five discrete functional connectivity states. Static connectivity analysis revealed that compared to healthy controls, patients show significantly stronger connectivity, i.e., hyperconnectivity, between the thalamus and sensory networks (auditory, motor and visual, as well as reduced connectivity (hypoconnectivity between sensory networks from all modalities. Dynamic analysis suggests that (1, on average, schizophrenia patients spend much less time than healthy controls in states typified by strong, large-scale connectivity, and (2, that abnormal connectivity patterns are more pronounced during these connectivity states. In particular, states exhibiting cortical–subcortical antagonism (anti-correlations and strong positive connectivity between sensory networks are those that show the group differences of thalamic hyperconnectivity and sensory hypoconnectivity

  13. Individual-based analyses reveal limited functional overlap in a coral reef fish community.

    Science.gov (United States)

    Brandl, Simon J; Bellwood, David R

    2014-05-01

    Detailed knowledge of a species' functional niche is crucial for the study of ecological communities and processes. The extent of niche overlap, functional redundancy and functional complementarity is of particular importance if we are to understand ecosystem processes and their vulnerability to disturbances. Coral reefs are among the most threatened marine systems, and anthropogenic activity is changing the functional composition of reefs. The loss of herbivorous fishes is particularly concerning as the removal of algae is crucial for the growth and survival of corals. Yet, the foraging patterns of the various herbivorous fish species are poorly understood. Using a multidimensional framework, we present novel individual-based analyses of species' realized functional niches, which we apply to a herbivorous coral reef fish community. In calculating niche volumes for 21 species, based on their microhabitat utilization patterns during foraging, and computing functional overlaps, we provide a measurement of functional redundancy or complementarity. Complementarity is the inverse of redundancy and is defined as less than 50% overlap in niche volumes. The analyses reveal extensive complementarity with an average functional overlap of just 15.2%. Furthermore, the analyses divide herbivorous reef fishes into two broad groups. The first group (predominantly surgeonfishes and parrotfishes) comprises species feeding on exposed surfaces and predominantly open reef matrix or sandy substrata, resulting in small niche volumes and extensive complementarity. In contrast, the second group consists of species (predominantly rabbitfishes) that feed over a wider range of microhabitats, penetrating the reef matrix to exploit concealed surfaces of various substratum types. These species show high variation among individuals, leading to large niche volumes, more overlap and less complementarity. These results may have crucial consequences for our understanding of herbivorous processes on

  14. A functional genomics screen in planarians reveals regulators of whole-brain regeneration

    Science.gov (United States)

    Roberts-Galbraith, Rachel H; Brubacher, John L; Newmark, Phillip A

    2016-01-01

    Planarians regenerate all body parts after injury, including the central nervous system (CNS). We capitalized on this distinctive trait and completed a gene expression-guided functional screen to identify factors that regulate diverse aspects of neural regeneration in Schmidtea mediterranea. Our screen revealed molecules that influence neural cell fates, support the formation of a major connective hub, and promote reestablishment of chemosensory behavior. We also identified genes that encode signaling molecules with roles in head regeneration, including some that are produced in a previously uncharacterized parenchymal population of cells. Finally, we explored genes downregulated during planarian regeneration and characterized, for the first time, glial cells in the planarian CNS that respond to injury by repressing several transcripts. Collectively, our studies revealed diverse molecules and cell types that underlie an animal’s ability to regenerate its brain. DOI: http://dx.doi.org/10.7554/eLife.17002.001 PMID:27612384

  15. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  16. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  17. Functional analysis of the zebrafish ortholog of HMGCS1 reveals independent functions for cholesterol and isoprenoids in craniofacial development.

    Directory of Open Access Journals (Sweden)

    Anita M Quintana

    Full Text Available There are 8 different human syndromes caused by mutations in the cholesterol synthesis pathway. A subset of these disorders such as Smith-Lemli-Opitz disorder, are associated with facial dysmorphia. However, the molecular and cellular mechanisms underlying such facial deficits are not fully understood, primarily because of the diverse functions associated with the cholesterol synthesis pathway. Recent evidence has demonstrated that mutation of the zebrafish ortholog of HMGCR results in orofacial clefts. Here we sought to expand upon these data, by deciphering the cholesterol dependent functions of the cholesterol synthesis pathway from the cholesterol independent functions. Moreover, we utilized loss of function analysis and pharmacological inhibition to determine the extent of sonic hedgehog (Shh signaling in animals with aberrant cholesterol and/or isoprenoid synthesis. Our analysis confirmed that mutation of hmgcs1, which encodes the first enzyme in the cholesterol synthesis pathway, results in craniofacial abnormalities via defects in cranial neural crest cell differentiation. Furthermore targeted pharmacological inhibition of the cholesterol synthesis pathway revealed a novel function for isoprenoid synthesis during vertebrate craniofacial development. Mutation of hmgcs1 had no effect on Shh signaling at 2 and 3 days post fertilization (dpf, but did result in a decrease in the expression of gli1, a known Shh target gene, at 4 dpf, after morphological deficits in craniofacial development and chondrocyte differentiation were observed in hmgcs1 mutants. These data raise the possibility that deficiencies in cholesterol modulate chondrocyte differentiation by a combination of Shh independent and Shh dependent mechanisms. Moreover, our results describe a novel function for isoprenoids in facial development and collectively suggest that cholesterol regulates craniofacial development through versatile mechanisms.

  18. Quantitative protein localization signatures reveal an association between spatial and functional divergences of proteins.

    Science.gov (United States)

    Loo, Lit-Hsin; Laksameethanasan, Danai; Tung, Yi-Ling

    2014-03-01

    Protein subcellular localization is a major determinant of protein function. However, this important protein feature is often described in terms of discrete and qualitative categories of subcellular compartments, and therefore it has limited applications in quantitative protein function analyses. Here, we present Protein Localization Analysis and Search Tools (PLAST), an automated analysis framework for constructing and comparing quantitative signatures of protein subcellular localization patterns based on microscopy images. PLAST produces human-interpretable protein localization maps that quantitatively describe the similarities in the localization patterns of proteins and major subcellular compartments, without requiring manual assignment or supervised learning of these compartments. Using the budding yeast Saccharomyces cerevisiae as a model system, we show that PLAST is more accurate than existing, qualitative protein localization annotations in identifying known co-localized proteins. Furthermore, we demonstrate that PLAST can reveal protein localization-function relationships that are not obvious from these annotations. First, we identified proteins that have similar localization patterns and participate in closely-related biological processes, but do not necessarily form stable complexes with each other or localize at the same organelles. Second, we found an association between spatial and functional divergences of proteins during evolution. Surprisingly, as proteins with common ancestors evolve, they tend to develop more diverged subcellular localization patterns, but still occupy similar numbers of compartments. This suggests that divergence of protein localization might be more frequently due to the development of more specific localization patterns over ancestral compartments than the occupation of new compartments. PLAST enables systematic and quantitative analyses of protein localization-function relationships, and will be useful to elucidate protein

  19. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  20. Multivoxel Patterns Reveal Functionally Differentiated Networks Underlying Auditory Feedback Processing of Speech

    DEFF Research Database (Denmark)

    Zheng, Zane Z.; Vicente-Grabovetsky, Alejandro; MacDonald, Ewen N.

    2013-01-01

    The everyday act of speaking involves the complex processes of speech motor control. An important component of control is monitoring, detection, and processing of errors when auditory feedback does not correspond to the intended motor gesture. Here we show, using fMRI and converging operations...... within a multivoxel pattern analysis framework, that this sensorimotor process is supported by functionally differentiated brain networks. During scanning, a real-time speech-tracking system was used to deliver two acoustically different types of distorted auditory feedback or unaltered feedback while...... human participants were vocalizing monosyllabic words, and to present the same auditory stimuli while participants were passively listening. Whole-brain analysis of neural-pattern similarity revealed three functional networks that were differentially sensitive to distorted auditory feedback during...

  1. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  2. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  3. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  4. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  5. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  6. Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

    Science.gov (United States)

    Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

    2011-01-01

    We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

  7. Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

    Directory of Open Access Journals (Sweden)

    Andrew T Kwon

    2011-12-01

    Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

  8. Separable roles of UFO during floral development revealed by conditional restoration of gene function.

    Science.gov (United States)

    Laufs, Patrick; Coen, Enrico; Kronenberger, Jocelyne; Traas, Jan; Doonan, John

    2003-02-01

    The UNUSUAL FLORAL ORGANS (UFO) gene is required for several aspects of floral development in Arabidopsis including specification of organ identity in the second and third whorls and the proper pattern of primordium initiation in the inner three whorls. UFO is expressed in a dynamic pattern during the early phases of flower development. Here we dissect the role of UFO by ubiquitously expressing it in ufo loss-of-function flowers at different developmental stages and for various durations using an ethanol-inducible expression system. The previously known functions of UFO could be separated and related to its expression at specific stages of development. We show that a 24- to 48-hour period of UFO expression from floral stage 2, before any floral organs are visible, is sufficient to restore normal petal and stamen development. The earliest requirement for UFO is during stage 2, when the endogenous UFO gene is transiently expressed in the centre of the wild-type flower and is required to specify the initiation patterns of petal, stamen and carpel primordia. Petal and stamen identity is determined during stages 2 or 3, when UFO is normally expressed in the presumptive second and third whorl. Although endogenous UFO expression is absent from the stamen whorl from stage 4 onwards, stamen identity can be restored by UFO activation up to stage 6. We also observed floral phenotypes not observed in loss-of-function or constitutive gain-of-function backgrounds, revealing additional roles of UFO in outgrowth of petal primordia.

  9. Analyses of soil microbial community compositions and functional genes reveal potential consequences of natural forest succession.

    Science.gov (United States)

    Cong, Jing; Yang, Yunfeng; Liu, Xueduan; Lu, Hui; Liu, Xiao; Zhou, Jizhong; Li, Diqiang; Yin, Huaqun; Ding, Junjun; Zhang, Yuguang

    2015-05-06

    The succession of microbial community structure and function is a central ecological topic, as microbes drive the Earth's biogeochemical cycles. To elucidate the response and mechanistic underpinnings of soil microbial community structure and metabolic potential relevant to natural forest succession, we compared soil microbial communities from three adjacent natural forests: a coniferous forest (CF), a mixed broadleaf forest (MBF) and a deciduous broadleaf forest (DBF) on Shennongjia Mountain in central China. In contrary to plant communities, the microbial taxonomic diversity of the DBF was significantly (P the DBF. Furthermore, a network analysis of microbial carbon and nitrogen cycling genes showed the network for the DBF samples was relatively large and tight, revealing strong couplings between microbes. Soil temperature, reflective of climate regimes, was important in shaping microbial communities at both taxonomic and functional gene levels. As a first glimpse of both the taxonomic and functional compositions of soil microbial communities, our results suggest that microbial community structure and function potentials will be altered by future environmental changes, which have implications for forest succession.

  10. Global Analysis of the Fungal Microbiome in Cystic Fibrosis Patients Reveals Loss of Function of the Transcriptional Repressor Nrg1 as a Mechanism of Pathogen Adaptation.

    Science.gov (United States)

    Kim, Sang Hu; Clark, Shawn T; Surendra, Anuradha; Copeland, Julia K; Wang, Pauline W; Ammar, Ron; Collins, Cathy; Tullis, D Elizabeth; Nislow, Corey; Hwang, David M; Guttman, David S; Cowen, Leah E

    2015-11-01

    The microbiome shapes diverse facets of human biology and disease, with the importance of fungi only beginning to be appreciated. Microbial communities infiltrate diverse anatomical sites as with the respiratory tract of healthy humans and those with diseases such as cystic fibrosis, where chronic colonization and infection lead to clinical decline. Although fungi are frequently recovered from cystic fibrosis patient sputum samples and have been associated with deterioration of lung function, understanding of species and population dynamics remains in its infancy. Here, we coupled high-throughput sequencing of the ribosomal RNA internal transcribed spacer 1 (ITS1) with phenotypic and genotypic analyses of fungi from 89 sputum samples from 28 cystic fibrosis patients. Fungal communities defined by sequencing were concordant with those defined by culture-based analyses of 1,603 isolates from the same samples. Different patients harbored distinct fungal communities. There were detectable trends, however, including colonization with Candida and Aspergillus species, which was not perturbed by clinical exacerbation or treatment. We identified considerable inter- and intra-species phenotypic variation in traits important for host adaptation, including antifungal drug resistance and morphogenesis. While variation in drug resistance was largely between species, striking variation in morphogenesis emerged within Candida species. Filamentation was uncoupled from inducing cues in 28 Candida isolates recovered from six patients. The filamentous isolates were resistant to the filamentation-repressive effects of Pseudomonas aeruginosa, implicating inter-kingdom interactions as the selective force. Genome sequencing revealed that all but one of the filamentous isolates harbored mutations in the transcriptional repressor NRG1; such mutations were necessary and sufficient for the filamentous phenotype. Six independent nrg1 mutations arose in Candida isolates from different patients

  11. Global Analysis of the Fungal Microbiome in Cystic Fibrosis Patients Reveals Loss of Function of the Transcriptional Repressor Nrg1 as a Mechanism of Pathogen Adaptation.

    Directory of Open Access Journals (Sweden)

    Sang Hu Kim

    2015-11-01

    Full Text Available The microbiome shapes diverse facets of human biology and disease, with the importance of fungi only beginning to be appreciated. Microbial communities infiltrate diverse anatomical sites as with the respiratory tract of healthy humans and those with diseases such as cystic fibrosis, where chronic colonization and infection lead to clinical decline. Although fungi are frequently recovered from cystic fibrosis patient sputum samples and have been associated with deterioration of lung function, understanding of species and population dynamics remains in its infancy. Here, we coupled high-throughput sequencing of the ribosomal RNA internal transcribed spacer 1 (ITS1 with phenotypic and genotypic analyses of fungi from 89 sputum samples from 28 cystic fibrosis patients. Fungal communities defined by sequencing were concordant with those defined by culture-based analyses of 1,603 isolates from the same samples. Different patients harbored distinct fungal communities. There were detectable trends, however, including colonization with Candida and Aspergillus species, which was not perturbed by clinical exacerbation or treatment. We identified considerable inter- and intra-species phenotypic variation in traits important for host adaptation, including antifungal drug resistance and morphogenesis. While variation in drug resistance was largely between species, striking variation in morphogenesis emerged within Candida species. Filamentation was uncoupled from inducing cues in 28 Candida isolates recovered from six patients. The filamentous isolates were resistant to the filamentation-repressive effects of Pseudomonas aeruginosa, implicating inter-kingdom interactions as the selective force. Genome sequencing revealed that all but one of the filamentous isolates harbored mutations in the transcriptional repressor NRG1; such mutations were necessary and sufficient for the filamentous phenotype. Six independent nrg1 mutations arose in Candida isolates from

  12. The phosphoproteome of Aspergillus nidulans reveals functional association with cellular processes involved in morphology and secretion.

    Science.gov (United States)

    Ramsubramaniam, Nikhil; Harris, Steven D; Marten, Mark R

    2014-11-01

    We describe the first phosphoproteome of the model filamentous fungus Aspergillus nidulans. Phosphopeptides were enriched using titanium dioxide, separated using a convenient ultra-long reverse phase gradient, and identified using a "high-high" strategy (high mass accuracy on the parent and fragment ions) with higher-energy collisional dissociation. Using this approach 1801 phosphosites, from 1637 unique phosphopeptides, were identified. Functional classification revealed phosphoproteins were overrepresented under GO categories related to fungal morphogenesis: "sites of polar growth," "vesicle mediated transport," and "cytoskeleton organization." In these same GO categories, kinase-substrate analysis of phosphoproteins revealed the majority were target substrates of CDK and CK2 kinase families, indicating these kinase families play a prominent role in fungal morphogenesis. Kinase-substrate analysis also identified 57 substrates for kinases known to regulate secretion of hydrolytic enzymes (e.g. PkaA, SchA, and An-Snf1). Altogether this data will serve as a benchmark that can be used to elucidate regulatory networks functionally associated with fungal morphogenesis and secretion. All MS data have been deposited in the ProteomeXchange with identifier PXD000715 (http://proteomecentral.proteomexchange.org/dataset/PXD000715). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  14. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  15. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  17. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  18. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  19. Metabolomics analysis reveals the metabolic and functional roles of flavonoids in light-sensitive tea leaves.

    Science.gov (United States)

    Zhang, Qunfeng; Liu, Meiya; Ruan, Jianyun

    2017-03-20

    As the predominant secondary metabolic pathway in tea plants, flavonoid biosynthesis increases with increasing temperature and illumination. However, the concentration of most flavonoids decreases greatly in light-sensitive tea leaves when they are exposed to light, which further improves tea quality. To reveal the metabolism and potential functions of flavonoids in tea leaves, a natural light-sensitive tea mutant (Huangjinya) cultivated under different light conditions was subjected to metabolomics analysis. The results showed that chlorotic tea leaves accumulated large amounts of flavonoids with ortho-dihydroxylated B-rings (e.g., catechin gallate, quercetin and its glycosides etc.), whereas total flavonoids (e.g., myricetrin glycoside, epigallocatechin gallate etc.) were considerably reduced, suggesting that the flavonoid components generated from different metabolic branches played different roles in tea leaves. Furthermore, the intracellular localization of flavonoids and the expression pattern of genes involved in secondary metabolic pathways indicate a potential photoprotective function of dihydroxylated flavonoids in light-sensitive tea leaves. Our results suggest that reactive oxygen species (ROS) scavenging and the antioxidation effects of flavonoids help chlorotic tea plants survive under high light stress, providing new evidence to clarify the functional roles of flavonoids, which accumulate to high levels in tea plants. Moreover, flavonoids with ortho-dihydroxylated B-rings played a greater role in photo-protection to improve the acclimatization of tea plants.

  20. Comparative expression profiling reveals gene functions in female meiosis and gametophyte development in Arabidopsis.

    Science.gov (United States)

    Zhao, Lihua; He, Jiangman; Cai, Hanyang; Lin, Haiyan; Li, Yanqiang; Liu, Renyi; Yang, Zhenbiao; Qin, Yuan

    2014-11-01

    Megasporogenesis is essential for female fertility, and requires the accomplishment of meiosis and the formation of functional megaspores. The inaccessibility and low abundance of female meiocytes make it particularly difficult to elucidate the molecular basis underlying megasporogenesis. We used high-throughput tag-sequencing analysis to identify genes expressed in female meiocytes (FMs) by comparing gene expression profiles from wild-type ovules undergoing megasporogenesis with those from the spl mutant ovules, which lack megasporogenesis. A total of 862 genes were identified as FMs, with levels that are consistently reduced in spl ovules in two biological replicates. Fluorescence-assisted cell sorting followed by RNA-seq analysis of DMC1:GFP-labeled female meiocytes confirmed that 90% of the FMs are indeed detected in the female meiocyte protoplast profiling. We performed reverse genetic analysis of 120 candidate genes and identified four FM genes with a function in female meiosis progression in Arabidopsis. We further revealed that KLU, a putative cytochrome P450 monooxygenase, is involved in chromosome pairing during female meiosis, most likely by affecting the normal expression pattern of DMC1 in ovules during female meiosis. Our studies provide valuable information for functional genomic analyses of plant germline development as well as insights into meiosis. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  1. Edge reconstruction in armchair phosphorene nanoribbons revealed by discontinuous Galerkin density functional theory.

    Science.gov (United States)

    Hu, Wei; Lin, Lin; Yang, Chao

    2015-12-21

    With the help of our recently developed massively parallel DGDFT (Discontinuous Galerkin Density Functional Theory) methodology, we perform large-scale Kohn-Sham density functional theory calculations on phosphorene nanoribbons with armchair edges (ACPNRs) containing a few thousands to ten thousand atoms. The use of DGDFT allows us to systematically achieve a conventional plane wave basis set type of accuracy, but with a much smaller number (about 15) of adaptive local basis (ALB) functions per atom for this system. The relatively small number of degrees of freedom required to represent the Kohn-Sham Hamiltonian, together with the use of the pole expansion the selected inversion (PEXSI) technique that circumvents the need to diagonalize the Hamiltonian, results in a highly efficient and scalable computational scheme for analyzing the electronic structures of ACPNRs as well as their dynamics. The total wall clock time for calculating the electronic structures of large-scale ACPNRs containing 1080-10,800 atoms is only 10-25 s per self-consistent field (SCF) iteration, with accuracy fully comparable to that obtained from conventional planewave DFT calculations. For the ACPNR system, we observe that the DGDFT methodology can scale to 5000-50,000 processors. We use DGDFT based ab initio molecular dynamics (AIMD) calculations to study the thermodynamic stability of ACPNRs. Our calculations reveal that a 2 × 1 edge reconstruction appears in ACPNRs at room temperature.

  2. Reliable and rapid characterization of functional FCN2 gene variants reveals diverse geographical patterns

    Directory of Open Access Journals (Sweden)

    Ojurongbe Olusola

    2012-05-01

    Full Text Available Abstract Background Ficolin-2 coded by FCN2 gene is a soluble serum protein and an innate immune recognition element of the complement system. FCN2 gene polymorphisms reveal distinct geographical patterns and are documented to alter serum ficolin levels and modulate disease susceptibility. Methods We employed a real-time PCR based on Fluorescence Resonance Energy Transfer (FRET method to genotype four functional SNPs including -986 G > A (#rs3124952, -602 G > A (#rs3124953, -4A > G (#rs17514136 and +6424 G > T (#rs7851696 in the ficolin-2 (FCN2 gene. We characterized the FCN2 variants in individuals representing Brazilian (n = 176, Nigerian (n = 180, Vietnamese (n = 172 and European Caucasian ethnicity (n = 165. Results We observed that the genotype distribution of three functional SNP variants (−986 G > A, -602 G > A and -4A > G differ significantly between the populations investigated (p p  Conclusions The observed distribution of the FCN2 functional SNP variants may likely contribute to altered serum ficolin levels and this may depend on the different disease settings in world populations. To conclude, the use of FRET based real-time PCR especially for FCN2 gene will benefit a larger scientific community who extensively depend on rapid, reliable method for FCN2 genotyping.

  3. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  4. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  5. Structure of Prokaryotic Polyamine Deacetylase Reveals Evolutionary Functional Relationships with Eukaryotic Histone Deacetylases

    Energy Technology Data Exchange (ETDEWEB)

    P Lombardi; H Angell; D Whittington; E Flynn; K Rajashankar; D Christianson

    2011-12-31

    Polyamines are a ubiquitous class of polycationic small molecules that can influence gene expression by binding to nucleic acids. Reversible polyamine acetylation regulates nucleic acid binding and is required for normal cell cycle progression and proliferation. Here, we report the structures of Mycoplana ramosa acetylpolyamine amidohydrolase (APAH) complexed with a transition state analogue and a hydroxamate inhibitor and an inactive mutant complexed with two acetylpolyamine substrates. The structure of APAH is the first of a histone deacetylase-like oligomer and reveals that an 18-residue insert in the L2 loop promotes dimerization and the formation of an 18 {angstrom} long 'L'-shaped active site tunnel at the dimer interface, accessible only to narrow and flexible substrates. The importance of dimerization for polyamine deacetylase function leads to the suggestion that a comparable dimeric or double-domain histone deacetylase could catalyze polyamine deacetylation reactions in eukaryotes.

  6. Sparse genetic tracing reveals regionally specific functional organization of mammalian nociceptors.

    Science.gov (United States)

    Olson, William; Abdus-Saboor, Ishmail; Cui, Lian; Burdge, Justin; Raabe, Tobias; Ma, Minghong; Luo, Wenqin

    2017-10-12

    The human distal limbs have a high spatial acuity for noxious stimuli but a low density of pain-sensing neurites. To elucidate mechanisms underlying regional differences in processing nociception, we sparsely traced non-peptidergic nociceptors across the body using a newly generated Mrgprd CreERT2 mouse line. We found that mouse plantar paw skin is also innervated by a low density of Mrgprd + nociceptors, while individual arbors in different locations are comparable in size. Surprisingly, the central arbors of plantar paw and trunk innervating nociceptors have distinct morphologies in the spinal cord. This regional difference is well correlated with a heightened signal transmission for plantar paw circuits, as revealed by both spinal cord slice recordings and behavior assays. Taken together, our results elucidate a novel somatotopic functional organization of the mammalian pain system and suggest that regional central arbor structure could facilitate the "enlarged representation" of plantar paw regions in the CNS.

  7. Revealing the functions of the transketolase enzyme isoforms in Rhodopseudomonas palustris using a systems biology approach.

    Directory of Open Access Journals (Sweden)

    Chia-Wei Hu

    Full Text Available BACKGROUND: Rhodopseudomonas palustris (R. palustris is a purple non-sulfur anoxygenic phototrophic bacterium that belongs to the class of proteobacteria. It is capable of absorbing atmospheric carbon dioxide and converting it to biomass via the process of photosynthesis and the Calvin-Benson-Bassham (CBB cycle. Transketolase is a key enzyme involved in the CBB cycle. Here, we reveal the functions of transketolase isoforms I and II in R. palustris using a systems biology approach. METHODOLOGY/PRINCIPAL FINDINGS: By measuring growth ability, we found that transketolase could enhance the autotrophic growth and biomass production of R. palustris. Microarray and real-time quantitative PCR revealed that transketolase isoforms I and II were involved in different carbon metabolic pathways. In addition, immunogold staining demonstrated that the two transketolase isoforms had different spatial localizations: transketolase I was primarily associated with the intracytoplasmic membrane (ICM but transketolase II was mostly distributed in the cytoplasm. Comparative proteomic analysis and network construction of transketolase over-expression and negative control (NC strains revealed that protein folding, transcriptional regulation, amino acid transport and CBB cycle-associated carbon metabolism were enriched in the transketolase I over-expressed strain. In contrast, ATP synthesis, carbohydrate transport, glycolysis-associated carbon metabolism and CBB cycle-associated carbon metabolism were enriched in the transketolase II over-expressed strain. Furthermore, ATP synthesis assays showed a significant increase in ATP synthesis in the transketolase II over-expressed strain. A PEPCK activity assay showed that PEPCK activity was higher in transketolase over-expressed strains than in the negative control strain. CONCLUSIONS/SIGNIFICANCE: Taken together, our results indicate that the two isoforms of transketolase in R. palustris could affect photoautotrophic growth

  8. Cell array-based intracellular localization screening reveals novel functional features of human chromosome 21 proteins

    Directory of Open Access Journals (Sweden)

    Kahlem Pascal

    2006-06-01

    Full Text Available Abstract Background Trisomy of human chromosome 21 (Chr21 results in Down's syndrome, a complex developmental and neurodegenerative disease. Molecular analysis of Down's syndrome, however, poses a particular challenge, because the aneuploid region of Chr21 contains many genes of unknown function. Subcellular localization of human Chr21 proteins may contribute to further understanding of the functions and regulatory mechanisms of the genes that code for these proteins. Following this idea, we used a transfected-cell array technique to perform a rapid and cost-effective analysis of the intracellular distribution of Chr 21 proteins. Results We chose 89 genes that were distributed over the majority of 21q, ranging from RBM11 (14.5 Mb to MCM3AP (46.6 Mb, with part of them expressed aberrantly in the Down's syndrome mouse model. Open reading frames of these genes were cloned into a mammalian expression vector with an amino-terminal His6 tag. All of the constructs were arrayed on glass slides and reverse transfected into HEK293T cells for protein expression. Co-localization detection using a set of organelle markers was carried out for each Chr21 protein. Here, we report the subcellular localization properties of 52 proteins. For 34 of these proteins, their localization is described for the first time. Furthermore, the alteration in cell morphology and growth as a result of protein over-expression for claudin-8 and claudin-14 genes has been characterized. Conclusion The cell array-based protein expression and detection approach is a cost-effective platform for large-scale functional analyses, including protein subcellular localization and cell phenotype screening. The results from this study reveal novel functional features of human Chr21 proteins, which should contribute to further understanding of the molecular pathology of Down's syndrome.

  9. Master stability functions reveal diffusion-driven pattern formation in networks

    Science.gov (United States)

    Brechtel, Andreas; Gramlich, Philipp; Ritterskamp, Daniel; Drossel, Barbara; Gross, Thilo

    2018-03-01

    We study diffusion-driven pattern formation in networks of networks, a class of multilayer systems, where different layers have the same topology, but different internal dynamics. Agents are assumed to disperse within a layer by undergoing random walks, while they can be created or destroyed by reactions between or within a layer. We show that the stability of homogeneous steady states can be analyzed with a master stability function approach that reveals a deep analogy between pattern formation in networks and pattern formation in continuous space. For illustration, we consider a generalized model of ecological meta-food webs. This fairly complex model describes the dispersal of many different species across a region consisting of a network of individual habitats while subject to realistic, nonlinear predator-prey interactions. In this example, the method reveals the intricate dependence of the dynamics on the spatial structure. The ability of the proposed approach to deal with this fairly complex system highlights it as a promising tool for ecology and other applications.

  10. Metagenomic analysis reveals that modern microbialites and polar microbial mats have similar taxonomic and functional potential

    Directory of Open Access Journals (Sweden)

    Richard Allen White III

    2015-09-01

    Full Text Available Within the subarctic climate of Clinton Creek, Yukon, Canada, lies an abandoned and flooded open-pit asbestos mine that harbors rapidly growing microbialites. To understand their formation we completed a metagenomic community profile of the microbialites and their surrounding sediments. Assembled metagenomic data revealed that bacteria within the phylum Proteobacteria numerically dominated this system, although the relative abundances of taxa within the phylum varied among environments. Bacteria belonging to Alphaproteobacteria and Gammaproteobacteria were dominant in the microbialites and sediments, respectively. The microbialites were also home to many other groups associated with microbialite formation including filamentous cyanobacteria and dissimilatory sulfate-reducing Deltaproteobacteria, consistent with the idea of a shared global microbialite microbiome. Other members were present that are typically not associated with microbialites including Gemmatimonadetes and iron-oxidizing Betaproteobacteria, which participate in carbon metabolism and iron cycling. Compared to the sediments, the microbialite microbiome has significantly more genes associated with photosynthetic processes (e.g., photosystem II reaction centers, carotenoid and chlorophyll biosynthesis and carbon fixation (e.g., CO dehydrogenase. The Clinton Creek microbialite communities had strikingly similar functional potentials to non-lithifying microbial mats from the Canadian High Arctic and Antarctica, but are functionally distinct, from non-lithifying mats or biofilms from Yellowstone. Clinton Creek microbialites also share metabolic genes (R2 0.900. These metagenomic profiles from an anthropogenic microbialite-forming ecosystem provide context to microbialite formation on a human-relevant timescale.

  11. Form and function relationships revealed by long-term research in a semiarid mountain catchment

    Science.gov (United States)

    McNamara, J. P.; Benner, S. G.; Chandler, D. G.; Flores, A. N.; Marshall, H. P.; Seyfried, M. S.; Poulos, M. J.; Pierce, J. L.

    2017-12-01

    Fifteen years of cumulative research in the Dry Creek Experimental Watershed in southwest Idaho, USA has revealed relationships between catchment form and function and contributed to improved fundamental understanding of Critical Zone structure, function, and evolution that would not have been possible through independent short term projects alone. The impacts of aspect and elevation on incident energy and water, coupled with climate seasonality, has produced tightly connected landforms properties and hydrologic processes. North-facing hillslopes have steeper slopes, thicker soil mantles, and finer soil texture than their south-facing counterparts. Finer soils enable higher water holding capacities on north facing slopes, which when coupled with thicker soils produces higher soil water storage capacity. The storage of water first as snow, then as soil moisture determines how upland ecosystems survive the seasonal and persistent water stress that happens each year, and sustains streamflow throughout the year. The cumulative body of local knowledge has improved general understanding of catchment science, serves as a resource for developing, evaluating, and improving conceptual and numerical of process-based models, and for data-driven hydrologic education.

  12. MOBIUS-STRIP-LIKE COLUMNAR FUNCTIONAL CONNECTIONS ARE REVEALED IN SOMATO-SENSORY RECEPTIVE FIELD CENTROIDS.

    Directory of Open Access Journals (Sweden)

    James Joseph Wright

    2014-10-01

    Full Text Available Receptive fields of neurons in the forelimb region of areas 3b and 1 of primary somatosensory cortex, in cats and monkeys, were mapped using extracellular recordings obtained sequentially from nearly radial penetrations. Locations of the field centroids indicated the presence of a functional system, in which cortical homotypic representations of the limb surfaces are entwined in three-dimensional Mobius-strip-like patterns of synaptic connections. Boundaries of somatosensory receptive field in nested groups irregularly overlie the centroid order, and are interpreted as arising from the superposition of learned connections upon the embryonic order. Since the theory of embryonic synaptic self-organisation used to model these results was devised and earlier used to explain findings in primary visual cortex, the present findings suggest the theory may be of general application throughout cortex, and may reveal a modular functional synaptic system, which, only in some parts of the cortex, and in some species, is manifest as anatomical ordering into columns.

  13. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  14. Proteomic Profiling in the Brain of CLN1 Disease Model Reveals Affected Functional Modules.

    Science.gov (United States)

    Tikka, Saara; Monogioudi, Evanthia; Gotsopoulos, Athanasios; Soliymani, Rabah; Pezzini, Francesco; Scifo, Enzo; Uusi-Rauva, Kristiina; Tyynelä, Jaana; Baumann, Marc; Jalanko, Anu; Simonati, Alessandro; Lalowski, Maciej

    2016-03-01

    Neuronal ceroid lipofuscinoses (NCL) are the most commonly inherited progressive encephalopathies of childhood. Pathologically, they are characterized by endolysosomal storage with different ultrastructural features and biochemical compositions. The molecular mechanisms causing progressive neurodegeneration and common molecular pathways linking expression of different NCL genes are largely unknown. We analyzed proteome alterations in the brains of a mouse model of human infantile CLN1 disease-palmitoyl-protein thioesterase 1 (Ppt1) gene knockout and its wild-type age-matched counterpart at different stages: pre-symptomatic, symptomatic and advanced. For this purpose, we utilized a combination of laser capture microdissection-based quantitative liquid chromatography tandem mass spectrometry (MS) and matrix-assisted laser desorption/ionization time-of-flight MS imaging to quantify/visualize the changes in protein expression in disease-affected brain thalamus and cerebral cortex tissue slices, respectively. Proteomic profiling of the pre-symptomatic stage thalamus revealed alterations mostly in metabolic processes and inhibition of various neuronal functions, i.e., neuritogenesis. Down-regulation in dynamics associated with growth of plasma projections and cellular protrusions was further corroborated by findings from RNA sequencing of CLN1 patients' fibroblasts. Changes detected at the symptomatic stage included: mitochondrial functions, synaptic vesicle transport, myelin proteome and signaling cascades, such as RhoA signaling. Considerable dysregulation of processes related to mitochondrial cell death, RhoA/Huntington's disease signaling and myelin sheath breakdown were observed at the advanced stage of the disease. The identified changes in protein levels were further substantiated by bioinformatics and network approaches, immunohistochemistry on brain tissues and literature knowledge, thus identifying various functional modules affected in the CLN1 childhood

  15. Revealing the functional neuroanatomy of intrinsic alertness using fMRI: methodological peculiarities.

    Science.gov (United States)

    Clemens, Benjamin; Zvyagintsev, Mikhail; Sack, Alexander T; Sack, Alexander; Heinecke, Armin; Willmes, Klaus; Sturm, Walter

    2011-01-01

    Clinical observations and neuroimaging data revealed a right-hemisphere fronto-parietal-thalamic-brainstem network for intrinsic alertness, and additional left fronto-parietal activity during phasic alertness. The primary objective of this fMRI study was to map the functional neuroanatomy of intrinsic alertness as precisely as possible in healthy participants, using a novel assessment paradigm already employed in clinical settings. Both the paradigm and the experimental design were optimized to specifically assess intrinsic alertness, while at the same time controlling for sensory-motor processing. The present results suggest that the processing of intrinsic alertness is accompanied by increased activity within the brainstem, thalamus, anterior cingulate gyrus, right insula, and right parietal cortex. Additionally, we found increased activation in the left hemisphere around the middle frontal gyrus (BA 9), the insula, the supplementary motor area, and the cerebellum. Our results further suggest that rather minute aspects of the experimental design may induce aspects of phasic alertness, which in turn might lead to additional brain activation in left-frontal areas not normally involved in intrinsic alertness. Accordingly, left BA 9 activation may be related to co-activation of the phasic alertness network due to the switch between rest and task conditions functioning as an external warning cue triggering the phasic alertness network. Furthermore, activation of the intrinsic alertness network during fixation blocks due to enhanced expectancy shortly before the switch to the task block might, when subtracted from the task block, lead to diminished activation in the typical right hemisphere intrinsic alertness network. Thus, we cautiously suggest that--as a methodological artifact--left frontal activations might show up due to phasic alertness involvement and intrinsic alertness activations might be weakened due to contrasting with fixation blocks, when assessing the

  16. Metagenomics, metatranscriptomics and single cell genomics reveal functional response of active Oceanospirillales to Gulf oil spill

    Energy Technology Data Exchange (ETDEWEB)

    Mason, Olivia U.; Hazen, Terry C.; Borglin, Sharon; Chain, Patrick S. G.; Dubinsky, Eric A.; Fortney, Julian L.; Han, James; Holman, Hoi-Ying N.; Hultman, Jenni; Lamendella, Regina; Mackelprang, Rachel; Malfatti, Stephanie; Tom, Lauren M.; Tringe, Susannah G.; Woyke, Tanja; Zhou, Jizhong; Rubin, Edward M.; Jansson, Janet K.

    2012-06-12

    The Deepwater Horizon oil spill in the Gulf of Mexico resulted in a deep-sea hydrocarbon plume that caused a shift in the indigenous microbial community composition with unknown ecological consequences. Early in the spill history, a bloom of uncultured, thus uncharacterized, members of the Oceanospirillales was previously detected, but their role in oil disposition was unknown. Here our aim was to determine the functional role of the Oceanospirillales and other active members of the indigenous microbial community using deep sequencing of community DNA and RNA, as well as single-cell genomics. Shotgun metagenomic and metatranscriptomic sequencing revealed that genes for motility, chemotaxis and aliphatic hydrocarbon degradation were significantly enriched and expressed in the hydrocarbon plume samples compared with uncontaminated seawater collected from plume depth. In contrast, although genes coding for degradation of more recalcitrant compounds, such as benzene, toluene, ethylbenzene, total xylenes and polycyclic aromatic hydrocarbons, were identified in the metagenomes, they were expressed at low levels, or not at all based on analysis of the metatranscriptomes. Isolation and sequencing of two Oceanospirillales single cells revealed that both cells possessed genes coding for n-alkane and cycloalkane degradation. Specifically, the near-complete pathway for cyclohexane oxidation in the Oceanospirillales single cells was elucidated and supported by both metagenome and metatranscriptome data. The draft genome also included genes for chemotaxis, motility and nutrient acquisition strategies that were also identified in the metagenomes and metatranscriptomes. These data point towards a rapid response of members of the Oceanospirillales to aliphatic hydrocarbons in the deep sea.

  17. Functional proteomic analyses of Bothrops atrox venom reveals phenotypes associated with habitat variation in the Amazon.

    Science.gov (United States)

    Sousa, Leijiane F; Portes-Junior, José A; Nicolau, Carolina A; Bernardoni, Juliana L; Nishiyama, Milton Y; Amazonas, Diana R; Freitas-de-Sousa, Luciana A; Mourão, Rosa Hv; Chalkidis, Hipócrates M; Valente, Richard H; Moura-da-Silva, Ana M

    2017-04-21

    Venom variability is commonly reported for venomous snakes including Bothrops atrox. Here, we compared the composition of venoms from B. atrox snakes collected at Amazonian conserved habitats (terra-firme upland forest and várzea) and human modified areas (pasture and degraded areas). Venom samples were submitted to shotgun proteomic analysis as a whole or compared after fractionation by reversed-phase chromatography. Whole venom proteomes revealed a similar composition among the venoms with predominance of SVMPs, CTLs, and SVSPs and intermediate amounts of PLA 2 s and LAAOs. However, when distribution of particular isoforms was analyzed by either method, the venom from várzea snakes showed a decrease in hemorrhagic SVMPs and an increase in SVSPs, and procoagulant SVMPs and PLA 2 s. These differences were validated by experimental approaches including both enzymatic and in vivo assays, and indicated restrictions in respect to antivenom efficacy to variable components. Thus, proteomic analysis at the isoform level combined to in silico prediction of functional properties may indicate venom biological activity. These results also suggest that the prevalence of functionally distinct isoforms contributes to the variability of the venoms and could reflect the adaptation of B. atrox to distinct prey communities in different Amazon habitats. In this report, we compared isoforms present in venoms from snakes collected at different Amazonian habitats. By means of a species venom gland transcriptome and the in silico functional prediction of each isoform, we were able to predict the principal venom activities in vitro and in animal models. We also showed remarkable differences in the venom pools from snakes collected at the floodplain (várzea habitat) compared to other habitats. Not only was this venom less hemorrhagic and more procoagulant, when compared to the venom pools from the other three habitats studied, but also this enhanced procoagulant activity was not

  18. Live Imaging of Calcium Dynamics during Axon Degeneration Reveals Two Functionally Distinct Phases of Calcium Influx

    Science.gov (United States)

    Yamagishi, Yuya; Tessier-Lavigne, Marc

    2015-01-01

    Calcium is a key regulator of axon degeneration caused by trauma and disease, but its specific spatial and temporal dynamics in injured axons remain unclear. To clarify the function of calcium in axon degeneration, we observed calcium dynamics in single injured neurons in live zebrafish larvae and tested the temporal requirement for calcium in zebrafish neurons and cultured mouse DRG neurons. Using laser axotomy to induce Wallerian degeneration (WD) in zebrafish peripheral sensory axons, we monitored calcium dynamics from injury to fragmentation, revealing two stereotyped phases of axonal calcium influx. First, axotomy triggered a transient local calcium wave originating at the injury site. This initial calcium wave only disrupted mitochondria near the injury site and was not altered by expression of the protective WD slow (WldS) protein. Inducing multiple waves with additional axotomies did not change the kinetics of degeneration. In contrast, a second phase of calcium influx occurring minutes before fragmentation spread as a wave throughout the axon, entered mitochondria, and was abolished by WldS expression. In live zebrafish, chelating calcium after the first wave, but before the second wave, delayed the progress of fragmentation. In cultured DRG neurons, chelating calcium early in the process of WD did not alter degeneration, but chelating calcium late in WD delayed fragmentation. We propose that a terminal calcium wave is a key instructive component of the axon degeneration program. SIGNIFICANCE STATEMENT Axon degeneration resulting from trauma or neurodegenerative disease can cause devastating deficits in neural function. Understanding the molecular and cellular events that execute axon degeneration is essential for developing treatments to address these conditions. Calcium is known to contribute to axon degeneration, but its temporal requirements in this process have been unclear. Live calcium imaging in severed zebrafish neurons and temporally controlled

  19. Functional proteomic analysis reveals the involvement of KIAA1199 in breast cancer growth, motility and invasiveness

    International Nuclear Information System (INIS)

    Jami, Mohammad-Saeid; Huang, Xin; Peng, Hong; Fu, Kai; Li, Yan; Singh, Rakesh K; Ding, Shi-Jian; Hou, Jinxuan; Liu, Miao; Varney, Michelle L; Hassan, Hesham; Dong, Jixin; Geng, Liying; Wang, Jing; Yu, Fang

    2014-01-01

    KIAA1199 is a recently identified novel gene that is up-regulated in human cancer with poor survival. Our proteomic study on signaling polarity in chemotactic cells revealed KIAA1199 as a novel protein target that may be involved in cellular chemotaxis and motility. In the present study, we examined the functional significance of KIAA1199 expression in breast cancer growth, motility and invasiveness. We validated the previous microarray observation by tissue microarray immunohistochemistry using a TMA slide containing 12 breast tumor tissue cores and 12 corresponding normal tissues. We performed the shRNA-mediated knockdown of KIAA1199 in MDA-MB-231 and HS578T cells to study the role of this protein in cell proliferation, migration and apoptosis in vitro. We studied the effects of KIAA1199 knockdown in vivo in two groups of mice (n = 5). We carried out the SILAC LC-MS/MS based proteomic studies on the involvement of KIAA1199 in breast cancer. KIAA1199 mRNA and protein was significantly overexpressed in breast tumor specimens and cell lines as compared with non-neoplastic breast tissues from large-scale microarray and studies of breast cancer cell lines and tumors. To gain deeper insights into the novel role of KIAA1199 in breast cancer, we modulated KIAA1199 expression using shRNA-mediated knockdown in two breast cancer cell lines (MDA-MB-231 and HS578T), expressing higher levels of KIAA1199. The KIAA1199 knockdown cells showed reduced motility and cell proliferation in vitro. Moreover, when the knockdown cells were injected into the mammary fat pads of female athymic nude mice, there was a significant decrease in tumor incidence and growth. In addition, quantitative proteomic analysis revealed that knockdown of KIAA1199 in breast cancer (MDA-MB-231) cells affected a broad range of cellular functions including apoptosis, metabolism and cell motility. Our findings indicate that KIAA1199 may play an important role in breast tumor growth and invasiveness, and that it

  20. UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

    Energy Technology Data Exchange (ETDEWEB)

    Rao, K.N.; Swaminathan, S.; Burley, S. K.

    2008-12-11

    We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

  1. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  2. Mutation of Growth Arrest Specific 8 Reveals a Role in Motile Cilia Function and Human Disease.

    Science.gov (United States)

    Lewis, Wesley R; Malarkey, Erik B; Tritschler, Douglas; Bower, Raqual; Pasek, Raymond C; Porath, Jonathan D; Birket, Susan E; Saunier, Sophie; Antignac, Corinne; Knowles, Michael R; Leigh, Margaret W; Zariwala, Maimoona A; Challa, Anil K; Kesterson, Robert A; Rowe, Steven M; Drummond, Iain A; Parant, John M; Hildebrandt, Friedhelm; Porter, Mary E; Yoder, Bradley K; Berbari, Nicolas F

    2016-07-01

    Ciliopathies are genetic disorders arising from dysfunction of microtubule-based cellular appendages called cilia. Different cilia types possess distinct stereotypic microtubule doublet arrangements with non-motile or 'primary' cilia having a 9+0 and motile cilia have a 9+2 array of microtubule doublets. Primary cilia are critical sensory and signaling centers needed for normal mammalian development. Defects in their structure/function result in a spectrum of clinical and developmental pathologies including abnormal neural tube and limb patterning. Altered patterning phenotypes in the limb and neural tube are due to perturbations in the hedgehog (Hh) signaling pathway. Motile cilia are important in fluid movement and defects in motility result in chronic respiratory infections, altered left-right asymmetry, and infertility. These features are the hallmarks of Primary Ciliary Dyskinesia (PCD, OMIM 244400). While mutations in several genes are associated with PCD in patients and animal models, the genetic lesion in many cases is unknown. We assessed the in vivo functions of Growth Arrest Specific 8 (GAS8). GAS8 shares strong sequence similarity with the Chlamydomonas Nexin-Dynein Regulatory Complex (NDRC) protein 4 (DRC4) where it is needed for proper flagella motility. In mammalian cells, the GAS8 protein localizes not only to the microtubule axoneme of motile cilia, but also to the base of non-motile cilia. Gas8 was recently implicated in the Hh signaling pathway as a regulator of Smoothened trafficking into the cilium. Here, we generate the first mouse with a Gas8 mutation and show that it causes severe PCD phenotypes; however, there were no overt Hh pathway phenotypes. In addition, we identified two human patients with missense variants in Gas8. Rescue experiments in Chlamydomonas revealed a subtle defect in swim velocity compared to controls. Further experiments using CRISPR/Cas9 homology driven repair (HDR) to generate one of these human missense variants in

  3. Functional malignant cell heterogeneity in pancreatic neuroendocrine tumors revealed by targeting of PDGF-DD.

    Science.gov (United States)

    Cortez, Eliane; Gladh, Hanna; Braun, Sebastian; Bocci, Matteo; Cordero, Eugenia; Björkström, Niklas K; Miyazaki, Hideki; Michael, Iacovos P; Eriksson, Ulf; Folestad, Erika; Pietras, Kristian

    2016-02-16

    Intratumoral heterogeneity is an inherent feature of most human cancers and has profound implications for cancer therapy. As a result, there is an emergent need to explore previously unmapped mechanisms regulating distinct subpopulations of tumor cells and to understand their contribution to tumor progression and treatment response. Aberrant platelet-derived growth factor receptor beta (PDGFRβ) signaling in cancer has motivated the development of several antagonists currently in clinical use, including imatinib, sunitinib, and sorafenib. The discovery of a novel ligand for PDGFRβ, platelet-derived growth factor (PDGF)-DD, opened the possibility of a previously unidentified signaling pathway involved in tumor development. However, the precise function of PDGF-DD in tumor growth and invasion remains elusive. Here, making use of a newly generated Pdgfd knockout mouse, we reveal a functionally important malignant cell heterogeneity modulated by PDGF-DD signaling in pancreatic neuroendocrine tumors (PanNET). Our analyses demonstrate that tumor growth was delayed in the absence of signaling by PDGF-DD. Surprisingly, ablation of PDGF-DD did not affect the vasculature or stroma of PanNET; instead, we found that PDGF-DD stimulated bulk tumor cell proliferation by induction of paracrine mitogenic signaling between heterogeneous malignant cell clones, some of which expressed PDGFRβ. The presence of a subclonal population of tumor cells characterized by PDGFRβ expression was further validated in a cohort of human PanNET. In conclusion, we demonstrate a previously unrecognized heterogeneity in PanNET characterized by signaling through the PDGF-DD/PDGFRβ axis.

  4. Proteomic analysis of chromoplasts from six crop species reveals insights into chromoplast function and development.

    Science.gov (United States)

    Wang, Yong-Qiang; Yang, Yong; Fei, Zhangjun; Yuan, Hui; Fish, Tara; Thannhauser, Theodore W; Mazourek, Michael; Kochian, Leon V; Wang, Xiaowu; Li, Li

    2013-02-01

    Chromoplasts are unique plastids that accumulate massive amounts of carotenoids. To gain a general and comparative characterization of chromoplast proteins, this study performed proteomic analysis of chromoplasts from six carotenoid-rich crops: watermelon, tomato, carrot, orange cauliflower, red papaya, and red bell pepper. Stromal and membrane proteins of chromoplasts were separated by 1D gel electrophoresis and analysed using nLC-MS/MS. A total of 953-2262 proteins from chromoplasts of different crop species were identified. Approximately 60% of the identified proteins were predicted to be plastid localized. Functional classification using MapMan bins revealed large numbers of proteins involved in protein metabolism, transport, amino acid metabolism, lipid metabolism, and redox in chromoplasts from all six species. Seventeen core carotenoid metabolic enzymes were identified. Phytoene synthase, phytoene desaturase, ζ-carotene desaturase, 9-cis-epoxycarotenoid dioxygenase, and carotenoid cleavage dioxygenase 1 were found in almost all crops, suggesting relative abundance of them among the carotenoid pathway enzymes. Chromoplasts from different crops contained abundant amounts of ATP synthase and adenine nucleotide translocator, which indicates an important role of ATP production and transport in chromoplast development. Distinctive abundant proteins were observed in chromoplast from different crops, including capsanthin/capsorubin synthase and fibrillins in pepper, superoxide dismutase in watermelon, carrot, and cauliflower, and glutathione-S-transferease in papaya. The comparative analysis of chromoplast proteins among six crop species offers new insights into the general metabolism and function of chromoplasts as well as the uniqueness of chromoplasts in specific crop species. This work provides reference datasets for future experimental study of chromoplast biogenesis, development, and regulation in plants.

  5. Effects of prefrontal tDCS on executive function: Methodological considerations revealed by meta-analysis.

    Science.gov (United States)

    Imburgio, Michael J; Orr, Joseph M

    2018-05-01

    A meta-analysis of studies using single-session transcranial direct current stimulation (tDCS) to target the dorsolateral prefrontal cortex (DLPFC) was undertaken to examine the effect of stimulation on executive function (EF) in healthy samples. 27 studies were included in analyses, yielding 71 effect sizes. The most relevant measure for each task was determined a priori and used to calculate Hedge's g. Methodological characteristics of each study were examined individually as potential moderators of effect size. Stimulation effects on three domains of EF (inhibition of prepotent responses, mental set shifting, and information updating and monitoring) were analyzed separately. In line with previous work, the current study found no significant effect of anodal unilateral tDCS, cathodal unilateral tDCS, or bilateral tDCS on EF. Further moderator and subgroup analyses were only carried out for anodal unilateral montages due to the small number of studies using other montages. Subgroup analyses revealed a significant effect of anodal unilateral tDCS on updating tasks, but not on inhibition or set-shifting tasks. Cathode location significantly moderated the effect of anodal unilateral tDCS. Extracranial cathodes yielded a significant effect on EF while cranial cathodes yielded no effect. Anode size also significantly moderated effect of anodal unilateral tDCS, with smaller anodes being more effective than larger anodes. In summary, anodal DLPFC stimulation is more effective at improving updating ability than inhibition and set-shifting ability, but anodal stimulation can significantly improve general executive function when extracranial cathodes or small anodes are used. Future meta-analyses may examine how stimulation's effects on specific behavioral tasks, rather than broader domains, might be affected by methodological moderators. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Mutation of Growth Arrest Specific 8 Reveals a Role in Motile Cilia Function and Human Disease.

    Directory of Open Access Journals (Sweden)

    Wesley R Lewis

    2016-07-01

    Full Text Available Ciliopathies are genetic disorders arising from dysfunction of microtubule-based cellular appendages called cilia. Different cilia types possess distinct stereotypic microtubule doublet arrangements with non-motile or 'primary' cilia having a 9+0 and motile cilia have a 9+2 array of microtubule doublets. Primary cilia are critical sensory and signaling centers needed for normal mammalian development. Defects in their structure/function result in a spectrum of clinical and developmental pathologies including abnormal neural tube and limb patterning. Altered patterning phenotypes in the limb and neural tube are due to perturbations in the hedgehog (Hh signaling pathway. Motile cilia are important in fluid movement and defects in motility result in chronic respiratory infections, altered left-right asymmetry, and infertility. These features are the hallmarks of Primary Ciliary Dyskinesia (PCD, OMIM 244400. While mutations in several genes are associated with PCD in patients and animal models, the genetic lesion in many cases is unknown. We assessed the in vivo functions of Growth Arrest Specific 8 (GAS8. GAS8 shares strong sequence similarity with the Chlamydomonas Nexin-Dynein Regulatory Complex (NDRC protein 4 (DRC4 where it is needed for proper flagella motility. In mammalian cells, the GAS8 protein localizes not only to the microtubule axoneme of motile cilia, but also to the base of non-motile cilia. Gas8 was recently implicated in the Hh signaling pathway as a regulator of Smoothened trafficking into the cilium. Here, we generate the first mouse with a Gas8 mutation and show that it causes severe PCD phenotypes; however, there were no overt Hh pathway phenotypes. In addition, we identified two human patients with missense variants in Gas8. Rescue experiments in Chlamydomonas revealed a subtle defect in swim velocity compared to controls. Further experiments using CRISPR/Cas9 homology driven repair (HDR to generate one of these human missense

  7. Evaluation of the regional lung function revealed in radioaerosol scintigram of chronic obstructive pulmonary disease, 1

    International Nuclear Information System (INIS)

    Suzuki, Teruyasu

    1980-01-01

    We classified the findings of radioaerosol inhalation scintigrams of patients with various stages of obstructive pulmonary disease (COPD) into 4 grades, according to the extent of peripheral irregularity and central hot spot formation; Stage I represents normal homogeneous distribution, stage II represents peripheral irregularity, stage III represents additional hot spot formation and stage IV represents further regional defect. This aerosol grading criteria was then compared with routine and specific lung function tests. The aerosol grading criterion correlated well with FEV sub(1.0)% which is a good indicator of the severity of COPD. The central hot spot formation correlated well with FEV sub(1.0)% and respiratory resistance (R.p.) determined by the oscillation method, both of which are good indicators of abnormality in central airway resistance. Peripheral irregularity correlated well with: 1) flows at 50%VC and 25%VC in a maximum forced expiratory flow volume curve; 2) closing volume (CV/VC%); 3) delta N 2 %/l in N 2 single washout test; and 4) the regional delay of 133 Xe washout process, all of which are sensitive indicators of small airway disease. It is therefore reasonable to conclude that the radioaerosol scintigram reveals the regional lung function both in terms of airway resistance (R) and compliance (C). This criterion was useful in quantitatively evaluating the regional ventilation distribution of COPD and the therapeutic effect on bronchial asthma. The mechanism of aerosol praticle deposition related to characteristic central hot spot formation accompanied with peripheral irregularity in a radioaerosol scintigram of COPD, needs further exploration concerning the aerodynamic behavior of aerosol particles in the airways both during inspiration and expiration. (author)

  8. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  9. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  10. X-ray CT Scanning Reveals Long-Term Copper Pollution Effects on Functional Soil Structure

    DEFF Research Database (Denmark)

    Naveed, Muhammad; Møldrup, Per; Homstrup, Martin

    Soil structure plays the main role in the ability of the soil to fulfill essential soil functions such as the root growth, rate of water infiltration and retention, transport of gaseous and chemicals/pollutants through the soil. Soil structure is a dynamic soil property and affected by various...... factors such as soil type, land use, and soil contamination. In this study, we quantified the soil structure using X-ray CT scanning and revealed the effect of a long history of Copper (Cu) pollution on it. A fallow field at Hygum Denmark provides this opportunity as it had a long history of Copper...... sulphate contamination in a gradient with Cu content varies from 21 mg kg-1 to 3837 mg kg-1. Total 20 intact soil columns (diameter of 10 cm and height of 8 cm) were sampled at five locations along the Cu-gradient from a depth of 5 to 15 cm below surface level. The soil columns were scanned at a voxel...

  11. Proteomic analysis reveals a novel function of the kinase Sat4p in Saccharomyces cerevisiae mitochondria.

    Directory of Open Access Journals (Sweden)

    Uta Gey

    Full Text Available The Saccharomyces cerevisiae kinase Sat4p has been originally identified as a protein involved in salt tolerance and stabilization of plasma membrane transporters, implicating a cytoplasmic localization. Our study revealed an additional mitochondrial (mt localization, suggesting a dual function for Sat4p. While no mt related phenotype was observed in the absence of Sat4p, its overexpression resulted in significant changes of a specific mitochondrial subproteome. As shown by a comparative two dimensional difference gel electrophoresis (2D-DIGE approach combined with mass spectrometry, particularly two groups of proteins were affected: the iron-sulfur containing aconitase-type proteins (Aco1p, Lys4p and the lipoamide-containing subproteome (Lat1p, Kgd2p and Gcv3p. The lipoylation sites of all three proteins could be assigned by nanoLC-MS/MS to Lys75 (Lat1p, Lys114 (Kgd2p and Lys102 (Gcv3p, respectively. Sat4p overexpression resulted in accumulation of the delipoylated protein variants and in reduced levels of aconitase-type proteins, accompanied by a decrease in the activities of the respective enzyme complexes. We propose a regulatory role of Sat4p in the late steps of the maturation of a specific subset of mitochondrial iron-sulfur cluster proteins, including Aco1p and lipoate synthase Lip5p. Impairment of the latter enzyme may account for the observed lipoylation defects.

  12. Functional Genomic Screening Reveals Core Modulators of Echinocandin Stress Responses in Candida albicans

    Directory of Open Access Journals (Sweden)

    Tavia Caplan

    2018-05-01

    Full Text Available Summary: Candida albicans is a leading cause of death due to fungal infection. Treatment of systemic candidiasis often relies on echinocandins, which disrupt cell wall synthesis. Resistance is readily acquired via mutations in the drug target gene, FKS1. Both basal tolerance and resistance to echinocandins require cellular stress responses. We performed a systematic analysis of 3,030 C. albicans mutants to define circuitry governing cellular responses to echinocandins. We identified 16 genes for which deletion or transcriptional repression enhanced echinocandin susceptibility, including components of the Pkc1-MAPK signaling cascade. We discovered that the molecular chaperone Hsp90 is required for the stability of Pkc1 and Bck1, establishing key mechanisms through which Hsp90 mediates echinocandin resistance. We also discovered that perturbation of the CCT chaperonin complex causes enhanced echinocandin sensitivity, altered cell wall architecture, and aberrant septin localization. Thus, we provide insights into the mechanisms by which cellular chaperones enable crucial responses to echinocandin-induced stress. : Caplan et al. screen 3,030 Candida albicans mutants to define circuitry governing cellular responses to echinocandins, the first-line therapy for systemic candidiasis. They reveal that the molecular chaperone Hsp90 is required for stability of Pkc1 and Bck1 and that the CCT chaperonin complex is a key modulator of echinocandin susceptibility. Keywords: fungal pathogen, Candida albicans, echinocandins, Hsp90, Pkc1, CCT complex, client protein, stress response, functional genomic screen, drug resistance

  13. Structure-guided mutational analysis reveals the functional requirements for product specificity of DOT1 enzymes.

    Science.gov (United States)

    Dindar, Gülcin; Anger, Andreas M; Mehlhorn, Christine; Hake, Sandra B; Janzen, Christian J

    2014-11-12

    DOT1 enzymes are conserved methyltransferases that catalyse the methylation of lysine 79 on histone H3 (H3K79). Most eukaryotes contain one DOT1 enzyme, whereas African trypanosomes have two homologues, DOT1A and DOT1B, with different enzymatic activities. DOT1A mediates mono- and dimethylation of H3K76, the homologue of H3K79 in other organisms, whereas DOT1B additionally catalyses H3K76 trimethylation. However, it is unclear how these different enzymatic activities are achieved. Here we employ a trypanosomal nucleosome reconstitution system and structure-guided homology modelling to identify critical residues within and outside the catalytic centre that modulate product specificity. Exchange of these residues transfers the product specificity from one enzyme to the other, and reveals the existence of distinct regulatory domains adjacent to the catalytic centre. Our study provides the first evidence that a few crucial residues in DOT1 enzymes are sufficient to catalyse methyl-state-specific reactions. These results might also have far-reaching consequences for the functional understanding of homologous enzymes in higher eukaryotes.

  14. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  15. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  16. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  17. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  18. Global mRNA expression analysis in myosin II deficient strains of Saccharomyces cerevisiae reveals an impairment of cell integrity functions

    Directory of Open Access Journals (Sweden)

    Rivera-Molina Félix E

    2008-01-01

    Full Text Available Abstract Background The Saccharomyces cerevisiae MYO1 gene encodes the myosin II heavy chain (Myo1p, a protein required for normal cytokinesis in budding yeast. Myo1p deficiency in yeast (myo1Δ causes a cell separation defect characterized by the formation of attached cells, yet it also causes abnormal budding patterns, formation of enlarged and elongated cells, increased osmotic sensitivity, delocalized chitin deposition, increased chitin synthesis, and hypersensitivity to the chitin synthase III inhibitor Nikkomycin Z. To determine how differential expression of genes is related to these diverse cell wall phenotypes, we analyzed the global mRNA expression profile of myo1Δ strains. Results Global mRNA expression profiles of myo1Δ strains and their corresponding wild type controls were obtained by hybridization to yeast oligonucleotide microarrays. Results for selected genes were confirmed by real time RT-PCR. A total of 547 differentially expressed genes (p ≤ 0.01 were identified with 263 up regulated and 284 down regulated genes in the myo1Δ strains. Gene set enrichment analysis revealed the significant over-representation of genes in the protein biosynthesis and stress response categories. The SLT2/MPK1 gene was up regulated in the microarray, and a myo1Δslt2Δ double mutant was non-viable. Overexpression of ribosomal protein genes RPL30 and RPS31 suppressed the hypersensitivity to Nikkomycin Z and increased the levels of phosphorylated Slt2p in myo1Δ strains. Increased levels of phosphorylated Slt2p were also observed in wild type strains under these conditions. Conclusion Following this analysis of global mRNA expression in yeast myo1Δ strains, we conclude that 547 genes were differentially regulated in myo1Δ strains and that the stress response and protein biosynthesis gene categories were coordinately regulated in this mutant. The SLT2/MPK1 gene was confirmed to be essential for myo1Δ strain viability, supporting that the up

  19. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  20. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  1. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  2. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  3. Proteomic Profiles Reveal the Function of Different Vegetative Tissues of Moringa oleifera.

    Science.gov (United States)

    Wang, Lei; Zou, Qiong; Wang, Jinxing; Zhang, Junjie; Liu, Zeping; Chen, Xiaoyang

    2016-12-01

    Moringa oleifera is a rich source of bioactive compounds and is widely used in traditional medicine and food for its nutritional value; however, the protein and peptide components of different tissues are rarely discussed. Here, we describe the first investigation of M. oleifera proteomes using mass spectrometry and bioinformatics methods. We aimed to elucidate the protein profiles of M. oleifera leaves, stem, bark, and root. Totally 202 proteins were identified from four vegetative organs. We identified 101 proteins from leaves, 51 from stem, 94 from bark and 67 from root, finding that only five proteins existed in both four vegetative parts. The calculated pI of most of the proteins is distributed in 5-10 and the molecular weight distributed below 100 kDa. Functional classification analysis revealed that proteins which are involved in catalytic activities are the most abundant both in leaves, stem, bark and root. Identification of several heat shock proteins in four vegetative tissues might be adaptive for resistance to high temperature environmental stresses of tropical or subtropical areas. Some enzymes involved in antioxidant processes were also identified in M. oleifera leaves, stem, bark and root. Among the four tissues studies here, leaves protein content and molecular diversity were the highest. The identification of the flocculating protein MO2.1 and MO2.2 in the bark and root provides clue to clarify the antimicrobial molecular mechanisms of root and bark. This study provides information on the protein compositions of M. oleifera vegetative tissues that will be beneficial for potential drug and food supplement development and plant physiology research.

  4. Epileptic Networks in Focal Cortical Dysplasia Revealed Using Electroencephalography–Functional Magnetic Resonance Imaging

    Science.gov (United States)

    Thornton, Rachel; Vulliemoz, Serge; Rodionov, Roman; Carmichael, David W; Chaudhary, Umair J; Diehl, Beate; Laufs, Helmut; Vollmar, Christian; McEvoy, Andrew W; Walker, Matthew C; Bartolomei, Fabrice; Guye, Maxime; Chauvel, Patrick; Duncan, John S; Lemieux, Louis

    2011-01-01

    Objective Surgical treatment of focal epilepsy in patients with focal cortical dysplasia (FCD) is most successful if all epileptogenic tissue is resected. This may not be evident on structural magnetic resonance imaging (MRI), so intracranial electroencephalography (icEEG) is needed to delineate the seizure onset zone (SOZ). EEG-functional MRI (fMRI) can reveal interictal discharge (IED)-related hemodynamic changes in the irritative zone (IZ). We assessed the value of EEG-fMRI in patients with FCD-associated focal epilepsy by examining the relationship between IED-related hemodynamic changes, icEEG findings, and postoperative outcome. Methods Twenty-three patients with FCD-associated focal epilepsy undergoing presurgical evaluation including icEEG underwent simultaneous EEG-fMRI at 3T. IED-related hemodynamic changes were modeled, and results were overlaid on coregistered T1-weighted MRI scans fused with computed tomography scans showing the intracranial electrodes. IED-related hemodynamic changes were compared with the SOZ on icEEG and postoperative outcome at 1 year. Results Twelve of 23 patients had IEDs during recording, and 11 of 12 had significant IED-related hemodynamic changes. The fMRI results were concordant with the SOZ in 5 of 11 patients, all of whom had a solitary SOZ on icEEG. Four of 5 had >50% reduction in seizure frequency following resective surgery. The remaining 6 of 11 patients had widespread or discordant regions of IED-related fMRI signal change. Five of 6 had either a poor surgical outcome (<50% reduction in seizure frequency) or widespread SOZ precluding surgery. Interpretation Comparison of EEG-fMRI with icEEG suggests that EEG-fMRI may provide useful additional information about the SOZ in FCD. Widely distributed discordant regions of IED-related hemodynamic change appear to be associated with a widespread SOZ and poor postsurgical outcome. ANN NEUROL 2011 PMID:22162063

  5. Nicotinic Receptor Alpha7 Expression during Tooth Morphogenesis Reveals Functional Pleiotropy

    Science.gov (United States)

    Rogers, Scott W.; Gahring, Lorise C.

    2012-01-01

    The expression of nicotinic acetylcholine receptor (nAChR) subtype, alpha7, was investigated in the developing teeth of mice that were modified through homologous recombination to express a bi-cistronic IRES-driven tau-enhanced green fluorescent protein (GFP); alpha7GFP) or IRES-Cre (alpha7Cre). The expression of alpha7GFP was detected first in cells of the condensing mesenchyme at embryonic (E) day E13.5 where it intensifies through E14.5. This expression ends abruptly at E15.5, but was again observed in ameloblasts of incisors at E16.5 or molar ameloblasts by E17.5–E18.5. This expression remains detectable until molar enamel deposition is completed or throughout life as in the constantly erupting mouse incisors. The expression of alpha7GFP also identifies all stages of innervation of the tooth organ. Ablation of the alpha7-cell lineage using a conditional alpha7Cre×ROSA26-LoxP(diphtheria toxin A) strategy substantially reduced the mesenchyme and this corresponded with excessive epithelium overgrowth consistent with an instructive role by these cells during ectoderm patterning. However, alpha7knock-out (KO) mice exhibited normal tooth size and shape indicating that under normal conditions alpha7 expression is dispensable to this process. The function of ameloblasts in alpha7KO mice is altered relative to controls. High resolution micro-computed tomography analysis of adult mandibular incisors revealed enamel volume of the alpha7KO was significantly reduced and the organization of enamel rods was altered relative to controls. These results demonstrate distinct and varied spatiotemporal expression of alpha7 during tooth development, and they suggest that dysfunction of this receptor would have diverse impacts upon the adult organ. PMID:22666322

  6. Functional Coding Variation in Recombinant Inbred Mouse Lines Reveals Novel Serotonin Transporter-Associated Phenotypes

    Energy Technology Data Exchange (ETDEWEB)

    Carneiro, Ana [Vanderbilt University; Airey, David [University of Tennessee Health Science Center, Memphis; Thompson, Brent [Vanderbilt University; Zhu, C [Vanderbilt University; Rinchik, Eugene M [ORNL; Lu, Lu [University of Tennessee Health Science Center, Memphis; Chesler, Elissa J [ORNL; Erikson, Keith [University of North Carolina; Blakely, Randy [Vanderbilt University

    2009-01-01

    The human serotonin (5-hydroxytryptamine, 5-HT) transporter (hSERT, SLC6A4) figures prominently in the etiology or treatment of many prevalent neurobehavioral disorders including anxiety, alcoholism, depression, autism and obsessive-compulsive disorder (OCD). Here we utilize naturally occurring polymorphisms in recombinant inbred (RI) lines to identify novel phenotypes associated with altered SERT function. The widely used mouse strain C57BL/6J, harbors a SERT haplotype defined by two nonsynonymous coding variants (Gly39 and Lys152 (GK)). At these positions, many other mouse lines, including DBA/2J, encode Glu39 and Arg152 (ER haplotype), assignments found also in hSERT. Synaptosomal 5-HT transport studies revealed reduced uptake associated with the GK variant. Heterologous expression studies confirmed a reduced SERT turnover rate for the GK variant. Experimental and in silico approaches using RI lines (C57Bl/6J X DBA/2J=BXD) identifies multiple anatomical, biochemical and behavioral phenotypes specifically impacted by GK/ER variation. Among our findings are multiple traits associated with anxiety and alcohol consumption, as well as of the control of dopamine (DA) signaling. Further bioinformatic analysis of BXD phenotypes, combined with biochemical evaluation of SERT knockout mice, nominates SERT-dependent 5-HT signaling as a major determinant of midbrain iron homeostasis that, in turn, dictates ironregulated DA phenotypes. Our studies provide a novel example of the power of coordinated in vitro, in vivo and in silico approaches using murine RI lines to elucidate and quantify the system-level impact of gene variation.

  7. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  8. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  9. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  10. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  11. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  12. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  13. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  14. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  15. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Science.gov (United States)

    Traverso, Lucila; Lavore, Andrés; Sierra, Ivana; Palacio, Victorio; Martinez-Barnetche, Jesús; Latorre-Estivalis, José Manuel; Mougabure-Cueto, Gaston; Francini, Flavio; Lorenzo, Marcelo G; Rodríguez, Mario Henry; Ons, Sheila; Rivera-Pomar, Rolando V

    2017-02-01

    Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs), Cytochromes P450 (CYPs) and Carboxyl/Cholinesterases (CCEs). Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease. The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms on the high

  16. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso

    2017-02-01

    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  17. Whole-brain analytic measures of network communication reveal increased structure-function correlation in right temporal lobe epilepsy

    Directory of Open Access Journals (Sweden)

    Jonathan Wirsich

    2016-01-01

    In rTLE patients, we found a widespread hypercorrelated functional network. Network communication analysis revealed greater unspecific branching of the shortest path (search information in the structural connectome and a higher global correlation between the structural and functional connectivity for the patient group. We also found evidence for a preserved structural rich-club in the patient group. In sum, global augmentation of structure-function correlation might be linked to a smaller functional repertoire in rTLE patients, while sparing the central core of the brain which may represent a pathway that facilitates the spread of seizures.

  18. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  19. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  20. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  1. Linear and Non-Linear Dose-Response Functions Reveal a Hormetic Relationship Between Stress and Learning

    OpenAIRE

    Zoladz, Phillip R.; Diamond, David M.

    2008-01-01

    Over a century of behavioral research has shown that stress can enhance or impair learning and memory. In the present review, we have explored the complex effects of stress on cognition and propose that they are characterized by linear and non-linear dose-response functions, which together reveal a hormetic relationship between stress and learning. We suggest that stress initially enhances hippocampal function, resulting from amygdala-induced excitation of hippocampal synaptic plasticity, as ...

  2. Functional profiles reveal unique ecological roles of various biological soil crust organisms

    Science.gov (United States)

    Bowker, M.A.; Mau, R.L.; Maestre, F.T.; Escolar, C.; Castillo-Monroy, A. P.

    2011-01-01

    1. At the heart of the body of research on biodiversity effects on ecosystem function is the debate over whether different species tend to be functionally singular or redundant. When we consider ecosystem multi-function, the provision of multiple ecosystem functions simultaneously, we may find that seemingly redundant species may in fact play unique roles in ecosystems. 2. Over the last few decades, the significance of biological soil crusts (BSCs) as ecological boundaries and ecosystem engineers, and their multi-functional nature, has become increasingly well documented. We compiled 'functional profiles' of the organisms in this understudied community, to determine whether functional singularity emerges when multiple ecosystem functions are considered. 3. In two data sets, one representing multiple sites around the semi-arid regions of Spain (regional scale), and another from a single site in central Spain (local scale), we examined correlations between the abundance or frequency of BSC species in a community, and multiple surrogates of ecosystem functioning. There was a wide array of apparent effects of species on specific functions. 4. Notably, in gypsiferous soils and at regional scale, we found that indicators of carbon (C) and phosphorus cycling were apparently suppressed and promoted by the lichens Diploschistes diacapsis and Squamarina lentigera, respectively. The moss Pleurochaete squarrosa appears to promote C cycling in calcareous soils at this spatial scale. At the local scale in gypsiferous soils, D. diacapsis positively correlated with carbon cycling, but negatively with nitrogen cycling, whereas numerous lichens exhibited the opposite profile. 5. We found a high degree of functional singularity, i.e. that species were highly individualistic in their effects on multiple functions. Many functional attributes were not easily predictable from existing functional grouping systems based primarily on morphology. 6. Our results suggest that maintaining

  3. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  4. The structure of BVU2987 from Bacteroides vulgatus reveals a superfamily of bacterial periplasmic proteins with possible inhibitory function

    International Nuclear Information System (INIS)

    Das, Debanu; Finn, Robert D.; Carlton, Dennis; Miller, Mitchell D.; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Chen, Connie; Chiu, Hsiu-Ju; Chiu, Michelle; Clayton, Thomas; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; McMullan, Daniel; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; Bedem, Henry van den; Weekes, Dana; Wooten, Tiffany; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2010-01-01

    The crystal structure of the BVU2987 gene product from B. vulgatus (UniProt A6L4L1) reveals that members of the new Pfam family PF11396 (domain of unknown function; DUF2874) are similar to β-lactamase inhibitor protein and YpmB. Proteins that contain the DUF2874 domain constitute a new Pfam family PF11396. Members of this family have predominantly been identified in microbes found in the human gut and oral cavity. The crystal structure of one member of this family, BVU2987 from Bacteroides vulgatus, has been determined, revealing a β-lactamase inhibitor protein-like structure with a tandem repeat of domains. Sequence analysis and structural comparisons reveal that BVU2987 and other DUF2874 proteins are related to β-lactamase inhibitor protein, PepSY and SmpA-OmlA proteins and hence are likely to function as inhibitory proteins

  5. Whole brain resting-state analysis reveals decreased functional connectivity in major depression

    NARCIS (Netherlands)

    Veer, I.M.; Beckmann, C.F.; van Tol, M.J.; Ferrarini, L.; Milles, J.; Veltman, D.J.; Aleman, A.; van Buchem, M.A.; van der Wee, N.J.; Rombouts, S.A.R.B.

    2010-01-01

    Recently, both increases and decreases in resting-state functional connectivity have been found in major depression. However, these studies only assessed functional connectivity within a specific network or between a few regions of interest, while comorbidity and use of medication was not always

  6. Nationwide analysis of adrenocortical carcinoma reveals higher perioperative morbidity in functional tumors.

    Science.gov (United States)

    Parikh, Punam P; Rubio, Gustavo A; Farra, Josefina C; Lew, John I

    2017-08-25

    Current adrenalectomy outcomes for functional adrenocortical carcinoma (ACC) remain unclear. This study examines nationwide in-hospital post-adrenalectomy outcomes for ACC. A retrospective analysis of the Nationwide Inpatient Sample database (2006-2011) to identify unilateral adrenalectomy patients for functional or nonfunctional ACC was performed. Patient demographics, comorbidities and postoperative outcomes were evaluated by t-test, Chi-square and multivariate regression. Of 2199 patients who underwent adrenalectomy, 87% had nonfunctional and 13% had functional ACC (86% hypercortisolism, 16% hyperaldosteronism, 4% hyperandrogenism). Functional ACC patients had significantly more comorbidities, and experienced certain postoperative complications more frequently including wound issues, adrenocortical insufficiency and acute kidney injury with longer hospital stay compared to nonfunctional ACC (P analysis, functional ACC was an independent prognosticator for wound complications (28.1, 95%CI 4.59-176.6). Patients with functional ACC manifest significant comorbidities with certain in-hospital complications. Such high-risk patients require appropriate preoperative medical optimization prior to adrenalectomy. Patients with functional adrenocortical carcinoma (ACC) have significant preoperative comorbidities and experience higher rates of certain postoperative complications including wound complications, hematoma formation, adrenal insufficiency, pulmonary embolism and acute kidney injury. Functional ACC patients also necessitate longer hospitalizations. These patients should undergo appropriate preoperative counseling in preparation for adrenalectomy. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing.

    Science.gov (United States)

    Zhang, Rui; Deng, Patricia; Jacobson, Dionna; Li, Jin Billy

    2017-02-01

    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3'UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3'UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions.

  8. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  9. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  10. Investigation of pancreas indocrine function in order to reveal subclinical insulin resistence in women with acne

    OpenAIRE

    Filippova, T.; Rudykh, N.; Shevchuk, A.

    2008-01-01

    Changed glycemic curves and indices of insulin resistance, the increase of insulin basal level in comparison with healthy persons, presence of antibodies to insulin antigen, decrease of level sex hormone bilding globulin were revealed in patients with acne. It can be considered as sign of formation of subclinical insulin resistance.

  11. ‘Candidatus Competibacter’-lineage genomes retrieved from metagenomes reveal functional metabolic diversity

    DEFF Research Database (Denmark)

    McIlroy, Simon Jon; Albertsen, Mads; Andresen, Eva Kammer

    2014-01-01

    as for denitrification, nitrogen fixation, fermentation, trehalose synthesis and utilisation of glucose and lactate. Genetic comparison of P metabolism pathways with sequenced PAOs revealed the absence of the Pit phosphate transporter in the Competibacter-lineage genomes—identifying a key metabolic difference...

  12. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  13. Sparse coding reveals greater functional connectivity in female brains during naturalistic emotional experience.

    Directory of Open Access Journals (Sweden)

    Yudan Ren

    Full Text Available Functional neuroimaging is widely used to examine changes in brain function associated with age, gender or neuropsychiatric conditions. FMRI (functional magnetic resonance imaging studies employ either laboratory-designed tasks that engage the brain with abstracted and repeated stimuli, or resting state paradigms with little behavioral constraint. Recently, novel neuroimaging paradigms using naturalistic stimuli are gaining increasing attraction, as they offer an ecologically-valid condition to approximate brain function in real life. Wider application of naturalistic paradigms in exploring individual differences in brain function, however, awaits further advances in statistical methods for modeling dynamic and complex dataset. Here, we developed a novel data-driven strategy that employs group sparse representation to assess gender differences in brain responses during naturalistic emotional experience. Comparing to independent component analysis (ICA, sparse coding algorithm considers the intrinsic sparsity of neural coding and thus could be more suitable in modeling dynamic whole-brain fMRI signals. An online dictionary learning and sparse coding algorithm was applied to the aggregated fMRI signals from both groups, which was subsequently factorized into a common time series signal dictionary matrix and the associated weight coefficient matrix. Our results demonstrate that group sparse representation can effectively identify gender differences in functional brain network during natural viewing, with improved sensitivity and reliability over ICA-based method. Group sparse representation hence offers a superior data-driven strategy for examining brain function during naturalistic conditions, with great potential for clinical application in neuropsychiatric disorders.

  14. An atlas of the thioredoxin fold class reveals the complexity of function-enabling adaptations.

    Science.gov (United States)

    Atkinson, Holly J; Babbitt, Patricia C

    2009-10-01

    The group of proteins that contain a thioredoxin (Trx) fold is huge and diverse. Assessment of the variation in catalytic machinery of Trx fold proteins is essential in providing a foundation for understanding their functional diversity and predicting the function of the many uncharacterized members of the class. The proteins of the Trx fold class retain common features-including variations on a dithiol CxxC active site motif-that lead to delivery of function. We use protein similarity networks to guide an analysis of how structural and sequence motifs track with catalytic function and taxonomic categories for 4,082 representative sequences spanning the known superfamilies of the Trx fold. Domain structure in the fold class is varied and modular, with 2.8% of sequences containing more than one Trx fold domain. Most member proteins are bacterial. The fold class exhibits many modifications to the CxxC active site motif-only 56.8% of proteins have both cysteines, and no functional groupings have absolute conservation of the expected catalytic motif. Only a small fraction of Trx fold sequences have been functionally characterized. This work provides a global view of the complex distribution of domains and catalytic machinery throughout the fold class, showing that each superfamily contains remnants of the CxxC active site. The unifying context provided by this work can guide the comparison of members of different Trx fold superfamilies to gain insight about their structure-function relationships, illustrated here with the thioredoxins and peroxiredoxins.

  15. Functionalization of Planet-Satellite Nanostructures Revealed by Nanoscopic Localization of Distinct Macromolecular Species

    KAUST Repository

    Rossner, Christian; Roddatis, Vladimir; Lopatin, Sergei; Vana, Philipp

    2016-01-01

    The development of a straightforward method is reported to form hybrid polymer/gold planet-satellite nanostructures (PlSNs) with functional polymer. Polyacrylate type polymer with benzyl chloride in its backbone as a macromolecular tracer

  16. Purification and characterization of progenitor and mature human astrocytes reveals transcriptional and functional differences with mouse

    OpenAIRE

    Zhang, Ye; Sloan, Steven A.; Clarke, Laura E.; Caneda, Christine; Plaza, Colton A.; Blumenthal, Paul D.; Vogel, Hannes; Steinberg, Gary K.; Edwards, Michael S. B.; Li, Gordon; Duncan, John A.; Cheshier, Samuel H.; Shuer, Lawrence M.; Chang, Edward F.; Grant, Gerald A.

    2015-01-01

    The functional and molecular similarities and distinctions between human and murine astrocytes are poorly understood. Here we report the development of an immunopanning method to acutely purify astrocytes from fetal, juvenile, and adult human brains, and to maintain these cells in serum-free cultures. We found that human astrocytes have similar abilities to murine astrocytes in promoting neuronal survival, inducing functional synapse formation, and engulfing synaptosomes. In contrast to exist...

  17. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  18. An integrative architecture for general intelligence and executive function revealed by lesion mapping

    Science.gov (United States)

    Colom, Roberto; Solomon, Jeffrey; Krueger, Frank; Forbes, Chad; Grafman, Jordan

    2012-01-01

    Although cognitive neuroscience has made remarkable progress in understanding the involvement of the prefrontal cortex in executive control, the broader functional networks that support high-level cognition and give rise to general intelligence remain to be well characterized. Here, we investigated the neural substrates of the general factor of intelligence (g) and executive function in 182 patients with focal brain damage using voxel-based lesion–symptom mapping. The Wechsler Adult Intelligence Scale and Delis–Kaplan Executive Function System were used to derive measures of g and executive function, respectively. Impaired performance on these measures was associated with damage to a distributed network of left lateralized brain areas, including regions of frontal and parietal cortex and white matter association tracts, which bind these areas into a coordinated system. The observed findings support an integrative framework for understanding the architecture of general intelligence and executive function, supporting their reliance upon a shared fronto-parietal network for the integration and control of cognitive representations and making specific recommendations for the application of the Wechsler Adult Intelligence Scale and Delis–Kaplan Executive Function System to the study of high-level cognition in health and disease. PMID:22396393

  19. An atlas of the thioredoxin fold class reveals the complexity of function-enabling adaptations.

    Directory of Open Access Journals (Sweden)

    Holly J Atkinson

    2009-10-01

    Full Text Available The group of proteins that contain a thioredoxin (Trx fold is huge and diverse. Assessment of the variation in catalytic machinery of Trx fold proteins is essential in providing a foundation for understanding their functional diversity and predicting the function of the many uncharacterized members of the class. The proteins of the Trx fold class retain common features-including variations on a dithiol CxxC active site motif-that lead to delivery of function. We use protein similarity networks to guide an analysis of how structural and sequence motifs track with catalytic function and taxonomic categories for 4,082 representative sequences spanning the known superfamilies of the Trx fold. Domain structure in the fold class is varied and modular, with 2.8% of sequences containing more than one Trx fold domain. Most member proteins are bacterial. The fold class exhibits many modifications to the CxxC active site motif-only 56.8% of proteins have both cysteines, and no functional groupings have absolute conservation of the expected catalytic motif. Only a small fraction of Trx fold sequences have been functionally characterized. This work provides a global view of the complex distribution of domains and catalytic machinery throughout the fold class, showing that each superfamily contains remnants of the CxxC active site. The unifying context provided by this work can guide the comparison of members of different Trx fold superfamilies to gain insight about their structure-function relationships, illustrated here with the thioredoxins and peroxiredoxins.

  20. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  1. Simultaneous functional photoacoustic microscopy and electrocorticography reveal the impact of rtPA on dynamic neurovascular functions after cerebral ischemia.

    Science.gov (United States)

    Bandla, Aishwarya; Liao, Lun-De; Chan, Su Jing; Ling, Ji Min; Liu, Yu-Hang; Shih, Yen-Yu Ian; Pan, Han-Chi; Wong, Peter Tsun-Hon; Lai, Hsin-Yi; King, Nicolas Kon Kam; Chen, You-Yin; Ng, Wai Hoe; Thakor, Nitish V

    2018-06-01

    The advance of thrombolytic therapy has been hampered by the lack of optimization of the therapy during the hyperacute phase of focal ischemia. Here, we investigate neurovascular dynamics using a custom-designed hybrid electrocorticography (ECoG)-functional photoacoustic microscopy (fPAM) imaging system during the hyperacute phase (first 6 h) of photothrombotic ischemia (PTI) in male Wistar rats following recombinant tissue plasminogen activator (rtPA)-mediated thrombolysis. We reported, for the first time, the changes in neural activity and cerebral hemodynamic responses following rtPA infusion at different time points post PTI. Interestingly, very early administration of rtPA ( 4 h post PTI) resulted in the deterioration of neurovascular function. A therapeutic window between 1 and 3 h post PTI was found to improve recovery of neurovascular function (i.e. significant restoration of neural activity to 93 ± 4.2% of baseline and hemodynamics to 81 ± 2.1% of baseline, respectively). The novel combination of fPAM and ECoG enables direct mapping of neurovascular dynamics and serves as a platform to evaluate potential interventions for stroke.

  2. Functional assays and metagenomic analyses reveals differences between the microbial communities inhabiting the soil horizons of a Norway spruce plantation.

    Directory of Open Access Journals (Sweden)

    Stéphane Uroz

    Full Text Available In temperate ecosystems, acidic forest soils are among the most nutrient-poor terrestrial environments. In this context, the long-term differentiation of the forest soils into horizons may impact the assembly and the functions of the soil microbial communities. To gain a more comprehensive understanding of the ecology and functional potentials of these microbial communities, a suite of analyses including comparative metagenomics was applied on independent soil samples from a spruce plantation (Breuil-Chenue, France. The objectives were to assess whether the decreasing nutrient bioavailability and pH variations that naturally occurs between the organic and mineral horizons affects the soil microbial functional biodiversity. The 14 Gbp of pyrosequencing and Illumina sequences generated in this study revealed complex microbial communities dominated by bacteria. Detailed analyses showed that the organic soil horizon was significantly enriched in sequences related to Bacteria, Chordata, Arthropoda and Ascomycota. On the contrary the mineral horizon was significantly enriched in sequences related to Archaea. Our analyses also highlighted that the microbial communities inhabiting the two soil horizons differed significantly in their functional potentials according to functional assays and MG-RAST analyses, suggesting a functional specialisation of these microbial communities. Consistent with this specialisation, our shotgun metagenomic approach revealed a significant increase in the relative abundance of sequences related glycoside hydrolases in the organic horizon compared to the mineral horizon that was significantly enriched in glycoside transferases. This functional stratification according to the soil horizon was also confirmed by a significant correlation between the functional assays performed in this study and the functional metagenomic analyses. Together, our results suggest that the soil stratification and particularly the soil resource

  3. Characterization of the ovine ribosomal protein SA gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2010-03-01

    Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.

  4. Intraoperative mapping during repeat awake craniotomy reveals the functional plasticity of adult cortex.

    Science.gov (United States)

    Southwell, Derek G; Hervey-Jumper, Shawn L; Perry, David W; Berger, Mitchel S

    2016-05-01

    OBJECT To avoid iatrogenic injury during the removal of intrinsic cerebral neoplasms such as gliomas, direct electrical stimulation (DES) is used to identify cortical and subcortical white matter pathways critical for language, motor, and sensory function. When a patient undergoes more than 1 brain tumor resection as in the case of tumor recurrence, the use of DES provides an unusual opportunity to examine brain plasticity in the setting of neurological disease. METHODS The authors examined 561 consecutive cases in which patients underwent DES mapping during surgery forglioma resection. "Positive" and "negative" sites-discrete cortical regions where electrical stimulation did (positive) or did not (negative) produce transient sensory, motor, or language disturbance-were identified prior to tumor resection and documented by intraoperative photography for categorization into functional maps. In this group of 561 patients, 18 were identified who underwent repeat surgery in which 1 or more stimulation sites overlapped with those tested during the initial surgery. The authors compared intraoperative sensory, motor, or language mapping results between initial and repeat surgeries, and evaluated the clinical outcomes for these patients. RESULTS A total of 117 sites were tested for sensory (7 sites, 6.0%), motor (9 sites, 7.7%), or language (101 sites, 86.3%) function during both initial and repeat surgeries. The mean interval between surgical procedures was 4.1 years. During initial surgeries, 95 (81.2%) of 117 sites were found to be negative and 22 (18.8%) of 117 sites were found to be positive. During repeat surgeries, 103 (88.0%) of 117 sites were negative and 14 (12.0%) of 117 were positive. Of the 95 sites that were negative at the initial surgery, 94 (98.9%) were also negative at the repeat surgery, while 1 (1.1%) site was found to be positive. Of the 22 sites that were initially positive, 13 (59.1%) remained positive at repeat surgery, while 9 (40.9%) had become

  5. Exercise reveals impairments in left ventricular systolic function in patients with metabolic syndrome.

    Science.gov (United States)

    Fournier, Sara B; Reger, Brian L; Donley, David A; Bonner, Daniel E; Warden, Bradford E; Gharib, Wissam; Failinger, Conard F; Olfert, Melissa D; Frisbee, Jefferson C; Olfert, I Mark; Chantler, Paul D

    2014-01-01

    Metabolic syndrome (MetS) is the manifestation of a cluster of cardiovascular risk factors and is associated with a threefold increase in the risk of cardiovascular morbidity and mortality, which is suggested to be mediated, in part, by resting left ventricular (LV) systolic dysfunction. However, to what extent resting LV systolic function is impaired in MetS is controversial, and there are no data indicating whether LV systolic function is impaired during exercise. Accordingly, the objective of this study was to examine comprehensively the LV and arterial responses to exercise in individuals with MetS without diabetes and/or overt cardiovascular disease in comparison to a healthy control population. Cardiovascular function was characterized using Doppler echocardiography and gas exchange in individuals with MetS (n = 27) versus healthy control subjects (n = 20) at rest and during peak exercise. At rest, individuals with MetS displayed normal LV systolic function but reduced LV diastolic function compared with healthy control subjects. During peak exercise, individuals with MetS had impaired contractility, pump performance and vasodilator reserve capacity versus control subjects. A blunted contractile reserve response resulted in diminished arterial-ventricular coupling reserve and limited aerobic capacity in individuals with MetS versus control subjects. These findings are of clinical importance, because they provide insight into the pathophysiological changes in MetS that may predispose this population of individuals to an increased risk of cardiovascular morbidity and mortality.

  6. Positron Emission Tomography Reveals Abnormal Topological Organization in Functional Brain Network in Diabetic Patients.

    Science.gov (United States)

    Qiu, Xiangzhe; Zhang, Yanjun; Feng, Hongbo; Jiang, Donglang

    2016-01-01

    Recent studies have demonstrated alterations in the topological organization of structural brain networks in diabetes mellitus (DM). However, the DM-related changes in the topological properties in functional brain networks are unexplored so far. We therefore used fluoro-D-glucose positron emission tomography (FDG-PET) data to construct functional brain networks of 73 DM patients and 91 sex- and age-matched normal controls (NCs), followed by a graph theoretical analysis. We found that both DM patients and NCs had a small-world topology in functional brain network. In comparison to the NC group, the DM group was found to have significantly lower small-world index, lower normalized clustering coefficients and higher normalized characteristic path length. Moreover, for diabetic patients, the nodal centrality was significantly reduced in the right rectus, the right cuneus, the left middle occipital gyrus, and the left postcentral gyrus, and it was significantly increased in the orbitofrontal region of the left middle frontal gyrus, the left olfactory region, and the right paracentral lobule. Our results demonstrated that the diabetic brain was associated with disrupted topological organization in the functional PET network, thus providing functional evidence for the abnormalities of brain networks in DM.

  7. Positron Emission Tomography Reveals Abnormal Topological Organization in Functional Brain Network in Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Qiu eXiangzhe

    2016-05-01

    Full Text Available Recent studies have demonstrated alterations in the topological organization of structural brain networks in diabetes mellitus (DM. However, the DM-related changes in the topological properties in functional brain networks are almost unexplored so far. We therefore used fluoro-D-glucose positron emission tomography (FDG-PET data to construct functional brain networks of 73 DM patients and 91 sex- and age-matched normal controls (NCs, followed by a graph theoretical analysis. We found that both DM patients and NCs had a small-world topology in functional brain network. In comparison to the NC group, the DM group was found to have significantly lower small-world index, lower normalized clustering coefficients and higher normalized shortest path length. Moreover, for diabetic patients, the nodal centrality was significantly reduced in the right rectus, the right cuneus, the left middle occipital gyrus, and the left postcentral gyrus, and it was significantly increased in the orbitofrontal region of the left middle frontal gyrus, the left olfactory region, and the right paracentral lobule. Our results demonstrated that the diabetic brain was associated with disrupted topological organization in the functional PET network, thus providing the functional evidence for the abnormalities of brain networks in DM.

  8. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  9. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  10. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  11. The scaling behavior of hand motions reveals self-organization during an executive function task

    Science.gov (United States)

    Anastas, Jason R.; Stephen, Damian G.; Dixon, James A.

    2011-05-01

    Recent approaches to cognition explain cognitive phenomena in terms of interaction-dominant dynamics. In the current experiment, we extend this approach to executive function, a construct used to describe flexible, goal-oriented behavior. Participants were asked to perform a widely used executive function task, card sorting, under two conditions. In one condition, participants were given a rule with which to sort the cards. In the other condition, participants had to induce the rule from experimenter feedback. The motion of each participant’s hand was tracked during the sorting task. Detrended fluctuation analysis was performed on the inter-point time series using a windowing strategy to capture changes over each trial. For participants in the induction condition, the Hurst exponent sharply increased and then decreased. The Hurst exponents for the explicit condition did not show this pattern. Our results suggest that executive function may be understood in terms of changes in stability that arise from interaction-dominant dynamics.

  12. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  13. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  14. Interplay of ribosomal DNA loci in nucleolar dominance: dominant NORs are up-regulated by chromatin dynamics in the wheat-rye system.

    Directory of Open Access Journals (Sweden)

    Manuela Silva

    Full Text Available BACKGROUND: Chromatin organizational and topological plasticity, and its functions in gene expression regulation, have been strongly revealed by the analysis of nucleolar dominance in hybrids and polyploids where one parental set of ribosomal RNA (rDNA genes that are clustered in nucleolar organizing regions (NORs, is rendered silent by epigenetic pathways and heterochromatization. However, information on the behaviour of dominant NORs is very sparse and needed for an integrative knowledge of differential gene transcription levels and chromatin specific domain interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using molecular and cytological approaches in a wheat-rye addition line (wheat genome plus the rye nucleolar chromosome pair 1R, we investigated transcriptional activity and chromatin topology of the wheat dominant NORs in a nucleolar dominance situation. Herein we report dominant NORs up-regulation in the addition line through quantitative real-time PCR and silver-staining technique. Accompanying this modification in wheat rDNA trascription level, we also disclose that perinucleolar knobs of ribosomal chromatin are almost transcriptionally silent due to the residual detection of BrUTP incorporation in these domains, contrary to the marked labelling of intranucleolar condensed rDNA. Further, by comparative confocal analysis of nuclei probed to wheat and rye NORs, we found that in the wheat-rye addition line there is a significant decrease in the number of wheat-origin perinucleolar rDNA knobs, corresponding to a diminution of the rDNA heterochromatic fraction of the dominant (wheat NORs. CONCLUSIONS/SIGNIFICANCE: We demonstrate that inter-specific interactions leading to wheat-origin NOR dominance results not only on the silencing of rye origin NOR loci, but dominant NORs are also modified in their transcriptional activity and interphase organization. The results show a cross-talk between wheat and rye NORs, mediated by ribosomal chromatin

  15. Whole brain resting-state analysis reveals decreased functional connectivity in major depression

    Directory of Open Access Journals (Sweden)

    Ilya M. Veer

    2010-09-01

    Full Text Available Recently, both increases and decreases in resting-state functional connectivity have been found in major depression. However, these studies only assessed functional connectivity within a specific network or between a few regions of interest, while comorbidity and use of medication was not always controlled for. Therefore, the aim of the current study was to investigate whole-brain functional connectivity, unbiased by a priori definition of regions or networks of interest, in medication-free depressive patients without comorbidity. We analyzed resting-state fMRI data of 19 medication-free patients with a recent diagnosis of major depression (within six months before inclusion and no comorbidity, and 19 age- and gender-matched controls. Independent component analysis was employed on the concatenated data sets of all participants. Thirteen functionally relevant networks were identified, describing the entire study sample. Next, individual representations of the networks were created using a dual regression method. Statistical inference was subsequently done on these spatial maps using voxelwise permutation tests. Abnormal functional connectivity was found within three resting-state networks in depression: 1 decreased bilateral amygdala and left anterior insula connectivity in an affective network, 2 reduced connectivity of the left frontal pole in a network associated with attention and working memory, and 3 decreased bilateral lingual gyrus connectivity within ventromedial visual regions. None of these effects were associated with symptom severity or grey matter density. We found abnormal resting-state functional connectivity not previously associated with major depression, which might relate to abnormal affect regulation and mild cognitive deficits, both associated with the symptomatology of the disorder.

  16. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  17. A novel fragile X syndrome mutation reveals a conserved role for the carboxy-terminus in FMRP localization and function.

    Science.gov (United States)

    Okray, Zeynep; de Esch, Celine E F; Van Esch, Hilde; Devriendt, Koen; Claeys, Annelies; Yan, Jiekun; Verbeeck, Jelle; Froyen, Guy; Willemsen, Rob; de Vrij, Femke M S; Hassan, Bassem A

    2015-04-01

    Loss of function of the FMR1 gene leads to fragile X syndrome (FXS), the most common form of intellectual disability. The loss of FMR1 function is usually caused by epigenetic silencing of the FMR1 promoter leading to expansion and subsequent methylation of a CGG repeat in the 5' untranslated region. Very few coding sequence variations have been experimentally characterized and shown to be causal to the disease. Here, we describe a novel FMR1 mutation and reveal an unexpected nuclear export function for the C-terminus of FMRP. We screened a cohort of patients with typical FXS symptoms who tested negative for CGG repeat expansion in the FMR1 locus. In one patient, we identified a guanine insertion in FMR1 exon 15. This mutation alters the open reading frame creating a short novel C-terminal sequence, followed by a stop codon. We find that this novel peptide encodes a functional nuclear localization signal (NLS) targeting the patient FMRP to the nucleolus in human cells. We also reveal an evolutionarily conserved nuclear export function associated with the endogenous C-terminus of FMRP. In vivo analyses in Drosophila demonstrate that a patient-mimetic mutation alters the localization and function of Dfmrp in neurons, leading to neomorphic neuronal phenotypes. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.

  18. Integrating abundance and functional traits reveals new global hotspots of fish diversity.

    Science.gov (United States)

    Stuart-Smith, Rick D; Bates, Amanda E; Lefcheck, Jonathan S; Duffy, J Emmett; Baker, Susan C; Thomson, Russell J; Stuart-Smith, Jemina F; Hill, Nicole A; Kininmonth, Stuart J; Airoldi, Laura; Becerro, Mikel A; Campbell, Stuart J; Dawson, Terence P; Navarrete, Sergio A; Soler, German A; Strain, Elisabeth M A; Willis, Trevor J; Edgar, Graham J

    2013-09-26

    Species richness has dominated our view of global biodiversity patterns for centuries. The dominance of this paradigm is reflected in the focus by ecologists and conservation managers on richness and associated occurrence-based measures for understanding drivers of broad-scale diversity patterns and as a biological basis for management. However, this is changing rapidly, as it is now recognized that not only the number of species but the species present, their phenotypes and the number of individuals of each species are critical in determining the nature and strength of the relationships between species diversity and a range of ecological functions (such as biomass production and nutrient cycling). Integrating these measures should provide a more relevant representation of global biodiversity patterns in terms of ecological functions than that provided by simple species counts. Here we provide comparisons of a traditional global biodiversity distribution measure based on richness with metrics that incorporate species abundances and functional traits. We use data from standardized quantitative surveys of 2,473 marine reef fish species at 1,844 sites, spanning 133 degrees of latitude from all ocean basins, to identify new diversity hotspots in some temperate regions and the tropical eastern Pacific Ocean. These relate to high diversity of functional traits amongst individuals in the community (calculated using Rao's Q), and differ from previously reported patterns in functional diversity and richness for terrestrial animals, which emphasize species-rich tropical regions only. There is a global trend for greater evenness in the number of individuals of each species, across the reef fish species observed at sites ('community evenness'), at higher latitudes. This contributes to the distribution of functional diversity hotspots and contrasts with well-known latitudinal gradients in richness. Our findings suggest that the contribution of species diversity to a range of

  19. Functional genomic screening reveals asparagine dependence as a metabolic vulnerability in sarcoma

    OpenAIRE

    Hettmer, Simone; Schinzel, Anna C; Tchessalova, Daria; Schneider, Michaela; Parker, Christina L; Bronson, Roderick T; Richards, Nigel GJ; Hahn, William C; Wagers, Amy J

    2015-01-01

    eLife digest Sarcoma is a type of cancer that forms in the connective tissues of the body, such as bone, cartilage, muscle and fat. Usually, treatment involves surgical removal of the tumor and/or radiation to kill the tumor cells. However, if sarcomas spread to other parts of the body, the treatment options are limited. Genetic studies have revealed several genetic changes that contribute to the formation of sarcomas. Many sarcomas have a mutation in a gene that encodes a protein called Ras....

  20. Computational Approaches Reveal New Insights into Regulation and Function of Non; coding RNAs and their Targets

    KAUST Repository

    Alam, Tanvir

    2016-01-01

    Regulation and function of protein-coding genes are increasingly well-understood, but no comparable evidence exists for non-coding RNA (ncRNA) genes, which appear to be more numerous than protein-coding genes. We developed a novel machine

  1. Metagenomes reveal microbial structures, functional potentials, and biofouling-related genes in a membrane bioreactor.

    Science.gov (United States)

    Ma, Jinxing; Wang, Zhiwei; Li, Huan; Park, Hee-Deung; Wu, Zhichao

    2016-06-01

    Metagenomic sequencing was used to investigate the microbial structures, functional potentials, and biofouling-related genes in a membrane bioreactor (MBR). The results showed that the microbial community in the MBR was highly diverse. Notably, function analysis of the dominant genera indicated that common genes from different phylotypes were identified for important functional potentials with the observation of variation of abundances of genes in a certain taxon (e.g., Dechloromonas). Despite maintaining similar metabolic functional potentials with a parallel full-scale conventional activated sludge (CAS) system due to treating the identical wastewater, the MBR had more abundant nitrification-related bacteria and coding genes of ammonia monooxygenase, which could well explain its excellent ammonia removal in the low-temperature period. Furthermore, according to quantification of the genes involved in exopolysaccharide and extracellular polymeric substance (EPS) protein metabolism, the MBR did not show a much different potential in producing EPS compared to the CAS system, and bacteria from the membrane biofilm had lower abundances of genes associated with EPS biosynthesis and transport compared to the activated sludge in the MBR.

  2. Mapping functional connectivity in barrel-related columns reveals layer- and cell type-specific microcircuits.

    NARCIS (Netherlands)

    Schubert, D.; Kotter, R.; Staiger, J.F.

    2007-01-01

    Synaptic circuits bind together functional modules of the neocortex. We aim to clarify in a rodent model how intra- and transcolumnar microcircuits in the barrel cortex are laid out to segregate and also integrate sensory information. The primary somatosensory (barrel) cortex of rodents is the ideal

  3. Tissue Doppler echocardiography reveals impaired cardiac function in patients with reversible ischaemia

    DEFF Research Database (Denmark)

    Hoffmann, Søren; Mogelvang, Rasmus; Sogaard, Peter

    2011-01-01

    AIMS: To determine if echocardiographic tissue Doppler imaging (TDI) performed at rest detects reduced myocardial function in patients with reversible ischaemia. METHODS AND RESULTS: Eighty-four patients with angina pectoris, no previous history of ischaemic heart disease and normal left ventricu...

  4. Functional characterisation of an intron retaining K+ transporter of barley reveals intron-mediated alternate splicing

    KAUST Repository

    Shahzad, K.; Rauf, M.; Ahmed, M.; Malik, Z. A.; Habib, I.; Ahmed, Z.; Mahmood, K.; Ali, R.; Masmoudi, K.; Lemtiri-Chlieh, Fouad; Gehring, Christoph A; Berkowitz, G. A.; Saeed, N. A.

    2015-01-01

    Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably

  5. Lipid profiling and transcriptomic analysis reveals a functional interplay between estradiol and growth hormone in liver

    DEFF Research Database (Denmark)

    Fernández-Pérez, Leandro; Santana-Farré, Ruymán; Mirecki-Garrido, Mercedes de

    2014-01-01

    17β-estradiol (E2) may interfere with endocrine, metabolic, and gender-differentiated functions in liver in both females and males. Indirect mechanisms play a crucial role because of the E2 influence on the pituitary GH secretion and the GHR-JAK2-STAT5 signaling pathway in the target tissues. E2,...

  6. Revealing complex function, process and pathway interactions with high-throughput expression and biological annotation data.

    Science.gov (United States)

    Singh, Nitesh Kumar; Ernst, Mathias; Liebscher, Volkmar; Fuellen, Georg; Taher, Leila

    2016-10-20

    The biological relationships both between and within the functions, processes and pathways that operate within complex biological systems are only poorly characterized, making the interpretation of large scale gene expression datasets extremely challenging. Here, we present an approach that integrates gene expression and biological annotation data to identify and describe the interactions between biological functions, processes and pathways that govern a phenotype of interest. The product is a global, interconnected network, not of genes but of functions, processes and pathways, that represents the biological relationships within the system. We validated our approach on two high-throughput expression datasets describing organismal and organ development. Our findings are well supported by the available literature, confirming that developmental processes and apoptosis play key roles in cell differentiation. Furthermore, our results suggest that processes related to pluripotency and lineage commitment, which are known to be critical for development, interact mainly indirectly, through genes implicated in more general biological processes. Moreover, we provide evidence that supports the relevance of cell spatial organization in the developing liver for proper liver function. Our strategy can be viewed as an abstraction that is useful to interpret high-throughput data and devise further experiments.

  7. Diversity and functions of bacterial community in drinking water biofilms revealed by high-throughput sequencing

    Science.gov (United States)

    Chao, Yuanqing; Mao, Yanping; Wang, Zhiping; Zhang, Tong

    2015-06-01

    The development of biofilms in drinking water (DW) systems may cause various problems to water quality. To investigate the community structure of biofilms on different pipe materials and the global/specific metabolic functions of DW biofilms, PCR-based 454 pyrosequencing data for 16S rRNA genes and Illumina metagenomic data were generated and analysed. Considerable differences in bacterial diversity and taxonomic structure were identified between biofilms formed on stainless steel and biofilms formed on plastics, indicating that the metallic materials facilitate the formation of higher diversity biofilms. Moreover, variations in several dominant genera were observed during biofilm formation. Based on PCA analysis, the global functions in the DW biofilms were similar to other DW metagenomes. Beyond the global functions, the occurrences and abundances of specific protective genes involved in the glutathione metabolism, the SoxRS system, the OxyR system, RpoS regulated genes, and the production/degradation of extracellular polymeric substances were also evaluated. A near-complete and low-contamination draft genome was constructed from the metagenome of the DW biofilm, based on the coverage and tetranucleotide frequencies, and identified as a Bradyrhizobiaceae-like bacterium according to a phylogenetic analysis. Our findings provide new insight into DW biofilms, especially in terms of their metabolic functions.

  8. Functional SNPs in the human ficolin (FCN) genes reveal distinct geographical patterns

    DEFF Research Database (Denmark)

    Hummelshøj, Tina; Munthe-Fog, Lea; Madsen, Hans O

    2008-01-01

    -Xaa-Yaa repeats and a Trp279STOP introduces a stop codon, thereby destroying the fibrinogen-like domain of Ficolin-1. In contrast to FCN1 and FCN2, the number of SNPs in FCN3 was very low. In conclusion, large ethnic differences in the FCN genes that will affect the concentration, structure, and function...

  9. Activation of auditory white matter tracts as revealed by functional magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Tae, Woo Suk [Kangwon National University, Neuroscience Research Institute, School of Medicine, Chuncheon (Korea, Republic of); Yakunina, Natalia; Nam, Eui-Cheol [Kangwon National University, Neuroscience Research Institute, School of Medicine, Chuncheon (Korea, Republic of); Kangwon National University, Department of Otolaryngology, School of Medicine, Chuncheon, Kangwon-do (Korea, Republic of); Kim, Tae Su [Kangwon National University Hospital, Department of Otolaryngology, Chuncheon (Korea, Republic of); Kim, Sam Soo [Kangwon National University, Neuroscience Research Institute, School of Medicine, Chuncheon (Korea, Republic of); Kangwon National University, Department of Radiology, School of Medicine, Chuncheon (Korea, Republic of)

    2014-07-15

    The ability of functional magnetic resonance imaging (fMRI) to detect activation in brain white matter (WM) is controversial. In particular, studies on the functional activation of WM tracts in the central auditory system are scarce. We utilized fMRI to assess and characterize the entire auditory WM pathway under robust experimental conditions involving the acquisition of a large number of functional volumes, the application of broadband auditory stimuli of high intensity, and the use of sparse temporal sampling to avoid scanner noise effects and increase signal-to-noise ratio. Nineteen healthy volunteers were subjected to broadband white noise in a block paradigm; each run had four sound-on/off alternations and was repeated nine times for each subject. Sparse sampling (TR = 8 s) was used. In addition to traditional gray matter (GM) auditory center activation, WM activation was detected in the isthmus and midbody of the corpus callosum (CC), tapetum, auditory radiation, lateral lemniscus, and decussation of the superior cerebellar peduncles. At the individual level, 13 of 19 subjects (68 %) had CC activation. Callosal WM exhibited a temporal delay of approximately 8 s in response to the stimulation compared with GM. These findings suggest that direct evaluation of the entire functional network of the central auditory system may be possible using fMRI, which may aid in understanding the neurophysiological basis of the central auditory system and in developing treatment strategies for various central auditory disorders. (orig.)

  10. Activation of auditory white matter tracts as revealed by functional magnetic resonance imaging

    International Nuclear Information System (INIS)

    Tae, Woo Suk; Yakunina, Natalia; Nam, Eui-Cheol; Kim, Tae Su; Kim, Sam Soo

    2014-01-01

    The ability of functional magnetic resonance imaging (fMRI) to detect activation in brain white matter (WM) is controversial. In particular, studies on the functional activation of WM tracts in the central auditory system are scarce. We utilized fMRI to assess and characterize the entire auditory WM pathway under robust experimental conditions involving the acquisition of a large number of functional volumes, the application of broadband auditory stimuli of high intensity, and the use of sparse temporal sampling to avoid scanner noise effects and increase signal-to-noise ratio. Nineteen healthy volunteers were subjected to broadband white noise in a block paradigm; each run had four sound-on/off alternations and was repeated nine times for each subject. Sparse sampling (TR = 8 s) was used. In addition to traditional gray matter (GM) auditory center activation, WM activation was detected in the isthmus and midbody of the corpus callosum (CC), tapetum, auditory radiation, lateral lemniscus, and decussation of the superior cerebellar peduncles. At the individual level, 13 of 19 subjects (68 %) had CC activation. Callosal WM exhibited a temporal delay of approximately 8 s in response to the stimulation compared with GM. These findings suggest that direct evaluation of the entire functional network of the central auditory system may be possible using fMRI, which may aid in understanding the neurophysiological basis of the central auditory system and in developing treatment strategies for various central auditory disorders. (orig.)

  11. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  12. Replicated landscape genetic and network analyses reveal wide variation in functional connectivity for American pikas.

    Science.gov (United States)

    Castillo, Jessica A; Epps, Clinton W; Jeffress, Mackenzie R; Ray, Chris; Rodhouse, Thomas J; Schwalm, Donelle

    2016-09-01

    Landscape connectivity is essential for maintaining viable populations, particularly for species restricted to fragmented habitats or naturally arrayed in metapopulations and facing rapid climate change. The importance of assessing both structural connectivity (physical distribution of favorable habitat patches) and functional connectivity (how species move among habitat patches) for managing such species is well understood. However, the degree to which functional connectivity for a species varies among landscapes, and the resulting implications for conservation, have rarely been assessed. We used a landscape genetics approach to evaluate resistance to gene flow and, thus, to determine how landscape and climate-related variables influence gene flow for American pikas (Ochotona princeps) in eight federally managed sites in the western United States. We used empirically derived, individual-based landscape resistance models in conjunction with predictive occupancy models to generate patch-based network models describing functional landscape connectivity. Metareplication across landscapes enabled identification of limiting factors for dispersal that would not otherwise have been apparent. Despite the cool microclimates characteristic of pika habitat, south-facing aspects consistently represented higher resistance to movement, supporting the previous hypothesis that exposure to relatively high temperatures may limit dispersal in American pikas. We found that other barriers to dispersal included areas with a high degree of topographic relief, such as cliffs and ravines, as well as streams and distances greater than 1-4 km depending on the site. Using the empirically derived network models of habitat patch connectivity, we identified habitat patches that were likely disproportionately important for maintaining functional connectivity, areas in which habitat appeared fragmented, and locations that could be targeted for management actions to improve functional connectivity

  13. Structural fragment clustering reveals novel structural and functional motifs in α-helical transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Vassilev Boris

    2010-04-01

    Full Text Available Abstract Background A large proportion of an organism's genome encodes for membrane proteins. Membrane proteins are important for many cellular processes, and several diseases can be linked to mutations in them. With the tremendous growth of sequence data, there is an increasing need to reliably identify membrane proteins from sequence, to functionally annotate them, and to correctly predict their topology. Results We introduce a technique called structural fragment clustering, which learns sequential motifs from 3D structural fragments. From over 500,000 fragments, we obtain 213 statistically significant, non-redundant, and novel motifs that are highly specific to α-helical transmembrane proteins. From these 213 motifs, 58 of them were assigned to function and checked in the scientific literature for a biological assessment. Seventy percent of the motifs are found in co-factor, ligand, and ion binding sites, 30% at protein interaction interfaces, and 12% bind specific lipids such as glycerol or cardiolipins. The vast majority of motifs (94% appear across evolutionarily unrelated families, highlighting the modularity of functional design in membrane proteins. We describe three novel motifs in detail: (1 a dimer interface motif found in voltage-gated chloride channels, (2 a proton transfer motif found in heme-copper oxidases, and (3 a convergently evolved interface helix motif found in an aspartate symporter, a serine protease, and cytochrome b. Conclusions Our findings suggest that functional modules exist in membrane proteins, and that they occur in completely different evolutionary contexts and cover different binding sites. Structural fragment clustering allows us to link sequence motifs to function through clusters of structural fragments. The sequence motifs can be applied to identify and characterize membrane proteins in novel genomes.

  14. Graph theoretical analysis reveals disrupted topological properties of whole brain functional networks in temporal lobe epilepsy.

    Science.gov (United States)

    Wang, Junjing; Qiu, Shijun; Xu, Yong; Liu, Zhenyin; Wen, Xue; Hu, Xiangshu; Zhang, Ruibin; Li, Meng; Wang, Wensheng; Huang, Ruiwang

    2014-09-01

    Temporal lobe epilepsy (TLE) is one of the most common forms of drug-resistant epilepsy. Previous studies have indicated that the TLE-related impairments existed in extensive local functional networks. However, little is known about the alterations in the topological properties of whole brain functional networks. In this study, we acquired resting-state BOLD-fMRI (rsfMRI) data from 26 TLE patients and 25 healthy controls, constructed their whole brain functional networks, compared the differences in topological parameters between the TLE patients and the controls, and analyzed the correlation between the altered topological properties and the epilepsy duration. The TLE patients showed significant increases in clustering coefficient and characteristic path length, but significant decrease in global efficiency compared to the controls. We also found altered nodal parameters in several regions in the TLE patients, such as the bilateral angular gyri, left middle temporal gyrus, right hippocampus, triangular part of left inferior frontal gyrus, left inferior parietal but supramarginal and angular gyri, and left parahippocampus gyrus. Further correlation analysis showed that the local efficiency of the TLE patients correlated positively with the epilepsy duration. Our results indicated the disrupted topological properties of whole brain functional networks in TLE patients. Our findings indicated the TLE-related impairments in the whole brain functional networks, which may help us to understand the clinical symptoms of TLE patients and offer a clue for the diagnosis and treatment of the TLE patients. Copyright © 2014 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  15. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  16. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  17. Functional Analysis of In-frame Indel ARID1A Mutations Reveals New Regulatory Mechanisms of Its Tumor Suppressor Functions

    Directory of Open Access Journals (Sweden)

    Bin Guan

    2012-10-01

    Full Text Available AT-rich interactive domain 1A (ARID1A has emerged as a new tumor suppressor in which frequent somatic mutations have been identified in several types of human cancers. Although most ARID1A somatic mutations are frame-shift or nonsense mutations that contribute to mRNA decay and loss of protein expression, 5% of ARID1A mutations are in-frame insertions or deletions (indels that involve only a small stretch of peptides. Naturally occurring in-frame indel mutations provide unique and useful models to explore the biology and regulatory role of ARID1A. In this study, we analyzed indel mutations identified in gynecological cancers to determine how these mutations affect the tumor suppressor function of ARID1A. Our results demonstrate that all in-frame mutants analyzed lost their ability to inhibit cellular proliferation or activate transcription of CDKN1A, which encodes p21, a downstream effector of ARID1A. We also showed that ARID1A is a nucleocytoplasmic protein whose stability depends on its subcellular localization. Nuclear ARID1A is less stable than cytoplasmic ARID1A because ARID1A is rapidly degraded by the ubiquitin-proteasome system in the nucleus. In-frame deletions affecting the consensus nuclear export signal reduce steady-state protein levels of ARID1A. This defect in nuclear exportation leads to nuclear retention and subsequent degradation. Our findings delineate a mechanism underlying the regulation of ARID1A subcellular distribution and protein stability and suggest that targeting the nuclear ubiquitin-proteasome system can increase the amount of the ARID1A protein in the nucleus and restore its tumor suppressor functions.

  18. Functionalization of Planet-Satellite Nanostructures Revealed by Nanoscopic Localization of Distinct Macromolecular Species

    KAUST Repository

    Rossner, Christian

    2016-09-26

    The development of a straightforward method is reported to form hybrid polymer/gold planet-satellite nanostructures (PlSNs) with functional polymer. Polyacrylate type polymer with benzyl chloride in its backbone as a macromolecular tracer is synthesized to study its localization within PlSNs by analyzing the elemental distribution of chlorine. The functionalized nanohybrid structures are analyzed by scanning transmission electron microscopy, electron energy loss spectroscopy, and spectrum imaging. The results show that the RAFT (reversible addition-fragmentation chain transfer) polymers\\' sulfur containing end groups are colocalized at the gold cores, both within nanohybrids of simple core-shell morphology and within higher order PlSNs, providing microscopic evidence for the affinity of the RAFT group toward gold surfaces. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA., Weinheim.

  19. Functional Asymmetries Revealed in Visually Guided Saccades: An fMRI Study

    Energy Technology Data Exchange (ETDEWEB)

    Petit, L.; Zago, L.; Vigneau, M.; Crivello, F.; Mazoyer, B.; Mellet, E.; Tzourio-Mazoyer, N. [Centre for Imaging, Neurosciences and Applications to Pathologies, UMR6232 CNRS CEA (France); Mazoyer, B. [Centre Hospitalier Universitaire, Caen (France); Andersson, F. [Institut Federatif de Recherche 135, Imagerie fonctionnelle, Tours (France); Mazoyer, B. [Institut Universitaire de France, Paris (France)

    2009-07-01

    Because eye movements are a fundamental tool for spatial exploration, we hypothesized that the neural bases of these movements in humans should be under right cerebral dominance, as already described for spatial attention. We used functional magnetic resonance imaging in 27 right-handed participants who alternated central fixation with either large or small visually guided saccades (VGS), equally performed in both directions. Hemispheric functional asymmetry was analyzed to identify whether brain regions showing VGS activation elicited hemispheric asymmetries. Hemispheric anatomical asymmetry was also estimated to assess its influence on the VGS functional lateralization. Right asymmetrical activations of a saccadic/attentional system were observed in the lateral frontal eye fields (FEF), the anterior part of the intra-parietal sulcus (aIPS), the posterior third of the superior temporal sulcus (STS), the occipito-temporal junction (MT/V5 area), the middle occipital gyrus, and medially along the calcarine fissure (V1). The present rightward functional asymmetries were not related to differences in gray matter (GM) density/sulci positions between right and left hemispheres in the pre-central, intra-parietal, superior temporal, and extrastriate regions. Only V1 asymmetries were explained for almost 20% of the variance by a difference in the position of the right and left calcarine fissures. Left asymmetrical activations of a saccadic motor system were observed in the medial FEF and in the motor strip eye field along the Rolando sulcus. They were not explained by GM asymmetries. We suggest that the leftward saccadic motor asymmetry is part of a general dominance of the left motor cortex in right-handers, which must include an effect of sighting dominance. Our results demonstrate that, although bilateral by nature, the brain network involved in the execution of VGSs, irrespective of their direction, presented specific right and left asymmetries that were not related to

  20. Functional Asymmetries Revealed in Visually Guided Saccades: An fMRI Study

    International Nuclear Information System (INIS)

    Petit, L.; Zago, L.; Vigneau, M.; Crivello, F.; Mazoyer, B.; Mellet, E.; Tzourio-Mazoyer, N.; Mazoyer, B.; Andersson, F.; Mazoyer, B.

    2009-01-01

    Because eye movements are a fundamental tool for spatial exploration, we hypothesized that the neural bases of these movements in humans should be under right cerebral dominance, as already described for spatial attention. We used functional magnetic resonance imaging in 27 right-handed participants who alternated central fixation with either large or small visually guided saccades (VGS), equally performed in both directions. Hemispheric functional asymmetry was analyzed to identify whether brain regions showing VGS activation elicited hemispheric asymmetries. Hemispheric anatomical asymmetry was also estimated to assess its influence on the VGS functional lateralization. Right asymmetrical activations of a saccadic/attentional system were observed in the lateral frontal eye fields (FEF), the anterior part of the intra-parietal sulcus (aIPS), the posterior third of the superior temporal sulcus (STS), the occipito-temporal junction (MT/V5 area), the middle occipital gyrus, and medially along the calcarine fissure (V1). The present rightward functional asymmetries were not related to differences in gray matter (GM) density/sulci positions between right and left hemispheres in the pre-central, intra-parietal, superior temporal, and extrastriate regions. Only V1 asymmetries were explained for almost 20% of the variance by a difference in the position of the right and left calcarine fissures. Left asymmetrical activations of a saccadic motor system were observed in the medial FEF and in the motor strip eye field along the Rolando sulcus. They were not explained by GM asymmetries. We suggest that the leftward saccadic motor asymmetry is part of a general dominance of the left motor cortex in right-handers, which must include an effect of sighting dominance. Our results demonstrate that, although bilateral by nature, the brain network involved in the execution of VGSs, irrespective of their direction, presented specific right and left asymmetries that were not related to

  1. Decoupling phylogenetic and functional diversity to reveal hidden signals in community assembly

    Czech Academy of Sciences Publication Activity Database

    de Bello, Francesco; Šmilauer, P.; Diniz-Filho, J. A. F.; Carmona, C. P.; Lososová, Z.; Herben, Tomáš; Götzenberger, Lars

    2017-01-01

    Roč. 8, č. 10 (2017), s. 1200-1211 ISSN 2041-210X R&D Projects: GA ČR(CZ) GA16-15012S; GA ČR GB14-36079G EU Projects: European Commission(XE) 267243 Institutional support: RVO:67985939 Keywords : community ecology * phylogenetic diversity * functional diversity Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 5.708, year: 2016

  2. The functional micro-organization of grid cells revealed by cellular-resolution imaging.

    Science.gov (United States)

    Heys, James G; Rangarajan, Krsna V; Dombeck, Daniel A

    2014-12-03

    Establishing how grid cells are anatomically arranged, on a microscopic scale, in relation to their firing patterns in the environment would facilitate a greater microcircuit-level understanding of the brain's representation of space. However, all previous grid cell recordings used electrode techniques that provide limited descriptions of fine-scale organization. We therefore developed a technique for cellular-resolution functional imaging of medial entorhinal cortex (MEC) neurons in mice navigating a virtual linear track, enabling a new experimental approach to study MEC. Using these methods, we show that grid cells are physically clustered in MEC compared to nongrid cells. Additionally, we demonstrate that grid cells are functionally micro-organized: the similarity between the environment firing locations of grid cell pairs varies as a function of the distance between them according to a "Mexican hat"-shaped profile. This suggests that, on average, nearby grid cells have more similar spatial firing phases than those further apart. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Dynamic changes in protein functional linkage networks revealed by integration with gene expression data.

    Directory of Open Access Journals (Sweden)

    Shubhada R Hegde

    2008-11-01

    Full Text Available Response of cells to changing environmental conditions is governed by the dynamics of intricate biomolecular interactions. It may be reasonable to assume, proteins being the dominant macromolecules that carry out routine cellular functions, that understanding the dynamics of protein:protein interactions might yield useful insights into the cellular responses. The large-scale protein interaction data sets are, however, unable to capture the changes in the profile of protein:protein interactions. In order to understand how these interactions change dynamically, we have constructed conditional protein linkages for Escherichia coli by integrating functional linkages and gene expression information. As a case study, we have chosen to analyze UV exposure in wild-type and SOS deficient E. coli at 20 minutes post irradiation. The conditional networks exhibit similar topological properties. Although the global topological properties of the networks are similar, many subtle local changes are observed, which are suggestive of the cellular response to the perturbations. Some such changes correspond to differences in the path lengths among the nodes of carbohydrate metabolism correlating with its loss in efficiency in the UV treated cells. Similarly, expression of hubs under unique conditions reflects the importance of these genes. Various centrality measures applied to the networks indicate increased importance for replication, repair, and other stress proteins for the cells under UV treatment, as anticipated. We thus propose a novel approach for studying an organism at the systems level by integrating genome-wide functional linkages and the gene expression data.

  4. Psychophysical "blinding" methods reveal a functional hierarchy of unconscious visual processing.

    Science.gov (United States)

    Breitmeyer, Bruno G

    2015-09-01

    Numerous non-invasive experimental "blinding" methods exist for suppressing the phenomenal awareness of visual stimuli. Not all of these suppressive methods occur at, and thus index, the same level of unconscious visual processing. This suggests that a functional hierarchy of unconscious visual processing can in principle be established. The empirical results of extant studies that have used a number of different methods and additional reasonable theoretical considerations suggest the following tentative hierarchy. At the highest levels in this hierarchy is unconscious processing indexed by object-substitution masking. The functional levels indexed by crowding, the attentional blink (and other attentional blinding methods), backward pattern masking, metacontrast masking, continuous flash suppression, sandwich masking, and single-flash interocular suppression, fall at progressively lower levels, while unconscious processing at the lowest levels is indexed by eye-based binocular-rivalry suppression. Although unconscious processing levels indexed by additional blinding methods is yet to be determined, a tentative placement at lower levels in the hierarchy is also given for unconscious processing indexed by Troxler fading and adaptation-induced blindness, and at higher levels in the hierarchy indexed by attentional blinding effects in addition to the level indexed by the attentional blink. The full mapping of levels in the functional hierarchy onto cortical activation sites and levels is yet to be determined. The existence of such a hierarchy bears importantly on the search for, and the distinctions between, neural correlates of conscious and unconscious vision. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Endozoicomonas genomes reveal functional adaptation and plasticity in bacterial strains symbiotically associated with diverse marine hosts

    KAUST Repository

    Neave, Matthew J.

    2017-01-17

    Endozoicomonas bacteria are globally distributed and often abundantly associated with diverse marine hosts including reef-building corals, yet their function remains unknown. In this study we generated novel Endozoicomonas genomes from single cells and metagenomes obtained directly from the corals Stylophora pistillata, Pocillopora verrucosa, and Acropora humilis. We then compared these culture-independent genomes to existing genomes of bacterial isolates acquired from a sponge, sea slug, and coral to examine the functional landscape of this enigmatic genus. Sequencing and analysis of single cells and metagenomes resulted in four novel genomes with 60–76% and 81–90% genome completeness, respectively. These data also confirmed that Endozoicomonas genomes are large and are not streamlined for an obligate endosymbiotic lifestyle, implying that they have free-living stages. All genomes show an enrichment of genes associated with carbon sugar transport and utilization and protein secretion, potentially indicating that Endozoicomonas contribute to the cycling of carbohydrates and the provision of proteins to their respective hosts. Importantly, besides these commonalities, the genomes showed evidence for differential functional specificity and diversification, including genes for the production of amino acids. Given this metabolic diversity of Endozoicomonas we propose that different genotypes play disparate roles and have diversified in concert with their hosts.

  6. Comprehensive proteome analysis of lysosomes reveals the diverse function of macrophages in immune responses.

    Science.gov (United States)

    Gao, Yanpan; Chen, Yanyu; Zhan, Shaohua; Zhang, Wenhao; Xiong, Feng; Ge, Wei

    2017-01-31

    Phagocytosis and autophagy in macrophages have been shown to be essential to both innate and adaptive immunity. Lysosomes are the main catabolic subcellular organelles responsible for degradation and recycling of both extracellular and intracellular material, which are the final steps in phagocytosis and autophagy. However, the molecular mechanisms underlying lysosomal functions after infection remain obscure. In this study, we conducted a quantitative proteomics analysis of the changes in constitution and glycosylation of proteins in lysosomes derived from murine RAW 264.7 macrophage cells treated with different types of pathogens comprising examples of bacteria (Listeria monocytogenes, L. m), DNA viruses (herpes simplex virus type-1, HSV-1) and RNA viruses (vesicular stomatitis virus, VSV). In total, 3,704 lysosome-related proteins and 300 potential glycosylation sites on 193 proteins were identified. Comparative analysis showed that the aforementioned pathogens induced distinct alterations in the proteome of the lysosome, which is closely associated with the immune functions of macrophages, such as toll-like receptor activation, inflammation and antigen-presentation. The most significant changes in proteins and fluctuations in glycosylation were also determined. Furthermore, Western blot analysis showed that the changes in expression of these proteins were undetectable at the whole cell level. Thus, our study provides unique insights into the function of lysosomes in macrophage activation and immune responses.

  7. Comparative genomics provides insights into the lifestyle and reveals functional heterogeneity of dark septate endophytic fungi.

    Science.gov (United States)

    Knapp, Dániel G; Németh, Julianna B; Barry, Kerrie; Hainaut, Matthieu; Henrissat, Bernard; Johnson, Jenifer; Kuo, Alan; Lim, Joanne Hui Ping; Lipzen, Anna; Nolan, Matt; Ohm, Robin A; Tamás, László; Grigoriev, Igor V; Spatafora, Joseph W; Nagy, László G; Kovács, Gábor M

    2018-04-20

    Dark septate endophytes (DSE) are a form-group of root endophytic fungi with elusive functions. Here, the genomes of two common DSE of semiarid areas, Cadophora sp. and Periconia macrospinosa were sequenced and analyzed with another 32 ascomycetes of different lifestyles. Cadophora sp. (Helotiales) and P. macrospinosa (Pleosporales) have genomes of 70.46 Mb and 54.99 Mb with 22,766 and 18,750 gene models, respectively. The majority of DSE-specific protein clusters lack functional annotation with no similarity to characterized proteins, implying that they have evolved unique genetic innovations. Both DSE possess an expanded number of carbohydrate active enzymes (CAZymes), including plant cell wall degrading enzymes (PCWDEs). Those were similar in three other DSE, and contributed a signal for the separation of root endophytes in principal component analyses of CAZymes, indicating shared genomic traits of DSE fungi. Number of secreted proteases and lipases, aquaporins, and genes linked to melanin synthesis were also relatively high in our fungi. In spite of certain similarities between our two DSE, we observed low levels of convergence in their gene family evolution. This suggests that, despite originating from the same habitat, these two fungi evolved along different evolutionary trajectories and display considerable functional differences within the endophytic lifestyle.

  8. Endozoicomonas genomes reveal functional adaptation and plasticity in bacterial strains symbiotically associated with diverse marine hosts

    KAUST Repository

    Neave, Matthew J.; Michell, Craig; Apprill, Amy; Voolstra, Christian R.

    2017-01-01

    Endozoicomonas bacteria are globally distributed and often abundantly associated with diverse marine hosts including reef-building corals, yet their function remains unknown. In this study we generated novel Endozoicomonas genomes from single cells and metagenomes obtained directly from the corals Stylophora pistillata, Pocillopora verrucosa, and Acropora humilis. We then compared these culture-independent genomes to existing genomes of bacterial isolates acquired from a sponge, sea slug, and coral to examine the functional landscape of this enigmatic genus. Sequencing and analysis of single cells and metagenomes resulted in four novel genomes with 60–76% and 81–90% genome completeness, respectively. These data also confirmed that Endozoicomonas genomes are large and are not streamlined for an obligate endosymbiotic lifestyle, implying that they have free-living stages. All genomes show an enrichment of genes associated with carbon sugar transport and utilization and protein secretion, potentially indicating that Endozoicomonas contribute to the cycling of carbohydrates and the provision of proteins to their respective hosts. Importantly, besides these commonalities, the genomes showed evidence for differential functional specificity and diversification, including genes for the production of amino acids. Given this metabolic diversity of Endozoicomonas we propose that different genotypes play disparate roles and have diversified in concert with their hosts.

  9. Continental cichlid radiations: functional diversity reveals the role of changing ecological opportunity in the Neotropics.

    Science.gov (United States)

    Arbour, Jessica Hilary; López-Fernández, Hernán

    2016-08-17

    Adaptive radiations have been hypothesized to contribute broadly to the diversity of organisms. Models of adaptive radiation predict that ecological opportunity and ecological release, the availability of empty ecological niches and the response by adapting lineages to occupy them, respectively, drive patterns of phenotypic and lineage diversification. Adaptive radiations driven by 'ecological opportunity' are well established in island systems; it is less clear if ecological opportunity influences continent-wide diversification. We use Neotropical cichlid fishes to test if variation in rates of functional evolution is consistent with changing ecological opportunity. Across a functional morphological axis associated with ram-suction feeding traits, evolutionary rates declined through time as lineages diversified in South America. Evolutionary rates of ram-suction functional morphology also appear to have accelerated as cichlids colonized Central America and encountered renewed opportunity. Our results suggest that ecological opportunity may play an important role in shaping patterns of morphological diversity of even broadly distributed lineages like Neotropical cichlids. © 2016 The Author(s).

  10. Progress in studies on nucleolus functions

    International Nuclear Information System (INIS)

    Chang Lei; Zhou Guangming

    2011-01-01

    Nucleoli is the sites for ribosome synthesis and processing, however, recent approaches have revealed that it is also involved in variety of cellular processes, especially the cellular stress response. As sensors, nucleoli regulate the localization of nucleolar proteins, such as (Alternate Reading Frame, ARF), and the activation of key factors, such as P53, and consequently mediate the cellular stress response.In this paper, recent progress in the studies on nucleolar functions in cellular stress response to radiation is reviewed. (authors)

  11. Functional photoreceptor loss revealed with adaptive optics: an alternate cause of color blindness.

    Science.gov (United States)

    Carroll, Joseph; Neitz, Maureen; Hofer, Heidi; Neitz, Jay; Williams, David R

    2004-06-01

    There is enormous variation in the X-linked L/M (long/middle wavelength sensitive) gene array underlying "normal" color vision in humans. This variability has been shown to underlie individual variation in color matching behavior. Recently, red-green color blindness has also been shown to be associated with distinctly different genotypes. This has opened the possibility that there may be important phenotypic differences within classically defined groups of color blind individuals. Here, adaptive optics retinal imaging has revealed a mechanism for producing dichromatic color vision in which the expression of a mutant cone photopigment gene leads to the loss of the entire corresponding class of cone photoreceptor cells. Previously, the theory that common forms of inherited color blindness could be caused by the loss of photoreceptor cells had been discounted. We confirm that remarkably, this loss of one-third of the cones does not impair any aspect of vision other than color.

  12. Sex differences in functional activation patterns revealed by increased emotion processing demands.

    Science.gov (United States)

    Hall, Geoffrey B C; Witelson, Sandra F; Szechtman, Henry; Nahmias, Claude

    2004-02-09

    Two [O(15)] PET studies assessed sex differences regional brain activation in the recognition of emotional stimuli. Study I revealed that the recognition of emotion in visual faces resulted in bilateral frontal activation in women, and unilateral right-sided activation in men. In study II, the complexity of the emotional face task was increased through tje addition of associated auditory emotional stimuli. Men again showed unilateral frontal activation, in this case to the left; whereas women did not show bilateral frontal activation, but showed greater limbic activity. These results suggest that when processing broader cross-modal emotional stimuli, men engage more in associative cognitive strategies while women draw more on primary emotional references.

  13. Functional gene polymorphism to reveal species history: the case of the CRTISO gene in cultivated carrots.

    Directory of Open Access Journals (Sweden)

    Vanessa Soufflet-Freslon

    Full Text Available Carrot is a vegetable cultivated worldwide for the consumption of its root. Historical data indicate that root colour has been differentially selected over time and according to geographical areas. Root pigmentation depends on the relative proportion of different carotenoids for the white, yellow, orange and red types but only internally for the purple one. The genetic control for root carotenoid content might be partially associated with carotenoid biosynthetic genes. Carotenoid isomerase (CRTISO has emerged as a regulatory step in the carotenoid biosynthesis pathway and could be a good candidate to show how a metabolic pathway gene reflects a species genetic history.In this study, the nucleotide polymorphism and the linkage disequilibrium among the complete CRTISO sequence, and the deviation from neutral expectation were analysed by considering population subdivision revealed with 17 microsatellite markers. A sample of 39 accessions, which represented different geographical origins and root colours, was used. Cultivated carrot was divided into two genetic groups: one from Middle East and Asia (Eastern group, and another one mainly from Europe (Western group. The Western and Eastern genetic groups were suggested to be differentially affected by selection: a signature of balancing selection was detected within the first group whereas the second one showed no selection. A focus on orange-rooted carrots revealed that cultivars cultivated in Asia were mainly assigned to the Western group but showed CRTISO haplotypes common to Eastern carrots.The carotenoid pathway CRTISO gene data proved to be complementary to neutral markers in order to bring critical insight in the cultivated carrot history. We confirmed the occurrence of two migration events since domestication. Our results showed a European background in material from Japan and Central Asia. While confirming the introduction of European carrots in Japanese resources, the history of Central Asia

  14. Evolution of the snake body form reveals homoplasy in amniote Hox gene function.

    Science.gov (United States)

    Head, Jason J; Polly, P David

    2015-04-02

    Hox genes regulate regionalization of the axial skeleton in vertebrates, and changes in their expression have been proposed to be a fundamental mechanism driving the evolution of new body forms. The origin of the snake-like body form, with its deregionalized pre-cloacal axial skeleton, has been explained as either homogenization of Hox gene expression domains, or retention of standard vertebrate Hox domains with alteration of downstream expression that suppresses development of distinct regions. Both models assume a highly regionalized ancestor, but the extent of deregionalization of the primaxial domain (vertebrae, dorsal ribs) of the skeleton in snake-like body forms has never been analysed. Here we combine geometric morphometrics and maximum-likelihood analysis to show that the pre-cloacal primaxial domain of elongate, limb-reduced lizards and snakes is not deregionalized compared with limbed taxa, and that the phylogenetic structure of primaxial morphology in reptiles does not support a loss of regionalization in the evolution of snakes. We demonstrate that morphometric regional boundaries correspond to mapped gene expression domains in snakes, suggesting that their primaxial domain is patterned by a normally functional Hox code. Comparison of primaxial osteology in fossil and modern amniotes with Hox gene distributions within Amniota indicates that a functional, sequentially expressed Hox code patterned a subtle morphological gradient along the anterior-posterior axis in stem members of amniote clades and extant lizards, including snakes. The highly regionalized skeletons of extant archosaurs and mammals result from independent evolution in the Hox code and do not represent ancestral conditions for clades with snake-like body forms. The developmental origin of snakes is best explained by decoupling of the primaxial and abaxial domains and by increases in somite number, not by changes in the function of primaxial Hox genes.

  15. Evidence of functional connectivity between auditory cortical areas revealed by amplitude modulation sound processing.

    Science.gov (United States)

    Guéguin, Marie; Le Bouquin-Jeannès, Régine; Faucon, Gérard; Chauvel, Patrick; Liégeois-Chauvel, Catherine

    2007-02-01

    The human auditory cortex includes several interconnected areas. A better understanding of the mechanisms involved in auditory cortical functions requires a detailed knowledge of neuronal connectivity between functional cortical regions. In human, it is difficult to track in vivo neuronal connectivity. We investigated the interarea connection in vivo in the auditory cortex using a method of directed coherence (DCOH) applied to depth auditory evoked potentials (AEPs). This paper presents simultaneous AEPs recordings from insular gyrus (IG), primary and secondary cortices (Heschl's gyrus and planum temporale), and associative areas (Brodmann area [BA] 22) with multilead intracerebral electrodes in response to sinusoidal modulated white noises in 4 epileptic patients who underwent invasive monitoring with depth electrodes for epilepsy surgery. DCOH allowed estimation of the causality between 2 signals recorded from different cortical sites. The results showed 1) a predominant auditory stream within the primary auditory cortex from the most medial region to the most lateral one whatever the modulation frequency, 2) unidirectional functional connection from the primary to secondary auditory cortex, 3) a major auditory propagation from the posterior areas to the anterior ones, particularly at 8, 16, and 32 Hz, and 4) a particular role of Heschl's sulcus dispatching information to the different auditory areas. These findings suggest that cortical processing of auditory information is performed in serial and parallel streams. Our data showed that the auditory propagation could not be associated to a unidirectional traveling wave but to a constant interaction between these areas that could reflect the large adaptive and plastic capacities of auditory cortex. The role of the IG is discussed.

  16. A novel flow cytometric HTS assay reveals functional modulators of ATP binding cassette transporter ABCB6.

    Science.gov (United States)

    Polireddy, Kishore; Khan, Mohiuddin Md Taimur; Chavan, Hemantkumar; Young, Susan; Ma, Xiaochao; Waller, Anna; Garcia, Matthew; Perez, Dominique; Chavez, Stephanie; Strouse, Jacob J; Haynes, Mark K; Bologa, Cristian G; Oprea, Tudor I; Tegos, George P; Sklar, Larry A; Krishnamurthy, Partha

    2012-01-01

    ABCB6 is a member of the adenosine triphosphate (ATP)-binding cassette family of transporter proteins that is increasingly recognized as a relevant physiological and therapeutic target. Evaluation of modulators of ABCB6 activity would pave the way toward a more complete understanding of the significance of this transport process in tumor cell growth, proliferation and therapy-related drug resistance. In addition, this effort would improve our understanding of the function of ABCB6 in normal physiology with respect to heme biosynthesis, and cellular adaptation to metabolic demand and stress responses. To search for modulators of ABCB6, we developed a novel cell-based approach that, in combination with flow cytometric high-throughput screening (HTS), can be used to identify functional modulators of ABCB6. Accumulation of protoporphyrin, a fluorescent molecule, in wild-type ABCB6 expressing K562 cells, forms the basis of the HTS assay. Screening the Prestwick Chemical Library employing the HTS assay identified four compounds, benzethonium chloride, verteporfin, tomatine hydrochloride and piperlongumine, that reduced ABCB6 mediated cellular porphyrin levels. Validation of the identified compounds employing the hemin-agarose affinity chromatography and mitochondrial transport assays demonstrated that three out of the four compounds were capable of inhibiting ABCB6 mediated hemin transport into isolated mitochondria. However, only verteporfin and tomatine hydrochloride inhibited ABCB6's ability to compete with hemin as an ABCB6 substrate. This assay is therefore sensitive, robust, and suitable for automation in a high-throughput environment as demonstrated by our identification of selective functional modulators of ABCB6. Application of this assay to other libraries of synthetic compounds and natural products is expected to identify novel modulators of ABCB6 activity.

  17. A novel flow cytometric HTS assay reveals functional modulators of ATP binding cassette transporter ABCB6.

    Directory of Open Access Journals (Sweden)

    Kishore Polireddy

    Full Text Available ABCB6 is a member of the adenosine triphosphate (ATP-binding cassette family of transporter proteins that is increasingly recognized as a relevant physiological and therapeutic target. Evaluation of modulators of ABCB6 activity would pave the way toward a more complete understanding of the significance of this transport process in tumor cell growth, proliferation and therapy-related drug resistance. In addition, this effort would improve our understanding of the function of ABCB6 in normal physiology with respect to heme biosynthesis, and cellular adaptation to metabolic demand and stress responses. To search for modulators of ABCB6, we developed a novel cell-based approach that, in combination with flow cytometric high-throughput screening (HTS, can be used to identify functional modulators of ABCB6. Accumulation of protoporphyrin, a fluorescent molecule, in wild-type ABCB6 expressing K562 cells, forms the basis of the HTS assay. Screening the Prestwick Chemical Library employing the HTS assay identified four compounds, benzethonium chloride, verteporfin, tomatine hydrochloride and piperlongumine, that reduced ABCB6 mediated cellular porphyrin levels. Validation of the identified compounds employing the hemin-agarose affinity chromatography and mitochondrial transport assays demonstrated that three out of the four compounds were capable of inhibiting ABCB6 mediated hemin transport into isolated mitochondria. However, only verteporfin and tomatine hydrochloride inhibited ABCB6's ability to compete with hemin as an ABCB6 substrate. This assay is therefore sensitive, robust, and suitable for automation in a high-throughput environment as demonstrated by our identification of selective functional modulators of ABCB6. Application of this assay to other libraries of synthetic compounds and natural products is expected to identify novel modulators of ABCB6 activity.

  18. Abnormal regional homogeneity in patients with essential tremor revealed by resting-state functional MRI.

    Directory of Open Access Journals (Sweden)

    Weidong Fang

    Full Text Available Essential tremor (ET is one of the most common movement disorders in human adults. It can be characterized as a progressive neurological disorder of which the most recognizable feature is a tremor of the arms or hands that is apparent during voluntary movements such as eating and writing. The pathology of ET remains unclear. Resting-state fMRI (RS-fMRI, as a non-invasive imaging technique, was employed to investigate abnormalities of functional connectivity in ET in the brain. Regional homogeneity (ReHo was used as a metric of RS-fMRI to assess the local functional connectivity abnormality in ET with 20 ET patients and 20 age- and gender-matched healthy controls (HC. The ET group showed decreased ReHo in the anterior and posterior bilateral cerebellar lobes, the bilateral thalamus and the insular lobe, and increased ReHo in the bilateral prefrontal and parietal cortices, the left primary motor cortex and left supplementary motor area. The abnormal ReHo value of ET patients in the bilateral anterior cerebellar lobes and the right posterior cerebellar lobe were negatively correlated with the tremor severity score, while positively correlated with that in the left primary motor cortex. These findings suggest that the abnormality in cerebello-thalamo-cortical motor pathway is involved in tremor generation and propagation, which may be related to motor-related symptoms in ET patients. Meanwhile, the abnormality in the prefrontal and parietal regions may be associated with non-motor symptoms in ET. These findings suggest that the ReHo could be utilized for investigations of functional-pathological mechanism of ET.

  19. Revealing molecular mechanisms by integrating high-dimensional functional screens with protein interaction data.

    Directory of Open Access Journals (Sweden)

    Angela Simeone

    2014-09-01

    Full Text Available Functional genomics screens using multi-parametric assays are powerful approaches for identifying genes involved in particular cellular processes. However, they suffer from problems like noise, and often provide little insight into molecular mechanisms. A bottleneck for addressing these issues is the lack of computational methods for the systematic integration of multi-parametric phenotypic datasets with molecular interactions. Here, we present Integrative Multi Profile Analysis of Cellular Traits (IMPACT. The main goal of IMPACT is to identify the most consistent phenotypic profile among interacting genes. This approach utilizes two types of external information: sets of related genes (IMPACT-sets and network information (IMPACT-modules. Based on the notion that interacting genes are more likely to be involved in similar functions than non-interacting genes, this data is used as a prior to inform the filtering of phenotypic profiles that are similar among interacting genes. IMPACT-sets selects the most frequent profile among a set of related genes. IMPACT-modules identifies sub-networks containing genes with similar phenotype profiles. The statistical significance of these selections is subsequently quantified via permutations of the data. IMPACT (1 handles multiple profiles per gene, (2 rescues genes with weak phenotypes and (3 accounts for multiple biases e.g. caused by the network topology. Application to a genome-wide RNAi screen on endocytosis showed that IMPACT improved the recovery of known endocytosis-related genes, decreased off-target effects, and detected consistent phenotypes. Those findings were confirmed by rescreening 468 genes. Additionally we validated an unexpected influence of the IGF-receptor on EGF-endocytosis. IMPACT facilitates the selection of high-quality phenotypic profiles using different types of independent information, thereby supporting the molecular interpretation of functional screens.

  20. Presbycusis Disrupts Spontaneous Activity Revealed by Resting-State Functional MRI

    Directory of Open Access Journals (Sweden)

    Yu-Chen Chen

    2018-03-01

    Full Text Available Purpose: Presbycusis, age-related hearing loss, is believed to involve neural changes in the central nervous system, which is associated with an increased risk of cognitive impairment. The goal of this study was to determine if presbycusis disrupted spontaneous neural activity in specific brain areas involved in auditory processing, attention and cognitive function using resting-state functional magnetic resonance imaging (fMRI approach.Methods: Hearing and resting-state fMRI measurements were obtained from 22 presbycusis patients and 23 age-, sex- and education-matched healthy controls. To identify changes in spontaneous neural activity associated with age-related hearing loss, we compared the amplitude of low-frequency fluctuations (ALFF and regional homogeneity (ReHo of fMRI signals in presbycusis patients vs. controls and then determined if these changes were linked to clinical measures of presbycusis.Results: Compared with healthy controls, presbycusis patients manifested decreased spontaneous activity mainly in the superior temporal gyrus (STG, parahippocampal gyrus (PHG, precuneus and inferior parietal lobule (IPL as well as increased neural activity in the middle frontal gyrus (MFG, cuneus and postcentral gyrus (PoCG. A significant negative correlation was observed between ALFF/ReHo activity in the STG and average hearing thresholds in presbycusis patients. Increased ALFF/ReHo activity in the MFG was positively correlated with impaired Trail-Making Test B (TMT-B scores, indicative of impaired cognitive function involving the frontal lobe.Conclusions: Presbycusis patients have disrupted spontaneous neural activity reflected by ALFF and ReHo measurements in several brain regions; these changes are associated with specific cognitive performance and speech/language processing. These findings mainly emphasize the crucial role of aberrant resting-state ALFF/ReHo patterns in presbycusis patients and will lead to a better understanding of the

  1. Presbycusis Disrupts Spontaneous Activity Revealed by Resting-State Functional MRI.

    Science.gov (United States)

    Chen, Yu-Chen; Chen, Huiyou; Jiang, Liang; Bo, Fan; Xu, Jin-Jing; Mao, Cun-Nan; Salvi, Richard; Yin, Xindao; Lu, Guangming; Gu, Jian-Ping

    2018-01-01

    Purpose : Presbycusis, age-related hearing loss, is believed to involve neural changes in the central nervous system, which is associated with an increased risk of cognitive impairment. The goal of this study was to determine if presbycusis disrupted spontaneous neural activity in specific brain areas involved in auditory processing, attention and cognitive function using resting-state functional magnetic resonance imaging (fMRI) approach. Methods : Hearing and resting-state fMRI measurements were obtained from 22 presbycusis patients and 23 age-, sex- and education-matched healthy controls. To identify changes in spontaneous neural activity associated with age-related hearing loss, we compared the amplitude of low-frequency fluctuations (ALFF) and regional homogeneity (ReHo) of fMRI signals in presbycusis patients vs. controls and then determined if these changes were linked to clinical measures of presbycusis. Results : Compared with healthy controls, presbycusis patients manifested decreased spontaneous activity mainly in the superior temporal gyrus (STG), parahippocampal gyrus (PHG), precuneus and inferior parietal lobule (IPL) as well as increased neural activity in the middle frontal gyrus (MFG), cuneus and postcentral gyrus (PoCG). A significant negative correlation was observed between ALFF/ReHo activity in the STG and average hearing thresholds in presbycusis patients. Increased ALFF/ReHo activity in the MFG was positively correlated with impaired Trail-Making Test B (TMT-B) scores, indicative of impaired cognitive function involving the frontal lobe. Conclusions : Presbycusis patients have disrupted spontaneous neural activity reflected by ALFF and ReHo measurements in several brain regions; these changes are associated with specific cognitive performance and speech/language processing. These findings mainly emphasize the crucial role of aberrant resting-state ALFF/ReHo patterns in presbycusis patients and will lead to a better understanding of the

  2. Structural-Functional Analysis Reveals a Specific Domain Organization in Family GH20 Hexosaminidases.

    Science.gov (United States)

    Val-Cid, Cristina; Biarnés, Xevi; Faijes, Magda; Planas, Antoni

    2015-01-01

    Hexosaminidases are involved in important biological processes catalyzing the hydrolysis of N-acetyl-hexosaminyl residues in glycosaminoglycans and glycoconjugates. The GH20 enzymes present diverse domain organizations for which we propose two minimal model architectures: Model A containing at least a non-catalytic GH20b domain and the catalytic one (GH20) always accompanied with an extra α-helix (GH20b-GH20-α), and Model B with only the catalytic GH20 domain. The large Bifidobacterium bifidum lacto-N-biosidase was used as a model protein to evaluate the minimal functional unit due to its interest and structural complexity. By expressing different truncated forms of this enzyme, we show that Model A architectures cannot be reduced to Model B. In particular, there are two structural requirements general to GH20 enzymes with Model A architecture. First, the non-catalytic domain GH20b at the N-terminus of the catalytic GH20 domain is required for expression and seems to stabilize it. Second, the substrate-binding cavity at the GH20 domain always involves a remote element provided by a long loop from the catalytic domain itself or, when this loop is short, by an element from another domain of the multidomain structure or from the dimeric partner. Particularly, the lacto-N-biosidase requires GH20b and the lectin-like domain at the N- and C-termini of the catalytic GH20 domain to be fully soluble and functional. The lectin domain provides this remote element to the active site. We demonstrate restoration of activity of the inactive GH20b-GH20-α construct (model A architecture) by a complementation assay with the lectin-like domain. The engineering of minimal functional units of multidomain GH20 enzymes must consider these structural requirements.

  3. Targeted Gene-Silencing Reveals the Functional Significance of Myocardin Signaling in the Failing Heart

    Science.gov (United States)

    Torrado, Mario; Iglesias, Raquel; Centeno, Alberto; López, Eduardo; Mikhailov, Alexander T.

    2011-01-01

    Background Myocardin (MYOCD), a potent transcriptional coactivator of smooth muscle (SM) and cardiac genes, is upregulated in failing myocardium in animal models and human end-stage heart failure (HF). However, the molecular and functional consequences of myocd upregulation in HF are still unclear. Methodology/Principal Findings The goal of the present study was to investigate if targeted inhibition of upregulated expression of myocd could influence failing heart gene expression and function. To this end, we used the doxorubicin (Dox)-induced diastolic HF (DHF) model in neonatal piglets, in which, as we show, not only myocd but also myocd-dependent SM-marker genes are highly activated in failing left ventricular (LV) myocardium. In this model, intra-myocardial delivery of short-hairpin RNAs, designed to target myocd variants expressed in porcine heart, leads on day 2 post-delivery to: (1) a decrease in the activated expression of myocd and myocd-dependent SM-marker genes in failing myocardium to levels seen in healthy control animals, (2) amelioration of impaired diastolic dysfunction, and (3) higher survival rates of DHF piglets. The posterior restoration of elevated myocd expression (on day 7 post-delivery) led to overexpression of myocd-dependent SM-marker genes in failing LV-myocardium that was associated with a return to altered diastolic function. Conclusions/Significance These data provide the first evidence that a moderate inhibition (e.g., normalization) of the activated MYOCD signaling in the diseased heart may be promising from a therapeutic point of view. PMID:22028870

  4. Targeted gene-silencing reveals the functional significance of myocardin signaling in the failing heart.

    Directory of Open Access Journals (Sweden)

    Mario Torrado

    Full Text Available BACKGROUND: Myocardin (MYOCD, a potent transcriptional coactivator of smooth muscle (SM and cardiac genes, is upregulated in failing myocardium in animal models and human end-stage heart failure (HF. However, the molecular and functional consequences of myocd upregulation in HF are still unclear. METHODOLOGY/PRINCIPAL FINDINGS: The goal of the present study was to investigate if targeted inhibition of upregulated expression of myocd could influence failing heart gene expression and function. To this end, we used the doxorubicin (Dox-induced diastolic HF (DHF model in neonatal piglets, in which, as we show, not only myocd but also myocd-dependent SM-marker genes are highly activated in failing left ventricular (LV myocardium. In this model, intra-myocardial delivery of short-hairpin RNAs, designed to target myocd variants expressed in porcine heart, leads on day 2 post-delivery to: (1 a decrease in the activated expression of myocd and myocd-dependent SM-marker genes in failing myocardium to levels seen in healthy control animals, (2 amelioration of impaired diastolic dysfunction, and (3 higher survival rates of DHF piglets. The posterior restoration of elevated myocd expression (on day 7 post-delivery led to overexpression of myocd-dependent SM-marker genes in failing LV-myocardium that was associated with a return to altered diastolic function. CONCLUSIONS/SIGNIFICANCE: These data provide the first evidence that a moderate inhibition (e.g., normalization of the activated MYOCD signaling in the diseased heart may be promising from a therapeutic point of view.

  5. A new therapeutic effect of simvastatin revealed by functional improvement in muscular dystrophy.

    Science.gov (United States)

    Whitehead, Nicholas P; Kim, Min Jeong; Bible, Kenneth L; Adams, Marvin E; Froehner, Stanley C

    2015-10-13

    Duchenne muscular dystrophy (DMD) is a lethal, degenerative muscle disease with no effective treatment. DMD muscle pathogenesis is characterized by chronic inflammation, oxidative stress, and fibrosis. Statins, cholesterol-lowering drugs, inhibit these deleterious processes in ischemic diseases affecting skeletal muscle, and therefore have potential to improve DMD. However, statins have not been considered for DMD, or other muscular dystrophies, principally because skeletal-muscle-related symptoms are rare, but widely publicized, side effects of these drugs. Here we show positive effects of statins in dystrophic skeletal muscle. Simvastatin dramatically reduced damage and enhanced muscle function in dystrophic (mdx) mice. Long-term simvastatin treatment vastly improved overall muscle health in mdx mice, reducing plasma creatine kinase activity, an established measure of muscle damage, to near-normal levels. This reduction was accompanied by reduced inflammation, more oxidative muscle fibers, and improved strength of the weak diaphragm muscle. Shorter-term treatment protected against muscle fatigue and increased mdx hindlimb muscle force by 40%, a value comparable to current dystrophin gene-based therapies. Increased force correlated with reduced NADPH Oxidase 2 protein expression, the major source of oxidative stress in dystrophic muscle. Finally, in old mdx mice with severe muscle degeneration, simvastatin enhanced diaphragm force and halved fibrosis, a major cause of functional decline in DMD. These improvements were accompanied by autophagy activation, a recent therapeutic target for DMD, and less oxidative stress. Together, our findings highlight that simvastatin substantially improves the overall health and function of dystrophic skeletal muscles and may provide an unexpected, novel therapy for DMD and related neuromuscular diseases.

  6. Computer Simulations Reveal Multiple Functions for Aromatic Residues in Cellulase Enzymes (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2012-07-01

    NREL researchers use high-performance computing to demonstrate fundamental roles of aromatic residues in cellulase enzyme tunnels. National Renewable Energy Laboratory (NREL) computer simulations of a key industrial enzyme, the Trichoderma reesei Family 6 cellulase (Cel6A), predict that aromatic residues near the enzyme's active site and at the entrance and exit tunnel perform different functions in substrate binding and catalysis, depending on their location in the enzyme. These results suggest that nature employs aromatic-carbohydrate interactions with a wide variety of binding affinities for diverse functions. Outcomes also suggest that protein engineering strategies in which mutations are made around the binding sites may require tailoring specific to the enzyme family. Cellulase enzymes ubiquitously exhibit tunnels or clefts lined with aromatic residues for processing carbohydrate polymers to monomers, but the molecular-level role of these aromatic residues remains unknown. In silico mutation of the aromatic residues near the catalytic site of Cel6A has little impact on the binding affinity, but simulation suggests that these residues play a major role in the glucopyranose ring distortion necessary for cleaving glycosidic bonds to produce fermentable sugars. Removal of aromatic residues at the entrance and exit of the cellulase tunnel, however, dramatically impacts the binding affinity. This suggests that these residues play a role in acquiring cellulose chains from the cellulose crystal and stabilizing the reaction product, respectively. These results illustrate that the role of aromatic-carbohydrate interactions varies dramatically depending on the position in the enzyme tunnel. As aromatic-carbohydrate interactions are present in all carbohydrate-active enzymes, the results have implications for understanding protein structure-function relationships in carbohydrate metabolism and recognition, carbon turnover in nature, and protein engineering

  7. 3D topology of orientation columns in visual cortex revealed by functional optical coherence tomography.

    Science.gov (United States)

    Nakamichi, Yu; Kalatsky, Valery A; Watanabe, Hideyuki; Sato, Takayuki; Rajagopalan, Uma Maheswari; Tanifuji, Manabu

    2018-04-01

    Orientation tuning is a canonical neuronal response property of six-layer visual cortex that is encoded in pinwheel structures with center orientation singularities. Optical imaging of intrinsic signals enables us to map these surface two-dimensional (2D) structures, whereas lack of appropriate techniques has not allowed us to visualize depth structures of orientation coding. In the present study, we performed functional optical coherence tomography (fOCT), a technique capable of acquiring a 3D map of the intrinsic signals, to study the topology of orientation coding inside the cat visual cortex. With this technique, for the first time, we visualized columnar assemblies in orientation coding that had been predicted from electrophysiological recordings. In addition, we found that the columnar structures were largely distorted around pinwheel centers: center singularities were not rigid straight lines running perpendicularly to the cortical surface but formed twisted string-like structures inside the cortex that turned and extended horizontally through the cortex. Looping singularities were observed with their respective termini accessing the same cortical surface via clockwise and counterclockwise orientation pinwheels. These results suggest that a 3D topology of orientation coding cannot be fully anticipated from 2D surface measurements. Moreover, the findings demonstrate the utility of fOCT as an in vivo mesoscale imaging method for mapping functional response properties of cortex in the depth axis. NEW & NOTEWORTHY We used functional optical coherence tomography (fOCT) to visualize three-dimensional structure of the orientation columns with millimeter range and micrometer spatial resolution. We validated vertically elongated columnar structure in iso-orientation domains. The columnar structure was distorted around pinwheel centers. An orientation singularity formed a string with tortuous trajectories inside the cortex and connected clockwise and counterclockwise

  8. Scientific and methodic approaches to reveal stability essence at the industrial enterprises and its functional components

    Directory of Open Access Journals (Sweden)

    Lyulyov Oleksii Valentynovych

    2016-12-01

    Full Text Available The article deals with theoretical analysis of the scientific approaches concerning definition of the concept “stability”, which exist in the scientific literature. There are five different approaches to interpret the concept “enterprise stability”, as an open economic system. On this base, the author’s definition of the enterprise stability is formed. Due to the carried out analysis of the main tendencies in changes of the industry development factors for 2006-2015 and future expectations, the main functional constituents of the enterprise stability. The author suggests to use an approach of self-organizational artificial neural networks to evaluate stability degree at the industrial enterprises.

  9. Lipid profiling and transcriptomic analysis reveals a functional interplay between estradiol and growth hormone in liver.

    Directory of Open Access Journals (Sweden)

    Leandro Fernández-Pérez

    Full Text Available 17β-estradiol (E2 may interfere with endocrine, metabolic, and gender-differentiated functions in liver in both females and males. Indirect mechanisms play a crucial role because of the E2 influence on the pituitary GH secretion and the GHR-JAK2-STAT5 signaling pathway in the target tissues. E2, through its interaction with the estrogen receptor, exerts direct effects on liver. Hypothyroidism also affects endocrine and metabolic functions of the liver, rendering a metabolic phenotype with features that mimic deficiencies in E2 or GH. In this work, we combined the lipid and transcriptomic analysis to obtain comprehensive information on the molecular mechanisms of E2 effects, alone and in combination with GH, to regulate liver functions in males. We used the adult hypothyroid-orchidectomized rat model to minimize the influence of internal hormones on E2 treatment and to explore its role in male-differentiated functions. E2 influenced genes involved in metabolism of lipids and endo-xenobiotics, and the GH-regulated endocrine, metabolic, immune, and male-specific responses. E2 induced a female-pattern of gene expression and inhibited GH-regulated STAT5b targeted genes. E2 did not prevent the inhibitory effects of GH on urea and amino acid metabolism-related genes. The combination of E2 and GH decreased transcriptional immune responses. E2 decreased the hepatic content of saturated fatty acids and induced a transcriptional program that seems to be mediated by the activation of PPARα. In contrast, GH inhibited fatty acid oxidation. Both E2 and GH replacements reduced hepatic CHO levels and increased the formation of cholesterol esters and triacylglycerols. Notably, the hepatic lipid profiles were endowed with singular fingerprints that may be used to segregate the effects of different hormonal replacements. In summary, we provide in vivo evidence that E2 has a significant impact on lipid content and transcriptome in male liver and that E2 exerts a

  10. A Broad RNA Virus Survey Reveals Both miRNA Dependence and Functional Sequestration

    DEFF Research Database (Denmark)

    Scheel, Troels K H; Luna, Joseph M; Liniger, Matthias

    2016-01-01

    , critically depended on the interaction of cellular miR-17 and let-7 with the viral 3' UTR. Unlike canonical miRNA interactions, miR-17 and let-7 binding enhanced pestivirus translation and RNA stability. miR-17 sequestration by pestiviruses conferred reduced AGO binding and functional de...... immunoprecipitation (CLIP) of the Argonaute (AGO) proteins to characterize strengths and specificities of miRNA interactions in the context of 15 different RNA virus infections, including several clinically relevant pathogens. Notably, replication of pestiviruses, a major threat to milk and meat industries...

  11. Functional Magnetic Resonance Imaging of Rats with Experimental Autoimmune Encephalomyelitis Reveals Brain Cortex Remodeling

    Science.gov (United States)

    Tambalo, Stefano; Peruzzotti-Jametti, Luca; Rigolio, Roberta; Fiorini, Silvia; Bontempi, Pietro; Mallucci, Giulia; Balzarotti, Beatrice; Marmiroli, Paola; Sbarbati, Andrea; Cavaletti, Guido

    2015-01-01

    Cortical reorganization occurring in multiple sclerosis (MS) patients is thought to play a key role in limiting the effect of structural tissue damage. Conversely, its exhaustion may contribute to the irreversible disability that accumulates with disease progression. Several aspects of MS-related cortical reorganization, including the overall functional effect and likely modulation by therapies, still remain to be elucidated. The aim of this work was to assess the extent of functional cortical reorganization and its brain structural/pathological correlates in Dark Agouti rats with experimental autoimmune encephalomyelitis (EAE), a widely accepted preclinical model of chronic MS. Morphological and functional MRI (fMRI) were performed before disease induction and during the relapsing and chronic phases of EAE. During somatosensory stimulation of the right forepaw, fMRI demonstrated that cortical reorganization occurs in both relapsing and chronic phases of EAE with increased activated volume and decreased laterality index versus baseline values. Voxel-based morphometry demonstrated gray matter (GM) atrophy in the cerebral cortex, and both GM and white matter atrophy were assessed by ex vivo pathology of the sensorimotor cortex and corpus callosum. Neuroinflammation persisted in the relapsing and chronic phases, with dendritic spine density in the layer IV sensory neurons inversely correlating with the number of cluster of differentiation 45-positive inflammatory lesions. Our work provides an innovative experimental platform that may be pivotal for the comprehension of key mechanisms responsible for the accumulation of irreversible brain damage and for the development of innovative therapies to reduce disability in EAE/MS. SIGNIFICANCE STATEMENT Since the early 2000s, functional MRI (fMRI) has demonstrated profound modifications in the recruitment of cortical areas during motor, cognitive, and sensory tasks in multiple sclerosis (MS) patients. Experimental autoimmune

  12. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  13. Muscle biopsies from human muscle diseases with myopathic pathology reveal common alterations in mitochondrial function.

    Science.gov (United States)

    Sunitha, Balaraju; Gayathri, Narayanappa; Kumar, Manish; Keshava Prasad, Thottethodi Subrahmanya; Nalini, Atchayaram; Padmanabhan, Balasundaram; Srinivas Bharath, Muchukunte Mukunda

    2016-07-01

    Muscle diseases are clinically and genetically heterogeneous and manifest as dystrophic, inflammatory and myopathic pathologies, among others. Our previous study on the cardiotoxin mouse model of myodegeneration and inflammation linked muscle pathology with mitochondrial damage and oxidative stress. In this study, we investigated whether human muscle diseases display mitochondrial changes. Muscle biopsies from muscle disease patients, represented by dysferlinopathy (dysfy) (dystrophic pathology; n = 43), polymyositis (PM) (inflammatory pathology; n = 24), and distal myopathy with rimmed vacuoles (DMRV) (distal myopathy; n = 31) were analyzed. Mitochondrial damage (ragged blue and COX-deficient fibers) was revealed in dysfy, PM, and DMRV cases by enzyme histochemistry (SDH and COX-SDH), electron microscopy (vacuolation and altered cristae) and biochemical assays (significantly increased ADP/ATP ratio). Proteomic analysis of muscle mitochondria from all three muscle diseases by isobaric tag for relative and absolute quantitation labeling and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis demonstrated down-regulation of electron transport chain (ETC) complex subunits, assembly factors and Krebs cycle enzymes. Interestingly, 80 of the under-expressed proteins were common among the three pathologies. Assay of ETC and Krebs cycle enzyme activities validated the MS data. Mitochondrial proteins from muscle pathologies also displayed higher tryptophan (Trp) oxidation and the same was corroborated in the cardiotoxin model. Molecular modeling predicted Trp oxidation to alter the local structure of mitochondrial proteins. Our data highlight mitochondrial alterations in muscle pathologies, represented by morphological changes, altered mitochondrial proteome and protein oxidation, thereby establishing the role of mitochondrial damage in human muscle diseases. We investigated whether human muscle diseases display mitochondrial changes. Muscle biopsies

  14. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  15. Developmental Reorganization of the Core and Extended Face Networks Revealed by Global Functional Connectivity.

    Science.gov (United States)

    Wang, Xu; Zhu, Qi; Song, Yiying; Liu, Jia

    2017-08-28

    Prior studies on development of functional specialization in human brain mainly focus on age-related increases in regional activation and connectivity among regions. However, a few recent studies on the face network demonstrate age-related decrease in face-specialized activation in the extended face network (EFN), in addition to increase in activation in the core face network (CFN). Here we used a voxel-based global brain connectivity approach to investigate whether development of the face network exhibited both increase and decrease in network connectivity. We found the voxel-wise resting-state functional connectivity (FC) within the CFN increased with age in bilateral posterior superior temporal sulcus, suggesting the integration of the CFN during development. Interestingly, the FC of the voxels in the EFN to the right fusiform face area and occipital face area decreased with age, suggesting that the CFN segregated from the EFN during development. Moreover, the age-related connectivity in the CFN was related to behavioral performance in face processing. Overall, our study demonstrated developmental reorganization of the face network achieved by both integration within the CFN and segregation of the CFN from the EFN, which may account for the simultaneous increases and decreases in neural activation during the development of the face network. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Genetic analysis of yeast RPA1 reveals its multiple functions in DNA metabolism

    International Nuclear Information System (INIS)

    Umezu, K.; Sugawara, N.; Chen, C.; Haber, J.E.; Kolodner, R.D.

    1998-01-01

    Replication protein A (RPA) is a single-stranded DNA-binding protein identified as an essential factor for SV40 DNA replication in vitro. To understand the in vivo functions of RPA, we mutagenized the Saccharomyces cerevisiae RFA1 gene and identified 19 ultraviolet light (UV) irradiation- and methyl methane sulfonate (MMS)-sensitive mutants and 5 temperature-sensitive mutants. The UV- and MMS-sensitive mutants showed up to 10 4 to 10 5 times increased sensitivity to these agents. Some of the UV- and MMSsensitive mutants were killed by an HO-induced double-strand break atMAT. Physical analysis of recombination in one UV- and MMS-sensitive rfa1 mutant demonstrated that it was defective for mating type switching and single-strand annealing recombination. Two temperature-sensitive mutants were characterized in detail, and at the restrictive temperature were found to have an arrest phenotype and DNA content indicative of incomplete DNA replication. DNA sequence analysis indicated that most of the mutations altered amino acids that were conserved between yeast, human, and Xenopus RPA1. Taken together, we conclude that RPA1 has multiple roles in vivo and functions in DNA replication, repair, and recombination, like the single-stranded DNA-binding proteins of bacteria and phages. (author)

  17. Speech processing asymmetry revealed by dichotic listening and functional brain imaging.

    Science.gov (United States)

    Hugdahl, Kenneth; Westerhausen, René

    2016-12-01

    In this article, we review research in our laboratory from the last 25 to 30 years on the neuronal basis for laterality of speech perception focusing on the upper, posterior parts of the temporal lobes, and its functional and structural connections to other brain regions. We review both behavioral and brain imaging data, with a focus on dichotic listening experiments, and using a variety of imaging modalities. The data have come in most parts from healthy individuals and from studies on normally functioning brain, although we also review a few selected clinical examples. We first review and discuss the structural model for the explanation of the right-ear advantage (REA) and left hemisphere asymmetry for auditory language processing. A common theme across many studies have been our interest in the interaction between bottom-up, stimulus-driven, and top-down, instruction-driven, aspects of hemispheric asymmetry, and how perceptual factors interact with cognitive factors to shape asymmetry of auditory language information processing. In summary, our research have shown laterality for the initial processing of consonant-vowel syllables, first observed as a behavioral REA when subjects are required to report which syllable of a dichotic syllable-pair they perceive. In subsequent work we have corroborated the REA with brain imaging, and have shown that the REA is modulated through both bottom-up manipulations of stimulus properties, like sound intensity, and top-down manipulations of cognitive properties, like attention focus. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Structural and functional properties of hemoglobins from unicellular organisms as revealed by resonance Raman spectroscopy.

    Science.gov (United States)

    Egawa, Tsuyoshi; Yeh, Syun-Ru

    2005-01-01

    Hemoglobins have been discovered in organisms from virtually all kingdoms. Their presence in unicellular organisms suggests that the gene for hemoglobin is very ancient and that the hemoglobins must have functions other than oxygen transport, in view of the fact that O2 delivery is a diffusion-controlled process in these organisms. Based on sequence alignment, three groups of hemoglobins have been characterized in unicellular organisms. The group-one hemoglobins, termed truncated hemoglobins, consist of proteins with 110-140 amino acid residues and a novel two-over-two alpha-helical sandwich motif. The group-two hemoglobins, termed flavohemoglobins, consist of a hemoglobin domain, with a classical three-over-three alpha-helical sandwich motif, and a flavin-containing reductase domain that is covalently attached to it. The group-three hemoglobins consist of myoglobin-like proteins that have high sequence homology and structural similarity to the hemoglobin domain of flavohemoglobins. In this review, recent resonance Raman studies of each group of these proteins are presented. Their implications are discussed in the context of the structural and functional properties of these novel hemoglobins.

  19. Unexpected functional similarities between gatekeeper tumour suppressor genes and proto-oncogenes revealed by systems biology.

    Science.gov (United States)

    Zhao, Yongzhong; Epstein, Richard J

    2011-05-01

    Familial tumor suppressor genes comprise two subgroups: caretaker genes (CTs) that repair DNA, and gatekeeper genes (GKs) that trigger cell death. Since GKs may also induce cell cycle delay and thus enhance cell survival by facilitating DNA repair, we hypothesized that the prosurvival phenotype of GKs could be selected during cancer progression, and we used a multivariable systems biology approach to test this. We performed multidimensional data analysis, non-negative matrix factorization and logistic regression to compare the features of GKs with those of their putative antagonists, the proto-oncogenes (POs), as well as with control groups of CTs and functionally unrelated congenital heart disease genes (HDs). GKs and POs closely resemble each other, but not CTs or HDs, in terms of gene structure (Pexpression level and breadth (Pimplied suggest a common functional attribute that is strongly negatively selected-that is, a shared phenotype that enhances cell survival. The counterintuitive finding of similar evolutionary pressures affecting GKs and POs raises an intriguing possibility: namely, that cancer microevolution is accelerated by an epistatic cascade in which upstream suppressor gene defects subvert the normal bifunctionality of wild-type GKs by constitutively shifting the phenotype away from apoptosis towards survival. If correct, this interpretation would explain the hitherto unexplained phenomenon of frequent wild-type GK (for example, p53) overexpression in tumors.

  20. Novel gene function revealed by mouse mutagenesis screens for models of age-related disease.

    Science.gov (United States)

    Potter, Paul K; Bowl, Michael R; Jeyarajan, Prashanthini; Wisby, Laura; Blease, Andrew; Goldsworthy, Michelle E; Simon, Michelle M; Greenaway, Simon; Michel, Vincent; Barnard, Alun; Aguilar, Carlos; Agnew, Thomas; Banks, Gareth; Blake, Andrew; Chessum, Lauren; Dorning, Joanne; Falcone, Sara; Goosey, Laurence; Harris, Shelley; Haynes, Andy; Heise, Ines; Hillier, Rosie; Hough, Tertius; Hoslin, Angela; Hutchison, Marie; King, Ruairidh; Kumar, Saumya; Lad, Heena V; Law, Gemma; MacLaren, Robert E; Morse, Susan; Nicol, Thomas; Parker, Andrew; Pickford, Karen; Sethi, Siddharth; Starbuck, Becky; Stelma, Femke; Cheeseman, Michael; Cross, Sally H; Foster, Russell G; Jackson, Ian J; Peirson, Stuart N; Thakker, Rajesh V; Vincent, Tonia; Scudamore, Cheryl; Wells, Sara; El-Amraoui, Aziz; Petit, Christine; Acevedo-Arozena, Abraham; Nolan, Patrick M; Cox, Roger; Mallon, Anne-Marie; Brown, Steve D M

    2016-08-18

    Determining the genetic bases of age-related disease remains a major challenge requiring a spectrum of approaches from human and clinical genetics to the utilization of model organism studies. Here we report a large-scale genetic screen in mice employing a phenotype-driven discovery platform to identify mutations resulting in age-related disease, both late-onset and progressive. We have utilized N-ethyl-N-nitrosourea mutagenesis to generate pedigrees of mutagenized mice that were subject to recurrent screens for mutant phenotypes as the mice aged. In total, we identify 105 distinct mutant lines from 157 pedigrees analysed, out of which 27 are late-onset phenotypes across a range of physiological systems. Using whole-genome sequencing we uncover the underlying genes for 44 of these mutant phenotypes, including 12 late-onset phenotypes. These genes reveal a number of novel pathways involved with age-related disease. We illustrate our findings by the recovery and characterization of a novel mouse model of age-related hearing loss.

  1. Structural Studies Reveal the Functional Modularity of the Scc2-Scc4 Cohesin Loader

    Directory of Open Access Journals (Sweden)

    William C.H. Chao

    2015-08-01

    Full Text Available The remarkable accuracy of eukaryotic cell division is partly maintained by the cohesin complex acting as a molecular glue to prevent premature sister chromatid separation. The loading of cohesin onto chromosomes is catalyzed by the Scc2-Scc4 loader complex. Here, we report the crystal structure of Scc4 bound to the N terminus of Scc2 and show that Scc4 is a tetratricopeptide repeat (TPR superhelix. The Scc2 N terminus adopts an extended conformation and is entrapped by the core of the Scc4 superhelix. Electron microscopy (EM analysis reveals that the Scc2-Scc4 loader complex comprises three domains: a head, body, and hook. Deletion studies unambiguously assign the Scc2N-Scc4 as the globular head domain, whereas in vitro cohesin loading assays show that the central body and the hook domains are sufficient to catalyze cohesin loading onto circular DNA, but not chromatinized DNA in vivo, suggesting a possible role for Scc4 as a chromatin adaptor.

  2. Computational Approaches Reveal New Insights into Regulation and Function of Non; coding RNAs and their Targets

    KAUST Repository

    Alam, Tanvir

    2016-11-28

    Regulation and function of protein-coding genes are increasingly well-understood, but no comparable evidence exists for non-coding RNA (ncRNA) genes, which appear to be more numerous than protein-coding genes. We developed a novel machine-learning model to distinguish promoters of long ncRNA (lncRNA) genes from those of protein-coding genes. This represents the first attempt to make this distinction based on properties of the associated gene promoters. From our analyses, several transcription factors (TFs), which are known to be regulated by lncRNAs, also emerged as potential global regulators of lncRNAs, suggesting that lncRNAs and TFs may participate in bidirectional feedback regulatory network. Our results also raise the possibility that, due to the historical dependence on protein-coding gene in defining the chromatin states of active promoters, an adjustment of these chromatin signature profiles to incorporate lncRNAs is warranted in the future. Secondly, we developed a novel method to infer functions for lncRNA and microRNA (miRNA) transcripts based on their transcriptional regulatory networks in 119 tissues and 177 primary cells of human. This method for the first time combines information of cell/tissueVspecific expression of a transcript and the TFs and transcription coVfactors (TcoFs) that control activation of that transcript. Transcripts were annotated using statistically enriched GO terms, pathways and diseases across cells/tissues and associated knowledgebase (FARNA) is developed. FARNA, having the most comprehensive function annotation of considered ncRNAs across the widest spectrum of cells/tissues, has a potential to contribute to our understanding of ncRNA roles and their regulatory mechanisms in human. Thirdly, we developed a novel machine-learning model to identify LD motif (a protein interaction motif) of paxillin, a ncRNA target that is involved in cell motility and cancer metastasis. Our recognition model identified new proteins not

  3. Crustal Structure and Deformation of the Sichuan-Yunnan Region Revealed by receiver Function Data

    Science.gov (United States)

    Zeng, S.; Zheng, Y.

    2017-12-01

    Sichuan-Yunnan and its surrounding areas locates in the southeast side to the Tibetan Plateau, due to the intrusion of the Indian Plate under the Tibetan Plateau, materials escape from the Tibetan Plateau and flow southward to southeastward. Because of such tectonic environment, the Sichuan-Yunnan region is experiencing high tectonic movement, and is capable of highly diffused seismicity. Based on dynamic simulation and field survey investigations, tectonic and geological studies proposed a decoupling model in this region and lower crustal flow may inflate in the crust. However, this idea needs more evidences, especially anisotropic structures to support it, since the anisotropic structures are usually directly related to the movement of materials, or to the tectonic distributions. In the past several years, a number of works have been done on the anisotropic structures in the Tibetan Plateau and its surroundings. In usually, previous studies were mainly carried out by two kinds of methods. First, the shear wave splitting of SKS, which mainly reflects the accumulation effect of the anisotropy of the crust to the mantle; the other way is use surface wave to investigate the anisotropic features at different azimuths and depths. In the recent years, receiver function is used to determine the inclination and anisotropy of the subsurface structure, comparing with the other two methods, receiver functions can provide higher resolution and reliable anisotropic features in the crust. Following the method of Liu and Niu(2012), we collected teleseismic data from the Himalayan first term network, and picked out high quality data based on the waveform SNR ratio, as well as the azimuthal distributions. Comparing with previous work (e.g., Sun et al.,2012), our work can provide more receiver functions results with higher reliability. We find that the crust beneath the Sichuan-Yunnan region has a thickness of 30-60 km and Vp/Vs ratio of 1.70-1.80. The Moho depth from northwest to

  4. Metatranscriptome Sequencing Reveals Insights into the Gene Expression and Functional Potential of Rumen Wall Bacteria

    Directory of Open Access Journals (Sweden)

    Evelyne Mann

    2018-01-01

    Full Text Available Microbiota of the rumen wall constitute an important niche of rumen microbial ecology and their composition has been elucidated in different ruminants during the last years. However, the knowledge about the function of rumen wall microbes is still limited. Rumen wall biopsies were taken from three fistulated dairy cows under a standard forage-based diet and after 4 weeks of high concentrate feeding inducing a subacute rumen acidosis (SARA. Extracted RNA was used for metatranscriptome sequencing using Illumina HiSeq sequencing technology. The gene expression of the rumen wall microbial community was analyzed by mapping 35 million sequences against the Kyoto Encyclopedia for Genes and Genomes (KEGG database and determining differentially expressed genes. A total of 1,607 functional features were assigned with high expression of genes involved in central metabolism, galactose, starch and sucrose metabolism. The glycogen phosphorylase (EC:2.4.1.1 which degrades (1->4-alpha-D-glucans was among the highest expressed genes being transcribed by 115 bacterial genera. Energy metabolism genes were also highly expressed, including the pyruvate orthophosphate dikinase (EC:2.7.9.1 involved in pyruvate metabolism, which was covered by 177 genera. Nitrogen metabolism genes, in particular glutamate dehydrogenase (EC:1.4.1.4, glutamine synthetase (EC:6.3.1.2 and glutamate synthase (EC:1.4.1.13, EC:1.4.1.14 were also found to be highly expressed and prove rumen wall microbiota to be actively involved in providing host-relevant metabolites for exchange across the rumen wall. In addition, we found all four urease subunits (EC:3.5.1.5 transcribed by members of the genera Flavobacterium, Corynebacterium, Helicobacter, Clostridium, and Bacillus, and the dissimilatory sulfate reductase (EC 1.8.99.5 dsrABC, which is responsible for the reduction of sulfite to sulfide. We also provide in situ evidence for cellulose and cellobiose degradation, a key step in fiber-rich feed

  5. Functional comparison of the nematode Hox gene lin-39 in C. elegans and P. pacificus reveals evolutionary conservation of protein function despite divergence of primary sequences.

    Science.gov (United States)

    Grandien, K; Sommer, R J

    2001-08-15

    Hox transcription factors have been implicated in playing a central role in the evolution of animal morphology. Many studies indicate the evolutionary importance of regulatory changes in Hox genes, but little is known about the role of functional changes in Hox proteins. In the nematodes Pristionchus pacificus and Caenorhabditis elegans, developmental processes can be compared at the cellular, genetic, and molecular levels and differences in gene function can be identified. The Hox gene lin-39 is involved in the regulation of nematode vulva development. Comparison of known lin-39 mutations in P. pacificus and C. elegans revealed both conservation and changes of gene function. Here, we study evolutionary changes of lin-39 function using hybrid transgenes and site-directed mutagenesis in an in vivo assay using C. elegans lin-39 mutants. Our data show that despite the functional differences of LIN-39 between the two species, Ppa-LIN-39, when driven by Cel-lin-39 regulatory elements, can functionally replace Cel-lin-39. Furthermore, we show that the MAPK docking and phosphorylation motifs unique for Cel-LIN-39 are dispensable for Cel-lin-39 function. Therefore, the evolution of lin-39 function is driven by changes in regulatory elements rather than changes in the protein itself.

  6. Different patterns of auditory cortex activation revealed by functional magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Formisano, E; Pepino, A; Bracale, M [Department of Electronic Engineering, Biomedical Unit, Universita di Napoli, Federic II, Italy, Via Claudio 21, 80125 Napoli (Italy); Di Salle, F [Department of Biomorphological and Functional Sciences, Radiologucal Unit, Universita di Napoli, Federic II, Italy, Via Claudio 21, 80125 Napoli (Italy); Lanfermann, H; Zanella, F E [Department of Neuroradiology, J.W. Goethe Universitat, Frankfurt/M. (Germany)

    1999-12-31

    In the last few years, functional Magnetic Resonance Imaging (fMRI) has been widely accepted as an effective tool for mapping brain activities in both the sensorimotor and the cognitive field. The present work aims to assess the possibility of using fMRI methods to study the cortical response to different acoustic stimuli. Furthermore, we refer to recent data collected at Frankfurt University on the cortical pattern of auditory hallucinations. Healthy subjects showed broad bilateral activation, mostly located in the transverse gyrus of Heschl. The analysis of the cortical activation induced by different stimuli has pointed out a remarkable difference in the spatial and temporal features of the auditory cortex response to pulsed tones and pure tones. The activated areas during episodes of auditory hallucinations match the location of primary auditory cortex as defined in control measurements with the same patients and in the experiments on healthy subjects. (authors) 17 refs., 4 figs.

  7. Revealing the Supramolecular Nature of Side-Chain Terpyridine-Functionalized Polymer Networks

    Directory of Open Access Journals (Sweden)

    Jérémy Brassinne

    2015-01-01

    Full Text Available Nowadays, finely controlling the mechanical properties of polymeric materials is possible by incorporating supramolecular motifs into their architecture. In this context, the synthesis of a side-chain terpyridine-functionalized poly(2-(dimethylaminoethyl methacrylate is reported via reversible addition-fragmentation chain transfer polymerization. By addition of transition metal ions, concentrated aqueous solutions of this polymer turn into metallo-supramolecular hydrogels whose dynamic mechanical properties are investigated by rotational rheometry. Hence, the possibility for the material to relax mechanical constrains via dissociation of transient cross-links is brought into light. In addition, the complex phenomena occurring under large oscillatory shear are interpreted in the context of transient networks.

  8. Functional MRI reveals expert-novice differences during sport-related anticipation.

    Science.gov (United States)

    Wright, Michael J; Bishop, Daniel T; Jackson, Robin C; Abernethy, Bruce

    2010-01-27

    We examined the effect of expertise on cortical activation during sports anticipation using functional MRI. In experiment 1, recreational players predicted badminton stroke direction and the pattern of active clusters was consistent with a proposed perception-of-action network. This pattern was not replicated in a stimulus-matched, action-unrelated control task. In experiment 2, players of three different skill levels anticipated stroke direction from clips occluded either 160 ms before or 80 ms after racquet-shuttle contact. Early-occluded sequences produced more activation than late-occluded sequences overall, in most cortical regions of interest, but experts showed an additional enhancement in medial, dorsolateral and ventrolateral frontal cortex. Anticipation in open-skill sports engages cortical areas integral to observing and understanding others' actions; such activity is enhanced in experts.

  9. Different patterns of auditory cortex activation revealed by functional magnetic resonance imaging

    International Nuclear Information System (INIS)

    Formisano, E.; Pepino, A.; Bracale, M.; Di Salle, F.; Lanfermann, H.; Zanella, F.E.

    1998-01-01

    In the last few years, functional Magnetic Resonance Imaging (fMRI) has been widely accepted as an effective tool for mapping brain activities in both the sensorimotor and the cognitive field. The present work aims to assess the possibility of using fMRI methods to study the cortical response to different acoustic stimuli. Furthermore, we refer to recent data collected at Frankfurt University on the cortical pattern of auditory hallucinations. Healthy subjects showed broad bilateral activation, mostly located in the transverse gyrus of Heschl. The analysis of the cortical activation induced by different stimuli has pointed out a remarkable difference in the spatial and temporal features of the auditory cortex response to pulsed tones and pure tones. The activated areas during episodes of auditory hallucinations match the location of primary auditory cortex as defined in control measurements with the same patients and in the experiments on healthy subjects. (authors)

  10. Nanobodies targeting norovirus capsid reveal functional epitopes and potential mechanisms of neutralization.

    Directory of Open Access Journals (Sweden)

    Anna D Koromyslova

    2017-11-01

    Full Text Available Norovirus is the leading cause of gastroenteritis worldwide. Despite recent developments in norovirus propagation in cell culture, these viruses are still challenging to grow routinely. Moreover, little is known on how norovirus infects the host cells, except that histo-blood group antigens (HBGAs are important binding factors for infection and cell entry. Antibodies that bind at the HBGA pocket and block attachment to HBGAs are believed to neutralize the virus. However, additional neutralization epitopes elsewhere on the capsid likely exist and impeding the intrinsic structural dynamics of the capsid could be equally important. In the current study, we investigated a panel of Nanobodies in order to probe functional epitopes that could trigger capsid rearrangement and/ or interfere with HBGA binding interactions. The precise binding sites of six Nanobodies (Nano-4, Nano-14, Nano-26, Nano-27, Nano-32, and Nano-42 were identified using X-ray crystallography. We showed that these Nanobodies bound on the top, side, and bottom of the norovirus protruding domain. The impact of Nanobody binding on norovirus capsid morphology was analyzed using electron microscopy and dynamic light scattering. We discovered that distinct Nanobody epitopes were associated with varied changes in particle structural integrity and assembly. Interestingly, certain Nanobody-induced capsid morphological changes lead to the capsid protein degradation and viral RNA exposure. Moreover, Nanobodies employed multiple inhibition mechanisms to prevent norovirus attachment to HBGAs, which included steric obstruction (Nano-14, allosteric interference (Nano-32, and violation of normal capsid morphology (Nano-26 and Nano-85. Finally, we showed that two Nanobodies (Nano-26 and Nano-85 not only compromised capsid integrity and inhibited VLPs attachment to HBGAs, but also recognized a broad panel of norovirus genotypes with high affinities. Consequently, Nano-26 and Nano-85 have a great

  11. Nanobodies targeting norovirus capsid reveal functional epitopes and potential mechanisms of neutralization

    Science.gov (United States)

    2017-01-01

    Norovirus is the leading cause of gastroenteritis worldwide. Despite recent developments in norovirus propagation in cell culture, these viruses are still challenging to grow routinely. Moreover, little is known on how norovirus infects the host cells, except that histo-blood group antigens (HBGAs) are important binding factors for infection and cell entry. Antibodies that bind at the HBGA pocket and block attachment to HBGAs are believed to neutralize the virus. However, additional neutralization epitopes elsewhere on the capsid likely exist and impeding the intrinsic structural dynamics of the capsid could be equally important. In the current study, we investigated a panel of Nanobodies in order to probe functional epitopes that could trigger capsid rearrangement and/ or interfere with HBGA binding interactions. The precise binding sites of six Nanobodies (Nano-4, Nano-14, Nano-26, Nano-27, Nano-32, and Nano-42) were identified using X-ray crystallography. We showed that these Nanobodies bound on the top, side, and bottom of the norovirus protruding domain. The impact of Nanobody binding on norovirus capsid morphology was analyzed using electron microscopy and dynamic light scattering. We discovered that distinct Nanobody epitopes were associated with varied changes in particle structural integrity and assembly. Interestingly, certain Nanobody-induced capsid morphological changes lead to the capsid protein degradation and viral RNA exposure. Moreover, Nanobodies employed multiple inhibition mechanisms to prevent norovirus attachment to HBGAs, which included steric obstruction (Nano-14), allosteric interference (Nano-32), and violation of normal capsid morphology (Nano-26 and Nano-85). Finally, we showed that two Nanobodies (Nano-26 and Nano-85) not only compromised capsid integrity and inhibited VLPs attachment to HBGAs, but also recognized a broad panel of norovirus genotypes with high affinities. Consequently, Nano-26 and Nano-85 have a great potential to

  12. Combined structural and functional imaging reveals cortical deactivations in grapheme-colour synaesthesia

    Directory of Open Access Journals (Sweden)

    Erik eO'Hanlon

    2013-10-01

    Full Text Available Synaesthesia is a heritable condition in which particular stimuli generate specific and consistent sensory percepts or associations in another modality or processing stream. Functional neuroimaging studies have identified potential correlates of these experiences, including, in some but not all cases, the hyperactivation of visuotemporal areas and of parietal areas thought to be involved in perceptual binding. Structural studies have identified a similarly variable spectrum of differences between synaesthetes and controls. However, it remains unclear the extent to which these neural correlates reflect the synaesthetic experience itself or additional phenotypes associated with the condition. Here, we acquired both structural and functional neuroimaging data comparing thirteen grapheme-colour synaesthetes with eleven non-synaesthetes. Using voxel-based morphometry and diffusion tensor imaging, we identify a number of clusters of increased volume of grey matter, of white matter or of increased fractional anisotropy in synaesthetes versus controls. To assess the possible involvement of these areas in the synaesthetic experience, we used nine areas of increased grey matter volume as regions of interest in an fMRI experiment that characterised the contrast in response to stimuli which induced synaesthesia (i.e. letters versus those which did not (non-meaningful symbols. Two of these areas, in left lateral occipital cortex and in postcentral gyrus, showed sensitivity to this contrast in synaesthetes but not controls. Unexpectedly, in both regions, the letter stimuli produced a strong negative BOLD signal in synaesthetes. An additional whole-brain fMRI analysis identified fourteen areas, three of which were driven mainly by a negative BOLD response to letters in synaesthetes. Our findings suggest that cortical deactivations may be involved in the conscious experience of internally generated synaesthetic percepts

  13. Metatranscriptomes reveal functional variation in diatom communities from the Antarctic Peninsula

    KAUST Repository

    Pearson, Gareth A

    2015-04-14

    Functional genomics of diatom-dominated communities fromthe Antarctic Peninsula was studied using comparative metatranscriptomics. Samples obtained from diatom-rich communities in the Bransfield Strait, the western Weddell Sea and sea ice in the Bellingshausen Sea/Wilkins Ice Shelf yielded more than 500K pyrosequencing reads that were combined to produce a global metatranscriptome assembly. Multi-gene phylogenies recovered three distinct communities, and diatom-assigned contigs further indicated little read-sharing between communities, validating an assembly-based annotation and analysis approach. Although functional analysis recovered a core of abundant shared annotations that were expressed across the three diatom communities, over 40% of annotations (but accounting for <10% of sequences) were community-specific. The two pelagic communities differed in their expression of N-metabolism and acquisition genes, which was almost absent in post-bloom conditions in the Weddell Sea community, while enrichment of transporters for ammonia and urea in Bransfield Strait diatoms suggests a physiological stance towards acquisition of reduced N-sources. The depletion of carbohydrate and energy metabolism pathways in sea ice relative to pelagic communities, together with increased light energy dissipation (via LHCSR proteins), photorespiration, and NO3 - uptake and utilization all pointed to irradiance stress and/or inorganic carbon limitation within sea ice. Ice-binding proteins and cold-shock transcription factors were also enriched in sea ice diatoms. Surprisingly, the abundance of gene transcripts for the translational machinery tracked decreasing environmental temperature across only a 4 °C range, possibly reflecting constraints on translational efficiency and protein production in cold environments. © 2015 International Society for Microbial Ecology All rights reserved.

  14. Expression analysis of Arabidopsis vacuolar sorting receptor 3 reveals a putative function in guard cells.

    Science.gov (United States)

    Avila, Emily L; Brown, Michelle; Pan, Songqin; Desikan, Radhika; Neill, Steven J; Girke, Thomas; Surpin, Marci; Raikhel, Natasha V

    2008-01-01

    Vacuolar sorting receptors (VSRs) are responsible for the proper targeting of soluble cargo proteins to their destination compartments. The Arabidopsis genome encodes seven VSRs. In this work, the spatio-temporal expression of one of the members of this gene family, AtVSR3, was determined by RT-PCR and promoter::reporter gene fusions. AtVSR3 was expressed specifically in guard cells. Consequently, a reverse genetics approach was taken to determine the function of AtVSR3 by using RNA interference (RNAi) technology. Plants expressing little or no AtVSR3 transcript had a compressed life cycle, bolting approximately 1 week earlier and senescing up to 2 weeks earlier than the wild-type parent line. While the development and distribution of stomata in AtVSR3 RNAi plants appeared normal, stomatal function was altered. The guard cells of mutant plants did not close in response to abscisic acid treatment, and the mean leaf temperatures of the RNAi plants were on average 0.8 degrees C lower than both wild type and another vacuolar sorting receptor mutant, atvsr1-1. Furthermore, the loss of AtVSR3 protein caused the accumulation of nitric oxide and hydrogen peroxide, signalling molecules implicated in the regulation of stomatal opening and closing. Finally, proteomics and western blot analyses of cellular proteins isolated from wild-type and AtVSR3 RNAi leaves showed that phospholipase Dgamma, which may play a role in abscisic acid signalling, accumulated to higher levels in AtVSR3 RNAi guard cells. Thus, AtVSR3 may play an important role in responses to plant stress.

  15. Lithosphere structure in Madagascar as revealed from receiver functions and surface waves analysis.

    Science.gov (United States)

    Rindraharisaona, E. J.; Tilmann, F. J.; Yuan, X.; Dreiling, J.; Priestley, K. F.; Barruol, G.; Wysession, M. E.

    2017-12-01

    The geological history of Madagascar makes it an ideal place to study the lithospheric structure and its evolution. It comprises Archean to Proterozoic units on the central eastern part, which is surrounded by a Triassic to Jurassic basin formation in the west and Cretaceous volcanics along the coasts. Quaternary volcanic rocks have been embedded in crystalline and sedimentary rocks. The aim of the present work is to characterize the crustal structure and determine the imprint of the dominant geodynamic events that have affected Madagascar: the Pan-African orogeny, the breakup of Gondwanaland and Neogene tectonic activity. From 2011 to 2014 different temporary seismic arrays were deployed in Madagascar. We based the current study mostly on SELASOMA project, which is composed of 50 seismic stations that were installed traversing southern Madagascar from the west to the east, sampling the different geological units. To measured seismic dispersion curves, one a wide period ranges using ambient noise, Rayleigh and Love surface waves. To compute the average crustal Vp/Vs ratio internal crustal structure and discontinuities in the mantle, we use both P- and S-waves receiver functions. To better resolve of the crustal structure, we jointly inverted P-wave receiver functions and Rayleigh wave group velocity.The crustal extension during the Carboniferous to Cenozoic has thinned the igneous crust down to 15 km in the western Morondava basin by removing much of the lower crust, while the thickness of the upper crust is nearly identical in the sedimentary basin and under Proterozoic and Archaean rocks of the eastern two thirds of Southern Madagascar. In general, the Archean crust is thicker than the Proterozoic, because mafic component is missing in the Proterozoic domain while it forms the bottom of the Archean crust. The lithosphere thickness in the southern part of Madagascar is estimated to be between 90 and 125 km.

  16. Simple analytical model reveals the functional role of embodied sensorimotor interaction in hexapod gaits

    Science.gov (United States)

    Aoi, Shinya; Nachstedt, Timo; Manoonpong, Poramate; Wörgötter, Florentin; Matsuno, Fumitoshi

    2018-01-01

    Insects have various gaits with specific characteristics and can change their gaits smoothly in accordance with their speed. These gaits emerge from the embodied sensorimotor interactions that occur between the insect’s neural control and body dynamic systems through sensory feedback. Sensory feedback plays a critical role in coordinated movements such as locomotion, particularly in stick insects. While many previously developed insect models can generate different insect gaits, the functional role of embodied sensorimotor interactions in the interlimb coordination of insects remains unclear because of their complexity. In this study, we propose a simple physical model that is amenable to mathematical analysis to explain the functional role of these interactions clearly. We focus on a foot contact sensory feedback called phase resetting, which regulates leg retraction timing based on touchdown information. First, we used a hexapod robot to determine whether the distributed decoupled oscillators used for legs with the sensory feedback generate insect-like gaits through embodied sensorimotor interactions. The robot generated two different gaits and one had similar characteristics to insect gaits. Next, we proposed the simple model as a minimal model that allowed us to analyze and explain the gait mechanism through the embodied sensorimotor interactions. The simple model consists of a rigid body with massless springs acting as legs, where the legs are controlled using oscillator phases with phase resetting, and the governed equations are reduced such that they can be explained using only the oscillator phases with some approximations. This simplicity leads to analytical solutions for the hexapod gaits via perturbation analysis, despite the complexity of the embodied sensorimotor interactions. This is the first study to provide an analytical model for insect gaits under these interaction conditions. Our results clarified how this specific foot contact sensory

  17. Principles of motivation revealed by the diverse functions of neuropharmacological and neuroanatomical substrates underlying feeding behavior.

    Science.gov (United States)

    Baldo, Brian A; Pratt, Wayne E; Will, Matthew J; Hanlon, Erin C; Bakshi, Vaishali P; Cador, Martine

    2013-11-01

    Circuits that participate in specific subcomponents of feeding (e.g., gustatory perception, peripheral feedback relevant to satiety and energy balance, reward coding, etc.) are found at all levels of the neural axis. Further complexity is conferred by the wide variety of feeding-modulatory neurotransmitters and neuropeptides that act within these circuits. An ongoing challenge has been to refine the understanding of the functional specificity of these neurotransmitters and circuits, and there have been exciting advances in recent years. We focus here on foundational work of Dr. Ann Kelley that identified distinguishable actions of striatal opioid peptide modulation and dopamine transmission in subcomponents of reward processing. We also discuss her work in overlaying these neuropharmacological effects upon anatomical pathways that link the telencephalon (cortex and basal ganglia) with feeding-control circuits in the hypothalamus. Using these seminal contributions as a starting point, we will discuss new findings that expand our understanding of (1) the specific, differentiable motivational processes that are governed by central dopamine and opioid transmission, (2) the manner in which other striatal neuromodulators, specifically acetylcholine, endocannabinoids and adenosine, modulate these motivational processes (including via interactions with opioid systems), and (3) the organization of the cortical-subcortical network that subserves opioid-driven feeding. The findings discussed here strengthen the view that incentive-motivational properties of food are coded by substrates and neural circuits that are distinguishable from those that mediate the acute hedonic experience of food reward. Striatal opioid transmission modulates reward processing by engaging frontotemporal circuits, possibly via a hypothalamic-thalamic axis, that ultimately impinges upon hypothalamic modules dedicated to autonomic function and motor pattern control. We will conclude by discussing

  18. Metatranscriptomes reveal functional variation in diatom communities from the Antarctic Peninsula

    KAUST Repository

    Pearson, Gareth A; Lago-Leston, Asuncion; Cá novas, Fernando; Cox, Cymon J; Verret, Frederic; Lasternas, Sebastian; Duarte, Carlos M.; Agusti, Susana; Serrã o, Ester A

    2015-01-01

    Functional genomics of diatom-dominated communities fromthe Antarctic Peninsula was studied using comparative metatranscriptomics. Samples obtained from diatom-rich communities in the Bransfield Strait, the western Weddell Sea and sea ice in the Bellingshausen Sea/Wilkins Ice Shelf yielded more than 500K pyrosequencing reads that were combined to produce a global metatranscriptome assembly. Multi-gene phylogenies recovered three distinct communities, and diatom-assigned contigs further indicated little read-sharing between communities, validating an assembly-based annotation and analysis approach. Although functional analysis recovered a core of abundant shared annotations that were expressed across the three diatom communities, over 40% of annotations (but accounting for <10% of sequences) were community-specific. The two pelagic communities differed in their expression of N-metabolism and acquisition genes, which was almost absent in post-bloom conditions in the Weddell Sea community, while enrichment of transporters for ammonia and urea in Bransfield Strait diatoms suggests a physiological stance towards acquisition of reduced N-sources. The depletion of carbohydrate and energy metabolism pathways in sea ice relative to pelagic communities, together with increased light energy dissipation (via LHCSR proteins), photorespiration, and NO3 - uptake and utilization all pointed to irradiance stress and/or inorganic carbon limitation within sea ice. Ice-binding proteins and cold-shock transcription factors were also enriched in sea ice diatoms. Surprisingly, the abundance of gene transcripts for the translational machinery tracked decreasing environmental temperature across only a 4 °C range, possibly reflecting constraints on translational efficiency and protein production in cold environments. © 2015 International Society for Microbial Ecology All rights reserved.

  19. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  20. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  1. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  2. Comprehensive gene expression profiling reveals synergistic functional networks in cerebral vessels after hypertension or hypercholesterolemia.

    Directory of Open Access Journals (Sweden)

    Wei-Yi Ong

    Full Text Available Atherosclerotic stenosis of cerebral arteries or intracranial large artery disease (ICLAD is a major cause of stroke especially in Asians, Hispanics and Africans, but relatively little is known about gene expression changes in vessels at risk. This study compares comprehensive gene expression profiles in the middle cerebral artery (MCA of New Zealand White rabbits exposed to two stroke risk factors i.e. hypertension and/or hypercholesterolemia, by the 2-Kidney-1-Clip method, or dietary supplementation with cholesterol. Microarray and Ingenuity Pathway Analyses of the MCA of the hypertensive rabbits showed up-regulated genes in networks containing the node molecules: UBC (ubiquitin, P38 MAPK, ERK, NFkB, SERPINB2, MMP1 and APP (amyloid precursor protein; and down-regulated genes related to MAPK, ERK 1/2, Akt, 26 s proteasome, histone H3 and UBC. The MCA of hypercholesterolemic rabbits showed differentially expressed genes that are surprisingly, linked to almost the same node molecules as the hypertensive rabbits, despite a relatively low percentage of 'common genes' (21 and 7% between the two conditions. Up-regulated common genes were related to: UBC, SERPINB2, TNF, HNF4A (hepatocyte nuclear factor 4A and APP, and down-regulated genes, related to UBC. Increased HNF4A message and protein were verified in the aorta. Together, these findings reveal similar nodal molecules and gene pathways in cerebral vessels affected by hypertension or hypercholesterolemia, which could be a basis for synergistic action of risk factors in the pathogenesis of ICLAD.

  3. Comprehensive Gene Expression Profiling Reveals Synergistic Functional Networks in Cerebral Vessels after Hypertension or Hypercholesterolemia

    Science.gov (United States)

    Ong, Wei-Yi; Ng, Mary Pei-Ern; Loke, Sau-Yeen; Jin, Shalai; Wu, Ya-Jun; Tanaka, Kazuhiro; Wong, Peter Tsun-Hon

    2013-01-01

    Atherosclerotic stenosis of cerebral arteries or intracranial large artery disease (ICLAD) is a major cause of stroke especially in Asians, Hispanics and Africans, but relatively little is known about gene expression changes in vessels at risk. This study compares comprehensive gene expression profiles in the middle cerebral artery (MCA) of New Zealand White rabbits exposed to two stroke risk factors i.e. hypertension and/or hypercholesterolemia, by the 2-Kidney-1-Clip method, or dietary supplementation with cholesterol. Microarray and Ingenuity Pathway Analyses of the MCA of the hypertensive rabbits showed up-regulated genes in networks containing the node molecules: UBC (ubiquitin), P38 MAPK, ERK, NFkB, SERPINB2, MMP1 and APP (amyloid precursor protein); and down-regulated genes related to MAPK, ERK 1/2, Akt, 26 s proteasome, histone H3 and UBC. The MCA of hypercholesterolemic rabbits showed differentially expressed genes that are surprisingly, linked to almost the same node molecules as the hypertensive rabbits, despite a relatively low percentage of ‘common genes’ (21 and 7%) between the two conditions. Up-regulated common genes were related to: UBC, SERPINB2, TNF, HNF4A (hepatocyte nuclear factor 4A) and APP, and down-regulated genes, related to UBC. Increased HNF4A message and protein were verified in the aorta. Together, these findings reveal similar nodal molecules and gene pathways in cerebral vessels affected by hypertension or hypercholesterolemia, which could be a basis for synergistic action of risk factors in the pathogenesis of ICLAD. PMID:23874591

  4. Dissection of Ire1 functions reveals stress response mechanisms uniquely evolved in Candida glabrata.

    Directory of Open Access Journals (Sweden)

    Taiga Miyazaki

    2013-01-01

    Full Text Available Proper protein folding in the endoplasmic reticulum (ER is vital in all eukaryotes. When misfolded proteins accumulate in the ER lumen, the transmembrane kinase/endoribonuclease Ire1 initiates splicing of HAC1 mRNA to generate the bZIP transcription factor Hac1, which subsequently activates its target genes to increase the protein-folding capacity of the ER. This cellular machinery, called the unfolded protein response (UPR, is believed to be an evolutionarily conserved mechanism in eukaryotes. In this study, we comprehensively characterized mutant phenotypes of IRE1 and other related genes in the human fungal pathogen Candida glabrata. Unexpectedly, Ire1 was required for the ER stress response independently of Hac1 in this fungus. C. glabrata Ire1 did not cleave mRNAs encoding Hac1 and other bZIP transcription factors identified in the C. glabrata genome. Microarray analysis revealed that the transcriptional response to ER stress is not mediated by Ire1, but instead is dependent largely on calcineurin signaling and partially on the Slt2 MAPK pathway. The loss of Ire1 alone did not confer increased antifungal susceptibility in C. glabrata contrary to UPR-defective mutants in other fungi. Taken together, our results suggest that the canonical Ire1-Hac1 UPR is not conserved in C. glabrata. It is known in metazoans that active Ire1 nonspecifically cleaves and degrades a subset of ER-localized mRNAs to reduce the ER load. Intriguingly, this cellular response could occur in an Ire1 nuclease-dependent fashion in C. glabrata. We also uncovered the attenuated virulence of the C. glabrata Δire1 mutant in a mouse model of disseminated candidiasis. This study has unveiled the unique evolution of ER stress response mechanisms in C. glabrata.

  5. Genome-wide functional analysis of plasmodium protein phosphatases reveals key regulators of parasite development and differentiation

    KAUST Repository

    Guttery, David S.

    2014-07-09

    Reversible protein phosphorylation regulated by kinases and phosphatases controls many cellular processes. Although essential functions for the malaria parasite kinome have been reported, the roles of most protein phosphatases (PPs) during Plasmodium development are unknown. We report a functional analysis of the Plasmodium berghei protein phosphatome, which exhibits high conservation with the P. falciparum phosphatome and comprises 30 predicted PPs with differential and distinct expression patterns during various stages of the life cycle. Gene disruption analysis of P. berghei PPs reveals that half of the genes are likely essential for asexual blood stage development, whereas six are required for sexual development/sporogony in mosquitoes. Phenotypic screening coupled with transcriptome sequencing unveiled morphological changes and altered gene expression in deletion mutants of two N-myristoylated PPs. These findings provide systematic functional analyses of PPs in Plasmodium, identify how phosphatases regulate parasite development and differentiation, and can inform the identification of drug targets for malaria. © 2014 The Authors.

  6. Genome-wide functional analysis of plasmodium protein phosphatases reveals key regulators of parasite development and differentiation

    KAUST Repository

    Guttery, David  S.; Poulin, Benoit; Ramaprasad, Abhinay; Wall, Richard  J.; Ferguson, David  J.P.; Brady, Declan; Patzewitz, Eva-Maria; Whipple, Sarah; Straschil, Ursula; Wright, Megan  H.; Mohamed, Alyaa  M.A.H.; Radhakrishnan, Anand; Arold, Stefan T.; Tate, Edward  W.; Holder, Anthony  A.; Wickstead, Bill; Pain, Arnab; Tewari, Rita

    2014-01-01

    Reversible protein phosphorylation regulated by kinases and phosphatases controls many cellular processes. Although essential functions for the malaria parasite kinome have been reported, the roles of most protein phosphatases (PPs) during Plasmodium development are unknown. We report a functional analysis of the Plasmodium berghei protein phosphatome, which exhibits high conservation with the P. falciparum phosphatome and comprises 30 predicted PPs with differential and distinct expression patterns during various stages of the life cycle. Gene disruption analysis of P. berghei PPs reveals that half of the genes are likely essential for asexual blood stage development, whereas six are required for sexual development/sporogony in mosquitoes. Phenotypic screening coupled with transcriptome sequencing unveiled morphological changes and altered gene expression in deletion mutants of two N-myristoylated PPs. These findings provide systematic functional analyses of PPs in Plasmodium, identify how phosphatases regulate parasite development and differentiation, and can inform the identification of drug targets for malaria. © 2014 The Authors.

  7. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  8. Moho Depth Variations in the Northeastern North China Craton Revealed by Receiver Function Imaging

    Science.gov (United States)

    Zhang, P.; Chen, L.; Yao, H.; Fang, L.

    2016-12-01

    The North China Craton (NCC), one of the oldest cratons in the world, has attracted wide attention in Earth Science for decades because of the unusual Mesozoic destruction of its cratonic lithosphere. Understanding the deep processes and mechanism of this craton destruction demands detailed knowledge about the deep structure of the region. In this study, we used two-year teleseismic receiver function data from the North China Seismic Array consisting of 200 broadband stations deployed in the northeastern NCC to image the Moho undulation of the region. A 2-D wave equation-based poststack depth migration method was employed to construct the structural images along 19 profiles, and a pseudo 3D crustal velocity model of the region based on previous ambient noise tomography and receiver function study was adopted in the migration. We considered both the Ps and PpPs phases, but in some cases we also conducted PpSs+PsPs migration using different back azimuth ranges of the data, and calculated the travel times of all the considered phases to constrain the Moho depths. By combining the structure images along the 19 profiles, we got a high-resolution Moho depth map beneath the northeastern NCC. Our results broadly consist with the results of previous active source studies [http://www.craton.cn/data], and show a good correlation of the Moho depths with geological and tectonic features. Generally, the Moho depths are distinctly different on the opposite sides of the North-South Gravity Lineament. The Moho in the west are deeper than 40 km and shows a rapid uplift from 40 km to 30 km beneath the Taihang Mountain Range in the middle. To the east in the Bohai Bay Basin, the Moho further shallows to 30-26 km depth and undulates by 3 km, coinciding well with the depressions and uplifts inside the basin. The Moho depth beneath the Yin-Yan Mountains in the north gradually decreases from 42 km in the west to 25 km in the east, varying much smoother than that to the south.

  9. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  10. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  11. Temporal dynamics of hot desert microbial communities reveal structural and functional responses to water input.

    Science.gov (United States)

    Armstrong, Alacia; Valverde, Angel; Ramond, Jean-Baptiste; Makhalanyane, Thulani P; Jansson, Janet K; Hopkins, David W; Aspray, Thomas J; Seely, Mary; Trindade, Marla I; Cowan, Don A

    2016-09-29

    The temporal dynamics of desert soil microbial communities are poorly understood. Given the implications for ecosystem functioning under a global change scenario, a better understanding of desert microbial community stability is crucial. Here, we sampled soils in the central Namib Desert on sixteen different occasions over a one-year period. Using Illumina-based amplicon sequencing of the 16S rRNA gene, we found that α-diversity (richness) was more variable at a given sampling date (spatial variability) than over the course of one year (temporal variability). Community composition remained essentially unchanged across the first 10 months, indicating that spatial sampling might be more important than temporal sampling when assessing β-diversity patterns in desert soils. However, a major shift in microbial community composition was found following a single precipitation event. This shift in composition was associated with a rapid increase in CO 2 respiration and productivity, supporting the view that desert soil microbial communities respond rapidly to re-wetting and that this response may be the result of both taxon-specific selection and changes in the availability or accessibility of organic substrates. Recovery to quasi pre-disturbance community composition was achieved within one month after rainfall.

  12. Functional Insights Revealed by the Kinetic Mechanism of CRISPR/Cas9.

    Science.gov (United States)

    Raper, Austin T; Stephenson, Anthony A; Suo, Zucai

    2018-02-28

    The discovery of prokaryotic adaptive immunity prompted widespread use of the RNA-guided clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) endonuclease Cas9 for genetic engineering. However, its kinetic mechanism remains undefined, and details of DNA cleavage are poorly characterized. Here, we establish a kinetic mechanism of Streptococcus pyogenes Cas9 from guide-RNA binding through DNA cleavage and product release. Association of DNA to the binary complex of Cas9 and guide-RNA is rate-limiting during the first catalytic turnover, while DNA cleavage from a pre-formed ternary complex of Cas9, guide-RNA, and DNA is rapid. Moreover, an extremely slow release of DNA products essentially restricts Cas9 to be a single-turnover enzyme. By simultaneously measuring the contributions of the HNH and RuvC nuclease activities of Cas9 to DNA cleavage, we also uncovered the kinetic basis by which HNH conformationally regulates the RuvC cleavage activity. Together, our results provide crucial kinetic and functional details regarding Cas9 which will inform gene-editing experiments, guide future research to understand off-target DNA cleavage by Cas9, and aid in the continued development of Cas9 as a biotechnological tool.

  13. Situating and teaching 21st century zoology: revealing pattern in the form and function of animals.

    Science.gov (United States)

    Russell, Anthony P

    2009-09-01

    The current challenges (increasing levels of integration in the biological sciences) facing the teaching of zoology and the structure of the zoology curriculum are explored herein. General context is provided and a more focused scrutiny of the situation in North America is presented. The changing emphases in more broadly-based biological sciences programs in North America are outlined, and their influence on the role of zoology as part of fundamental biological training is considered. The longer term impact of such changes in emphasis on the teaching of zoology is discussed, and the central role that zoology can play in dealing with both science content and science education is advanced. Based upon a focal workshop on the future of the zoology curriculum in Canada, a perspective on the challenges facing curriculum evolution is provided. Extensive curriculum redesign is called for to ensure that zoology provides a broad-scale integrative approach to the understanding of biodiversity in evolutionary, ecological and functional contexts. Barriers to, and drivers of change are identified and the need for collaborative approaches to curricular evolution is emphasized. © 2009 ISZS, Blackwell Publishing and IOZ/CAS.

  14. Bite of the cats: relationships between functional integration and mechanical performance as revealed by mandible geometry.

    Science.gov (United States)

    Piras, Paolo; Maiorino, Leonardo; Teresi, Luciano; Meloro, Carlo; Lucci, Federico; Kotsakis, Tassos; Raia, Pasquale

    2013-11-01

    Cat-like carnivorous mammals represent a relatively homogeneous group of species whose morphology appears constrained by exclusive adaptations for meat eating. We present the most comprehensive data set of extant and extinct cat-like species to test for evolutionary transformations in size, shape and mechanical performance, that is, von Mises stress and surface traction, of the mandible. Size and shape were both quantified by means of geometric morphometrics, whereas mechanical performance was assessed applying finite element models to 2D geometry of the mandible. Additionally, we present the first almost complete composite phylogeny of cat-like carnivorans for which well-preserved mandibles are known, including representatives of 35 extant and 59 extinct species of Felidae, Nimravidae, and Barbourofelidae. This phylogeny was used to test morphological differentiation, allometry, and covariation of mandible parts within and among clades. After taking phylogeny into account, we found that both allometry and mechanical variables exhibit a significant impact on mandible shape. We also tested whether mechanical performance was linked to morphological integration. Mechanical stress at the coronoid process is higher in sabertoothed cats than in any other clade. This is strongly related to the high degree of covariation within modules of sabertooths mandibles. We found significant correlation between integration at the clade level and per-clade averaged stress values, on both original data and by partialling out interclade allometry from shapes when calculating integration. This suggests a strong interaction between natural selection and the evolution of developmental and functional modules at the clade level.

  15. Tracking of plus-ends reveals microtubule functional diversity in different cell types

    Science.gov (United States)

    Shaebani, M. Reza; Pasula, Aravind; Ott, Albrecht; Santen, Ludger

    2016-07-01

    Many cellular processes are tightly connected to the dynamics of microtubules (MTs). While in neuronal axons MTs mainly regulate intracellular trafficking, they participate in cytoskeleton reorganization in many other eukaryotic cells, enabling the cell to efficiently adapt to changes in the environment. We show that the functional differences of MTs in different cell types and regions is reflected in the dynamic properties of MT tips. Using plus-end tracking proteins EB1 to monitor growing MT plus-ends, we show that MT dynamics and life cycle in axons of human neurons significantly differ from that of fibroblast cells. The density of plus-ends, as well as the rescue and catastrophe frequencies increase while the growth rate decreases toward the fibroblast cell margin. This results in a rather stable filamentous network structure and maintains the connection between nucleus and membrane. In contrast, plus-ends are uniformly distributed along the axons and exhibit diverse polymerization run times and spatially homogeneous rescue and catastrophe frequencies, leading to MT segments of various lengths. The probability distributions of the excursion length of polymerization and the MT length both follow nearly exponential tails, in agreement with the analytical predictions of a two-state model of MT dynamics.

  16. Temporal dynamics of hot desert microbial communities reveal structural and functional responses to water input

    Energy Technology Data Exchange (ETDEWEB)

    Armstrong, Alacia; Valverde, Angel; Ramond, Jean-Baptiste; Makhalanyane, Thulani P.; Jansson, Janet K.; Hopkins, David W.; Aspray, Thomas J.; Seely, Mary; Trindade, Marla I.; Cowan, Don A.

    2016-09-29

    The temporal dynamics of desert soil microbial communities are poorly understood. Given the implications for ecosystem functioning under a global change scenario, a better understanding of desert microbial community stability is crucial. Here, we sampled soils in the central Namib Desert on sixteen different occasions over a one-year period. Using Illumina-based amplicon sequencing of the 16S rRNA gene, we found that α-diversity (richness) was more variable at a given sampling date (spatial variability) than over the course of one year (temporal variability). Community composition remained essentially unchanged across the first 10 months, indicating that spatial sampling might be more important than temporal sampling when assessing β-diversity patterns in desert soils. However, a major shift in microbial community composition was found following a single precipitation event. This shift in composition was associated with a rapid increase in CO2 respiration and productivity, supporting the view that desert soil microbial communities respond rapidly to re-wetting and that this response may be the result of both taxon-specific selection and changes in the availability or accessibility of organic substrates. Recovery to quasi pre-disturbance community composition was achieved within one month after rainfall.

  17. Revealing turning points in ecosystem functioning over the Northern Eurasian agricultural frontier.

    Science.gov (United States)

    Horion, Stéphanie; Prishchepov, Alexander V; Verbesselt, Jan; de Beurs, Kirsten; Tagesson, Torbern; Fensholt, Rasmus

    2016-08-01

    The collapse of the Soviet Union in 1991 has been a turning point in the World history that left a unique footprint on the Northern Eurasian ecosystems. Conducting large scale mapping of environmental change and separating between naturogenic and anthropogenic drivers is a difficult endeavor in such highly complex systems. In this research a piece-wise linear regression method was used for breakpoint detection in Rain-Use Efficiency (RUE) time series and a classification of ecosystem response types was produced. Supported by earth observation data, field data, and expert knowledge, this study provides empirical evidence regarding the occurrence of drastic changes in RUE (assessment of the timing, the direction and the significance of these changes) in Northern Eurasian ecosystems between 1982 and 2011. About 36% of the study area (3.4 million km(2) ) showed significant (P agricultural land abandonment. Our study also showed that recurrent droughts deeply affected vegetation productivity throughout the observation period, with a general worsening of the drought conditions in recent years. Moreover, recent human-induced turning points in ecosystem functioning were detected and attributed to ongoing recultivation and change in irrigation practices in the Volgograd region, and to increased salinization and increased grazing intensity around Lake Balkhash. The ecosystem-state assessment method introduced here proved to be a valuable support that highlighted hotspots of potentially altered ecosystems and allowed for disentangling human from climatic disturbances. © 2016 John Wiley & Sons Ltd.

  18. Magnetic resonance imaging reveals functional anatomy and biomechanics of a living dragon tree

    Science.gov (United States)

    Hesse, Linnea; Masselter, Tom; Leupold, Jochen; Spengler, Nils; Speck, Thomas; Korvink, Jan Gerrit

    2016-01-01

    Magnetic resonance imaging (MRI) was used to gain in vivo insight into load-induced displacements of inner plant tissues making a non-invasive and non-destructive stress and strain analysis possible. The central aim of this study was the identification of a possible load-adapted orientation of the vascular bundles and their fibre caps as the mechanically relevant tissue in branch-stem-attachments of Dracaena marginata. The complex three-dimensional deformations that occur during mechanical loading can be analysed on the basis of quasi-three-dimensional data representations of the outer surface, the inner tissue arrangement (meristem and vascular system), and the course of single vascular bundles within the branch-stem-attachment region. In addition, deformations of vascular bundles could be quantified manually and by using digital image correlation software. This combination of qualitative and quantitative stress and strain analysis leads to an improved understanding of the functional morphology and biomechanics of D. marginata, a plant that is used as a model organism for optimizing branched technical fibre-reinforced lightweight trusses in order to increase their load bearing capacity. PMID:27604526

  19. Revealing Soil Structure and Functional Macroporosity along a Clay Gradient Using X-ray Computed Tomography

    DEFF Research Database (Denmark)

    Naveed, Muhammad; Møldrup, Per; Arthur, Emmanuel

    2013-01-01

    clay content, respectively) at a field site in Lerbjerg, Denmark. The water-holding capacity of soils markedly increased with increasing soil clay content, while significantly higher air permeability was observed for the L1 to L3 soils than for the L4 to L6 soils. Higher air permeability values......The influence of clay content in soil-pore structure development and the relative importance of macroporosity in governing convective fluid flow are two key challenges toward better understanding and quantifying soil ecosystem functions. In this study, soil physical measurements (soil-water...... retention and air permeability) and x-ray computed tomography (CT) scanning were combined and used from two scales on intact soil columns (100 and 580 cm3). The columns were sampled along a natural clay gradient at six locations (L1, L2, L3, L4, L5 and L6 with 0.11, 0.16, 0.21, 0.32, 0.38 and 0.46 kg kg−1...

  20. Network-based analysis reveals functional connectivity related to internet addiction tendency

    Directory of Open Access Journals (Sweden)

    Tanya eWen

    2016-02-01

    Full Text Available IntroductionPreoccupation and compulsive use of the internet can have negative psychological effects, such that it is increasingly being recognized as a mental disorder. The present study employed network-based statistics to explore how whole-brain functional connections at rest is related to the extent of individual’s level of internet addiction, indexed by a self-rated questionnaire. We identified two topologically significant networks, one with connections that are positively correlated with internet addiction tendency, and one with connections negatively correlated with internet addiction tendency. The two networks are interconnected mostly at frontal regions, which might reflect alterations in the frontal region for different aspects of cognitive control (i.e., for control of internet usage and gaming skills. Next, we categorized the brain into several large regional subgroupings, and found that the majority of proportions of connections in the two networks correspond to the cerebellar model of addiction which encompasses the four-circuit model. Lastly, we observed that the brain regions with the most inter-regional connections associated with internet addiction tendency replicate those often seen in addiction literature, and is corroborated by our meta-analysis of internet addiction studies. This research provides a better understanding of large-scale networks involved in internet addiction tendency and shows that pre-clinical levels of internet addiction are associated with similar regions and connections as clinical cases of addiction.

  1. Chemical Transport Knockout for Oxidized Vitamin C, Dehydroascorbic Acid, Reveals Its Functions in vivo

    Directory of Open Access Journals (Sweden)

    Hongbin Tu

    2017-09-01

    Full Text Available Despite its transport by glucose transporters (GLUTs in vitro, it is unknown whether dehydroascorbic acid (oxidized vitamin C, DHA has any in vivo function. To investigate, we created a chemical transport knockout model using the vitamin C analog 6-bromo-ascorbate. This analog is transported on sodium-dependent vitamin C transporters but its oxidized form, 6-bromo-dehydroascorbic acid, is not transported by GLUTs. Mice (gulo−/− unable to synthesize ascorbate (vitamin C were raised on 6-bromo-ascorbate. Despite normal survival, centrifugation of blood produced hemolysis secondary to near absence of red blood cell (RBC ascorbate/6-bromo-ascorbate. Key findings with clinical implications were that RBCs in vitro transported dehydroascorbic acid but not bromo-dehydroascorbic acid; RBC ascorbate in vivo was obtained only via DHA transport; ascorbate via DHA transport in vivo was necessary for RBC structural integrity; and internal RBC ascorbate was essential to maintain ascorbate plasma concentrations in vitro/in vivo.

  2. Acquisition of omptin reveals cryptic virulence function of autotransporter YapE in Yersinia pestis

    Science.gov (United States)

    Pennington, Jarrod; Miller, Virginia L.

    2013-01-01

    SUMMARY Autotransporters, the largest family of secreted proteins in Gram negative bacteria, perform a variety of functions, including adherence, cytotoxicity, and immune evasion. In Yersinia pestis the autotransporter YapE has adhesive properties and contributes to bubonic infection of the mouse model. Here, we demonstrate that omptin cleavage of Y. pestis YapE is required to mediate bacterial aggregation and adherence to eukaryotic cells. We demonstrate that omptin cleavage is specific for the Y. pestis and Y. pseudotuberculosis YapE orthologs but is not conserved in the Y. enterocolitica protein. We also show that cleavage of YapE occurs in Y. pestis but not in the enteric Yersinia species, and requires the omptin Pla (plasminogen activator protease), which is encoded on the Y. pestis-specific plasmid pPCP1. Together, these data show that post-translation modification of YapE appears to be specific to Y. pestis, was acquired along with the acquisition of pPCP1 during the divergence of Y. pestis from Y. pseudotuberculosis, and are the first evidence of a novel mechanism to regulate bacterial adherence. PMID:23701256

  3. Digoxin reveals a functional connection between HIV-1 integration preference and T-cell activation.

    Science.gov (United States)

    Zhyvoloup, Alexander; Melamed, Anat; Anderson, Ian; Planas, Delphine; Lee, Chen-Hsuin; Kriston-Vizi, Janos; Ketteler, Robin; Merritt, Andy; Routy, Jean-Pierre; Ancuta, Petronela; Bangham, Charles R M; Fassati, Ariberto

    2017-07-01

    HIV-1 integrates more frequently into transcribed genes, however the biological significance of HIV-1 integration targeting has remained elusive. Using a selective high-throughput chemical screen, we discovered that the cardiac glycoside digoxin inhibits wild-type HIV-1 infection more potently than HIV-1 bearing a single point mutation (N74D) in the capsid protein. We confirmed that digoxin repressed viral gene expression by targeting the cellular Na+/K+ ATPase, but this did not explain its selectivity. Parallel RNAseq and integration mapping in infected cells demonstrated that digoxin inhibited expression of genes involved in T-cell activation and cell metabolism. Analysis of >400,000 unique integration sites showed that WT virus integrated more frequently than N74D mutant within or near genes susceptible to repression by digoxin and involved in T-cell activation and cell metabolism. Two main gene networks down-regulated by the drug were CD40L and CD38. Blocking CD40L by neutralizing antibodies selectively inhibited WT virus infection, phenocopying digoxin. Thus the selectivity of digoxin depends on a combination of integration targeting and repression of specific gene networks. The drug unmasked a functional connection between HIV-1 integration and T-cell activation. Our results suggest that HIV-1 evolved integration site selection to couple its early gene expression with the status of target CD4+ T-cells, which may affect latency and viral reactivation.

  4. Digoxin reveals a functional connection between HIV-1 integration preference and T-cell activation.

    Directory of Open Access Journals (Sweden)

    Alexander Zhyvoloup

    2017-07-01

    Full Text Available HIV-1 integrates more frequently into transcribed genes, however the biological significance of HIV-1 integration targeting has remained elusive. Using a selective high-throughput chemical screen, we discovered that the cardiac glycoside digoxin inhibits wild-type HIV-1 infection more potently than HIV-1 bearing a single point mutation (N74D in the capsid protein. We confirmed that digoxin repressed viral gene expression by targeting the cellular Na+/K+ ATPase, but this did not explain its selectivity. Parallel RNAseq and integration mapping in infected cells demonstrated that digoxin inhibited expression of genes involved in T-cell activation and cell metabolism. Analysis of >400,000 unique integration sites showed that WT virus integrated more frequently than N74D mutant within or near genes susceptible to repression by digoxin and involved in T-cell activation and cell metabolism. Two main gene networks down-regulated by the drug were CD40L and CD38. Blocking CD40L by neutralizing antibodies selectively inhibited WT virus infection, phenocopying digoxin. Thus the selectivity of digoxin depends on a combination of integration targeting and repression of specific gene networks. The drug unmasked a functional connection between HIV-1 integration and T-cell activation. Our results suggest that HIV-1 evolved integration site selection to couple its early gene expression with the status of target CD4+ T-cells, which may affect latency and viral reactivation.

  5. Language processing of auditory cortex revealed by functional magnetic resonance imaging in presbycusis patients.

    Science.gov (United States)

    Chen, Xianming; Wang, Maoxin; Deng, Yihong; Liang, Yonghui; Li, Jianzhong; Chen, Shiyan

    2016-01-01

    Contralateral temporal lobe activation decreases with aging, regardless of hearing status, with elderly individuals showing reduced right ear advantage. Aging and hearing loss possibly lead to presbycusis speech discrimination decline. To evaluate presbycusis patients' auditory cortex activation under verbal stimulation. Thirty-six patients were enrolled: 10 presbycusis patients (mean age = 64 years, range = 60-70), 10 in the healthy aged group (mean age = 66 years, range = 60-70), and 16 young healthy volunteers (mean age = 25 years, range = 23-28). These three groups underwent simultaneous 1 kHz and 90 dB single-syllable word stimuli and (blood-oxygen-level-dependent functional magnetic resonance imaging) BOLD fMRI examinations. The main activation regions were superior temporal and middle temporal gyrus. For all aged subjects, the right region of interest (ROI) activation volume was decreased compared with the young group. With left ear stimulation, bilateral ROI activation intensity held. With right ear stimulation, the aged group's activation intensity was higher. Using monaural stimulation in the young group, contralateral temporal lobe activation volume and intensity were higher vs ipsilateral, while they were lower in the aged and presbycusis groups. On left and right ear auditory tasks, the young group showed right ear advantage, while the aged and presbycusis groups showed reduced right ear advantage.

  6. Pam heterozygous mice reveal essential role for Cu in amygdalar behavioral and synaptic function.

    Science.gov (United States)

    Gaier, Eric D; Eipper, Betty A; Mains, Richard E

    2014-05-01

    Copper (Cu) is an essential element with many biological roles, but its roles in the mammalian nervous system are poorly understood. Mice deficient in the cuproenzyme peptidylglycine α-amidating monooxygenase (Pam(+/-) mice) were initially generated to study neuropeptide amidation. Pam(+/-) mice exhibit profound deficits in a few behavioral tasks, including enhancements in innate fear along with deficits in acquired fear. Interestingly, several Pam(+/-) phenotypes were recapitulated in Cu-restricted wild-type mice and rescued in Cu-supplemented Pam(+/-) mice. These behaviors correspond to enhanced excitability and deficient synaptic plasticity in the amygdala of Pam(+/-) mice, which are also rescued by Cu supplementation. Cu and ATP7A are present at synapses, in key positions to respond to and influence synaptic activity. Further study demonstrated that extracellular Cu is necessary for wild-type synaptic plasticity and sufficient to induce long-term potentiation. These experiments support roles for PAM in Cu homeostasis and for synaptic Cu in amygdalar function. © 2014 New York Academy of Sciences.

  7. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.

    Science.gov (United States)

    Bohlen, Christopher J; Bennett, F Chris; Tucker, Andrew F; Collins, Hannah Y; Mulinyawe, Sara B; Barres, Ben A

    2017-05-17

    Microglia, the resident macrophages of the CNS, engage in various CNS-specific functions that are critical for development and health. To better study microglia and the properties that distinguish them from other tissue macrophage populations, we have optimized serum-free culture conditions to permit robust survival of highly ramified adult microglia under defined-medium conditions. We find that astrocyte-derived factors prevent microglial death ex vivo and that this activity results from three primary components, CSF-1/IL-34, TGF-β2, and cholesterol. Using microglial cultures that have never been exposed to serum, we demonstrate a dramatic and lasting change in phagocytic capacity after serum exposure. Finally, we find that mature microglia rapidly lose signature gene expression after isolation, and that this loss can be reversed by engrafting cells back into an intact CNS environment. These data indicate that the specialized gene expression profile of mature microglia requires continuous instructive signaling from the intact CNS. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Function of the ATR N-terminal domain revealed by an ATM/ATR chimera

    International Nuclear Information System (INIS)

    Chen Xinping; Zhao Runxiang; Glick, Gloria G.; Cortez, David

    2007-01-01

    The ATM and ATR kinases function at the apex of checkpoint signaling pathways. These kinases share significant sequence similarity, phosphorylate many of the same substrates, and have overlapping roles in initiating cell cycle checkpoints. However, they sense DNA damage through distinct mechanisms. ATR primarily senses single stranded DNA (ssDNA) through its interaction with ATRIP, and ATM senses double strand breaks through its interaction with Nbs1. We determined that the N-terminus of ATR contains a domain that binds ATRIP. Attaching this domain to ATM allowed the fusion protein (ATM*) to bind ATRIP and associate with RPA-coated ssDNA. ATM* also gained the ability to localize efficiently to stalled replication forks as well as double strand breaks. Despite having normal kinase activity when tested in vitro and being phosphorylated on S1981 in vivo, ATM* is defective in checkpoint signaling and does not complement cellular deficiencies in either ATM or ATR. These data indicate that the N-terminus of ATR is sufficient to bind ATRIP and to promote localization to sites of replication stress

  9. Whole-brain analytic measures of network communication reveal increased structure-function correlation in right temporal lobe epilepsy.

    Science.gov (United States)

    Wirsich, Jonathan; Perry, Alistair; Ridley, Ben; Proix, Timothée; Golos, Mathieu; Bénar, Christian; Ranjeva, Jean-Philippe; Bartolomei, Fabrice; Breakspear, Michael; Jirsa, Viktor; Guye, Maxime

    2016-01-01

    The in vivo structure-function relationship is key to understanding brain network reorganization due to pathologies. This relationship is likely to be particularly complex in brain network diseases such as temporal lobe epilepsy, in which disturbed large-scale systems are involved in both transient electrical events and long-lasting functional and structural impairments. Herein, we estimated this relationship by analyzing the correlation between structural connectivity and functional connectivity in terms of analytical network communication parameters. As such, we targeted the gradual topological structure-function reorganization caused by the pathology not only at the whole brain scale but also both in core and peripheral regions of the brain. We acquired diffusion (dMRI) and resting-state fMRI (rsfMRI) data in seven right-lateralized TLE (rTLE) patients and fourteen healthy controls and analyzed the structure-function relationship by using analytical network communication metrics derived from the structural connectome. In rTLE patients, we found a widespread hypercorrelated functional network. Network communication analysis revealed greater unspecific branching of the shortest path (search information) in the structural connectome and a higher global correlation between the structural and functional connectivity for the patient group. We also found evidence for a preserved structural rich-club in the patient group. In sum, global augmentation of structure-function correlation might be linked to a smaller functional repertoire in rTLE patients, while sparing the central core of the brain which may represent a pathway that facilitates the spread of seizures.

  10. Phylogeny and phylogeography of functional genes shared among seven terrestrial subsurface metagenomes reveal N-cycling and microbial evolutionary relationships

    Directory of Open Access Journals (Sweden)

    Maggie CY Lau

    2014-10-01

    Full Text Available Comparative studies on community phylogenetics and phylogeography of microorganisms living in extreme environments are rare. Terrestrial subsurface habitats are valuable for studying microbial biogeographical patterns due to their isolation and the restricted dispersal mechanisms. Since the taxonomic identity of a microorganism does not always correspond well with its functional role in a particular community, the use of taxonomic assignments or patterns may give limited inference on how microbial functions are affected by historical, geographical and environmental factors. With seven metagenomic libraries generated from fracture water samples collected from five South African mines, this study was carried out to (1 screen for ubiquitous functions or pathways of biogeochemical cycling of CH4, S and N; (2 to characterize the biodiversity represented by the common functional genes; (3 to investigate the subsurface biogeography as revealed by this subset of genes; and (4 to explore the possibility of using metagenomic data for evolutionary study. The ubiquitous functional genes are NarV, NPD, PAP reductase, NifH, NifD, NifK, NifE and NifN genes. Although these 8 common functional genes were taxonomically and phylogenetically diverse and distinct from each other, the dissimilarity between samples did not correlate strongly with either geographical, environmental or residence time of the water. Por genes homologous to those of Thermodesulfovibrio yellowstonii detected in all metagenomes were deep lineages of Nitrospirae, suggesting that subsurface habitats have preserved ancestral genetic signatures that inform the study of the origin and evolution of prokaryotes.

  11. Proteome-wide Structural Analysis of PTM Hotspots Reveals Regulatory Elements Predicted to Impact Biological Function and Disease*

    Science.gov (United States)

    Dewhurst, Henry; Sundararaman, Niveda

    2016-01-01

    Post-translational modifications (PTMs) regulate protein behavior through modulation of protein-protein interactions, enzymatic activity, and protein stability essential in the translation of genotype to phenotype in eukaryotes. Currently, less than 4% of all eukaryotic PTMs are reported to have biological function - a statistic that continues to decrease with an increasing rate of PTM detection. Previously, we developed SAPH-ire (Structural Analysis of PTM Hotspots) - a method for the prioritization of PTM function potential that has been used effectively to reveal novel PTM regulatory elements in discrete protein families (Dewhurst et al., 2015). Here, we apply SAPH-ire to the set of eukaryotic protein families containing experimental PTM and 3D structure data - capturing 1,325 protein families with 50,839 unique PTM sites organized into 31,747 modified alignment positions (MAPs), of which 2010 (∼6%) possess known biological function. Here, we show that using an artificial neural network model (SAPH-ire NN) trained to identify MAP hotspots with biological function results in prediction outcomes that far surpass the use of single hotspot features, including nearest neighbor PTM clustering methods. We find the greatest enhancement in prediction for positions with PTM counts of five or less, which represent 98% of all MAPs in the eukaryotic proteome and 90% of all MAPs found to have biological function. Analysis of the top 1092 MAP hotspots revealed 267 of truly unknown function (containing 5443 distinct PTMs). Of these, 165 hotspots could be mapped to human KEGG pathways for normal and/or disease physiology. Many high-ranking hotspots were also found to be disease-associated pathogenic sites of amino acid substitution despite the lack of observable PTM in the human protein family member. Taken together, these experiments demonstrate that the functional relevance of a PTM can be predicted very effectively by neural network models, revealing a large but testable

  12. Proteome-wide Structural Analysis of PTM Hotspots Reveals Regulatory Elements Predicted to Impact Biological Function and Disease.

    Science.gov (United States)

    Torres, Matthew P; Dewhurst, Henry; Sundararaman, Niveda

    2016-11-01

    Post-translational modifications (PTMs) regulate protein behavior through modulation of protein-protein interactions, enzymatic activity, and protein stability essential in the translation of genotype to phenotype in eukaryotes. Currently, less than 4% of all eukaryotic PTMs are reported to have biological function - a statistic that continues to decrease with an increasing rate of PTM detection. Previously, we developed SAPH-ire (Structural Analysis of PTM Hotspots) - a method for the prioritization of PTM function potential that has been used effectively to reveal novel PTM regulatory elements in discrete protein families (Dewhurst et al., 2015). Here, we apply SAPH-ire to the set of eukaryotic protein families containing experimental PTM and 3D structure data - capturing 1,325 protein families with 50,839 unique PTM sites organized into 31,747 modified alignment positions (MAPs), of which 2010 (∼6%) possess known biological function. Here, we show that using an artificial neural network model (SAPH-ire NN) trained to identify MAP hotspots with biological function results in prediction outcomes that far surpass the use of single hotspot features, including nearest neighbor PTM clustering methods. We find the greatest enhancement in prediction for positions with PTM counts of five or less, which represent 98% of all MAPs in the eukaryotic proteome and 90% of all MAPs found to have biological function. Analysis of the top 1092 MAP hotspots revealed 267 of truly unknown function (containing 5443 distinct PTMs). Of these, 165 hotspots could be mapped to human KEGG pathways for normal and/or disease physiology. Many high-ranking hotspots were also found to be disease-associated pathogenic sites of amino acid substitution despite the lack of observable PTM in the human protein family member. Taken together, these experiments demonstrate that the functional relevance of a PTM can be predicted very effectively by neural network models, revealing a large but testable

  13. Detailed Configuration of the Underthrusting Indian Lithosphere Beneath Western Tibet Revealed by Receiver Function Images

    Science.gov (United States)

    Xu, Qiang; Zhao, Junmeng; Yuan, Xiaohui; Liu, Hongbing; Pei, Shunping

    2017-10-01

    We analyze the teleseismic waveform data recorded by 42 temporary stations from the Y2 and ANTILOPE-1 arrays using the P and S receiver function techniques to investigate the lithospheric structure beneath western Tibet. The Moho is reliably identified as a prominent feature at depths of 55-82 km in the stacked traces and in depth migrated images. It has a concave shape and reaches the deepest location at about 80 km north of the Indus-Yarlung suture (IYS). An intracrustal discontinuity is observed at 55 km depth below the southern Lhasa terrane, which could represent the upper border of the eclogitized underthrusting Indian lower crust. Underthrusting of the Indian crust has been widely observed beneath the Lhasa terrane and correlates well with the Bouguer gravity low, suggesting that the gravity anomalies in the Lhasa terrane are induced by topography of the Moho. At 20 km depth, a midcrustal low-velocity zone (LVZ) is observed beneath the Tethyan Himalaya and southern Lhasa terrane, suggesting a layer of partial melts that decouples the thrust/fold deformation of the upper crust from the shortening and underthrusting in the lower crust. The Sp conversions at the lithosphere-asthenosphere boundary (LAB) can be recognized at depths of 130-200 km, showing that the Indian lithospheric mantle is underthrusting with a ramp-flat shape beneath southern Tibet and probably is detached from the lower crust immediately under the IYS. Our observations reconstruct the configuration of the underthrusting Indian lithosphere and indicate significant along strike variations.

  14. Functional and evolutionary characterization of Ohr proteins in eukaryotes reveals many active homologs among pathogenic fungi

    Directory of Open Access Journals (Sweden)

    D.A. Meireles

    2017-08-01

    Full Text Available Ohr and OsmC proteins comprise two subfamilies within a large group of proteins that display Cys-based, thiol dependent peroxidase activity. These proteins were previously thought to be restricted to prokaryotes, but we show here, using iterated sequence searches, that Ohr/OsmC homologs are also present in 217 species of eukaryotes with a massive presence in Fungi (186 species. Many of these eukaryotic Ohr proteins possess an N-terminal extension that is predicted to target them to mitochondria. We obtained recombinant proteins for four eukaryotic members of the Ohr/OsmC family and three of them displayed lipoyl peroxidase activity. Further functional and biochemical characterization of the Ohr homologs from the ascomycete fungus Mycosphaerella fijiensis Mf_1 (MfOhr, the causative agent of Black Sigatoka disease in banana plants, was pursued. Similarly to what has been observed for the bacterial proteins, we found that: (i the peroxidase activity of MfOhr was supported by DTT or dihydrolipoamide (dithiols, but not by β-mercaptoethanol or GSH (monothiols, even in large excess; (ii MfOhr displayed preference for organic hydroperoxides (CuOOH and tBOOH over hydrogen peroxide; (iii MfOhr presented extraordinary reactivity towards linoleic acid hydroperoxides (k=3.18 (±2.13×108 M−1 s−1. Both Cys87 and Cys154 were essential to the peroxidase activity, since single mutants for each Cys residue presented no activity and no formation of intramolecular disulfide bond upon treatment with hydroperoxides. The pKa value of the Cysp residue was determined as 5.7±0.1 by a monobromobimane alkylation method. Therefore, eukaryotic Ohr peroxidases share several biochemical features with prokaryotic orthologues and are preferentially located in mitochondria. Keywords: Ohr/OsmC, Thiol-dependent peroxidases, Phylogeny

  15. Functional and evolutionary characterization of Ohr proteins in eukaryotes reveals many active homologs among pathogenic fungi.

    Science.gov (United States)

    Meireles, D A; Domingos, R M; Gaiarsa, J W; Ragnoni, E G; Bannitz-Fernandes, R; da Silva Neto, J F; de Souza, R F; Netto, L E S

    2017-08-01

    Ohr and OsmC proteins comprise two subfamilies within a large group of proteins that display Cys-based, thiol dependent peroxidase activity. These proteins were previously thought to be restricted to prokaryotes, but we show here, using iterated sequence searches, that Ohr/OsmC homologs are also present in 217 species of eukaryotes with a massive presence in Fungi (186 species). Many of these eukaryotic Ohr proteins possess an N-terminal extension that is predicted to target them to mitochondria. We obtained recombinant proteins for four eukaryotic members of the Ohr/OsmC family and three of them displayed lipoyl peroxidase activity. Further functional and biochemical characterization of the Ohr homologs from the ascomycete fungus Mycosphaerella fijiensis Mf_1 (MfOhr), the causative agent of Black Sigatoka disease in banana plants, was pursued. Similarly to what has been observed for the bacterial proteins, we found that: (i) the peroxidase activity of MfOhr was supported by DTT or dihydrolipoamide (dithiols), but not by β-mercaptoethanol or GSH (monothiols), even in large excess; (ii) MfOhr displayed preference for organic hydroperoxides (CuOOH and tBOOH) over hydrogen peroxide; (iii) MfOhr presented extraordinary reactivity towards linoleic acid hydroperoxides (k=3.18 (±2.13)×10 8 M -1 s -1 ). Both Cys 87 and Cys 154 were essential to the peroxidase activity, since single mutants for each Cys residue presented no activity and no formation of intramolecular disulfide bond upon treatment with hydroperoxides. The pK a value of the Cys p residue was determined as 5.7±0.1 by a monobromobimane alkylation method. Therefore, eukaryotic Ohr peroxidases share several biochemical features with prokaryotic orthologues and are preferentially located in mitochondria. Copyright © 2017. Published by Elsevier B.V.

  16. Structure-function analysis of Staphylococcus aureus amidase reveals the determinants of peptidoglycan recognition and cleavage.

    Science.gov (United States)

    Büttner, Felix Michael; Zoll, Sebastian; Nega, Mulugeta; Götz, Friedrich; Stehle, Thilo

    2014-04-18

    The bifunctional major autolysin AtlA of Staphylococcus aureus cleaves the bacterium's peptidoglycan network (PGN) at two distinct sites during cell division. Deletion of the enzyme results in large cell clusters with disordered division patterns, indicating that AtlA could be a promising target for the development of new antibiotics. One of the two functions of AtlA is performed by the N-acetylmuramyl-l-alanine amidase AmiA, which cleaves the bond between the carbohydrate and the peptide moieties of PGN. To establish the structural requirements of PGN recognition and the enzymatic mechanism of cleavage, we solved the crystal structure of the catalytic domain of AmiA (AmiA-cat) in complex with a peptidoglycan-derived ligand at 1.55 Å resolution. The peptide stem is clearly visible in the structure, forming extensive contacts with protein residues by docking into an elongated groove. Less well defined electron density and the analysis of surface features indicate likely positions of the carbohydrate backbone and the pentaglycine bridge. Substrate specificity analysis supports the importance of the pentaglycine bridge for fitting into the binding cleft of AmiA-cat. PGN of S. aureus with l-lysine tethered with d-alanine via a pentaglycine bridge is completely hydrolyzed, whereas PGN of Bacillus subtilis with meso-diaminopimelic acid directly tethered with d-alanine is not hydrolyzed. An active site mutant, H370A, of AmiA-cat was completely inactive, providing further support for the proposed catalytic mechanism of AmiA. The structure reported here is not only the first of any bacterial amidase in which both the PGN component and the water molecule that carries out the nucleophilic attack on the carbonyl carbon of the scissile bond are present; it is also the first peptidoglycan amidase complex structure of an important human pathogen.

  17. Functional characterisation of an intron retaining K+ transporter of barley reveals intron-mediated alternate splicing

    KAUST Repository

    Shahzad, K.

    2015-01-01

    Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably retained introns from barley (Hordeum vulgare) in yeast (Saccharomyces cerevisiae), and transcript profiling in yeast and transgenic tobacco (Nicotiana tabacum) is presented. Expression of intron-retaining HvHKT2;1 cDNA (HvHKT2;1-i) in trk1, trk2 yeast strain defective in K+ uptake restored growth in medium containing hygromycin in the presence of different concentrations of K+ and mediated hypersensitivity to Na+. HvHKT2;1-i produces multiple transcripts via alternate splicing of two regular introns and three exons in different compositions. HKT isoforms with retained introns and exon skipping variants were detected in relative expression analysis of (i) HvHKT2;1-i in barley under native conditions, (ii) in transgenic tobacco plants constitutively expressing HvHKT2;1-i, and (iii) in trk1, trk2 yeast expressing HvHKT2;1-i under control of an inducible promoter. Mixed proportions of three HKT transcripts: HvHKT2;1-e (first exon region), HvHKT2;1-i1 (first intron) and HvHKT2;1-i2 (second intron) were observed. The variation in transcript accumulation in response to changing K+ and Na+ concentrations was observed in both heterologous and plant systems. These findings suggest a link between intron-retaining transcripts and different splice variants to ion homeostasis, and their possible role in salt stress.

  18. Computer animations of color markings reveal the function of visual threat signals in Neolamprologus pulcher.

    Science.gov (United States)

    Balzarini, Valentina; Taborsky, Michael; Villa, Fabienne; Frommen, Joachim G

    2017-02-01

    Visual signals, including changes in coloration and color patterns, are frequently used by animals to convey information. During contests, body coloration and its changes can be used to assess an opponent's state or motivation. Communication of aggressive propensity is particularly important in group-living animals with a stable dominance hierarchy, as the outcome of aggressive interactions determines the social rank of group members. Neolamprologus pulcher is a cooperatively breeding cichlid showing frequent within-group aggression. Both sexes exhibit two vertical black stripes on the operculum that vary naturally in shape and darkness. During frontal threat displays these patterns are actively exposed to the opponent, suggesting a signaling function. To investigate the role of operculum stripes during contests we manipulated their darkness in computer animated pictures of the fish. We recorded the responses in behavior and stripe darkness of test subjects to which these animated pictures were presented. Individuals with initially darker stripes were more aggressive against the animations and showed more operculum threat displays. Operculum stripes of test subjects became darker after exposure to an animation exhibiting a pale operculum than after exposure to a dark operculum animation, highlighting the role of the darkness of this color pattern in opponent assessment. We conclude that (i) the black stripes on the operculum of N. pulcher are a reliable signal of aggression and dominance, (ii) these markings play an important role in opponent assessment, and (iii) 2D computer animations are well suited to elicit biologically meaningful short-term aggressive responses in this widely used model system of social evolution.

  19. Transcriptomics of aged Drosophila motor neurons reveals a matrix metalloproteinase that impairs motor function.

    Science.gov (United States)

    Azpurua, Jorge; Mahoney, Rebekah E; Eaton, Benjamin A

    2018-04-01

    The neuromuscular junction (NMJ) is responsible for transforming nervous system signals into motor behavior and locomotion. In the fruit fly Drosophila melanogaster, an age-dependent decline in motor function occurs, analogous to the decline experienced in mice, humans, and other mammals. The molecular and cellular underpinnings of this decline are still poorly understood. By specifically profiling the transcriptome of Drosophila motor neurons across age using custom microarrays, we found that the expression of the matrix metalloproteinase 1 (dMMP1) gene reproducibly increased in motor neurons in an age-dependent manner. Modulation of physiological aging also altered the rate of dMMP1 expression, validating dMMP1 expression as a bona fide aging biomarker for motor neurons. Temporally controlled overexpression of dMMP1 specifically in motor neurons was sufficient to induce deficits in climbing behavior and cause a decrease in neurotransmitter release at neuromuscular synapses. These deficits were reversible if the dMMP1 expression was shut off again immediately after the onset of motor dysfunction. Additionally, repression of dMMP1 enzymatic activity via overexpression of a tissue inhibitor of metalloproteinases delayed the onset of age-dependent motor dysfunction. MMPs are required for proper tissue architecture during development. Our results support the idea that matrix metalloproteinase 1 is acting as a downstream effector of antagonistic pleiotropy in motor neurons and is necessary for proper development, but deleterious when reactivated at an advanced age. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  20. RNA interference reveals allatotropin functioning in larvae and adults of Spodoptera frugiperda (Lepidoptera, Noctuidae

    Directory of Open Access Journals (Sweden)

    I.T.E. Hassanien

    2014-05-01

    Full Text Available The allatotropin of S. frugiperda (Spofr-AT and its cDNA sequence were characterized 10 years ago, but no functional analyses of the peptide are available. Here we used the RNA interference technique to study the effects of Spofr-AT gene suppression on juvenile hormone (JH and ecdysteroid titers in the hemolymph of larvae, virgin and mated females, and of males. Spofr-AT gene silencing in last instar larvae resulted in an increase in the amount of JH III and 20-hydroxyecdysone in the hemolymph of the animals, corresponding to an acceleration of the prepupal commitment and transformation to the pupa. Mated females showed much higher JH titers in their hemolymph than virgins and laid almost twice the number of eggs. Spofr-AT gene silencing in freshly ecdysed females led to a further increase in egg production and oviposition, but had only a minor effect on the hemoylmph JH titer. Mated females contain considerable amounts of JH I and JH II in their hemoylmph, which are thought to be received from males during copulation. To confirm this hypothesis, we measured the amount of JH homologs in the male accessory reproductive glands (MARG before mating and in the bursa copulatrix (BC of the female after mating. MARG contained high amounts of JH I and JH II, which are transferred to the BC during copulation. One day after mating, JH disappeared from the BC and was then found in the hemolymph of the females. In conclusion, Spofr-AT acts as a true allatotropin in larvae and adults of both sexes of the armyworm.

  1. Audiovisual functional magnetic resonance imaging adaptation reveals multisensory integration effects in object-related sensory cortices.

    Science.gov (United States)

    Doehrmann, Oliver; Weigelt, Sarah; Altmann, Christian F; Kaiser, Jochen; Naumer, Marcus J

    2010-03-03

    Information integration across different sensory modalities contributes to object recognition, the generation of associations and long-term memory representations. Here, we used functional magnetic resonance imaging adaptation to investigate the presence of sensory integrative effects at cortical levels as early as nonprimary auditory and extrastriate visual cortices, which are implicated in intermediate stages of object processing. Stimulation consisted of an adapting audiovisual stimulus S(1) and a subsequent stimulus S(2) from the same basic-level category (e.g., cat). The stimuli were carefully balanced with respect to stimulus complexity and semantic congruency and presented in four experimental conditions: (1) the same image and vocalization for S(1) and S(2), (2) the same image and a different vocalization, (3) different images and the same vocalization, or (4) different images and vocalizations. This two-by-two factorial design allowed us to assess the contributions of auditory and visual stimulus repetitions and changes in a statistically orthogonal manner. Responses in visual regions of right fusiform gyrus and right lateral occipital cortex were reduced for repeated visual stimuli (repetition suppression). Surprisingly, left lateral occipital cortex showed stronger responses to repeated auditory stimuli (repetition enhancement). Similarly, auditory regions of interest of the right middle superior temporal gyrus and sulcus exhibited repetition suppression to auditory repetitions and repetition enhancement to visual repetitions. Our findings of crossmodal repetition-related effects in cortices of the respective other sensory modality add to the emerging view that in human subjects sensory integrative mechanisms operate on earlier cortical processing levels than previously assumed.

  2. Structure-Function Analysis of Staphylococcus aureus Amidase Reveals the Determinants of Peptidoglycan Recognition and Cleavage*

    Science.gov (United States)

    Büttner, Felix Michael; Zoll, Sebastian; Nega, Mulugeta; Götz, Friedrich; Stehle, Thilo

    2014-01-01

    The bifunctional major autolysin AtlA of Staphylococcus aureus cleaves the bacterium's peptidoglycan network (PGN) at two distinct sites during cell division. Deletion of the enzyme results in large cell clusters with disordered division patterns, indicating that AtlA could be a promising target for the development of new antibiotics. One of the two functions of AtlA is performed by the N-acetylmuramyl-l-alanine amidase AmiA, which cleaves the bond between the carbohydrate and the peptide moieties of PGN. To establish the structural requirements of PGN recognition and the enzymatic mechanism of cleavage, we solved the crystal structure of the catalytic domain of AmiA (AmiA-cat) in complex with a peptidoglycan-derived ligand at 1.55 Å resolution. The peptide stem is clearly visible in the structure, forming extensive contacts with protein residues by docking into an elongated groove. Less well defined electron density and the analysis of surface features indicate likely positions of the carbohydrate backbone and the pentaglycine bridge. Substrate specificity analysis supports the importance of the pentaglycine bridge for fitting into the binding cleft of AmiA-cat. PGN of S. aureus with l-lysine tethered with d-alanine via a pentaglycine bridge is completely hydrolyzed, whereas PGN of Bacillus subtilis with meso-diaminopimelic acid directly tethered with d-alanine is not hydrolyzed. An active site mutant, H370A, of AmiA-cat was completely inactive, providing further support for the proposed catalytic mechanism of AmiA. The structure reported here is not only the first of any bacterial amidase in which both the PGN component and the water molecule that carries out the nucleophilic attack on the carbonyl carbon of the scissile bond are present; it is also the first peptidoglycan amidase complex structure of an important human pathogen. PMID:24599952

  3. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  4. Gustatory imagery reveals functional connectivity from the prefrontal to insular cortices traced with magnetoencephalography.

    Science.gov (United States)

    Kobayashi, Masayuki; Sasabe, Tetsuya; Shigihara, Yoshihito; Tanaka, Masaaki; Watanabe, Yasuyoshi

    2011-01-01

    Our experience and prejudice concerning food play an important role in modulating gustatory information processing; gustatory memory stored in the central nervous system influences gustatory information arising from the peripheral nervous system. We have elucidated the mechanism of the "top-down" modulation of taste perception in humans using functional magnetic resonance imaging (fMRI) and demonstrated that gustatory imagery is mediated by the prefrontal (PFC) and insular cortices (IC). However, the temporal order of activation of these brain regions during gustatory imagery is still an open issue. To explore the source of "top-down" signals during gustatory imagery tasks, we analyzed the temporal activation patterns of activated regions in the cerebral cortex using another non-invasive brain imaging technique, magnetoencephalography (MEG). Gustatory imagery tasks were presented by words (Letter G-V) or pictures (Picture G-V) of foods/beverages, and participants were requested to recall their taste. In the Letter G-V session, 7/9 (77.8%) participants showed activation in the IC with a latency of 401.7±34.7 ms (n = 7) from the onset of word exhibition. In 5/7 (71.4%) participants who exhibited IC activation, the PFC was activated prior to the IC at a latency of 315.2±56.5 ms (n = 5), which was significantly shorter than the latency to the IC activation. In the Picture G-V session, the IC was activated in 6/9 (66.7%) participants, and only 1/9 (11.1%) participants showed activation in the PFC. There was no significant dominance between the right and left IC or PFC during gustatory imagery. These results support those from our previous fMRI study in that the Letter G-V session rather than the Picture G-V session effectively activates the PFC and IC and strengthen the hypothesis that the PFC mediates "top-down" control of retrieving gustatory information from the storage of long-term memories and in turn activates the IC.

  5. Gustatory imagery reveals functional connectivity from the prefrontal to insular cortices traced with magnetoencephalography.

    Directory of Open Access Journals (Sweden)

    Masayuki Kobayashi

    Full Text Available Our experience and prejudice concerning food play an important role in modulating gustatory information processing; gustatory memory stored in the central nervous system influences gustatory information arising from the peripheral nervous system. We have elucidated the mechanism of the "top-down" modulation of taste perception in humans using functional magnetic resonance imaging (fMRI and demonstrated that gustatory imagery is mediated by the prefrontal (PFC and insular cortices (IC. However, the temporal order of activation of these brain regions during gustatory imagery is still an open issue. To explore the source of "top-down" signals during gustatory imagery tasks, we analyzed the temporal activation patterns of activated regions in the cerebral cortex using another non-invasive brain imaging technique, magnetoencephalography (MEG. Gustatory imagery tasks were presented by words (Letter G-V or pictures (Picture G-V of foods/beverages, and participants were requested to recall their taste. In the Letter G-V session, 7/9 (77.8% participants showed activation in the IC with a latency of 401.7±34.7 ms (n = 7 from the onset of word exhibition. In 5/7 (71.4% participants who exhibited IC activation, the PFC was activated prior to the IC at a latency of 315.2±56.5 ms (n = 5, which was significantly shorter than the latency to the IC activation. In the Picture G-V session, the IC was activated in 6/9 (66.7% participants, and only 1/9 (11.1% participants showed activation in the PFC. There was no significant dominance between the right and left IC or PFC during gustatory imagery. These results support those from our previous fMRI study in that the Letter G-V session rather than the Picture G-V session effectively activates the PFC and IC and strengthen the hypothesis that the PFC mediates "top-down" control of retrieving gustatory information from the storage of long-term memories and in turn activates the IC.

  6. Structural and functional analysis of cyclin D1 reveals p27 and substrate inhibitor binding requirements.

    Science.gov (United States)

    Liu, Shu; Bolger, Joshua K; Kirkland, Lindsay O; Premnath, Padmavathy N; McInnes, Campbell

    2010-12-17

    synthesized in order to explore structure-activity relationship for binding to the cyclin D1 groove, which to date has not been carried out in a systematic fashion. Collectively, the data presented provide new insights into how compounds can be developed that function as chemical biology probes to determine the cellular and antitumor effects of CDK inhibition. Furthermore, such compounds will serve as templates for structure-guided efforts to develop potential therapeutics based on selective inhibition of CDK4/cyclin D activity.

  7. Anatomical Reconstruction and Functional Imaging Reveal an Ordered Array of Skylight Polarization Detectors in Drosophila.

    Science.gov (United States)

    Weir, Peter T; Henze, Miriam J; Bleul, Christiane; Baumann-Klausener, Franziska; Labhart, Thomas; Dickinson, Michael H

    2016-05-11

    Many insects exploit skylight polarization as a compass cue for orientation and navigation. In the fruit fly, Drosophila melanogaster, photoreceptors R7 and R8 in the dorsal rim area (DRA) of the compound eye are specialized to detect the electric vector (e-vector) of linearly polarized light. These photoreceptors are arranged in stacked pairs with identical fields of view and spectral sensitivities, but mutually orthogonal microvillar orientations. As in larger flies, we found that the microvillar orientation of the distal photoreceptor R7 changes in a fan-like fashion along the DRA. This anatomical arrangement suggests that the DRA constitutes a detector for skylight polarization, in which different e-vectors maximally excite different positions in the array. To test our hypothesis, we measured responses to polarized light of varying e-vector angles in the terminals of R7/8 cells using genetically encoded calcium indicators. Our data confirm a progression of preferred e-vector angles from anterior to posterior in the DRA, and a strict orthogonality between the e-vector preferences of paired R7/8 cells. We observed decreased activity in photoreceptors in response to flashes of light polarized orthogonally to their preferred e-vector angle, suggesting reciprocal inhibition between photoreceptors in the same medullar column, which may serve to increase polarization contrast. Together, our results indicate that the polarization-vision system relies on a spatial map of preferred e-vector angles at the earliest stage of sensory processing. The fly's visual system is an influential model system for studying neural computation, and much is known about its anatomy, physiology, and development. The circuits underlying motion processing have received the most attention, but researchers are increasingly investigating other functions, such as color perception and object recognition. In this work, we investigate the early neural processing of a somewhat exotic sense, called

  8. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  9. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  10. Integrative Analysis of Subcellular Quantitative Proteomics Studies Reveals Functional Cytoskeleton Membrane-Lipid Raft Interactions in Cancer.

    Science.gov (United States)

    Shah, Anup D; Inder, Kerry L; Shah, Alok K; Cristino, Alexandre S; McKie, Arthur B; Gabra, Hani; Davis, Melissa J; Hill, Michelle M

    2016-10-07

    Lipid rafts are dynamic membrane microdomains that orchestrate molecular interactions and are implicated in cancer development. To understand the functions of lipid rafts in cancer, we performed an integrated analysis of quantitative lipid raft proteomics data sets modeling progression in breast cancer, melanoma, and renal cell carcinoma. This analysis revealed that cancer development is associated with increased membrane raft-cytoskeleton interactions, with ∼40% of elevated lipid raft proteins being cytoskeletal components. Previous studies suggest a potential functional role for the raft-cytoskeleton in the action of the putative tumor suppressors PTRF/Cavin-1 and Merlin. To extend the observation, we examined lipid raft proteome modulation by an unrelated tumor suppressor opioid binding protein cell-adhesion molecule (OPCML) in ovarian cancer SKOV3 cells. In agreement with the other model systems, quantitative proteomics revealed that 39% of OPCML-depleted lipid raft proteins are cytoskeletal components, with microfilaments and intermediate filaments specifically down-regulated. Furthermore, protein-protein interaction network and simulation analysis showed significantly higher interactions among cancer raft proteins compared with general human raft proteins. Collectively, these results suggest increased cytoskeleton-mediated stabilization of lipid raft domains with greater molecular interactions as a common, functional, and reversible feature of cancer cells.

  11. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  12. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  13. Linear and non-linear dose-response functions reveal a hormetic relationship between stress and learning.

    Science.gov (United States)

    Zoladz, Phillip R; Diamond, David M

    2008-10-16

    Over a century of behavioral research has shown that stress can enhance or impair learning and memory. In the present review, we have explored the complex effects of stress on cognition and propose that they are characterized by linear and non-linear dose-response functions, which together reveal a hormetic relationship between stress and learning. We suggest that stress initially enhances hippocampal function, resulting from amygdala-induced excitation of hippocampal synaptic plasticity, as well as the excitatory effects of several neuromodulators, including corticosteroids, norepinephrine, corticotropin-releasing hormone, acetylcholine and dopamine. We propose that this rapid activation of the amygdala-hippocampus brain memory system results in a linear dose-response relation between emotional strength and memory formation. More prolonged stress, however, leads to an inhibition of hippocampal function, which can be attributed to compensatory cellular responses that protect hippocampal neurons from excitotoxicity. This inhibition of hippocampal functioning in response to prolonged stress is potentially relevant to the well-described curvilinear dose-response relationship between arousal and memory. Our emphasis on the temporal features of stress-brain interactions addresses how stress can activate, as well as impair, hippocampal functioning to produce a hormetic relationship between stress and learning.

  14. The structure of bradyzoite-specific enolase from Toxoplasma gondii reveals insights into its dual cytoplasmic and nuclear functions

    Energy Technology Data Exchange (ETDEWEB)

    Ruan, Jiapeng [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Mouveaux, Thomas [Université Lille Nord de France, (France); Light, Samuel H.; Minasov, George; Anderson, Wayne F. [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Tomavo, Stanislas [Université Lille Nord de France, (France); Ngô, Huân M., E-mail: h-ngo@northwestern.edu [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); BrainMicro LLC, 21 Pendleton Street, New Haven, CT 06511 (United States)

    2015-03-01

    The second crystal structure of a parasite protein preferentially enriched in the brain cyst of T. gondii has been solved at 2.75 Å resolution. Bradyzoite enolase 1 is reported to have differential functions as a glycolytic enzyme and a transcriptional regulator in bradyzoites. In addition to catalyzing a central step in glycolysis, enolase assumes a remarkably diverse set of secondary functions in different organisms, including transcription regulation as documented for the oncogene c-Myc promoter-binding protein 1. The apicomplexan parasite Toxoplasma gondii differentially expresses two nuclear-localized, plant-like enolases: enolase 1 (TgENO1) in the latent bradyzoite cyst stage and enolase 2 (TgENO2) in the rapidly replicative tachyzoite stage. A 2.75 Å resolution crystal structure of bradyzoite enolase 1, the second structure to be reported of a bradyzoite-specific protein in Toxoplasma, captures an open conformational state and reveals that distinctive plant-like insertions are located on surface loops. The enolase 1 structure reveals that a unique residue, Glu164, in catalytic loop 2 may account for the lower activity of this cyst-stage isozyme. Recombinant TgENO1 specifically binds to a TTTTCT DNA motif present in the cyst matrix antigen 1 (TgMAG1) gene promoter as demonstrated by gel retardation. Furthermore, direct physical interactions of both nuclear TgENO1 and TgENO2 with the TgMAG1 gene promoter are demonstrated in vivo using chromatin immunoprecipitation (ChIP) assays. Structural and biochemical studies reveal that T. gondii enolase functions are multifaceted, including the coordination of gene regulation in parasitic stage development. Enolase 1 provides a potential lead in the design of drugs against Toxoplasma brain cysts.

  15. Phosphoproteome analysis of functional mitochondria isolated from resting human muscle reveals extensive phosphorylation of inner membrane protein complexes and enzymes

    DEFF Research Database (Denmark)

    Zhao, Xiaolu; Leon, Ileana R; Bak, Steffen

    2011-01-01

    . In skeletal muscle, mitochondrial dysfunction is linked to insulin resistance in humans with obesity and type 2 diabetes. We performed a phosphoproteomic study of functional mitochondria isolated from human muscle biopsies with the aim to obtain a comprehensive overview of mitochondrial phosphoproteins...... in insulin resistance. We also assigned phosphorylation sites in mitochondrial proteins involved in amino acid degradation, importers and transporters, calcium homeostasis, and apoptosis. Bioinformatics analysis of kinase motifs revealed that many of these mitochondrial phosphoproteins are substrates....... Future comparative phosphoproteome analysis of mitochondria from healthy and diseased individuals will provide insights into the role of abnormal phosphorylation in pathologies, such as type 2 diabetes....

  16. Coupled cryoconite ecosystem structure-function relationships are revealed by comparing bacterial communities in alpine and Arctic glaciers

    DEFF Research Database (Denmark)

    Edwards, Arwyn; Mur, Luis A. J.; Girdwood, Susan E.

    2014-01-01

    Cryoconite holes are known as foci of microbial diversity and activity on polar glacier surfaces, but are virtually unexplored microbial habitats in alpine regions. In addition, whether cryoconite community structure reflects ecosystem functionality is poorly understood. Terminal restriction...... revealed Proteobacteria were particularly abundant, with Cyanobacteria likely acting as ecosystem engineers in both alpine and Arctic cryoconite communities. However, despite these generalities, significant differences in bacterial community structures, compositions and metabolomes are found between alpine...... fragment length polymorphism and Fourier transform infrared metabolite fingerprinting of cryoconite from glaciers in Austria, Greenland and Svalbard demonstrated cryoconite bacterial communities are closely correlated with cognate metabolite fingerprints. The influence of bacterial-associated fatty acids...

  17. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  18. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  20. Quantitative Imaging of Cholinergic Interneurons Reveals a Distinctive Spatial Organization and a Functional Gradient across the Mouse Striatum.

    Directory of Open Access Journals (Sweden)

    Miriam Matamales

    Full Text Available Information processing in the striatum requires the postsynaptic integration of glutamatergic and dopaminergic signals, which are then relayed to the output nuclei of the basal ganglia to influence behavior. Although cellularly homogeneous in appearance, the striatum contains several rare interneuron populations which tightly modulate striatal function. Of these, cholinergic interneurons (CINs have been recently shown to play a critical role in the control of reward-related learning; however how the striatal cholinergic network is functionally organized at the mesoscopic level and the way this organization influences striatal function remains poorly understood. Here, we systematically mapped and digitally reconstructed the entire ensemble of CINs in the mouse striatum and quantitatively assessed differences in densities, spatial arrangement and neuropil content across striatal functional territories. This approach demonstrated that the rostral portion of the striatum contained a higher concentration of CINs than the caudal striatum and that the cholinergic content in the core of the ventral striatum was significantly lower than in the rest of the regions. Additionally, statistical comparison of spatial point patterns in the striatal cholinergic ensemble revealed that only a minor portion of CINs (17% aggregated into cluster and that they were predominantly organized in a random fashion. Furthermore, we used a fluorescence reporter to estimate the activity of over two thousand CINs in naïve mice and found that there was a decreasing gradient of CIN overall function along the dorsomedial-to-ventrolateral axis, which appeared to be independent of their propensity to aggregate within the striatum. Altogether this work suggests that the regulation of striatal function by acetylcholine across the striatum is highly heterogeneous, and that signals originating in external afferent systems may be principally determining the function of CINs in the

  1. Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy?

    Science.gov (United States)

    Johnson, Arlen W; Ellis, Steve R

    2011-05-01

    Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917-929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.

  2. Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy?

    OpenAIRE

    Johnson, Arlen W.; Ellis, Steve R.

    2011-01-01

    Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917–929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.

  3. Ribosome-dependent ATPase interacts with conserved membrane protein in Escherichia coli to modulate protein synthesis and oxidative phosphorylation.

    Directory of Open Access Journals (Sweden)

    Mohan Babu

    Full Text Available Elongation factor RbbA is required for ATP-dependent deacyl-tRNA release presumably after each peptide bond formation; however, there is no information about the cellular role. Proteomic analysis in Escherichia coli revealed that RbbA reciprocally co-purified with a conserved inner membrane protein of unknown function, YhjD. Both proteins are also physically associated with the 30S ribosome and with members of the lipopolysaccharide transport machinery. Genome-wide genetic screens of rbbA and yhjD deletion mutants revealed aggravating genetic interactions with mutants deficient in the electron transport chain. Cells lacking both rbbA and yhjD exhibited reduced cell division, respiration and global protein synthesis as well as increased sensitivity to antibiotics targeting the ETC and the accuracy of protein synthesis. Our results suggest that RbbA appears to function together with YhjD as part of a regulatory network that impacts bacterial oxidative phosphorylation and translation efficiency.

  4. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  5. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  6. Functional specificity of cardiolipin synthase revealed by the identification of a cardiolipin synthase CrCLS1 in Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Chun-Hsien eHung

    2016-01-01

    Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.

  7. Analyses in zebrafish embryos reveal that nanotoxicity profiles are dependent on surface-functionalization controlled penetrance of biological membranes.

    Science.gov (United States)

    Paatero, Ilkka; Casals, Eudald; Niemi, Rasmus; Özliseli, Ezgi; Rosenholm, Jessica M; Sahlgren, Cecilia

    2017-08-21

    Mesoporous silica nanoparticles (MSNs) are extensively explored as drug delivery systems, but in depth understanding of design-toxicity relationships is still scarce. We used zebrafish (Danio rerio) embryos to study toxicity profiles of differently surface functionalized MSNs. Embryos with the chorion membrane intact, or dechoroniated embryos, were incubated or microinjected with amino (NH 2 -MSNs), polyethyleneimine (PEI-MSNs), succinic acid (SUCC-MSNs) or polyethyleneglycol (PEG-MSNs) functionalized MSNs. Toxicity was assessed by viability and cardiovascular function. NH 2 -MSNs, SUCC-MSNs and PEG-MSNs were well tolerated, 50 µg/ml PEI-MSNs induced 100% lethality 48 hours post fertilization (hpf). Dechoroniated embryos were more sensitive and 10 µg/ml PEI-MSNs reduced viability to 5% at 96hpf. Sensitivity to PEG- and SUCC-, but not NH 2 -MSNs, was also enhanced. Typically cardiovascular toxicity was evident prior to lethality. Confocal microscopy revealed that PEI-MSNs penetrated into the embryos whereas PEG-, NH2- and SUCC-MSNs remained aggregated on the skin surface. Direct exposure of inner organs by microinjecting NH 2 -MSNs and PEI-MSNs demonstrated that the particles displayed similar toxicity indicating that functionalization affects the toxicity profile by influencing penetrance through biological barriers. The data emphasize the need for careful analyses of toxicity mechanisms in relevant models and constitute an important knowledge step towards the development of safer and sustainable nanotherapies.

  8. Functional gene profiling through metaRNAseq approach reveals diet-dependent variation in rumen microbiota of buffalo (Bubalus bubalis).

    Science.gov (United States)

    Hinsu, Ankit T; Parmar, Nidhi R; Nathani, Neelam M; Pandit, Ramesh J; Patel, Anand B; Patel, Amrutlal K; Joshi, Chaitanya G

    2017-04-01

    Recent advances in next generation sequencing technology have enabled analysis of complex microbial community from genome to transcriptome level. In the present study, metatranscriptomic approach was applied to elucidate functionally active bacteria and their biological processes in rumen of buffalo (Bubalus bubalis) adapted to different dietary treatments. Buffaloes were adapted to a diet containing 50:50, 75:25 and 100:0 forage to concentrate ratio, each for 6 weeks, before ruminal content sample collection. Metatranscriptomes from rumen fiber adherent and fiber-free active bacteria were sequenced using Ion Torrent PGM platform followed by annotation using MG-RAST server and CAZYmes (Carbohydrate active enzymes) analysis toolkit. In all the samples Bacteroidetes was the most abundant phylum followed by Firmicutes. Functional analysis using KEGG Orthology database revealed Metabolism as the most abundant category at level 1 within which Carbohydrate metabolism was dominating. Diet treatments also exerted significant differences in proportion of enzymes involved in metabolic pathways for VFA production. Carbohydrate Active Enzyme(CAZy) analysis revealed the abundance of genes encoding glycoside hydrolases with the highest representation of GH13 CAZy family in all the samples. The findings provide an overview of the activities occurring in the rumen as well as active bacterial population and the changes occurring through different dietary treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The elastic network model reveals a consistent picture on intrinsic functional dynamics of type II restriction endonucleases

    International Nuclear Information System (INIS)

    Uyar, A; Kurkcuoglu, O; Doruker, P; Nilsson, L

    2011-01-01

    The vibrational dynamics of various type II restriction endonucleases, in complex with cognate/non-cognate DNA and in the apo form, are investigated with the elastic network model in order to reveal common functional mechanisms in this enzyme family. Scissor-like and tong-like motions observed in the slowest modes of all enzymes and their complexes point to common DNA recognition and cleavage mechanisms. Normal mode analysis further points out that the scissor-like motion has an important role in differentiating between cognate and non-cognate sequences at the recognition site, thus implying its catalytic relevance. Flexible regions observed around the DNA-binding site of the enzyme usually concentrate on the highly conserved β-strands, especially after DNA binding. These β-strands may have a structurally stabilizing role in functional dynamics for target site recognition and cleavage. In addition, hot spot residues based on high-frequency modes reveal possible communication pathways between the two distant cleavage sites in the enzyme family. Some of these hot spots also exist on the shortest path between the catalytic sites and are highly conserved

  10. Fab-based inhibitors reveal ubiquitin independent functions for HIV Vif neutralization of APOBEC3 restriction factors.

    Directory of Open Access Journals (Sweden)

    Jennifer M Binning

    2018-01-01

    Full Text Available The lentiviral protein Viral Infectivity Factor (Vif counteracts the antiviral effects of host APOBEC3 (A3 proteins and contributes to persistent HIV infection. Vif targets A3 restriction factors for ubiquitination and proteasomal degradation by recruiting them to a multi-protein ubiquitin E3 ligase complex. Here, we describe a degradation-independent mechanism of Vif-mediated antagonism that was revealed through detailed structure-function studies of antibody antigen-binding fragments (Fabs to the Vif complex. Two Fabs were found to inhibit Vif-mediated A3 neutralization through distinct mechanisms: shielding A3 from ubiquitin transfer and blocking Vif E3 assembly. Combined biochemical, cell biological and structural studies reveal that disruption of Vif E3 assembly inhibited A3 ubiquitination but was not sufficient to restore its packaging into viral particles and antiviral activity. These observations establish that Vif can neutralize A3 family members in a degradation-independent manner. Additionally, this work highlights the potential of Fabs as functional probes, and illuminates how Vif uses a multi-pronged approach involving both degradation dependent and independent mechanisms to suppress A3 innate immunity.

  11. Expression profiling and functional analysis reveals that TOR is a key player in regulating photosynthesis and phytohormone signaling pathways in Arabidopsis.

    Science.gov (United States)

    Dong, Pan; Xiong, Fangjie; Que, Yumei; Wang, Kai; Yu, Lihua; Li, Zhengguo; Ren, Maozhi

    2015-01-01

    Target of rapamycin (TOR) acts as a master regulator to control cell growth by integrating nutrient, energy, and growth factors in all eukaryotic species. TOR plays an evolutionarily conserved role in regulating the transcription of genes associated with anabolic and catabolic processes in Arabidopsis, but little is known about the functions of TOR in photosynthesis and phytohormone signaling, which are unique features of plants. In this study, AZD8055 (AZD) was screened as the strongest active-site TOR inhibitor (asTORi) in Arabidopsis compared with TORIN1 and KU63794 (KU). Gene expression profiles were evaluated using RNA-seq after treating Arabidopsis seedlings with AZD. More than three-fold differentially expressed genes (DEGs) were identified in AZD-treated plants relative to rapamycin-treated plants in previous studies. Most of the DEGs and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways involved in cell wall elongation, ribosome biogenesis, and cell autophagy were common to both AZD- and rapamycin-treated samples, but AZD displayed much broader and more efficient inhibition of TOR compared with rapamycin. Importantly, the suppression of TOR by AZD resulted in remodeling of the expression profile of the genes associated with photosynthesis and various phytohormones, indicating that TOR plays a crucial role in modulating photosynthesis and phytohormone signaling in Arabidopsis. These newly identified DEGs expand the understanding of TOR signaling in plants. This study elucidates the novel functions of TOR in photosynthesis and phytohormone signaling and provides a platform to study the downstream targets of TOR in Arabidopsis.

  12. Cyclosporin A treatment of Leishmania donovani reveals stage-specific functions of cyclophilins in parasite proliferation and viability.

    Directory of Open Access Journals (Sweden)

    Wai-Lok Yau

    Full Text Available BACKGROUND: Cyclosporin A (CsA has important anti-microbial activity against parasites of the genus Leishmania, suggesting CsA-binding cyclophilins (CyPs as potential drug targets. However, no information is available on the genetic diversity of this important protein family, an