WorldWideScience

Sample records for functional murine cmp-sialic

  1. Identification of the nuclear export signals that regulate the intracellular localization of the mouse CMP-sialic acid synthetase

    International Nuclear Information System (INIS)

    Fujita, Akiko; Sato, Chihiro; Kitajima, Ken.

    2007-01-01

    The CMP-sialic acid synthetase (CSS) catalyzes the activation of sialic acid (Sia) to CMP-Sia which is a donor substrate of sialyltransferases. The vertebrate CSSs are usually localized in nucleus due to the nuclear localization signal (NLS) on the molecule. In this study, we first point out that a small, but significant population of the mouse CMP-sialic acid synthetase (mCSS) is also present in cytoplasm, though mostly in nucleus. As a mechanism for the localization in cytoplasm, we first identified two nuclear export signals (NESs) in mCSS, based on the localization studies of the potential NES-deleted mCSS mutants as well as the potential NES-tagged eGFP proteins. These two NESs are conserved among mammalian and fish CSSs, but not present in the bacterial or insect CSS. These results suggest that the intracellular localization of vertebrate CSSs is regulated by not only the NLS, but also the NES sequences

  2. Assessment of carbon nanoparticle exposure on murine macrophage function

    Science.gov (United States)

    Suro-Maldonado, Raquel M.

    There is growing concern about the potential cytotoxicity of nanoparticles. Exposure to respirable ultrafine particles (2.5uM) can adversely affect human health and have been implicated with episodes of increased respiratory diseases such as asthma and allergies. Nanoparticles are of particular interest because of their ability to penetrate into the lung and potentially elicit health effects triggering immune responses. Nanoparticles are structures and devises with length scales in the 1 to 100-nanometer range. Black carbon (BC) nanoparticles have been observed to be products of combustion, especially flame combustion and multi-walled carbon nanotubes (MWCNT) have been shown to be found in both indoor and outdoor air. Furthermore, asbestos, which have been known to cause mesothelioma as well as lung cancer, have been shown to be structurally identical to MWCNTs. The aims of these studies were to examine the effects of carbon nanoparticles on murine macrophage function and clearance mechanisms. Macrophages are immune cells that function as the first line of defense against invading pathogens and are likely to be amongst the first cells affected by nanoparticles. Our research focused on two manufactured nanoparticles, MWCNT and BC. The two were tested against murine-derived macrophages in a chronic contact model. We hypothesized that long-term chronic exposure to carbon nanoparticles would decrease macrophages ability to effectively respond to immunological challenge. Production of nitric oxide (NO), tumor necrosis factor alpha (TNF-alpha), cell surface macrophage; activation markers, reactive oxygen species formation (ROS), and antigen processing and presentation were examined in response to lipopolysaccharide (LPS) following a 144hr exposure to the particulates. Data demonstrated an increase in TNF-alpha, and NO production; a decrease in phagocytosis and antigen processing and presentation; and a decrease in the expression levels of cell surface macrophage

  3. Ontogeny and function of murine epidermal Langerhans cells.

    Science.gov (United States)

    Kaplan, Daniel H

    2017-09-19

    Langerhans cells (LCs) are epidermis-resident antigen-presenting cells that share a common ontogeny with macrophages but function as dendritic cells (DCs). Their development, recruitment and retention in the epidermis is orchestrated by interactions with keratinocytes through multiple mechanisms. LC and dermal DC subsets often show functional redundancy, but LCs are required for specific types of adaptive immune responses when antigen is concentrated in the epidermis. This Review will focus on those developmental and functional properties that are unique to LCs.

  4. Utilizing CMP-Sialic Acid Analogs to Unravel Neisseria gonorrhoeae Lipooligosaccharide-Mediated Complement Resistance and Design Novel Therapeutics.

    Directory of Open Access Journals (Sweden)

    Sunita Gulati

    2015-12-01

    Full Text Available Neisseria gonorrhoeae deploys a novel immune evasion strategy wherein the lacto-N-neotetraose (LNnT structure of lipooligosaccharide (LOS is capped by the bacterial sialyltransferase, using host cytidine-5'-monophosphate (CMP-activated forms of the nine-carbon nonulosonate (NulO sugar N-acetyl-neuraminic acid (Neu5Ac, a sialic acid (Sia abundant in humans. This allows evasion of complement-mediated killing by recruiting factor H (FH, an inhibitor of the alternative complement pathway, and by limiting classical pathway activation ("serum-resistance". We utilized CMP salts of six additional natural or synthetic NulOs, Neu5Gc, Neu5Gc8Me, Neu5Ac9Ac, Neu5Ac9Az, legionaminic acid (Leg5Ac7Ac and pseudaminic acid (Pse5Ac7Ac, to define structural requirements of Sia-mediated serum-resistance. While all NulOs except Pse5Ac7Ac were incorporated into the LNnT-LOS, only Neu5Gc incorporation yielded high-level serum-resistance and FH binding that was comparable to Neu5Ac, whereas Neu5Ac9Az and Leg5Ac7Ac incorporation left bacteria fully serum-sensitive and did not enhance FH binding. Neu5Ac9Ac and Neu5Gc8Me rendered bacteria resistant only to low serum concentrations. While serum-resistance mediated by Neu5Ac was associated with classical pathway inhibition (decreased IgG binding and C4 deposition, Leg5Ac7Ac and Neu5Ac9Az incorporation did not inhibit the classical pathway. Remarkably, CMP-Neu5Ac9Az and CMP-Leg5Ac7Ac each prevented serum-resistance despite a 100-fold molar excess of CMP-Neu5Ac in growth media. The concomitant presence of Leg5Ac7Ac and Neu5Ac on LOS resulted in uninhibited classical pathway activation. Surprisingly, despite near-maximal FH binding in this instance, the alternative pathway was not regulated and factor Bb remained associated with bacteria. Intravaginal administration of CMP-Leg5Ac7Ac to BALB/c mice infected with gonorrhea (including a multidrug-resistant isolate reduced clearance times and infection burden. Bacteria recovered from CMP-Leg5Ac7Ac-treated mice were sensitive to human complement ex vivo, simulating in vitro findings. These data reveal critical roles for the Sia exocyclic side-chain in gonococcal serum-resistance. Such CMP-NulO analogs may provide a novel therapeutic strategy against the global threat of multidrug-resistant gonorrhea.

  5. Single Amino Acid Insertion in Loop 4 Confers Amphotropic Murine Leukemia Virus Receptor Function upon Murine Pit1

    DEFF Research Database (Denmark)

    Lundorf, Mikkel D.; Pedersen, Finn Skou; O'Hara, Bryan

    1998-01-01

    Pit1 is the human receptor for gibbon ape leukemia virus (GALV) and feline leukemia virus subgroup B (FeLV-B), while the related human protein Pit2 is a receptor for amphotropic murine leukemia virus (A-MuLV). The A-MuLV-related isolate 10A1 can utilize both Pit1 and Pit2 as receptors. A stretch...

  6. 3,3′-Diindolylmethane Stimulates Murine Immune Function In Vitro and In Vivo*

    OpenAIRE

    Xue, Ling; Pestka, James J.; Li, Maoxiang; Firestone, Gary L; Bjeldanes, Leonard F.

    2007-01-01

    3,3′-Diindolylmethane (DIM), a major condensation product of indole-3-carbinol (I3C), exhibits chemopreventive properties in animal models of cancer. Recent studies have shown that DIM stimulates interferon-gamma (IFN-γ) production and potentiates the IFN-γ signaling pathway in human breast cancer cells via a mechanism that includes increased expression of the IFN-γ receptor. The goal of this study was to test the hypothesis that DIM modulates the murine immune function. Specifically, the eff...

  7. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  8. Heterogeneity of functional properties of Clone 66 murine breast cancer cells expressing various stem cell phenotypes.

    Science.gov (United States)

    Mukhopadhyay, Partha; Farrell, Tracy; Sharma, Gayatri; McGuire, Timothy R; O'Kane, Barbara; Sharp, J Graham

    2013-01-01

    Breast cancer grows, metastasizes and relapses from rare, therapy resistant cells with a stem cell phenotype (cancer stem cells/CSCs). However, there is a lack of studies comparing the functions of CSCs isolated using different phenotypes in order to determine if CSCs are homogeneous or heterogeneous. Cells with various stem cell phenotypes were isolated by sorting from Clone 66 murine breast cancer cells that grow orthotopically in immune intact syngeneic mice. These populations were compared by in vitro functional assays for proliferation, growth, sphere and colony formation; and in vivo limiting dilution analysis of tumorigenesis. The proportion of cells expressing CD44(high)CD24(low/neg), side population (SP) cells, ALDH1(+), CD49f(high), CD133(high), and CD34(high) differed, suggesting heterogeneity. Differences in frequency and size of tumor spheres from these populations were observed. Higher rates of proliferation of non-SP, ALDH1(+), CD34(low), and CD49f(high) suggested properties of transit amplifying cells. Colony formation was higher from ALDH1(-) and non-SP cells than ALDH1(+) and SP cells suggesting a progenitor phenotype. The frequency of clonal colonies that grew in agar varied and was differentially altered by the presence of Matrigel™. In vivo, fewer cells with a stem cell phenotype were needed for tumor formation than "non-stem" cells. Fewer SP cells were needed to form tumors than ALDH1(+) cells suggesting further heterogeneities of cells with stem phenotypes. Different levels of cytokines/chemokines were produced by Clone 66 with RANTES being the highest. Whether the heterogeneity reflects soluble factor production remains to be determined. These data demonstrate that Clone 66 murine breast cancer cells that express stem cell phenotypes are heterogeneous and exhibit different functional properties, and this may also be the case for human breast cancer stem cells.

  9. Herpes simplex virus type 2 induces rapid cell death and functional impairment of murine dendritic cells in vitro

    NARCIS (Netherlands)

    Jones, CA; Fernandez, M; Herc, K; Bosnjak, L; Miranda-Saksena, M; Boadle, RA; Cunningham, A

    2003-01-01

    Dendritic cells (DC) are critical for stimulation of naive T cells. Little is known about the effect of herpes simplex virus type 2 (HSV-2) infection on DC structure or function or if the observed effects of HSV-1 on human DC are reproduced in murine DC. Here, we demonstrate that by 12 h

  10. Murine epidermal Langerhans cells and langerin-expressing dermal dendritic cells are unrelated and exhibit distinct functions

    NARCIS (Netherlands)

    Nagao, Keisuke; Ginhoux, Florent; Leitner, Wolfgang W.; Motegi, Sei-Ichiro; Bennett, Clare L.; Clausen, Björn E.; Merad, Miriam; Udey, Mark C.

    2009-01-01

    A new langerin(+) DC subset has recently been identified in murine dermis (langerin(+) dDC), but the lineage and functional relationships between these cells and langerin(+) epidermal Langerhans cells (LC) are incompletely characterized. Selective expression of the cell adhesion molecule EpCAM by LC

  11. Mitochondrial biogenesis and energy production in differentiating murine stem cells: a functional metabolic study.

    Science.gov (United States)

    Han, Sungwon; Auger, Christopher; Thomas, Sean C; Beites, Crestina L; Appanna, Vasu D

    2014-02-01

    The significance of metabolic networks in guiding the fate of the stem cell differentiation is only beginning to emerge. Oxidative metabolism has been suggested to play a major role during this process. Therefore, it is critical to understand the underlying mechanisms of metabolic alterations occurring in stem cells to manipulate the ultimate outcome of these pluripotent cells. Here, using P19 murine embryonal carcinoma cells as a model system, the role of mitochondrial biogenesis and the modulation of metabolic networks during dimethyl sulfoxide (DMSO)-induced differentiation are revealed. Blue native polyacrylamide gel electrophoresis (BN-PAGE) technology aided in profiling key enzymes, such as hexokinase (HK) [EC 2.7.1.1], glucose-6-phosphate isomerase (GPI) [EC 5.3.1.9], pyruvate kinase (PK) [EC 2.7.1.40], Complex I [EC 1.6.5.3], and Complex IV [EC 1.9.3.1], that are involved in the energy budget of the differentiated cells. Mitochondrial adenosine triphosphate (ATP) production was shown to be increased in DMSO-treated cells upon exposure to the tricarboxylic acid (TCA) cycle substrates, such as succinate and malate. The increased mitochondrial activity and biogenesis were further confirmed by immunofluorescence microscopy. Collectively, the results indicate that oxidative energy metabolism and mitochondrial biogenesis were sharply upregulated in DMSO-differentiated P19 cells. This functional metabolic and proteomic study provides further evidence that modulation of mitochondrial energy metabolism is a pivotal component of the cellular differentiation process and may dictate the final destiny of stem cells.

  12. Different concentrations of kaempferol distinctly modulate murine embryonic stem cell function.

    Science.gov (United States)

    Correia, Marcelo; Rodrigues, Ana S; Perestrelo, Tânia; Pereira, Sandro L; Ribeiro, Marcelo F; Sousa, Maria I; Ramalho-Santos, João

    2016-01-01

    Kaempferol (3,4',5,7-tetrahydroxyflavone) is a natural flavonoid with several beneficial and protective effects. It has been demonstrated that kaempferol has anticancer properties, particularly due to its effects on proliferation, apoptosis and the cell cycle. However, possible effects on pluripotent embryonic stem cell function have not yet been addressed. Embryonic stem cells have the ability to self-renew and to differentiate into all three germ layers with potential applications in regenerative medicine and in vitro toxicology. We show that exposure of murine embryonic stem cells (mESC) to high concentrations of kaempferol (200 μM) leads to decreased cell numbers, although the resulting smaller cell colonies remain pluripotent. However, lower concentrations of this compound (20 μM) increase the expression of pluripotency markers in mESCs. Mitochondrial membrane potential and mitochondrial mass are not affected, but a dose-dependent increase in apoptosis takes place. Moreover, mESC differentiation is impaired by kaempferol, which was not related to apoptosis induction. Our results show that low concentrations of kaempferol can be beneficial for pluripotency, but inhibit proper differentiation of mESCs. Additionally, high concentrations induce apoptosis and increase mitochondrial reactive oxygen species (ROS). Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Functional Heterogeneity in the CD4+ T Cell Response to Murine γ-Herpesvirus 68

    Science.gov (United States)

    Hu, Zhuting; Blackman, Marcia A.; Kaye, Kenneth M.; Usherwood, Edward J.

    2015-01-01

    CD4+ T cells are critical for the control of virus infections, T cell memory and immune surveillance. Here we studied the differentiation and function of murine γ-herpesvirus 68 (MHV-68)-specific CD4+ T cells using gp150-specific TCR transgenic mice. This allowed a more detailed study of the characteristics of the CD4+ T cell response than previously available approaches for this virus. Most gp150-specific CD4+ T cells expressed T-bet and produced IFN-γ, indicating MHV-68 infection triggered differentiation of CD4+ T cells largely into the Th1 subset, whereas some became TFH and Foxp3+ regulatory T cells. These CD4+ T cells were protective against MHV-68 infection, in the absence of CD8+ T cells and B cells, and protection depended on IFN-γ secretion. Marked heterogeneity was observed in the CD4+ T cells, based on Ly6C expression. Ly6C expression positively correlated with IFN-γ, TNF-α and granzyme B production, T-bet and KLRG1 expression, proliferation and CD4+ T cell-mediated cytotoxicity. Ly6C expression inversely correlated with survival, CCR7 expression and secondary expansion potential. Ly6C+ and Ly6C− gp150-specific CD4+ T cells were able to interconvert in a bidirectional manner upon secondary antigen exposure in vivo. These results indicate that Ly6C expression is closely associated with antiviral activity in effector CD4+ T cells, but inversely correlated with memory potential. Interconversion between Ly6C+ and Ly6C− cells may maintain a balance between the two antigen-specific CD4+ T cell populations during MHV-68 infection. These findings have significant implications for Ly6C as a surface marker to distinguish functionally distinct CD4+ T cells during persistent virus infection. PMID:25662997

  14. Functional imaging of murine hearts using accelerated self-gated UTE cine MRI.

    Science.gov (United States)

    Motaal, Abdallah G; Noorman, Nils; de Graaf, Wolter L; Hoerr, Verena; Florack, Luc M J; Nicolay, Klaas; Strijkers, Gustav J

    2015-01-01

    We introduce a fast protocol for ultra-short echo time (UTE) Cine magnetic resonance imaging (MRI) of the beating murine heart. The sequence involves a self-gated UTE with golden-angle radial acquisition and compressed sensing reconstruction. The self-gated acquisition is performed asynchronously with the heartbeat, resulting in a randomly undersampled kt-space that facilitates compressed sensing reconstruction. The sequence was tested in 4 healthy rats and 4 rats with chronic myocardial infarction, approximately 2 months after surgery. As a control, a non-accelerated self-gated multi-slice FLASH sequence with an echo time (TE) of 2.76 ms, 4.5 signal averages, a matrix of 192 × 192, and an acquisition time of 2 min 34 s per slice was used to obtain Cine MRI with 15 frames per heartbeat. Non-accelerated UTE MRI was performed with TE = 0.29 ms, a reconstruction matrix of 192 × 192, and an acquisition time of 3 min 47 s per slice for 3.5 averages. Accelerated imaging with 2×, 4× and 5× undersampled kt-space data was performed with 1 min, 30 and 15 s acquisitions, respectively. UTE Cine images up to 5× undersampled kt-space data could be successfully reconstructed using a compressed sensing algorithm. In contrast to the FLASH Cine images, flow artifacts in the UTE images were nearly absent due to the short echo time, simplifying segmentation of the left ventricular (LV) lumen. LV functional parameters derived from the control and the accelerated Cine movies were statistically identical.

  15. Functional imaging of murine hearts using accelerated self-gated UTE cine MRI

    NARCIS (Netherlands)

    Motaal, Abdallah G.; Noorman, Nils; de Graaf, Wolter L.; Hoerr, Verena; Florack, Luc M. J.; Nicolay, Klaas; Strijkers, Gustav J.

    2015-01-01

    We introduce a fast protocol for ultra-short echo time (UTE) Cine magnetic resonance imaging (MRI) of the beating murine heart. The sequence involves a self-gated UTE with golden-angle radial acquisition and compressed sensing reconstruction. The self-gated acquisition is performed asynchronously

  16. Molecular and functional characterization of Kv7 K+ channel in murine gastrointestinal smooth muscles

    DEFF Research Database (Denmark)

    Jepps, Thomas Andrew; Greenwood, Iain A; Moffatt, James D

    2009-01-01

    that K(v)7.x especially K(v)7.4 and K(v)7.5 are expressed in different regions of the murine gastrointestinal tract and blockers of K(v)7 channels augment inherent contractile activity. Drugs that selectively block K(v)7.4/7.5 might be promising therapeutics for the treatment of motility disorders...

  17. Modulation of phenotypic and functional maturation of murine dendritic cells (DCs) by purified Achyranthes bidentata polysaccharide (ABP).

    Science.gov (United States)

    Zou, Yaxuan; Meng, Jingjuan; Chen, Wenna; Liu, Jingling; Li, Xuan; Li, Weiwei; Lu, Changlong; Shan, Fengping

    2011-08-01

    There are a large number of interactions at molecular and cellular levels between the plant polysaccharides and immune system. Plant polysaccharides present an interesting effects as immunomodulators, particularly in the induction of the cells both in innate and adaptive immune systems. Activation of DCs could improve antitumoral responses usually diminished in cancer patients, and natural adjuvants provide a possibility of inducing this activation. ABP is a purified polysaccharide isolated from Achyranthes bidentata, a traditional Chinese medicine (TCM). The aim of this study is to investigate modulation of phenotypic and functional maturation of murine DCs by ABP. Both phenotypic and functional activities were assessed with use of conventional scanning electronic microscopy (SEM) for the morphology of the DC, transmitted electron microscopy (TEM) for intracellular lysosomes inside the DC, cellular immunohistochemistry for phagocytosis by the DCs, flow cytometry (FCM) for the changes in key surface molecules, bio-assay for the activity of acidic phosphatases (ACP), and ELISA for the production of pro-inflammatory cytokine IL-12. In fact, we found that purified ABP induced phenotypic maturation revealed by increased expression of CD86, CD40, and MHC II. Functional experiments showed the down-regulation of ACP inside DCs (which occurs when phagocytosis of DCs is decreased, and antigen presentation increased with maturation). Finally, ABP increased the production of IL-12. These data reveal that ABP promotes effective activation of murine DCs. This adjuvant-like activity may have therapeutic applications in clinical settings where immune responses need boosting. It is therefore concluded that ABP can exert positive modulation to murine DCs. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Ribonucleases 6 and 7 have antimicrobial function in the human and murine urinary tract

    Science.gov (United States)

    Becknell, Brian; Eichler, Tad; Beceiro, Susana; Li, Birong; Easterling, Robert; Carpenter, Ashley R.; James, Cindy; McHugh, Kirk M.; Hains, David S.; Partida-Sanchez, Santiago; Spencer, John David

    2014-01-01

    Recent evidence suggests antimicrobial peptides protect the urinary tract from infection. Ribonuclease 7 (RNase 7), a member of the RNase A superfamily, is a potent epithelial-derived protein that maintains human urinary tract sterility. RNase 7 expression is restricted to primates, limiting evaluation of its antimicrobial activity in vivo. Here we identified Ribonuclease 6 (RNase 6) as the RNase A Superfamily member present in humans and mice that is most conserved at the amino acid level relative to RNase 7. Like RNase 7, recombinant human and murine RNase 6 has potent antimicrobial activity against uropathogens. Quantitative real-time PCR and immunoblot analysis indicate that RNase 6 mRNA and protein are up-regulated in the human and murine urinary tract during infection. Immunostaining located RNase 6 to resident and infiltrating monocytes, macrophages, and neutrophils. Uropathogenic E. coli induces RNase 6 peptide expression in human CD14+ monocytes and murine bone marrow derived macrophages. Thus, RNase 6 is an inducible, myeloid-derived protein with markedly different expression from the epithelial-derived RNase 7 but with equally potent antimicrobial activity. Our studies suggest RNase 6 serves as an evolutionarily conserved antimicrobial peptide that participates in the maintenance of urinary tract sterility. PMID:25075772

  19. A potent complement factor C3 specific nanobody inhibiting multiple functions in the alternative pathway of human and murine complement.

    Science.gov (United States)

    Jensen, Rasmus K; Pihl, Rasmus; Gadeberg, Trine A F; Jensen, Jan K; Andersen, Kasper R; Thiel, Steffen; Laursen, Nick S; Andersen, Gregers Rom

    2018-03-01

    The complement system is a complex, carefully regulated proteolytic cascade for which suppression of aberrant activation is of increasing clinical relevance and inhibition of the complement alternative pathway is a subject of intense research. Here, we describe the nanobody hC3Nb1 that binds to multiple functional states of C3 with sub-nanomolar affinity. The nanobody causes a complete shutdown of alternative pathway activity in human and murine serum when present in concentrations comparable to C3, and hC3Nb1 is shown to prevent both proconvertase assembly as well as binding of the C3 substrate to C3 convertases. Our crystal structure of the C3b-hC3Nb1 complex and functional experiments demonstrate that proconvertase formation is blocked by steric hindrance between the nanobody and an Asn-linked glycan on complement factor B. In addition, hC3Nb1 is shown to prevent factor H binding to C3b rationalizing its inhibition of factor I activity. Our results identify hC3Nb1 as a versatile, inexpensive, and powerful inhibitor of the alternative pathway in both human and murine in vitro model systems of complement activation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Maturation and upregulation of functions of murine dendritic cells (DCs) under the influence of purified aromatic-turmerone (AR).

    Science.gov (United States)

    Yonggang, Tan; Yiming, Meng; Heying, Zhang; Cheng, Sun; Qiushi, Wang; Xianghong, Yang; Wei, Zheng; Huawei, Zhou; Shan, Fengping

    2012-10-01

    The aim of this work is to evaluate the effects of purified aromatic-turmerone (ar-turmerione, AR) on murine dendritic cells (DCs). These impacts of AR on DCs from bone marrow derived DCs(BMDCs) were assessed with use of conventional scanning electron microscopy (SEM), fluorescence activated cell sorting (FACS), transmission electron microscopy (TEM), cytochemistry assay, FITC-dextran, bio-assay and enzyme linked immunosorbent assay (ELISA). We found that AR induced phenotypic maturation as evidenced by increased expression of CD86, CD40, CD83, CD80 and major histocompatibility complex II (MHC II). The functional tests showed the activity of acidic phosphatase (ACP) inside the DCs were downregulated after treatment with AR (which occurs when phagocytosis of DCs were decreased). Finally, we proved that AR increased the production of IL-12 and tumor necrosis factor α (TNF-α). These data suggested that AR could promote phenotypic and functional maturation of DCs and this adjuvant-like activity may have potential therapeutic value. It is therefore concluded that AR could exert positive modulation on murine DCs.

  1. ZFP521 regulates murine hematopoietic stem cell function and facilitates MLL-AF9 leukemogenesis in mouse and human cells.

    Science.gov (United States)

    Garrison, Brian S; Rybak, Adrian P; Beerman, Isabel; Heesters, Balthasar; Mercier, Francois E; Scadden, David T; Bryder, David; Baron, Roland; Rossi, Derrick J

    2017-08-03

    The concept that tumor-initiating cells can co-opt the self-renewal program of endogenous stem cells as a means of enforcing their unlimited proliferative potential is widely accepted, yet identification of specific factors that regulate self-renewal of normal and cancer stem cells remains limited. Using a comparative transcriptomic approach, we identify ZNF521 / Zfp521 as a conserved hematopoietic stem cell (HSC)-enriched transcription factor in human and murine hematopoiesis whose function in HSC biology remains elusive. Competitive serial transplantation assays using Zfp521 -deficient mice revealed that ZFP521 regulates HSC self-renewal and differentiation. In contrast, ectopic expression of ZFP521 in HSCs led to a robust maintenance of progenitor activity in vitro. Transcriptional analysis of human acute myeloid leukemia (AML) patient samples revealed that ZNF521 is highly and specifically upregulated in AMLs with MLL translocations. Using an MLL-AF9 murine leukemia model and serial transplantation studies, we show that ZFP521 is not required for leukemogenesis, although its absence leads to a significant delay in leukemia onset. Furthermore, knockdown of ZNF521 reduced proliferation in human leukemia cell lines possessing MLL-AF9 translocations. Taken together, these results identify ZNF521/ZFP521 as a critical regulator of HSC function, which facilitates MLL-AF9-mediated leukemic disease in mice.

  2. Auditory function after application of ototopical vancomycin and mupirocin solutions in a murine model.

    Science.gov (United States)

    Rutherford, Kimberley D; Kavanagh, Katherine; Parham, Kourosh

    2011-03-01

    To determine whether mupirocin (440 µg/mL) and vancomycin otic drops (25 mg/mL) show evidence of ototoxicity in CBA/J mice immediately following a 7-day course of daily intratympanic (IT) injections and 1 month following treatment. Nonrandomized controlled trial. Academic hospital laboratory. Twenty CBA/J mice. Mean auditory brainstem response (ABR) thresholds increased in all drug- and saline-treated ears immediately after 7 days of IT injections but returned to baseline for most stimulus frequencies by 30 days later. This finding appeared to be correlated with the presence and subsequent resolution of tympanic membrane (TM) perforations and granulation tissue at the injection sites. Mupirocin-treated ears showed no significant difference in ABR thresholds compared to saline-treated ears. No significant differences were noted between vancomycin- and saline-treated ears, but there was a significant interaction between testing day and stimulus frequency (P injections (95% confidence interval, -13.5 to -5.5, P application of mupirocin solution (440 µg/mL) caused no significant change in the ABR thresholds in a murine model, vancomycin solution (25 mg/mL) resulted in high-frequency threshold elevations in both the ear directly injected and the contralateral ear. Mupirocin solution may be beneficial in managing otitis externa and media caused by resistant pathogens. Further studies of ototopical vancomycin are needed to define parameters governing its safe use.

  3. Irradiation induced modest changes in murine cardiac function despite progressive structural damage to the myocardium and microvasculature

    International Nuclear Information System (INIS)

    Seemann, Ingar; Gabriels, Karen; Visser, Nils L.; Hoving, Saske; Poele, Johannes A. te; Pol, Jeffrey F.; Gijbels, Marion J.; Janssen, Ben J.; Leeuwen, Fijs W. van; Daemen, Mat J.; Heeneman, Sylvia; Stewart, Fiona A.

    2012-01-01

    Background: Radiotherapy of thoracic and chest wall tumors increases the long-term risk of cardiotoxicity, but the underlying mechanisms are unclear. Methods: Single doses of 2, 8, or 16 Gy were delivered to the hearts of mice and damage was evaluated at 20, 40, and 60 weeks, relative to age matched controls. Single photon emission computed tomography (SPECT/CT) and ultrasound were used to measure cardiac geometry and function, which was related to histo-morphology and microvascular damage. Results: Gated SPECT/CT and ultrasound demonstrated decreases in end diastolic and systolic volumes, while the ejection fraction was increased at 20 and 40 weeks after 2, 8, and 16 Gy. Cardiac blood volume was decreased at 20 and 60 weeks after irradiation. Histological examination revealed inflammatory changes at 20 and 40 weeks after 8 and 16 Gy. Microvascular density in the left ventricle was decreased at 40 and 60 weeks after 8 and 16 Gy, with functional damage to remaining microvasculature manifest as decreased alkaline phosphatase (2, 8, and 16 Gy), increased von Willebrand Factor and albumin leakage from vessels (8 and 16 Gy), and amyloidosis (16 Gy). 16 Gy lead to sudden death between 30 and 40 weeks in 38% of mice. Conclusions: Irradiation with 2 and 8 Gy induced modest changes in murine cardiac function within 20 weeks but this did not deteriorate further, despite progressive structural and microvascular damage. This indicates that heart function can compensate for significant structural damage, although higher doses, eventually lead to sudden death.

  4. Production and Functional Characterization of Murine Osteoclasts Differentiated from ER-Hoxb8-Immortalized Myeloid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Frank Zach

    Full Text Available In vitro differentiation into functional osteoclasts is routinely achieved by incubation of embryonic stem cells, induced pluripotent stem cells, or primary as well as cryopreserved spleen and bone marrow-derived cells with soluble receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor. Additionally, osteoclasts can be derived from co-cultures with osteoblasts or by direct administration of soluble receptor activator of nuclear factor kappa-B ligand to RAW 264.7 macrophage lineage cells. However, despite their benefits for osteoclast-associated research, these different methods have several drawbacks with respect to differentiation yields, time and animal consumption, storage life of progenitor cells or the limited potential for genetic manipulation of osteoclast precursors. In the present study, we therefore established a novel protocol for the differentiation of osteoclasts from murine ER-Hoxb8-immortalized myeloid stem cells. We isolated and immortalized bone marrow cells from wild type and genetically manipulated mouse lines, optimized protocols for osteoclast differentiation and compared these cells to osteoclasts derived from conventional sources. In vitro generated ER-Hoxb8 osteoclasts displayed typical osteoclast characteristics such as multi-nucleation, tartrate-resistant acid phosphatase staining of supernatants and cells, F-actin ring formation and bone resorption activity. Furthermore, the osteoclast differentiation time course was traced on a gene expression level. Increased expression of osteoclast-specific genes and decreased expression of stem cell marker genes during differentiation of osteoclasts from ER-Hoxb8-immortalized myeloid progenitor cells were detected by gene array and confirmed by semi-quantitative and quantitative RT-PCR approaches. In summary, we established a novel method for the quantitative production of murine bona fide osteoclasts from ER-Hoxb8 stem cells generated from

  5. BCG vaccination drives accumulation and effector function of innate lymphoid cells in murine lungs.

    Science.gov (United States)

    Steigler, Pia; Daniels, Naomi J; McCulloch, Tim R; Ryder, Brin M; Sandford, Sarah K; Kirman, Joanna R

    2018-04-01

    The tuberculosis (TB) vaccine bacille Calmette-Guérin (BCG) prevents disseminated childhood TB; however, it fails to protect against the more prevalent pulmonary TB. Limited understanding of the immune response to Mycobacterium tuberculosis, the causative agent of TB, has hindered development of improved vaccines. Although memory CD4 T cells are considered the main mediators of protection against TB, recent studies suggest there are other key subsets that contribute to antimycobacterial immunity. To that end, innate cells may be involved in the protective response. In this study, we investigated the primary response of innate lymphoid cells (ILCs) to BCG exposure. Using a murine model, we showed that ILCs increased in number in the lungs and lymph nodes in response to BCG vaccination. Additionally, there was significant production of the antimycobacterial cytokine IFN-γ by ILCs. As ILCs are located at mucosal sites, it was investigated whether mucosal vaccination (intranasal) stimulated an enhanced response compared to the traditional vaccination approach (intradermal or subcutaneous). Indeed, in response to intranasal vaccination, the number of ILCs, and IFN-γ production in NK cells and ILC1s in the lungs and lymph nodes, were higher than that provoked through intradermal or subcutaneous vaccination. This work provides the first evidence that BCG vaccination activates ILCs, paving the way for future research to elucidate the protective potential of ILCs against mycobacterial infection. Additionally, the finding that lung ILCs respond rigorously to mucosal vaccination may have implications for the delivery of novel TB vaccines. © 2018 Australasian Society for Immunology Inc.

  6. Expression and function of S100A8/A9 (calprotectin) in human typhoid fever and the murine Salmonella model.

    Science.gov (United States)

    De Jong, Hanna K; Achouiti, Ahmed; Koh, Gavin C K W; Parry, Christopher M; Baker, Stephen; Faiz, Mohammed Abul; van Dissel, Jaap T; Vollaard, Albert M; van Leeuwen, Ester M M; Roelofs, Joris J T H; de Vos, Alex F; Roth, Johannes; van der Poll, Tom; Vogl, Thomas; Wiersinga, Willem Joost

    2015-04-01

    Typhoid fever, caused by the Gram-negative bacterium Salmonella enterica serovar Typhi, is a major cause of community-acquired bacteremia and death worldwide. S100A8 (MRP8) and S100A9 (MRP14) form bioactive antimicrobial heterodimers (calprotectin) that can activate Toll-like receptor 4, promoting lethal, endotoxin-induced shock and multi-organ failure. We aimed to characterize the expression and function of S100A8/A9 in patients with typhoid fever and in a murine invasive Salmonella model. S100A8/A9 protein levels were determined in acute phase plasma or feces from 28 Bangladeshi patients, and convalescent phase plasma from 60 Indonesian patients with blood culture or PCR-confirmed typhoid fever, and compared to 98 healthy control subjects. To functionally characterize the role of S100A8/A9, we challenged wildtype (WT) and S100A9-/- mice with S. Typhimurium and determined bacterial loads and inflammation 2- and 5- days post infection. We further assessed the antimicrobial function of recombinant S100A8/A9 on S. Typhimurium and S. Typhi replication in vitro. Typhoid fever patients demonstrated a marked increase of S100A8/A9 in acute phase plasma and feces and this increases correlated with duration of fever prior to admission. S100A8/A9 directly inhibited the growth of S. Typhimurium and S. Typhi in vitro in a dose and time dependent fashion. WT mice inoculated with S. Typhimurium showed increased levels of S100A8/A9 in both the liver and the systemic compartment but S100A9-/- mice were indistinguishable from WT mice with respect to bacterial growth, survival, and inflammatory responses, as determined by cytokine release, histopathology and organ injury. S100A8/A9 is markedly elevated in human typhoid, correlates with duration of fever prior to admission and directly inhibits the growth of S. Typhimurium and S. Typhi in vitro. Despite elevated levels in the murine invasive Salmonella model, S100A8/A9 does not contribute to an effective host response against S

  7. Expression and function of S100A8/A9 (calprotectin in human typhoid fever and the murine Salmonella model.

    Directory of Open Access Journals (Sweden)

    Hanna K De Jong

    2015-04-01

    Full Text Available Typhoid fever, caused by the Gram-negative bacterium Salmonella enterica serovar Typhi, is a major cause of community-acquired bacteremia and death worldwide. S100A8 (MRP8 and S100A9 (MRP14 form bioactive antimicrobial heterodimers (calprotectin that can activate Toll-like receptor 4, promoting lethal, endotoxin-induced shock and multi-organ failure. We aimed to characterize the expression and function of S100A8/A9 in patients with typhoid fever and in a murine invasive Salmonella model.S100A8/A9 protein levels were determined in acute phase plasma or feces from 28 Bangladeshi patients, and convalescent phase plasma from 60 Indonesian patients with blood culture or PCR-confirmed typhoid fever, and compared to 98 healthy control subjects. To functionally characterize the role of S100A8/A9, we challenged wildtype (WT and S100A9-/- mice with S. Typhimurium and determined bacterial loads and inflammation 2- and 5- days post infection. We further assessed the antimicrobial function of recombinant S100A8/A9 on S. Typhimurium and S. Typhi replication in vitro. Typhoid fever patients demonstrated a marked increase of S100A8/A9 in acute phase plasma and feces and this increases correlated with duration of fever prior to admission. S100A8/A9 directly inhibited the growth of S. Typhimurium and S. Typhi in vitro in a dose and time dependent fashion. WT mice inoculated with S. Typhimurium showed increased levels of S100A8/A9 in both the liver and the systemic compartment but S100A9-/- mice were indistinguishable from WT mice with respect to bacterial growth, survival, and inflammatory responses, as determined by cytokine release, histopathology and organ injury.S100A8/A9 is markedly elevated in human typhoid, correlates with duration of fever prior to admission and directly inhibits the growth of S. Typhimurium and S. Typhi in vitro. Despite elevated levels in the murine invasive Salmonella model, S100A8/A9 does not contribute to an effective host response

  8. A potent complement factor C3 specific nanobody inhibiting multiple functions in the alternative pathway of human and murine complement

    DEFF Research Database (Denmark)

    Jensen, Rasmus K; Pihl, Rasmus; Gadeberg, Trine A F

    2018-01-01

    The complement system is a complex, carefully regulated proteolytic cascade for which suppression of aberrant activation is of increasing clinical relevance and inhibition of the complement alternative pathway is a subject of intense research. Here, we describe the nanobody hC3Nb1 that binds...... to multiple functional states of C3 with sub-nanomolar affinity. The nanobody causes a complete shutdown of alternative pathway activity in human and murine serum when present in concentrations comparable to C3, and hC3Nb1 is shown to prevent both proconvertase assembly as well as binding of the C3 substrate...... to C3 convertases. Our crystal structure of the C3b-hC3Nb1 complex and functional experiments demonstrate that proconvertase formation is blocked by steric hindrance between the nanobody and an Asn-linked glycan on complement factor B. In addition, hC3Nb1 is shown to prevent factor H binding to C3b...

  9. Functional interaction between the N- and C-terminal domains of murine leukemia virus surface envelope protein

    International Nuclear Information System (INIS)

    Lu, C.-W.; Roth, Monica J.

    2003-01-01

    A series of murine leukemia viruses (MuLVs) with chimeric envelope proteins (Env) was generated to map functional interactions between the N- and the C-terminal domains of surface proteins (SU). All these chimeras have the 4070A amphotropic receptor-binding region flanked by various lengths of Moloney ecotropic N- and C-terminal Env. A charged residue, E49 (E16 on the mature protein), was identified at the N-terminals of Moloney MuLV SU that is important for the interaction with the C-terminal domain of the SU. The region that interacts with E49 was localized between junction 4 (R265 of M-MuLV Env) and junction 6 (L374 of M-MuLV Env) of SU. Sequencing the viable chimeric Env virus populations identified residues within the SU protein that improved the replication kinetics of the input chimeric Env viruses. Mutations in the C-domain of SU (G387E/R, L435I, L442P) were found to improve chimera IV4, which displayed a delayed onset of replication. The replication of AE6, containing a chimeric junction in the SU C-terminus, was improved by mutations in the N-domain (N40H, E80K), the proline-rich region (Q252R), or the transmembrane protein (L538N). Altogether, these observations provide insights into the structural elements required for Env function

  10. A method for the isolation and characterization of functional murine monoclonal antibodies by single B cell cloning.

    Science.gov (United States)

    Carbonetti, Sara; Oliver, Brian G; Vigdorovich, Vladimir; Dambrauskas, Nicholas; Sack, Brandon; Bergl, Emilee; Kappe, Stefan H I; Sather, D Noah

    2017-09-01

    Monoclonal antibody technologies have enabled dramatic advances in immunology, the study of infectious disease, and modern medicine over the past 40years. However, many monoclonal antibody discovery procedures are labor- and time-intensive, low efficiency, and expensive. Here we describe an optimized mAb discovery platform for the rapid and efficient isolation, cloning and characterization of monoclonal antibodies in murine systems. In this platform, antigen-binding splenic B cells from immunized mice are isolated by FACS and cocultured with CD40L positive cells to induce proliferation and mAb production. After 12days of coculture, cell culture supernatants are screened for antigen, and IgG positivity and RNA is isolated for reverse-transcription. Positive-well cDNA is then amplified by PCR and the resulting amplicons can be cloned into ligation-independent expression vectors, which are then used directly to transfect HEK293 cells for recombinant antibody production. After 4days of growth, conditioned medium can be screened using biolayer interferometry for antigen binding and affinity measurements. Using this method, we were able to isolate six unique, functional monoclonal antibodies against an antigen of the human malaria parasite Plasmodium falciparum. Importantly, this method incorporates several important advances that circumvent the need for single-cell PCR, restriction cloning, and large scale protein production, and can be applied to a wide array of protein antigens. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Human Leucocyte Antigen-G (HLA-G and Its Murine Functional Homolog Qa2 in the Trypanosoma cruzi Infection

    Directory of Open Access Journals (Sweden)

    Fabrício C. Dias

    2015-01-01

    Full Text Available Genetic susceptibility factors, parasite strain, and an adequate modulation of the immune system seem to be crucial for disease progression after Trypanosoma cruzi infection. HLA-G and its murine functional homolog Qa2 have well-recognized immunomodulatory properties. We evaluated the HLA-G 3′ untranslated region (3′UTR polymorphic sites (associated with mRNA stability and target for microRNA binding and HLA-G tissue expression (heart, colon, and esophagus in patients presenting Chagas disease, stratified according to the major clinical variants. Further, we investigated the transcriptional levels of Qa2 and other pro- and anti-inflammatory genes in affected mouse tissues during T. cruzi experimental acute and early chronic infection induced by the CL strain. Chagas disease patients exhibited differential HLA-G 3′UTR susceptibility allele/genotype/haplotype patterns, according to the major clinical variant (digestive/cardiac/mixed/indeterminate. HLA-G constitutive expression on cardiac muscle and colonic cells was decreased in Chagasic tissues; however, no difference was observed for Chagasic and non-Chagasic esophagus tissues. The transcriptional levels of Qa2 and other anti and proinflammatory (CTLA-4, PDCD1, IL-10, INF-γ, and NOS-2 genes were induced only during the acute T. cruzi infection in BALB/c and C57BL/6 mice. We present several lines of evidence indicating the role of immunomodulatory genes and molecules in human and experimental T. cruzi infection.

  12. High frame rate retrospectively triggered Cine MRI for assessment of murine diastolic function

    NARCIS (Netherlands)

    Coolen, Bram F.; Abdurrachim, Desiree; Motaal, Abdallah G.; Nicolay, Klaas; Prompers, Jeanine J.; Strijkers, Gustav J.

    2013-01-01

    To assess left ventricular (LV) diastolic function in mice with Cine MRI, a high frame rate (>60 frames per cardiac cycle) is required. For conventional electrocardiography-triggered Cine MRI, the frame rate is inversely proportional to the pulse repetition time (TR). However, TR cannot be lowered

  13. Osteomacs interact with megakaryocytes and osteoblasts to regulate murine hematopoietic stem cell function.

    Science.gov (United States)

    Mohamad, Safa F; Xu, Linlin; Ghosh, Joydeep; Childress, Paul J; Abeysekera, Irushi; Himes, Evan R; Wu, Hao; Alvarez, Marta B; Davis, Korbin M; Aguilar-Perez, Alexandra; Hong, Jung Min; Bruzzaniti, Angela; Kacena, Melissa A; Srour, Edward F

    2017-12-12

    Networking between hematopoietic stem cells (HSCs) and cells of the hematopoietic niche is critical for stem cell function and maintenance of the stem cell pool. We characterized calvariae-resident osteomacs (OMs) and their interaction with megakaryocytes to sustain HSC function and identified distinguishing properties between OMs and bone marrow (BM)-derived macrophages. OMs, identified as CD45 + F4/80 + cells, were easily detectable (3%-5%) in neonatal calvarial cells. Coculture of neonatal calvarial cells with megakaryocytes for 7 days increased OM three- to sixfold, demonstrating that megakaryocytes regulate OM proliferation. OMs were required for the hematopoiesis-enhancing activity of osteoblasts, and this activity was augmented by megakaryocytes. Serial transplantation demonstrated that HSC repopulating potential was best maintained by in vitro cultures containing osteoblasts, OMs, and megakaryocytes. With or without megakaryocytes, BM-derived macrophages were unable to functionally substitute for neonatal calvarial cell-associated OMs. In addition, OMs differentiated into multinucleated, tartrate resistant acid phosphatase-positive osteoclasts capable of bone resorption. Nine-color flow cytometric analysis revealed that although BM-derived macrophages and OMs share many cell surface phenotypic similarities (CD45, F4/80, CD68, CD11b, Mac2, and Gr-1), only a subgroup of OMs coexpressed M-CSFR and CD166, thus providing a unique profile for OMs. CD169 was expressed by both OMs and BM-derived macrophages and therefore was not a distinguishing marker between these 2 cell types. These results demonstrate that OMs support HSC function and illustrate that megakaryocytes significantly augment the synergistic activity of osteoblasts and OMs. Furthermore, this report establishes for the first time that the crosstalk between OMs, osteoblasts, and megakaryocytes is a novel network supporting HSC function.

  14. High frame rate retrospectively triggered Cine MRI for assessment of murine diastolic function.

    Science.gov (United States)

    Coolen, Bram F; Abdurrachim, Desiree; Motaal, Abdallah G; Nicolay, Klaas; Prompers, Jeanine J; Strijkers, Gustav J

    2013-03-01

    To assess left ventricular (LV) diastolic function in mice with Cine MRI, a high frame rate (>60 frames per cardiac cycle) is required. For conventional electrocardiography-triggered Cine MRI, the frame rate is inversely proportional to the pulse repetition time (TR). However, TR cannot be lowered at will to increase the frame rate because of gradient hardware, spatial resolution, and signal-to-noise limitations. To overcome these limitations associated with electrocardiography-triggered Cine MRI, in this paper, we introduce a retrospectively triggered Cine MRI protocol capable of producing high-resolution high frame rate Cine MRI of the mouse heart for addressing left ventricular diastolic function. Simulations were performed to investigate the influence of MRI sequence parameters and the k-space filling trajectory in relation to the desired number of frames per cardiac cycle. An optimized protocol was applied in vivo and compared with electrocardiography-triggered Cine for which a high-frame rate could only be achieved by several interleaved acquisitions. Retrospective high frame rate Cine MRI proved superior to the interleaved electrocardiography-triggered protocols. High spatial-resolution Cine movies with frames rates up to 80 frames per cardiac cycle were obtained in 25 min. Analysis of left ventricular filling rate curves allowed accurate determination of early and late filling rates and revealed subtle impairments in left ventricular diastolic function of diabetic mice in comparison with nondiabetic mice. Copyright © 2012 Wiley Periodicals, Inc.

  15. Macrophage function in murine allogeneic bone marrow radiation chimeras in the early phase after transplantation

    International Nuclear Information System (INIS)

    Roesler, J.; Baccarini, M.; Vogt, B.; Lohmann-Matthes, M.L.

    1989-01-01

    We tested several of the functions of macrophages (M phi) in the early phase after allogeneic bone marrow transfer to get information about this important aspect of the nonspecific immune system in the T-cell-deficient recipient. On days 3-5 after transfer, the number of M phi was reduced in the spleen, liver, lungs, and peritoneal cavity (Pe). The phagocytosis of sheep red blood cells (SRBC) by these M phi was normal or even enhanced, as in the case of Pe-M phi. Already on days 8-12 after transfer, the number of M phi in spleen and liver exceeded that of controls, whereas the number was still reduced in lungs and Pe. We examined their ability to kill P815 tumor cells, to produce tumor necrosis factor-alpha (TNF alpha), to phagocytose SRBC, to produce reactive oxygen intermediates (ROI) in vitro and to kill Listeria monocytogenes in vivo. Most functions were normal and often even enhanced, depending on the organ origin, but the ability of Pe-M phi to produce ROI was reduced. Proliferative response to macrophage colony-stimulating factor (M-CSF) and killing of YAC-1 tumor cells revealed a high frequency of macrophage precursor cells in the spleen and liver and a high natural killer (NK) activity in the liver. Altogether, enhanced nonspecific immune function, especially preactivated M phi, may enable chimeras to survive attacks by opportunistic pathogens

  16. Taurine modulates neutrophil function but potentiates uropathogenic E. coli infection in the murine bladder.

    LENUS (Irish Health Repository)

    Condron, Claire

    2010-08-01

    Eradication of a urinary tract infection (UTI) appears to be related to a number of innate host defence mechanisms and their interactions with invading bacteria. Recurrent UTIs (rUTIs) pose a difficult problem in that these bacteria use both host and bacterial factors to evade elimination. Neutrophil bactericidal function is depressed, both systemically and in urine, in patients with a history of recurrent UTI. Taurine is a semi-essential amino acid and is successful in preserving neutrophil bactericidal function in urine. Taurine may preserve neutrophil function at the urothelium and thus aid UTI resolution. Adult female (6 weeks old) C57Bl\\/6 mice were randomised into three groups: a saline gavage only control group, a saline gavage + E. coli group, and a taurine gavage + E. coli group [21 g\\/70 kg taurine in 0.9% normal saline (N\\/S) for 5 days]. Whilst taurine gavage pre-treatment resulted in increased serum neutrophils respiratory burst activity, at the urothelial-endothelial interface it caused higher colony forming units in the urine and a higher incidence of E. coli invasion in the bladder wall with no evidence of increased bladder wall neutrophils infiltration on MPO assay of histological assessment. Histologically there was also evidence of reduced bladder inflammation and urothelial cell apoptosis. In conclusion, taurine effectively increases neutrophils activity but given its anti-inflammatory properties, at the expense of decreased urothelial-endothelial activation thus preventing clearance of active E. coli infection in the bladder. Despite the negative results, this study demonstrates the importance of modulating interactions at the urothelial interface.

  17. The extracellular redox state modulates mitochondrial function, gluconeogenesis, and glycogen synthesis in murine hepatocytes.

    Science.gov (United States)

    Nocito, Laura; Kleckner, Amber S; Yoo, Elsia J; Jones Iv, Albert R; Liesa, Marc; Corkey, Barbara E

    2015-01-01

    Circulating redox state changes, determined by the ratio of reduced/oxidized pairs of different metabolites, have been associated with metabolic diseases. However, the pathogenic contribution of these changes and whether they modulate normal tissue function is unclear. As alterations in hepatic gluconeogenesis and glycogen metabolism are hallmarks that characterize insulin resistance and type 2 diabetes, we tested whether imposed changes in the extracellular redox state could modulate these processes. Thus, primary hepatocytes were treated with different ratios of the following physiological extracellular redox couples: β-hydroxybutyrate (βOHB)/acetoacetate (Acoc), reduced glutathione (GSH)/oxidized glutathione (GSSG), and cysteine/cystine. Exposure to a more oxidized ratio via extracellular βOHB/Acoc, GSH/GSSG, and cysteine/cystine in hepatocytes from fed mice increased intracellular hydrogen peroxide without causing oxidative damage. On the other hand, addition of more reduced ratios of extracellular βOHB/Acoc led to increased NAD(P)H and maximal mitochondrial respiratory capacity in hepatocytes. Greater βOHB/Acoc ratios were also associated with decreased β-oxidation, as expected with enhanced lipogenesis. In hepatocytes from fasted mice, a more extracellular reduced state of βOHB/Acoc led to increased alanine-stimulated gluconeogenesis and enhanced glycogen synthesis capacity from added glucose. Thus, we demonstrated for the first time that the extracellular redox state regulates the major metabolic functions of the liver and involves changes in intracellular NADH, hydrogen peroxide, and mitochondrial respiration. Because redox state in the blood can be communicated to all metabolically sensitive tissues, this work confirms the hypothesis that circulating redox state may be an important regulator of whole body metabolism and contribute to alterations associated with metabolic diseases.

  18. The extracellular redox state modulates mitochondrial function, gluconeogenesis, and glycogen synthesis in murine hepatocytes.

    Directory of Open Access Journals (Sweden)

    Laura Nocito

    Full Text Available Circulating redox state changes, determined by the ratio of reduced/oxidized pairs of different metabolites, have been associated with metabolic diseases. However, the pathogenic contribution of these changes and whether they modulate normal tissue function is unclear. As alterations in hepatic gluconeogenesis and glycogen metabolism are hallmarks that characterize insulin resistance and type 2 diabetes, we tested whether imposed changes in the extracellular redox state could modulate these processes. Thus, primary hepatocytes were treated with different ratios of the following physiological extracellular redox couples: β-hydroxybutyrate (βOHB/acetoacetate (Acoc, reduced glutathione (GSH/oxidized glutathione (GSSG, and cysteine/cystine. Exposure to a more oxidized ratio via extracellular βOHB/Acoc, GSH/GSSG, and cysteine/cystine in hepatocytes from fed mice increased intracellular hydrogen peroxide without causing oxidative damage. On the other hand, addition of more reduced ratios of extracellular βOHB/Acoc led to increased NAD(PH and maximal mitochondrial respiratory capacity in hepatocytes. Greater βOHB/Acoc ratios were also associated with decreased β-oxidation, as expected with enhanced lipogenesis. In hepatocytes from fasted mice, a more extracellular reduced state of βOHB/Acoc led to increased alanine-stimulated gluconeogenesis and enhanced glycogen synthesis capacity from added glucose. Thus, we demonstrated for the first time that the extracellular redox state regulates the major metabolic functions of the liver and involves changes in intracellular NADH, hydrogen peroxide, and mitochondrial respiration. Because redox state in the blood can be communicated to all metabolically sensitive tissues, this work confirms the hypothesis that circulating redox state may be an important regulator of whole body metabolism and contribute to alterations associated with metabolic diseases.

  19. Effects of Portulaca oleracea L. Polysaccharides on Phenotypic and Functional Maturation of Murine Bone Marrow Derived Dendritic Cells.

    Science.gov (United States)

    Zhao, Rui; Zhang, Tao; Zhao, Hui; Cai, Yaping

    2015-01-01

    Portulaca oleracea L. is an annual plant widely distributed from the temperate to the tropical zones. POL-P3b, a polysaccharide fraction purified from Portulaca oleracea L., is able to enhance immunity and inhibit tumor formation. Induction of antitumor immunity by dendritic-tumor fusion cells can be modulated by their activation status. Mature dendritic cells are significantly better than immature dendritic cells at cytotoxic T-lymphocyte induction. In this study, we analyzed the effects of POL-P3b on the maturation and function of murine bone-marrow-derived dendritic cells (DCs) and relevant mechanisms. The phenotypic maturation of DCs was confirmed by flow cytometry. We found that POL-P3b upregulated the expression of CD80, CD86, CD83, and major histocompatibility complex class II molecules on DCs, stimulated production of more interleukin (IL)-12, tumor necrosis factor-α, and less IL-10. Also, DCs pulsed POL-P3b and freeze-thaw antigen increased DCs-driven T cells' proliferation and promoted U14 cells' apoptosis. Furthermore, the expression of TLR-4 was significantly increased on DCs treated by POL-P3b. These results suggested that POL-P3b may induce DCs maturation through TLR-4. Taken together, our results may have important implications for the molecular mechanisms of immunopotentiation of POL-P3b, and provide direct evidence to suggest that POL-P3b should be considered as a potent adjuvant nutrient supplement for DC-based vaccines.

  20. Functional analysis of the Borrelia burgdorferi bba64 gene product in murine infection via tick infestation.

    Directory of Open Access Journals (Sweden)

    Toni G Patton

    Full Text Available Borrelia burgdorferi, the causative agent of Lyme borreliosis, is transmitted to humans from the bite of Ixodes spp. ticks. During the borrelial tick-to-mammal life cycle, B. burgdorferi must adapt to many environmental changes by regulating several genes, including bba64. Our laboratory recently demonstrated that the bba64 gene product is necessary for mouse infectivity when B. burgdorferi is transmitted by an infected tick bite, but not via needle inoculation. In this study we investigated the phenotypic properties of a bba64 mutant strain, including 1 replication during tick engorgement, 2 migration into the nymphal salivary glands, 3 host transmission, and 4 susceptibility to the MyD88-dependent innate immune response. Results revealed that the bba64 mutant's attenuated infectivity by tick bite was not due to a growth defect inside an actively feeding nymphal tick, or failure to invade the salivary glands. These findings suggested there was either a lack of spirochete transmission to the host dermis or increased susceptibility to the host's innate immune response. Further experiments showed the bba64 mutant was not culturable from mouse skin taken at the nymphal bite site and was unable to establish infection in MyD88-deficient mice via tick infestation. Collectively, the results of this study indicate that BBA64 functions at the salivary gland-to-host delivery interface of vector transmission and is not involved in resistance to MyD88-mediated innate immunity.

  1. Metabolism of murine TH 17 cells: Impact on cell fate and function.

    Science.gov (United States)

    Wang, Ran; Solt, Laura A

    2016-04-01

    An effective adaptive immune response relies on the ability of lymphocytes to rapidly act upon a variety of insults. In T lymphocytes, this response includes cell growth, clonal expansion, differentiation, and cytokine production, all of which place a significant energy burden on the cell. Recent evidence shows that T-cell metabolic reprogramming is an essential component of the adaptive immune response and specific metabolic pathways dictate T-cell fate decisions, including the development of TH 17 versus T regulatory (Treg) cells. TH 17 cells have garnered significant attention due to their roles in the pathology of immune-mediated inflammatory diseases. Attempts to characterize TH 17 cells have demonstrated that they are highly dynamic, adjusting their function to environmental cues, which dictate their metabolic program. In this review, we highlight recent data demonstrating the impact of cellular metabolism on the TH 17/Treg balance and present factors that mediate TH 17-cell metabolism. Some examples of these include the differential impact of the mTOR signaling complexes on T-helper-cell differentiation, hypoxia inducible factor 1 alpha (HIF1α) promotion of glycolysis to favor TH 17-cell development, and ACC1-dependent de novo fatty acid synthesis favoring TH 17-cell development over Treg cells. Finally, we discuss the potential therapeutic options and the implications of modulating TH 17-cell metabolism for the treatment of TH 17-mediated diseases. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Renal scar formation and kidney function following antibiotic-treated murine pyelonephritis

    Directory of Open Access Journals (Sweden)

    Patrick D. Olson

    2017-11-01

    Full Text Available We present a new preclinical model to study treatment, resolution and sequelae of severe ascending pyelonephritis. Urinary tract infection (UTI, primarily caused by uropathogenic Escherichia coli (UPEC, is a common disease in children. Severe pyelonephritis is the primary cause of acquired renal scarring in childhood, which may eventually lead to hypertension and chronic kidney disease in a small but important fraction of patients. Preclinical modeling of UTI utilizes almost exclusively females, which (in most mouse strains exhibit inherent resistance to severe ascending kidney infection; consequently, no existing preclinical model has assessed the consequences of recovery from pyelonephritis following antibiotic treatment. We recently published a novel mini-surgical bladder inoculation technique, with which male C3H/HeN mice develop robust ascending pyelonephritis, highly prevalent renal abscesses and evidence of fibrosis. Here, we devised and optimized an antibiotic treatment strategy within this male model to more closely reflect the clinical course of pyelonephritis. A 5-day ceftriaxone regimen initiated at the onset of abscess development achieved resolution of bladder and kidney infection. A minority of treated mice displayed persistent histological abscess at the end of treatment, despite microbiological cure of pyelonephritis; a matching fraction of mice 1 month later exhibited renal scars featuring fibrosis and ongoing inflammatory infiltrates. Successful antibiotic treatment preserved renal function in almost all infected mice, as assessed by biochemical markers 1 and 5 months post-treatment; hydronephrosis was observed as a late effect of treated pyelonephritis. An occasional mouse developed chronic kidney disease, generally reflecting the incidence of this late sequela in humans. In total, this model offers a platform to study the molecular pathogenesis of pyelonephritis, response to antibiotic therapy and emergence of sequelae

  3. Galectin-3 functions as an alarmin: pathogenic role for sepsis development in murine respiratory tularemia.

    Directory of Open Access Journals (Sweden)

    Bibhuti B Mishra

    Full Text Available Sepsis is a complex immune disorder with a mortality rate of 20-50% and currently has no therapeutic interventions. It is thus critical to identify and characterize molecules/factors responsible for its development. We have recently shown that pulmonary infection with Francisella results in sepsis development. As extensive cell death is a prominent feature of sepsis, we hypothesized that host endogenous molecules called alarmins released from dead or dying host cells cause a hyperinflammatory response culminating in sepsis development. In the current study we investigated the role of galectin-3, a mammalian β-galactoside binding lectin, as an alarmin in sepsis development during F. novicida infection. We observed an upregulated expression and extracellular release of galectin-3 in the lungs of mice undergoing lethal pulmonary infection with virulent strain of F. novicida but not in those infected with a non-lethal, attenuated strain of the bacteria. In comparison with their wild-type C57Bl/6 counterparts, F. novicida infected galectin-3 deficient (galectin-3(-/- mice demonstrated significantly reduced leukocyte infiltration, particularly neutrophils in their lungs. They also exhibited a marked decrease in inflammatory cytokines, vascular injury markers, and neutrophil-associated inflammatory mediators. Concomitantly, in-vitro pre-treatment of primary neutrophils and macrophages with recombinant galectin-3 augmented F. novicida-induced activation of these cells. Correlating with the reduced inflammatory response, F. novicida infected galectin-3(-/- mice exhibited improved lung architecture with reduced cell death and improved survival over wild-type mice, despite similar bacterial burden. Collectively, these findings suggest that galectin-3 functions as an alarmin by augmenting the inflammatory response in sepsis development during pulmonary F. novicida infection.

  4. Expression and functions of galectin-7 in human and murine melanomas.

    Directory of Open Access Journals (Sweden)

    Katherine Biron-Pain

    Full Text Available The identification of galectin-7 as a p53-induced gene and its ability to induce apoptosis in many cell types support the hypothesis that galectin-7 has strong antitumor activity. This has been well documented in colon cancer. However, in some cases, such as breast cancer and lymphoma, its high expression level correlates with aggressive subtypes of cancer, suggesting that galectin-7 may have a dual role in cancer progression. In fact, in breast cancer, overexpression of galectin-7 alone is sufficient to promote metastasis to the bone and lung. In the present work, we investigated the expression and function of galectin-7 in melanoma. An analysis of datasets obtained from whole-genome profiling of human melanoma tissues revealed that galectin-7 mRNA was detected in more than 90% of biopsies of patients with nevi while its expression was more rarely found in biopsies collected from patients with malignant melanoma. This frequency, however, was likely due to the presence of normal epidermis tissues in biopsies, as shown our studies at the protein level by immunohistochemical analysis. Using the experimental melanoma B16F1 cell line, we found that melanoma cells can express galectin-7 at the primary tumor site and in lung metastasis. Moreover, we found that overexpression of galectin-7 increased the resistance of melanoma cells to apoptosis while inducing de novo egr-1 expression. Overexpression of galectin-7, however, was insufficient to modulate the growth of tumors induced by the subcutaneous injection of B16F1 cells. It also failed to modulate the dissemination of B16F1 cells to the lung.

  5. Receptor for advanced glycation end-products and World Trade Center particulate induced lung function loss: A case-cohort study and murine model of acute particulate exposure.

    Science.gov (United States)

    Caraher, Erin J; Kwon, Sophia; Haider, Syed H; Crowley, George; Lee, Audrey; Ebrahim, Minah; Zhang, Liqun; Chen, Lung-Chi; Gordon, Terry; Liu, Mengling; Prezant, David J; Schmidt, Ann Marie; Nolan, Anna

    2017-01-01

    World Trade Center-particulate matter(WTC-PM) exposure and metabolic-risk are associated with WTC-Lung Injury(WTC-LI). The receptor for advanced glycation end-products (RAGE) is most highly expressed in the lung, mediates metabolic risk, and single-nucleotide polymorphisms at the AGER-locus predict forced expiratory volume(FEV). Our objectives were to test the hypotheses that RAGE is a biomarker of WTC-LI in the FDNY-cohort and that loss of RAGE in a murine model would protect against acute PM-induced lung disease. We know from previous work that early intense exposure at the time of the WTC collapse was most predictive of WTC-LI therefore we utilized a murine model of intense acute PM-exposure to determine if loss of RAGE is protective and to identify signaling/cytokine intermediates. This study builds on a continuing effort to identify serum biomarkers that predict the development of WTC-LI. A case-cohort design was used to analyze a focused cohort of male never-smokers with normal pre-9/11 lung function. Odds of developing WTC-LI increased by 1.2, 1.8 and 1.0 in firefighters with soluble RAGE (sRAGE)≥97pg/mL, CRP≥2.4mg/L, and MMP-9≤397ng/mL, respectively, assessed in a multivariate logistic regression model (ROCAUC of 0.72). Wild type(WT) and RAGE-deficient(Ager-/-) mice were exposed to PM or PBS-control by oropharyngeal aspiration. Lung function, airway hyperreactivity, bronchoalveolar lavage, histology, transcription factors and plasma/BAL cytokines were quantified. WT-PM mice had decreased FEV and compliance, and increased airway resistance and methacholine reactivity after 24-hours. Decreased IFN-γ and increased LPA were observed in WT-PM mice; similar findings have been reported for firefighters who eventually develop WTC-LI. In the murine model, lack of RAGE was protective from loss of lung function and airway hyperreactivity and was associated with modulation of MAP kinases. We conclude that in a multivariate adjusted model increased sRAGE is

  6. Receptor for advanced glycation end-products and World Trade Center particulate induced lung function loss: A case-cohort study and murine model of acute particulate exposure.

    Directory of Open Access Journals (Sweden)

    Erin J Caraher

    Full Text Available World Trade Center-particulate matter(WTC-PM exposure and metabolic-risk are associated with WTC-Lung Injury(WTC-LI. The receptor for advanced glycation end-products (RAGE is most highly expressed in the lung, mediates metabolic risk, and single-nucleotide polymorphisms at the AGER-locus predict forced expiratory volume(FEV. Our objectives were to test the hypotheses that RAGE is a biomarker of WTC-LI in the FDNY-cohort and that loss of RAGE in a murine model would protect against acute PM-induced lung disease. We know from previous work that early intense exposure at the time of the WTC collapse was most predictive of WTC-LI therefore we utilized a murine model of intense acute PM-exposure to determine if loss of RAGE is protective and to identify signaling/cytokine intermediates. This study builds on a continuing effort to identify serum biomarkers that predict the development of WTC-LI. A case-cohort design was used to analyze a focused cohort of male never-smokers with normal pre-9/11 lung function. Odds of developing WTC-LI increased by 1.2, 1.8 and 1.0 in firefighters with soluble RAGE (sRAGE≥97pg/mL, CRP≥2.4mg/L, and MMP-9≤397ng/mL, respectively, assessed in a multivariate logistic regression model (ROCAUC of 0.72. Wild type(WT and RAGE-deficient(Ager-/- mice were exposed to PM or PBS-control by oropharyngeal aspiration. Lung function, airway hyperreactivity, bronchoalveolar lavage, histology, transcription factors and plasma/BAL cytokines were quantified. WT-PM mice had decreased FEV and compliance, and increased airway resistance and methacholine reactivity after 24-hours. Decreased IFN-γ and increased LPA were observed in WT-PM mice; similar findings have been reported for firefighters who eventually develop WTC-LI. In the murine model, lack of RAGE was protective from loss of lung function and airway hyperreactivity and was associated with modulation of MAP kinases. We conclude that in a multivariate adjusted model increased s

  7. The effect of perioperative analgesic drugs omnopon and dexketoprofen on the functional activity of immune cells in murine model of tumor surgery.

    Science.gov (United States)

    Sydor, R I; Khranovska, N M; Skachkova, O V; Skivka, L M

    2016-01-01

    We aimed to investigate the effect of perioperative analgesia with nonselective cyclooxygenase-2 inhibitor dexketoprofen and opioid drug omnopon on the functional activity of immune cells in tumor excision murine model. Lewis lung carcinoma cells were transplanted into hind paw of C57/black mice. On the 23th day tumor was removed. Analgesic drugs were injected 30 min before and once a day for 3 days after the surgery. Biological material was obtained a day before, 1 day and 3 days after the tumor removal. IFN-γ, IL-4, IL-10 and TGF-β mRNA levels in splenic cells were assessed by quantitative real-time RT-PCR. Cytotoxic activity of splenocytes was estimated by flow cytometry. We found that in splenocytes of mice received opioid analgesia IL-10 mRNA level was increased 2.3 times on day one after the surgery compared to preoperative level (P dexketoprofen group this parameter did not change. IFN-γ gene expression level on day 3 after tumor removal was 40% higher in splenocytes of dexketoprofen treated mice as compared with omnopon treated animals (P dexketoprofen against (50.2 ± 3.3)% in omnopon group. In conclusion, perioperative analgesia with cyclooxygenase inhibitor dexketoprofen in contrast to opioid analgesia with omnopon preserves higher functional activity of murine immune cells in the experimental model of tumor surgery.

  8. Recombinant human interleukin 2 directly provides signals for the proliferation and functional maturation of murine B lymphocytes

    OpenAIRE

    Moll, Heidrun; Emmrich, F.; Simon, Markus M.

    2009-01-01

    In this study the effect of recombinant human interleukin 2 (rec.hIL-2) on the proliferation and maturation of B lymphocytes was investigated. It was found that the presence of rec.hIL 2 results in proliferation of mitogen (LPS)-activated B cell blasts. In addition, it is shown that highly enriched murine B cells can be induced by rec.hIL-2 to proliferate and to develop into antibody-secreting cells (PFC) in the presence of antigen (SRBC). When tested for its effect on B cell preparations enr...

  9. Tyrosine 129 of the murine gammaherpesvirus M2 protein is critical for M2 function in vivo.

    Science.gov (United States)

    Rangaswamy, Udaya S; O'Flaherty, Brigid M; Speck, Samuel H

    2014-01-01

    A common strategy shared by all known gammaherpesviruses is their ability to establish a latent infection in lymphocytes--predominantly in B cells. In immunocompromised patients, such as transplant recipients or AIDS patients, gammaherpesvirus infections can lead to the development of lymphoproliferative disease and lymphoid malignancies. The human gamma-herpesviruses, EBV and KSHV, encode proteins that are capable of modulating the host immune signaling machinery, thereby subverting host immune responses. Murine gamma-herpesvirus 68 (MHV68) infection of laboratory strains of mice has proven to be useful small-animal model that shares important pathogenic strategies with the human gamma-herpesviruses. The MHV68 M2 protein is known to manipulate B cell signaling and, dependent on route and dose of virus inoculation, plays a role in both the establishment of latency and virus reactivation. M2 contains two tyrosines that are targets for phosphorylation, and have been shown to interact with the B cell signaling machinery. Here we describe in vitro and in vivo studies of M2 mutants which reveals that while both tyrosines Y120 and Y129 are required for M2 induction of IL-10 expression from primary murine B cells in vitro, only Y129 is critical for reactivation from latency and plasma cell differentiation in vivo.

  10. Tyrosine 129 of the murine gammaherpesvirus M2 protein is critical for M2 function in vivo.

    Directory of Open Access Journals (Sweden)

    Udaya S Rangaswamy

    Full Text Available A common strategy shared by all known gammaherpesviruses is their ability to establish a latent infection in lymphocytes--predominantly in B cells. In immunocompromised patients, such as transplant recipients or AIDS patients, gammaherpesvirus infections can lead to the development of lymphoproliferative disease and lymphoid malignancies. The human gamma-herpesviruses, EBV and KSHV, encode proteins that are capable of modulating the host immune signaling machinery, thereby subverting host immune responses. Murine gamma-herpesvirus 68 (MHV68 infection of laboratory strains of mice has proven to be useful small-animal model that shares important pathogenic strategies with the human gamma-herpesviruses. The MHV68 M2 protein is known to manipulate B cell signaling and, dependent on route and dose of virus inoculation, plays a role in both the establishment of latency and virus reactivation. M2 contains two tyrosines that are targets for phosphorylation, and have been shown to interact with the B cell signaling machinery. Here we describe in vitro and in vivo studies of M2 mutants which reveals that while both tyrosines Y120 and Y129 are required for M2 induction of IL-10 expression from primary murine B cells in vitro, only Y129 is critical for reactivation from latency and plasma cell differentiation in vivo.

  11. Genetic deletion of the bacterial sensor NOD2 improves murine Crohn’s disease-like ileitis independent of functional dysbiosis

    Energy Technology Data Exchange (ETDEWEB)

    Corridoni, D.; Rodriguez-Palacios, A.; Di Stefano, G.; Di Martino, L.; Antonopoulos, D. A.; Chang, E. B.; Arseneau, K. O.; Pizarro, T. T.; Cominelli, F.

    2016-11-16

    Although genetic polymorphisms in NOD2 (nucleotide-binding oligomerization domain-containing 2) have been associated with the pathogenesis of Crohn’s disease (CD), little is known regarding the role of wild-type (WT) NOD2 in the gut. To date, most murine studies addressing the role of WT Nod2 have been conducted using healthy (ileitis/colitis-free) mouse strains. Here, we evaluated the effects of Nod2 deletion in a murine model of spontaneous ileitis, i.e., the SAMP1Yit/Fc (SAMP) strain, which closely resembles CD. Remarkably, Nod2 deletion improved both chronic cobblestone ileitis (by 50% assessed, as the % of abnormal mucosa at 24 wks of age), as well as acute dextran sodium sulfate (DSS) colitis. Mechanistically, Th2 cytokine production and Th2-transcription factor activation (i.e., STAT6 phosphorylation) were reduced. Microbiologically, the effects of Nod2 deletion appeared independent of fecal microbiota composition and function, assessed by 16S rRNA and metatranscriptomics. Our findings indicate that pharmacological blockade of NOD2 signaling in humans could improve health in Th2-driven chronic intestinal inflammation.

  12. The effect of perioperative analgesic drugs omnopon and dexketoprofen on the functional activity of immune cells in murine model of tumor surgery

    Directory of Open Access Journals (Sweden)

    R. I. Sydor

    2016-08-01

    Full Text Available We aimed to investigate the effect of perioperative analgesia with nonselective cyclooxygenase-2 inhibitor dexketoprofen and opioid drug omnopon on the functional activity of immune cells in tumor excision murine model. Lewis lung carcinoma cells were transplanted into hind paw of C57/black mice. On the 23th day tumor was removed. Analgesic drugs were injected 30 min before and once a day for 3 days after the surgery. Biological material was obtained a day before, 1 day and 3 days after the tumor removal. IFN-γ, IL-4, IL-10 and TGF-β mRNA levels in splenic cells were assessed by quantitative real-time RT-PCR. Cytotoxic activity of splenocytes was estimated by flow cytometry. We found that in splenocytes of mice received opioid analgesia IL-10 mRNA level was increased 2.3 times on day one after the surgery compared to preoperative level (P < 0.05, while in dexketoprofen group this parameter did not change. IFN-γ gene expression level on day 3 after tumor removal was 40% higher in splenocytes of dexketoprofen treated mice as compared with omnopon treated animals (P < 0.05. Cytotoxic activity of splenocytes on day 3 postsurgery was (62.2 ± 2.4% in dexketoprofen against (50.2 ± 3.3% in omnopon group. In conclusion, perioperative analgesia with cyclooxygenase inhibitor dexketoprofen in contrast to opioid analgesia with omnopon preserves higher functional activity of murine immune cells in the experimental model of tumor surgery.

  13. The effect of prenatal pravastatin treatment on altered fetal programming of postnatal growth and metabolic function in a preeclampsia-like murine model.

    Science.gov (United States)

    McDonnold, Mollie; Tamayo, Esther; Kechichian, Talar; Gamble, Phyllis; Longo, Monica; Hankins, Gary D V; Saade, George R; Costantine, Maged M

    2014-06-01

    Preeclampsia alters fetal programming and results in long-term metabolic consequences in the offspring. Pravastatin has been shown to prevent preeclampsia in animal models. Our aim was to characterize the effects of preeclampsia on fetal programming of adult growth and metabolic function, and evaluate the role of preventive pravastatin therapy, using a well characterized murine model. CD-1 mice were injected through the tail vein with adenovirus carrying soluble fms-like tyrosine kinase 1 (sFlt-1) and randomly allocated to pravastatin (5 mg/kg/day; sFlt-1/prav, n = 7) or water (sFlt-1, n = 6) until weaning. A control group was injected with adenovirus carrying the murine immunoglobulin G2α Fc fragment (mFc, n = 8). Male and female offspring (6-8/group) were weighed every month until 6 months of age. Intraperitoneal glucose tolerance testing was performed after 16 hours of fasting at 3 and 6 months of age; glucose and insulin responses were measured. sFlt-1 offspring weight was lower than mFc control (P < .001) until 2 months of age for females and 5 months of age for males (P < .001). There were no differences in postnatal growth between mFc and sFlt-1/prav offspring. At 3 and 6 months, female sFlt-1 offspring had higher glucose response compared with mFc and sFlt-1/prav. Three-month-old male sFlt-1 had lower insulin response compared with mFc offspring. Preeclampsia alters postnatal growth and metabolic function in the adult offspring in this animal model. Maternal therapy with prav prevents some of these alterations in the offspring. Copyright © 2014 Mosby, Inc. All rights reserved.

  14. Differential expression and function of breast regression protein 39 (BRP-39 in murine models of subacute cigarette smoke exposure and allergic airway inflammation

    Directory of Open Access Journals (Sweden)

    Coyle Anthony J

    2011-04-01

    Full Text Available Abstract Background While the presence of the chitinase-like molecule YKL40 has been reported in COPD and asthma, its relevance to inflammatory processes elicited by cigarette smoke and common environmental allergens, such as house dust mite (HDM, is not well understood. The objective of the current study was to assess expression and function of BRP-39, the murine equivalent of YKL40 in a murine model of cigarette smoke-induced inflammation and contrast expression and function to a model of HDM-induced allergic airway inflammation. Methods CD1, C57BL/6, and BALB/c mice were room air- or cigarette smoke-exposed for 4 days in a whole-body exposure system. In separate experiments, BALB/c mice were challenged with HDM extract once a day for 10 days. BRP-39 was assessed by ELISA and immunohistochemistry. IL-13, IL-1R1, IL-18, and BRP-39 knock out (KO mice were utilized to assess the mechanism and relevance of BRP-39 in cigarette smoke- and HDM-induced airway inflammation. Results Cigarette smoke exposure elicited a robust induction of BRP-39 but not the catalytically active chitinase, AMCase, in lung epithelial cells and alveolar macrophages of all mouse strains tested. Both BRP-39 and AMCase were increased in lung tissue after HDM exposure. Examining smoke-exposed IL-1R1, IL-18, and IL-13 deficient mice, BRP-39 induction was found to be IL-1 and not IL-18 or IL-13 dependent, while induction of BRP-39 by HDM was independent of IL-1 and IL-13. Despite the importance of BRP-39 in cellular inflammation in HDM-induced airway inflammation, BRP-39 was found to be redundant for cigarette smoke-induced airway inflammation and the adjuvant properties of cigarette smoke. Conclusions These data highlight the contrast between the importance of BRP-39 in HDM- and cigarette smoke-induced inflammation. While functionally important in HDM-induced inflammation, BRP-39 is a biomarker of cigarette smoke induced inflammation which is the byproduct of an IL-1

  15. Murine dishevelled 3 functions in redundant pathways with dishevelled 1 and 2 in normal cardiac outflow tract, cochlea, and neural tube development.

    Science.gov (United States)

    Etheridge, S Leah; Ray, Saugata; Li, Shuangding; Hamblet, Natasha S; Lijam, Nardos; Tsang, Michael; Greer, Joy; Kardos, Natalie; Wang, Jianbo; Sussman, Daniel J; Chen, Ping; Wynshaw-Boris, Anthony

    2008-11-01

    Dishevelled (Dvl) proteins are important signaling components of both the canonical beta-catenin/Wnt pathway, which controls cell proliferation and patterning, and the planar cell polarity (PCP) pathway, which coordinates cell polarity within a sheet of cells and also directs convergent extension cell (CE) movements that produce narrowing and elongation of the tissue. Three mammalian Dvl genes have been identified and the developmental roles of Dvl1 and Dvl2 were previously determined. Here, we identify the functions of Dvl3 in development and provide evidence of functional redundancy among the three murine Dvls. Dvl3(-/-) mice died perinatally with cardiac outflow tract abnormalities, including double outlet right ventricle and persistent truncus arteriosis. These mutants also displayed a misorientated stereocilia in the organ of Corti, a phenotype that was enhanced with the additional loss of a single allele of the PCP component Vangl2/Ltap (LtapLp/+). Although neurulation appeared normal in both Dvl3(-/-) and LtapLp/+ mutants, Dvl3(+/-);LtapLp/+ combined mutants displayed incomplete neural tube closure. Importantly, we show that many of the roles of Dvl3 are also shared by Dvl1 and Dvl2. More severe phenotypes were observed in Dvl3 mutants with the deficiency of another Dvl, and increasing Dvl dosage genetically with Dvl transgenes demonstrated the ability of Dvls to compensate for each other to enable normal development. Interestingly, global canonical Wnt signaling appeared largely unaffected in the double Dvl mutants, suggesting that low Dvl levels are sufficient for functional canonical Wnt signals. In summary, we demonstrate that Dvl3 is required for cardiac outflow tract development and describe its importance in the PCP pathway during neurulation and cochlea development. Finally, we establish several developmental processes in which the three Dvls are functionally redundant.

  16. Murine dishevelled 3 functions in redundant pathways with dishevelled 1 and 2 in normal cardiac outflow tract, cochlea, and neural tube development.

    Directory of Open Access Journals (Sweden)

    S Leah Etheridge

    2008-11-01

    Full Text Available Dishevelled (Dvl proteins are important signaling components of both the canonical beta-catenin/Wnt pathway, which controls cell proliferation and patterning, and the planar cell polarity (PCP pathway, which coordinates cell polarity within a sheet of cells and also directs convergent extension cell (CE movements that produce narrowing and elongation of the tissue. Three mammalian Dvl genes have been identified and the developmental roles of Dvl1 and Dvl2 were previously determined. Here, we identify the functions of Dvl3 in development and provide evidence of functional redundancy among the three murine Dvls. Dvl3(-/- mice died perinatally with cardiac outflow tract abnormalities, including double outlet right ventricle and persistent truncus arteriosis. These mutants also displayed a misorientated stereocilia in the organ of Corti, a phenotype that was enhanced with the additional loss of a single allele of the PCP component Vangl2/Ltap (LtapLp/+. Although neurulation appeared normal in both Dvl3(-/- and LtapLp/+ mutants, Dvl3(+/-;LtapLp/+ combined mutants displayed incomplete neural tube closure. Importantly, we show that many of the roles of Dvl3 are also shared by Dvl1 and Dvl2. More severe phenotypes were observed in Dvl3 mutants with the deficiency of another Dvl, and increasing Dvl dosage genetically with Dvl transgenes demonstrated the ability of Dvls to compensate for each other to enable normal development. Interestingly, global canonical Wnt signaling appeared largely unaffected in the double Dvl mutants, suggesting that low Dvl levels are sufficient for functional canonical Wnt signals. In summary, we demonstrate that Dvl3 is required for cardiac outflow tract development and describe its importance in the PCP pathway during neurulation and cochlea development. Finally, we establish several developmental processes in which the three Dvls are functionally redundant.

  17. Mitochondrial function is involved in regulation of cholesterol efflux to apolipoprotein (apoA-I from murine RAW 264.7 macrophages

    Directory of Open Access Journals (Sweden)

    Allen Anne Marie

    2012-12-01

    Full Text Available Abstract Background Mitochondrial DNA damage, increased production of reactive oxygen species and progressive respiratory chain dysfunction, together with increased deposition of cholesterol and cholesteryl esters, are hallmarks of atherosclerosis. This study investigated the role of mitochondrial function in regulation of macrophage cholesterol efflux to apolipoprotein A-I, by the addition of established pharmacological modulators of mitochondrial function. Methods Murine RAW 264.7 macrophages were treated with a range of concentrations of resveratrol, antimycin, dinitrophenol, nigericin and oligomycin, and changes in viability, cytotoxicity, membrane potential and ATP, compared with efflux of [3H]cholesterol to apolipoprotein (apo A-I. The effect of oligomycin treatment on expression of genes implicated in macrophage cholesterol homeostasis were determined by quantitative polymerase chain reaction, and immunoblotting, relative to the housekeeping enzyme, Gapdh, and combined with studies of this molecule on cholesterol esterification, de novo lipid biosynthesis, and induction of apoptosis. Significant differences were determined using analysis of variance, and Dunnett’s or Bonferroni post t-tests, as appropriate. Results The positive control, resveratrol (24 h, significantly enhanced cholesterol efflux to apoA-I at concentrations ≥30 μM. By contrast, cholesterol efflux to apoA-I was significantly inhibited by nigericin (45%; ppAbca1 mRNA. Oligomycin treatment did not affect cholesterol biosynthesis, but significantly inhibited cholesterol esterification following exposure to acetylated LDL, and induced apoptosis at ≥30 μM. Finally, oligomycin induced the expression of genes implicated in both cholesterol efflux (Abca1, Abcg4, Stard1 and cholesterol biosynthesis (Hmgr, Mvk, Scap, Srebf2, indicating profound dysregulation of cholesterol homeostasis. Conclusions Acute loss of mitochondrial function, and in particular Δψm, reduces

  18. Brain mitochondrial function in a murine model of cerebral malaria and the therapeutic effects of rhEPO

    DEFF Research Database (Denmark)

    Karlsson, Michael; Hempel, Casper; Sjövall, Fredrik

    2013-01-01

    and no connection between disease severity and mitochondrial respiratory function. Treatment with rhEPO similarly had no effect on respiratory function. Thus cerebral metabolic dysfunction in CM does not seem to be directly linked to altered mitochondrial respiratory capacity as analyzed in brain homogenates ex...

  19. Expression and function of cannabinoid receptors CB1 and CB2 and their cognate cannabinoid ligands in murine embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Shuxian Jiang

    2007-07-01

    Full Text Available Characterization of intrinsic and extrinsic factors regulating the self-renewal/division and differentiation of stem cells is crucial in determining embryonic stem (ES cell fate. ES cells differentiate into multiple hematopoietic lineages during embryoid body (EB formation in vitro, which provides an experimental platform to define the molecular mechanisms controlling germ layer fate determination and tissue formation.The cannabinoid receptor type 1 (CB1 and cannabinoid receptor type 2 (CB2 are members of the G-protein coupled receptor (GPCR family, that are activated by endogenous ligands, the endocannabinoids. CB1 receptor expression is abundant in brain while CB2 receptors are mostly expressed in hematopoietic cells. However, the expression and the precise roles of CB1 and CB2 and their cognate ligands in ES cells are not known. We observed significant induction of CB1 and CB2 cannabinoid receptors during the hematopoietic differentiation of murine ES (mES-derived embryoid bodies. Furthermore, mES cells as well as ES-derived embryoid bodies at days 7 and 14, expressed endocannabinoids, the ligands for both CB1 and CB2. The CB1 and CB2 antagonists (AM251 and AM630, respectively induced mES cell death, strongly suggesting that endocannabinoids are involved in the survival of mES cells. Treatment of mES cells with the exogenous cannabinoid ligand Delta(9-THC resulted in the increased hematopoietic differentiation of mES cells, while addition of AM251 or AM630 blocked embryoid body formation derived from the mES cells. In addition, cannabinoid agonists induced the chemotaxis of ES-derived embryoid bodies, which was specifically inhibited by the CB1 and CB2 antagonists.This work has not been addressed previously and yields new information on the function of cannabinoid receptors, CB1 and CB2, as components of a novel pathway regulating murine ES cell differentiation. This study provides insights into cannabinoid system involvement in ES cell

  20. Effect of Xiaoqinglong decoction on mucus hypersecretion in the airways and cilia function in a murine model of asthma

    Directory of Open Access Journals (Sweden)

    Mingyue Qi

    2017-07-01

    Conclusion: XQL can attenuate cilia shortening, aid the clearance function of ciliated epithelial cells, and reduce mucus production in an OVA-induced asthma model in mice. XQL can inhibit mucus hypersecretion and could be a new type of pharmacotherapy.

  1. From inflammation to wound healing: using a simple model to understand the functional versatility of murine macrophages.

    Science.gov (United States)

    Childs, Lauren M; Paskow, Michael; Morris, Sidney M; Hesse, Matthias; Strogatz, Steven

    2011-11-01

    Macrophages are fundamental cells of the innate immune system. Their activation is essential for such distinct immune functions as inflammation (pathogen-killing) and tissue repair (wound healing). An open question has been the functional stability of an individual macrophage cell: whether it can change its functional profile between different immune responses such as between the repair pathway and the inflammatory pathway. We studied this question theoretically by constructing a rate equation model for the key substrate, enzymes and products of the pathways; we then tested the model experimentally. Both our model and experiments show that individual macrophages can switch from the repair pathway to the inflammation pathway but that the reverse switch does not occur.

  2. Human CD4 restores normal T cell development and function in mice deficient in murine CD4

    OpenAIRE

    1994-01-01

    The ability of a human coreceptor to function in mice was investigated by generating human CD4 (hCD4)-expressing transgenic mice on a mouse CD4-deficient (mCD4-/-) background. From developing thymocyte to matured T lymphocyte functions, hCD4 was shown to be physiologically active. By examining the expansion and deletion of specific V beta T cell families in mutated mice with and without hCD4, it was found that hCD4 can participate in positive and negative selection. Mature hCD4 single positiv...

  3. Rabies virus cross-reactive murine T cell clones: analysis of helper and delayed-type hypersensitivity function.

    NARCIS (Netherlands)

    H. Bunschoten; B. Dietzschold; I.J.Th.M. Claassen (Ivo); R. Klapmuts; F. UytdeHaag; A.D.M.E. Osterhaus (Albert)

    1990-01-01

    textabstractThree T cell clones derived from rabies virus-immunized BALB/c mice were analysed for specificity and function. The clones proved to be broadly cross-reactive by responding to different rabies virus isolates (PM, ERA, CVS, HEP) and other representatives of the genus Lyssavirus, like the

  4. Dietary n-3 PUFA affect TcR-mediated activation of purified murine T cells and accessory cell function in co-cultures

    Science.gov (United States)

    CHAPKIN, R S; ARRINGTON, J L; APANASOVICH, T V; CARROLL, R J; MCMURRAY, D N

    2002-01-01

    Diets enriched in n-3 polyunsaturated fatty acids (PUFA) suppress several functions of murine splenic T cells by acting directly on the T cells and/or indirectly on accessory cells. In this study, the relative contribution of highly purified populations of the two cell types to the dietary suppression of T cell function was examined. Mice were fed diets containing different levels of n-3 PUFA; safflower oil (SAF; control containing no n-3 PUFA), fish oil (FO) at 2% and 4%, or 1% purified docosahexaenoic acid (DHA) for 2 weeks. Purified (>90%) T cells were obtained from the spleen, and accessory cells (>95% adherent, esterase-positive) were obtained by peritoneal lavage. Purified T cells or accessory cells from each diet group were co-cultured with the alternative cell type from every other diet group, yielding a total of 16 different co-culture combinations. The T cells were stimulated with either concanavalin A (ConA) or antibodies to the T cell receptor (TcR)/CD3 complex and the costimulatory molecule CD28 (αCD3/αCD28), and proliferation was measured after four days. Suppression of T cell proliferation in the co-cultures was dependent upon the dose of dietary n-3 PUFA fed to mice from which the T cells were derived, irrespective of the dietary treatment of accessory cell donors. The greatest dietary effect was seen in mice consuming the DHA diet (P = 0·034 in the anova; P = 0·0053 in the Trend Test), and was observed with direct stimulation of the T cell receptor and CD28 costimulatory ligand, but not with ConA. A significant dietary effect was also contributed accessory cells (P = 0·033 in the Trend Test). We conclude that dietary n-3 PUFA affect TcR-mediated by T cell activation by both direct and indirect (accessory cell) mechanisms. PMID:12296847

  5. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  6. Dual AAV therapy ameliorates exercise-induced muscle injury and functional ischemia in murine models of Duchenne muscular dystrophy.

    Science.gov (United States)

    Zhang, Yadong; Yue, Yongping; Li, Liang; Hakim, Chady H; Zhang, Keqing; Thomas, Gail D; Duan, Dongsheng

    2013-09-15

    Neuronal nitric oxide synthase (nNOS) membrane delocalization contributes to the pathogenesis of Duchenne muscular dystrophy (DMD) by promoting functional muscle ischemia and exacerbating muscle injury during exercise. We have previously shown that supra-physiological expression of nNOS-binding mini-dystrophin restores normal blood flow regulation and prevents functional ischemia in transgenic mdx mice, a DMD model. A critical next issue is whether systemic dual adeno-associated virus (AAV) gene therapy can restore nNOS-binding mini-dystrophin expression and mitigate muscle activity-related functional ischemia and injury. Here, we performed systemic gene transfer in mdx and mdx4cv mice using a pair of dual AAV vectors that expressed a 6 kb nNOS-binding mini-dystrophin gene. Vectors were packaged in tyrosine mutant AAV-9 and co-injected (5 × 10(12) viral genome particles/vector/mouse) via the tail vein to 1-month-old dystrophin-null mice. Four months later, we observed 30-50% mini-dystrophin positive myofibers in limb muscles. Treatment ameliorated histopathology, increased muscle force and protected against eccentric contraction-induced injury. Importantly, dual AAV therapy successfully prevented chronic exercise-induced muscle force drop. Doppler hemodynamic assay further showed that therapy attenuated adrenergic vasoconstriction in contracting muscle. Our results suggest that partial transduction can still ameliorate nNOS delocalization-associated functional deficiency. Further evaluation of nNOS binding mini-dystrophin dual AAV vectors is warranted in dystrophic dogs and eventually in human patients.

  7. Interferon-β Suppresses Murine Th1 Cell Function in the Absence of Antigen-Presenting Cells

    Science.gov (United States)

    Boivin, Nicolas; Baillargeon, Joanie; Doss, Prenitha Mercy Ignatius Arokia; Roy, Andrée-Pascale; Rangachari, Manu

    2015-01-01

    Interferon (IFN)-β is a front-line therapy for the treatment of the relapsing-remitting form of multiple sclerosis. However, its immunosuppressive mechanism of function remains incompletely understood. While it has been proposed that IFN-β suppresses the function of inflammatory myelin antigen-reactive T cells by promoting the release of immunomodulatory cytokines such as IL-27 from antigen-presenting cells (APCs), its direct effects on inflammatory CD4+ Th1 cells are less clear. Here, we establish that IFN-β inhibits mouse IFN-γ+ Th1 cell function in the absence of APCs. CD4+ T cells express the type I interferon receptor, and IFN-β can suppress Th1 cell proliferation under APC-free stimulation conditions. IFN-β-treated myelin antigen-specific Th1 cells are impaired in their ability to induce severe experimental autoimmune encephalomyelitis (EAE) upon transfer to lymphocyte-deficient Rag1-/- mice. Polarized Th1 cells downregulate IFN-γ and IL-2, and upregulate the negative regulatory receptor Tim-3, when treated with IFN-β in the absence of APCs. Further, IFN-β treatment of Th1 cells upregulates phosphorylation of Stat1, and downregulates phosphorylation of Stat4. Our data indicate that IFN-γ-producing Th1 cells are directly responsive to IFN-β and point to a novel mechanism of IFN-β-mediated T cell suppression that is independent of APC-derived signals. PMID:25885435

  8. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

    Science.gov (United States)

    Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

    2018-02-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function.

    Science.gov (United States)

    Manesia, Javed K; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M

    2017-04-15

    During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term "transcription." By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function.

  10. Cell Adhesion Molecule CD166/ALCAM Functions Within the Crypt to Orchestrate Murine Intestinal Stem Cell HomeostasisSummary

    Directory of Open Access Journals (Sweden)

    Nicholas R. Smith

    2017-05-01

    Full Text Available Background & Aims: Intestinal epithelial homeostasis is maintained by active-cycling and slow-cycling stem cells confined within an instructive crypt-based niche. Exquisite regulating of these stem cell populations along the proliferation-to-differentiation axis maintains a homeostatic balance to prevent hyperproliferation and cancer. Although recent studies focus on how secreted ligands from mesenchymal and epithelial populations regulate intestinal stem cells (ISCs, it remains unclear what role cell adhesion plays in shaping the regulatory niche. Previously we have shown that the cell adhesion molecule and cancer stem cell marker, CD166/ALCAM (activated leukocyte cell adhesion molecule, is highly expressed by both active-cycling Lgr5+ ISCs and adjacent Paneth cells within the crypt base, supporting the hypothesis that CD166 functions to mediate ISC maintenance and signal coordination. Methods: Here we tested this hypothesis by analyzing a CD166–/– mouse combined with immunohistochemical, flow cytometry, gene expression, and enteroid culture. Results: We found that animals lacking CD166 expression harbored fewer active-cycling Lgr5+ ISCs. Homeostasis was maintained by expansion of the transit-amplifying compartment and not by slow-cycling Bmi1+ ISC stimulation. Loss of active-cycling ISCs was coupled with deregulated Paneth cell homeostasis, manifested as increased numbers of immature Paneth progenitors due to decreased terminal differentiation, linked to defective Wnt signaling. CD166–/– Paneth cells expressed reduced Wnt3 ligand expression and depleted nuclear β-catenin. Conclusions: These data support a function for CD166 as an important cell adhesion molecule that shapes the signaling microenvironment by mediating ISC–niche cell interactions. Furthermore, loss of CD166 expression results in decreased ISC and Paneth cell homeostasis and an altered Wnt microenvironment. Keywords: Intestinal Stem Cell, Homeostasis

  11. IL-17A influences essential functions of the monocyte/macrophage lineage and is involved in advanced murine and human atherosclerosis.

    Science.gov (United States)

    Erbel, Christian; Akhavanpoor, Mohammadreza; Okuyucu, Deniz; Wangler, Susanne; Dietz, Alex; Zhao, Li; Stellos, Konstantinos; Little, Kristina M; Lasitschka, Felix; Doesch, Andreas; Hakimi, Maani; Dengler, Thomas J; Giese, Thomas; Blessing, Erwin; Katus, Hugo A; Gleissner, Christian A

    2014-11-01

    Atherosclerosis is a chronic inflammatory disease. Lesion progression is primarily mediated by cells of the monocyte/macrophage lineage. IL-17A is a proinflammatory cytokine, which modulates immune cell trafficking and is involved inflammation in (auto)immune and infectious diseases. But the role of IL-17A still remains controversial. In the current study, we investigated effects of IL-17A on advanced murine and human atherosclerosis, the common disease phenotype in clinical care. The 26-wk-old apolipoprotein E-deficient mice were fed a standard chow diet and treated either with IL-17A mAb (n = 15) or irrelevant Ig (n = 10) for 16 wk. Furthermore, essential mechanisms of IL-17A in atherogenesis were studied in vitro. Inhibition of IL-17A markedly prevented atherosclerotic lesion progression (p = 0.001) by reducing inflammatory burden and cellular infiltration (p = 0.01) and improved lesion stability (p = 0.01). In vitro experiments showed that IL-17A plays a role in chemoattractance, monocyte adhesion, and sensitization of APCs toward pathogen-derived TLR4 ligands. Also, IL-17A induced a unique transcriptome pattern in monocyte-derived macrophages distinct from known macrophage types. Stimulation of human carotid plaque tissue ex vivo with IL-17A induced a proinflammatory milieu and upregulation of molecules expressed by the IL-17A-induced macrophage subtype. In this study, we show that functional blockade of IL-17A prevents atherosclerotic lesion progression and induces plaque stabilization in advanced lesions in apolipoprotein E-deficient mice. The underlying mechanisms involve reduced inflammation and distinct effects of IL-17A on monocyte/macrophage lineage. In addition, translational experiments underline the relevance for the human system. Copyright © 2014 by The American Association of Immunologists, Inc.

  12. Comparison of altered expression of histocompatibility antigens with altered immune function in murine spleen cells treated with ultraviolet radiation and/or TPA

    International Nuclear Information System (INIS)

    Pretell, J.O.; Cone, R.E.

    1985-01-01

    Previous studies in our laboratory demonstrated that several treatments that inhibited the ability of cells to stimulate the mixed lymphocyte reaction (MLR) also blocked the shedding of histocompatibility antigens and Ia antigens from murine spleen cells. In the present studies, one of these treatments, ultraviolet radiation (UV), was shown to cause an initial loss in the density of H-2K, IA, and IE antigens prior to the block in shedding observed after culture of these cells. Further analysis revealed that the UV-induced loss of antigens could be prevented by the presence of colchicine during irradiation. Biosynthetic analyses revealed the IA antigen synthesis was also inhibited in the UV-irradiated cells. Examination of the effects of a second agent, 12-0-tetradecanoylphorbol-13-acetate (TPA) on the turnover of histocompatibility antigens revealed that the biosynthesis and shedding of these antigens were accelerated by this agent. However, addition of TPA to UV-irradiated cells did not result in a reversal of the UV-induced block in biosynthesis of IA antigens. Results of immune function assays correlated with the biochemical studies: UV-irradiation inhibited the generation of the MLR, but TPA enhanced this reaction, and addition of TPA to mixed lymphocyte cultures with UV-irradiated stimulators did not reverse the UV-induced inhibition. These results suggest that, although the turnover of histocompatibility antigens may be affected by TPA and UV in an antagonistic fashion, additional factors other than the expression of histocompatibility antigens are operating in the inhibition of stimulation of an MLR by UV radiation or its enhancement by TPA

  13. Effects of Trauma-Hemorrhage and IL-6 Deficiency on Splenic Immune Function in a Murine Trauma Model

    Directory of Open Access Journals (Sweden)

    P. Mommsen

    2012-01-01

    Full Text Available Splenic immune function is known to be depressed following hemorrhage. The present study investigates the effects of femoral shaft fracture, isolated or in combination with hemorrhage, on early stage cytokine production capacity of splenocytes and observes the role of IL-6 under these conditions. Male IL-6 knockout (IL-6−/− and wild-type mice (WT were randomly divided into three groups: sham (S, isolated femoral fracture (Fx, and femoral fracture + volume controlled hemorrhage (TH-Fx (=6 per group. Animals were sacrificed four hours after induction of hemorrhage and fracture. Cytokine release (TNF-α, IL-6, and IL-10 of isolated and LPS-stimulated splenocytes was determined by cytometric bead array. Femoral fracture with or without hemorrhage caused a suppression of in vitro cytokine production capacity of splenocytes at an early posttraumatic stage in WT and IL-6−/−. In the absence of IL-6, the profile of splenic cytokine secretion is significantly altered, identifying this cytokine as a potential therapeutic target to modulate the posttraumatic immune response.

  14. Deep-Sea-Derived Butyrolactone I Suppresses Ovalbumin-Induced Anaphylaxis by Regulating Mast Cell Function in a Murine Model.

    Science.gov (United States)

    Liu, Qing-Mei; Xie, Chun-Lan; Gao, Yuan-Yuan; Liu, Bo; Lin, Wei-Xiang; Liu, Hong; Cao, Min-Jie; Su, Wen-Jin; Yang, Xian-Wen; Liu, Guang-Ming

    2018-05-22

    Deep-sea-derived butyrolactone I (BTL-I), which was identified as a type of butanolide, was isolated from Aspergillus sp. Ovalbumin (OVA)-induced BALB/c anaphylaxis was established to explore the antifood allergic activity of BTL-I. As a result, BTL-I was able to alleviate OVA-induced allergy symptoms, reduce the levels of histamine and mouse mast cell proteinases, inhibit OVA-specific IgE, and decrease the population of mast cells in the spleen and mesenteric lymph nodes. BTL-I also significantly suppressed mast-dependent passive cutaneous anaphylaxis. Additionally, the maturation of bone marrow-derived mast cells (BMMCs) declined as BTL-I caused down-regulation of c-KIT receptors. Furthermore, molecular docking analyses revealed that BTL-I interacted with the inhibitory receptor, FcγRIIB. In conclusion, the reduction of mast cell function by deep-sea-derived BTL-I as well as its interactions with the inhibitory receptor, FcγRIIB, may contribute to BTL-I-related protection against food anaphylaxis.

  15. Linking Ventilator Injury-Induced Leak across the Blood-Gas Barrier to Derangements in Murine Lung Function

    Directory of Open Access Journals (Sweden)

    Bradford J. Smith

    2017-07-01

    Full Text Available Mechanical ventilation is vital to the management of acute respiratory distress syndrome, but it frequently leads to ventilator-induced lung injury (VILI. Understanding the pathophysiological processes involved in the development of VILI is an essential prerequisite for improving lung-protective ventilation strategies. The goal of this study was to relate the amount and nature of material accumulated in the airspaces to biomarkers of injury and the derecruitment behavior of the lung in VILI. Forty-nine BALB/c mice were mechanically ventilated with combinations of tidal volume and end-expiratory pressures to produce varying degrees of overdistension and atelectasis while lung function was periodically assessed. Total protein, serum protein, and E-Cadherin levels were measured in bronchoalveolar lavage fluid (BALF. Tissue injury was assessed by histological scoring. We found that both high tidal volume and zero positive end-expiratory pressure were necessary to produce significant VILI. Increased BALF protein content was correlated with increased lung derecruitability, elevated peak pressures, and histological evidence of tissue injury. Blood derived molecules were present in the BALF in proportion to histological injury scores and epithelial injury, reflected by E-Cadherin levels in BALF. We conclude that repetitive recruitment is an important factor in the pathogenesis of VILI that exacerbates injury associated with tidal overdistension. Furthermore, the dynamic mechanical behavior of the injured lung provides a means to assess both the degree of tissue injury and the nature and amount of blood-derived fluid and proteins that accumulate in the airspaces.

  16. The mutational profile and infiltration pattern of murine MLH1-/- tumors: concurrences, disparities and cell line establishment for functional analysis.

    Science.gov (United States)

    Maletzki, Claudia; Beyrich, Franziska; Hühns, Maja; Klar, Ernst; Linnebacher, Michael

    2016-08-16

    Mice lines homozygous negative for one of the four DNA mismatch repair (MMR) genes (MLH1, MSH2, PMS2, MSH6) were generated as models for MMR deficient (MMR-D) diseases. Clinically, hereditary forms of MMR-D include Lynch syndrome (characterized by a germline MMR gene defect) and constitutional MMR-D, the biallelic form. MMR-D knockout mice may be representative for both diseases. Here, we aimed at characterizing the MLH1-/- model focusing on tumor-immune microenvironment and identification of coding microsatellite mutations in lymphomas and gastrointestinal tumors (GIT).All tumors showed microsatellite instability (MSI) in non-coding mononucleotide markers. Mutational profiling of 26 coding loci in MSI+ GIT and lymphomas revealed instability in half of the microsatellites, two of them (Rfc3 and Rasal2) shared between both entities. MLH1-/- tumors of both entities displayed a similar phenotype (high CD71, FasL, PD-L1 and CTLA-4 expression). Additional immunofluorescence verified the tumors' natural immunosuppressive character (marked CD11b/CD200R infiltration). Vice versa, CD3+ T cells as well as immune checkpoints molecules were detectable, indicative for an active immune microenvironment. For functional analysis, a permanent cell line from an MLH1-/- GIT was established. The newly developed MLH1-/- A7450 cells exhibit stable in vitro growth, strong invasive potential and heterogeneous drug response. Moreover, four additional MSI target genes (Nktr1, C8a, Taf1b, and Lig4) not recognized in the primary were identified in this cell line.Summing up, molecular and immunological mechanisms of MLH1-/- driven carcinogenesis correlate well with clinical features of MMR-D. MLH1-/- knockout mice combine characteristics of Lynch syndrome and constitutional MMR-D, making them suitable models for preclinical research aiming at MMR-D related diseases.

  17. Fundación del primer bioterio MPF funcional de Colombia Foundation of a functional murine pathogen free animal facility in Colombia

    Directory of Open Access Journals (Sweden)

    Ómar Vesga

    2003-02-01

    Full Text Available Cualquier investigación donde se experimente con modelos animales exige que el estado microbiológico y genético de los mismos sea definido desde el principio y verificado periódicamente para garantizar la fiabilidad y certeza de los datos. Buscando producir ratones libres de patógenos murinos en Colombia, se importaron 173 reproductores no emparentados suizos albinos de la cepa ICR que se hospedaron bajo condiciones protocolizadas de aislamiento microbiológico en el Bioterio MPF de la Facultad de Medicina de la Universidad de Antioquia. Tras dos años de funcionamiento ininterrumpido, el control microbiológico demostró que los progenitores mantuvieron inalterada la flora con la cual fueron exportados a Colombia, que sus crías portan flora murina idéntica, y que la misma corresponde a la exigida internacionalmente. Diversas pruebas a la integridad de la barrera microbiológica condujeron a la detección y erradicación de un brote infeccioso por Parvovirus murino. El control reproductivo permitió mantener intacta la heterocigocidad de la cepa, denominada Udea:ICR(CD-1. In order to guarantee the accuracy of the data, experimentation with animal models requires well defined microbiological and genetic statuses with periodical verification. To produce murine pathogen free mice, an outbreeding program was set up by importing 173 non-related Swiss albino ICR breeders that were hosted under strict conditions of microbiological isolation in the animal facilities of the University of Antioquia Medical Faculty. After two years of uninterrupted reproduction, microbiological control demonstrated unaltered murine flora for both parents and offspring, the same with which original breeders were dispatched to Colombia, complying with current international standards. An outbreak of Murine Parvovirus (MPV was timely detected and erradicated thanks to strict testing of microbiological barriers. The breeding program allowed the production of animals free

  18. Anatomy and Histology of the Human and Murine Prostate.

    Science.gov (United States)

    Ittmann, Michael

    2018-05-01

    The human and murine prostate glands have similar functional roles in the generation of seminal fluid to assist in reproduction. There are significant differences in the anatomy and histology of murine and human prostate and knowledge of the normal anatomy and histology of the murine prostate is essential to interpreting changes in genetically engineered mouse models. In this review, the normal anatomy and histology of both human and mouse prostate will be described. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  19. Tumor necrosis factor alpha blockade exacerbates murine psoriasis-like disease by enhancing Th17 function and decreasing expansion of Treg cells.

    Science.gov (United States)

    Ma, Hak-Ling; Napierata, Lee; Stedman, Nancy; Benoit, Stephen; Collins, Mary; Nickerson-Nutter, Cheryl; Young, Deborah A

    2010-02-01

    Patients with psoriasis and psoriatic arthritis respond well to tumor necrosis factor alpha (TNFalpha) blockers in general; however, there is now mounting evidence that a small cohort of patients with rheumatoid arthritis who receive TNFalpha blockers develop psoriasis. This study was undertaken to explore the mechanisms underlying TNFalpha blockade-induced exacerbation of skin inflammation in murine psoriasis-like skin disease. Skin inflammation was induced in BALB/c scid/scid mice after they received CD4+CD45RB(high)CD25- (naive CD4) T cells from donor mice. These mice were treated with either anti-interleukin-12 (anti-IL-12)/23p40 antibody or murine TNFRII-Fc fusion protein and were examined for signs of disease, including histologic features, various cytokine levels in the serum, and cytokine or FoxP3 transcripts in the affected skin and draining lymph node (LN) cells. In a separate study, naive CD4+ T cells were differentiated into Th1 or Th17 lineages with anti-CD3/28 magnetic beads and appropriate cytokines in the presence or absence of TNFalpha. Cytokine gene expression from these differentiated cells was also determined. Neutralization of TNFalpha exacerbated skin inflammation and markedly enhanced the expression of the proinflammatory cytokines IL-1beta, IL-6, IL-17, IL-21, and IL-22 but suppressed FoxP3 expression in the skin and reduced the number of FoxP3-positive Treg cells in the draining LNs. TNFalpha also demonstrated a divergent role during priming and reactivation of naive T cells. These results reveal a novel immunoregulatory role of TNFalpha on Th17 and Treg cells in some individuals, which may account for the exacerbation of skin inflammation in some patients who receive anti-TNF treatments.

  20. Signaling pathways regulating murine pancreatic development

    DEFF Research Database (Denmark)

    Serup, Palle

    2012-01-01

    The recent decades have seen a huge expansion in our knowledge about pancreatic development. Numerous lineage-restricted transcription factor genes have been identified and much has been learned about their function. Similarly, numerous signaling pathways important for pancreas development have...... been identified and the specific roles have been investigated by genetic and cell biological methods. The present review presents an overview of the principal signaling pathways involved in regulating murine pancreatic growth, morphogenesis, and cell differentiation....

  1. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  2. Plasma membrane calcium ATPase 4 (PMCA4) co-ordinates calcium and nitric oxide signaling in regulating murine sperm functional activity.

    Science.gov (United States)

    Olli, Kristine E; Li, Kun; Galileo, Deni S; Martin-DeLeon, Patricia A

    2018-01-01

    Reduced sperm motility (asthenospermia) and resulting infertility arise from deletion of the Plasma Membrane Ca 2+ -ATPase 4 (Pmca4) gene which encodes the highly conserved Ca 2+ efflux pump, PMCA4. This is the major Ca 2+ clearance protein in murine sperm. Since the mechanism underlying asthenospermia in PMCA4's absence or reduced activity is unknown, we investigated if sperm PMCA4 negatively regulates nitric oxide synthases (NOSs) and when absent NO, peroxynitrite, and oxidative stress levels are increased. Using co-immunoprecipitation (Co-IP) and Fluorescence Resonance Energy Transfer (FRET), we show an association of PMCA4 with the NOSs in elevated cytosolic [Ca 2+ ] in capacitated and Ca 2+ ionophore-treated sperm and with neuronal (nNOS) at basal [Ca 2+ ] (ucapacitated sperm). FRET efficiencies for PMCA4-eNOS were 35% and 23% in capacitated and uncapacitated sperm, significantly (p < 0.01) different, with the molecules being <10 nm apart. For PMCA4-nNOS, this interaction was seen only for capacitated sperm where FRET efficiency was 24%, significantly (p < 0.05) higher than in uncapacitated sperm (6%). PMCA4 and the NOSs were identified as interacting partners in a quaternary complex that includes Caveolin1, which co-immunoprecipitated with eNOS in a Ca 2+ -dependent manner. In Pmca4 -/- sperm NOS activity was elevated twofold in capacitated/uncapacitated sperm (vs. wild-type), accompanied by a twofold increase in peroxynitrite levels and significantly (p < 0.001) increased numbers of apoptotic germ cells. The data support a quaternary complex model in which PMCA4 co-ordinates Ca 2+ and NO signaling to maintain motility, with increased NO levels resulting in asthenospermia in Pmca4 -/- males. They suggest the involvement of PMCA4 mutations in human asthenospermia, with diagnostic relevance. © 2017 Wiley Periodicals, Inc.

  3. Functional Interplay Between Murine Leukemia Virus Glycogag, Serinc5, and Surface Glycoprotein Governs Virus Entry, with Opposite Effects on Gammaretroviral and Ebolavirus Glycoproteins

    Directory of Open Access Journals (Sweden)

    Yadvinder S. Ahi

    2016-11-01

    Full Text Available Gammaretroviruses, such as murine leukemia viruses (MLVs, encode, in addition to the canonical Gag, Pol, and Env proteins that will form progeny virus particles, a protein called “glycogag” (glycosylated Gag. MLV glycogag contains the entire Gag sequence plus an 88-residue N-terminal extension. It has recently been reported that glycogag, like the Nef protein of HIV-1, counteracts the antiviral effects of the cellular protein Serinc5. We have found, in agreement with prior work, that glycogag strongly enhances the infectivity of MLVs with some Env proteins but not those with others. In contrast, however, glycogag was detrimental to MLVs carrying Ebolavirus glycoprotein. Glycogag could be replaced, with respect to viral infectivity, by the unrelated S2 protein of equine infectious anemia virus. We devised an assay for viral entry in which virus particles deliver the Cre recombinase into cells, leading to the expression of a reporter. Data from this assay showed that both the positive and the negative effects of glycogag and S2 upon MLV infectivity are exerted at the level of virus entry. Moreover, transfection of the virus-producing cells with a Serinc5 expression plasmid reduced the infectivity and entry capability of MLV carrying xenotropic MLV Env, particularly in the absence of glycogag. Conversely, Serinc5 expression abrogated the negative effects of glycogag upon the infectivity and entry capability of MLV carrying Ebolavirus glycoprotein. As Serinc5 may influence cellular phospholipid metabolism, it seems possible that all of these effects on virus entry derive from changes in the lipid composition of viral membranes.

  4. Clonorchis sinensis-derived total protein attenuates airway inflammation in murine asthma model by inducing regulatory T cells and modulating dendritic cell functions

    International Nuclear Information System (INIS)

    Jeong, Young-Il; Kim, Seung Hyun; Ju, Jung Won; Cho, Shin Hyeong; Lee, Won Ja; Park, Jin Wook; Park, Yeong-Min; Lee, Sang Eun

    2011-01-01

    Highlights: → Treatment with Clonorchis sinensis-derived total protein attenuates OVA-induced airway inflammation and AHR to methacholine. → Induction of CD4 + CD25 + Foxp3 + T cells and IL-10 along with suppression of splenocyte proliferation by C. sinensis-derived total protein. → C. sinensis-derived total protein interferes with the expression of co-stimulatory molecules in DCs. -- Abstract: Asthma is characterized by Th2-mediated inflammation, resulting in airway hyperresponsiveness (AHR) through airway remodeling. Recent epidemiological and experimental reports have suggested an inverse relationship between the development of allergy and helminth infections. Infection by Clonorchis sinensis, a liver fluke that resides in the bile duct of humans, is endemic predominantly in Asia including Korea and China. Using a murine model for asthma, we investigated the effects of C. sinensis-derived total protein (Cs-TP) on allergen-induced airway inflammation and the mechanism underlying the protective effects of Cs-TP administration on asthma. Treatment with Cs-TP attenuated OVA-induced airway inflammation and methacholine-induced AHR, as well as eosinophilia development, lymphocyte infiltration into the lung, and goblet cell metaplasia. This protective effect of Cs-TP is associated with markedly reduced OVA-specific IgE and Th1/Th2 cytokine production. Moreover, Cs-TP increased the number of CD4 + CD25 + Foxp3 + regulatory T (Treg) cells as well as their suppressive activity. In fact, proliferation of OVA-restimulated splenocytes was suppressed significantly. Cs-TP also inhibited the expression of such co-stimulatory molecules as CD80, CD86, and CD40 in LPS- or OVA-stimulated dendritic cells (DCs), suggesting that Cs-TP could interfere with the capacity of airway DCs to prime naive T cells. These data demonstrate the capacity of C. sinensis to ameliorate allergic asthma and broaden our understanding of the paradoxical relationship between the allergic immune

  5. Clonorchis sinensis-derived total protein attenuates airway inflammation in murine asthma model by inducing regulatory T cells and modulating dendritic cell functions

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Young-Il [Div. of Malaria and Parasitic Diseases, Korea Centers for Disease Control and Prevention, Osong (Korea, Republic of); Kim, Seung Hyun [Div. of AIDS, National Institute of Health, Korea Centers for Disease Control and Prevention, Osong (Korea, Republic of); Ju, Jung Won; Cho, Shin Hyeong; Lee, Won Ja [Div. of Malaria and Parasitic Diseases, Korea Centers for Disease Control and Prevention, Osong (Korea, Republic of); Park, Jin Wook; Park, Yeong-Min [Dept. of Microbiology and Immunology, College of Medicine, Pusan National University, Yang-San (Korea, Republic of); Lee, Sang Eun, E-mail: ondalgl@cdc.go.kr [Div. of Malaria and Parasitic Diseases, Korea Centers for Disease Control and Prevention, Osong (Korea, Republic of)

    2011-04-22

    Highlights: {yields} Treatment with Clonorchis sinensis-derived total protein attenuates OVA-induced airway inflammation and AHR to methacholine. {yields} Induction of CD4{sup +}CD25{sup +}Foxp3{sup +} T cells and IL-10 along with suppression of splenocyte proliferation by C. sinensis-derived total protein. {yields} C. sinensis-derived total protein interferes with the expression of co-stimulatory molecules in DCs. -- Abstract: Asthma is characterized by Th2-mediated inflammation, resulting in airway hyperresponsiveness (AHR) through airway remodeling. Recent epidemiological and experimental reports have suggested an inverse relationship between the development of allergy and helminth infections. Infection by Clonorchis sinensis, a liver fluke that resides in the bile duct of humans, is endemic predominantly in Asia including Korea and China. Using a murine model for asthma, we investigated the effects of C. sinensis-derived total protein (Cs-TP) on allergen-induced airway inflammation and the mechanism underlying the protective effects of Cs-TP administration on asthma. Treatment with Cs-TP attenuated OVA-induced airway inflammation and methacholine-induced AHR, as well as eosinophilia development, lymphocyte infiltration into the lung, and goblet cell metaplasia. This protective effect of Cs-TP is associated with markedly reduced OVA-specific IgE and Th1/Th2 cytokine production. Moreover, Cs-TP increased the number of CD4{sup +}CD25{sup +}Foxp3{sup +} regulatory T (Treg) cells as well as their suppressive activity. In fact, proliferation of OVA-restimulated splenocytes was suppressed significantly. Cs-TP also inhibited the expression of such co-stimulatory molecules as CD80, CD86, and CD40 in LPS- or OVA-stimulated dendritic cells (DCs), suggesting that Cs-TP could interfere with the capacity of airway DCs to prime naive T cells. These data demonstrate the capacity of C. sinensis to ameliorate allergic asthma and broaden our understanding of the paradoxical

  6. Altered regulation of Akt signaling with murine cerebral malaria, effects on long-term neuro-cognitive function, restoration with lithium treatment.

    Directory of Open Access Journals (Sweden)

    Minxian Dai

    Full Text Available Neurological and cognitive impairment persist in more than 20% of cerebral malaria (CM patients long after successful anti-parasitic treatment. We recently reported that long term memory and motor coordination deficits are also present in our experimental cerebral malaria model (ECM. We also documented, in a murine model, a lack of obvious pathology or inflammation after parasite elimination, suggesting that the long-term negative neurological outcomes result from potentially reversible biochemical and physiological changes in brains of ECM mice, subsequent to acute ischemic and inflammatory processes. Here, we demonstrate for the first time that acute ECM results in significantly reduced activation of protein kinase B (PKB or Akt leading to decreased Akt phosphorylation and inhibition of the glycogen kinase synthase (GSK3β in the brains of mice infected with Plasmodium berghei ANKA (PbA compared to uninfected controls and to mice infected with the non-neurotrophic P. berghei NK65 (PbN. Though Akt activation improved to control levels after chloroquine treatment in PbA-infected mice, the addition of lithium chloride, a compound which inhibits GSK3β activity and stimulates Akt activation, induced a modest, but significant activation of Akt in the brains of infected mice when compared to uninfected controls treated with chloroquine with and without lithium. In addition, lithium significantly reversed the long-term spatial and visual memory impairment as well as the motor coordination deficits which persisted after successful anti-parasitic treatment. GSK3β inhibition was significantly increased after chloroquine treatment, both in lithium and non-lithium treated PbA-infected mice. These data indicate that acute ECM is associated with abnormalities in cell survival pathways that result in neuronal damage. Regulation of Akt/GSK3β with lithium reduces neuronal degeneration and may have neuroprotective effects in ECM. Aberrant regulation of Akt

  7. Alterations in NO- and PGI2- dependent function in aorta in the orthotopic murine model of metastatic 4T1 breast cancer: relationship with pulmonary endothelial dysfunction and systemic inflammation.

    Science.gov (United States)

    Buczek, E; Denslow, A; Mateuszuk, L; Proniewski, B; Wojcik, T; Sitek, B; Fedorowicz, A; Jasztal, A; Kus, E; Chmura-Skirlinska, A; Gurbiel, R; Wietrzyk, J; Chlopicki, S

    2018-05-22

    Patients with cancer develop endothelial dysfunction and subsequently display a higher risk of cardiovascular events. The aim of the present work was to examine changes in nitric oxide (NO)- and prostacyclin (PGI 2 )-dependent endothelial function in the systemic conduit artery (aorta), in relation to the formation of lung metastases and to local and systemic inflammation in a murine orthotopic model of metastatic breast cancer. BALB/c female mice were orthotopically inoculated with 4T1 breast cancer cells. Development of lung metastases, lung inflammation, changes in blood count, systemic inflammatory response (e.g. SAA, SAP and IL-6), as well as changes in NO- and PGI 2 -dependent endothelial function in the aorta, were examined 2, 4, 5 and 6 weeks following cancer cell transplantation. As early as 2 weeks following transplantation of breast cancer cells, in the early metastatic stage, lungs displayed histopathological signs of inflammation, NO production was impaired and nitrosylhemoglobin concentration in plasma was decreased. After 4 to 6 weeks, along with metastatic development, progressive leukocytosis and systemic inflammation (as seen through increased SAA, SAP, haptoglobin and IL-6 plasma concentrations) were observed. Six weeks following cancer cell inoculation, but not earlier, endothelial dysfunction in aorta was detected; this involved a decrease in basal NO production and a decrease in NO-dependent vasodilatation, that was associated with a compensatory increase in cyclooxygenase-2 (COX-2)- derived PGI 2 production. In 4 T1 metastatic breast cancer in mice early pulmonary metastasis was correlated with lung inflammation, with an early decrease in pulmonary as well as systemic NO availability. Late metastasis was associated with robust, cancer-related, systemic inflammation and impairment of NO-dependent endothelial function in the aorta that was associated with compensatory upregulation of the COX-2-derived PGI 2 pathway.

  8. Functional analysis of the RAD50/MRE11 protein complex through targeted disruption of the murine RAD50 genomic locus: implications for DNA double strand break repair. An astro research fellowship presentation

    International Nuclear Information System (INIS)

    Yao, Michelle S.; Bladl, Anthony R.; Petrini, John H.J.

    1997-01-01

    Purpose/Objective: The products of the S. cerevisiae genes ScRAD50 and ScMRE11 act in a protein complex and are required for non-homologous end-joining, the predominant mechanism of DNA double strand break (dsb) repair in mammalian cells. Mutation of these genes results in sensitivity to ionizing radiation (IR), a defect in initiation of meiosis, increased and error-prone recombination during mitosis, and overall genomic instability. This resultant phenotype is reminiscent of that seen in mammalian syndromes of genomic instability such as ataxia-telangiectasia and Bloom syndrome, hallmarks of which are radiation sensitivity and predisposition to malignancy. The murine homologues to ScRAD50 and ScMRE11 have recently been identified; both demonstrate impressive primary sequence conservation with their yeast counterparts, and are expected to mediate conserved functions. The roles of muRAD50 in genomic maintenance and in dsb repair will be examined in two parts. The first will include a determination of normal muRAD50 expression patterns. Second, the effects of disruption of the muRAD50 gene will be assessed. A specific targeting event has introduced a conditional murad50 null mutation into the genome of murine embryonic stem (ES) cells. These mutant ES cells are being used to create mutant mice, thus allowing functional characterization of muRAD50 on both the cellular and organismic levels. Such analyses will contribute to the delineation of the mammalian dsb repair pathway and to the cellular response to IR, and will serve as a mammalian model system for genomic instability. Materials and Methods: Wild-type tissue expression patterns and protein-protein interactions were determined by standard biochemical techniques, including immunoprecipitation, polyacrylamide gel electrophoresis, and Western blotting. Molecular cloning techniques were used to create the gene targeting vectors, which were designed to result in either a deletion of exon 1 (equivalent to a null

  9. Over-expression of mitochondrial creatine kinase in the murine heart improves functional recovery and protects against injury following ischaemia-reperfusion.

    Science.gov (United States)

    Whittington, Hannah J; Ostrowski, Philip J; McAndrew, Debra J; Cao, Fang; Shaw, Andrew; Eykyn, Thomas R; Lake, Hannah; Tyler, Jack; Schneider, Jurgen E; Neubauer, Stefan; Zervou, Sevasti; Lygate, Craig A

    2018-03-02

    Mitochondrial creatine kinase (MtCK) couples ATP production via oxidative phosphorylation to phosphocreatine in the cytosol, which acts as a mobile energy store available for regeneration of ATP at times of high demand. We hypothesised that elevating MtCK would be beneficial in ischaemia-reperfusion (I/R) injury. Mice were created overexpressing the sarcomeric MtCK gene with αMHC promoter at the Rosa26 locus (MtCK-OE) and compared with wild-type (WT) littermates. MtCK activity was 27% higher than WT, with no change in other CK isoenzymes or creatine levels. Electron microscopy confirmed normal mitochondrial cell density and mitochondrial localisation of transgenic protein. Respiration in isolated mitochondria was unaltered and metabolomic analysis by 1H-NMR suggests that cellular metabolism was not grossly affected by transgene expression. There were no significant differences in cardiac structure or function under baseline conditions by cine-MRI or LV haemodynamics. In Langendorff-perfused hearts subjected to 20min ischaemia and 30 min reperfusion, MtCK-OE exhibited less ischaemic contracture and improved functional recovery (Rate pressure product 58% above WT; P < 0.001). These hearts had reduced myocardial infarct size, which was confirmed in vivo: 55±4% in WT vs 29±4% in MtCK-OE; P < 0.0001). Isolated cardiomyocytes from MtCK-OE hearts exhibited delayed opening of the mitochondrial permeability transition pore (mPTP) compared to WT, which was confirmed by reduced mitochondrial swelling in response to calcium. There was no detectable change in the structural integrity of the mitochondrial membrane. Modest elevation of MtCK activity in the heart does not adversely affect cellular metabolism, mitochondrial or in vivo cardiac function, but modifies mPTP opening to protect against I/R injury and improve functional recovery. Our findings support MtCK as a prime therapeutic target in myocardial ischaemia.

  10. Improvement of cardiac contractile function by peptide-based inhibition of NF-κB in the utrophin/dystrophin-deficient murine model of muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Guttridge Denis C

    2011-05-01

    Full Text Available Abstract Background Duchenne muscular dystrophy (DMD is an inherited and progressive disease causing striated muscle deterioration. Patients in their twenties generally die from either respiratory or cardiac failure. In order to improve the lifespan and quality of life of DMD patients, it is important to prevent or reverse the progressive loss of contractile function of the heart. Recent studies by our labs have shown that the peptide NBD (Nemo Binding Domain, targeted at blunting Nuclear Factor κB (NF-κB signaling, reduces inflammation, enhances myofiber regeneration, and improves contractile deficits in the diaphragm in dystrophin-deficient mdx mice. Methods To assess whether cardiac function in addition to diaphragm function can be improved, we investigated physiological and histological parameters of cardiac muscle in mice deficient for both dystrophin and its homolog utrophin (double knockout = dko mice treated with NBD peptide. These dko mice show classic pathophysiological hallmarks of heart failure, including myocyte degeneration, an impaired force-frequency response and a severely blunted β-adrenergic response. Cardiac contractile function at baseline and frequencies and pre-loads throughout the in vivo range as well as β-adrenergic reserve was measured in isolated cardiac muscle preparations. In addition, we studied histopathological and inflammatory markers in these mice. Results At baseline conditions, active force development in cardiac muscles from NBD treated dko mice was more than double that of vehicle-treated dko mice. NBD treatment also significantly improved frequency-dependent behavior of the muscles. The increase in force in NBD-treated dko muscles to β-adrenergic stimulation was robustly restored compared to vehicle-treated mice. However, histological features, including collagen content and inflammatory markers were not significantly different between NBD-treated and vehicle-treated dko mice. Conclusions We conclude

  11. Functional and Biochemical Endothelial Profiling In Vivo in a Murine Model of Endothelial Dysfunction; Comparison of Effects of 1-Methylnicotinamide and Angiotensin-converting Enzyme Inhibitor

    Science.gov (United States)

    Bar, Anna; Olkowicz, Mariola; Tyrankiewicz, Urszula; Kus, Edyta; Jasinski, Krzysztof; Smolenski, Ryszard T.; Skorka, Tomasz; Chlopicki, Stefan

    2017-01-01

    Although it is known that 1-methylnicotinamide (MNA) displays vasoprotective activity in mice, as yet the effect of MNA on endothelial function has not been demonstrated in vivo. Here, using magnetic resonance imaging (MRI) we profile the effects of MNA on endothelial phenotype in mice with atherosclerosis (ApoE/LDLR-/-) in vivo, in comparison to angiotensin (Ang) -converting enzyme (ACE) inhibitor (perindopril), with known vasoprotective activity. On a biochemical level, we analyzed whether MNA- or perindopril-induced improvement in endothelial function results in changes in ACE/Ang II-ACE2/Ang-(1–7) balance, and L-arginine/asymmetric dimethylarginine (ADMA) ratio. Endothelial function and permeability were evaluated in the brachiocephalic artery (BCA) in 4-month-old ApoE/LDLR-/- mice that were non-treated or treated for 1 month or 2 months with either MNA (100 mg/kg/day) or perindopril (10 mg/kg/day). The 3D IntraGate®FLASH sequence was used for evaluation of BCA volume changes following acetylcholine (Ach) administration, and for relaxation time (T1) mapping around BCA to assess endothelial permeability using an intravascular contrast agent. Activity of ACE/Ang II and ACE2/Ang-(1–7) pathways as well as metabolites of L-arginine/ADMA pathway were measured using liquid chromatography/mass spectrometry-based methods. In non-treated 6-month-old ApoE/LDLR-/- mice, Ach induced a vasoconstriction in BCA that amounted to –7.2%. 2-month treatment with either MNA or perindopril resulted in the reversal of impaired Ach-induced response to vasodilatation (4.5 and 5.5%, respectively) and a decrease in endothelial permeability (by about 60% for MNA-, as well as perindopril-treated mice). Improvement of endothelial function by MNA and perindopril was in both cases associated with the activation of ACE2/Ang-(1–7) and the inhibition of ACE/Ang II axes as evidenced by an approximately twofold increase in Ang-(1–9) and Ang-(1–7) and a proportional decrease in Ang II

  12. Biodistribution and Pharmacokinetics Study of siRNA-loaded Anti-NTSR1-mAb-functionalized Novel Hybrid Nanoparticles in a Metastatic Orthotopic Murine Lung Cancer Model

    Directory of Open Access Journals (Sweden)

    Maryna Perepelyuk

    2016-01-01

    Full Text Available Small interfering RNA (siRNA is effective in silencing critical molecular pathways in cancer. The use of this tool as a treatment modality is limited by lack of an intelligent carrier system to enhance the preferential delivery of this molecule to specific targets in vivo. In the present study, the in vivo behavior of novel anti-NTSR1-mAb-functionalized antimutant K-ras siRNA-loaded hybrid nanoparticles, delivered by i.p. injection to non-small-cell lung cancer in mice models, was investigated and compared to that of a naked siRNA formulation. The siRNA in anti-NTSR1-mAb-functionalized hybrid nanoparticles was preferentially accumulated in tumor-bearing lungs and metastasized tumor for at least 48 hours while the naked siRNA formulation showed lack of preferential accumulation in all of the organs monitored. The plasma terminal half-life of nanoparticle-delivered siRNA was 11 times higher (17–1.5 hours than that of the naked siRNA formulation. The mean residence time and AUClast were 3.4 and 33 times higher than the corresponding naked siRNA formulation, respectively. High-performance liquid chromatography analysis showed that the hybrid nanoparticle carrier system protected the encapsulated siRNA against degradation in vivo. Our novel anti-NTSR1-mAb-functionalized hybrid nanoparticles provide a useful platform for in vivo targeting of siRNA for both experimental and clinical purposes.

  13. A method for high purity intestinal epithelial cell culture from adult human and murine tissues for the investigation of innate immune function.

    Science.gov (United States)

    Graves, Christina L; Harden, Scott W; LaPato, Melissa; Nelson, Michael; Amador, Byron; Sorenson, Heather; Frazier, Charles J; Wallet, Shannon M

    2014-12-01

    Intestinal epithelial cells (IECs) serve as an important physiologic barrier between environmental antigens and the host intestinal immune system. Thus, IECs serve as a first line of defense and may act as sentinel cells during inflammatory insults. Despite recent renewed interest in IEC contributions to host immune function, the study of primary IEC has been hindered by lack of a robust culture technique, particularly for small intestinal and adult tissues. Here, a novel adaptation for culture of primary IEC is described for human duodenal organ donor tissue as well as duodenum and colon of adult mice. These epithelial cell cultures display characteristic phenotypes and are of high purity. In addition, the innate immune function of human primary IEC, specifically with regard to Toll-like receptor (TLR) expression and microbial ligand responsiveness, is contrasted with a commonly used intestinal epithelial cell line (HT-29). Specifically, TLR expression at the mRNA level and production of cytokine (IFNγ and TNFα) in response to TLR agonist stimulation is assessed. Differential expression of TLRs as well as innate immune responses to ligand stimulation is observed in human-derived cultures compared to that of HT-29. Thus, use of this adapted method to culture primary epithelial cells from adult human donors and from adult mice will allow for more appropriate studies of IECs as innate immune effectors. Published by Elsevier B.V.

  14. Colon-targeted delivery of cyclosporine A using dual-functional Eudragit® FS30D/PLGA nanoparticles ameliorates murine experimental colitis.

    Science.gov (United States)

    Naeem, Muhammad; Bae, Junhwan; Oshi, Murtada A; Kim, Min-Soo; Moon, Hyung Ryong; Lee, Bok Luel; Im, Eunok; Jung, Yunjin; Yoo, Jin-Wook

    2018-01-01

    Colon-targeted oral nanoparticles (NPs) have emerged as an ideal, safe, and effective therapy for ulcerative colitis (UC) owing to their ability to selectively accumulate in inflamed colonic mucosa. Cyclosporine A (CSA), an immunosuppressive agent, has long been used as rescue therapy in severe steroid-refractory UC. In this study, we developed CSA-loaded dual-functional polymeric NPs composed of Eudragit ® FS30D as a pH-sensitive polymer for targeted delivery to the inflamed colon, and poly(lactic-co-glycolic acid) (PLGA) as a sustained-release polymer. CSA-loaded Eudragit FS30D nanoparticles (ENPs), PLGA nanoparticles (PNPs), and Eudragit FS30D/PLGA nanoparticles (E/PNPs) were prepared using the oil-in-water emulsion method. Scanning electron microscope images and zeta size data showed successful preparation of CSA-loaded NPs. PNPs exhibited a burst drug release of >60% at pH 1.2 (stomach pH) in 0.5 h, which can lead to unwanted systemic absorption and side effects. ENPs effectively inhibited the burst drug release at pH 1.2 and 6.8 (proximal small intestine pH); however, nearly 100% of the CSA in ENPs was released rapidly at pH 7.4 (ileum-colon pH) owing to complete NP dissolution. In contrast to single-functional PNPs and ENPs, the dual-functional E/PNPs minimized burst drug release (only 18%) at pH 1.2 and 6.8, and generated a sustained release at pH 7.4 thereafter. Importantly, in distribution studies in the gastrointestinal tracts of mice, E/PNPs significantly improved CSA distribution to the colon compared with PNPs or ENPs. In a mouse model of colitis, E/PNP treatment improved weight loss and colon length, and decreased rectal bleeding, spleen weight, histological scoring, myeloperoxidase activity, macrophage infiltration, and expression of proinflammatory cytokines compared with PNPs or ENPs. Overall, this work confirms the benefits of CSA-loaded E/PNPs for efficiently delivering CSA to the colon, suggesting their potential for UC therapy.

  15. Ecotropic murine leukemia virus-induced fusion of murine cells

    International Nuclear Information System (INIS)

    Pinter, A.; Chen, T.; Lowy, A.; Cortez, N.G.; Silagi, S.

    1986-01-01

    Extensive fusion occurs upon cocultivation of murine fibroblasts producing ecotropic murine leukemia viruses (MuLVs) with a large variety of murine cell lines in the presence of the polyene antibiotic amphotericin B, the active component of the antifungal agent Fungizone. The resulting polykaryocytes contain nuclei from both infected and uninfected cells, as evidenced by autoradiographic labeling experiments in which one or the other parent cell type was separately labeled with [ 3 H]thymidine and fused with an unlabeled parent. This cell fusion specifically requires the presence of an ecotropic MuLV-producing parent and is not observed for cells producing xenotropic, amphotropic, or dualtropic viruses. Mouse cells infected with nonecotropic viruses retain their sensitivity toward fusion, whereas infection with ecotropic viruses abrogates the fusion of these cells upon cocultivation with other ecotropic MuLV-producing cells. Nonmurine cells lacking the ecotropic gp70 receptor are not fused under similar conditions. Fusion is effectively inhibited by monospecific antisera to gp70, but not by antisera to p15(E), and studies with monoclonal antibodies identify distinct amino- and carboxy-terminal gp70 regions which play a role in the fusion reaction. The enhanced fusion which occurs in the presence of amphotericin B provides a rapid and sensitive assay for the expression of ecotropic MuLVs and should facilitate further mechanistic studies of MuLV-induced fusion of murine cells

  16. E3L and F1L Gene Functions Modulate the Protective Capacity of Modified Vaccinia Virus Ankara Immunization in Murine Model of Human Smallpox

    Directory of Open Access Journals (Sweden)

    Asisa Volz

    2018-01-01

    Full Text Available The highly attenuated Modified Vaccinia virus Ankara (MVA lacks most of the known vaccinia virus (VACV virulence and immune evasion genes. Today MVA can serve as a safety-tested next-generation smallpox vaccine. Yet, we still need to learn about regulatory gene functions preserved in the MVA genome, such as the apoptosis inhibitor genes F1L and E3L. Here, we tested MVA vaccine preparations on the basis of the deletion mutant viruses MVA-ΔF1L and MVA-ΔE3L for efficacy against ectromelia virus (ECTV challenge infections in mice. In non-permissive human tissue culture the MVA deletion mutant viruses produced reduced levels of the VACV envelope antigen B5. Upon mousepox challenge at three weeks after vaccination, MVA-ΔF1L and MVA-ΔE3L exhibited reduced protective capacity in comparison to wildtype MVA. Surprisingly, however, all vaccines proved equally protective against a lethal ECTV infection at two days after vaccination. Accordingly, the deletion mutant MVA vaccines induced high levels of virus-specific CD8+ T cells previously shown to be essential for rapidly protective MVA vaccination. These results suggest that inactivation of the anti-apoptotic genes F1L or E3L modulates the protective capacity of MVA vaccination most likely through the induction of distinct orthopoxvirus specific immunity in the absence of these viral regulatory proteins.

  17. Phenotypic and functional properties of murine thymocytes. II. Quantitation of host- and donor-derived cytolytic T lymphocyte precursors in regenerating radiation bone marrow chimeras

    International Nuclear Information System (INIS)

    Ceredig, R.; McDonald, H.R.

    1982-01-01

    Thymocytes from radiation bone marrow chimeras, in which donor bone marrow and irradiated recipient differed at the Thy-1 locus, were stained by indirect immunofluorescence with monoclonal anti-Thy-1 antibodies and analyzed by flow microfluorometry (FMF). Kinetic studies indicated an early appearance of host-derived (CBA, Thy-1.2 + ) thymocytes, which reaches maximum number of 10 to 20 x 10 6 cells at 12 to 16 days after bone marrow reconstitution. Donor-derived (AKR, Thy-1.1 + ) cells were not detectable until 10 to 12 days after reconstitution; subsequently, they increased exponentially in number until 28 days, when they accounted for essentially all cells in the thymus (50 x 10 6 ). Concomitant with the appearance and disappearance of host-derived cells was a change in their Thy-1 surface phenotype. In particular, the proportion of host cells having a ''mature'' phenotype (weakly Thy-1.2 staining) increased progressively with time after irradiation. Functional studies using a sensitive mixed leukocyte microculture system to quantitate cytolytic T lymphocyte precursors (CTL-P) were also carried out in regenerating chimeric thymuses. Initially, the regenerating thymus contained few CTL-P, but by 4 wk after reconstitution, frequencies similar to control adult thymuses were obtained. Analysis of the CTL-P content of host and donor-derived subpopulations, separated either by appropriate anti-Thy-1 antibody plus complement or by direct cell sorting, indicated that both host- and donor-derived cells contained appreciable numbers of CTL-P. Furthermore, increases in CTL-P frequency of both host and donor subpopulations correlated with changes in their surface Thy-1 phenotype

  18. Phenotypic and functional properties of murine thymocytes. II. Quantitation of host- and donor-derived cytolytic T lymphocyte precursors in regenerating radiation bone marrow chimeras

    Energy Technology Data Exchange (ETDEWEB)

    Ceredig, R.; McDonald, H.R.

    1982-02-01

    Thymocytes from radiation bone marrow chimeras, in which donor bone marrow and irradiated recipient differed at the Thy-1 locus, were stained by indirect immunofluorescence with monoclonal anti-Thy-1 antibodies and analyzed by flow microfluorometry (FMF). Kinetic studies indicated an early appearance of host-derived (CBA, Thy-1.2/sup +/) thymocytes, which reaches maximum number of 10 to 20 x 10/sup 6/ cells at 12 to 16 days after bone marrow reconstitution. Donor-derived (AKR, Thy-1.1/sup +/) cells were not detectable until 10 to 12 days after reconstitution; subsequently, they increased exponentially in number until 28 days, when they accounted for essentially all cells in the thymus (50 x 10/sup 6/). Concomitant with the appearance and disappearance of host-derived cells was a change in their Thy-1 surface phenotype. In particular, the proportion of host cells having a ''mature'' phenotype (weakly Thy-1.2 staining) increased progressively with time after irradiation. Functional studies using a sensitive mixed leukocyte microculture system to quantitate cytolytic T lymphocyte precursors (CTL-P) were also carried out in regenerating chimeric thymuses. Initially, the regenerating thymus contained few CTL-P, but by 4 wk after reconstitution, frequencies similar to control adult thymuses were obtained. Analysis of the CTL-P content of host and donor-derived subpopulations, separated either by appropriate anti-Thy-1 antibody plus complement or by direct cell sorting, indicated that both host- and donor-derived cells contained appreciable numbers of CTL-P. Furthermore, increases in CTL-P frequency of both host and donor subpopulations correlated with changes in their surface Thy-1 phenotype.

  19. Intravaginal infection with herpes simplex virus type-2 (HSV-2) generates a functional effector memory T cell population that persists in the murine genital tract.

    Science.gov (United States)

    Tang, Vera A; Rosenthal, Kenneth L

    2010-12-01

    Although the female genital tract is the main portal of entry for sexually transmitted infections in women, we still have limited understanding of the generation, maintenance and characteristics of memory T cells in the local tissue. Here, we utilized a mouse model of intravaginal HSV-2 infection and tetramers against the immunodominant HSV glycoprotein B epitope recognized by CD8+ T cells to examine the generation, maintenance and characteristics of anti-HSV memory T cells in the genital tract following acute infection. Our results show that the highest percentage of HSVgB-specific CD8+ T cells was found in the genital tract compared to the spleen or iliac lymphnode. Indeed, although the actual number of CD8+ T cells contracted following viral clearance, approximately one quarter of the CD8+ population that remained in the genital tissue was HSVgB-specific. Memory gB-tetramer+CD8 T cells in the genital tract were positive for CD127 and KLRG1 and negative for CD62L and CCR7, thus confirming that HSV-specific CD8 cells were effector memory T cells that lack the capacity for homing to lymphoid tissues. Functionally, both memory CD8+ and CD4+ HSV-specific populations in the genital tract produced IFNγ when stimulated in vitro and CD4+ cells also produced TNFα. Genital HSVgB-specific memory T cells expressed tissue-homing integrins CD103 (αE integrin) and CD49a (VLA-1 or α1 integrin). Our findings suggest that HSV-specific memory T cells are retained in the genital tract, poised to act as an early line of defense against future virus encounter. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  20. Adeno-associated Virus Serotype 9 - Driven Expression of BAG3 Improves Left Ventricular Function in Murine Hearts with Left Ventricular Dysfunction Secondary to a Myocardial Infarction.

    Science.gov (United States)

    Knezevic, Tijana; Myers, Valerie D; Su, Feifei; Wang, JuFang; Song, Jianliang; Zhang, Xue-Qian; Gao, Erhe; Gao, Guofeng; Muniswamy, Madesh; Gupta, Manish K; Gordon, Jennifer; Weiner, Kristen N; Rabinowitz, Joseph; Ramsey, Frederick V; Tilley, Douglas G; Khalili, Kamel; Cheung, Joseph Y; Feldman, Arthur M

    2016-12-01

    The present study was undertaken to test the hypothesis that gene delivery of BCL2-Associated Athanogene 3 (BAG3) to the heart of mice with left ventricular dysfunction secondary to a myocardial infarction could enhance cardiac performance. BAG3 is a 575 amino acid protein that has pleotropic functions in the cell including pro-autophagy and anti-apoptosis. Mutations in BAG3 have been associated with both skeletal muscle dysfunction and familial dilated cardiomyopathy and BAG3 levels are diminished in non-familial heart failure. Eight-week-old C57/BL6 mice underwent ligation of the left coronary artery (MI) or sham surgery (Sham). Eight weeks later, mice in both groups were randomly assigned to receive either a retro-orbital injection of rAAV9-BAG3 (MI-BAG3 or Sham-BAG3) or rAAV9-GFP (MI-GFP or Sham GFP). Mice were sacrificed at 3 weeks post-injection and myocytes were isolated from the left ventricle. MI-BAG3 mice demonstrated a significantly (p BAG3 injection with further improvement in LVEF, fractional shortening and stroke volume at 3 weeks post-injection without changes in LV mass or LV volume. Injection of rAAV9-BAG3 had no effect on LVEF in Sham mice. The salutary benefits of rAAV9-BAG3 were also observed in myocytes isolated from MI hearts including improved cell shortening (pBAG3 gene therapy may provide a novel therapeutic option for the treatment of heart failure.

  1. Adeno-associated Virus Serotype 9 – Driven Expression of BAG3 Improves Left Ventricular Function in Murine Hearts with Left Ventricular Dysfunction Secondary to a Myocardial Infarction

    Science.gov (United States)

    Knezevic, Tijana; Myers, Valerie D.; Su, Feifei; Wang, JuFang; Song, Jianliang; Zhang, Xue-Qian; Gao, Erhe; Gao, Guofeng; Muniswamy, Madesh; Gupta, Manish K.; Gordon, Jennifer; Weiner, Kristen N.; Rabinowitz, Joseph; Ramsey, Frederick V.; Tilley, Douglas G.; Khalili, Kamel; Cheung, Joseph Y.; Feldman, Arthur M.

    2016-01-01

    Objectives The present study was undertaken to test the hypothesis that gene delivery of BCL2-Associated Athanogene 3 (BAG3) to the heart of mice with left ventricular dysfunction secondary to a myocardial infarction could enhance cardiac performance. Background BAG3 is a 575 amino acid protein that has pleotropic functions in the cell including pro-autophagy and anti-apoptosis. Mutations in BAG3 have been associated with both skeletal muscle dysfunction and familial dilated cardiomyopathy and BAG3 levels are diminished in non-familial heart failure. Methods Eight-week-old C57/BL6 mice underwent ligation of the left coronary artery (MI) or sham surgery (Sham). Eight weeks later, mice in both groups were randomly assigned to receive either a retro-orbital injection of rAAV9-BAG3 (MI-BAG3 or Sham-BAG3) or rAAV9-GFP (MI-GFP or Sham GFP). Mice were sacrificed at 3 weeks post-injection and myocytes were isolated from the left ventricle. Results MI-BAG3 mice demonstrated a significantly (p BAG3 injection with further improvement in LVEF, fractional shortening and stroke volume at 3 weeks post-injection without changes in LV mass or LV volume. Injection of rAAV9-BAG3 had no effect on LVEF in Sham mice. The salutary benefits of rAAV9-BAG3 were also observed in myocytes isolated from MI hearts including improved cell shortening (pBAG3 gene therapy may provide a novel therapeutic option for the treatment of heart failure. PMID:28164169

  2. Flt3 ligand-eGFP-reporter expression characterizes functionally distinct subpopulations of CD150+ long-term repopulating murine hematopoietic stem cells.

    Science.gov (United States)

    Tornack, Julia; Kawano, Yohei; Garbi, Natalio; Hämmerling, Günter J; Melchers, Fritz; Tsuneto, Motokazu

    2017-09-01

    The pool of hematopoietic stem cells (HSCs) in the bone marrow is a mixture of resting, proliferating, and differentiating cells. Long-term repopulating HSCs (LT-HSC) are routinely enriched as Lin - Sca1 + c-Kit + CD34 - Flt3 - CD150 + CD48 - cells. The Flt3 ligand (Flt3L) and its receptor Flt3 are important regulators of HSC maintenance, expansion and differentiation. Using Flt3L-eGFP reporter mice, we show that endogenous Flt3L-eGFP-reporter RNA expression correlates with eGFP-protein expression. This Flt3L-eGFP-reporter expression distinguishes two LT-HSC populations with differences in gene expressions and reconstituting potential. Thus, Flt3L-eGFP-reporter low cells are identified as predominantly resting HSCs with long-term repopulating capacities. In contrast, Flt3L-eGFP-reporter high cells are in majority proliferating HSCs with only short-term repopulating capacities. Flt3L-eGFP-reporter low cells express hypoxia, autophagy-inducing, and the LT-HSC-associated genes HoxB5 and Fgd5, while Flt3L-eGFP-reporter high HSCs upregulate genes involved in HSC differentiation. Flt3L-eGFP-reporter low cells develop to Flt3L-eGFP-reporter high cells in vitro, although Flt3L-eGFP-reporter high cells remain Flt3L-eGFP-reporter high . CD150 + Flt3L-eGFP-reporter low cells express either endothelial protein C receptor (EPCR) or CD41, while Flt3L-eGFP-reporter high cells do express EPCR but not CD41. Thus, FACS-enrichment of Flt3/ Flt3L-eGFP-reporter negative, Lin - CD150 + CD48 - EPCR + CD41 + HSCs allows a further 5-fold enrichment of functional LT-HSCs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. ImmunoPET Imaging of Murine CD4+ T Cells Using Anti-CD4 Cys-Diabody: Effects of Protein Dose on T Cell Function and Imaging.

    Science.gov (United States)

    Freise, Amanda C; Zettlitz, Kirstin A; Salazar, Felix B; Lu, Xiang; Tavaré, Richard; Wu, Anna M

    2017-08-01

    Molecular imaging of CD4 + T cells throughout the body has implications for monitoring autoimmune disease and immunotherapy of cancer. Given the key role of these cells in regulating immunity, it is important to develop a biologically inert probe. GK1.5 cys-diabody (cDb), a previously developed anti-mouse CD4 antibody fragment, was tested at different doses to assess its effects on positron emission tomography (PET) imaging and CD4 + T cell viability, proliferation, CD4 expression, and function. The effect of protein dose on image contrast (lymphoid tissue-to-muscle ratio) was assessed by administering different amounts of 89 Zr-labeled GK1.5 cDb to mice followed by PET imaging and ex vivo biodistribution analysis. To assess impact of GK1.5 cDb on T cell biology, GK1.5 cDb was incubated with T cells in vitro or administered intravenously to C57BL/6 mice at multiple protein doses. CD4 expression and T cell proliferation were analyzed with flow cytometry and cytokines were assayed. For immunoPET imaging, the lowest protein dose of 2 μg of 89 Zr-labeled GK1.5 cDb resulted in significantly higher % injected dose/g in inguinal lymph nodes (ILN) and spleen compared to the 12-μg protein dose. In vivo administration of GK1.5 cDb at the high dose of 40 μg caused a transient decrease in CD4 expression in spleen, blood, lymph nodes, and thymus, which recovered within 3 days postinjection; this effect was reduced, although not abrogated, when 2 μg was administered. Proliferation was inhibited in vivo in ILN but not the spleen by injection of 40 μg GK1.5 cDb. Concentrations of GK1.5 cDb in excess of 25 nM significantly inhibited CD4 + T cell proliferation and interferon-γ production in vitro. Overall, using low-dose GK1.5 cDb minimized biological effects on CD4 + T cells. Low-dose GK1.5 cDb yields high-contrast immunoPET images with minimal effects on T cell biology in vitro and in vivo and may be a useful tool for investigating CD4 + T cells in the context of

  4. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes Internalin A for enhanced infectivity in the murine oral infection model

    LENUS (Irish Health Repository)

    Monk, Ian R

    2010-12-13

    Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human

  5. Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model

    Directory of Open Access Journals (Sweden)

    Hill Colin

    2010-12-01

    Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced

  6. Topical Apigenin Alleviates Cutaneous Inflammation in Murine Models

    Directory of Open Access Journals (Sweden)

    Mao-Qiang Man

    2012-01-01

    Full Text Available Herbal medicines have been used in preventing and treating skin disorders for centuries. It has been demonstrated that systemic administration of chrysanthemum extract exhibits anti-inflammatory properties. However, whether topical applications of apigenin, a constituent of chrysanthemum extract, influence cutaneous inflammation is still unclear. In the present study, we first tested whether topical applications of apigenin alleviate cutaneous inflammation in murine models of acute dermatitis. The murine models of acute allergic contact dermatitis and acute irritant contact dermatitis were established by topical application of oxazolone and phorbol 12-myristate 13-acetate (TPA, respectively. Inflammation was assessed in both dermatitis models by measuring ear thickness. Additionally, the effect of apigenin on stratum corneum function in a murine subacute allergic contact dermatitis model was assessed with an MPA5 physiology monitor. Our results demonstrate that topical applications of apigenin exhibit therapeutic effects in both acute irritant contact dermatitis and allergic contact dermatitis models. Moreover, in comparison with the vehicle treatment, topical apigenin treatment significantly reduced transepidermal water loss, lowered skin surface pH, and increased stratum corneum hydration in a subacute murine allergic contact dermatitis model. Together, these results suggest that topical application of apigenin could provide an alternative regimen for the treatment of dermatitis.

  7. Imported rickettsioses : think of murine typhus

    NARCIS (Netherlands)

    van der Kleij, FGH; Gansevoort, RT; Kreeftenberg, HG

    Murine typhus is a disease still prevalent in many parts of the world. Because the incidence in the US and Europe has declined rapidly, physicians in these continents have become unfamiliar with the clinical picture. Murine typhus is associated with significant morbidity and fatalities do occur,

  8. Reproductive survival and hypoxic protection as a function of radiation ionization density. Further studies with murine leukemia cells irradiated in vitro with monoenergetic accelerated charged particles and assayed in vivo

    International Nuclear Information System (INIS)

    Berry, R.J.

    1977-01-01

    Murine lymphocytic leukemia P-388 cells have been irradiated in vitro under aerobic or hypoxic conditions with monoenergetic track segments of beams of accelerated helium or boron ions, and survival of their reproductive capacity assessed in vivo. These cells showed a maximum cell killing per rad at a relatively low ionization density (ca. 60--80 keV/μm) and their response ceased to depend on the presence or absence of oxygen at all LET values above ea. 100 keV/μm. This is similar to the LET dependence of cell killing reported recently for human lymphocytes which die a nonreproductive interphase death, and differs from the response of human kidney-derived cells which have been studied in vitro by other workers. The significance of these differences in predicting the response of cells and tissues to radiations such as fast neutrons or pi - mesons which produce wide spectra of ionization densities is discussed briefly

  9. Glycosaminoglycan interactions in murine gammaherpesvirus-68 infection.

    Directory of Open Access Journals (Sweden)

    Laurent Gillet

    2007-04-01

    Full Text Available Glycosaminoglycans (GAGs commonly participate in herpesvirus entry. They are thought to provide a reversible attachment to cells that promotes subsequent receptor binding. Murine gamma-herpesvirus-68 (MHV-68 infection of fibroblasts and epithelial cells is highly GAG-dependent. This is a function of the viral gp150, in that gp150-deficient mutants are much less GAG-dependent than wild-type. Here we show that the major MHV-68 GAG-binding protein is not gp150 but gp70, a product of ORF4. Surprisingly, ORF4-deficient MHV-68 showed normal cell binding and was more sensitive than wild-type to inhibition by soluble heparin rather than less. Thus, the most obvious viral GAG interaction made little direct contribution to infection. Indeed, a large fraction of the virion gp70 had its GAG-binding domain removed by post-translational cleavage. ORF4 may therefore act mainly to absorb soluble GAGs and prevent them from engaging gp150 prematurely. In contrast to gp70, gp150 bound poorly to GAGs, implying that it provides little in the way of adhesion. We hypothesize that it acts instead as a GAG-sensitive switch that selectively activates MHV-68 entry at cell surfaces.

  10. Anticonvulsive evaluation of THIP in the murine pentylenetetrazole kindling model

    DEFF Research Database (Denmark)

    Simonsen, Charlotte; Boddum, Kim; von Schoubye, Nadia L

    2017-01-01

    . Evaluation of THIP as a potential anticonvulsant has given contradictory results in different animal models and for this reason, we reevaluated the anticonvulsive properties of THIP in the murine pentylenetetrazole (PTZ) kindling model. As loss of δ-GABAA R in the dentate gyrus has been associated...... the observed upregulation of δ-GABAA Rs. Even in the demonstrated presence of functional δ-GABAA Rs, THIP (0.5-4 mg/kg) showed no anticonvulsive effect in the PTZ kindling model using a comprehensive in vivo evaluation of the anticonvulsive properties....

  11. Murine cell glycolipids customization by modular expression of glycosyltransferases.

    Science.gov (United States)

    Cid, Emili; Yamamoto, Miyako; Buschbeck, Marcus; Yamamoto, Fumiichiro

    2013-01-01

    Functional analysis of glycolipids has been hampered by their complex nature and combinatorial expression in cells and tissues. We report an efficient and easy method to generate cells with specific glycolipids. In our proof of principle experiments we have demonstrated the customized expression of two relevant glycosphingolipids on murine fibroblasts, stage-specific embryonic antigen 3 (SSEA-3), a marker for stem cells, and Forssman glycolipid, a xenoantigen. Sets of genes encoding glycosyltansferases were transduced by viral infection followed by multi-color cell sorting based on coupled expression of fluorescent proteins.

  12. The mechanical fingerprint of murine excisional wounds.

    Science.gov (United States)

    Pensalfini, Marco; Haertel, Eric; Hopf, Raoul; Wietecha, Mateusz; Werner, Sabine; Mazza, Edoardo

    2018-01-01

    A multiscale mechanics approach to the characterization of murine excisional wounds subjected to uniaxial tensile loading is presented. Local strain analysis at a physiological level of tension uncovers the presence of two distinct regions within the wound: i) a very compliant peripheral cushion and ii) a core area undergoing modest deformation. Microstructural visualizations of stretched wound specimens show negligible engagement of the collagen located in the center of a 7-day old wound; fibers remain coiled despite the applied tension, confirming the existence of a mechanically isolated wound core. The compliant cushion located at the wound periphery appears to protect the newly-formed tissue from excessive deformation during the phase of new tissue formation. The early remodeling phase (day 14) is characterized by a restored mechanical connection between far field and wound center. The latter remains less deformable, a characteristic possibly required for cell activities during tissue remodeling. The distribution of fibrillary collagens at these two time points corresponds well to the identified heterogeneity of mechanical properties of the wound region. This novel approach provides new insight into the mechanical properties of wounded skin and will be applicable to the analysis of compound-treated wounds or wounds in genetically modified tissue. Biophysical characterization of healing wounds is crucial to assess the recovery of the skin barrier function and the associated mechanobiological processes. For the first time, we performed highly resolved local deformation analysis to identify mechanical characteristics of the wound and its periphery. Our results reveal the presence of a compliant cushion surrounding a stiffer wound core; we refer to this heterogeneous mechanical behavior as "mechanical fingerprint" of the wound. The mechanical response is shown to progress towards that of the intact skin as healing takes place. Histology and multiphoton microscopy

  13. Local IL-23 expression in murine vaginal candidiasis and its relationship with infection and immune status.

    Science.gov (United States)

    Wu, Yan; Tan, Zhijian; Liu, Zhixiang; Xia, Dechao; Li, Jiawen

    2006-01-01

    To investigate the expression of vaginal IL-23 and its role in experimental murine vaginal candidiasis and its relationship with infection and immune status, immuno-competent (group A) and immuno-suppressed (group B) murine models of vaginal candidiasis were established in estrogen-treated mice. Non-estrogen-treated mice were used as controls (group C). The level of IL-23 p19 mRNA in murine vaginal tissue was determined by RT-PCR. Significantly increased levels of IL-23p19mRNA were observed on the 4th, the 7th and 14th day after inoculation in immuno-competent group when compared with that in control group (Pvaginal candidiasis and has a protective function during infection. Low vaginal IL-23 level may correlate with the increased susceptibility to Candida albicans in immuno-suppressed group.

  14. A murine ESC-like state facilitates transgenesis and homologous recombination in human pluripotent stem cells

    NARCIS (Netherlands)

    C. Buecker (Christa); H.H. Chen; J.M. Polo (Jose); L. Daheron (Laurence); L. Bu (Lei); T.S. Barakat (Tahsin Stefan); P. Okwieka (Patricia); A. Porter (Andrew); J.H. Gribnau (Joost); K. Hochedlinger (Konrad); N. Geijsen (Niels)

    2010-01-01

    textabstractMurine pluripotent stem cells can exist in two functionally distinct states, LIF-dependent embryonic stem cells (ESCs) and bFGF-dependent epiblast stem cells (EpiSCs). However, human pluripotent cells so far seemed to assume only an epiblast-like state. Here we demonstrate that human

  15. P2X7 receptor activation induces cell death and microparticle release in murine erythroleukemia cells.

    NARCIS (Netherlands)

    Constantinescu, P.; Wang, B.; Kovacevic, K.; Jalilian, I.; Bosman, G.J.C.G.M.; Wiley, J.S.; Sluyter, R.

    2010-01-01

    Extracellular ATP induces cation fluxes in and impairs the growth of murine erythroleukemia (MEL) cells in a manner characteristic of the purinergic P2X7 receptor, however the presence of P2X7 in these cells is unknown. This study investigated whether MEL cells express functional P2X7. RT-PCR,

  16. Characterization, expression and complex formation of the murine Fanconi anaemia gene product Fancg.

    Science.gov (United States)

    van de Vrugt, Henri J; Koomen, Mireille; Berns, Mariska A D; de Vries, Yne; Rooimans, Martin A; van der Weel, Laura; Blom, Eric; de Groot, Jan; Schepers, Rik J; Stone, Stacie; Hoatlin, Maureen E; Cheng, Ngan Ching; Joenje, Hans; Arwert, Fré

    2002-03-01

    Fanconi anaemia (FA) is an autosomal recessive chromosomal instability disorder. Six distinct FA disease genes have been identified, the products of which function in an integrated pathway that is thought to support a nuclear caretaker function. Comparison of FA gene characteristics in different species may help to unravel the molecular function of the FA pathway. We have cloned the murine homologue of the Fanconi anaemia complementation group G gene, FANCG/XRCC9. The murine Fancg protein shows an 83% similarity to the human protein sequence, and has a predicted molecular weight of 68.5 kDa. Expression of mouse Fancg in human FA-G lymphoblasts fully corrects their cross-linker hypersensitivity. At mRNA and protein levels we detected the co-expression of Fancg and Fanca in murine tissues. In addition, mouse Fancg and Fanca proteins co-purify by immunoprecipitation. Upon transfection into Fanca-deficient mouse embryonic fibroblasts EGFP-Fancg chimeric protein was detectable in the nucleus. We identified a murine cDNA, Fancg, which cross-complements the cellular defect of human FA-G cells and thus represents a true homologue of human FANCG. Spleen, thymus and testis showed the highest Fancg expression levels. Although Fancg and Fanca are able to form a complex, this interaction is not required for Fancg to accumulate in the nuclear compartment.

  17. Reemergence of Murine Typhus in the US

    Centers for Disease Control (CDC) Podcasts

    2015-04-21

    Dr. Lucas Blanton discusses the Reemergence of Murine Typhus in Galveston Texas in 2013.  Created: 4/21/2015 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 4/27/2015.

  18. Scanning electron microscopy of the neuropathology of murine cerebral malaria

    Directory of Open Access Journals (Sweden)

    Brenneis Christian

    2006-11-01

    Full Text Available Abstract Background The mechanisms leading to death and functional impairments due to cerebral malaria (CM are yet not fully understood. Most of the knowledge about the pathomechanisms of CM originates from studies in animal models. Though extensive histopathological studies of the murine brain during CM are existing, alterations have not been visualized by scanning electron microscopy (SEM so far. The present study investigates the neuropathological features of murine CM by applying SEM. Methods C57BL/6J mice were infected with Plasmodium berghei ANKA blood stages. When typical symptoms of CM developed perfused brains were processed for SEM or light microscopy, respectively. Results Ultrastructural hallmarks were disruption of vessel walls, parenchymal haemorrhage, leukocyte sequestration to the endothelium, and diapedesis of macrophages and lymphocytes into the Virchow-Robin space. Villous appearance of observed lymphocytes were indicative of activated state. Cerebral oedema was evidenced by enlargement of perivascular spaces. Conclusion The results of the present study corroborate the current understanding of CM pathophysiology, further support the prominent role of the local immune system in the neuropathology of CM and might expose new perspectives for further interventional studies.

  19. Murine models of osteosarcoma: A piece of the translational puzzle.

    Science.gov (United States)

    Walia, Mannu K; Castillo-Tandazo, Wilson; Mutsaers, Anthony J; Martin, Thomas John; Walkley, Carl R

    2018-06-01

    Osteosarcoma (OS) is the most common cancer of bone in children and young adults. Despite extensive research efforts, there has been no significant improvement in patient outcome for many years. An improved understanding of the biology of this cancer and how genes frequently mutated contribute to OS may help improve outcomes for patients. While our knowledge of the mutational burden of OS is approaching saturation, our understanding of how these mutations contribute to OS initiation and maintenance is less clear. Murine models of OS have now been demonstrated to be highly valid recapitulations of human OS. These models were originally based on the frequent disruption of p53 and Rb in familial OS syndromes, which are also common mutations in sporadic OS. They have been applied to significantly improve our understanding about the functions of recurrently mutated genes in disease. The murine models can be used as a platform for preclinical testing and identifying new therapeutic targets, in addition to testing the role of additional mutations in vivo. Most recently these models have begun to be used for discovery based approaches and screens, which hold significant promise in furthering our understanding of the genetic and therapeutic sensitivities of OS. In this review, we discuss the mouse models of OS that have been reported in the last 3-5 years and newly identified pathways from these studies. Finally, we discuss the preclinical utilization of the mouse models of OS for identifying and validating actionable targets to improve patient outcome. © 2017 Wiley Periodicals, Inc.

  20. The Murine Factor H-Related Protein FHR-B Promotes Complement Activation

    Directory of Open Access Journals (Sweden)

    Marcell Cserhalmi

    2017-09-01

    Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.

  1. DMPD: The actions of bacterial DNA on murine macrophages. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 10534106 The actions of bacterial DNA on murine macrophages. Sester DP, Stacey KJ, ... Show The actions of bacterial DNA on murine macrophages. PubmedID 10534106 Title The actions of bacterial DNA on murine macrophage

  2. T-cell effector function and unresponsiveness in the murine lymphocytic choriomeningitis virus infection. II. Delayed-type hypersensitivity unresponsiveness reflects a defective differentiation from TD precursor to effector cell

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Marker, O

    1986-01-01

    is markedly depressed in high-dose mice, suggesting an association between DTH and virus clearance. When virus-primed memory cells are transferred, DTH reactivity as well as virus-clearing capacity is restored in high-dose mice, indicating that the virus is not present in a changed or concealed form. The role...... transfer a DTH response emerged, indicating that TD priming had taken place in high-dose animals. Pre-irradiation of high-dose primed cells markedly inhibited the antiviral activity as well as DTH, suggesting that upon transfer to naive recipients TD precursors from high-dose mice would proliferate...... precursor into effector cells which is reversible upon transfer to a less antigen loaded environment. Furthermore, it is suggested that TD function is crucial to the process of virus clearance....

  3. Azithromycin prophylaxis and treatment of murine toxoplasmosis.

    Science.gov (United States)

    Tabbara, Khalid F; Hammouda, Ehab; Tawfik, Abdulkader; Al-Omar, Othman M; Abu El-Asrar, Ahmed M

    2005-03-01

    To evaluate the azithromycin effects alone and in combination with other agents in the prophylaxis and treatment of murine toxoplasmosis. A total of 280 BALB/c mice were included, and 2 x 103 Toxoplasma organisms of the RH strain Toxoplasma gondii strain ATCC50174 were given intraperitoneally to each mouse. In experiment one, 40 animals were given azithromycin 200 milligram/kilogram/daily for 3 days starting the day of inoculation, 40 mice were control. In experiment 2, the treatment was started 48 hours after inoculation and given daily for 3 days: one group received azithromycin 200 milligram/kilogram/day, the second group received pyrimethamine 25 milligram/kilogram/day, and the sulfadiazine 100 milligram/kilogram/day. The third group was control. In experiment 3, 7 groups of animals received one of the following (1) none, (2) azithromycin 200 milligram/kilogram/day, (3) pyrimethamine 25 milligram/kilogram/day and sulfadiazine 100 milligram/kilogram/day, (4) azithromycin and sulfadiazine, (5) azithromycin and pyrimethamine, (6) azithromycin with sulfadiazine and pyrimethamine, (7) sulfadiazine alone. Treatment was initiated 72 hours after inoculation for 3 days. The study was conducted at the Animal Care Facility of King Saud University, Riyadh, Kingdom of Saudi Arabia. Animals that received azithromycin simultaneously with inoculation survived, and all control animals died. All animals died in groups receiving single drug therapy. Animals treated with azithromycin and sulfadiazine showed a survival rate of 40%, sulfadiazine and pyrimethamine 40%, or azithromycin with sulfadiazine and pyrimethamine 95% (p<0.0001). Azithromycin alone was found to be effective in the prophylaxis of murine toxoplasmosis. Combination therapy was effective in the treatment of murine toxoplasmosis.

  4. Gene expression in IFN-g-activated murine macrophages

    Directory of Open Access Journals (Sweden)

    Pereira C.A.

    2004-01-01

    Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.

  5. Cardiac ankyrin repeat protein (CARP) expression in human and murine atherosclerotic lesions - Activin induces carp in smooth muscle cells

    NARCIS (Netherlands)

    de Waard, Vivian; van Achterberg, Tanja A. E.; Beauchamp, Nicholas J.; Pannekoek, Hans; de Vries, Carlie J. M.

    2003-01-01

    Objective-Cardiac ankyrin repeat protein (CARP) is a transcription factor-related protein that has been studied most extensively in the heart. In the present study, we investigated the expression and the potential function of CARP in human and murine atherosclerosis. Methods and Results-CARP

  6. Cytotoxic effector functions of T cells are not required for protective immunity against fatal Rickettsia typhi infection in a murine model of infection: Role of TH1 and TH17 cytokines in protection and pathology.

    Directory of Open Access Journals (Sweden)

    Kristin Moderzynski

    2017-02-01

    Full Text Available Endemic typhus caused by Rickettsia (R. typhi is an emerging febrile disease that can be fatal due to multiple organ pathology. Here we analyzed the requirements for protection against R. typhi by T cells in the CB17 SCID model of infection. BALB/c wild-type mice generate CD4+ TH1 and cytotoxic CD8+ T cells both of which are sporadically reactivated in persistent infection. Either adoptively transferred CD8+ or CD4+ T cells protected R. typhi-infected CB17 SCID mice from death and provided long-term control. CD8+ T cells lacking either IFNγ or Perforin were still protective, demonstrating that the cytotoxic function of CD8+ T cells is not essential for protection. Immune wild-type CD4+ T cells produced high amounts of IFNγ, induced the release of nitric oxide in R. typhi-infected macrophages and inhibited bacterial growth in vitro via IFNγ and TNFα. However, adoptive transfer of CD4+IFNγ-/- T cells still protected 30-90% of R. typhi-infected CB17 SCID mice. These cells acquired a TH17 phenotype, producing high amounts of IL-17A and IL-22 in addition to TNFα, and inhibited bacterial growth in vitro. Surprisingly, the neutralization of either TNFα or IL-17A in CD4+IFNγ-/- T cell recipient mice did not alter bacterial elimination by these cells in vivo, led to faster recovery and enhanced survival compared to isotype-treated animals. Thus, collectively these data show that although CD4+ TH1 cells are clearly efficient in protection against R. typhi, CD4+ TH17 cells are similarly protective if the harmful effects of combined production of TNFα and IL-17A can be inhibited.

  7. Efficacy of posaconazole in murine experimental sporotrichosis.

    Science.gov (United States)

    Fernández-Silva, Fabiola; Capilla, Javier; Mayayo, Emilio; Guarro, Josep

    2012-05-01

    We developed a murine model of systemic sporotrichosis by using three strains of each of the two commonest species causing sporotrichosis, i.e., Sporothrix schenckii sensu stricto and Sporothrix brasiliensis, in order to evaluate the efficacy of posaconazole (PSC). The drug was administered at a dose of 2.5 or 5 mg/kg of body weight twice a day by gavage, and one group was treated with amphotericin B (AMB) as a control treatment. Posaconazole, especially at 5 mg/kg, showed good efficacy against all the strains tested, regardless of their MICs, as measured by prolonged survival, tissue burden reduction, and histopathology.

  8. Irradiation Design for an Experimental Murine Model

    International Nuclear Information System (INIS)

    Ballesteros-Zebadua, P.; Moreno-Jimenez, S.; Suarez-Campos, J. E.; Celis, M. A.; Larraga-Gutierrez, J. M.; Garcia-Garduno, O. A.; Rubio-Osornio, M. C.; Custodio-Ramirez, V.; Paz, C.

    2010-01-01

    In radiotherapy and stereotactic radiosurgery, small animal experimental models are frequently used, since there are still a lot of unsolved questions about the biological and biochemical effects of ionizing radiation. This work presents a method for small-animal brain radiotherapy compatible with a dedicated 6MV Linac. This rodent model is focused on the research of the inflammatory effects produced by ionizing radiation in the brain. In this work comparisons between Pencil Beam and Monte Carlo techniques, were used in order to evaluate accuracy of the calculated dose using a commercial planning system. Challenges in this murine model are discussed.

  9. Thrombopoietin inhibits murine mast cell differentiation

    Science.gov (United States)

    Martelli, Fabrizio; Ghinassi, Barbara; Lorenzini, Rodolfo; Vannucchi, Alessandro M; Rana, Rosa Alba; Nishikawa, Mitsuo; Partamian, Sandra; Migliaccio, Giovanni; Migliaccio, Anna Rita

    2009-01-01

    We have recently shown that Mpl, the thrombopoietin receptor, is expressed on murine mast cells and on their precursors and that targeted deletion of the Mpl gene increases mast cell differentiation in mice. Here we report that treatment of mice with thrombopoietin, or addition of this growth factor to bone marrow-derived mast cell cultures, severely hampers the generation of mature cells from their precursors by inducing apoptosis. Analysis of the expression profiling of mast cells obtained in the presence of thrombopoietin suggests that thrombopoietin induces apoptosis of mast cells by reducing expression of the transcription factor Mitf and its target anti-apoptotic gene Bcl2. PMID:18276801

  10. [Virulence of Sporothrix globosa in murine models].

    Science.gov (United States)

    Cruz Choappa, Rodrigo; Pérez Gaete, Salomón; Rodríguez Badilla, Valentina; Vieille Oyarzo, Peggy; Opazo Sanchez, Héctor

    The sporothricosis disease is an infection caused by species included in Sporothrix schenkii complex. Verify the virulence of a strain of S. globosa using two different concentrations of inoculum by intraperitoneally and subcutaneously, into a mouse model. Nonrandomized pilot study, in murine inoculated with a strain of S. globosa (CBS 14.076M) by intraperitoneally and subcutaneously with inoculum concentrations of 0.5 and 4 McFarland. For this purpose 18 rodents CF-1 (ISP, Santiago, Chile) were used. The studied strain did not induce illness or injury on animals, they all survived and neither the tissue culture nor the histopathological analysis showed fungal growth or suggestive infection by organ abnormalities. The S. globosa strain did not present any virulence enough to cause disease at 0.5 and 4.0 McFarland concentration inoculum when inoculated in both intraperitoneally and subcutaneously, in murine models. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Murine colon proteome and characterization of the protein pathways

    Directory of Open Access Journals (Sweden)

    Magdeldin Sameh

    2012-08-01

    Full Text Available Abstract Background Most of the current proteomic researches focus on proteome alteration due to pathological disorders (i.e.: colorectal cancer rather than normal healthy state when mentioning colon. As a result, there are lacks of information regarding normal whole tissue- colon proteome. Results We report here a detailed murine (mouse whole tissue- colon protein reference dataset composed of 1237 confident protein (FDR I and Mw ranged from 3–12 and 4–600 KDa, respectively. Gravy index scoring predicted 19.5% membranous and 80.5% globularly located proteins. GO hierarchies and functional network analysis illustrated proteins function together with their relevance and implication of several candidates in malignancy such as Mitogen- activated protein kinase (Mapk8, 9 in colorectal cancer, Fibroblast growth factor receptor (Fgfr 2, Glutathione S-transferase (Gstp1 in prostate cancer, and Cell division control protein (Cdc42, Ras-related protein (Rac1,2 in pancreatic cancer. Protein abundances calculated with 3 different algorithms (NSAF, PAF and emPAI provide a relative quantification under normal condition as guidance. Conclusions This highly confidence colon proteome catalogue will not only serve as a useful reference for further experiments characterizing differentially expressed proteins induced from diseased conditions, but also will aid in better understanding the ontology and functional absorptive mechanism of the colon as well.

  12. Role of P2X7 on steroid synthesis in murine luteal cells

    Directory of Open Access Journals (Sweden)

    Chunping Zhang

    2016-03-01

    Full Text Available The extracellular adenosine triphosphate (ATP regulates different cellular functions through activating purinergic receptors as a signalling molecule or neurotransmitter. P2X7 is highly expressed in murine small luteal cells. In this study, murine luteal cells were cultured in vitro and treated with P2X7 agonists – ATP and 2′(3′-O-(4-benzoyl-benzoyl-adenosine 50-triphosphate (BzATP and with P2X7 antagonist – brilliant blue G (BBG. We found that ATP and BzATP increased the production of progesterone and had no influence on the production of estradiol. BBG reversed the effect of BzATP and ATP. Further studies demonstrated that ATP and BzATP promoted the expression of CYP11A. These results revealed that P2X7 receptor activation is involved in the steroid synthesis in corpus luteum.

  13. Clearance of 131I-labeled murine monoclonal antibody from patients' blood by intravenous human anti-murine immunoglobulin antibody

    International Nuclear Information System (INIS)

    Stewart, J.S.; Sivolapenko, G.B.; Hird, V.; Davies, K.A.; Walport, M.; Ritter, M.A.; Epenetos, A.A.

    1990-01-01

    Five patients treated with intraperitoneal 131I-labeled mouse monoclonal antibody for ovarian cancer also received i.v. exogenous polyclonal human anti-murine immunoglobulin antibody. The pharmacokinetics of 131I-labeled monoclonal antibody in these patients were compared with those of 28 other patients receiving i.p.-radiolabeled monoclonal antibody for the first time without exogenous human anti-murine immunoglobulin, and who had no preexisting endogenous human anti-murine immunoglobulin antibody. Patients receiving i.v. human anti-murine immunoglobulin antibody demonstrated a rapid clearance of 131I-labeled monoclonal antibody from their circulation. The (mean) maximum 131I blood content was 11.4% of the injected activity in patients receiving human anti-murine immunoglobulin antibody compared to 23.3% in patients not given human anti-murine immunoglobulin antibody. Intravenous human anti-murine immunoglobulin antibody decreased the radiation dose to bone marrow (from 131I-labeled monoclonal antibody in the vascular compartment) 4-fold. Following the injection of human anti-murine immunoglobulin antibody, 131I-monoclonal/human anti-murine immunoglobulin antibody immune complexes were rapidly transported to the liver. Antibody dehalogenation in the liver was rapid, with 87% of the injected 131I excreted in 5 days. Despite the efficient hepatic uptake of immune complexes, dehalogenation of monoclonal antibody was so rapid that the radiation dose to liver parenchyma from circulating 131I was decreased 4-fold rather than increased. All patients developed endogenous human anti-murine immunoglobulin antibody 2 to 3 weeks after treatment

  14. Noncanonical microRNAs and endogenous siRNAs in lytic infection of murine gammaherpesvirus.

    Directory of Open Access Journals (Sweden)

    Jing Xia

    Full Text Available MicroRNA (miRNA and endogenous small interfering RNA (endo-siRNA are two essential classes of small noncoding RNAs (sncRNAs in eukaryotes. The class of miRNA is diverse and there exist noncanonical miRNAs that bypass the canonical miRNA biogenesis pathway. In order to identify noncanonical miRNAs and endo-siRNAs responding to virus infection and study their potential function, we sequenced small-RNA species from cells lytically infected with murine gammaherpesvirus 68 (MHV68. In addition to three novel canonical miRNAs in mouse, two antisense miRNAs in virus and 25 novel noncanonical miRNAs, including miRNAs derived from transfer RNAs, small nucleolar RNAs and introns, in the host were identified. These noncanonical miRNAs exhibited features distinct from that of canonical miRNAs in lengths of hairpins, base pairings and first nucleotide preference. Many of the novel miRNAs are conserved in mammals. Besides several known murine endo-siRNAs detected by the sequencing profiling, a novel locus in the mouse genome was identified to produce endo-siRNAs. This novel endo-siRNA locus is comprised of two tandem inverted B4 short interspersed nuclear elements (SINEs. Unexpectedly, the SINE-derived endo-siRNAs were found in a variety of sequencing data and virus-infected cells. Moreover, a murine miRNA was up-regulated more than 35 fold in infected than in mock-treated cells. The putative targets of the viral and the up-regulated murine miRNAs were potentially involved in processes of gene transcription and protein phosphorylation, and localized to membranes, suggesting their potential role in manipulating the host basal immune system during lytic infection. Our results extended the number of noncanonical miRNAs in mammals and shed new light on their potential functions of lytic infection of MHV68.

  15. 1.8 Å structure of murine GITR ligand dimer expressed in Drosophila melanogaster S2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Kausik [Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Ramagopal, Udupi A. [Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Nathenson, Stanley G., E-mail: nathenso@aecom.yu.edu [Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Cell Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Almo, Steven C., E-mail: nathenso@aecom.yu.edu [Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States)

    2009-05-01

    1.8 Å X-ray crystal structure of mouse GITRL expressed in D. melanogaster S2 cells shows an identical ‘strand-exchanged’ dimeric assembly similar to that observed previously for the E. coli-expressed protein. Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique ‘strand-exchanged’ dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with the murine GITRL costimulatory system. In this present work, the 1.8 Å resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical ‘strand-exchanged’ dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL.

  16. 1.8 Å structure of murine GITR ligand dimer expressed in Drosophila melanogaster S2 cells

    International Nuclear Information System (INIS)

    Chattopadhyay, Kausik; Ramagopal, Udupi A.; Nathenson, Stanley G.; Almo, Steven C.

    2009-01-01

    1.8 Å X-ray crystal structure of mouse GITRL expressed in D. melanogaster S2 cells shows an identical ‘strand-exchanged’ dimeric assembly similar to that observed previously for the E. coli-expressed protein. Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique ‘strand-exchanged’ dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with the murine GITRL costimulatory system. In this present work, the 1.8 Å resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical ‘strand-exchanged’ dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL

  17. Megakaryocytes compensate for Kit insufficiency in murine arthritis.

    Science.gov (United States)

    Cunin, Pierre; Penke, Loka R; Thon, Jonathan N; Monach, Paul A; Jones, Tatiana; Chang, Margaret H; Chen, Mary M; Melki, Imene; Lacroix, Steve; Iwakura, Yoichiro; Ware, Jerry; Gurish, Michael F; Italiano, Joseph E; Boilard, Eric; Nigrovic, Peter A

    2017-05-01

    The growth factor receptor Kit is involved in hematopoietic and nonhematopoietic development. Mice bearing Kit defects lack mast cells; however, strains bearing different Kit alleles exhibit diverse phenotypes. Herein, we investigated factors underlying differential sensitivity to IgG-mediated arthritis in 2 mast cell-deficient murine lines: KitWsh/Wsh, which develops robust arthritis, and KitW/Wv, which does not. Reciprocal bone marrow transplantation between KitW/Wv and KitWsh/Wsh mice revealed that arthritis resistance reflects a hematopoietic defect in addition to mast cell deficiency. In KitW/Wv mice, restoration of susceptibility to IgG-mediated arthritis was neutrophil independent but required IL-1 and the platelet/megakaryocyte markers NF-E2 and glycoprotein VI. In KitW/Wv mice, platelets were present in numbers similar to those in WT animals and functionally intact, and transfer of WT platelets did not restore arthritis susceptibility. These data implicated a platelet-independent role for the megakaryocyte, a Kit-dependent lineage that is selectively deficient in KitW/Wv mice. Megakaryocytes secreted IL-1 directly and as a component of circulating microparticles, which activated synovial fibroblasts in an IL-1-dependent manner. Transfer of WT but not IL-1-deficient megakaryocytes restored arthritis susceptibility to KitW/Wv mice. These findings identify functional redundancy among Kit-dependent hematopoietic lineages and establish an unanticipated capacity of megakaryocytes to mediate IL-1-driven systemic inflammatory disease.

  18. Cloning and characterization of murine fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis, and ovary.

    Science.gov (United States)

    van de Vrugt, H J; Cheng, N C; de Vries, Y; Rooimans, M A; de Groot, J; Scheper, R J; Zhi, Y; Hoatlin, M E; Joenje, H; Arwert, F

    2000-04-01

    Fanconi anemia (FA) is an autosomal recessive disorder in humans characterized by bone marrow failure, cancer predisposition, and cellular hypersensitivity to cross-linking agents such as mitomycin C and diepoxybutane. FA genes display a caretaker function essential for maintenance of genomic integrity. We have cloned the murine homolog of FANCA, the gene mutated in the major FA complementation group (FA-A). The full-length mouse Fanca cDNA consists of 4503 bp and encodes a protein with a predicted molecular weight of 161 kDa. The deduced Fanca mouse protein shares 81% amino acid sequence similarity and 66% identity with the human protein. The nuclear localization signal and partial leucine zipper consensus motifs found in the human FANCA protein were also present in the murine homolog. In spite of the species difference, the murine Fanca cDNA was capable of correcting the cross-linker sensitive phenotype of human FA-A cells, suggesting functional conservation. Based on Northern as well as Western blots, Fanca was mainly expressed in lymphoid tissues, testis, and ovary. This expression pattern correlates with some of the clinical symptoms observed in FA patients. The availability of the murine Fanca cDNA now allows the gene to be studied in experimental mouse models.

  19. Murine leukemia viruses: objects and organisms.

    Science.gov (United States)

    Rein, Alan

    2011-01-01

    Murine leukemia viruses (MLVs) are among the simplest retroviruses. Prototypical gammaretroviruses encode only the three polyproteins that will be used in the assembly of progeny virus particles. These are the Gag polyprotein, which is the structural protein of a retrovirus particle, the Pol protein, comprising the three retroviral enzymes-protease, which catalyzes the maturation of the particle, reverse transcriptase, which copies the viral RNA into DNA upon infection of a new host cell, and integrase, which inserts the DNA into the chromosomal DNA of the host cell, and the Env polyprotein, which induces the fusion of the viral membrane with that of the new host cell, initiating infection. In general, a productive MLV infection has no obvious effect upon host cells. Although gammaretroviral structure and replication follow the same broad outlines as those of other retroviruses, we point out a number of significant differences between different retroviral genera.

  20. Proliferative capacity of murine hematopoietic stem cells

    International Nuclear Information System (INIS)

    Hellman, S.; Botnick, L.E.; Hannon, E.C.; Vigneulle, R.M.

    1978-01-01

    The present study demonstrates a decrease in self-renewal capacity with serial transfer of murine hematopoietic stem cells. Production of differentiated cell progeny is maintained longer than stem cell self-renewal. In normal animals the capacity for self-renewal is not decreased with increasing donor age. The stem cell compartment in normal animals, both young and old, appears to be proliferatively quiescent. After apparent recovery from the alkylating agent busulfan, the probability of stem cell self-renewal is decreased, there is a permanent defect in the capacity of the bone marrow for serial transplantation, and the stem cells are proliferatively active. These findings support a model of the hematopoietic stem cell compartment as a continuum of cells with decreasing capacities for self-renewal, increasing likelihood for differentiation, and increasing proliferative activity. Cells progress in the continuum in one direction and such progression is not reversible

  1. Murine model of long term obstructive jaundice

    Science.gov (United States)

    Aoki, Hiroaki; Aoki, Masayo; Yang, Jing; Katsuta, Eriko; Mukhopadhyay, Partha; Ramanathan, Rajesh; Woelfel, Ingrid A.; Wang, Xuan; Spiegel, Sarah; Zhou, Huiping; Takabe, Kazuaki

    2016-01-01

    Background With the recent emergence of conjugated bile acids as signaling molecules in cancer, a murine model of obstructive jaundice by cholestasis with long-term survival is in need. Here, we investigated the characteristics of 3 murine models of obstructive jaundice. Methods C57BL/6J mice were used for total ligation of the common bile duct (tCL), partial common bile duct ligation (pCL), and ligation of left and median hepatic bile duct with gallbladder removal (LMHL) models. Survival was assessed by Kaplan-Meier method. Fibrotic change was determined by Masson-Trichrome staining and Collagen expression. Results 70% (7/10) of tCL mice died by Day 7, whereas majority 67% (10/15) of pCL mice survived with loss of jaundice. 19% (3/16) of LMHL mice died; however, jaundice continued beyond Day 14, with survival of more than a month. Compensatory enlargement of the right lobe was observed in both pCL and LMHL models. The pCL model demonstrated acute inflammation due to obstructive jaundice 3 days after ligation but jaundice rapidly decreased by Day 7. The LHML group developed portal hypertension as well as severe fibrosis by Day 14 in addition to prolonged jaundice. Conclusion The standard tCL model is too unstable with high mortality for long-term studies. pCL may be an appropriate model for acute inflammation with obstructive jaundice but long term survivors are no longer jaundiced. The LHML model was identified to be the most feasible model to study the effect of long-term obstructive jaundice. PMID:27916350

  2. Formation and maturation of the murine meniscus.

    Science.gov (United States)

    Gamer, Laura W; Xiang, Lin; Rosen, Vicki

    2017-08-01

    Meniscal injuries are commonplace, but current surgical repair procedures do not prevent degenerative joint changes that occur after meniscal injury and often lead to osteoarthritis. Successful tissue regeneration in adults often recapitulates events that occur during embryogenesis, suggesting that understanding the regulatory pathways controlling these early processes may provide clues for developing strategies for tissue repair. While the mouse is now widely used to study joint diseases, detailed knowledge of the basic biology of murine meniscus is not readily available. Here, we examine meniscal morphogenesis in mice from embryonic day 13.5 (E13.5) to 6 months of age using histology, in situ hybridization, and immunohistochemistry. We find that the meniscus is a morphologically distinct structure at E16 when it begins to regionalize. At birth, the meniscus has a distinguishable inner, avascular, round chondrocyte cell region, an outer, vascularized, fibroblast cell region, and a surface superficial zone. Maturation begins at 2 weeks of age when the meniscus expresses type I collagen, type II collagen, type X collagen, and MMP-13 in specific patterns. By 4 weeks of age, small areas of ossification are detected in the anterior meniscal horn, a common feature seen in rodents. Maturation appears complete at 8 weeks of age, when the meniscus resembles the adult structure complete with ossifying tissue that contains bone marrow like areas. Our results provide, the first systematic study of mouse meniscal development and will be a valuable tool for analyzing murine models of knee joint formation and disease. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1683-1689, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  3. Puerarin Facilitates T-Tubule Development of Murine Embryonic Stem Cell-Derived Cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Lu Wang

    2014-07-01

    Full Text Available Aims: The embryonic stem cell-derived cardiomyocytes (ES-CM is one of the promising cell sources for repopulation of damaged myocardium. However, ES-CMs present immature structure, which impairs their integration with host tissue and functional regeneration. This study used murine ES-CMs as an in vitro model of cardiomyogenesis to elucidate the effect of puerarin, the main compound found in the traditional Chinese medicine the herb Radix puerariae, on t-tubule development of murine ES-CMs. Methods: Electron microscope was employed to examine the ultrastructure. The investigation of transverse-tubules (t-tubules was performed by Di-8-ANEPPS staining. Quantitative real-time PCR was utilized to study the transcript level of genes related to t-tubule development. Results: We found that long-term application of puerarin throughout cardiac differentiation improved myofibril array and sarcomeres formation, and significantly facilitated t-tubules development of ES-CMs. The transcript levels of caveolin-3, amphiphysin-2 and junctophinlin-2, which are crucial for the formation and development of t-tubules, were significantly upregulated by puerarin treatment. Furthermore, puerarin repressed the expression of miR-22, which targets to caveolin-3. Conclusion: Our data showed that puerarin facilitates t-tubule development of murine ES-CMs. This might be related to the repression of miR-22 by puerarin and upregulation of Cav3, Bin1 and JP2 transcripts.

  4. Differential gene expression in the murine gastric fundus lacking interstitial cells of Cajal

    Directory of Open Access Journals (Sweden)

    Ward Sean M

    2003-06-01

    Full Text Available Abstract Background The muscle layers of murine gastric fundus have no interstitial cells of Cajal at the level of the myenteric plexus and only possess intramuscular interstitial cells and this tissue does not generate electric slow waves. The absence of intramuscular interstitial cells in W/WV mutants provides a unique opportunity to study the molecular changes that are associated with the loss of these intercalating cells. Method The gene expression profile of the gastric fundus of wild type and W/WV mice was assayed by murine microarray analysis displaying a total of 8734 elements. Queried genes from the microarray analysis were confirmed by semi-quantitative reverse transcription-polymerase chain reaction. Results Twenty-one genes were differentially expressed in wild type and W/WV mice. Eleven transcripts had 2.0–2.5 fold higher mRNA expression in W/WV gastric fundus when compared to wild type tissues. Ten transcripts had 2.1–3.9 fold lower expression in W/WV mutants in comparison with wild type animals. None of these genes have ever been implicated in any bowel motility function. Conclusions These data provides evidence that several important genes have significantly changed in the murine fundus of W/WV mutants that lack intramuscular interstitial cells of Cajal and have reduced enteric motor neurotransmission.

  5. Cytoplasmic superoxide dismutase and catalase activity and resistance to radiation lethality in murine tumor cells

    International Nuclear Information System (INIS)

    Davy, C.A.; Tesfay, Z.; Jones, J.; Rosenberg, R.C.; McCarthy, C.; Rosenberg, S.O.

    1986-01-01

    Reduced species of molecular oxygen are produced by the interaction of ionizing radiation with aqueous solutions containing molecular oxygen. The enzymes catalase and superoxide dismutase (SOD) are thought to function in vivo as scavengers of metabolically produced peroxide and superoxide respectively. SOD has been shown to protect against the lethal effects of ionizing radiation in vitro and in vivo. The authors have investigated the relationship between the cytosolic SOD catalase content and the sensitivity to radiation lethality of a number of murine cell lines (402AX, EL-4, MB-2T3, MB-4, MEL, P-815, SAI, SP-2, and SV-3T3). K/sub i/(CN - ) for murine Cu-Zn-SOD was determined to be 6.8 x 10 -6 M. No cytosolic Mn-SOD activity was found in any of the cell lines studied. No correlation was found between the cytosolic Cu-Zn-SOD or cytosolic catalase activity and the resistance to radiation lethality or the murine cell lines studied

  6. Sex differences in the MB49 syngeneic, murine model of bladder cancer.

    Science.gov (United States)

    White-Gilbertson, Shai; Davis, Megan; Voelkel-Johnson, Christina; Kasman, Laura M

    The MB49 syngeneic, murine model of bladder cancer has been widely used for more than 35 years. In humans, bladder cancer is one third as prevalent in women as in men, with a trend toward lower prevalence in parous compared to nulliparous women. Our objective was to determine if the MB49 bladder cancer model reproduces the sex differences observed in humans, and to determine its sensitivity to testosterone and the pregnancy hormone, human chorionic gonadotropin (hCG). Male and female C57BL/6 mice were implanted with MB49 murine bladder cancer cells, and observed for tumor growth. MB49 dose responses to hCG and dihydrotestosterone were determined in vitro . MB49 tumor growth was significantly greater in male mice than female mice. Pregnancy did not affect MB49 tumor growth in female mice. MB49 cells did not proliferate in response to hCG in vitro and the functional receptor for gonadotropins was absent. Dihydrotestosterone strongly stimulated growth of MB49 cells in vitro . The MB49 murine model of bladder cancer reproduced some aspects of the sex differences observed in humans. Our results suggest that testosterone may stimulate MB49 cell proliferation, which may explain the more rapid MB49 tumor growth observed in male mice.

  7. Antioxidative effects in vivo and colonization of Lactobacillus plantarum MA2 in the murine intestinal tract.

    Science.gov (United States)

    Tang, Wei; Xing, Zhuqing; Hu, Wei; Li, Chao; Wang, Jinju; Wang, Yanping

    2016-08-01

    Lactobacillus plantarum MA2 was isolated from traditional Chinese Tibet kefir grains, which possess several excellent properties and functions. We previously demonstrated the antioxidant activities of this bacterium in vitro. However, the maintenance and survival of L. plantarum MA2 inside the murine intestinal tract, where it exerts its probiotic properties, and whether its effects are elicited directly on the host remain unknown. Therefore, this study investigated the mechanisms of L. plantarum MA2 in aging mice following D-galactose administration. The levels of malondialdehyde decreased significantly in the L. plantarum MA2 groups after oral ingestion compared to the D-galactose model group, and total antioxidant capacity and glutathione peroxidase and superoxide dismutase activities increased significantly in the serum and liver. We combined fluorescein isothiocyanate labeling and green fluorescent protein expression to dynamically monitor the colonization and distribution of L. plantarum MA2 in the murine intestinal tract. The results indicated that L. plantarum MA2 was detected in the ileum, colon, and feces after single and continuous oral administration at day 21 and was maintained at 10(4)-10(5) CFU/g. These results suggest that L. plantarum MA2 colonizes and survives in the murine intestinal tract to exert its antioxidative effects.

  8. A role for smoothened during murine lens and cornea development.

    Directory of Open Access Journals (Sweden)

    Janet J Y Choi

    Full Text Available Various studies suggest that Hedgehog (Hh signalling plays roles in human and zebrafish ocular development. Recent studies (Kerr et al., Invest Ophthalmol Vis Sci. 2012; 53, 3316-30 showed that conditionally activating Hh signals promotes murine lens epithelial cell proliferation and disrupts fibre differentiation. In this study we examined the expression of the Hh pathway and the requirement for the Smoothened gene in murine lens development. Expression of Hh pathway components in developing lens was examined by RT-PCR, immunofluorescence and in situ hybridisation. The requirement of Smo in lens development was determined by conditional loss-of-function mutations, using LeCre and MLR10 Cre transgenic mice. The phenotype of mutant mice was examined by immunofluorescence for various markers of cell cycle, lens and cornea differentiation. Hh pathway components (Ptch1, Smo, Gli2, Gli3 were detected in lens epithelium from E12.5. Gli2 was particularly localised to mitotic nuclei and, at E13.5, Gli3 exhibited a shift from cytosol to nucleus, suggesting distinct roles for these transcription factors. Conditional deletion of Smo, from ∼E12.5 (MLR10 Cre did not affect ocular development, whereas deletion from ∼E9.5 (LeCre resulted in lens and corneal defects from E14.5. Mutant lenses were smaller and showed normal expression of p57Kip2, c-Maf, E-cadherin and Pax6, reduced expression of FoxE3 and Ptch1 and decreased nuclear Hes1. There was normal G1-S phase but decreased G2-M phase transition at E16.5 and epithelial cell death from E14.5-E16.5. Mutant corneas were thicker due to aberrant migration of Nrp2+ cells from the extraocular mesenchyme, resulting in delayed corneal endothelial but normal epithelial differentiation. These results indicate the Hh pathway is required during a discrete period (E9.5-E12.5 in lens development to regulate lens epithelial cell proliferation, survival and FoxE3 expression. Defective corneal development occurs

  9. Murine but not human basophil undergoes cell-specific proteolysis of a major endoplasmic reticulum chaperone.

    Directory of Open Access Journals (Sweden)

    Bei Liu

    Full Text Available Basophil has been implicated in anti-parasite defense, allergy and in polarizing T(H2 response. Mouse model has been commonly used to study basophil function although the difference between human and mouse basophils is underappreciated. As an essential chaperone for multiple Toll-like receptors and integrins in the endoplasmic reticulum, gp96 also participates in general protein homeostasis and in the ER unfolded protein response to ensure cell survival during stress. The roles of gp96 in basophil development are unknown.We genetically delete gp96 in mice and examined the expression of gp96 in basophils by Western blot and flow cytometry. We compared the expression pattern of gp96 between human and mouse basophils.We found that gp96 was dispensable for murine basophil development. Moreover, gp96 was cleaved by serine protease(s in murine but not human basophils leading to accumulation of a nun-functional N-terminal ∼50 kDa fragment and striking induction of the unfolded protein response. The alteration of gp96 was unique to basophils and was not observed in any other cell types including mast cells. We also demonstrated that the ectopic expression of a mouse-specific tryptase mMCP11 does not lead to gp96 cleavage in human basophils.Our study revealed a remarkable biochemical event of gp96 silencing in murine but not human basophils, highlighting the need for caution in using mouse models to infer the function of basophils in human immune response. Our study also reveals a novel mechanism of shutting down gp96 post-translationally in regulating its function.

  10. Murine but not human basophil undergoes cell-specific proteolysis of a major endoplasmic reticulum chaperone.

    Science.gov (United States)

    Liu, Bei; Staron, Matthew; Li, Zihai

    2012-01-01

    Basophil has been implicated in anti-parasite defense, allergy and in polarizing T(H)2 response. Mouse model has been commonly used to study basophil function although the difference between human and mouse basophils is underappreciated. As an essential chaperone for multiple Toll-like receptors and integrins in the endoplasmic reticulum, gp96 also participates in general protein homeostasis and in the ER unfolded protein response to ensure cell survival during stress. The roles of gp96 in basophil development are unknown. We genetically delete gp96 in mice and examined the expression of gp96 in basophils by Western blot and flow cytometry. We compared the expression pattern of gp96 between human and mouse basophils. We found that gp96 was dispensable for murine basophil development. Moreover, gp96 was cleaved by serine protease(s) in murine but not human basophils leading to accumulation of a nun-functional N-terminal ∼50 kDa fragment and striking induction of the unfolded protein response. The alteration of gp96 was unique to basophils and was not observed in any other cell types including mast cells. We also demonstrated that the ectopic expression of a mouse-specific tryptase mMCP11 does not lead to gp96 cleavage in human basophils. Our study revealed a remarkable biochemical event of gp96 silencing in murine but not human basophils, highlighting the need for caution in using mouse models to infer the function of basophils in human immune response. Our study also reveals a novel mechanism of shutting down gp96 post-translationally in regulating its function.

  11. Reduction in DNA repair capacity following differentiation of murine proadipocytes

    International Nuclear Information System (INIS)

    Tofilon, P.J.; Meyn, R.E.

    1988-01-01

    It has been suggested that terminally differentiated mammalian cells have a decreased DNA repair capacity, compared with proliferating stem cells. To investigate this hypothesis, we have examined γ-ray-induced DNA strand breaks and their repair in the murine proadipocyte stem cell line 3T3-T. By exposure to human plasma, 3T3-T cells can be induced to undergo nonterminal and then terminal differentiation. DNA strand breaks were evaluated using the technique of alkaline elution. No difference was detected among stem, nonterminally differentiated, and terminally differentiated cells in the initial levels of radiation-induced DNA strand breaks. Each of the strand break dose responses increased as a linear function of γ-ray dose. The strand breaks induced by 4 Gy rejoined following biphasic kinetics for each cell type. At each time point examined after irradiation, however, the percentage of strand breaks that had not rejoined in terminally differentiated cells was three to six times greater than in stem cells. The rate of strand break rejoining in nonterminally differentiated cells was of an intermediate value between that of the stem and of the terminally differentiated cells. These results indicate that, at least for 3T3-T cells, differentiated cells have a reduced capacity for DNA repair

  12. Effects of spaceflight on the muscles of the murine shoulder.

    Science.gov (United States)

    Shen, Hua; Lim, Chanteak; Schwartz, Andrea G; Andreev-Andrievskiy, Alexander; Deymier, Alix C; Thomopoulos, Stavros

    2017-12-01

    Mechanical loading is necessary for the development and maintenance of the musculoskeletal system. Removal of loading via microgravity, paralysis, or bed rest leads to rapid loss of muscle mass and function; however, the molecular mechanisms that lead to these changes are largely unknown, particularly for the spaceflight (SF) microgravity environment. Furthermore, few studies have explored these effects on the shoulder, a dynamically stabilized joint with a large range of motion; therefore, we examined the effects of microgravity on mouse shoulder muscles for the 15-d Space Transportation System (STS)-131, 13-d STS-135, and 30-d Bion-M1 missions. Mice from STS missions were euthanized within 4 h after landing, whereas mice from the Bion-M1 mission were euthanized within 14 h after landing. The motion-generating deltoid muscle was more sensitive to microgravity than the joint-stabilizing rotator cuff muscles. Mice from the STS-131 mission exhibited reduced myogenic ( Myf5 and -6 ) and adipogenic ( Pparg , Cebpa , and Lep ) gene expression, whereas either no change or an increased expression of these genes was observed in mice from the Bion-M1 mission. In summary, muscle responses to microgravity were muscle-type specific, short-duration SF caused dramatic molecular changes to shoulder muscles and responses to reloading upon landing were rapid.-Shen, H., Lim, C., Schwartz, A. G., Andreev-Andrievskiy, A., Deymier, A. C., Thomopoulos, S. Effects of spaceflight on the muscles of the murine shoulder. © FASEB.

  13. Tofacitinib Ameliorates Murine Lupus and Its Associated Vascular Dysfunction.

    Science.gov (United States)

    Furumoto, Yasuko; Smith, Carolyne K; Blanco, Luz; Zhao, Wenpu; Brooks, Stephen R; Thacker, Seth G; Abdalrahman, Zarzour; Sciumè, Giuseppe; Tsai, Wanxia L; Trier, Anna M; Nunez, Leti; Mast, Laurel; Hoffmann, Victoria; Remaley, Alan T; O'Shea, John J; Kaplan, Mariana J; Gadina, Massimo

    2017-01-01

    Dysregulation of innate and adaptive immune responses contributes to the pathogenesis of systemic lupus erythematosus (SLE) and its associated premature vascular damage. No drug to date targets both systemic inflammatory disease and the cardiovascular complications of SLE. Tofacitinib is a JAK inhibitor that blocks signaling downstream of multiple cytokines implicated in lupus pathogenesis. While clinical trials have shown that tofacitinib exhibits significant clinical efficacy in various autoimmune diseases, its role in SLE and the associated vascular pathology remains to be characterized. MRL/lpr lupus-prone mice were administered tofacitinib or vehicle by gavage for 6 weeks (therapeutic arm) or 8 weeks (preventive arm). Nephritis, skin inflammation, serum levels of autoantibodies and cytokines, mononuclear cell phenotype and gene expression, neutrophil extracellular traps (NETs) release, endothelium-dependent vasorelaxation, and endothelial differentiation were compared in treated and untreated mice. Treatment with tofacitinib led to significant improvement in measures of disease activity, including nephritis, skin inflammation, and autoantibody production. In addition, tofacitinib treatment reduced serum levels of proinflammatory cytokines and interferon responses in splenocytes and kidney tissue. Tofacitinib also modulated the formation of NETs and significantly increased endothelium-dependent vasorelaxation and endothelial differentiation. The drug was effective in both preventive and therapeutic strategies. Tofacitinib modulates the innate and adaptive immune responses, ameliorates murine lupus, and improves vascular function. These results indicate that JAK inhibitors have the potential to be beneficial in SLE and its associated vascular damage. © 2016, American College of Rheumatology.

  14. Biological properties in vitro of a combination of recombinant murine interleukin-3 and granulocyte-macrophage colony-stimulating factor.

    Science.gov (United States)

    Riklis, I; Kletter, Y; Bleiberg, I; Fabian, I

    1989-04-01

    The effect of recombinant murine interleukin-3 (rIL-3) and recombinant murine granulocyte-macrophage colony-stimulating factor (rGM-CSF) on in vitro murine myeloid progenitor cell (CFU-C) growth and on the function of murine resident peritoneal macrophages was investigated. Both rIL-3 and rGM-CSF are known to support the growth of CFU-C and, when combined, were found to act synergistically to induce the development of an increased number of CFU-C. The distribution pattern of myeloid colonies in the presence of these two growth factors was in general similar to that in the presence of rGM-CSF alone. Both rGM-CSF and rIL-3 enhanced the phagocytosis of Candida albicans (CA) by mature macrophages producing an increase in the percentage of phagocytosing cells as well as an increase in the number of yeast particles ingested per cell. No additive effect on the phagocytosis was observed when the two growth factors were added concurrently. rGM-CSF, but not rIL-3, enhanced the killing of CA by macrophages. This killing was inhibited by scavengers of oxygen radicals.

  15. Highly efficient gene transfer using a retroviral vector into murine T cells for preclinical chimeric antigen receptor-expressing T cell therapy

    International Nuclear Information System (INIS)

    Kusabuka, Hotaka; Fujiwara, Kento; Tokunaga, Yusuke; Hirobe, Sachiko; Nakagawa, Shinsaku; Okada, Naoki

    2016-01-01

    Adoptive immunotherapy using chimeric antigen receptor-expressing T (CAR-T) cells has attracted attention as an efficacious strategy for cancer treatment. To prove the efficacy and safety of CAR-T cell therapy, the elucidation of immunological mechanisms underlying it in mice is required. Although a retroviral vector (Rv) is mainly used for the introduction of CAR to murine T cells, gene transduction efficiency is generally less than 50%. The low transduction efficiency causes poor precision in the functional analysis of CAR-T cells. We attempted to improve the Rv gene transduction protocol to more efficiently generate functional CAR-T cells by optimizing the period of pre-cultivation and antibody stimulation. In the improved protocol, gene transduction efficiency to murine T cells was more than 90%. In addition, almost all of the prepared murine T cells expressed CAR after puromycin selection. These CAR-T cells had antigen-specific cytotoxic activity and secreted multiple cytokines by antigen stimulation. We believe that our optimized gene transduction protocol for murine T cells contributes to the advancement of T cell biology and development of immunotherapy using genetically engineered T cells. - Highlights: • We established highly efficient gene transduction protocols for murine T cells. • CD8"+ CAR-T cells had antigen-specific cytotoxic activity. • CD4"+ CAR-T cells secreted multiple cytokines by antigen stimulation. • This finding can contribute to the development of T-cell biology and immunotherapy.

  16. Highly efficient gene transfer using a retroviral vector into murine T cells for preclinical chimeric antigen receptor-expressing T cell therapy

    Energy Technology Data Exchange (ETDEWEB)

    Kusabuka, Hotaka; Fujiwara, Kento; Tokunaga, Yusuke; Hirobe, Sachiko; Nakagawa, Shinsaku, E-mail: nakagawa@phs.osaka-u.ac.jp; Okada, Naoki, E-mail: okada@phs.osaka-u.ac.jp

    2016-04-22

    Adoptive immunotherapy using chimeric antigen receptor-expressing T (CAR-T) cells has attracted attention as an efficacious strategy for cancer treatment. To prove the efficacy and safety of CAR-T cell therapy, the elucidation of immunological mechanisms underlying it in mice is required. Although a retroviral vector (Rv) is mainly used for the introduction of CAR to murine T cells, gene transduction efficiency is generally less than 50%. The low transduction efficiency causes poor precision in the functional analysis of CAR-T cells. We attempted to improve the Rv gene transduction protocol to more efficiently generate functional CAR-T cells by optimizing the period of pre-cultivation and antibody stimulation. In the improved protocol, gene transduction efficiency to murine T cells was more than 90%. In addition, almost all of the prepared murine T cells expressed CAR after puromycin selection. These CAR-T cells had antigen-specific cytotoxic activity and secreted multiple cytokines by antigen stimulation. We believe that our optimized gene transduction protocol for murine T cells contributes to the advancement of T cell biology and development of immunotherapy using genetically engineered T cells. - Highlights: • We established highly efficient gene transduction protocols for murine T cells. • CD8{sup +} CAR-T cells had antigen-specific cytotoxic activity. • CD4{sup +} CAR-T cells secreted multiple cytokines by antigen stimulation. • This finding can contribute to the development of T-cell biology and immunotherapy.

  17. Non- invasive in vivo analysis of a murine aortic graft using high resolution ultrasound microimaging

    International Nuclear Information System (INIS)

    Rowinska, Zuzanna; Zander, Simone; Zernecke, Alma; Jacobs, Michael; Langer, Stephan; Weber, Christian; Merx, Marc W.; Koeppel, Thomas A.

    2012-01-01

    Introduction: As yet, murine aortic grafts have merely been monitored histopathologically. The aim of our study was to examine how these grafts can be monitored in vivo and non-invasively by using high-resolution ultrasound microimaging to evaluate function and morphology. A further aim was to prove if this in vivo monitoring can be correlated to immunohistological data that indicates graft integrity. Methods: Murine infrarenal aortic isografts were orthotopically transplanted into 14 female mice (C57BL/6-Background) whereas a group of sham-operated animals (n = 10) served as controls. To assess the graft morphology and hemodynamics, we examined the mice over a post-operative period of 8 weeks with a sophisticated ultrasound system (Vevo 770, Visual Sonics). Results: The non-invasive graft monitoring was feasible in all transplanted mice. We could demonstrate a regular post-transplant graft function and morphology, such as anterior/posterior wall displacement and wall thickness. Mild alterations of anterior wall motion dynamics could only be observed at the site of distal graft anastomosis (8 weeks after grafting (transplant vs. sham mice: 0.02 mm ± 0.01 vs. 0.03 mm ± 0.01, p < 0.05). However, the integrity of the entire graft wall could be confirmed by histopathological evaluation of the grafts. Conclusions: With regard to graft patency, function and morphology, high resolution ultrasound microimaging has proven to be a valuable tool for longitudinal, non-invasive, in vivo graft monitoring in this murine aortic transplantation model. Consequently, this experimental animal model provides an excellent basis for molecular and pharmacological studies using genetically engineered mice.

  18. Murine Ileocolic Bowel Resection with Primary Anastomosis

    Science.gov (United States)

    Perry, Troy; Borowiec, Anna; Dicken, Bryan; Fedorak, Richard; Madsen, Karen

    2014-01-01

    Intestinal resections are frequently required for treatment of diseases involving the gastrointestinal tract, with Crohn’s disease and colon cancer being two common examples. Despite the frequency of these procedures, a significant knowledge gap remains in describing the inherent effects of intestinal resection on host physiology and disease pathophysiology. This article provides detailed instructions for an ileocolic resection with primary end-to-end anastomosis in mice, as well as essential aspects of peri-operative care to maximize post-operative success. When followed closely, this procedure yields a 95% long-term survival rate, no failure to thrive, and minimizes post-operative complications of bowel obstruction and anastomotic leak. The technical challenges of performing the procedure in mice are a barrier to its wide spread use in research. The skills described in this article can be acquired without previous surgical experience. Once mastered, the murine ileocolic resection procedure will provide a reproducible tool for studying the effects of intestinal resection in models of human disease. PMID:25406841

  19. Essential role of the TFIID subunit TAF4 in murine embryogenesis and embryonic stem cell differentiation

    OpenAIRE

    Langer, Diana; Martianov, Igor; Alpern, Daniel; Rhinn, Muriel; Keime, Celine; Dolle, Pascal; Mengus, Gabrielle; Davidson, Irwin

    2016-01-01

    TAF4 (TATA-binding protein-associated factor 4) and its paralogue TAF4b are components of the TFIID core module. We inactivated the murine Taf4a gene to address Taf4 function during embryogenesis. Here we show that Taf4a(-/-) embryos survive until E9.5 where primary germ layers and many embryonic structures are identified showing Taf4 is dispensable for their specification. In contrast, Taf4 is required for correct patterning of the trunk and anterior structures, ventral morphogenesis and pro...

  20. Glycoprotein VI/Fc receptor γ chain-independent tyrosine phosphorylation and activation of murine platelets by collagen

    OpenAIRE

    Jarvis, Gavin E.; Best, Denise; Watson, Steve P.

    2004-01-01

    We have investigated the ability of collagen to induce signalling and functional responses in suspensions of murine platelets deficient in the FcRγ (Fc receptor γ) chain, which lack the collagen receptor GPVI (glycoprotein VI). In the absence of the FcRγ chain, collagen induced a unique pattern of tyrosine phosphorylation which was potentiated by the thromboxane analogue U46619. Immunoprecipitation studies indicated that neither collagen alone nor the combination of collagen plus U46619 induc...

  1. Activation of the polyomavirus enhancer by a murine activator protein 1 (AP1) homolog and two contiguous proteins.

    OpenAIRE

    Martin, M E; Piette, J; Yaniv, M; Tang, W J; Folk, W R

    1988-01-01

    The polyomavirus enhancer is composed of multiple DNA sequence elements serving as binding sites for proteins present in mouse nuclear extracts that activate transcription and DNA replication. We have identified three such proteins and their binding sites and correlate them with enhancer function. Mutation of nucleotide (nt) 5140 in the enhancer alters the binding site (TGACTAA, nt 5139-5145) for polyomavirus enhancer A binding protein 1 (PEA1), a murine homolog of the human transcription fac...

  2. Analysis of cardiomyocyte movement in the developing murine heart

    Energy Technology Data Exchange (ETDEWEB)

    Hashimoto, Hisayuki [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan); Yuasa, Shinsuke, E-mail: yuasa@a8.keio.jp [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan); Tabata, Hidenori [Department of Anatomy, Keio University School of Medicine, Tokyo (Japan); Tohyama, Shugo; Seki, Tomohisa; Egashira, Toru; Hayashiji, Nozomi; Hattori, Fumiyuki; Kusumoto, Dai; Kunitomi, Akira; Takei, Makoto; Kashimura, Shin; Yozu, Gakuto; Shimojima, Masaya; Motoda, Chikaaki; Muraoka, Naoto [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan); Nakajima, Kazunori [Department of Anatomy, Keio University School of Medicine, Tokyo (Japan); Sakaue-Sawano, Asako; Miyawaki, Atsushi [Life Function and Dynamics, ERATO, JST, 2-1 Hirosawa, Wako-city, Saitama 351-0198 (Japan); Laboratory for Cell Function and Dynamics, Advanced Technology Development Group, Brain Science Institute, RIKEN, 2-1 Hirosawa, Wako-city, Saitama 351-0198 (Japan); Fukuda, Keiichi [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan)

    2015-09-04

    The precise assemblage of several types of cardiac precursors controls heart organogenesis. The cardiac precursors show dynamic movement during early development and then form the complicated heart structure. However, cardiomyocyte movements inside the newly organized mammalian heart remain unclear. We previously established the method of ex vivo time-lapse imaging of the murine heart to study cardiomyocyte behavior by using the Fucci (fluorescent ubiquitination-based cell cycle indicator) system, which can effectively label individual G1, S/G2/M, and G1/S-transition phase nuclei in living cardiomyocytes as red, green, and yellow, respectively. Global analysis of gene expression in Fucci green positive ventricular cardiomyocytes confirmed that cell cycle regulatory genes expressed in G1/S, S, G2/M, and M phase transitions were upregulated. Interestingly, pathway analysis revealed that many genes related to the cell cycle were significantly upregulated in the Fucci green positive ventricular cardiomyocytes, while only a small number of genes related to cell motility were upregulated. Time-lapse imaging showed that murine proliferating cardiomyocytes did not exhibit dynamic movement inside the heart, but stayed on site after entering the cell cycle. - Highlights: • We directly visualized cardiomyocyte movement inside the developing murine heart. • Cell cycle related genes were upregulated in the proliferating cardiomyocytes. • Time-lapse imaging revealed that proliferating murine cardiomyocytes stayed in place. • Murine ventricular cardiomyocytes proliferate on site during development.

  3. Murine Typhus: An Important Consideration for the Nonspecific Febrile Illness

    Directory of Open Access Journals (Sweden)

    Gurjot Basra

    2012-01-01

    Full Text Available Murine typhus is a widely distributed flea-borne infection caused by Rickettsia typhi. Symptoms of murine typhus are nonspecific and mimic a variety of other infectious diseases. We herein report a case of murine typhus in an area where the broad use of DDT in the mid-20th century has now made it a rare disease. The patient described presented with headache, fever, and a faint macular rash. Initial laboratory studies revealed a slight transaminase elevation. Further questioning revealed exposure to opossums, prompting the consideration of murine typhus as a diagnosis. Although typhus group antibodies were not present during the patient’s acute illness, empiric therapy with doxycycline was initiated, and the patient defervesced. One month after convalescence, the patient returned to clinic with serum that contained typhus group antibodies with an IgG titer of 1 : 1024. Murine typhus is an important consideration during the workup of a patient with a nonspecific febrile illness. Exposure to reservoir hosts and the flea vector place humans at risk for this disease. Clinician recognition of this entity is required for diagnosis and effective therapy.

  4. Mutational library analysis of selected amino acids in the receptor binding domain of envelope of Akv murine leukemia virus by conditionally replication competent bicistronic vectors

    DEFF Research Database (Denmark)

    Bahrami, Shervin; Jespersen, Thomas; Pedersen, Finn Skou

    2003-01-01

    The envelope protein of retroviruses is responsible for viral entry into host cells. Here, we describe a mutational library approach to dissect functional domains of the envelope protein involving a retroviral vector, which expresses both the envelope protein of Akv murine leukemia virus (MLV) an...

  5. Preclinical Murine Models for Lung Cancer: Clinical Trial Applications

    Directory of Open Access Journals (Sweden)

    Amelia Kellar

    2015-01-01

    Full Text Available Murine models for the study of lung cancer have historically been the backbone of preliminary preclinical data to support early human clinical trials. However, the availability of multiple experimental systems leads to debate concerning which model, if any, is best suited for a particular therapeutic strategy. It is imperative that these models accurately predict clinical benefit of therapy. This review provides an overview of the current murine models used to study lung cancer and the advantages and limitations of each model, as well as a retrospective evaluation of the uses of each model with respect to accuracy in predicting clinical benefit of therapy. A better understanding of murine models and their uses, as well as their limitations may aid future research concerning the development and implementation of new targeted therapies and chemotherapeutic agents for lung cancer.

  6. Murine Models of Gastric Corpus PreneoplasiaSummary

    Directory of Open Access Journals (Sweden)

    Christine P. Petersen

    2017-01-01

    Full Text Available Intestinal-type gastric adenocarcinoma evolves in a field of pre-existing metaplasia. Over the past 20 years, a number of murine models have been developed to address aspects of the physiology and pathophysiology of metaplasia induction. Although none of these models has achieved true recapitulation of the induction of adenocarcinoma, they have led to important insights into the factors that influence the induction and progression of metaplasia. Here, we review the pathologic definitions relevant to alterations in gastric corpus lineages and classification of metaplasia by specific lineage markers. In addition, we review present murine models of the induction and progression of spasmolytic polypeptide (TFF2–expressing metaplasia, the predominant metaplastic lineage observed in murine models. These models provide a basis for the development of a broader understanding of the physiological and pathophysiological roles of metaplasia in the stomach. Keywords: SPEM, Intestinal Metaplasia, Gastric Cancer, TFF2, Chief Cell, Hyperplasia

  7. Helicobacter pylori impairs murine dendritic cell responses to infection.

    Directory of Open Access Journals (Sweden)

    Ya-Hui Wang

    Full Text Available BACKGROUND: Helicobacter pylori, a human pathogen associated with chronic gastritis, peptic ulcer and gastric malignancies, is generally viewed as an extracellular microorganism. Here, we show that H. pylori replicates in murine bone marrow derived-dendritic cells (BMDCs within autophagosomes. METHODOLOGY/PRINCIPAL FINDINGS: A 10-fold increase of CFU is found between 2 h and 6 h p.i. in H. pylori-infected BMDCs. Autophagy is induced around the bacterium and participates at late time points of infection for the clearance of intracellular H. pylori. As a consequence of infection, LC3, LAMP1 and MHC class II molecules are retained within the H. pylori-containing vacuoles and export of MHC class II molecules to cell surface is blocked. However, formalin-fixed H. pylori still maintain this inhibitory activity in BMDC derived from wild type mice, but not in from either TLR4 or TLR2-deficient mice, suggesting the involvement of H. pylori-LPS in this process. TNF-alpha, IL-6 and IL-10 expression was also modulated upon infection showing a TLR2-specific dependent IL-10 secretion. No IL-12 was detected favoring the hypothesis of a down modulation of DC functions during H. pylori infection. Furthermore, antigen-specific T cells proliferation was also impaired upon infection. CONCLUSIONS/SIGNIFICANCE: H. pylori can infect and replicate in BMDCs and thereby affects DC-mediated immune responses. The implication of this new finding is discussed for the biological life cycle of H. pylori in the host.

  8. Murine model for congenital CMV infection and hearing impairment

    Directory of Open Access Journals (Sweden)

    Tao Liu

    2011-02-01

    Full Text Available Abstract Background Congenital cytomegalovirus (CMV infection is the leading cause of sensorineural hearing loss (SNHL, and SNHL is the most frequent sequela of congenital CMV infection. But the pathogenic mechanism remains unknown, and there is no ideal CMV intrauterine infection animal model to study the mechanisms by which SNHL develops. Methods We established the congenital murine cytomegalovirus (MCMV infection model by directly injecting the virus into the placenta on day 12.5 of gestation. Then, we observed the development and the MCMV congenital infection rate of the fetuses on the day they were born. Furthermore, we detected the auditory functions, the conditions of the MCMV infection, and the histological change of the inner ears of 28-day-old and 70-day-old offspring. Results Both the fetal loss rate and the teratism rate of offspring whose placentas were inoculated with MCMV increased, and their body length, head circumference, and weight decreased. The hearing level of offspring both decreased at both 28- and 70-days post birth; the 70-day-old mice developed lower hearing levels than did the 28-day old mice. No significant inflammatory changes in the cochleae of the mice were observed. MCMV DNA signals were mainly detected in the spiral ganglion neurons and the endolymph area, but not in the perilymph area. The number of neurons decreased, and their ultrastructures changed. Moreover, with age, the number of neurons dramatically decreased, and the ultrastructural lesions of neurons became much more severe. Conclusions The results suggest that the direct injection of MCMV into the placenta may efficiently cause fetal infection and disturb the intrauterine development of the fetus, and placental inoculation itself has no obvious adverse effects on offspring. The reduction in the number of spiral ganglion neurons and the ultrastructural lesions of the neurons may be the major cause of congenital CMV infection-induced progressive SNHL.

  9. Nuclear localization of Annexin A7 during murine brain development

    Directory of Open Access Journals (Sweden)

    Noegel Angelika A

    2005-04-01

    Full Text Available Abstract Background Annexin A7 is a member of the annexin protein family, which is characterized by its ability to interact with phospholipids in the presence of Ca2+-ions and which is thought to function in Ca2+-homeostasis. Results from mutant mice showed altered Ca2+-wave propagation in astrocytes. As the appearance and distribution of Annexin A7 during brain development has not been investigated so far, we focused on the distribution of Annexin A7 protein during mouse embryogenesis in the developing central nervous system and in the adult mouse brain. Results Annexin A7 is expressed in cells of the developing brain where a change in its subcellular localization from cytoplasm to nucleus was observed. In the adult CNS, the subcellular distribution of Annexin A7 depends on the cell type. By immunohistochemistry analysis Annexin A7 was detected in the cytosol of undifferentiated cells at embryonic days E5–E8. At E11–E15 the protein is still present in the cytosol of cells predominantly located in the ventricular germinative zone surrounding the lateral ventricle. Later on, at embryonic day E16, Annexin A7 in cells of the intermediate and marginal zone of the neopallium translocates to the nucleus. Neuronal cells of all areas in the adult brain present Annexin A7 in the nucleus, whereas glial fibrillary acidic protein (GFAP-positive astrocytes exhibit both, a cytoplasmic and nuclear staining. The presence of nuclear Annexin A7 was confirmed by extraction of the nucleoplasm from isolated nuclei obtained from neuronal and astroglial cell lines. Conclusion We have demonstrated a translocation of Annexin A7 to nuclei of cells in early murine brain development and the presence of Annexin A7 in nuclei of neuronal cells in the adult animal. The role of Annexin A7 in nuclei of differentiating and mature neuronal cells remains elusive.

  10. A rapid murine coma and behavior scale for quantitative assessment of murine cerebral malaria.

    Directory of Open Access Journals (Sweden)

    Ryan W Carroll

    Full Text Available BACKGROUND: Cerebral malaria (CM is a neurological syndrome that includes coma and seizures following malaria parasite infection. The pathophysiology is not fully understood and cannot be accounted for by infection alone: patients still succumb to CM, even if the underlying parasite infection has resolved. To that effect, there is no known adjuvant therapy for CM. Current murine CM (MCM models do not allow for rapid clinical identification of affected animals following infection. An animal model that more closely mimics the clinical features of human CM would be helpful in elucidating potential mechanisms of disease pathogenesis and evaluating new adjuvant therapies. METHODOLOGY/PRINCIPAL FINDINGS: A quantitative, rapid murine coma and behavior scale (RMCBS comprised of 10 parameters was developed to assess MCM manifested in C57BL/6 mice infected with Plasmodium berghei ANKA (PbA. Using this method a single mouse can be completely assessed within 3 minutes. The RMCBS enables the operator to follow the evolution of the clinical syndrome, validated here by correlations with intracerebral hemorrhages. It provides a tool by which subjects can be identified as symptomatic prior to the initiation of trial treatment. CONCLUSIONS/SIGNIFICANCE: Since the RMCBS enables an operator to rapidly follow the course of disease, label a subject as affected or not, and correlate the level of illness with neuropathologic injury, it can ultimately be used to guide the initiation of treatment after the onset of cerebral disease (thus emulating the situation in the field. The RMCBS is a tool by which an adjuvant therapy can be objectively assessed.

  11. Immunohistochemical Characterization of S100A6 in the Murine Ovary

    International Nuclear Information System (INIS)

    Hanaue, Mayu; Miwa, Naofumi; Takamatsu, Ken

    2012-01-01

    S100 proteins comprise a large family of Ca 2+ -binding proteins and exhibit a variety of intra- and extracellular functions. Despite our growing knowledge about the biology of S100 proteins in some tissues such as brain and smooth muscle, little is known about S100 proteins in the normal mammalian reproductive tissue. In the present study, we investigated the distribution pattern of S100A6 (alternatively named calcyclin) in the murine ovary by immunohistochemical study using specific antibody. S100A6 was localized substantially in the cytoplasm of luteal cells, with concomitant expression of S100A11, another S100 protein, but not in the other type of cells such as oocytes, follicle epithelial cells (granulosa cells), and cells of stroma including theca interna cells in the murine ovary. S100A6-immunoreactive corpora lutea (CLs) were divided into two types: homogeneously and heterogeneously stained CLs, and possibly they may represent differentiating and mature CL, respectively. Our regression analysis revealed that expression level of S100A6 positively correlated with that of cytochrome P450 11A, a steroidogenic enzyme in the heterogeously stained CL. These results suggested that S100A6 may contribute to differentiation of steroidogenic activity of luteal cells in a synergistic manner with S100A11 by facilitating some shared functions

  12. Nanoelectroablation therapy for murine basal cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Nuccitelli, Richard, E-mail: rich@bioelectromed.com [BioElectroMed Corp., 849 Mitten Rd., Suite 104, Burlingame, CA 94010 (United States); Tran, Kevin; Athos, Brian; Kreis, Mark; Nuccitelli, Pamela [BioElectroMed Corp., 849 Mitten Rd., Suite 104, Burlingame, CA 94010 (United States); Chang, Kris S.; Epstein, Ervin H. [The Children' s Hospital Oakland Research Institute, Oakland, CA 94609 (United States); Tang, Jean Y. [The Children' s Hospital Oakland Research Institute, Oakland, CA 94609 (United States); Stanford University, Stanford, CA 94305 (United States)

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer Nanoelectroablation is a new, non-thermal therapy that triggers apoptosis in tumors. Black-Right-Pointing-Pointer Low energy, ultrashort, high voltage pulses ablate the tumor with little or no scar. Black-Right-Pointing-Pointer Nanoelectroablation eliminates 99.8% of the BCC but may leave a few remnants behind. Black-Right-Pointing-Pointer Pilot clinical trials on human BCCs are ongoing and leave no remnants in most cases. -- Abstract: When skin tumors are exposed to non-thermal, low energy, nanosecond pulsed electric fields (nsPEF), apoptosis is initiated both in vitro and in vivo. This nanoelectroablation therapy has already been proven effective in treating subdermal murine allograft tumors. We wanted to determine if this therapy would be equally effective in the treatment of autochthonous BCC tumors in Ptch1{sup +/-}K14-Cre-ER p53 fl/fl mice. These tumors are similar to human BCCs in histology and in response to drug therapy . We have treated 27 BCCs across 8 mice with either 300 pulses of 300 ns duration or 2700 pulses of 100 ns duration, all at 30 kV/cm and 5-7 pulses per second. Every nsPEF-treated BCC began to shrink within a day after treatment and their initial mean volume of 36 {+-} 5 (SEM) mm{sup 3} shrunk by 76 {+-} 3% over the ensuing two weeks. After four weeks, they were 99.8% ablated if the size of the treatment electrode matched the tumor size. If the tumor was larger than the 4 mm wide electrode, multiple treatments were needed for complete ablation. Treated tumors were harvested for histological analysis at various times after treatment and exhibited apoptosis markers. Specifically, pyknosis of nuclei was evident as soon as 2 days after nsPEF treatment, and DNA fragmentation as detected via TUNEL staining was also evident post treatment. Nanoelectroablation is effective in triggering apoptosis and remission of radiation-induced BCCs with a single 6 min-long treatment of 2700 pulses.

  13. Cultivation of murine bone marrow macrophages in sponges: a method that permits recovery of viable cultured cells

    Energy Technology Data Exchange (ETDEWEB)

    Akporiaye, E T; Stewart, S; Stewart, C C

    1984-01-01

    Various investigators have cultured murine bone marrow or peritoneal cells in vitro on glass or plastic surfaces with the ultimate aim of retrieving adherent macrophages for morphologic and functional evaluation. The removal of these adherent macrophages by conventional techniques has been consistently accompanied by low yield and significant cell damage. The authors report here a simple technique for culturing murine bone marrow cells in gelatin sponges (Spongostan and Gelfoam) in growth medium containing 10% fetal bovine serum and 10% L-cell conditioned medium. Viable cells were retrieved from the sponges in 10 min by digestion with collagenase. The in situ growth kinetics were similar to those found for cells cultured on plastic dishes. The recovered cells were adherent, phagocytic, positive for Fc ..gamma.. receptors, and had esterase activity. 23 references, 1 figure, 1 table.

  14. Transgene stability for three replication competent murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Duch, M.; Carrasco, M.L.; Jespersen, T.

    2004-01-01

    cassette consisting of an internal ribosome entry site followed by the enhanced green fluorescent protein coding sequence inserted in different configurations into murine leukemia virus genomes. In two of the constructs, the insert was located in the upstream part of the U3 region while in the third...

  15. Murine alpha1-adrenoceptor subtypes. I. Radioligand binding studies

    NARCIS (Netherlands)

    Yang, M.; Reese, J.; Cotecchia, S.; Michel, M. C.

    1998-01-01

    Alpha1-adrenoceptors were identified in murine tissues by [3H]prazosin saturation binding studies, with a rank order of cerebral cortex > cerebellum > liver > lung > kidney > heart > spleen, with the spleen not exhibiting detectable expression. Competition binding studies were performed with

  16. Reversal of Liver Fibrosis in Chronic Murine Schistosomiasis ...

    African Journals Online (AJOL)

    NO Al-Harbi, SA Bahashwan, MS Aboonq, MA Ramadan, AA Bahashwan. Abstract. Purpose: To evaluate the safety, pharmacological effect and mechanism of action of an antifibrotic compound, safironil (SAF)/praziquantel (PZQ) combination on reversal of liver fibrogenesis in chronic murine Schistosomiasis mansoni.

  17. Protective antitumor activity induced by a fusion vaccine with murine ...

    African Journals Online (AJOL)

    Targeting angiogenesis is an effective strategy for anticancer therapy. The vascular endothelialcadherin (VE-cad) regulated angiogenesis is a potential target for anti-angiogenesis. Here, we develop a fusion vaccine plasmid DNA pSec-MBD2-VE-cad from VE-cad and murine beta defensin2 (MBD2) to induce immunity for ...

  18. Turnover of T cells in murine gammaherpesvirus 68-infected mice

    DEFF Research Database (Denmark)

    Hamilton-Easton, A M; Christensen, Jan Pravsgaard; Doherty, P C

    1999-01-01

    Respiratory challenge of C57BL/6 mice with murine gammaherpesvirus 68 induces proliferation of T lymphocytes early after infection, as evidenced by incorporation of the DNA precursor bromodeoxyuridine. Using pulse-chase analysis, splenic and peripheral blood activated T lymphocytes were found...

  19. Expression of biologically active murine interleukin-18 in Lactococcus lactis.

    Science.gov (United States)

    Feizollahzadeh, Sadegh; Khanahmad, Hossein; Rahimmanesh, Ilnaz; Ganjalikhani-Hakemi, Mazdak; Andalib, Alireza; Sanei, Mohammad Hossein; Rezaei, Abbas

    2016-11-01

    The food-grade bacterium Lactococcus lactis is increasingly used for heterologous protein expression in therapeutic and industrial applications. The ability of L. lactis to secrete biologically active cytokines may be used for the generation of therapeutic cytokines. Interleukin (IL)-18 enhances the immune response, especially on mucosal surfaces, emphasizing its therapeutic potential. However, it is produced as an inactive precursor and has to be enzymatically cleaved for maturation. We genetically manipulated L. lactis to secrete murine IL-18. The mature murine IL-18 gene was inserted downstream of a nisin promoter in pNZ8149 plasmid and the construct was used to transform L. lactis NZ3900. The transformants were selected on Elliker agar and confirmed by restriction enzyme digestion and sequencing. The expression and secretion of IL-18 protein was verified by SDS-PAGE, western blotting and ELISA. The biological activity of recombinant IL-18 was determined by its ability to induce interferon (IFN)-γ production in L. lactis co-cultured with murine splenic T cells. The amounts of IL-18 in bacterial lysates and supernatants were 3-4 μg mL -1 and 0.6-0.7 ng mL -1 , respectively. The successfully generated L. lactis strain that expressed biologically active murine IL-18 can be used to evaluate the possible therapeutic effects of IL-18 on mucosal surfaces. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Current Translational Research and Murine Models For Duchenne Muscular Dystrophy

    Science.gov (United States)

    Rodrigues, Merryl; Echigoya, Yusuke; Fukada, So-ichiro; Yokota, Toshifumi

    2016-01-01

    Duchenne muscular dystrophy (DMD) is an X-linked genetic disorder characterized by progressive muscle degeneration. Mutations in the DMD gene result in the absence of dystrophin, a protein required for muscle strength and stability. Currently, there is no cure for DMD. Since murine models are relatively easy to genetically manipulate, cost effective, and easily reproducible due to their short generation time, they have helped to elucidate the pathobiology of dystrophin deficiency and to assess therapies for treating DMD. Recently, several murine models have been developed by our group and others to be more representative of the human DMD mutation types and phenotypes. For instance, mdx mice on a DBA/2 genetic background, developed by Fukada et al., have lower regenerative capacity and exhibit very severe phenotype. Cmah-deficient mdx mice display an accelerated disease onset and severe cardiac phenotype due to differences in glycosylation between humans and mice. Other novel murine models include mdx52, which harbors a deletion mutation in exon 52, a hot spot region in humans, and dystrophin/utrophin double-deficient (dko), which displays a severe dystrophic phenotype due the absence of utrophin, a dystrophin homolog. This paper reviews the pathological manifestations and recent therapeutic developments in murine models of DMD such as standard mdx (C57BL/10), mdx on C57BL/6 background (C57BL/6-mdx), mdx52, dystrophin/utrophin double-deficient (dko), mdxβgeo, Dmd-null, humanized DMD (hDMD), mdx on DBA/2 background (DBA/2-mdx), Cmah-mdx, and mdx/mTRKO murine models. PMID:27854202

  1. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model.

    LENUS (Irish Health Repository)

    Monk, Ian R

    2010-01-01

    Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells.

  2. Effects of murine and human bone marrow-derived mesenchymal stem cells on cuprizone induced demyelination.

    Directory of Open Access Journals (Sweden)

    Jasmin Nessler

    Full Text Available For the treatment of patients with multiple sclerosis there are no regenerative approaches to enhance remyelination. Mesenchymal stem cells (MSC have been proposed to exert such regenerative functions. Intravenous administration of human MSC reduced the clinical severity of experimental autoimmune encephalomyelitis (EAE, an animal model mimicking some aspects of multiple sclerosis. However, it is not clear if this effect was achieved by systemic immunomodulation or if there is an active neuroregeneration in the central nervous system (CNS. In order to investigate remyelination and regeneration in the CNS we analysed the effects of intravenously and intranasally applied murine and human bone marrow-derived MSC on cuprizone induced demyelination, a toxic animal model which allows analysis of remyelination without the influence of the peripheral immune system. In contrast to EAE no effects of MSC on de- and remyelination and glial cell reactions were found. In addition, neither murine nor human MSC entered the lesions in the CNS in this toxic model. In conclusion, MSC are not directed into CNS lesions in the cuprizone model where the blood-brain-barrier is intact and thus cannot provide support for regenerative processes.

  3. Immunotoxicity and allergic potential induced by topical application of dimethyl carbonate (DMC) in a murine model

    Science.gov (United States)

    Anderson, Stacey E.; Franko, Jennifer; Anderson, Katie L.; Munson, Albert E.; Lukomska, Ewa; Meade, B. Jean

    2015-01-01

    Dimethyl carbonate (DMC) is an industrial chemical, used as a paint and adhesive solvent, with the potential for significant increases in production. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of DMC following dermal exposure using a murine model. Following a 28-day exposure, DMC produced a significant decrease in thymus weight at concentrations of 75% and greater. No effects on body weight, hematological parameters (erythrocytes, leukocytes, and their differentials), or immune cell phenotyping (B-cells, T-cells, and T-cell sub-sets) were identified. The IgM antibody response to sheep red blood cell (SRBC) was significantly reduced in the spleen but not the serum. DMC was not identified to be an irritant and evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50–100%, did not identify increases in lymphocyte proliferation. These results demonstrate that dermal exposure to DMC induces immune suppression in a murine model and raise concern about potential human exposure and the need for occupational exposure regulations. PMID:22953780

  4. CD40-mediated apoptosis in murine B-lymphoma lines containing mutated p53

    DEFF Research Database (Denmark)

    Hollmann, Annette C; Gong, Qiaoke; Owens, Trevor

    2002-01-01

    Crosslinking CD40 induces normal B-cells to proliferate and differentiate but causes many tumor cell lines to undergo apoptosis. As p53 is required for many apoptotic pathways, we analyzed the effects of CD40 ligation and their correlation with p53 function in four murine B-lymphoma lines. A20...... of detectable p21 mRNA in A20 and M12 cells. P21 mRNA was increased to detectable levels in M12 cells upon CD40 ligation; however, blocking this effect with the p53 inhibitor pifithrin had no effect on CD40-mediated apoptosis. Sequencing showed that p53 in A20 and M12 cells contained point mutations leading...... to amino acid substitutions in DNA binding regions, but was unmutated in WEHI231 and WEHI 279. These results suggest that CD40-mediated apoptosis can occur in the absence of functional p53....

  5. H4 histamine receptors mediate cell cycle arrest in growth factor-induced murine and human hematopoietic progenitor cells.

    Directory of Open Access Journals (Sweden)

    Anne-France Petit-Bertron

    Full Text Available The most recently characterized H4 histamine receptor (H4R is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional and protein levels and respond to its agonists by reduced growth factor-induced cell cycle progression that leads to decreased myeloid, erythroid and lymphoid colony formation. H4R activation prevents the induction of cell cycle genes through a cAMP/PKA-dependent pathway that is not associated with apoptosis. It is mediated specifically through H4R signaling since gene silencing or treatment with selective antagonists restores normal cell cycle progression. The arrest of growth factor-induced G1/S transition protects murine and human progenitor cells from the toxicity of the cell cycle-dependent anticancer drug Ara-C in vitro and reduces aplasia in a murine model of chemotherapy. This first evidence for functional H4R expression in hematopoietic progenitors opens new therapeutic perspectives for alleviating hematotoxic side effects of antineoplastic drugs.

  6. Stable integration of recombinant adeno-associated virus vector genomes after transduction of murine hematopoietic stem cells.

    Science.gov (United States)

    Han, Zongchao; Zhong, Li; Maina, Njeri; Hu, Zhongbo; Li, Xiaomiao; Chouthai, Nitin S; Bischof, Daniela; Weigel-Van Aken, Kirsten A; Slayton, William B; Yoder, Mervin C; Srivastava, Arun

    2008-03-01

    We previously reported that among single-stranded adeno-associated virus (ssAAV) vectors, serotypes 1 through 5, ssAAV1 is the most efficient in transducing murine hematopoietic stem cells (HSCs), but viral second-strand DNA synthesis remains a rate-limiting step. Subsequently, using double-stranded, self-complementary AAV (scAAV) vectors, serotypes 7 through 10, we observed that scAAV7 vectors also transduce murine HSCs efficiently. In the present study, we used scAAV1 and scAAV7 shuttle vectors to transduce HSCs in a murine bone marrow serial transplant model in vivo, which allowed examination of the AAV proviral integration pattern in the mouse genome, as well as recovery and nucleotide sequence analyses of AAV-HSC DNA junction fragments. The proviral genomes were stably integrated, and integration sites were localized to different mouse chromosomes. None of the integration sites was found to be in a transcribed gene, or near a cellular oncogene. None of the animals, monitored for up to 1 year, exhibited pathological abnormalities. Thus, AAV proviral integration-induced risk of oncogenesis was not found in our study, which provides functional confirmation of stable transduction of self-renewing multipotential HSCs by scAAV vectors as well as promise for the use of these vectors in the potential treatment of disorders of the hematopoietic system.

  7. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    International Nuclear Information System (INIS)

    Nishikado, Hideto; Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko; Ogawa, Hideoki; Okumura, Ko; Takai, Toshiro

    2015-01-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity

  8. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    Energy Technology Data Exchange (ETDEWEB)

    Nishikado, Hideto [Atopy (Allergy) Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan); Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko [Laboratory of Proteomics and Biomolecular Science, BioMedical Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan); Ogawa, Hideoki; Okumura, Ko [Atopy (Allergy) Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan); Takai, Toshiro, E-mail: t-takai@juntendo.ac.jp [Atopy (Allergy) Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan)

    2015-05-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity.

  9. Characterisation of Neutropenia-Associated Neutrophil Elastase Mutations in a Murine Differentiation Model In Vitro and In Vivo.

    Directory of Open Access Journals (Sweden)

    Michael Wiesmeier

    Full Text Available Severe congenital neutropenia (SCN is characterised by a differentiation block in the bone marrow and low neutrophil numbers in the peripheral blood, which correlates with increased risk of bacterial infections. Several underlying gene defects have been identified in SCN patients. Mutations in the neutrophil elastase (ELANE gene are frequently found in SCN and cyclic neutropenia. Both mislocalization and misfolding of mutant neutrophil elastase protein resulting in ER stress and subsequent induction of the unfolded protein response (UPR have been proposed to be responsible for neutrophil survival and maturation defects. However, the detailed molecular mechanisms still remain unclear, in part due to the lack of appropriate in vitro and in vivo models. Here we used a system of neutrophil differentiation from immortalised progenitor lines by conditional expression of Hoxb8, permitting the generation of mature near-primary neutrophils in vitro and in vivo. NE-deficient Hoxb8 progenitors were reconstituted with murine and human forms of typical NE mutants representative of SCN and cyclic neutropenia, and differentiation of the cells was analysed in vitro and in vivo. ER stress induction by NE mutations could be recapitulated during neutrophil differentiation in all NE mutant-reconstituted Hoxb8 cells. Despite ER stress induction, no change in survival, maturation or function of differentiating cells expressing either murine or human NE mutants was observed. Further analysis of in vivo differentiation of Hoxb8 cells in a murine model of adoptive transfer did not reveal any defects in survival or differentiation in the mouse. Although the Hoxb8 system has been found to be useful for dissection of defects in neutrophil development, our findings indicate that the use of murine systems for analysis of NE-mutation-associated pathogenesis is complicated by differences between humans and mice in the physiology of granulopoiesis, which may go beyond possible

  10. Newly Identified TLR9 Stimulant, M6-395 Is a Potent Polyclonal Activator for Murine B Cells.

    Science.gov (United States)

    Park, Mi-Hee; Jung, Yu-Jin; Kim, Pyeung-Hyeun

    2012-02-01

    Toll-like receptors (TLRs) have been extensively studied in recent years. However, functions of these molecules in murine B cell biology are largely unknown. A TLR4 stimulant, LPS is well known as a powerful polyclonal activator for murine B cells. In this study, we explored the effect of a murine TLR9 stimulant, M6-395 (a synthetic CpG ODNs) on B cell proliferation and Ig production. First, M6-395 was much more potent than LPS in augmenting B cell proliferation. As for Ig expression, M6-395 facilitated the expression of both TGF-β1-induced germ line transcript α (GLTα) and IL-4-induced GLTγ1 as levels as those by LPS and Pam3CSK4 (TLR1/2 agonist) : a certain Ig GLT expression is regarded as an indicative of the corresponding isotype switching recombination. However, IgA and IgG1 secretion patterns were quite different--these Ig isotype secretions by M6-395 were much less than those by LPS and Pam3CSK4. Moreover, the increase of IgA and IgG1 production by LPS and Pam3CSK4 was virtually abrogated by M6-395. The same was true for the secretion of IgG3. We found that this unexpected phenomena provoked by M6-395 is attributed, at least in part, to its excessive mitogenic nature. Taken together, these results suggest that M6-395 can act as a murine polyclonal activator but its strong mitogenic activity is unfavorable to Ig isotype switching.

  11. Poly-thymidine oligonucleotides mediate activation of murine glial cells primarily through TLR7, not TLR8.

    Directory of Open Access Journals (Sweden)

    Min Du

    Full Text Available The functional role of murine TLR8 in the inflammatory response of the central nervous system (CNS remains unclear. Murine TLR8 does not appear to respond to human TLR7/8 agonists, due to a five amino acid deletion in the ectodomain. However, recent studies have suggested that murine TLR8 may be stimulated by alternate ligands, which include vaccinia virus DNA, phosphothioate oligodeoxynucleotides (ODNs or the combination of phosphothioate poly-thymidine oligonucleotides (pT-ODNs with TLR7/8 agonists. In the current study, we analyzed the ability of pT-ODNs to induce activation of murine glial cells in the presence or absence of TLR7/8 agonists. We found that TLR7/8 agonists induced the expression of glial cell activation markers and induced the production of multiple proinflammatory cytokines and chemokines in mixed glial cultures. In contrast, pT-ODNs alone induced only low level expression of two cytokines, CCL2 and CXCL10. The combination of pT-ODNs along with TLR7/8 agonists induced a synergistic response with substantially higher levels of proinflammatory cytokines and chemokines compared to CL075. This enhancement was not due to cellular uptake of the agonist, indicating that the pT-ODN enhancement of cytokine responses was due to effects on an intracellular process. Interestingly, this response was also not due to synergistic stimulation of both TLR7 and TLR8, as the loss of TLR7 abolished the activation of glial cells and cytokine production. Thus, pT-ODNs act in synergy with TLR7/8 agonists to induce strong TLR7-dependent cytokine production in glial cells, suggesting that the combination of pT-ODNs with TLR7 agonists may be a useful mechanism to induce pronounced glial activation in the CNS.

  12. Adenoviral-mediated correction of methylmalonyl-CoA mutase deficiency in murine fibroblasts and human hepatocytes

    Directory of Open Access Journals (Sweden)

    Korson Mark

    2007-04-01

    Full Text Available Abstract Background Methylmalonic acidemia (MMA, a common organic aciduria, is caused by deficiency of the mitochondrial localized, 5'deoxyadenosylcobalamin dependent enzyme, methylmalonyl-CoA mutase (MUT. Liver transplantation in the absence of gross hepatic dysfunction provides supportive therapy and metabolic stability in severely affected patients, which invites the concept of using cell and gene delivery as future treatments for this condition. Methods To assess the effectiveness of gene delivery to restore the defective metabolism in this disorder, adenoviral correction experiments were performed using murine Mut embryonic fibroblasts and primary human methylmalonyl-CoA mutase deficient hepatocytes derived from a patient who harbored two early truncating mutations, E224X and R228X, in the MUT gene. Enzymatic and expression studies were used to assess the extent of functional correction. Results Primary hepatocytes, isolated from the native liver after removal subsequent to a combined liver-kidney transplantation procedure, or Mut murine fibroblasts were infected with a second generation recombinant adenoviral vector that expressed the murine methylmalonyl-CoA mutase as well as eGFP from distinct promoters. After transduction, [1-14C] propionate macromolecular incorporation studies and Western analysis demonstrated complete correction of the enzymatic defect in both cell types. Viral reconstitution of enzymatic expression in the human methylmalonyl-CoA mutase deficient hepatocytes exceeded that seen in fibroblasts or control hepatocytes. Conclusion These experiments provide proof of principle for viral correction in methylmalonic acidemia and suggest that hepatocyte-directed gene delivery will be an effective therapeutic treatment strategy in both murine models and in human patients. Primary hepatocytes from a liver that was unsuitable for transplantation provided an important resource for these studies.

  13. Accumulation of murine amyloid-β mimics early Alzheimer's disease.

    Science.gov (United States)

    Krohn, Markus; Bracke, Alexander; Avchalumov, Yosef; Schumacher, Toni; Hofrichter, Jacqueline; Paarmann, Kristin; Fröhlich, Christina; Lange, Cathleen; Brüning, Thomas; von Bohlen Und Halbach, Oliver; Pahnke, Jens

    2015-08-01

    Amyloidosis mouse models of Alzheimer's disease are generally established by transgenic approaches leading to an overexpression of mutated human genes that are known to be involved in the generation of amyloid-β in Alzheimer's families. Although these models made substantial contributions to the current knowledge about the 'amyloid hypothesis' of Alzheimer's disease, the overproduction of amyloid-β peptides mimics only inherited (familiar) Alzheimer's disease, which accounts for patients with Alzheimer's disease. The inherited form is even regarded a 'rare' disease according to the regulations for funding of the European Union (www.erare.eu). Here, we show that mice that are double-deficient for neprilysin (encoded by Mme), one major amyloid-β-degrading enzyme, and the ABC transporter ABCC1, a major contributor to amyloid-β clearance from the brain, develop various aspects of sporadic Alzheimer's disease mimicking the clinical stage of mild cognitive impairment. Using behavioural tests, electrophysiology and morphological analyses, we compared different ABC transporter-deficient animals and found that alterations are most prominent in neprilysin × ABCC1 double-deficient mice. We show that these mice have a reduced probability to survive, show increased anxiety in new environments, and have a reduced working memory performance. Furthermore, we detected morphological changes in the hippocampus and amygdala, e.g. astrogliosis and reduced numbers of synapses, leading to defective long-term potentiation in functional measurements. Compared to human, murine amyloid-β is poorly aggregating, due to changes in three amino acids at N-terminal positions 5, 10, and 13. Interestingly, our findings account for the action of early occurring amyloid-β species/aggregates, i.e. monomers and small amyloid-β oligomers. Thus, neprilysin × ABCC1 double-deficient mice present a new model for early effects of amyloid-β-related mild cognitive impairment that allows investigations

  14. Developmental constraints revealed by co-variation within and among molar rows in two murine rodents.

    Science.gov (United States)

    Renaud, Sabrina; Pantalacci, Sophie; Quéré, Jean-Pierre; Laudet, Vincent; Auffray, Jean-Christophe

    2009-01-01

    Morphological integration corresponds to interdependency between characters that can arise from several causes. Proximal causes of integration include that different phenotypic features may share common genetic sets and/or interact during their development. Ultimate causes may be the prolonged effect of selection favoring integration of functionally interacting characters, achieved by the molding of these proximal causes. Strong and direct interactions among successive teeth of a molar row are predicted by genetic and developmental evidences. Functional constraints related to occlusion, however, should have selected more strongly for a morphological integration of occluding teeth and a corresponding evolution of the underlying developmental and genetic pathways. To investigate how these predictions match the patterns of phenotypic integration, we studied the co-variation among the six molars of the murine molar row, focusing on two populations of house mice (Mus musculus domesticus) and wood mice (Apodemus sylvaticus). The size and shape of the three upper and lower molars were quantified and compared. Our results evidenced similar patterns in both species, size being more integrated than shape among all the teeth, and both size and shape co-varying strongly between adjacent teeth, but also between occluding teeth. Strong co-variation within each molar row is in agreement with developmental models showing a cascade influence of the first molar on the subsequent molars. In contrast, the strong co-variation between molars of the occluding tooth rows confirms that functional constraints molded patterns of integration and probably the underlying developmental pathways despite the low level of direct developmental interactions occurring among molar rows. These patterns of co-variation are furthermore conserved between the house mouse and the wood mouse that diverged >10 Ma, suggesting that they may constitute long-running constraints to the diversification of the murine

  15. Fitness of isogenic colony morphology variants of Pseudomonas aeruginosa in murine airway infection.

    Directory of Open Access Journals (Sweden)

    Elza Rakhimova

    Full Text Available Chronic lung infections with Pseudomonas aeruginosa are associated with the diversification of the persisting clone into niche specialists and morphotypes, a phenomenon called 'dissociative behaviour'. To explore the potential of P. aeruginosa to change its morphotype by single step loss-of-function mutagenesis, a signature-tagged mini-Tn5 plasposon library of the cystic fibrosis airway isolate TBCF10839 was screened for colony morphology variants under nine different conditions in vitro. Transposon insertion into 1% of the genome changed colony morphology into eight discernable morphotypes. Half of the 55 targets encode features of primary or secondary metabolism whereby quinolone production was frequently affected. In the other half the transposon had inserted into genes of the functional categories transport, regulation or motility/chemotaxis. To mimic dissociative behaviour of isogenic strains in lungs, pools of 25 colony morphology variants were tested for competitive fitness in an acute murine airway infection model. Six of the 55 mutants either grew better or worse in vivo than in vitro, respectively. Metabolic proficiency of the colony morphology variant was a key determinant for survival in murine airways. The most common morphotype of self-destructive autolysis did unexpectedly not impair fitness. Transposon insertions into homologous genes of strain PAO1 did not reproduce the TBCF10839 mutant morphotypes for 16 of 19 examined loci pointing to an important role of the genetic background on colony morphology. Depending on the chosen P. aeruginosa strain, functional genome scans will explore other areas of the evolutionary landscape. Based on our discordant findings of mutant phenotypes in P. aeruginosa strains PAO1, PA14 and TBCF10839, we conclude that the current focus on few reference strains may miss modes of niche adaptation and dissociative behaviour that are relevant for the microevolution of complex traits in the wild.

  16. Antibody responses against xenotropic murine leukemia virus-related virus envelope in a murine model.

    Directory of Open Access Journals (Sweden)

    Natalia Makarova

    2011-04-01

    Full Text Available Xenotropic murine leukemia virus-related virus (XMRV was recently discovered to be the first human gammaretrovirus that is associated with chronic fatigue syndrome and prostate cancer (PC. Although a mechanism for XMRV carcinogenesis is yet to be established, this virus belongs to the family of gammaretroviruses well known for their ability to induce cancer in the infected hosts. Since its original identification XMRV has been detected in several independent investigations; however, at this time significant controversy remains regarding reports of XMRV detection/prevalence in other cohorts and cell type/tissue distribution. The potential risk of human infection, coupled with the lack of knowledge about the basic biology of XMRV, warrants further research, including investigation of adaptive immune responses. To study immunogenicity in vivo, we vaccinated mice with a combination of recombinant vectors expressing codon-optimized sequences of XMRV gag and env genes and virus-like particles (VLP that had the size and morphology of live infectious XMRV.Immunization elicited Env-specific binding and neutralizing antibodies (NAb against XMRV in mice. The peak titers for ELISA-binding antibodies and NAb were 1:1024 and 1:464, respectively; however, high ELISA-binding and NAb titers were not sustained and persisted for less than three weeks after immunizations.Vaccine-induced XMRV Env antibody titers were transiently high, but their duration was short. The relatively rapid diminution in antibody levels may in part explain the differing prevalences reported for XMRV in various prostate cancer and chronic fatigue syndrome cohorts. The low level of immunogenicity observed in the present study may be characteristic of a natural XMRV infection in humans.

  17. Three-dimensional alginate spheroid culture system of murine osteosarcoma.

    Science.gov (United States)

    Akeda, Koji; Nishimura, Akinobu; Satonaka, Haruhiko; Shintani, Ken; Kusuzaki, Katsuyuki; Matsumine, Akihiko; Kasai, Yuichi; Masuda, Koichi; Uchida, Atsumasa

    2009-11-01

    Osteosarcoma (OS) is the most common primary malignant tumor of the bone and often forms pulmonary metastases, which are the most important prognostic factor. For further elucidation of the mechanism underlying the progression and metastasis of human OS, a culture system mimicking the microenvironment of the tumor in vivo is needed. We report a novel three-dimensional (3D) alginate spheroid culture system of murine osteosarcoma. Two different metastatic clones, the parental Dunn and its derivative line LM8, which has a higher metastatic potential to the lungs, were encapsulated in alginate beads to develop the 3D culture system. The beads containing murine OS cells were also transplanted into mice to determine their metastatic potential in vivo. In this culture system, murine OS cells encapsulated in alginate beads were able to grow in a 3D structure with cells detaching from the alginate environment. The number of detaching cells was higher in the LM8 cell line than the Dunn cell line. In the in vivo alginate bead transplantation model, the rate of pulmonary metastasis was higher with LM8 cells compared with that of Dunn cells. The cell characteristics and kinetics in this culture system closely reflect the original malignant potential of the cells in vivo.

  18. Enhancement of tumor radioresponse by combined chemotherapy in murine hepatocarcinoma

    International Nuclear Information System (INIS)

    Seong, Jin Sil; Kim, Sung Hee; Suh, Chang Ok

    2000-01-01

    The purpose of this study was to identify drugs that can enhance radioresponse of murine hepatocarcinoma. C3H/HeJ mice bearing 8 mm tumors of murine hepatocarcinoma, HCa-l, were treated with 25 Gy radiation and one of the following drugs: 5-Fu, 150 mg/kg; adriamycin, 8 mg/kg; cisplatin, 6 mg/kg; paclitaxel, 40 mg/kg; and gemcitabine, 50 mg/kg. Tumor response to the treatment was determined by tumor growth delay assay and by enhancement factor. Apoptotic level was assessed in tissue sections. Expression of regulating molecules was analyzed by western blotting for p53, 8c1-2, Sax, Bel-XL, Bd-XS, and p21 WAF1/CIP1 . Among the drugs tested, only gemcitabine enhanced the antitumor effect of radiation, with enhancement factor of 1.6. Induction of apoptosis by a combination of gerncitabine and radiation was shown as only additive level. In analysis of radiation-induced expression of regulating molecules, the most significant change by combining gemcitabine was activation of p21 WAF1/CIP1 . Gemcitabine is the first drug showing an enhancement of radioresponse in murine hepatocarcinoma, when combined with radiation. The key element of enhancement is thought to be p21 WAF1/CIP1

  19. Enhancement of tumor radioresponse by combined chemotherapy in murine hepatocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Seong, Jin Sil; Kim, Sung Hee; Suh, Chang Ok [College of Medicine, Yonsei Univ., Seoul (Korea, Republic of)

    2000-12-01

    The purpose of this study was to identify drugs that can enhance radioresponse of murine hepatocarcinoma. C3H/HeJ mice bearing 8 mm tumors of murine hepatocarcinoma, HCa-l, were treated with 25 Gy radiation and one of the following drugs: 5-Fu, 150 mg/kg; adriamycin, 8 mg/kg; cisplatin, 6 mg/kg; paclitaxel, 40 mg/kg; and gemcitabine, 50 mg/kg. Tumor response to the treatment was determined by tumor growth delay assay and by enhancement factor. Apoptotic level was assessed in tissue sections. Expression of regulating molecules was analyzed by western blotting for p53, 8c1-2, Sax, Bel-XL, Bd-XS, and p21{sup WAF1/CIP1}. Among the drugs tested, only gemcitabine enhanced the antitumor effect of radiation, with enhancement factor of 1.6. Induction of apoptosis by a combination of gerncitabine and radiation was shown as only additive level. In analysis of radiation-induced expression of regulating molecules, the most significant change by combining gemcitabine was activation of p21 {sup WAF1/CIP1}. Gemcitabine is the first drug showing an enhancement of radioresponse in murine hepatocarcinoma, when combined with radiation. The key element of enhancement is thought to be p21{sup WAF1/CIP1}.

  20. Murine Colitis is Mediated by Vimentin

    OpenAIRE

    Mor-Vaknin, Nirit; Legendre, Maureen; Yu, Yue; Serezani, Carlos H. C.; Garg, Sanjay K.; Jatzek, Anna; Swanson, Michael D.; Gonzalez-Hernandez, Marta J.; Teitz-Tennenbaum, Seagal; Punturieri, Antonello; Engleberg, N. Cary; Banerjee, Ruma; Peters-Golden, Marc; Kao, John Y.; Markovitz, David M.

    2013-01-01

    Vimentin, an abundant intermediate filament protein, presumably has an important role in stabilizing intracellular architecture, but its function is otherwise poorly understood. In a vimentin knockout (Vim KO) mouse model, we note that Vim KO mice challenged with intraperitoneal Escherichia coli control bacterial infection better than do wild-type (WT) mice. In vitro, Vim KO phagocytes show significantly increased capacity to mediate bacterial killing by abundant production of reactive oxygen...

  1. Circulating endothelial progenitor cells do not contribute to regeneration of endothelium after murine arterial injury

    DEFF Research Database (Denmark)

    Hagensen, Mette; Raarup, Merete Krog; Mortensen, Martin Bødtker

    2012-01-01

    into endothelial cells (ECs). We tested this theory in a murine arterial injury model using carotid artery transplants and fluorescent reporter mice. METHODS AND RESULTS: Wire-injured carotid artery segments from wild-type mice were transplanted into TIE2-GFP transgenic mice expressing green fluorescent protein...... (GFP) in ECs. We found that the endothelium regenerated with GFP(+) ECs as a function of time, evolving from the anastomosis sites towards the centre of the transplant. A migration front of ECs at Day 7 was verified by scanning electron microscopy and by bright-field microscopy using recipient TIE2-lac......Z mice with endothelial β-galactosidase expression. These experiments indicated migration of flanking ECs rather than homing of circulating cells as the underlying mechanism. To confirm this, we interposed non-injured wild-type carotid artery segments between the denuded transplant and the TIE2-GFP...

  2. Isolation of Eosinophils from the Lamina Propria of the Murine Small Intestine.

    Science.gov (United States)

    Berek, Claudia; Beller, Alexander; Chu, Van Trung

    2016-01-01

    Only recently has it become apparent that eosinophils play a crucial role in mucosal immune homeostasis. Although eosinophils are the main cellular component of the lamina propria of the gastrointestinal tract, they have often been overlooked because they express numerous markers, which are normally used to characterize macrophages and/or dendritic cells. To study their function in mucosal immunity, it is important to isolate them with high purity and viability. Here, we describe a protocol to purify eosinophils from the lamina propria of the murine small intestine. The method involves preparation of the small intestine, removal of epithelial cells and digestion of the lamina propria to release eosinophils. A protocol to sort eosinophils is included.

  3. Anti-tumour therapeutic efficacy of OX40L in murine tumour model.

    Science.gov (United States)

    Ali, Selman A; Ahmad, Murrium; Lynam, June; McLean, Cornelia S; Entwisle, Claire; Loudon, Peter; Choolun, Esther; McArdle, Stephanie E B; Li, Geng; Mian, Shahid; Rees, Robert C

    2004-09-09

    OX40 ligand (OX40L), a member of TNF superfamily, is a co-stimulatory molecule involved in T cell activation. Systemic administration of mOX40L fusion protein significantly inhibited the growth of experimental lung metastasis and subcutaneous (s.c.) established colon (CT26) and breast (4T1) carcinomas. Vaccination with OX40L was significantly enhanced by combination treatment with intra-tumour injection of a disabled infectious single cycle-herpes simplex virus (DISC-HSV) vector encoding murine granulocyte macrophage-colony stimulating factor (mGM-CSF). Tumour rejection in response to OX40L therapy required functional CD4+ and CD8+ T cells and correlated with splenocyte cytotoxic T lymphocytes (CTLs) activity against the AH-1 gp70 peptide of the tumour associated antigen expressed by CT26 cells. These results demonstrate the potential role of the OX40L in cancer immunotherapy.

  4. The Role of the MHV Receptor and Related Glycoproteins in Murine Hepatitis Virus Infection of Murine Cell Lines

    Science.gov (United States)

    1995-04-13

    vaccinia virus-T7 RNA polymerase s y stem for e xpression of target genes . Mol . Cell . BioI . 7 : 2538-2544 . Gagneten , S ., Gout , 0 ., Dubois-Dalcq...glycoprotein. These results showed f or the first time that two murine CEA- related genes can be co-expressed in some cell lines from inbred mice...49 Southern Hybridization ................ . ............ 50 Subcloning of PCR Products and Gene Cloning ........ 51 Growth

  5. Characterization of a Murine Model of Bioequivalent Bladder Wound Healing and Repair Following Subtotal Cystectomy

    Directory of Open Access Journals (Sweden)

    Mona Zarifpour

    2017-05-01

    Full Text Available Previous work demonstrated restoration of a bioequivalent bladder within 8 weeks of removing the majority of the bladder (subtotal cystectomy or STC in rats. The goal of the present study was to extend our investigations of bladder repair to the murine model, to harness the power of mouse genetics to delineate the cellular and molecular mechanisms responsible for the observed robust bladder regrowth. Female C57 black mice underwent STC, and at 4, 8, and 12 weeks post-STC, bladder repair and function were assessed via cystometry, ex vivo pharmacologic organ bath studies, and T2-weighted magnetic resonance imaging (MRI. Histology was also performed to measure bladder wall thickness. We observed a time-dependent increase in bladder capacity (BC following STC, such that 8 and 12 weeks post-STC, BC and micturition volumes were indistinguishable from those of age-matched non-STC controls and significantly higher than observed at 4 weeks. MRI studies confirmed that bladder volume was indistinguishable within 3 months (11 weeks post-STC. Additionally, bladders emptied completely at all time points studied (i.e., no increases in residual volume, consistent with functional bladder repair. At 8 and 12 weeks post-STC, there were no significant differences in bladder wall thickness or in the different components (urothelium, lamina propria, or smooth muscle layers of the bladder wall compared with age-matched control animals. The maximal contractile response to pharmacological activation and electrical field stimulation increased over time in isolated tissue strips from repaired bladders but remained lower at all time points compared with controls. We have established and validated a murine model for the study of de novo organ repair that will allow for further mechanistic studies of this phenomenon after, for example, genetic manipulation.

  6. A simple quantitative model of macromolecular crowding effects on protein folding: Application to the murine prion protein(121-231)

    Science.gov (United States)

    Bergasa-Caceres, Fernando; Rabitz, Herschel A.

    2013-06-01

    A model of protein folding kinetics is applied to study the effects of macromolecular crowding on protein folding rate and stability. Macromolecular crowding is found to promote a decrease of the entropic cost of folding of proteins that produces an increase of both the stability and the folding rate. The acceleration of the folding rate due to macromolecular crowding is shown to be a topology-dependent effect. The model is applied to the folding dynamics of the murine prion protein (121-231). The differential effect of macromolecular crowding as a function of protein topology suffices to make non-native configurations relatively more accessible.

  7. Lineage-Specific Responses of Tooth Shape in Murine Rodents (Murinae, Rodentia) to Late Miocene Dietary Change in the Siwaliks of Pakistan

    OpenAIRE

    Kimura, Yuri; Jacobs, Louis L.; Flynn, Lawrence J.

    2013-01-01

    Past ecological responses of mammals to climate change are recognized in the fossil record by adaptive significance of morphological variations. To understand the role of dietary behavior on functional adaptations of dental morphology in rodent evolution, we examine evolutionary change of tooth shape in late Miocene Siwalik murine rodents, which experienced a dietary shift toward C4 diets during late Miocene ecological change indicated by carbon isotopic evidence. Geometric morphometric analy...

  8. An HSEF for murine myeloid leukemia

    Energy Technology Data Exchange (ETDEWEB)

    Bond, V.P.; Cronkite, E.P.; Bullis, J.E. [Brookhaven National Lab., Upton, NY (United States); Wuu, C.S.; Marino, S.A.; Zaider, M. [Columbia Univ., New York, NY (United States). Dept. of Radiation Oncology

    1996-10-01

    In the past decade, a large amount of effort has gone into the development of hit size effectiveness functions (HSEFs), with the ultimate aim of replacing the present absorbed dose-RBE-Q system. However, the absorbed dose determined at the tissue level is incapable of providing information on single hits on (doses to) the single cell. As a result, it is necessary to resort to microdosimetry, which is capable of providing not only the number of hits on cells, but the distribution of hit sizes as well. From this information, an HSEF can be derived. However, to date there have been no sets of data available on animals exposed to radiations of several qualities, and for which microdosimetric data were available. The objective of the present set of experiments was to remedy this situation. Large numbers of mice were exposed to radiations of several different qualities, and were observed throughout their entire lifespan for the appearance of myeloid leukemia. The HSEF developed for this neoplasm is presented and discussed.

  9. An HSEF for murine myeloid leukemia

    International Nuclear Information System (INIS)

    Bond, V.P.; Cronkite, E.P.; Bullis, J.E.; Wuu, C.S.; Marino, S.A.; Zaider, M.

    1996-01-01

    In the past decade, a large amount of effort has gone into the development of hit size effectiveness functions (HSEFs), with the ultimate aim of replacing the present absorbed dose-RBE-Q system. However, the absorbed dose determined at the tissue level is incapable of providing information on single hits on (doses to) the single cell. As a result, it is necessary to resort to microdosimetry, which is capable of providing not only the number of hits on cells, but the distribution of hit sizes as well. From this information, an HSEF can be derived. However, to date there have been no sets of data available on animals exposed to radiations of several qualities, and for which microdosimetric data were available. The objective of the present set of experiments was to remedy this situation. Large numbers of mice were exposed to radiations of several different qualities, and were observed throughout their entire lifespan for the appearance of myeloid leukemia. The HSEF developed for this neoplasm is presented and discussed

  10. Broadband acoustic properties of a murine skull.

    Science.gov (United States)

    Estrada, Héctor; Rebling, Johannes; Turner, Jake; Razansky, Daniel

    2016-03-07

    It has been well recognized that the presence of a skull imposes harsh restrictions on the use of ultrasound and optoacoustic techniques in the study, treatment and modulation of the brain function. We propose a rigorous modeling and experimental methodology for estimating the insertion loss and the elastic constants of the skull over a wide range of frequencies and incidence angles. A point-source-like excitation of ultrawideband acoustic radiation was induced via the absorption of nanosecond duration laser pulses by a 20 μm diameter microsphere. The acoustic waves transmitted through the skull are recorded by a broadband, spherically focused ultrasound transducer. A coregistered pulse-echo ultrasound scan is subsequently performed to provide accurate skull geometry to be fed into an acoustic transmission model represented in an angular spectrum domain. The modeling predictions were validated by measurements taken from a glass cover-slip and ex vivo adult mouse skulls. The flexible semi-analytical formulation of the model allows for seamless extension to other transducer geometries and diverse experimental scenarios involving broadband acoustic transmission through locally flat solid structures. It is anticipated that accurate quantification and modeling of the skull transmission effects would ultimately allow for skull aberration correction in a broad variety of applications employing transcranial detection or transmission of high frequency ultrasound.

  11. Enzyme replacement therapy for murine hypophosphatasia.

    Science.gov (United States)

    Millán, José Luis; Narisawa, Sonoko; Lemire, Isabelle; Loisel, Thomas P; Boileau, Guy; Leonard, Pierre; Gramatikova, Svetlana; Terkeltaub, Robert; Camacho, Nancy Pleshko; McKee, Marc D; Crine, Philippe; Whyte, Michael P

    2008-06-01

    Hypophosphatasia (HPP) is the inborn error of metabolism that features rickets or osteomalacia caused by loss-of-function mutation(s) within the gene that encodes the tissue-nonspecific isozyme of alkaline phosphatase (TNALP). Consequently, natural substrates for this ectoenzyme accumulate extracellulary including inorganic pyrophosphate (PPi), an inhibitor of mineralization, and pyridoxal 5'-phosphate (PLP), a co-factor form of vitamin B6. Babies with the infantile form of HPP often die with severe rickets and sometimes hypercalcemia and vitamin B6-dependent seizures. There is no established medical treatment. Human TNALP was bioengineered with the C terminus extended by the Fc region of human IgG for one-step purification and a deca-aspartate sequence (D10) for targeting to mineralizing tissue (sALP-FcD10). TNALP-null mice (Akp2-/-), an excellent model for infantile HPP, were treated from birth using sALP-FcD10. Short-term and long-term efficacy studies consisted of once daily subcutaneous injections of 1, 2, or 8.2 mg/kg sALP-FcD10 for 15, 19, and 15 or 52 days, respectively. We assessed survival and growth rates, circulating levels of sALP-FcD10 activity, calcium, PPi, and pyridoxal, as well as skeletal and dental manifestations using radiography, microCT, and histomorphometry. Akp2-/- mice receiving high-dose sALP-FcD10 grew normally and appeared well without skeletal or dental disease or epilepsy. Plasma calcium, PPi, and pyridoxal concentrations remained in their normal ranges. We found no evidence of significant skeletal or dental disease. Enzyme replacement using a bone-targeted, recombinant form of human TNALP prevents infantile HPP in Akp2-/- mice.

  12. Enzyme Replacement Therapy for Murine Hypophosphatasia*

    Science.gov (United States)

    Millán, José Luis; Narisawa, Sonoko; Lemire, Isabelle; Loisel, Thomas P; Boileau, Guy; Leonard, Pierre; Gramatikova, Svetlana; Terkeltaub, Robert; Camacho, Nancy Pleshko; McKee, Marc D; Crine, Philippe; Whyte, Michael P

    2008-01-01

    Introduction Hypophosphatasia (HPP) is the inborn error of metabolism that features rickets or osteomalacia caused by loss-of-function mutation(s) within the gene that encodes the tissue-nonspecific isozyme of alkaline phosphatase (TNALP). Consequently, natural substrates for this ectoenzyme accumulate extracellulary including inorganic pyrophosphate (PPi), an inhibitor of mineralization, and pyridoxal 5`-phosphate (PLP), a co-factor form of vitamin B6. Babies with the infantile form of HPP often die with severe rickets and sometimes hypercalcemia and vitamin B6-dependent seizures. There is no established medical treatment. Materials and Methods Human TNALP was bioengineered with the C terminus extended by the Fc region of human IgG for one-step purification and a deca-aspartate sequence (D10) for targeting to mineralizing tissue (sALP-FcD10). TNALP-null mice (Akp2−/−), an excellent model for infantile HPP, were treated from birth using sALP-FcD10. Short-term and long-term efficacy studies consisted of once daily subcutaneous injections of 1, 2, or 8.2 mg/kg sALP-FcD10 for 15, 19, and 15 or 52 days, respectively. We assessed survival and growth rates, circulating levels of sALP-FcD10 activity, calcium, PPi, and pyridoxal, as well as skeletal and dental manifestations using radiography, μCT, and histomorphometry. Results Akp2−/− mice receiving high-dose sALP-FcD10 grew normally and appeared well without skeletal or dental disease or epilepsy. Plasma calcium, PPi, and pyridoxal concentrations remained in their normal ranges. We found no evidence of significant skeletal or dental disease. Conclusions Enzyme replacement using a bone-targeted, recombinant form of human TNALP prevents infantile HPP in Akp2−/− mice. PMID:18086009

  13. [Evaluation of Fusarium spp. pathogenicity in plant and murine models].

    Science.gov (United States)

    Forero-Reyes, Consuelo M; Alvarado-Fernández, Angela M; Ceballos-Rojas, Ana M; González-Carmona, Lady C; Linares-Linares, Melva Y; Castañeda-Salazar, Rubiela; Pulido-Villamarín, Adriana; Góngora-Medina, Manuel E; Cortés-Vecino, Jesús A; Rodríguez-Bocanegra, María X

    The genus Fusarium is widely recognized for its phytopathogenic capacity. However, it has been reported as an opportunistic pathogen in immunocompetent and immunocompromised patients. Thus, it can be considered a microorganism of interest in pathogenicity studies on different hosts. Therefore, this work evaluated the pathogenicity of Fusarium spp. isolates from different origins in plants and animals (murine hosts). Twelve isolates of Fusarium spp. from plants, animal superficial mycoses, and human superficial and systemic mycoses were inoculated in tomato, passion fruit and carnation plants, and in immunocompetent and immunosuppressed BALB/c mice. Pathogenicity tests in plants did not show all the symptoms associated with vascular wilt in the three plant models; however, colonization and necrosis of the vascular bundles, regardless of the species and origin of the isolates, showed the infective potential of Fusarium spp. in different plant species. Moreover, the pathogenicity tests in the murine model revealed behavioral changes. It was noteworthy that only five isolates (different origin and species) caused mortality. Additionally, it was observed that all isolates infected and colonized different organs, regardless of the species and origin of the isolates or host immune status. In contrast, the superficial inoculation test showed no evidence of epidermal injury or colonization. The observed results in plant and murine models suggest the pathogenic potential of Fusarium spp. isolates in different types of hosts. However, further studies on pathogenicity are needed to confirm the multihost capacity of this genus. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Characterization of a Novel Murine Model to Study Zika Virus.

    Science.gov (United States)

    Rossi, Shannan L; Tesh, Robert B; Azar, Sasha R; Muruato, Antonio E; Hanley, Kathryn A; Auguste, Albert J; Langsjoen, Rose M; Paessler, Slobodan; Vasilakis, Nikos; Weaver, Scott C

    2016-06-01

    The mosquito-borne Zika virus (ZIKV) is responsible for an explosive ongoing outbreak of febrile illness across the Americas. ZIKV was previously thought to cause only a mild, flu-like illness, but during the current outbreak, an association with Guillain-Barré syndrome and microcephaly in neonates has been detected. A previous study showed that ZIKV requires murine adaptation to generate reproducible murine disease. In our study, a low-passage Cambodian isolate caused disease and mortality in mice lacking the interferon (IFN) alpha receptor (A129 mice) in an age-dependent manner, but not in similarly aged immunocompetent mice. In A129 mice, viremia peaked at ∼10(7) plaque-forming units/mL by day 2 postinfection (PI) and reached high titers in the spleen by day 1. ZIKV was detected in the brain on day 3 PI and caused signs of neurologic disease, including tremors, by day 6. Robust replication was also noted in the testis. In this model, all mice infected at the youngest age (3 weeks) succumbed to illness by day 7 PI. Older mice (11 weeks) showed signs of illness, viremia, and weight loss but recovered starting on day 8. In addition, AG129 mice, which lack both type I and II IFN responses, supported similar infection kinetics to A129 mice, but with exaggerated disease signs. This characterization of an Asian lineage ZIKV strain in a murine model, and one of the few studies reporting a model of Zika disease and demonstrating age-dependent morbidity and mortality, could provide a platform for testing the efficacy of antivirals and vaccines. © The American Society of Tropical Medicine and Hygiene.

  15. Expression analysis of asthma candidate genes during human and murine lung development.

    Science.gov (United States)

    Melén, Erik; Kho, Alvin T; Sharma, Sunita; Gaedigk, Roger; Leeder, J Steven; Mariani, Thomas J; Carey, Vincent J; Weiss, Scott T; Tantisira, Kelan G

    2011-06-23

    Little is known about the role of most asthma susceptibility genes during human lung development. Genetic determinants for normal lung development are not only important early in life, but also for later lung function. To investigate the role of expression patterns of well-defined asthma susceptibility genes during human and murine lung development. We hypothesized that genes influencing normal airways development would be over-represented by genes associated with asthma. Asthma genes were first identified via comprehensive search of the current literature. Next, we analyzed their expression patterns in the developing human lung during the pseudoglandular (gestational age, 7-16 weeks) and canalicular (17-26 weeks) stages of development, and in the complete developing lung time series of 3 mouse strains: A/J, SW, C57BL6. In total, 96 genes with association to asthma in at least two human populations were identified in the literature. Overall, there was no significant over-representation of the asthma genes among genes differentially expressed during lung development, although trends were seen in the human (Odds ratio, OR 1.22, confidence interval, CI 0.90-1.62) and C57BL6 mouse (OR 1.41, CI 0.92-2.11) data. However, differential expression of some asthma genes was consistent in both developing human and murine lung, e.g. NOD1, EDN1, CCL5, RORA and HLA-G. Among the asthma genes identified in genome wide association studies, ROBO1, RORA, HLA-DQB1, IL2RB and PDE10A were differentially expressed during human lung development. Our data provide insight about the role of asthma susceptibility genes during lung development and suggest common mechanisms underlying lung morphogenesis and pathogenesis of respiratory diseases.

  16. Primary osteopathy of vertebrae in a neurofibromatosis type 1 murine model.

    Science.gov (United States)

    Zhang, Wei; Rhodes, Steven D; Zhao, Liming; He, Yongzheng; Zhang, Yingze; Shen, Yong; Yang, Dalong; Wu, Xiaohua; Li, Xiaohong; Yang, Xianlin; Park, Su-Jung; Chen, Shi; Turner, Charles; Yang, Feng-Chun

    2011-06-01

    Neurofibromatosis type 1 (NF1) is a common autosomal dominant genetic disorder caused by mutation of the NF1 tumor suppressor gene. Spinal deformities are common skeletal manifestations in patients with NF1. To date, the mechanism of vertebral abnormalities remains unclear because of the lack of appropriate animal models for the skeletal manifestations of NF1. In the present study, we report a novel murine NF1 model, Nf1(flox/-);Col2.3Cre(+) mice. These mice display short vertebral segments. In addition, a significant reduction in cortical and trabecular bone mass of the vertebrae was observed in Nf1(flox/-);Col2.3Cre(+) mice as measured by dual-energy X-ray absorptiometry (DEXA) and peripheral quantitative computed tomography (pQCT). Peak stress and peak load were also significantly reduced in Nf1(flox/-);Col2.3Cre(+) mice as compared to controls. Furthermore, the lumbar vertebrae showed enlargement of the inter-vertebral canal, a characteristic feature of lumbar vertebrae in NF1 patients. Finally, histologic analysis demonstrated increased numbers of osteoclasts and decreased numbers of osteoblasts in the vertebrae of Nf1(flox/-);Col2.3Cre(+) mice in comparison to controls. In summary, Nf1(flox/-);Col2.3Cre(+) mice demonstrate multiple structural and functional abnormalities in the lumbar vertebrae which recapitulate the dystrophic vertebral changes in NF1 patients. This novel murine model provides a platform to understand the cellular and molecular mechanisms underlying the pathogenesis of spinal deficits in NF1 patients. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. CTGF/CCN2 Postconditioning Increases Tolerance of Murine Hearts towards Ischemia-Reperfusion Injury.

    Directory of Open Access Journals (Sweden)

    Ole Jørgen Kaasbøll

    Full Text Available Previous studies of ischemia-reperfusion injury (IRI in hearts from mice with cardiac-restricted overexpression of CCN2 have shown that CCN2 increases tolerance towards IRI. The objectives of this study were to investigate to what extent post-ischemic administration of recombinant human CCN2 (rhCCN2 would limit infarct size and improve functional recovery and what signaling pathways are involved.Isolated mice hearts were perfused ad modum Langendorff, subjected to no-flow, global ischemia, and subsequently, exposed to mammalian cell derived, full-length (38-40kDa rhCCN2 (250 nM or vehicle during the first 15 min of a 60 min reperfusion period.Post-ischemic administration of rhCCN2 resulted in attenuation of infarct size from 58 ± 4% to 34 ± 2% (p < 0.001 which was abrogated by concomitant administration of the PI3 kinase inhibitor LY294002 (45 ± 3% vs. 50 ± 3%, ns. In congruence with reduction of infarct size rhCCN2 also improved recovery of left ventricular developed pressure (p < 0.05. Western blot analyses of extracts of ex vivo-perfused murine hearts also revealed that rhCCN2 evoked concentration-dependent increase of cardiac phospho-GSK3β (serine-9 contents.We demonstrate that post-ischemic administration of rhCCN2 increases the tolerance of ex vivo-perfused murine hearts to IRI. Mechanistically, this postconditioning effect of rhCCN2 appeared to be mediated by activation of the reperfusion injury salvage kinase pathway as demonstrated by sensitivity to PI3 kinase inhibition and increased CCN2-induced phosphorylation of GSK3β (Ser-9. Thus, the rationale for testing rhCCN2-mediated post-ischemic conditioning of the heart in more complex models is established.

  18. Hepatic Mitochondrial Dysfunction and Immune Response in a Murine Model of Peanut Allergy

    Directory of Open Access Journals (Sweden)

    Giovanna Trinchese

    2018-06-01

    Full Text Available Background: Evidence suggests a relevant role for liver and mitochondrial dysfunction in allergic disease. However, the role of hepatic mitochondrial function in food allergy is largely unknown. We aimed to investigate hepatic mitochondrial dysfunction in a murine model of peanut allergy. Methods: Three-week-old C3H/HeOuJ mice were sensitized by the oral route with peanut-extract (PNT. We investigated: 1. the occurrence of effective sensitization to PNT by analysing acute allergic skin response, anaphylactic symptoms score, body temperature, serum mucosal mast cell protease-1 (mMCP-1 and anti-PNT immunoglobulin E (IgE levels; 2. hepatic involvement by analysing interleukin (IL-4, IL-5, IL-13, IL-10 and IFN-γ mRNA expression; 3. hepatic mitochondrial oxidation rates and efficiency by polarography, and hydrogen peroxide (H2O2 yield, aconitase and superoxide dysmutase activities by spectrophotometry. Results: Sensitization to PNT was demonstrated by acute allergic skin response, anaphylactic symptoms score, body temperature decrease, serum mMCP-1 and anti-peanut IgE levels. Liver involvement was demonstrated by a significant increase of hepatic Th2 cytokines (IL-4, IL-5 and IL-13 mRNA expression. Mitochondrial dysfunction was demonstrated by lower state 3 respiration rate in the presence of succinate, decreased fatty acid oxidation in the presence of palmitoyl-carnitine, increased yield of ROS proven by the inactivation of aconitase enzyme and higher H2O2 mitochondrial release. Conclusions: We provide evidence of hepatic mitochondrial dysfunction in a murine model of peanut allergy. These data could open the way to the identification of new mitochondrial targets for innovative preventive and therapeutic strategies against food allergy.

  19. Disruption of canonical TGFβ-signaling in murine coronary progenitor cells by low level arsenic

    Energy Technology Data Exchange (ETDEWEB)

    Allison, Patrick; Huang, Tianfang; Broka, Derrick; Parker, Patti [Department of Pharmacology and Toxicology College of Pharmacy, Southwest Environmental Health Sciences Center, Steele Children' s Research Center and Bio5 Institute, University of Arizona, Tucson, AZ 85721 (United States); Barnett, Joey V. [Department of Pharmacology, Vanderbilt Medical University, Nashville, TN (United States); Camenisch, Todd D., E-mail: camenisch@pharmacy.arizona.edu [Department of Pharmacology and Toxicology College of Pharmacy, Southwest Environmental Health Sciences Center, Steele Children' s Research Center and Bio5 Institute, University of Arizona, Tucson, AZ 85721 (United States)

    2013-10-01

    Exposure to arsenic results in several types of cancers as well as heart disease. A major contributor to ischemic heart pathologies is coronary artery disease, however the influences by environmental arsenic in this disease process are not known. Similarly, the impact of toxicants on blood vessel formation and function during development has not been studied. During embryogenesis, the epicardium undergoes proliferation, migration, and differentiation into several cardiac cell types including smooth muscle cells which contribute to the coronary vessels. The TGFβ family of ligands and receptors is essential for developmental cardiac epithelial to mesenchymal transition (EMT) and differentiation into coronary smooth muscle cells. In this in vitro study, 18 hour exposure to 1.34 μM arsenite disrupted developmental EMT programming in murine epicardial cells causing a deficit in cardiac mesenchyme. The expression of EMT genes including TGFβ2, TGFβ receptor-3, Snail, and Has-2 are decreased in a dose-dependent manner following exposure to arsenite. TGFβ2 cell signaling is abrogated as detected by decreases in phosphorylated Smad2/3 when cells are exposed to 1.34 μM arsenite. There is also loss of nuclear accumulation pSmad due to arsenite exposure. These observations coincide with a decrease in vimentin positive mesenchymal cells invading three-dimensional collagen gels. However, arsenite does not block TGFβ2 mediated smooth muscle cell differentiation by epicardial cells. Overall these results show that arsenic exposure blocks developmental EMT gene programming in murine coronary progenitor cells by disrupting TGFβ2 signals and Smad activation, and that smooth muscle cell differentiation is refractory to this arsenic toxicity. - Highlights: • Arsenic blocks TGFβ2 induced expression of EMT genes. • Arsenic blocks TGFβ2 triggered Smad2/3 phosphorylation and nuclear translocation. • Arsenic blocks epicardial cell differentiation into cardiac mesenchyme.

  20. Essential pathogenic role of endogenous IL-18 in murine diabetes induced by multiple low doses of streptozotocin. Prevention of hyperglycemia and insulitis by a recombinant IL-18-binding protein: Fc construct

    DEFF Research Database (Denmark)

    Nicoletti, Ferdinando; Di Marco, Roberto; Papaccio, Gianpaolo

    2003-01-01

    IL-18 is a cytokine structurally and functionally related to IL-1 that, in synergy with IL-12, stimulates the synthesis of IFN-gamma from T lymphocytes and natural killer cells. Because IFN-gamma plays a key pathogenic role in the development of murine immunoinflammatory diabetes induced by multi...

  1. Corn silk induced cyclooxygenase-2 in murine macrophages.

    Science.gov (United States)

    Kim, Kyung A; Shin, Hyun-Hee; Choi, Sang Kyu; Choi, Hye-Seon

    2005-10-01

    Stimulation of murine macrophages with corn silk induced cyclooxygenase (COX)-2 with secretion of PGE2. Expression of COX-2 was inhibited by pyrolidine dithiocarbamate (PDTC), and increased DNA binding by nuclear factor kappa B (NF-kappaB), indicating that COX-2 induction proceeds also via the NF-kappaB signaling pathway. A specific inhibitor of COX-2 decreased the expression level of inducible nitric oxide synthase (iNOS) stimulated by corn silk. PGE2 elevated the expression level of iNOS, probably via EP2 and EP4 receptors on the surface of the macrophages.

  2. Collagen-Induced Arthritis: A model for Murine Autoimmune Arthritis

    OpenAIRE

    Pietrosimone, K. M.; Jin, M.; Poston, B.; Liu, P.

    2015-01-01

    Collagen-induced arthritis (CIA) is a common autoimmune animal model used to study rheumatoid arthritis (RA). The development of CIA involves infiltration of macrophages and neutrophils into the joint, as well as T and B cell responses to type II collagen. In murine CIA, genetically susceptible mice (DBA/1J) are immunized with a type II bovine collagen emulsion in complete Freund’s adjuvant (CFA), and receive a boost of type II bovine collagen in incomplete Freund’s adjuvant (IFA) 21 days aft...

  3. Murine nephrotoxic nephritis as a model of chronic kidney disease

    DEFF Research Database (Denmark)

    Ougaard, M. K.E.; Kvist, P. H.; Jensen, H. E.

    2018-01-01

    Using the nonaccelerated murine nephrotoxic nephritis (NTN) as a model of chronic kidney disease (CKD) could provide an easily inducible model that enables a rapid test of treatments. Originally, the NTN model was developed as an acute model of glomerulonephritis, but in this study we evaluate...... progressive mesangial expansion and significant renal fibrosis within three weeks suggesting CKD development. CD1 and C57BL/6 females showed a similar disease progression, but female mice seemed more susceptible to NTS compared to male mice. The presence of albuminuria, GFR decline, mesangial expansion...

  4. Biological markers as predictors of radiosensitivity in syngeneic murine tumors

    International Nuclear Information System (INIS)

    Chang, Sei Kyung; Shin, Hyun Soo; Seong, Jin Sil; Kim, Sung Hee

    2006-01-01

    We investigated whether a relationship exists between tumor control dose 50 (TCD 50 ) or tumor growth delay (TGD) and radiation induced apoptosis (RIA) in syngeneic murine tumors. Also we investigated the biological markers that can predict radiosensitivity in murine tumor system through analysis of relationship between TCD 50 , TGD, RIA and constitutive expression levels of the genetic products regulating RIA. Syngeneic murine tumors such as ovarian adenocarcinoma, mammary carcinoma, squamous cell carcinoma, fibrosarcoma, hepatocarcinoma were used in this study. C3H/HeJ mice were bred and maintained in our specific pathogen free mouse colony and were 8 ∼ 12 weeks old when used for the experiments. The tumors, growing in the right hind legs of mice, were analyzed for TCD 50 , TGD, and RIA at 8 mm in diameter. The tumors were also analyzed for the constitutive expression levels of p53, p21 WAF1/CIP1 , BAX, Bcl-2, Bcl-x L , Bcl-x S , and p34. Correlation analysis was performed whether the level of RIA were correlated with TCD 50 or TGD, and the constitutive expression levels of genetic products regulating RIA were correlated with TCD 50 , TGD, RIA. The level of RIA showed a significant positive correlation (R = 0.922, ρ = 0.026) with TGD, and showed a trend to correlation (R = -0.848), marginally significant correlation with TCD 50 (ρ = 0.070). It indicates that tumors that respond to radiation with high percentage of apoptosis were more radiosensitive. The constitutive expression levels of p21 WAF1/CIP1 and p34 showed a significant correlation either with TCD 50 (R = 0.893, ρ = 0.041 and R = 0.904, ρ = 0.035) or with TGD (R = -0.922, ρ 0.026 and R = -0.890, ρ = 0.043). The tumors with high constitutive expression levels of p21 WAF1/CIP1 or p34 were less radiosensitive than those with low expression. Radiosensitivity may be predicted with the level of RIA in murine tumors. The constitutive expression levels of p21 WAF1/CIP1 or p34 can be used as biological

  5. Production of antibodies which recognize opiate receptors on murine leukocytes

    Energy Technology Data Exchange (ETDEWEB)

    Carr, D.J.J.; Bost, K.L.; Blalock, J.E.

    1988-01-01

    An antibody has been developed which recognizes opiate receptors on cells of the immune system. This antibody blocks specific binding of the radiolabeled opiate receptor ligand, /sup 3/H-dihydromorphine, to receptors on murine splenocytes. Additionally, the anti-receptor antibody competes with ..beta..-endorphin, meta-enkephalin, and naloxone for the same binding site on the leukocytes. Moreover, the anti-receptor antibody possesses agonist activity similar to ..beta..-endorphin in suppressing cAMP production by lymphocytes. These results suggest the development of an antibody which recognizes classical opiate receptors on cells of the immune system.

  6. Studies on murine plasmocytoma treatment with mistletoe lectin I

    International Nuclear Information System (INIS)

    Raabe, F.; Storch, H.

    1987-01-01

    Mistletoe lectin I was tested in vivo and in vitro for its cytotoxic activity against murine plasmacytoma cells P3/X63-Ag8. As a result of this treatment, 30 to 60% of the BALB/c mice developed complete tumor regressions. 83% of the mice treated with mistletoe lectin I were resistant to viable tumor cell challenge after 100 days. The cytotoxic activity in vitro tested by 3 H-thymidine incorporation into P3/X63-Ag8 cells was very high. The rate was markedly reduced at concentrations up to 0.07 ng/ml. (author)

  7. Adrenaline influences the release of interleukin-6 from murine pituicytes

    DEFF Research Database (Denmark)

    Christensen, J D; Hansen, E W; Frederiksen, C

    1999-01-01

    In this study, we examined the effect of adrenaline and interleukin-1beta on interleukin-6 secretion from cultured murine neurohypophyseal cells. Cells were cultured from neurohypophyses of 3- to 5-week-old mice and experiments were performed after 13 days in culture. Interleukin-6 was measured...... in 24-h samples using a sandwich fluoroimmunoassay. Unstimulated cells released 19+/-3 fmol interleukin-6/neurohypophysis/24 h (mean +/- S.E.M., n = 42). Adrenaline and interleukin-1beta increased the release of interleukin-6 from the cells in a concentration-dependent manner. Incubation with adrenaline...

  8. Biological markers as predictors of radiosensitivity in syngeneic murine tumors

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Sei Kyung; Shin, Hyun Soo [Bundang CHA General Hospital, Seongnam (Korea, Republic of); Seong, Jin Sil; Kim, Sung Hee [Yonsei Cancer Center, Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2006-06-15

    We investigated whether a relationship exists between tumor control dose 50 (TCD{sub 50}) or tumor growth delay (TGD) and radiation induced apoptosis (RIA) in syngeneic murine tumors. Also we investigated the biological markers that can predict radiosensitivity in murine tumor system through analysis of relationship between TCD{sub 50}, TGD, RIA and constitutive expression levels of the genetic products regulating RIA. Syngeneic murine tumors such as ovarian adenocarcinoma, mammary carcinoma, squamous cell carcinoma, fibrosarcoma, hepatocarcinoma were used in this study. C3H/HeJ mice were bred and maintained in our specific pathogen free mouse colony and were 8 {approx} 12 weeks old when used for the experiments. The tumors, growing in the right hind legs of mice, were analyzed for TCD{sub 50}, TGD, and RIA at 8 mm in diameter. The tumors were also analyzed for the constitutive expression levels of p53, p21{sup WAF1/CIP1}, BAX, Bcl-2, Bcl-x{sub L}, Bcl-x{sub S}, and p34. Correlation analysis was performed whether the level of RIA were correlated with TCD{sub 50} or TGD, and the constitutive expression levels of genetic products regulating RIA were correlated with TCD{sub 50}, TGD, RIA. The level of RIA showed a significant positive correlation (R = 0.922, {rho} = 0.026) with TGD, and showed a trend to correlation (R = -0.848), marginally significant correlation with TCD{sub 50} ({rho} = 0.070). It indicates that tumors that respond to radiation with high percentage of apoptosis were more radiosensitive. The constitutive expression levels of p21{sup WAF1/CIP1} and p34 showed a significant correlation either with TCD{sub 50} (R = 0.893, {rho} = 0.041 and R = 0.904, {rho} = 0.035) or with TGD (R = -0.922, {rho} 0.026 and R = -0.890, {rho} = 0.043). The tumors with high constitutive expression levels of p21{sup WAF1/CIP1} or p34 were less radiosensitive than those with low expression. Radiosensitivity may be predicted with the level of RIA in murine tumors. The

  9. Propylthiouracil is teratogenic in murine embryos.

    Directory of Open Access Journals (Sweden)

    Valeria C Benavides

    Full Text Available Hyperthyroidism during pregnancy is treated with the antithyroid drugs (ATD propylthiouracil (PTU and methimazole (MMI. PTU currently is recommended as the drug of choice during early pregnancy. Yet, despite widespread ATD use in pregnancy, formal studies of ATD teratogenic effects have not been performed.We examined the teratogenic effects of PTU and MMI during embryogenesis in mice. To span different periods of embryogenesis, dams were treated with compounds or vehicle daily from embryonic day (E 7.5 to 9.5 or from E3.5 to E7.5. Embryos were examined for gross malformations at E10.5 or E18.5 followed by histological and micro-CT analysis. Influences of PTU on gene expression levels were examined by RNA microarray analysis.When dams were treated from E7.5 to E9.5 with PTU, neural tube and cardiac abnormalities were observed at E10.5. Cranial neural tube defects were significantly more common among the PTU-exposed embryos than those exposed to MMI or vehicle. Blood in the pericardial sac, which is a feature indicative of abnormal cardiac function and/or abnormal vasculature, was observed more frequently in PTU-treated than MMI-treated or vehicle-treated embryos. Following PTU treatment, a total of 134 differentially expressed genes were identified. Disrupted genetic pathways were those associated with cytoskeleton remodeling and keratin filaments. At E 18.5, no gross malformations were evident in either ATD group, but the number of viable PTU embryos per dam at E18.5 was significantly lower from those at E10.5, indicating loss of malformed embryos. These data show that PTU exposure during embryogenesis is associated with delayed neural tube closure and cardiac abnormalities. In contrast, we did not observe structural or cardiac defects associated with MMI exposure except at the higher dose. We find that PTU exposure during embryogenesis is associated with fetal loss. These observations suggest that PTU has teratogenic potential.

  10. Analysis of the capacity to produce IL-3 in murine AIDS

    DEFF Research Database (Denmark)

    Neuenschwander, A U; Marker, O; Thomsen, Allan Randrup

    1994-01-01

    Adult C57BL/6 mice infected with LP-BM5 murine leukaemia virus represent a model of murine AIDS (MAIDS). In this study we have analysed the capacity of CD4+ T cells from infected mice to produce IL-3 following stimulation with ConA for 24-72 h. In contrast to the position with IL-2, the production...

  11. Murine typhus in two travelers returning from Bali, Indonesia: an underdiagnosed disease.

    Science.gov (United States)

    Takeshita, Nozomi; Imoto, Kazuya; Ando, Shuji; Yanagisawa, Kunio; Ohji, Goh; Kato, Yasuyuki; Sakata, Akiko; Hosokawa, Naoto; Kishimoto, Toshio

    2010-01-01

    Two Japanese travelers from Bali were diagnosed with murine typhus in Japan during the same period. Although one had only mild illness, the other experienced liver and kidney dysfunction. Murine typhus may be missed not only in endemic areas around the world, but also in travelers, especially those returning from marine resorts in these areas. © 2010 International Society of Travel Medicine.

  12. CD8+ T Cells Contribute to the Development of Coronary Arteritis in the Lactobacillus casei Cell Wall Extract-Induced Murine Model of Kawasaki Disease.

    Science.gov (United States)

    Noval Rivas, Magali; Lee, Youngho; Wakita, Daiko; Chiba, Norika; Dagvadorj, Jargalsaikhan; Shimada, Kenichi; Chen, Shuang; Fishbein, Michael C; Lehman, Thomas J A; Crother, Timothy R; Arditi, Moshe

    2017-02-01

    Kawasaki disease (KD) is the leading cause of acquired heart disease among children in developed countries. Coronary lesions in KD in humans are characterized by an increased presence of infiltrating CD3+ T cells; however, the specific contributions of the different T cell subpopulations in coronary arteritis development remain unknown. Therefore, we sought to investigate the function of CD4+ and CD8+ T cells, Treg cells, and natural killer (NK) T cells in the pathogenesis of KD. We addressed the function of T cell subsets in KD development by using a well-established murine model of Lactobacillus casei cell wall extract (LCWE)-induced KD vasculitis. We determined which T cell subsets were required for development of KD vasculitis by using several knockout murine strains and depleting monoclonal antibodies. LCWE-injected mice developed coronary lesions characterized by the presence of inflammatory cell infiltrates. Frequently, this chronic inflammation resulted in complete occlusion of the coronary arteries due to luminal myofibroblast proliferation (LMP) as well as the development of coronary arteritis and aortitis. We found that CD8+ T cells, but not CD4+ T cells, NK T cells, or Treg cells, were required for development of KD vasculitis. The LCWE-induced murine model of KD vasculitis mimics many histologic features of the disease in humans, such as the presence of CD8+ T cells and LMP in coronary artery lesions as well as epicardial coronary arteritis. Moreover, CD8+ T cells functionally contribute to the development of KD vasculitis in this murine model. Therapeutic strategies targeting infiltrating CD8+ T cells might be useful in the management of KD in humans. © 2016, American College of Rheumatology.

  13. Purification and characterization of progenitor and mature human astrocytes reveals transcriptional and functional differences with mouse

    OpenAIRE

    Zhang, Ye; Sloan, Steven A.; Clarke, Laura E.; Caneda, Christine; Plaza, Colton A.; Blumenthal, Paul D.; Vogel, Hannes; Steinberg, Gary K.; Edwards, Michael S. B.; Li, Gordon; Duncan, John A.; Cheshier, Samuel H.; Shuer, Lawrence M.; Chang, Edward F.; Grant, Gerald A.

    2015-01-01

    The functional and molecular similarities and distinctions between human and murine astrocytes are poorly understood. Here we report the development of an immunopanning method to acutely purify astrocytes from fetal, juvenile, and adult human brains, and to maintain these cells in serum-free cultures. We found that human astrocytes have similar abilities to murine astrocytes in promoting neuronal survival, inducing functional synapse formation, and engulfing synaptosomes. In contrast to exist...

  14. Histone deacetylase 1 and 2 are essential for murine neural crest proliferation, pharyngeal arch development, and craniofacial morphogenesis.

    Science.gov (United States)

    Milstone, Zachary J; Lawson, Grace; Trivedi, Chinmay M

    2017-12-01

    Craniofacial anomalies involve defective pharyngeal arch development and neural crest function. Copy number variation at 1p35, containing histone deacetylase 1 (Hdac1), or 6q21-22, containing Hdac2, are implicated in patients with craniofacial defects, suggesting an important role in guiding neural crest development. However, the roles of Hdac1 and Hdac2 within neural crest cells remain unknown. The neural crest and its derivatives express both Hdac1 and Hdac2 during early murine development. Ablation of Hdac1 and Hdac2 within murine neural crest progenitor cells cause severe hemorrhage, atrophic pharyngeal arches, defective head morphogenesis, and complete embryonic lethality. Embryos lacking Hdac1 and Hdac2 in the neural crest exhibit decreased proliferation and increased apoptosis in both the neural tube and the first pharyngeal arch. Mechanistically, loss of Hdac1 and Hdac2 upregulates cyclin-dependent kinase inhibitors Cdkn1a, Cdkn1b, Cdkn1c, Cdkn2b, Cdkn2c, and Tp53 within the first pharyngeal arch. Our results show that Hdac1 and Hdac2 function redundantly within the neural crest to regulate proliferation and the development of the pharyngeal arches by means of repression of cyclin-dependent kinase inhibitors. Developmental Dynamics 246:1015-1026, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. β-Arrestin2 mediates progression of murine primary myelofibrosis.

    Science.gov (United States)

    Rein, Lindsay Am; Wisler, James W; Kim, Jihee; Theriot, Barbara; Huang, LiYin; Price, Trevor; Yang, Haeyoon; Chen, Minyong; Chen, Wei; Sipkins, Dorothy; Fedoriw, Yuri; Walker, Julia Kl; Premont, Richard T; Lefkowitz, Robert J

    2017-12-21

    Primary myelofibrosis is a myeloproliferative neoplasm associated with significant morbidity and mortality, for which effective therapies are lacking. β-Arrestins are multifunctional adaptor proteins involved in developmental signaling pathways. One isoform, β-arrestin2 (βarr2), has been implicated in initiation and progression of chronic myeloid leukemia, another myeloproliferative neoplasm closely related to primary myelofibrosis. Accordingly, we investigated the relationship between βarr2 and primary myelofibrosis. In a murine model of MPLW515L-mutant primary myelofibrosis, mice transplanted with donor βarr2-knockout (βarr2-/-) hematopoietic stem cells infected with MPL-mutant retrovirus did not develop myelofibrosis, whereas controls uniformly succumbed to disease. Although transplanted βarr2-/- cells homed properly to marrow, they did not repopulate long-term due to increased apoptosis and decreased self-renewal of βarr2-/- cells. In order to assess the effect of acute loss of βarr2 in established primary myelofibrosis in vivo, we utilized a tamoxifen-induced Cre-conditional βarr2-knockout mouse. Mice that received Cre (+) donor cells and developed myelofibrosis had significantly improved survival compared with controls. These data indicate that lack of antiapoptotic βarr2 mediates marrow failure of murine hematopoietic stem cells overexpressing MPLW515L. They also indicate that βarr2 is necessary for progression of primary myelofibrosis, suggesting that it may serve as a novel therapeutic target in this disease.

  16. Targeted destruction of murine macrophage cells with bioconjugated gold nanorods

    Energy Technology Data Exchange (ETDEWEB)

    Pissuwan, Dakrong [University of Technology Sydney, Institute for Nanoscale Technology (Australia); Valenzuela, Stella M. [University of Technology Sydney, Department of Medical and Molecular Biosciences (Australia)], E-mail: stella.valenzuela@uts.edu.au; Killingsworth, Murray C. [Sydney South West Pathology Service (Australia)], E-mail: murray.killingsworth@swsahs.nsw.gov.au; Xu, Xiaoda; Cortie, Michael B. [University of Technology Sydney, Institute for Nanoscale Technology (Australia)], E-mail: michael.cortie@uts.edu.au

    2007-12-15

    Gold nanorods manifest a readily tunable longitudinal plasmon resonance with light and consequently have potential for use in photothermal therapeutics. Recent work by others has shown how gold nanoshells and rods can be used to target cancer cells, which can then be destroyed using relatively high power laser radiation ({approx}1x10{sup 5} to 1x10{sup 10} W/m{sup 2}). Here we extend this concept to demonstrate how gold nanorods can be modified to bind to target macrophage cells, and show that high intensity laser radiation is not necessary, with even 5x10{sup 2} W/m{sup 2} being sufficient, provided that a total fluence of {approx}30 J/cm{sup 2} is delivered. We used the murine cell line RAW 264.7 and the monoclonal antibody CD11b, raised against murine macrophages, as our model system and a 5 mW solid state diode laser as our energy source. Exposure of the cells labeled with gold nanorods to a laser fluence of 30 J/cm{sup 2} resulted in 81% cell death compared to only 0.9% in the control, non-labeled cells.

  17. Targeted destruction of murine macrophage cells with bioconjugated gold nanorods

    Science.gov (United States)

    Pissuwan, Dakrong; Valenzuela, Stella M.; Killingsworth, Murray C.; Xu, Xiaoda; Cortie, Michael B.

    2007-12-01

    Gold nanorods manifest a readily tunable longitudinal plasmon resonance with light and consequently have potential for use in photothermal therapeutics. Recent work by others has shown how gold nanoshells and rods can be used to target cancer cells, which can then be destroyed using relatively high power laser radiation (˜1×105 to 1×1010 W/m2). Here we extend this concept to demonstrate how gold nanorods can be modified to bind to target macrophage cells, and show that high intensity laser radiation is not necessary, with even 5×102 W/m2 being sufficient, provided that a total fluence of ˜30 J/cm2 is delivered. We used the murine cell line RAW 264.7 and the monoclonal antibody CD11b, raised against murine macrophages, as our model system and a 5 mW solid state diode laser as our energy source. Exposure of the cells labeled with gold nanorods to a laser fluence of 30 J/cm2 resulted in 81% cell death compared to only 0.9% in the control, non-labeled cells.

  18. Targeted destruction of murine macrophage cells with bioconjugated gold nanorods

    International Nuclear Information System (INIS)

    Pissuwan, Dakrong; Valenzuela, Stella M.; Killingsworth, Murray C.; Xu, Xiaoda; Cortie, Michael B.

    2007-01-01

    Gold nanorods manifest a readily tunable longitudinal plasmon resonance with light and consequently have potential for use in photothermal therapeutics. Recent work by others has shown how gold nanoshells and rods can be used to target cancer cells, which can then be destroyed using relatively high power laser radiation (∼1x10 5 to 1x10 10 W/m 2 ). Here we extend this concept to demonstrate how gold nanorods can be modified to bind to target macrophage cells, and show that high intensity laser radiation is not necessary, with even 5x10 2 W/m 2 being sufficient, provided that a total fluence of ∼30 J/cm 2 is delivered. We used the murine cell line RAW 264.7 and the monoclonal antibody CD11b, raised against murine macrophages, as our model system and a 5 mW solid state diode laser as our energy source. Exposure of the cells labeled with gold nanorods to a laser fluence of 30 J/cm 2 resulted in 81% cell death compared to only 0.9% in the control, non-labeled cells

  19. Activation of DNA damage repair pathways by murine polyomavirus

    Energy Technology Data Exchange (ETDEWEB)

    Heiser, Katie; Nicholas, Catherine; Garcea, Robert L., E-mail: Robert.Garcea@Colorado.edu

    2016-10-15

    Nuclear replication of DNA viruses activates DNA damage repair (DDR) pathways, which are thought to detect and inhibit viral replication. However, many DNA viruses also depend on these pathways in order to optimally replicate their genomes. We investigated the relationship between murine polyomavirus (MuPyV) and components of DDR signaling pathways including CHK1, CHK2, H2AX, ATR, and DNAPK. We found that recruitment and retention of DDR proteins at viral replication centers was independent of H2AX, as well as the viral small and middle T-antigens. Additionally, infectious virus production required ATR kinase activity, but was independent of CHK1, CHK2, or DNAPK signaling. ATR inhibition did not reduce the total amount of viral DNA accumulated, but affected the amount of virus produced, indicating a defect in virus assembly. These results suggest that MuPyV may utilize a subset of DDR proteins or non-canonical DDR signaling pathways in order to efficiently replicate and assemble. -- Highlights: •Murine polyomavirus activates and recruits DNA damage repair (DDR) proteins to replication centers. •Large T-antigen mediates recruitment of DDR proteins to viral replication centers. •Inhibition or knockout of CHK1, CHK2, DNA-PK or H2AX do not affect viral titers. •Inhibition of ATR activity reduces viral titers, but not viral DNA accumulation.

  20. Application of murine monoclonal antibodies to the serodiagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Ivanyl, J.; Coates, A.R.M.; Krambovitis, E.

    1982-01-01

    The immune response during infectious diseases leads to a rise in antibody titre to the various different antigenic determinants of the causative organism. The response is further complicated by the fact that it is relatively unusual for one individual to respond to all antigenic components of an organism. Demonstration of the specific immune response of an infected host by serological tests is often hampered by the broad cross-reactivity between several bacterial antigens. The authors report on a serodiagnostic application of murine monoclonal antibodies (MAB), specific for a human pathogen, M. tuberculosis by a technique which is applicable in principle to the serodiagnosis of many other infectious diseases. The serum diagnostic test is based on the competitive inhibition by human sera of the binding of 125 I-labelled murine monoclonal antibodies to M. tuberculosis-coated polyvinyl plates. Five monoclonal antibodies binding to distinct antigenic determinants of the organism were used as structural probes which conferred their stringent combining site specificities to the polyclonal mixture of antibodies from patients' sera. When compared with healthy controls, increased titres of inhibitory antibodies were found in about 70% of patients with active tuberculosis. The diagnostic value of the individual monoclonal antibodies as well as the benefit from the use of multiple specificity probes has been qualified

  1. Neurological Disorders in a Murine Model of Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    Jean-Marc Chillon

    2014-01-01

    Full Text Available Cardiovascular disease is highly prevalent in patients with chronic renal failure (CRF. However, data on the impact of CRF on the cerebral circulatory system are scarce—despite the fact that stroke is the third most common cause of cardiovascular death in people with CRF. In the present study, we examined the impact of CRF on behavior (anxiety, recognition and ischemic stroke severity in a well-defined murine model of CRF. We did not observe any significant increases between CRF mice and non-CRF mice in terms of anxiety. In contrast, CRF mice showed lower levels of anxiety in some tests. Recognition was not impaired (vs. controls after 6 weeks of CRF but was impaired after 10 weeks of CRF. Chronic renal failure enhances the severity of ischemic stroke, as evaluated by the infarct volume size in CRF mice after 34 weeks of CRF. Furthermore, neurological test results in non-CRF mice tended to improve in the days following ischemic stroke, whereas the results in CRF mice tended to worsen. In conclusion, we showed that a murine model of CRF is suitable for evaluating uremic toxicity and the associated neurological disorders. Our data confirm the role of uremic toxicity in the genesis of neurological abnormalities (other than anxiety.

  2. Differential chemokine responses in the murine brain following lyssavirus infection.

    Science.gov (United States)

    Hicks, D J; Núñez, A; Banyard, A C; Williams, A; Ortiz-Pelaez, A; Fooks, A R; Johnson, N

    2013-11-01

    The hallmark of lyssavirus infection is lethal encephalomyelitis. Previous studies have reported distinct lyssavirus isolate-related differences in severity of cellular recruitment into the encephalon in a murine model of infection following peripheral inoculation with rabies virus (RABV) and European bat lyssavirus (EBLV)-1 and -2. In order to understand the role of chemokines in this process, comparative studies of the chemokine pattern, distribution and production in response to infection with these lyssaviruses were undertaken. Expression of CCL2, CCL5 and CXCL10 was observed throughout the murine brain with a distinct caudal bias in distribution, similar to both inflammatory changes and virus antigen distribution. CCL2 immunolabelling was localized to neuronal and astroglial populations. CCL5 immunolabelling was only detected in the astroglia, while CXCL10 labelling, although present in the astroglia, was more prominent in neurons. Isolate-dependent differences in the amount of chemokine immunolabelling in specific brain regions and chemokine production by neurons in vitro were observed, with a greater expression of CCL5 in vivo and CXCL10 production in vitro after EBLV infection. Additionally, strong positive associations between chemokine immunolabelling and perivascular cuffing and, to a lesser extent, virus antigen score were also observed. These differences in chemokine expression may explain the variation in severity of encephalitic changes observed in animals infected with different lyssavirus isolates. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  3. Development of a murine model of acute radiation encephalopathy

    International Nuclear Information System (INIS)

    Xing Yigang; Tang Yamei; Liu Jun; Sun Ying

    2003-01-01

    Objective: To develop a murine model of acute radiation encephalopathy. Methods: A total of 40 rats were subjected to local γ-irradiation to the brain with the dosage of 7 Gy/d for 6 consecutive days. The amount of food intake, hairs and skin of irradiated field, body weight, general activities, CNS symptoms and signs were examined and recorded after irradiation. On day 3, 7, 14 and 30, the brain tissue was removed to observe histopathologic changes. Results: During the first two days after irradiation, the irradiated rats were agitated, and the amount of food intake decreased from day 2 onwards. No serious skin reaction to irradiation was observed. Survived rats had normal activities without any abnormal nervous signs. Histopathologic changes showed slight neuronal degeneration, smaller cell body, red-colored cytoplasm, disappearance of Nissl body, vacuolation, typical cell shrinkage, chromatin condensation and nuclear divergence. On the 14th and 30th days, hypochromatism, loose and reticular necrotic foci were found in some samples. Conclusion: The murine model of acute radiation encephalopathy is useful and practical in radiobiological studies

  4. [Nuclear matrix organization of the chromocenters in cultured murine fibroblasts].

    Science.gov (United States)

    Sheval', E V; Poliakov, V Iu

    2010-01-01

    In the current work, the structural organization of nuclear matrix of pericentromeric heterochromatin blocks (chromocenters) inside cultured murine fibroblasts was investigated. After 2 M NaCl extraction without DNase I treatment, chromocenters were extremely swelled, and it was impossible to detect them using conventional electron microscopy. Using immunogolding with anti-topoisomerase IIalpha antibody, we demonstrated that residual chromocenters were subdivided into numerous discrete aggregates. After 2 M NaCl extraction with DNase I treatment, the residual chromocenters appeared as a dense meshwork of thin fibers, and using this feature, the residual chromocenters were easily distinguished from the rest of nuclear matrix. After extraction with dextran sulfate and heparin, the chromocenters were decondensed, and chromatin complexes having rosette organization (central core from which numerous DNA fibers radiated) were seen. Probably, the appearance of these rosettes was a consequence of incomplete chromatin extraction. Thus, the nuclear matrix of pericentromeric chromosome regions in cultured murine fibroblasts differs morphologically from the rest of nuclear matrix.

  5. Effects of the murine skull in optoacoustic brain microscopy.

    Science.gov (United States)

    Kneipp, Moritz; Turner, Jake; Estrada, Héctor; Rebling, Johannes; Shoham, Shy; Razansky, Daniel

    2016-01-01

    Despite the great promise behind the recent introduction of optoacoustic technology into the arsenal of small-animal neuroimaging methods, a variety of acoustic and light-related effects introduced by adult murine skull severely compromise the performance of optoacoustics in transcranial imaging. As a result, high-resolution noninvasive optoacoustic microscopy studies are still limited to a thin layer of pial microvasculature, which can be effectively resolved by tight focusing of the excitation light. We examined a range of distortions introduced by an adult murine skull in transcranial optoacoustic imaging under both acoustically- and optically-determined resolution scenarios. It is shown that strong low-pass filtering characteristics of the skull may significantly deteriorate the achievable spatial resolution in deep brain imaging where no light focusing is possible. While only brain vasculature with a diameter larger than 60 µm was effectively resolved via transcranial measurements with acoustic resolution, significant improvements are seen through cranial windows and thinned skull experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Focal Solute Trapping and Global Glymphatic Pathway Impairment in a Murine Model of Multiple Microinfarcts.

    Science.gov (United States)

    Wang, Minghuan; Ding, Fengfei; Deng, SaiYue; Guo, Xuequn; Wang, Wei; Iliff, Jeffrey J; Nedergaard, Maiken

    2017-03-15

    Microinfarcts occur commonly in the aging brain as a consequence of diffuse embolic events and are associated with the development of vascular dementia and Alzheimer's disease. However, the manner in which disperse microscopic lesions reduce global cognitive function and increase the risk for Alzheimer's disease is unclear. The glymphatic system, which is a brain-wide perivascular network that supports the recirculation of CSF through the brain parenchyma, facilitates the clearance of interstitial solutes including amyloid β and tau. We investigated whether glymphatic pathway function is impaired in a murine model of multiple microinfarcts induced by intraarterial injection of cholesterol crystals. The analysis showed that multiple microinfarcts markedly impaired global influx of CSF along the glymphatic pathway. Although suppression of global glymphatic function was transient, resolving within 2 weeks of injury, CSF tracers also accumulated within tissue associated with microinfarcts. The effect of diffuse microinfarcts on global glymphatic pathway function was exacerbated in the mice aged 12 months compared with the 2- to 3-month-old mice. These findings indicate that glymphatic function is focally disrupted around microinfarcts and that the aging brain is more vulnerable to this disruption than the young brain. These observations suggest that microlesions may trap proteins and other interstitial solutes within the brain parenchyma, increasing the risk of amyloid plaque formation. SIGNIFICANCE STATEMENT Microinfarcts, small (glymphatic system is a brain-wide network of channels surrounding brain blood vessels that allows CSF to exchange with interstitial fluid, clearing away cellular wastes such as amyloid β. We observed that, in mice, microinfarcts impaired global glymphatic function and solutes from the CSF became trapped in tissue associated with microinfarcts. These data suggest that small, disperse ischemic lesions can impair glymphatic function across the

  7. Increased Nucleosomes and Neutrophil Activation Link to Disease Progression in Patients with Scrub Typhus but Not Murine Typhus in Laos.

    Science.gov (United States)

    Paris, Daniel H; Stephan, Femke; Bulder, Ingrid; Wouters, Diana; van der Poll, Tom; Newton, Paul N; Day, Nicholas P J; Zeerleder, Sacha

    2015-01-01

    Cell-mediated immunity is essential in protection against rickettsial illnesses, but the role of neutrophils in these intracellular vasculotropic infections remains unclear. This study analyzed the plasma levels of nucleosomes, FSAP-activation (nucleosome-releasing factor), and neutrophil activation, as evidenced by neutrophil-elastase (ELA) complexes, in sympatric Lao patients with scrub typhus and murine typhus. In acute scrub typhus elevated nucleosome levels correlated with lower GCS scores, raised respiratory rate, jaundice and impaired liver function, whereas neutrophil activation correlated with fibrinolysis and high IL-8 plasma levels, a recently identified predictor of severe disease and mortality. Nucleosome and ELA complex levels were associated with a 4.8-fold and 4-fold increased risk of developing severe scrub typhus, beyond cut off values of 1,040 U/ml for nucleosomes and 275 U/ml for ELA complexes respectively. In murine typhus, nucleosome levels associated with pro-inflammatory cytokines and the duration of illness, while ELA complexes correlated strongly with inflammation markers, jaundice and increased respiratory rates. This study found strong correlations between circulating nucleosomes and neutrophil activation in patients with scrub typhus, but not murine typhus, providing indirect evidence that nucleosomes could originate from neutrophil extracellular trap (NET) degradation. High circulating plasma nucleosomes and ELA complexes represent independent risk factors for developing severe complications in scrub typhus. As nucleosomes and histones exposed on NETs are highly cytotoxic to endothelial cells and are strongly pro-coagulant, neutrophil-derived nucleosomes could contribute to vascular damage, the pro-coagulant state and exacerbation of disease in scrub typhus, thus indicating a detrimental role of neutrophil activation. The data suggest that increased neutrophil activation relates to disease progression and severe complications, and

  8. Expression of bovine herpesvirus 1 glycoproteins gI and gIII in transfected murine cells

    International Nuclear Information System (INIS)

    Fitzpatrick, D.R.; Zamb, T.; Parker, M.D.; van Drunen Littel-van den Hurk, S.; Babiuk, L.A.; Lawman, M.J.P.

    1988-01-01

    Genes encoding two of the major glycoproteins of bovine herpesvirus 1 (BHV-1), gI and gIII, were cloned into the eucaryotic expression vectors pRSVcat and pSV2neo and transfected into murine LMTK - cells, and cloned cell lines were established. The relative amounts of gI or gIII expressed from the two vectors were similar. Expression of gI was cell associated and localized predominantly in the perinuclear region, but nuclear and plasma membrane staining was also observed. Expression of gI was additionally associated with cell fusion and the formation of polykaryons and giant cells. Expression of gIII was localized predominantly in the nuclear and plasma membranes. Radioimmunoprecipitation in the presence or absence of tunicamycin revealed that the recombinant glycoproteins were proteolytically processed and glycosylated and had molecular weights similar to those of the forms of gI and gIII expressed in BHV-1 infected bovine cells. However, both recombinant glycoproteins were glycosylated to a lesser extent than were the forms found in BHV-1 infected bovine cells. For gI, a deficiency in N-linked glycosylated of the amino-terminal half of the protein was identified; for gIII, a deficiency in O-linked glycosylation was implicated. The reactivity pattern of a panel of gI- and gIII-specific monoclonal antibodies, including six which recognize conformation-dependent epitopes, was found to be unaffected by the glycosylation differences and was identical for transfected of BHV-1-infected murine cells. Use of the transfected cells as targets in immune-mediated cytotoxicity assays demonstrated the functional recognition of recombinant gI and gIII by murine antibody and cytotoxic T lymphocytes

  9. Trifluorothymidine. Potential non-invasive diagnosis of herpes simplex infection using /sup 19/F nuclear magnetic resonance in a murine hepatitis model

    Energy Technology Data Exchange (ETDEWEB)

    Rand, K H; Raad, I; Houck, H J; El Koussi, A; Loftsson, T; Bodor, N; Brey, W; Rocca, J

    1987-12-01

    Trifluorothymidine (TFT) is known to be concentrated in herpes simplex virus (HSV) infected cells in vitro in the form of phosphorylated derivatives. The authors studied a murine hepatitis model of HSV infection to determine whether this in vitro observation would also be demonstrable in vivo. Following i.v. injection of 100 or 160 mg/kg TFT, TFT was found in significantly higher concentrations in the livers of HSV-2 infected mice than in the livers of uninfected mice, mice infected with murine hepatitis virus or mice with hepatitis from carbon tetrachloride treatment. Neither altered renal function, nor altered pharmacokinetics could account for this difference. /sup 19/F nuclear magnetic resonance spectroscopy readily detected the /sup 19/F from TFT in both liver extracts and whole livers, particularly at higher tissue levels, i.e. >50 ..mu..g/g tissue. If further studies with living animals support these preliminary observations, clinical application could be pursued. 34 refs.; 4 figs.; 3 tabs.

  10. Characterization of immortalized MARCO and SR-AI/II-deficient murine alveolar macrophage cell lines

    Directory of Open Access Journals (Sweden)

    Imrich Amy

    2008-05-01

    Full Text Available Abstract Background Alveolar macrophages (AM avidly bind and ingest unopsonized inhaled particles and bacteria through class A scavenger receptors (SRAs MARCO and SR-AI/II. Studies to characterize the function of these SRAs have used AMs from MARCO or SR-AI/II null mice, but this approach is limited by the relatively low yield of AMs. Moreover, studies using both MARCO and SR-AI/II-deficient (MS-/- mice have not been reported yet. Hence, we sought to develop continuous cell lines from primary alveolar macrophages from MS-/- mice. Results We used in vitro infection of the primary AMs with the J2 retrovirus carrying the v-raf and v-myc oncogenes. Following initial isolation in media supplemented with murine macrophage colony-stimulating factor (M-CSF, we subcloned three AM cell lines, designated ZK-1, ZK-2 and ZK-6. These cell lines grow well in RPMI-1640-10% FBS in the absence of M-CSF. These adherent but trypsin-sensitive cell lines have a doubling time of approximately 14 hours, exhibit typical macrophage morphology, and express macrophage-associated cell surface Mac-1 (CD11b and F4/80 antigens. The cell lines show robust Fc-receptor dependent phagocytosis of opsonized red blood cells. Similar to freshly isolated AMs from MS-/- mice, the cell lines exhibit decreased phagocytosis of unopsonized titanium dioxide (TiO2, fluorescent latex beads and bacteria (Staphylococcus aureus compared with the primary AMs from wild type (WT C57BL/6 mice. Conclusion Our results indicated that three contiguous murine alveolar macrophage cell lines with MS-/- (ZK1, ZK2 and ZK6 were established successfully. These cell lines demonstrated macrophage morphology and functional activity. Interestingly, similar to freshly isolated AMs from MS-/- mice, the cell lines have a reduced, but not absent, ability to bind and ingest particles, with an altered pattern of blockade by scavenger receptor inhibitors. These cell lines will facilitate in vitro studies to further define

  11. Lack of spontaneous and radiation-induced chromosome breakage at interstitial telomeric sites in murine scid cells.

    Science.gov (United States)

    Wong, H-P; Mozdarani, H; Finnegan, C; McIlrath, J; Bryant, P E; Slijepcevic, P

    2004-01-01

    Interstitial telomeric sites (ITSs) in chromosomes from DNA repair-proficient mammalian cells are sensitive to both spontaneous and radiation-induced chromosome breakage. Exact mechanisms of this chromosome breakage sensitivity are not known. To investigate factors that predispose ITSs to chromosome breakage we used murine scid cells. These cells lack functional DNA-PKcs, an enzyme involved in the repair of DNA double-strand breaks. Interestingly, our results revealed lack of both spontaneous and radiation-induced chromosome breakage at ITSs found in scid chromosomes. Therefore, it is possible that increased sensitivity of ITSs to chromosome breakage is associated with the functional DNA double-strand break repair machinery. To investigate if this is the case we used scid cells in which DNA-PKcs deficiency was corrected. Our results revealed complete disappearance of ITSs in scid cells with functional DNA-PKcs, presumably through chromosome breakage at ITSs, but their unchanged frequency in positive and negative control cells. Therefore, our results indicate that the functional DNA double-strand break machinery is required for elevated sensitivity of ITSs to chromosome breakage. Interestingly, we observed significant differences in mitotic chromosome condensation between scid cells and their counterparts with restored DNA-PKcs activity suggesting that lack of functional DNA-PKcs may cause a defect in chromatin organization. Increased condensation of mitotic chromosomes in the scid background was also confirmed in vivo. Therefore, our results indicate a previously unanticipated role of DNA-PKcs in chromatin organisation, which could contribute to the lack of ITS sensitivity to chromosome breakage in murine scid cells. Copyright 2003 S. Karger AG, Basel

  12. Rediscovering peritoneal macrophages in a murine endometriosis model.

    Science.gov (United States)

    Yuan, Ming; Li, Dong; An, Min; Li, Qiuju; Zhang, Lu; Wang, Guoyun

    2017-01-01

    What are the features of peritoneal macrophage subgroups and T helper cells in the development of murine endometriosis? During the development of endometriosis in a murine model, large peritoneal macrophages (LPMs) and small peritoneal macrophages (SPMs) are polarized into M1 and M2 cells, respectively, and the proportions of T helper (Th) 1, Th17 and T regulatory (T reg ) cells are increased. Numerous studies investigating the etiology and pathogenesis of endometriosis have focused on the polarization states of peritoneal macrophages in endometriosis models and patients, but the results are inconclusive. Further studies indicate that peritoneal macrophages are composed of two distinct subsets: LPMs and SPMs, although their roles in endometriosis are unknown. This study involves a prospective and randomized experiment. Fifty C57BL/6 female mice were randomly allocated to five control and five experimental groups (n = 5/group) according to the presence or absence of transplantation. The transplant periods are 0.25, 3, 14, 28 and 42 days. C57BL/6 mice were utilized to establish an endometriosis model by i.p. injection of allogeneic endometrial segments. Dynamic changes of peritoneal macrophage subsets and polarization profiles were evaluated by flow cytometry (FCM). Macrophage morphology and density were assessed by cell counting under a microscope. Dynamic changes of Th1, Th2, Th17 and T reg cells were estimated by FCM. Peritoneal macrophages are composed of two distinct subsets: LPMs and SPMs. The proportion of SPMs increased immediately after peritoneal injection of endometrial tissues, whereas LPMs showed an opposite trend. Peritoneal macrophages differentiated into both M1 and M2 macrophages. The bidirectional polarization of macrophages was caused by the inverse trends of polarization of LPMs and SPMs. Consistently, the proportions of Th1, Th17 and T reg cells were all increased in mice with endometriosis. N/A. In this study, detection was only performed in a

  13. Nanoliposomal artemisinin for the treatment of murine visceral leishmaniasis

    Directory of Open Access Journals (Sweden)

    Want MY

    2017-03-01

    Full Text Available Muzamil Y Want,1 Mohammad Islammudin,1 Garima Chouhan,1 Hani A Ozbak,2 Hassan A Hemeg,2 Asoke P Chattopadhyay,3 Farhat Afrin2 1Parasite Immunology Laboratory, Department of Biotechnology, Jamia Hamdard, Hamdard University, New Delhi, India; 2Department of Clinical Laboratory Sciences, Faculty of Applied Medical Sciences, Taibah University, Medina, Saudi Arabia; 3Department of Chemistry, University of Kalyani, Kalyani, India Abstract: Visceral leishmaniasis (VL is a fatal, vector-borne disease caused by the intracellular protozoa of the genus Leishmania. Most of the therapeutics for VL are toxic, expensive, or ineffective. Sesquiterpenes are a new class of drugs with proven antimicrobial and antiviral activities. Artemisinin is a sesquiterpene lactone with potent antileishmanial activity, but with limited access to infected cells, being a highly lipophilic molecule. Association of artemisinin with liposome is a desirable strategy to circumvent the problem of poor accessibility, thereby improving its efficacy, as demonstrated in a murine model of experimental VL. Nanoliposomal artemisinin (NLA was prepared by thin-film hydration method and optimized using Box–Behnken design with a mean particle diameter of 83±16 nm, polydispersity index of 0.2±0.03, zeta potential of -27.4±5.7 mV, and drug loading of 33.2%±2.1%. Morphological study of these nanoliposomes by microscopy showed a smooth and spherical surface. The mechanism of release of artemisinin from the liposomes followed the Higuchi model in vitro. NLA was free from concomitant signs of toxicity, both ex vivo in murine macrophages and in vivo in healthy BALB/c mice. NLA significantly denigrated the intracellular infection of Leishmania donovani amastigotes and the number of infected macrophages ex vivo with an IC50 of 6.0±1.4 µg/mL and 5.1±0.9 µg/mL, respectively. Following treatment in a murine model of VL, NLA demonstrated superior efficacy compared to artemisinin with a

  14. Quantifying lung morphology with respiratory-gated micro-CT in a murine model of emphysema

    Science.gov (United States)

    Ford, N. L.; Martin, E. L.; Lewis, J. F.; Veldhuizen, R. A. W.; Holdsworth, D. W.; Drangova, M.

    2009-04-01

    Non-invasive micro-CT imaging techniques have been developed to investigate lung structure in free-breathing rodents. In this study, we investigate the utility of retrospectively respiratory-gated micro-CT imaging in an emphysema model to determine if anatomical changes could be observed in the image-derived quantitative analysis at two respiratory phases. The emphysema model chosen was a well-characterized, genetically altered model (TIMP-3 knockout mice) that exhibits a homogeneous phenotype. Micro-CT scans of the free-breathing, anaesthetized mice were obtained in 50 s and retrospectively respiratory sorted and reconstructed, providing 3D images representing peak inspiration and end expiration with 0.15 mm isotropic voxel spacing. Anatomical measurements included the volume and CT density of the lungs and the volume of the major airways, along with the diameters of the trachea, left bronchus and right bronchus. From these measurements, functional parameters such as functional residual capacity and tidal volume were calculated. Significant differences between the wild-type and TIMP-3 knockout groups were observed for measurements of CT density over the entire lung, indicating increased air content in the lungs of TIMP-3 knockout mice. These results demonstrate retrospective respiratory-gated micro-CT, providing images at multiple respiratory phases that can be analyzed quantitatively to investigate anatomical changes in murine models of emphysema.

  15. Microarray Gene Expression Analysis of Murine Tumor Heterogeneity Defined by Dynamic Contrast-Enhanced MRI

    Directory of Open Access Journals (Sweden)

    Nick G. Costouros

    2002-07-01

    Full Text Available Current methods of studying angiogenesis are limited in their ability to serially evaluate in vivo function throughout a target tissue. Dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI and pharmacokinetic modeling provide a useful method for evaluating tissue vasculature based on contrast accumulation and washout. While it is often assumed that areas of high contrast enhancement and washout comprise areas of increased angiogenesis and tumor activity, the actual molecular pathways that are active in such areas are poorly understood. Using DCE-MRI in a murine subcutaneous tumor model, we were able to perform pharmacokinetic functional analysis of a tumor, coregistration of MRI images with histological cross-sections, immunohistochemistry, laser capture microdissection, and genetic profiling of tumor heterogeneity based on pharmacokinetic parameters. Using imaging as a template for biologic investigation, we have not found evidence of increased expression of proangiogenic modulators at the transcriptional level in either distinct pharmacokinetic region. Furthermore, these regions show no difference on histology and CD31 immunohistochemistry. However, the expression of ribosomal proteins was greatly increased in high enhancement and washout regions, implying increased protein translation and consequent increased cellular activity. Together, these findings point to the potential importance of posttranscriptional regulation in angiogenesis and the need for the development of angiogenesis-specific contrast agents to evaluate in vivo angiogenesis at a molecular level.

  16. Genotypic adaptations associated with prolonged persistence of Lactobacillus plantarum in the murine digestive tract.

    Science.gov (United States)

    van Bokhorst-van de Veen, Hermien; Smelt, Maaike J; Wels, Michiel; van Hijum, Sacha A F T; de Vos, Paul; Kleerebezem, Michiel; Bron, Peter A

    2013-08-01

    Probiotic bacteria harbor effector molecules that confer health benefits, but also adaptation factors that enable them to persist in the gastrointestinal tract of the consumer. To study these adaptation factors, an antibiotic-resistant derivative of the probiotic model organism Lactobacillus plantarum WCFS1 was repeatedly exposed to the mouse digestive tract by three consecutive rounds of (re)feeding of the longest persisting colonies. This exposure to the murine intestine allowed the isolation of intestine-adapted derivatives of the original strain that displayed prolonged digestive tract residence time. Re-sequencing of the genomes of these adapted derivatives revealed single nucleotide polymorphisms as well as a single nucleotide insertion in comparison with the genome of the original WCFS1 strain. Detailed in silico analysis of the identified genomic modifications pinpointed that alterations in the coding regions of genes encoding cell envelope associated functions and energy metabolism appeared to be beneficial for the gastrointestinal tract survival of L. plantarum WCFS1. This work demonstrates the feasibility of experimental evolution for the enhancement of the gastrointestinal residence time of probiotic strains, while full-genome resequencing of the adapted isolates provided clues towards the bacterial functions involved. Enhanced gastrointestinal residence is industrially relevant because it enhances the efficacy of the delivery of viable probiotics in situ.

  17. Hepatocyte growth factor, a determinant of airspace homeostasis in the murine lung.

    Directory of Open Access Journals (Sweden)

    Carla Calvi

    Full Text Available The alveolar compartment, the fundamental gas exchange unit in the lung, is critical for tissue oxygenation and viability. We explored hepatocyte growth factor (HGF, a pleiotrophic cytokine that promotes epithelial proliferation, morphogenesis, migration, and resistance to apoptosis, as a candidate mediator of alveolar formation and regeneration. Mice deficient in the expression of the HGF receptor Met in lung epithelial cells demonstrated impaired airspace formation marked by a reduction in alveolar epithelial cell abundance and survival, truncation of the pulmonary vascular bed, and enhanced oxidative stress. Administration of recombinant HGF to tight-skin mice, an established genetic emphysema model, attenuated airspace enlargement and reduced oxidative stress. Repair in the TSK/+ mouse was punctuated by enhanced akt and stat3 activation. HGF treatment of an alveolar epithelial cell line not only induced proliferation and scattering of the cells but also conferred protection against staurosporine-induced apoptosis, properties critical for alveolar septation. HGF promoted cell survival was attenuated by akt inhibition. Primary alveolar epithelial cells treated with HGF showed improved survival and enhanced antioxidant production. In conclusion, using both loss-of-function and gain-of-function maneuvers, we show that HGF signaling is necessary for alveolar homeostasis in the developing lung and that augmentation of HGF signaling can improve airspace morphology in murine emphysema. Our studies converge on prosurvival signaling and antioxidant protection as critical pathways in HGF-mediated airspace maintenance or repair. These findings support the exploration of HGF signaling enhancement for diseases of the airspace.

  18. Quantifying lung morphology with respiratory-gated micro-CT in a murine model of emphysema

    International Nuclear Information System (INIS)

    Ford, N L; Martin, E L; Lewis, J F; Veldhuizen, R A W; Holdsworth, D W; Drangova, M

    2009-01-01

    Non-invasive micro-CT imaging techniques have been developed to investigate lung structure in free-breathing rodents. In this study, we investigate the utility of retrospectively respiratory-gated micro-CT imaging in an emphysema model to determine if anatomical changes could be observed in the image-derived quantitative analysis at two respiratory phases. The emphysema model chosen was a well-characterized, genetically altered model (TIMP-3 knockout mice) that exhibits a homogeneous phenotype. Micro-CT scans of the free-breathing, anaesthetized mice were obtained in 50 s and retrospectively respiratory sorted and reconstructed, providing 3D images representing peak inspiration and end expiration with 0.15 mm isotropic voxel spacing. Anatomical measurements included the volume and CT density of the lungs and the volume of the major airways, along with the diameters of the trachea, left bronchus and right bronchus. From these measurements, functional parameters such as functional residual capacity and tidal volume were calculated. Significant differences between the wild-type and TIMP-3 knockout groups were observed for measurements of CT density over the entire lung, indicating increased air content in the lungs of TIMP-3 knockout mice. These results demonstrate retrospective respiratory-gated micro-CT, providing images at multiple respiratory phases that can be analyzed quantitatively to investigate anatomical changes in murine models of emphysema.

  19. Quantifying lung morphology with respiratory-gated micro-CT in a murine model of emphysema

    Energy Technology Data Exchange (ETDEWEB)

    Ford, N L [Department of Physics, Ryerson University, 350 Victoria Street, Toronto, Ontario M5B 2K3 (Canada); Martin, E L; Lewis, J F; Veldhuizen, R A W [Lawson Health Research Institute, 268 Grosvenor Street, London, Ontario N6A 4V2 (Canada); Holdsworth, D W; Drangova, M [Imaging Research Laboratories, Robarts Research Institute, 100 Perth Drive, PO Box 5015, London, Ontario N6A 5K8 (Canada)], E-mail: nlford@ryerson.ca

    2009-04-07

    Non-invasive micro-CT imaging techniques have been developed to investigate lung structure in free-breathing rodents. In this study, we investigate the utility of retrospectively respiratory-gated micro-CT imaging in an emphysema model to determine if anatomical changes could be observed in the image-derived quantitative analysis at two respiratory phases. The emphysema model chosen was a well-characterized, genetically altered model (TIMP-3 knockout mice) that exhibits a homogeneous phenotype. Micro-CT scans of the free-breathing, anaesthetized mice were obtained in 50 s and retrospectively respiratory sorted and reconstructed, providing 3D images representing peak inspiration and end expiration with 0.15 mm isotropic voxel spacing. Anatomical measurements included the volume and CT density of the lungs and the volume of the major airways, along with the diameters of the trachea, left bronchus and right bronchus. From these measurements, functional parameters such as functional residual capacity and tidal volume were calculated. Significant differences between the wild-type and TIMP-3 knockout groups were observed for measurements of CT density over the entire lung, indicating increased air content in the lungs of TIMP-3 knockout mice. These results demonstrate retrospective respiratory-gated micro-CT, providing images at multiple respiratory phases that can be analyzed quantitatively to investigate anatomical changes in murine models of emphysema.

  20. Regulation of adhesion behavior of murine macrophage using supported lipid membranes displaying tunable mannose domains

    International Nuclear Information System (INIS)

    Kaindl, T; Oelke, J; Kaufmann, S; Tanaka, M; Pasc, A; Konovalov, O V; Funari, S S; Engel, U; Wixforth, A

    2010-01-01

    Highly uniform, strongly correlated domains of synthetically designed lipids can be incorporated into supported lipid membranes. The systematic characterization of membranes displaying a variety of domains revealed that the equilibrium size of domains significantly depends on the length of fluorocarbon chains, which can be quantitatively interpreted within the framework of an equivalent dipole model. A mono-dispersive, narrow size distribution of the domains enables us to treat the inter-domain correlations as two-dimensional colloidal crystallization and calculate the potentials of mean force. The obtained results demonstrated that both size and inter-domain correlation can precisely be controlled by the molecular structures. By coupling α-D-mannose to lipid head groups, we studied the adhesion behavior of the murine macrophage (J774A.1) on supported membranes. Specific adhesion and spreading of macrophages showed a clear dependence on the density of functional lipids. The obtained results suggest that such synthetic lipid domains can be used as a defined platform to study how cells sense the size and distribution of functional molecules during adhesion and spreading.

  1. Forced recombination of psi-modified murine leukaemia virus-based vectors with murine leukaemia-like and VL30 murine endogenous retroviruses

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Duch, M

    1999-01-01

    Co-encapsidation of retroviral RNAs into virus particles allows for the generation of recombinant proviruses through events of template switching during reverse transcription. By use of a forced recombination system based on recombinational rescue of replication- defective primer binding site-imp....... We note that recombination-based rescue of primer binding site knock-out retroviral vectors may constitute a sensitive assay to register putative genetic interactions involving endogenous retroviral RNAs present in cells of various species.......-impaired Akv-MLV-derived vectors, we here examine putative genetic interactions between vector RNAs and copackaged endogenous retroviral RNAs of the murine leukaemia virus (MLV) and VL30 retroelement families. We show (i) that MLV recombination is not blocked by nonhomology within the 5' untranslated region...... harbouring the supposed RNA dimer-forming cis -elements and (ii) that copackaged retroviral RNAs can recombine despite pronounced sequence dissimilarity at the cross-over site(s) and within parts of the genome involved in RNA dimerization, encapsidation and strand transferring during reverse transcription...

  2. The murine Cd48 gene: allelic polymorphism in the IgV-like region.

    Science.gov (United States)

    Cabrero, J G; Freeman, G J; Reiser, H

    1998-12-01

    The murine CD48 molecule is a member of the immunoglobulin superfamily which regulates the activation of T lymphocytes. prior cloning experiments using mRNA from two different mouse strains had yielded discrepant sequences within the IgV-like domain of murine CD48. To resolve this issue, we have directly sequenced genomic DNA of 10 laboratory strains and two inbred strains of wild origin. The results of our analysis reveal an allelic polymorphism within the IgV-like domain of murine CD48.

  3. Preparation of Murine Submandibular Salivary Gland for Upright Intravital Microscopy.

    Science.gov (United States)

    Ficht, Xenia; Thelen, Flavian; Stolp, Bettina; Stein, Jens V

    2018-05-07

    The submandibular salivary gland (SMG) is one of the three major salivary glands, and is of interest for many different fields of biological research, including cell biology, oncology, dentistry, and immunology. The SMG is an exocrine gland comprised of secretory epithelial cells, myofibroblasts, endothelial cells, nerves, and extracellular matrix. Dynamic cellular processes in the rat and mouse SMG have previously been imaged, mostly using inverted multi-photon microscope systems. Here, we describe a straightforward protocol for the surgical preparation and stabilization of the murine SMG in anesthetized mice for in vivo imaging with upright multi-photon microscope systems. We present representative intravital image sets of endogenous and adoptively transferred fluorescent cells, including the labeling of blood vessels or salivary ducts and second harmonic generation to visualize fibrillar collagen. In sum, our protocol allows for surgical preparation of mouse salivary glands in upright microscopy systems, which are commonly used for intravital imaging in the field of immunology.

  4. Corn silk induces nitric oxide synthase in murine macrophages.

    Science.gov (United States)

    Kim, Kyung A; Choi, Sang Kyu; Choi, Hye Seon

    2004-12-31

    Corn silk has been purified as an anticoagulant previously and the active component is a polysaccharide with a molecular mass of 135 kDa. It activates murine macrophages to induce nitric oxide synthase (NOS) and generate substantial amounts of NO in time and dose-dependent manners. It was detectable first at 15 h after stimulation by corn silk, peaked at 24 h, and undetectable by 48 h. Induction of NOS is inhibited by pyrolidine dithiocarbamate (PDTC) and genistein, an inhibitor of nuclear factor kappa B (NF-kappaB) and tyrosine kinase, respectively, indicating that iNOS stimulated by corn silk is associated with tyrosine kinase and NF-kappaB signaling pathways. IkappaB-alpha degradation was detectible at 10 min, and the level was restored at 120 min after treatment of corn silk. Corn silk induced nuclear translocation of NF-kappaB by phosphorylation and degradation of IkappaB-alpha.

  5. Flow cytometric quantification of radiation responses of murine peritoneal cells

    International Nuclear Information System (INIS)

    Tokita, N.; Raju, M.R.

    1982-01-01

    Methods have been developed to distinguish subpopulations of murine peritoneal cells, and these were applied to the measurement of early changes in peritoneal cells after irradiation. The ratio of the two major subpopulations in the peritoneal fluid, lymphocytes and macrophages, was measured rapidly by means of cell volume distribution analysis as well as by hypotonic propidium iodide (PI) staining. After irradiation, dose and time dependent changes were noted in the cell volume distributions: a rapid loss of peritoneal lymphocytes, and an increase in the mean cell volume of macrophages. The hypotonic PI staining characteristics of the peritoneal cells showed two or three distinctive G 1 peaks. The ratio of the areas of these peaks was also found to be dependent of the radiation dose and the time after irradiation. These results demonstrate that these two parameters may be used to monitor changes induced by irradiation (biological dosimetry), and to sort different peritoneal subpopulations

  6. A novel inexpensive murine model of oral chronic digitalization.

    Science.gov (United States)

    Helber, Izo; Kanashiro, Rosemeire M; Alarcon, Ernesto A; Antonio, Ednei L; Tucci, Paulo J F

    2004-01-01

    A novel inexpensive murine model of oral administration of digitoxin (100 micro g/kg per day) added to routine chow is described. Serum digitoxin levels achieved after oral (n = 5; 116 +/- 14 ng/mL) and subcutaneous (n = 5; 124 +/- 11 ng/mL) administration were similar. A significant increase in the maximal left ventricular pressure rise of treated (n = 9) compared with control (n = 6) rats (dP/dt: 8956 +/- 233 vs 7980 +/- 234 mmHg/s, respectively; P = 0.01) characterized the positive inotropic action of digitoxin. In addition, no differences were observed in treated compared with control rats with regard to the electrocardiogram and systolic and diastolic left ventricular pressures.

  7. The kin17 Protein in Murine Melanoma Cells

    Directory of Open Access Journals (Sweden)

    Anelise C. Ramos

    2015-11-01

    Full Text Available kin17 has been described as a protein involved in the processes of DNA replication initiation, DNA recombination, and DNA repair. kin17 has been studied as a potential molecular marker of breast cancer. This work reports the detection and localization of this protein in the murine melanoma cell line B16F10-Nex2 and in two derived subclones with different metastatic potential, B16-8HR and B16-10CR. Nuclear and chromatin-associated protein fractions were analyzed, and kin17 was detected in all fractions, with an elevated concentration observed in the chromatin-associated fraction of the clone with low metastatic potential, suggesting that the kin17 expression level could be a marker of melanoma.

  8. Haemopedia: An Expression Atlas of Murine Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Carolyn A. de Graaf

    2016-09-01

    Full Text Available Hematopoiesis is a multistage process involving the differentiation of stem and progenitor cells into distinct mature cell lineages. Here we present Haemopedia, an atlas of murine gene-expression data containing 54 hematopoietic cell types, covering all the mature lineages in hematopoiesis. We include rare cell populations such as eosinophils, mast cells, basophils, and megakaryocytes, and a broad collection of progenitor and stem cells. We show that lineage branching and maturation during hematopoiesis can be reconstructed using the expression patterns of small sets of genes. We also have identified genes with enriched expression in each of the mature blood cell lineages, many of which show conserved lineage-enriched expression in human hematopoiesis. We have created an online web portal called Haemosphere to make analyses of Haemopedia and other blood cell transcriptional datasets easier. This resource provides simple tools to interrogate gene-expression-based relationships between hematopoietic cell types and genes of interest.

  9. Macropinocytosis is the Entry Mechanism of Amphotropic Murine Leukemia Virus

    DEFF Research Database (Denmark)

    Rasmussen, Izabela; Vilhardt, Frederik

    2015-01-01

    of infection. Understanding how pathogens and toxins exploit or divert endocytosis pathways has advanced our understanding of membrane trafficking pathways, which benefits development of new therapeutical schemes and methods of drug delivery. We show here that Murine Leukemia Virus (A-MLV) pseudotyped......, or NIH-3T3 cells knocked-down for caveolin expression, was unaffected. Conversely, A-MLV infection of NIH-3T3 and HeLa cells was sensitive to amiloride analogues and actin-depolymerizing drugs that interfere with macropinocytosis. Further manipulation of the actin cytoskeleton through conditional...... with the amphotropic (expands the host range to many mammalian cells) envelope protein gains entry into host cells by macropinocytosis. Macropinosomes form as large, fluid-filled vacuoles (up to 10 μm) following collapse of cell surface protrusions and membrane scission. We use drugs or introduction of mutant proteins...

  10. Effects of trichostatins on differentiation of murine erythroleukemia cells

    International Nuclear Information System (INIS)

    Yoshida, M.; Nomura, S.; Beppu, T.

    1987-01-01

    The fungistatic antibiotics trichostatins (TS) A and C were isolated from culture broth of Streptomyces platensis No. 145 and were found to be potent inducers of differentiation in murine erythroleukemia (Friend and RV133) cells at concentrations of 1.5 X 10(-8) M for TSA and 5 X 10(-7) M for TSC. Differentiation induced by TS was cooperatively enhanced by UV irradiation but not by treatment with dimethyl sulfoxide. This enhanced activity was completely inhibited by adding cycloheximide to the culture medium 2 h after exposure to TS, suggesting that TS are dimethyl sulfoxide-type inducers of erythroid differentiation. No inhibitory effect of TS was observed on macromolecular synthesis in cultured cells

  11. First transplantation of isolated murine follicles in alginate.

    Science.gov (United States)

    Vanacker, Julie; Dolmans, Marie-Madeleine; Luyckx, Valérie; Donnez, Jacques; Amorim, Christiani A

    2014-01-01

    Our aim is to develop an artificial ovary allowing survival and growth of isolated follicles and ovarian cells, to restore fertility in women diagnosed with pathologies at high risk of ovarian involvement. For this, alginate beads containing isolated preantral follicles and ovarian cells were autografted to immunocompetent mice. One week after grafting, the beads were invaded by proliferating murine cells (12.1%) and capillaries. The recovery rate of follicles per graft ranged from 0% to 35.5%. Of the analyzed follicles, 77% were Ki67-positive and 81%, TUNEL-negative. Three antral follicles were also identified, evidencing their ability to grow in the matrix. Our results suggest that an artificial ovary is now conceivable, opening new perspectives to restore fertility in women.

  12. Electrospun poly(ε-caprolactone)/Ca-deficient hydroxyapatite nanohybrids: Microstructure, mechanical properties and cell response by murine embryonic stem cells

    International Nuclear Information System (INIS)

    Bianco, Alessandra; Di Federico, Erica; Moscatelli, Ilana; Camaioni, Antonella; Armentano, Ilaria; Campagnolo, Luisa; Dottori, Mariaserena; Kenny, Jose Maria; Siracusa, Gregorio; Gusmano, Gualtiero

    2009-01-01

    Nanohybrid scaffolds mimicking extracellular matrix are promising experimental models to study stem cell behaviour, in terms of adhesion and proliferation. In the present study, the structural characterization of a novel electrospun nanohybrid and the analysis of cell response by a highly sensitive cell type, embryonic stem (ES) cells, are investigated. Ca-deficient hydroxyapatite nanocrystals (d-HAp) were synthesized by precipitation. Fibrous PCL/d-HAp nanohybrids were obtained by electrospinning, d-HAp content ranging between 2 and 55 wt.%. Electrospun mats showed a non-woven architecture, average fiber size was 1.5 ±0.5 μm, porosity 80-90%, and specific surface area 16 m 2 g -1 . Up to 6.4 wt.% d-HAp content, the nanohybrids displayed comparable microstructural, mechanical and dynamo-mechanical properties. Murine ES cell response to neat PCL and to nanohybrid PCL/d-HAp (6.4 wt.%) mats was evaluated by analyzing morphological, metabolic and functional markers. Cells growing on either scaffold proliferated and maintained pluripotency markers at essentially the same rate as cells growing on standard tissue culture plates with no detectable signs of cytotoxicity, despite a lower cell adhesion at the beginning of culture. These results indicate that electrospun PCL scaffolds may provide adequate supports for murine ES cell proliferation in a pluripotent state, and that the presence of d-HAp within the mat does not interfere with their growth.

  13. Phenotypic correction of Fanconi anemia cells in the murine bone marrow after carrier cell mediated delivery of lentiviral vector.

    Science.gov (United States)

    Chakkaramakkil Verghese, Santhosh; Goloviznina, Natalya A; Kurre, Peter

    2016-11-19

    Fanconi anemia (FA) is an autosomal-recessive disorder associated with hematopoietic failure and it is a candidate for hematopoietic stem cell (HSC)-directed gene therapy. However, the characteristically reduced HSC numbers found in FA patients, their ineffective mobilization from the marrow, and re-oxygenation damage during ex vivo manipulation have precluded clinical success using conventional in vitro approaches. We previously demonstrated that lentiviral vector (LV) particles reversibly attach to the cell surface where they gain protection from serum complement neutralization. We reasoned that cellular delivery of LV to the bone marrow niche could avoid detrimental losses during FA HSC mobilization and in vitro modification. Here, we demonstrate that a VSV-G pseudotyped lentivector, carrying the FANCC transgene, can be transmitted from carrier to bystander cells. In cell culture and transplantation models of FA, we further demonstrate that LV carrier cells migrate along SDF-1α gradients and transfer vector particles that stably integrate and phenotypically correct the characteristic DNA alkylator sensitivity in murine and human FA-deficient target bystander cells. Altogether, we demonstrate that cellular homing mechanisms can be harnessed for the functional phenotype correction in murine FA hematopoietic cells.

  14. Phenotypic correction of Fanconi anemia cells in the murine bone marrow after carrier cell mediated delivery of lentiviral vector

    Directory of Open Access Journals (Sweden)

    Santhosh Chakkaramakkil Verghese

    2016-11-01

    Full Text Available Abstract Fanconi anemia (FA is an autosomal-recessive disorder associated with hematopoietic failure and it is a candidate for hematopoietic stem cell (HSC-directed gene therapy. However, the characteristically reduced HSC numbers found in FA patients, their ineffective mobilization from the marrow, and re-oxygenation damage during ex vivo manipulation have precluded clinical success using conventional in vitro approaches. We previously demonstrated that lentiviral vector (LV particles reversibly attach to the cell surface where they gain protection from serum complement neutralization. We reasoned that cellular delivery of LV to the bone marrow niche could avoid detrimental losses during FA HSC mobilization and in vitro modification. Here, we demonstrate that a VSV-G pseudotyped lentivector, carrying the FANCC transgene, can be transmitted from carrier to bystander cells. In cell culture and transplantation models of FA, we further demonstrate that LV carrier cells migrate along SDF-1α gradients and transfer vector particles that stably integrate and phenotypically correct the characteristic DNA alkylator sensitivity in murine and human FA-deficient target bystander cells. Altogether, we demonstrate that cellular homing mechanisms can be harnessed for the functional phenotype correction in murine FA hematopoietic cells.

  15. Anti-ageing effects of a new synthetic sphingolipid (K6EAA-L12) on aged murine skin.

    Science.gov (United States)

    Jung, Minyoung; Lee, Sanghoon; Park, Hwa-young; Youm, Jong-Kyung; Jeong, Sekyoo; Bae, Jonghwan; Kwon, Mi Jung; Park, Byeong Deog; Lee, Seung Hun; Choi, Eung Ho

    2011-04-01

    Recently, we reported on the anti-ageing effects of K6PC-5. This compound induced keratinocyte differentiation and fibroblast proliferation by increasing sphingosine-1 phosphate synthesis. We performed this study to confirm the anti-ageing effects of new synthetic products (the K6EAA series) derived from K6PC-5 through an amino group induction. Cellular responses such as differentiation, proliferation and calcium mobilization were investigated using cultured human keratinocytes and fibroblasts. Also, we measured the expressions of collagen mRNA and protein using real time RT-PCR and ELISA, respectively. The K6EAA-L12 product, selected by in vitro screening, was evaluated for anti-ageing effects on intrinsically and extrinsically (photo) aged models of hairless mice. In the intrinsically aged murine skin, K6EAA-L12 showed anti-ageing effects by activating collagen synthesis, eventually causing dermal thickening. Also, in the photo-aged skin, the dermal collagen density and dermal thickness were increased. In photo-aged murine skin, K6EAA-L12 increased stratum corneum integrity by increasing corneodesmosome density and improved the barrier recovery rate. However, there were no changes in the expressions of epidermal differentiation maker proteins. In conclusion, topical K6EAA-L12, a new synthetic K6PC-5 derivative, improves intrinsically and extrinsically (photo) aged skin by increasing the collagen density and improving the skin barrier function. © 2011 John Wiley & Sons A/S.

  16. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  17. Immunotherapy of Alzheimer's disease (AD): from murine models to anti-amyloid beta (Abeta) human monoclonal antibodies.

    Science.gov (United States)

    Geylis, Valeria; Steinitz, Michael

    2006-01-01

    The deposition of amyloid beta (Abeta) protein is a key pathological feature in Alzheimer's disease (AD). In murine models of AD, both active and passive immunization against Abeta induce a marked reduction in amyloid brain burden and an improvement in cognitive functions. Preliminary results of a prematurely terminated clinical trial where AD patients were actively vaccinated with aggregated Abeta bear resemblance to those documented in murine models. Passive immunization of AD patients with anti-Abeta antibodies, in particular human antibodies, is a strategy that provides a more cautious management and control of any undesired side effects. Sera of all healthy adults contain anti-Abeta IgG autoimmune antibodies. Hence antigen-committed human B-cells are easily immortalized by Epstein-Barr virus (EBV) into anti-Abeta secreting cell lines. Two anti-Abeta human monoclonal antibodies which we recently prepared bind to the N-terminus of Abeta peptide and were shown to stain amyloid plaques in non-fixed brain sections from an AD patient. It is anticipated that specifically selected anti-Abeta human monoclonal antibodies could reduce and inhibit deposits of amyloid in brain while avoiding the cognitive decline that characterizes AD. In the future, this type of antibody may prove to be a promising immune therapy for the disease.

  18. Murine model of long-term obstructive jaundice.

    Science.gov (United States)

    Aoki, Hiroaki; Aoki, Masayo; Yang, Jing; Katsuta, Eriko; Mukhopadhyay, Partha; Ramanathan, Rajesh; Woelfel, Ingrid A; Wang, Xuan; Spiegel, Sarah; Zhou, Huiping; Takabe, Kazuaki

    2016-11-01

    With the recent emergence of conjugated bile acids as signaling molecules in cancer, a murine model of obstructive jaundice by cholestasis with long-term survival is in need. Here, we investigated the characteristics of three murine models of obstructive jaundice. C57BL/6J mice were used for total ligation of the common bile duct (tCL), partial common bile duct ligation (pCL), and ligation of left and median hepatic bile duct with gallbladder removal (LMHL) models. Survival was assessed by Kaplan-Meier method. Fibrotic change was determined by Masson-Trichrome staining and Collagen expression. Overall, 70% (7 of 10) of tCL mice died by day 7, whereas majority 67% (10 of 15) of pCL mice survived with loss of jaundice. A total of 19% (3 of 16) of LMHL mice died; however, jaundice continued beyond day 14, with survival of more than a month. Compensatory enlargement of the right lobe was observed in both pCL and LMHL models. The pCL model demonstrated acute inflammation due to obstructive jaundice 3 d after ligation but jaundice rapidly decreased by day 7. The LHML group developed portal hypertension and severe fibrosis by day 14 in addition to prolonged jaundice. The standard tCL model is too unstable with high mortality for long-term studies. pCL may be an appropriate model for acute inflammation with obstructive jaundice, but long-term survivors are no longer jaundiced. The LHML model was identified to be the most feasible model to study the effect of long-term obstructive jaundice. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Chimeric anti-tenascin antibody 81C6: Increased tumor localization compared with its murine parent

    International Nuclear Information System (INIS)

    Zalutsky, Michael R.; Archer, Gary E.; Garg, Pradeep K.; Batra, Surinder K.; Bigner, Darell D.

    1996-01-01

    When labeled using the Iodogen method, a chimeric antibody composed of the human IgG 2 constant region and the variable regions of murine anti-tenascin 81C6 exhibited superior uptake in human glioma xenografts compared with its murine parent. In the current study, three paired-label experiments were performed in athymic mice with subcutaneous D-54 MG human glioma xenografts to evaluate further the properties of radioiodinated chimeric 81C6. These studies demonstrated that (a) the enhanced tumor uptake of chimeric 81C6 is specific; (b) when labeling was performed using N-succinimidyl 3-iodobenzoate, chimeric 81C6 again showed preferential accumulation in tumor compared with murine 81C6; and (c) the tumor uptake advantage observed previously with murine 81C6 for N-succinimidyl 3-iodobenzoate compared with Iodogen labeling did not occur with chimeric 81C6

  20. Responses of the Murine Myeloid Colony-Forming Cell to Ansamycin Antibiotics

    Science.gov (United States)

    Horoszewicz, Julius S.; Carter, William A.

    1974-01-01

    The in vitro susceptibility of murine myeloid colony-forming cells to the antiproliferative activities of three ansamycin antibiotics was determined. These cells were found to be 10- to 40-fold more susceptible than the corresponding human ones. PMID:4151701

  1. Diagnosing hypoxia in murine models of rheumatoid arthritis from reflectance multispectral images

    Science.gov (United States)

    Glinton, Sophie; Naylor, Amy J.; Claridge, Ela

    2017-07-01

    Spectra computed from multispectral images of murine models of Rheumatoid Arthritis show a characteristic decrease in reflectance within the 600-800nm region which is indicative of the reduction in blood oxygenation and is consistent with hypoxia.

  2. Acute Febrile Illness and Complications Due to Murine Typhus, Texas, USA1,2.

    Science.gov (United States)

    Afzal, Zeeshan; Kallumadanda, Sunand; Wang, Feng; Hemmige, Vagish; Musher, Daniel

    2017-08-01

    Murine typhus occurs relatively commonly in southern Texas, as well as in California. We reviewed records of 90 adults and children in whom murine typhus was diagnosed during a 3-year period in 2 hospitals in southern Texas, USA. Most patients lacked notable comorbidities; all were immunocompetent. Initial signs and symptoms included fever (99%), malaise (82%), headache (77%), fatigue (70%), myalgias (68%), and rash (39%). Complications, often severe, in 28% of patients included bronchiolitis, pneumonia, meningitis, septic shock, cholecystitis, pancreatitis, myositis, and rhabdomyolysis; the last 3 are previously unreported in murine typhus. Low serum albumin and elevated procalcitonin, consistent with bacterial sepsis, were observed in >70% of cases. Rash was more common in children; thrombocytopenia, hyponatremia, elevated hepatic transaminases, and complications were more frequent in adults. Murine typhus should be considered as a diagnostic possibility in cases of acute febrile illness in southern and even in more northern US states.

  3. A fluorescence model of the murine lung for optical detection of pathogenic bacteria

    Science.gov (United States)

    Durkee, Madeleine S.; Cirillo, Jeffrey D.; Maitland, Kristen C.

    2017-07-01

    We present a computer model of intravital excitation and external fluorescence detection in the murine lungs validated with a three-dimensional lung tissue phantom. The model is applied to optical detection of pulmonary tuberculosis infection.

  4. Radiobiological studies on target cell populations in murine bone marrow transplantation recipients.

    NARCIS (Netherlands)

    van Os, Ronald Peter

    1994-01-01

    The experiments presented in this thesis were designed to investigate the role of total body irradiation (TBI) in conditioning murine recipients of syngeneic and allogeneic bone marrow transplantation (BMT). ... Zie: Summary

  5. Apoptosis induction and attenuation of inflammatory gene expression in murine macrophages via multitherapeutic nanomembranes

    International Nuclear Information System (INIS)

    Pierstorff, Erik; Krucoff, Max; Ho, Dean

    2008-01-01

    The realization of optimized therapeutic delivery is impaired by the challenge of localized drug activity and by the dangers of systemic cytotoxicity which often contribute to patient treatment complications. Here we demonstrate the block copolymer-mediated deposition and release of multiple therapeutics which include an LXRα/β agonist 3-((4-methoxyphenyl)amino)-4-phenyl-1-(phenylmethyl)-1H-pyrrole-2,5-dione (LXRa) and doxorubicin hydrochloride (Dox) at the air-water interface via Langmuir-Blodgett deposition, as well as copolymer-mediated potent drug elution toward the Raw 264.7 murine macrophage cell line. The resultant copolymer-therapeutic hybrid serves as a localized platform that can be functionalized with virtually any drug due to the integrated hydrophilic and hydrophobic components of the polymer structure. In addition, the sequestering function of the copolymer to anchor the drugs to implant surfaces can enhance delivery specificity when compared to systemic drug administration. Confirmation of drug functionality was confirmed via suppression of the interleukin 6 (Il-6) and tumor necrosis factor alpha (TNFα) inflammatory cytokines (LXRa), as well as DNA fragmentation analysis (Dox). Furthermore, the fragmentation assays and gene expression analysis demonstrated the innate biocompatibility of the copolymeric material at the gene expression level via the confirmed absence of material-induced apoptosis and a lack of inflammatory gene expression. This modality enables layer-by-layer control of agonist and chemotherapeutic functionalization at the nanoscale for the localization of drug dosage, while simultaneously utilizing the copolymer platform as an anchoring mechanism for drug sequestering, all with an innate material thickness of 4 nm per layer, which is orders of magnitude thinner than existing commercial technologies. Furthermore, these studies comprehensively confirmed the potential translational applicability of copolymeric nanomaterials as

  6. Acute lethal toxicity following passive immunization for treatment of murine cryptococcosis.

    OpenAIRE

    Savoy, A C; Lupan, D M; Manalo, P B; Roberts, J S; Schlageter, A M; Weinhold, L C; Kozel, T R

    1997-01-01

    Passive immunization with monoclonal antibodies (MAbs) specific for the major capsular polysaccharide of Cryptococcus neoformans alters the course of murine cryptococcosis. During studies of passive immunization for treatment of murine cryptococcosis, we noted the occurrence of an acute, lethal toxicity. Toxicity was characterized by scratching, lethargy, respiratory distress, collapse, and death within 20 to 60 min after injection of antibody. The toxic effect was observed only in mice with ...

  7. Amelioration of murine passive immune thrombocytopenia by IVIg and a therapeutic monoclonal CD44 antibody does not require the Myd88 signaling pathway.

    Directory of Open Access Journals (Sweden)

    Andrew R Crow

    Full Text Available Immune thrombocytopenia (ITP is an autoimmune bleeding disorder characterized by a low platelet count and the production of anti-platelet antibodies. The majority of ITP patients have antibodies to platelet integrin α(IIbβ₃ (GPIIbIIIa which can direct platelet phagocytosis by macrophages. One effective treatment for patients with ITP is intravenous immunoglobulin (IVIg which rapidly reverses thrombocytopenia. The exact mechanism of IVIg action in human patients is unclear, although in mouse models of passive ITP, IVIg can rapidly increase platelet counts in the absence of adaptive immunity. Another antibody therapeutic that can similarly increase platelet counts independent of adaptive immunity are CD44 antibodies. Toll-like receptors (TLRs are pattern recognition receptors which play a central role in helping direct the innate immune system. Dendritic cells, which are notable for their expression of TLRs, have been directly implicated in IVIg function as an initiator cell, while CD44 can associate with TLR2 and TLR4. We therefore questioned whether IVIg, or the therapeutic CD44 antibody KM114, mediate their ameliorative effects in a manner dependent upon normal TLR function. Here, we demonstrate that the TLR4 agonist LPS does not inhibit IVIg or KM114 amelioration of antibody-induced thrombocytopenia, and that these therapeutics do not ameliorate LPS-induced thrombocytopenia. IVIg was able to significantly ameliorate murine ITP in C3H/HeJ mice which have defective TLR4. All known murine TLRs except TLR3 utilize the Myd88 adapter protein to drive TLR signaling. Employing Myd88 deficient mice, we found that both IVIg and KM114 ameliorate murine ITP in Myd88 deficient mice to the same extent as normal mice. Thus both IVIg and anti-CD44 antibody can mediate their ameliorative effects in murine passive ITP independent of the Myd88 signaling pathway. These data help shed light on the mechanism of action of IVIg and KM114 in the amelioration of

  8. Identification of BC005512 as a DNA damage responsive murine endogenous retrovirus of GLN family involved in cell growth regulation.

    Directory of Open Access Journals (Sweden)

    Yuanfeng Wu

    Full Text Available Genotoxicity assessment is of great significance in drug safety evaluation, and microarray is a useful tool widely used to identify genotoxic stress responsive genes. In the present work, by using oligonucleotide microarray in an in vivo model, we identified an unknown gene BC005512 (abbreviated as BC, official full name: cDNA sequence BC005512, whose expression in mouse liver was specifically induced by seven well-known genotoxins (GTXs, but not by non-genotoxins (NGTXs. Bioinformatics revealed that BC was a member of the GLN family of murine endogenous retrovirus (ERV. However, the relationship to genotoxicity and the cellular function of GLN are largely unknown. Using NIH/3T3 cells as an in vitro model system and quantitative real-time PCR, BC expression was specifically induced by another seven GTXs, covering diverse genotoxicity mechanisms. Additionally, dose-response and linear regression analysis showed that expression level of BC in NIH/3T3 cells strongly correlated with DNA damage, measured using the alkaline comet assay,. While in p53 deficient L5178Y cells, GTXs could not induce BC expression. Further functional studies using RNA interference revealed that down-regulation of BC expression induced G1/S phase arrest, inhibited cell proliferation and thus suppressed cell growth in NIH/3T3 cells. Together, our results provide the first evidence that BC005512, a member from GLN family of murine ERV, was responsive to DNA damage and involved in cell growth regulation. These findings could be of great value in genotoxicity predictions and contribute to a deeper understanding of GLN biological functions.

  9. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    Science.gov (United States)

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-05-15

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

  10. MicroRNA-gene expression network in murine liver during Schistosoma japonicum infection.

    Directory of Open Access Journals (Sweden)

    Pengfei Cai

    Full Text Available BACKGROUND: Schistosomiasis japonica remains a significant public health problem in China and Southeast Asian countries. The most typical and serious outcome of the chronic oriental schistosomiasis is the progressive granuloma and fibrosis in the host liver, which has been a major medical challenge. However, the molecular mechanism underling the hepatic pathogenesis is still not clear. METHODOLOGY AND PRINCIPAL FINDINGS: Using microarrays, we quantified the temporal gene expression profiles in the liver of Schistosoma japonicum-infected BALB/c mice at 15, 30, and 45 day post infection (dpi with that from uninfected mice as controls. Gene expression alternation associated with liver damage was observed in the initial phase of infection (dpi 15, which became more magnificent with the onset of egg-laying. Up-regulated genes were dominantly associated with inflammatory infiltration, whereas down-regulated genes primarily led to the hepatic functional disorders. Simultaneously, microRNA profiles from the same samples were decoded by Solexa sequencing. More than 130 miRNAs were differentially expressed in murine liver during S. japonicum infection. MiRNAs significantly dysregulated in the mid-phase of infection (dpi 30, such as mmu-miR-146b and mmu-miR-155, may relate to the regulation of hepatic inflammatory responses, whereas miRNAs exhibiting a peak expression in the late phase of infection (dpi 45, such as mmu-miR-223, mmu-miR-146a/b, mmu-miR-155, mmu-miR-34c, mmu-miR-199, and mmu-miR-134, may represent a molecular signature of the development of schistosomal hepatopathy. Further, a dynamic miRNA-gene co-expression network in the progression of infection was constructed. CONCLUSIONS AND SIGNIFICANCE: This study presents a global view of dynamic expression of both mRNA and miRNA transcripts in murine liver during S. japonicum infection, and highlights that miRNAs may play a variety of regulatory roles in balancing the immune responses during the

  11. Trehalose protects against ocular surface disorders in experimental murine dry eye through suppression of apoptosis.

    Science.gov (United States)

    Chen, Wei; Zhang, Xiaobo; Liu, Mimi; Zhang, Jingna; Ye, Ya; Lin, Ying; Luyckx, Jacques; Qu, Jia

    2009-09-01

    The disaccharide trehalose is a key element involved in anhydrobiosis (the capability of surviving almost complete dehydration) in many organisms. Its presence also confers resistance to desiccation and high osmolarity in bacterial and human cells by protecting proteins and membranes from denaturation. The present study used a novel murine dry eye model induced by controlled low-humidity air velocity to determine whether topically applied trehalose could heal ocular surface epithelial disorders caused by ocular surface desiccation. In addition, the efficacy of 87.6 mM trehalose eyedrops was compared with that of 20% serum, the efficacy of which has been well documented. Mice ocular surface epithelial disorders were induced by exposure of murine eyes to continuous controlled low-humidity air velocity in an intelligently controlled environmental system (ICES) for 21 days, which accelerated the tear evaporation. The mice were then randomized into three groups: the control group received PBS (0.01 M) treatment; a second group received 87.6 mM trehalose eyedrops treatment; and the third group received mice serum eyedrops treatment. Each treatment was administered as a 10 microl dose every 6 h for 14 days. The resultant changes in corneal barrier function and histopathologic examination of cornea and conjunctiva were analyzed and the level of apoptosis on the ocular surface was assessed using active caspase-3. After 14 days of treatment, the corneal fluorescein staining area, the ruffling and desquamating cells on the apical corneal epithelium, as well as the apoptotic cells on ocular surface epithelium had significantly reduced in eyes treated with trehalose compared with those treated with serum and PBS. In contrast, after 14 days of treatment, improvements in the thickness of the corneal epithelium, the squamous metaplasia in conjunctival epithelium and the number of goblet cells of the conjunctiva were less marked in eyes treated with trehalose compared with serum

  12. Loss of NAC1 expression is associated with defective bony patterning in the murine vertebral axis.

    Directory of Open Access Journals (Sweden)

    Kai Lee Yap

    Full Text Available NAC1 encoded by NACC1 is a member of the BTB/POZ family of proteins and participates in several pathobiological processes. However, its function during tissue development has not been elucidated. In this study, we compared homozygous null mutant Nacc1(-/- and wild type Nacc1(+/+ mice to determine the consequences of diminished NAC1 expression. The most remarkable change in Nacc1(-/- mice was a vertebral patterning defect in which most knockout animals exhibited a morphological transformation of the sixth lumbar vertebra (L6 into a sacral identity; thus, the total number of pre-sacral vertebrae was decreased by one (to 25 in Nacc1(-/- mice. Heterozygous Nacc1(+/- mice had an increased tendency to adopt an intermediate phenotype in which L6 underwent partial sacralization. Nacc1(-/- mice also exhibited non-closure of the dorsal aspects of thoracic vertebrae T10-T12. Chondrocytes from Nacc1(+/+ mice expressed abundant NAC1 while Nacc1(-/- chondrocytes had undetectable levels. Loss of NAC1 in Nacc1(-/- mice was associated with significantly reduced chondrocyte migratory potential as well as decreased expression of matrilin-3 and matrilin-4, two cartilage-associated extracellular matrix proteins with roles in the development and homeostasis of cartilage and bone. These data suggest that NAC1 participates in the motility and differentiation of developing chondrocytes and cartilaginous tissues, and its expression is necessary to maintain normal axial patterning of murine skeleton.

  13. Second-Hand Smoke Increases Bronchial Hyperreactivity and Eosinophilia in a Murine Model of Allergic Aspergillosis

    Directory of Open Access Journals (Sweden)

    Brian W. P. Seymour

    2003-01-01

    Full Text Available Involuntary inhalation of tobacco smoke has been shown to aggravate the allergic response. Antibodies to fungal antigens such as Aspergillus fumigatus (Af cause an allergic lung disease in humans. This study was carried out to determine the effect of environmental tobacco smoke (ETS on a murine model of allergic bronchopulmonary aspergillosis (ABPA. BALB/c mice were exposed to aged and diluted sidestream cigarette smoke to simulate 'second-hand smoke'. The concentration was consistent with that achieved in enclosed public areas or households where multiple people smoke. During exposure, mice were sensitized to Af antigen intranasally. Mice that were sensitized to Af antigen and exposed to ETS developed significantly greater airway hyperreactivity than did mice similarly sensitized to Af but housed in ambient air. The effective concentration of aerosolized acetylcholine needed to double pulmonary flow resistance was significantly lower in Af + ETS mice compared to the Af + AIR mice. Immunological data that supports this exacerbation of airway hyperresponsiveness being mediated by an enhanced type 1 hypersensitivity response include: eosinophilia in peripheral blood and lung sections. All Af sensitized mice produced elevated levels of IL4, IL5 and IL10 but no IFN-γ indicating a polarized Th2 response. Thus, ETS can cause exacerbation of asthma in ABPA as demonstrated by functional airway hyperresponsiveness and elevated levels of blood eosinophilia.

  14. Simvastatin Treatment Improves Survival in a Murine Model of Burn Sepsis

    Science.gov (United States)

    Beffa, David C; Fischman, Alan J.; Fagan, Shawn P.; Hamrahi, Victoria F.; Kaneki, Masao; Yu, Yong-Ming; Tompkins, Ronald G.; Carter, Edward A.

    2014-01-01

    Infection is the most common and most serious complication of a major burn injury related to burn size. Despite improvements in antimicrobial therapies sepsis still accounts for 50–60% of deaths in burn patients. Given the acute onset and unpredictable nature of sepsis, primary prevention was rarely attempted in its management. However, recent studies have demonstrated that statin treatment can decrease mortality is a murine model of sepsis by preservation of cardiac function and reversal of inflammatory alterations. In addition, it has been shown that treatment with statins is associated with reduced incidence of sepsis in human patients. In the current study groups of CD1 male mice (n=12) were anesthetized and subjected to a dorsal 30% TBSA scald burn injury. Starting 2 hours post burn, the animals were divided into a treatment group receiving 0.2 µ/g simvastatin or a sham group receiving placebo. Simvastatin and placebo were administered by intraperitoneal injection with two dosing regimens; once daily and every 12 hours. On Post burn day 7 cecal ligation and puncture with a 21-gauge needle was performed under ketamine/xylazine anesthesia and the two different dosing schedules were continued. A simvastatin dose dependant improvement in survival was observed in the burn sepsis model. PMID:21145172

  15. Adult Murine Skeletal Muscle Contains Cells That Can Differentiate into Beating Cardiomyocytes In Vitro

    Directory of Open Access Journals (Sweden)

    Winitsky Steve O

    2005-01-01

    Full Text Available It has long been held as scientific fact that soon after birth, cardiomyocytes cease dividing, thus explaining the limited restoration of cardiac function after a heart attack. Recent demonstrations of cardiac myocyte differentiation observed in vitro or after in vivo transplantation of adult stem cells from blood, fat, skeletal muscle, or heart have challenged this view. Analysis of these studies has been complicated by the large disparity in the magnitude of effects seen by different groups and obscured by the recently appreciated process of in vivo stem-cell fusion. We now show a novel population of nonsatellite cells in adult murine skeletal muscle that progress under standard primary cell-culture conditions to autonomously beating cardiomyocytes. Their differentiation into beating cardiomyocytes is characterized here by video microscopy, confocal-detected calcium transients, electron microscopy, immunofluorescent cardiac-specific markers, and single-cell patch recordings of cardiac action potentials. Within 2 d after tail-vein injection of these marked cells into a mouse model of acute infarction, the marked cells are visible in the heart. By 6 d they begin to differentiate without fusing to recipient cardiac cells. Three months later, the tagged cells are visible as striated heart muscle restricted to the region of the cardiac infarct.

  16. Adult murine skeletal muscle contains cells that can differentiate into beating cardiomyocytes in vitro.

    Directory of Open Access Journals (Sweden)

    Steve O Winitsky

    2005-04-01

    Full Text Available It has long been held as scientific fact that soon after birth, cardiomyocytes cease dividing, thus explaining the limited restoration of cardiac function after a heart attack. Recent demonstrations of cardiac myocyte differentiation observed in vitro or after in vivo transplantation of adult stem cells from blood, fat, skeletal muscle, or heart have challenged this view. Analysis of these studies has been complicated by the large disparity in the magnitude of effects seen by different groups and obscured by the recently appreciated process of in vivo stem-cell fusion. We now show a novel population of nonsatellite cells in adult murine skeletal muscle that progress under standard primary cell-culture conditions to autonomously beating cardiomyocytes. Their differentiation into beating cardiomyocytes is characterized here by video microscopy, confocal-detected calcium transients, electron microscopy, immunofluorescent cardiac-specific markers, and single-cell patch recordings of cardiac action potentials. Within 2 d after tail-vein injection of these marked cells into a mouse model of acute infarction, the marked cells are visible in the heart. By 6 d they begin to differentiate without fusing to recipient cardiac cells. Three months later, the tagged cells are visible as striated heart muscle restricted to the region of the cardiac infarct.

  17. CTGF/CCN2 Postconditioning Increases Tolerance of Murine Hearts towards Ischemia-Reperfusion Injury.

    Science.gov (United States)

    Kaasbøll, Ole Jørgen; Moe, Ingvild Tronstad; Ahmed, Mohammad Shakil; Stang, Espen; Hagelin, Else Marie Valbjørn; Attramadal, Håvard

    2016-01-01

    Previous studies of ischemia-reperfusion injury (IRI) in hearts from mice with cardiac-restricted overexpression of CCN2 have shown that CCN2 increases tolerance towards IRI. The objectives of this study were to investigate to what extent post-ischemic administration of recombinant human CCN2 (rhCCN2) would limit infarct size and improve functional recovery and what signaling pathways are involved. Isolated mice hearts were perfused ad modum Langendorff, subjected to no-flow, global ischemia, and subsequently, exposed to mammalian cell derived, full-length (38-40kDa) rhCCN2 (250 nM) or vehicle during the first 15 min of a 60 min reperfusion period. Post-ischemic administration of rhCCN2 resulted in attenuation of infarct size from 58 ± 4% to 34 ± 2% (p concentration-dependent increase of cardiac phospho-GSK3β (serine-9) contents. We demonstrate that post-ischemic administration of rhCCN2 increases the tolerance of ex vivo-perfused murine hearts to IRI. Mechanistically, this postconditioning effect of rhCCN2 appeared to be mediated by activation of the reperfusion injury salvage kinase pathway as demonstrated by sensitivity to PI3 kinase inhibition and increased CCN2-induced phosphorylation of GSK3β (Ser-9). Thus, the rationale for testing rhCCN2-mediated post-ischemic conditioning of the heart in more complex models is established.

  18. Differential Susceptibility of Spleen Focus-Forming Virus and Murine Leukemia Viruses to Ansamycin Antibiotics

    Science.gov (United States)

    Horoszewicz, Julius S.; Leong, Susan S.; Carter, William A.

    1977-01-01

    The streptovaricin complex (SvCx) and rifamycin SV derivatives display potent antiviral activity against the polycythemic strain of Friend leukemia virus (FV-P), as measured by a reduction in the number of spleen foci produced in mice. Such reductions may be explained by inactivation of functions of (i) the spleen focus-forming virus (SFFV), (ii) its “helper” murine leukemia virus (MuLV), or (iii) both viruses normally present in FV-P. We noted that preincubation of FV-P with fractionation products of SvCx, or derivatives of rifamycin SV, at low concentrations (3 to 5 μg/ml) reduces the number of spleen foci 80 to 97%, whereas titers of MuLV (from the same inoculum) remain unaffected (MuLV titers were measured by XC, S+L−, and “helper activity” assays). Our findings indicate a remarkable biological selectivity of ansamycins, as well as nonansamycin components of SvCx, against the transforming and defective spleen focus-forming virus as compared to MuLV. Thus, the drugs might be useful in distinguishing other types of oncornaviruses. PMID:18986

  19. Prevention of murine cerebral malaria by low-dose cyclosporin A.

    Science.gov (United States)

    Grau, G E; Gretener, D; Lambert, P H

    1987-08-01

    The effects of cyclosporin A (CsA) were investigated in an experimental model of cerebral malaria. In this model, Plasmodium berghei ANKA-infected CBA/Ca mice develop a clinically and histologically characterized neurological syndrome which is considered to be the result of immunopathological reactions mediated by L3T4+ T cells. It was shown that CsA displayed a strong protective effect on neurological complications when given at a dose 1 mg/kg/day for 5 consecutive days (Days 4-8), which had no effect on the parasite. Paradoxically, this protection against neurological complications was not seen when parasiticidal doses were used during this limited 5-day period. A similar protective effect was observed with two CsA derivatives, C5-34 and H7-94. The mechanisms by which CsA and the two derivatives could prevent murine cerebral malaria are unknown but can be related to exquisite effects on some lymphocyte functions. In view of these results, it might be conceivable to investigate the benefits of using low doses of CsA in man, in conjunction with the classical antiparasite therapy, for the management of cerebral malaria.

  20. Engineered Murine HSCs Reconstitute Multi-lineage Hematopoiesis and Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Yi-Fen Lu

    2016-12-01

    Full Text Available Hematopoietic stem cell (HSC transplantation is curative for malignant and genetic blood disorders, but is limited by donor availability and immune-mismatch. Deriving HSCs from patient-matched embryonic/induced-pluripotent stem cells (ESCs/iPSCs could address these limitations. Prior efforts in murine models exploited ectopic HoxB4 expression to drive self-renewal and enable multi-lineage reconstitution, yet fell short in delivering robust lymphoid engraftment. Here, by titrating exposure of HoxB4-ESC-HSC to Notch ligands, we report derivation of engineered HSCs that self-renew, repopulate multi-lineage hematopoiesis in primary and secondary engrafted mice, and endow adaptive immunity in immune-deficient recipients. Single-cell analysis shows that following engraftment in the bone marrow niche, these engineered HSCs further specify to a hybrid cell type, in which distinct gene regulatory networks of hematopoietic stem/progenitors and differentiated hematopoietic lineages are co-expressed. Our work demonstrates engineering of fully functional HSCs via modulation of genetic programs that govern self-renewal and lineage priming.

  1. Homocysteine elicits an M1 phenotype in murine macrophages through an EMMPRIN-mediated pathway.

    Science.gov (United States)

    Winchester, Lee J; Veeranki, Sudhakar; Givvimani, Srikanth; Tyagi, Suresh C

    2015-07-01

    Hyperhomocysteinemia (HHcy) is associated with inflammatory diseases and is known to increase the production of reactive oxygen species (ROS), matrix metalloproteinase (MMP)-9, and inducible nitric oxide synthase, and to decrease endothelial nitric oxide production. However, the impact of HHcy on macrophage phenotype differentiation is not well-established. It has been documented that macrophages have 2 distinct phenotypes: the "classically activated/destructive" (M1), and the "alternatively activated/constructive" (M2) subtypes. We hypothesize that HHcy increases M1 macrophage differentiation through extracellular matrix metalloproteinase inducer (EMMPRIN), a known inducer of matrix metalloproteinases. murine J774A.1 and Raw 264.7 macrophages were treated with 100 and 500 μmol/L Hcy, respectively, for 24 h. Samples were analyzed using Western blotting and immunocytochemistry. Homocysteine treatment increased cluster of differentiation 40 (CD40; M1 marker) in J774A.1 and Raw 264.7 macrophages. MMP-9 was induced in both cell lines. EMMPRIN protein expression was also increased in both cell lines. Blocking EMMPRIN function by pre-treating cells with anti-EMMPRIN antibody, with or without Hcy, resulted in significantly lower expression of CD40 in both cell lines by comparison with the controls. A DCFDA assay demonstrated increased ROS production in both cell lines with Hcy treatment when compared with the controls. Our results suggest that HHcy results in an increase of the M1 macrophage phenotype. This effect seems to be at least partially mediated by EMMPRIN induction.

  2. IL-22 and IDO1 Affect Immunity and Tolerance to Murine and Human Vaginal Candidiasis

    Science.gov (United States)

    De Luca, Antonella; Carvalho, Agostinho; Cunha, Cristina; Iannitti, Rossana G.; Pitzurra, Lucia; Giovannini, Gloria; Mencacci, Antonella; Bartolommei, Lorenzo; Moretti, Silvia; Massi-Benedetti, Cristina; Fuchs, Dietmar; De Bernardis, Flavia; Puccetti, Paolo; Romani, Luigina

    2013-01-01

    The ability to tolerate Candida albicans, a human commensal of the gastrointestinal tract and vagina, implicates that host defense mechanisms of resistance and tolerance cooperate to limit fungal burden and inflammation at the different body sites. We evaluated resistance and tolerance to the fungus in experimental and human vulvovaginal candidiasis (VVC) as well as in recurrent VVC (RVVC). Resistance and tolerance mechanisms were both activated in murine VVC, involving IL-22 and IL-10-producing regulatory T cells, respectively, with a major contribution by the enzyme indoleamine 2,3-dioxygenase 1 (IDO1). IDO1 was responsible for the production of tolerogenic kynurenines, such that replacement therapy with kynurenines restored immunoprotection to VVC. In humans, two functional genetic variants in IL22 and IDO1 genes were found to be associated with heightened resistance to RVVC, and they correlated with increased local expression of IL-22, IDO1 and kynurenines. Thus, IL-22 and IDO1 are crucial in balancing resistance with tolerance to Candida, their deficiencies are risk factors for RVVC, and targeting tolerance via therapeutic kynurenines may benefit patients with RVVC. PMID:23853597

  3. Mediator Med23 deficiency enhances neural differentiation of murine embryonic stem cells through modulating BMP signaling.

    Science.gov (United States)

    Zhu, Wanqu; Yao, Xiao; Liang, Yan; Liang, Dan; Song, Lu; Jing, Naihe; Li, Jinsong; Wang, Gang

    2015-02-01

    Unraveling the mechanisms underlying early neural differentiation of embryonic stem cells (ESCs) is crucial to developing cell-based therapies of neurodegenerative diseases. Neural fate acquisition is proposed to be controlled by a 'default' mechanism, for which the molecular regulation is not well understood. In this study, we investigated the functional roles of Mediator Med23 in pluripotency and lineage commitment of murine ESCs. Unexpectedly, we found that, despite the largely unchanged pluripotency and self-renewal of ESCs, Med23 depletion rendered the cells prone to neural differentiation in different differentiation assays. Knockdown of two other Mediator subunits, Med1 and Med15, did not alter the neural differentiation of ESCs. Med15 knockdown selectively inhibited endoderm differentiation, suggesting the specificity of cell fate control by distinctive Mediator subunits. Gene profiling revealed that Med23 depletion attenuated BMP signaling in ESCs. Mechanistically, MED23 modulated Bmp4 expression by controlling the activity of ETS1, which is involved in Bmp4 promoter-enhancer communication. Interestingly, med23 knockdown in zebrafish embryos also enhanced neural development at early embryogenesis, which could be reversed by co-injection of bmp4 mRNA. Taken together, our study reveals an intrinsic, restrictive role of MED23 in early neural development, thus providing new molecular insights for neural fate determination. © 2015. Published by The Company of Biologists Ltd.

  4. Optical coherence tomography and computer-aided diagnosis of a murine model of chronic kidney disease

    Science.gov (United States)

    Wang, Bohan; Wang, Hsing-Wen; Guo, Hengchang; Anderson, Erik; Tang, Qinggong; Wu, Tongtong; Falola, Reuben; Smith, Tikina; Andrews, Peter M.; Chen, Yu

    2017-12-01

    Chronic kidney disease (CKD) is characterized by a progressive loss of renal function over time. Histopathological analysis of the condition of glomeruli and the proximal convolutional tubules over time can provide valuable insights into the progression of CKD. Optical coherence tomography (OCT) is a technology that can analyze the microscopic structures of a kidney in a nondestructive manner. Recently, we have shown that OCT can provide real-time imaging of kidney microstructures in vivo without administering exogenous contrast agents. A murine model of CKD induced by intravenous Adriamycin (ADR) injection is evaluated by OCT. OCT images of the rat kidneys have been captured every week up to eight weeks. Tubular diameter and hypertrophic tubule population of the kidneys at multiple time points after ADR injection have been evaluated through a fully automated computer-vision system. Results revealed that mean tubular diameter and hypertrophic tubule population increase with time in post-ADR injection period. The results suggest that OCT images of the kidney contain abundant information about kidney histopathology. Fully automated computer-aided diagnosis based on OCT has the potential for clinical evaluation of CKD conditions.

  5. Purification and Crystallization of Murine Myostatin: A Negative Regulator of Muscle Mass

    Science.gov (United States)

    Hong, Young S.; Adamek, Daniel; Bridge, Kristi; Malone, Christine C.; Young, Ronald B.; Miller, Teresa; Karr, Laurel

    2004-01-01

    Myostatin (MSTN) has been crystallized and its preliminary X-ray diffraction data were collected. MSTN is a negative regulator of muscle growt/differentiation and suppressor of fat accumulation. It is a member of TGF-b family of proteins. Like other members of this family, the regulation of MSTN is critically tied to its process of maturation. This process involves the formation of a homodimer followed by two proteolytic steps. The first proteolytic cleavage produces a species where the n-terminal portion of the dimer is covalently separated from, but remains non-covalently bound to, the c-terminal, functional, portion of the protein. The protein is activated upon removal of the n-terminal "pro-segment" by a second n-terminal proteolytic cut by BMP-1 in vivo, or by acid treatment in vitro. Understanding the structural nature and physical interactions involved in these regulatory processes is the objective of our studies. Murine MSTN was purified from culture media of genetically engineered Chinese Hamster Ovary cells by multicolumn purification process and crystallized using the vapor diffusion method.

  6. Clearance and binding of radiolabeled glycoproteins by cells of the murine mononuclear phagocyte system

    International Nuclear Information System (INIS)

    Imber, M.J.

    1982-01-01

    The clearance and binding of radiolabeled lactoferrin and fast α 2 -macroglobulin were studied. Both glycoproteins cleared rapidly following intravenous injection in mice, and both bound specifically to discrete receptors on murine peritoneal macrophages. The simultaneous presence of excess, unlabeled ligands specific for receptors recognizing terminal fucose, mannose, N-acetylglucosamine or galactose residues did not inhibit the clearance or binding of either lactoferrin or fast-α 2 M. The clearance and binding of enzymatically defucosylated lactoferrin was indistinguishable from native lactoferrin, indicating that terminal α(1-3)-linked fucose on lactoferrin is not necessary for receptor recognition. The clearance and binding of two fast -α 2 M forms, α 2 M-trypsin and α 2 M-MeNH 2 cross compete with each other. Saturation binding studies indicated that the total binding of mannosyl -BSA, fusocyl-BSA, and N-acetylglucosaminyl-BSA to macrophages activated by BCG was approximately 15% of the levels observed with inflammatory macrophages elicited by thioglycollate broth. Cross-competition binding studies demonstrated a common surface receptor mediated binding of all three neoglycoprotein ligands and was identical to the receptor on mononuclear phagocytes that binds mannosyl- and N-acetylglucosaminyl-terminated glycoproteins. These results suggest that difference between discrete states of macrophage function may be correlated with selective changes in levels of the surface receptor for mannose-containing glycoproteins

  7. Radioautographic analysis of changes in different phases of cell kinetics in murine oral mucosa

    International Nuclear Information System (INIS)

    Park, Chang Suck; You, Dong Soo

    1983-01-01

    The age related changes in the life cycle of the progenitor cell population of murine oral epithelia was studied. Using radioautographic methods which have been adopted in previous cell cycle studies, the age-related changes of different phases in renewing cells of the palatal, buccal and lingual mucosae were determined. The results confirm published findings on cell cycle changes of epithelia with aging and illustrated further that mitotic phases which has hither to been considered stationary, also changes with aging. The major parts revealed by this study are as follows: 1. The basal progenitor cells in different regions of oral mucosa have different generation times. 2. The basal cell cycle time increases as a function of aging and the region most affected by aging appears to be the epithelium of the cheek. 3. The phases of the cell cycle affected by the process of aging are in increasing order of magnitude: M-, S- and G1-phase. 4. The age related change in the number of DNA synthesizing basal progenitor cells occurs at two age periods. Between 1 and 12 months of life it decreases, while from 12 to 20 months it increases.

  8. Essential role of the TFIID subunit TAF4 in murine embryogenesis and embryonic stem cell differentiation.

    Science.gov (United States)

    Langer, Diana; Martianov, Igor; Alpern, Daniel; Rhinn, Muriel; Keime, Céline; Dollé, Pascal; Mengus, Gabrielle; Davidson, Irwin

    2016-03-30

    TAF4 (TATA-binding protein-associated factor 4) and its paralogue TAF4b are components of the TFIID core module. We inactivated the murine Taf4a gene to address Taf4 function during embryogenesis. Here we show that Taf4a(-/-) embryos survive until E9.5 where primary germ layers and many embryonic structures are identified showing Taf4 is dispensable for their specification. In contrast, Taf4 is required for correct patterning of the trunk and anterior structures, ventral morphogenesis and proper heart positioning. Overlapping expression of Taf4a and Taf4b during embryogenesis suggests their redundancy at early stages. In agreement with this, Taf4a(-/-) embryonic stem cells (ESCs) are viable and comprise Taf4b-containing TFIID. Nevertheless, Taf4a(-/-) ESCs do not complete differentiation into glutamatergic neurons and cardiomyocytes in vitro due to impaired preinitiation complex formation at the promoters of critical differentiation genes. We define an essential role of a core TFIID TAF in differentiation events during mammalian embryogenesis.

  9. Curcumin increases the pathogenicity of Salmonella enterica serovar Typhimurium in murine model.

    Directory of Open Access Journals (Sweden)

    Sandhya A Marathe

    Full Text Available Curcumin has gained immense importance for its vast therapeutic and prophylactic applications. Contrary to this, our study reveals that it regulates the defense pathways of Salmonella enterica serovar Typhimurium (S. Typhimurium to enhance its pathogenicity. In a murine model of typhoid fever, we observed higher bacterial load in Peyer's patches, mesenteric lymph node, spleen and liver, when infected with curcumin-treated Salmonella. Curcumin increased the resistance of S. Typhimurium against antimicrobial agents like antimicrobial peptides, reactive oxygen and nitrogen species. This increased tolerance might be attributed to the up-regulation of genes involved in resistance against antimicrobial peptides--pmrD and pmrHFIJKLM and genes with antioxidant function--mntH, sodA and sitA. We implicate that iron chelation property of curcumin have a role in regulating mntH and sitA. Interestingly, we see that the curcumin-mediated modulation of pmr genes is through the PhoPQ regulatory system. Curcumin downregulates SPI1 genes, required for entry into epithelial cells and upregulates SPI2 genes required to intracellular survival. Since it is known that the SPI1 and SPI2 system can be regulated by the PhoPQ system, this common regulator could explain curcumin's mode of action. This data urges us to rethink the indiscriminate use of curcumin especially during Salmonella outbreaks.

  10. ALDH2(E487K) mutation increases protein turnover and promotes murine hepatocarcinogenesis.

    Science.gov (United States)

    Jin, Shengfang; Chen, Jiang; Chen, Lizao; Histen, Gavin; Lin, Zhizhong; Gross, Stefan; Hixon, Jeffrey; Chen, Yue; Kung, Charles; Chen, Yiwei; Fu, Yufei; Lu, Yuxuan; Lin, Hui; Cai, Xiujun; Yang, Hua; Cairns, Rob A; Dorsch, Marion; Su, Shinsan M; Biller, Scott; Mak, Tak W; Cang, Yong

    2015-07-21

    Mitochondrial aldehyde dehydrogenase 2 (ALDH2) in the liver removes toxic aldehydes including acetaldehyde, an intermediate of ethanol metabolism. Nearly 40% of East Asians inherit an inactive ALDH2*2 variant, which has a lysine-for-glutamate substitution at position 487 (E487K), and show a characteristic alcohol flush reaction after drinking and a higher risk for gastrointestinal cancers. Here we report the characterization of knockin mice in which the ALDH2(E487K) mutation is inserted into the endogenous murine Aldh2 locus. These mutants recapitulate essentially all human phenotypes including impaired clearance of acetaldehyde, increased sensitivity to acute or chronic alcohol-induced toxicity, and reduced ALDH2 expression due to a dominant-negative effect of the mutation. When treated with a chemical carcinogen, these mutants exhibit increased DNA damage response in hepatocytes, pronounced liver injury, and accelerated development of hepatocellular carcinoma (HCC). Importantly, ALDH2 protein levels are also significantly lower in patient HCC than in peritumor or normal liver tissues. Our results reveal that ALDH2 functions as a tumor suppressor by maintaining genomic stability in the liver, and the common human ALDH2 variant would present a significant risk factor for hepatocarcinogenesis. Our study suggests that the ALDH2*2 allele-alcohol interaction may be an even greater human public health hazard than previously appreciated.

  11. Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Guiqing; Sun, Dawei; Rajashankar, Kanagalaghatta R.; Qian, Zhaohui; Holmes, Kathryn V.; Li, Fang (Cornell); (UMM-MED); (Colorado)

    2011-09-28

    Coronaviruses have evolved diverse mechanisms to recognize different receptors for their cross-species transmission and host-range expansion. Mouse hepatitis coronavirus (MHV) uses the N-terminal domain (NTD) of its spike protein as its receptor-binding domain. Here we present the crystal structure of MHV NTD complexed with its receptor murine carcinoembryonic antigen-related cell adhesion molecule 1a (mCEACAM1a). Unexpectedly, MHV NTD contains a core structure that has the same {beta}-sandwich fold as human galectins (S-lectins) and additional structural motifs that bind to the N-terminal Ig-like domain of mCEACAM1a. Despite its galectin fold, MHV NTD does not bind sugars, but instead binds mCEACAM1a through exclusive protein-protein interactions. Critical contacts at the interface have been confirmed by mutagenesis, providing a structural basis for viral and host specificities of coronavirus/CEACAM1 interactions. Sugar-binding assays reveal that galectin-like NTDs of some coronaviruses such as human coronavirus OC43 and bovine coronavirus bind sugars. Structural analysis and mutagenesis localize the sugar-binding site in coronavirus NTDs to be above the {beta}-sandwich core. We propose that coronavirus NTDs originated from a host galectin and retained sugar-binding functions in some contemporary coronaviruses, but evolved new structural features in MHV for mCEACAM1a binding.

  12. Murine FATP alleviates growth and biochemical deficiencies of yeast fat1Delta strains

    DEFF Research Database (Denmark)

    Dirusso, C C; Connell, E J; Færgeman, Nils J.

    2000-01-01

    following incubation of the cells with exogenous oleate. Expression of either Fat1p or murine FATP from a plasmid in a fat1Delta strain restored these phenotypic and biochemical deficiencies. Fat1p and FATP restored growth of fat1Delta cells in the presence of cerulenin and under hypoxic conditions....... Furthermore, fatty-acid transport was restored and was found to be chain length specific: octanoate, a medium-chain fatty acid was transported in a Fat1p- and FATP-independent manner while the long-chain fatty acids myristate, palmitate, and oleate required either Fat1p or FATP for maximal levels of transport....... Lignoceryl CoA synthetase activities were restored to wild-type levels in fat1Delta strains expressing either Fat1p or FATP. Fat1p or FATP also restored wild-type levels of beta-oxidation of exogenous long-chain fatty acids. These data show that Fat1p and FATP are functionally equivalent when expressed...

  13. Handling stress may confound murine gut microbiota studies

    Directory of Open Access Journals (Sweden)

    Cary R. Allen-Blevins

    2017-01-01

    Full Text Available Background Accumulating evidence indicates interactions between human milk composition, particularly sugars (human milk oligosaccharides or HMO, the gut microbiota of human infants, and behavioral effects. Some HMO secreted in human milk are unable to be endogenously digested by the human infant but are able to be metabolized by certain species of gut microbiota, including Bifidobacterium longum subsp. infantis (B. infantis, a species sensitive to host stress (Bailey & Coe, 2004. Exposure to gut bacteria like B. infantisduring critical neurodevelopment windows in early life appears to have behavioral consequences; however, environmental, physical, and social stress during this period can also have behavioral and microbial consequences. While rodent models are a useful method for determining causal relationships between HMO, gut microbiota, and behavior, murine studies of gut microbiota usually employ oral gavage, a technique stressful to the mouse. Our aim was to develop a less-invasive technique for HMO administration to remove the potential confound of gavage stress. Under the hypothesis that stress affects gut microbiota, particularly B. infantis, we predicted the pups receiving a prebiotic solution in a less-invasive manner would have the highest amount of Bifidobacteria in their gut. Methods This study was designed to test two methods, active and passive, of solution administration to mice and the effects on their gut microbiome. Neonatal C57BL/6J mice housed in a specific-pathogen free facility received increasing doses of fructooligosaccharide (FOS solution or deionized, distilled water. Gastrointestinal (GI tracts were collected from five dams, six sires, and 41 pups over four time points. Seven fecal pellets from unhandled pups and two pellets from unhandled dams were also collected. Qualitative real-time polymerase chain reaction (qRT-PCR was used to quantify and compare the amount of Bifidobacterium, Bacteroides, Bacteroidetes, and

  14. The Hydrogen Peroxide Scavenger, Catalase, Alleviates Ion Transport Dysfunction in Murine Colitis

    Science.gov (United States)

    Barrett, Kim E.; McCole, Declan F.

    2016-01-01

    Reactive oxygen species (ROS) such as hydrogen peroxide (H2O2) contribute to epithelial damage and ion transport dysfunction (key events in inflammatory diarrhea) in inflammatory bowel disease (IBD). The aim of this study was to identify if H2O2 mediates suppression of colonic ion transport function in the murine dextran sulfate sodium (DSS) colitis model by using the H2O2 degrading enzyme, catalase. Colitis was induced by administering DSS (4%) in drinking water for 5 days followed by 3 days on normal H2O. Mice were administered either pegylated-catalase or saline at day −1, 0 and +1 of DSS treatment. Ion transport responses to the Ca2+-dependent agonist, carbachol (CCh), or the cAMP-dependent agonist, forskolin, were measured across distal colonic mucosa mounted in Ussing chambers. Parameters of DSS-induced inflammation (loss in body weight, decreased colon length, altered stool consistency), were only partially alleviated by catalase while histology was only minimally improved. However, catalase significantly reversed the DSS-induced reduction in baseline ion transport as well as colonic Isc responses to CCh. However, ion transport responses to forskolin were not significantly restored. Catalase also reduced activation of ERK MAP kinase in the setting of colitis, and increased expression of the Na+-K+-2Cl− cotransporter, NKCC1, consistent with restoration of ion transport function. Ex vivo treatment of inflamed colonic mucosae with catalase also partially restored ion transport function. Therefore, catalase partially prevents, and rescues, the loss of ion transport properties in DSS colitis even in the setting of unresolved tissue inflammation. These findings indicate a prominent role for ROS in ion transport dysfunction in colitis and may suggest novel strategies for the treatment of inflammatory diarrhea. PMID:27543846

  15. Hydrogen peroxide scavenger, catalase, alleviates ion transport dysfunction in murine colitis.

    Science.gov (United States)

    Barrett, Kim E; McCole, Declan F

    2016-11-01

    Reactive oxygen species (ROS) such as hydrogen peroxide (H 2 O 2 ) contribute to epithelial damage and ion transport dysfunction (key events in inflammatory diarrhoea) in inflammatory bowel disease (IBD). The aim of this study was to identify if H 2 O 2 mediates suppression of colonic ion transport function in the murine dextran sulfate sodium (DSS) colitis model by using the H 2 O 2 degrading enzyme, catalase. Colitis was induced by administering DSS (4%) in drinking water for 5 days followed by 3 days on normal H 2 O. Mice were administered either pegylated catalase or saline at day -1, 0 and +1 of DSS treatment. Ion transport responses to the Ca 2+ -dependent agonist, carbachol (CCh), or the cAMP-dependent agonist, forskolin, were measured across distal colonic mucosa mounted in Ussing chambers. Parameters of DSS-induced inflammation (loss in body weight, decreased colon length, altered stool consistency), were only partially alleviated by catalase while histology was only minimally improved. However, catalase significantly reversed the DSS-induced reduction in baseline ion transport as well as colonic I sc responses to CCh. However, ion transport responses to forskolin were not significantly restored. Catalase also reduced activation of ERK MAP kinase in the setting of colitis, and increased expression of the Na + -K + -2Cl - cotransporter, NKCC1, consistent with restoration of ion transport function. Ex vivo treatment of inflamed colonic mucosae with catalase also partially restored ion transport function. Therefore, catalase partially prevents, and rescues, the loss of ion transport properties in DSS colitis even in the setting of unresolved tissue inflammation. These findings indicate a prominent role for ROS in ion transport dysfunction in colitis and may suggest novel strategies for the treatment of inflammatory diarrhoea. © 2016 John Wiley & Sons Australia, Ltd.

  16. Cardiac Imaging Using Clinical 1.5 T MRI Scanners in a Murine Ischemia/Reperfusion Model

    Directory of Open Access Journals (Sweden)

    Jakob G. J. Voelkl

    2011-01-01

    Full Text Available To perform cardiac imaging in mice without having to invest in expensive dedicated equipment, we adapted a clinical 1.5 Tesla (T magnetic resonance imaging (MRI scanner for use in a murine ischemia/reperfusion model. Phase-sensitive inversion recovery (PSIR sequence facilitated the determination of infarct sizes in vivo by late gadolinium enhancement. Results were compared to histological infarct areas in mice after ischemia/reperfusion procedure with a good correlation (=0.807, <.001. In addition, fractional area change (FAC was assessed with single slice cine MRI and was matched to infarct size (=−0.837 and fractional shortening (FS measured with echocardiography (=0.860; both <.001. Here, we demonstrate the use of clinical 1.5 MRI scanners as a feasible method for basic phenotyping in mice. These widely available scanners are capable of investigating in vivo infarct dimensions as well as assessment of cardiac functional parameters in mice with reasonable throughput.

  17. Maintenance and induction of murine embryonic stem cell differentiation using E-cadherin-Fc substrata without colony formation

    Science.gov (United States)

    Meng, Qing-Yuan; Akaike, Toshihiro

    2013-03-01

    Induced embryonic stem (ES) cells are expected to be promising cell resources for the observation of the cell behaviors in developmental biology as well as the implantation in cell treatments in human diseases. A recombinant E-cadherin substratum was developed as a cell recognizable substratum to maintain the ES cells' self-renewal and pluripotency at single cell level. Furthermore, the generation of various cell lineages in different germ layers, including hepatic or neural cells, was achieved on the chimeric protein layer precisely and effectively. The induction and isolation of specific cell population was carried out with the enhancing effect of other artificial extracellular matrices (ECMs) in enzyme-free process. The murine ES cell-derived cells showed highly morphological similarities and functional expressions to matured hepatocytes or neural progenitor cells.

  18. Localization of transient receptor potential ion channels in primary and motile cilia of the female murine reproductive organs

    DEFF Research Database (Denmark)

    Teilmann, Stefan C.; Byskov, Anne Grete; Pedersen, Per Amstrup

    2005-01-01

    We have examined the subcellular localization of transient receptor potential (TRP) ion channels and the potential sensory role of cilia in murine female reproductive organs using confocal laser scanning microscopy analysis on ovary and oviduct tissue sections as well as on primary cultures...... of follicular granulosa cells. We show that the Ca2+ permeable cation channel, polycystin-2, as well as polycystin-1, a receptor that forms a functional protein complex with polycystin 2, distinctively localize to primary cilia emerging from granulosa cells of antral follicles in vivo and in vitro. Both...... polycystins are localized to motile oviduct cilia and this localization is greatly increased upon ovulatory gonadotropic stimulation. Further, the Ca2+ permeable cation channel, TRP vaniloid 4 (TRPV4), localizes to a sub-population of motile cilia on the epithelial cells of the ampulla and isthmus with high...

  19. DMPD: Toll-like receptor 9 in murine lupus: more friend than foe! [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18241699 Toll-like receptor 9 in murine lupus: more friend than foe! Yu P, Musette ...us: more friend than foe! PubmedID 18241699 Title Toll-like receptor 9 in murine lupus...P, Peng SL. Immunobiology. 2008;213(2):151-7. Epub 2007 Sep 21. (.png) (.svg) (.html) (.csml) Show Toll-like receptor 9 in murine lup

  20. Murine Models of Heart Failure With Preserved Ejection Fraction

    Directory of Open Access Journals (Sweden)

    Maria Valero-Muñoz, PhD

    2017-12-01

    Full Text Available Heart failure with preserved ejection fraction (HFpEF is characterized by signs and symptoms of heart failure in the presence of a normal left ventricular ejection fraction. Despite accounting for up to 50% of all clinical presentations of heart failure, the mechanisms implicated in HFpEF are poorly understood, thus precluding effective therapy. The pathophysiological heterogeneity in the HFpEF phenotype also contributes to this disease and likely to the absence of evidence-based therapies. Limited access to human samples and imperfect animal models that completely recapitulate the human HFpEF phenotype have impeded our understanding of the mechanistic underpinnings that exist in this disease. Aging and comorbidities such as atrial fibrillation, hypertension, diabetes and obesity, pulmonary hypertension, and renal dysfunction are highly associated with HFpEF, yet the relationship and contribution between them remains ill-defined. This review discusses some of the distinctive clinical features of HFpEF in association with these comorbidities and highlights the advantages and disadvantage of commonly used murine models used to study the HFpEF phenotype.

  1. A murine model of targeted infusion for intracranial tumors.

    Science.gov (United States)

    Kim, Minhyung; Barone, Tara A; Fedtsova, Natalia; Gleiberman, Anatoli; Wilfong, Chandler D; Alosi, Julie A; Plunkett, Robert J; Gudkov, Andrei; Skitzki, Joseph J

    2016-01-01

    Historically, intra-arterial (IA) drug administration for malignant brain tumors including glioblastoma multiforme (GBM) was performed as an attempt to improve drug delivery. With the advent of percutaneous neuorovascular techniques and modern microcatheters, intracranial drug delivery is readily feasible; however, the question remains whether IA administration is safe and more effective compared to other delivery modalities such as intravenous (IV) or oral administrations. Preclinical large animal models allow for comparisons between treatment routes and to test novel agents, but can be expensive and difficult to generate large numbers and rapid results. Accordingly, we developed a murine model of IA drug delivery for GBM that is reproducible with clear readouts of tumor response and neurotoxicities. Herein, we describe a novel mouse model of IA drug delivery accessing the internal carotid artery to treat ipsilateral implanted GBM tumors that is consistent and reproducible with minimal experience. The intent of establishing this unique platform is to efficiently interrogate targeted anti-tumor agents that may be designed to take advantage of a directed, regional therapy approach for brain tumors.

  2. Antinociception induced by rosuvastatin in murine neuropathic pain.

    Science.gov (United States)

    Miranda, Hugo F; Sierralta, Fernando; Aranda, Nicolas; Poblete, Paula; Castillo, Rodrigo L; Noriega, Viviana; Prieto, Juan Carlos

    2018-06-01

    Neuropathic pain, and subsequent hypernociception, can be induced in mice by paclitaxel (PTX) administration and partial sciatic nerve ligation (PSNL). Its pharmacotherapy has been a clinical challenge, due to a lack of effective treatment. In two models of mouse neuropathic pain (PTX and PSNL) the antinociception induced by rosuvastatin and the participation of proinflammatory biomarkers, interleukin (IL)- 1β, TBARS and glutathione were evaluated. A dose-response curve for rosuvastatin ip was obtained on cold plate, hot plate and Von Frey assays. Changes on spinal cord levels of IL-1β, glutathione and lipid peroxidation were measured at 7 and 14days in PTX and PSNL murine models. PTX or PSNL were able to induce in mice peripheral neuropathy with hypernociception, either to 7 and 14days. Rosuvastatin induced a dose dependent antinociception in hot plate, cold plate and Von Frey assays. The increased levels of IL-1β or TBARS induced by pretreatment with PTX or PSNL were reduced by rosuvastatin. The reduction of spinal cord glutathione, by PTX or PSNL, expressed as the ratio GSH/GSSG, were increased significantly in animals pretreated with rosuvastatin. The anti-inflammatory properties of statins could underlie their beneficial effects on neuropathic pain by reduction of proinflammatory biomarkers and activation of glia. The findings of this study suggest a potential usefulness of rosuvastatin in the treatment of neuropathic pain. Copyright © 2018 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier B.V. All rights reserved.

  3. Murine leukemia virus (MLV replication monitored with fluorescent proteins

    Directory of Open Access Journals (Sweden)

    Bittner Alexandra

    2004-12-01

    Full Text Available Abstract Background Cancer gene therapy will benefit from vectors that are able to replicate in tumor tissue and cause a bystander effect. Replication-competent murine leukemia virus (MLV has been described to have potential as cancer therapeutics, however, MLV infection does not cause a cytopathic effect in the infected cell and viral replication can only be studied by immunostaining or measurement of reverse transcriptase activity. Results We inserted the coding sequences for green fluorescent protein (GFP into the proline-rich region (PRR of the ecotropic envelope protein (Env and were able to fluorescently label MLV. This allowed us to directly monitor viral replication and attachment to target cells by flow cytometry. We used this method to study viral replication of recombinant MLVs and split viral genomes, which were generated by replacement of the MLV env gene with the red fluorescent protein (RFP and separately cloning GFP-Env into a retroviral vector. Co-transfection of both plasmids into target cells resulted in the generation of semi-replicative vectors, and the two color labeling allowed to determine the distribution of the individual genomes in the target cells and was indicative for the occurrence of recombination events. Conclusions Fluorescently labeled MLVs are excellent tools for the study of factors that influence viral replication and can be used to optimize MLV-based replication-competent viruses or vectors for gene therapy.

  4. Collagen-Induced Arthritis: A model for Murine Autoimmune Arthritis.

    Science.gov (United States)

    Pietrosimone, K M; Jin, M; Poston, B; Liu, P

    2015-10-20

    Collagen-induced arthritis (CIA) is a common autoimmune animal model used to study rheumatoid arthritis (RA). The development of CIA involves infiltration of macrophages and neutrophils into the joint, as well as T and B cell responses to type II collagen. In murine CIA, genetically susceptible mice (DBA/1J) are immunized with a type II bovine collagen emulsion in complete Freund's adjuvant (CFA), and receive a boost of type II bovine collagen in incomplete Freund's adjuvant (IFA) 21 days after the first injection. These mice typically develop disease 26 to 35 days after the initial injection. C57BL/6J mice are resistant to arthritis induced by type II bovine collagen, but can develop arthritis when immunized with type II chicken collagen in CFA, and receive a boost of type II chicken collagen in IFA 21 days after the first injection. The concentration of heat-killed Mycobacterium tuberculosis H37RA (MT) in CFA also differs for each strain. DBA/1J mice develop arthritis with 1 mg/ml MT, while C57BL/6J mice require and 3-4 mg/ml MT in order to develop arthritis. CIA develops slowly in C57BL/6J mice and cases of arthritis are mild when compared to DBA/1J mice. This protocol describes immunization of DBA/1J mice with type II bovine collagen and the immunization of C57BL/6J mice with type II chicken collagen.

  5. An in vitro model of murine middle ear epithelium.

    Science.gov (United States)

    Mulay, Apoorva; Akram, Khondoker M; Williams, Debbie; Armes, Hannah; Russell, Catherine; Hood, Derek; Armstrong, Stuart; Stewart, James P; Brown, Steve D M; Bingle, Lynne; Bingle, Colin D

    2016-11-01

    Otitis media (OM), or middle ear inflammation, is the most common paediatric disease and leads to significant morbidity. Although understanding of underlying disease mechanisms is hampered by complex pathophysiology it is clear that epithelial abnormalities underpin the disease. There is currently a lack of a well-characterised in vitro model of the middle ear (ME) epithelium that replicates the complex cellular composition of the middle ear. Here, we report the development of a novel in vitro model of mouse middle ear epithelial cells (mMECs) at an air-liquid interface (ALI) that recapitulates the characteristics of the native murine ME epithelium. We demonstrate that mMECs undergo differentiation into the varied cell populations seen within the native middle ear. Proteomic analysis confirmed that the cultures secrete a multitude of innate defence proteins from their apical surface. We showed that the mMECs supported the growth of the otopathogen, nontypeable Haemophilus influenzae (NTHi), suggesting that the model can be successfully utilised to study host-pathogen interactions in the middle ear. Overall, our mMEC culture system can help to better understand the cell biology of the middle ear and improve our understanding of the pathophysiology of OM. The model also has the potential to serve as a platform for validation of treatments designed to reverse aspects of epithelial remodelling that underpin OM development. © 2016. Published by The Company of Biologists Ltd.

  6. Hamster and Murine Models of Severe Destructive Lyme Arthritis

    Science.gov (United States)

    Munson, Erik; Nardelli, Dean T.; Du Chateau, Brian K.; Callister, Steven M.; Schell, Ronald F.

    2012-01-01

    Arthritis is a frequent complication of infection in humans with Borrelia burgdorferi. Weeks to months following the onset of Lyme borreliosis, a histopathological reaction characteristic of synovitis including bone, joint, muscle, or tendon pain may occur. A subpopulation of patients may progress to a chronic, debilitating arthritis months to years after infection which has been classified as severe destructive Lyme arthritis. This arthritis involves focal bone erosion and destruction of articular cartilage. Hamsters and mice are animal models that have been utilized to study articular manifestations of Lyme borreliosis. Infection of immunocompetent LSH hamsters or C3H mice results in a transient synovitis. However, severe destructive Lyme arthritis can be induced by infecting irradiated hamsters or mice and immunocompetent Borrelia-vaccinated hamsters, mice, and interferon-gamma- (IFN-γ-) deficient mice with viable B. burgdorferi. The hamster model of severe destructive Lyme arthritis facilitates easy assessment of Lyme borreliosis vaccine preparations for deleterious effects while murine models of severe destructive Lyme arthritis allow for investigation of mechanisms of immunopathology. PMID:22461836

  7. Mechanism of immunotoxicological effects of tributyltin chloride on murine thymocytes.

    Science.gov (United States)

    Sharma, Neelima; Kumar, Anoop

    2014-04-01

    Tributyltin-chloride, a well-known organotin compound, is a widespread environmental toxicant. The immunotoxic effects of tributyltin-chloride on mammalian system and its mechanism is still unclear. This study is designed to explore the mode of action of tributyltin-induced apoptosis and other parallel apoptotic pathways in murine thymocytes. The earliest response in oxidative stress followed by mitochondrial membrane depolarization and caspase-3 activation has been observed. Pre-treatment with N-acetyl cysteine and buthionine sulfoximine effectively inhibited the tributyltin-induced apoptotic DNA and elevated the sub G1 population, respectively. Caspase inhibitors pretreatment prevent tributyltin-induced apoptosis. Western blot and flow cytometry indicate no translocation of apoptosis-inducing factor and endonuclease G in the nuclear fraction from mitochondria. Intracellular Ca(2+) levels are significantly raised by tributyltin chloride. These results clearly demonstrate caspase-dependent apoptotic pathway and support the role of oxidative stress, mitochondrial membrane depolarization, caspase-3 activation, and calcium during tributyltin-chloride (TBTC)-induced thymic apoptosis.

  8. Genomic rearrangement in radiation-induced murine myeloid leukemia

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi

    1994-01-01

    After whole body irradiation of 3Gy X ray to C3H/He male mice, acute myeloid leukemia is induced at an incidence of 20 to 30% within 2 years. We have studied the mechanism of occurrence of this radiation-induced murine myeloid leukemia. Detection and isolation of genomic structural aberration which may be accumulated accompanied with leukemogenesis are helpful in analyzing the complicated molecular process from radiation damage to leukemogenesis. So, our research work was done in three phases. First, structures of previously characterized oncogenes and cytokine-related genes were analyzed, and abnormal structures of fms(protooncogene encoding M-CSF receptor gene)-related and myc-related genes were found in several leukemia cells. Additionally, genomic structural aberration of IL-3 gene was observed in some leukemia cells, so that construction of genomic libraries and cloning of the abnormal IL-3 genomic DNAs were performed to characterize the structure. Secondly, because the breakage of chromosome 2 that is frequently observed in myeloid leukemia locates in proximal position of IL-1 gene cluster in some cases, the copy number of IL-1 gene was determined and the gene was cloned. Lastly, the abnormal genome of leukemia cell was cloned by in-gel competence reassociation method. We discussed these findings and evaluated the analysis of the molecular process of leukemogenesis using these cloned genomic fragments. (author)

  9. Effect of SPG (Sonifilan) immunotherapy and PDT on murine tumor

    International Nuclear Information System (INIS)

    Korbelik, M.; Krosl, G.; Dougherty, G.J.; Chaplin, D.J.

    1992-01-01

    PhotoDynamic Therapy of solid tumors is unique in eliciting a strong host immune response unparalleled in other cancer therapies. This immune response is manifested as an acute inflammatory reaction, and can be readily seen as redness and edema around the treated area. Destruction of typical solid tumor cannot be accomplished solely by direct phototoxic action. This was shown to be the case even with drugs more potent in this direct killing effect than Photofrin, the photosensitizer presently used in clinical PDT. Limiting factors seem to be regional insufficiencies in supply of molecular oxygen, needed for generation of phototoxic species. They can be ascribed to the existence of chronically and acute hypoxic tumor regions, oxygen consumption by the photodynamic process, and vascular shutdown induced during PDT. The remaining tumor mass is eradicated by an indirect effect, necrosis induced by destruction of tumor vasculature. Since most events in PDT treated tumor that lead to vascular collapse are, in fact, typical inflammatory manifestations, it was suggested that PDT-induced acute inflammatory reaction actually leads to vascular damage. In a related report characteristics are shown of cellular inflammatory infiltrate in PDT-treated murine tumor. This work examines the effect of combining PDT with immunotherapy, in an attempt to investigate a possibility of amplification of immune reaction to PDT and its direction towards more pervasive destruction of treated tumors. (authors). 6 refs

  10. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

    Science.gov (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

    2012-01-01

    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

  11. Chromosomal mechanisms in murine radiation acute myeloid leukemogenesis

    International Nuclear Information System (INIS)

    Bouffler, S.D.; Breckon, G.; Cox, R.

    1996-01-01

    Chromosome 2 abnormalities, particularly interstitial deletions, characterize murine radiation-induced acute myeloid leukaemias (AMLs). Here, G-band analyses in CBA/H mice of early (1-6 month) post 3 Gy X-radiation events in bone marrow cells in vivo and karyotype evolution in one unusual AML are presented. The early event analysis showed that all irradiated animals carry chromosome 2 abnormalities, that chromosome 2 abnormalities are more frequent than expected and that interstitial deletions are more common in chromosome 2 than in the remainder of the genome. On presentation AML case N122 carried a t(2; 11) terminal translocation which, with passaging, evolved into a del2(C3F3). Therefore two pathways in leukaemogenesis might exist, one deletion-driven, the other terminal tranlocation-driven involving interstitial genes and terminal genes respectively of chromosome 2. As all irradiated individuals carried chromosome 2 abnormalities, the formation of these aberrations does not determine individual leukaemogenic sensitivity as only 20-25% of animals would be expected to develop AML. Similar lines of argument suggest that chromosome 2 abnormalities are necessary but not sufficient for radiation leukaemogenesis in CBA/H nor are they rate limiting in leukaemogenesis. (Author)

  12. Retino-hypothalamic regulation of light-induced murine sleep

    Directory of Open Access Journals (Sweden)

    Fanuel eMuindi

    2014-08-01

    Full Text Available The temporal organization of sleep is regulated by an interaction between the circadian clock and homeostatic processes. Light indirectly modulates sleep through its ability to phase shift and entrain the circadian clock. Light can also exert a direct, circadian-independent effect on sleep. For example, acute exposure to light promotes sleep in nocturnal animals and wake in diurnal animals. The mechanisms whereby light directly influences sleep and arousal are not well understood. In this review, we discuss the direct effect of light on sleep at the level of the retina and hypothalamus in rodents. We review murine data from recent publications showing the roles of rod-, cone- and melanopsin-based photoreception on the initiation and maintenance of light-induced sleep. We also present hypotheses about hypothalamic mechanisms that have been advanced to explain the acute control of sleep by light. Specifically, we review recent studies assessing the roles of the ventrolateral preoptic area and the suprachiasmatic nucleus. We also discuss how light might differentially promote sleep and arousal in nocturnal and diurnal animals respectively. Lastly, we suggest new avenues for research on this topic which is still in its early stages.

  13. Combination effect of cisplatin and radiation in murine solid tumors

    International Nuclear Information System (INIS)

    Egawa, Shin; Lee, Kan-ei; Ishibashi, Akira; Komiyama, Hiroki; Umezawa, Iwao.

    1986-01-01

    The combination effect of cisplatin and radiation was studied using the two different murine systems of sarcoma 180 and Ehrlich solid tumors. In sarcoma 180 solid tumor the minimal effective doses (MED) of cisplatin and radiation were 19.5 mg/kg and 10375 rad respectively whereas these doses did not show any effective antitumor activity practically. Administration of cisplatin with a doses of 9 mg/kg given 24 hours before radiation (1000 rad), however, showed synergistic antitumor activity. In Ehrlich solid tumor the MED of cisplatin and radiation were 13.8 mg/kg and 2892 rad respectively. Treatment with cisplatin, 3, 6 or 9 mg/kg, given 24 hours before radiation (1000 rad) showed also synergistic antitumor activity also. Sodium thiosulfate (STS) rescue was effective in reducing toxicity of cisplatin on combined use of the drug with radiation. Cell kinetics of sarcoma 180 solid tumor in vivo after the combined treatment was analyzed by computer aided flowcytometry. Accumulation of cells in the radiosensitive G 2 + M phase was observed 18 to 42 hours after a single intraperitoneal administration of 9 mg/kg of cisplatin. It is strongly suggested that this synchronization is one of the mechanisms of the synergism in the combination therapy. (author)

  14. High salt intake does not exacerbate murine autoimmune thyroiditis

    Science.gov (United States)

    Kolypetri, P; Randell, E; Van Vliet, B N; Carayanniotis, G

    2014-01-01

    Recent studies have shown that high salt (HS) intake exacerbates experimental autoimmune encephalomyelitis and have raised the possibility that a HS diet may comprise a risk factor for autoimmune diseases in general. In this report, we have examined whether a HS diet regimen could exacerbate murine autoimmune thyroiditis, including spontaneous autoimmune thyroiditis (SAT) in non-obese diabetic (NOD.H2h4) mice, experimental autoimmune thyroiditis (EAT) in C57BL/6J mice challenged with thyroglobulin (Tg) and EAT in CBA/J mice challenged with the Tg peptide (2549–2560). The physiological impact of HS intake was confirmed by enhanced water consumption and suppressed aldosterone levels in all strains. However, the HS treatment failed to significantly affect the incidence and severity of SAT or EAT or Tg-specific immunoglobulin (Ig)G levels, relative to control mice maintained on a normal salt diet. In three experimental models, these data demonstrate that HS intake does not exacerbate autoimmune thyroiditis, indicating that a HS diet is not a risk factor for all autoimmune diseases. PMID:24528002

  15. An in vitro model of murine middle ear epithelium

    Directory of Open Access Journals (Sweden)

    Apoorva Mulay

    2016-11-01

    Full Text Available Otitis media (OM, or middle ear inflammation, is the most common paediatric disease and leads to significant morbidity. Although understanding of underlying disease mechanisms is hampered by complex pathophysiology it is clear that epithelial abnormalities underpin the disease. There is currently a lack of a well-characterised in vitro model of the middle ear (ME epithelium that replicates the complex cellular composition of the middle ear. Here, we report the development of a novel in vitro model of mouse middle ear epithelial cells (mMECs at an air–liquid interface (ALI that recapitulates the characteristics of the native murine ME epithelium. We demonstrate that mMECs undergo differentiation into the varied cell populations seen within the native middle ear. Proteomic analysis confirmed that the cultures secrete a multitude of innate defence proteins from their apical surface. We showed that the mMECs supported the growth of the otopathogen, nontypeable Haemophilus influenzae (NTHi, suggesting that the model can be successfully utilised to study host–pathogen interactions in the middle ear. Overall, our mMEC culture system can help to better understand the cell biology of the middle ear and improve our understanding of the pathophysiology of OM. The model also has the potential to serve as a platform for validation of treatments designed to reverse aspects of epithelial remodelling that underpin OM development.

  16. Snake venoms components with antitumor activity in murine melanoma cells

    International Nuclear Information System (INIS)

    Queiroz, Rodrigo Guimaraes

    2012-01-01

    Despite the constant advances in the treatment of cancer, this disease remains one of the main causes of mortality worldwide. So, the development of new treatment modalities is imperative. Snake venom causes a variety of biological effects because they constitute a complex mixture of substances as disintegrins, proteases (serine and metalo), phospholipases A2, L-amino acid oxidases and others. The goal of the present work is to evaluate a anti-tumor activity of some snake venoms fractions. There are several studies of components derived from snake venoms with this kind of activity. After fractionation of snake venoms of the families Viperidae and Elapidae, the fractions were assayed towards murine melanoma cell line B16-F10 and fibroblasts L929. The results showed that the fractions of venom of the snake Notechis ater niger had higher specificity and potential antitumor activity on B16-F10 cell line than the other studied venoms. Since the components of this venom are not explored yet coupled with the potential activity showed in this work, we decided to choose this venom to develop further studies. The cytotoxic fractions were evaluated to identify and characterize the components that showed antitumoral activity. Western blot assays and zymography suggests that these proteins do not belong to the class of metallo and serine proteinases. (author)

  17. Electrocautery effect on intestinal vascularisation in a murine model.

    Science.gov (United States)

    Tremblay, Jean-François; Sideris, Lucas; Leblond, François A; Trépanier, Jean-Sébastien; Badrudin, David; Drolet, Pierre; Mitchell, Andrew; Dubé, Pierre

    2016-09-01

    The use of electrocautery devices is associated with complications such as perforation or fistulisation when used near intestinal structures. This is likely due to its effect on vascularisation of the bowel wall. To test this hypothesis we established a murine model to quantify the effect of electrocautery injury on the intestinal microvascularisation. Sprague-Dawley rats were subjected to five electrocautery injuries on the small bowel in coagulation mode (30 W intensity) and in cut mode (40 W, 80 W and 200 W intensities) for durations of 1, 2 and 5 s. 5 mg/kg of fluorescein was injected intravenously, the injured bowel segments harvested and the rat sacrificed. The segments were analysed to measure the fluorescence of injured bowel compared to adjacent unharmed tissue. A significant decrease in bowel wall microvascularisation occurred with increasing intensity (coag 30 W/cut 40 W versus cut 200 W 1 s: p electrocautery injury (cut 40 W 1/2 s versus 5 s: p electrocautery injury, a significantly greater microvascularisation decrease was observed in jejunum compared to ileum (p electrocautery use. Unsurprisingly, the decrease in microvascularisation is greater with higher intensity and duration of electrocautery and is associated with more perforations in the experimental model. The jejunum seems more vulnerable to electrocautery injury than the ileum. These observations support caution when using electrocautery devices near intestinal structures.

  18. Melatonin modulates adiponectin expression on murine colitis with sleep deprivation.

    Science.gov (United States)

    Kim, Tae Kyun; Park, Young Sook; Baik, Haing-Woon; Jun, Jin Hyun; Kim, Eun Kyung; Sull, Jae Woong; Sung, Ho Joong; Choi, Jin Woo; Chung, Sook Hee; Gye, Myung Chan; Lim, Ju Yeon; Kim, Jun Bong; Kim, Seong Hwan

    2016-09-07

    To determine adiponectin expression in colonic tissue of murine colitis and systemic cytokine expression after melatonin treatments and sleep deprivation. The following five groups of C57BL/6 mice were used in this study: (1) group I, control; (2) group II, 2% DSS induced colitis for 7 d; (3) group III, 2% DSS induced colitis and melatonin treatment; (4) group IV, 2% DSS induced colitis with sleep deprivation (SD) using specially designed and modified multiple platform water baths; and (5) group V, 2% DSS induced colitis with SD and melatonin treatment. Melatonin (10 mg/kg) or saline was intraperitoneally injected daily to mice for 4 d. The body weight was monitored daily. The degree of colitis was evaluated histologically after sacrificing the mice. Immunohistochemical staining and Western blot analysis was performed using anti-adiponectin antibody. After sampling by intracardiac punctures, levels of serum cytokines were measured by ELISA. Sleep deprivation in water bath exacerbated DSS induced colitis and worsened weight loss. Melatonin injection not only alleviated the severity of mucosal injury, but also helped survival during stressful condition. The expression level of adiponectin in mucosa was decreased in colitis, with the lowest level observed in colitis combined with sleep deprivation. Melatonin injection significantly (P sleep deprivation.

  19. Concepts for treatment of micrometastases developed in murine systems

    International Nuclear Information System (INIS)

    Schabel, F.M. Jr.

    1976-01-01

    Current knowledge of tumor cell population growth kinetics indicates that the growth fraction (viable tumor cells undergoing active cell replication) is inversely related to population size. Tumor cells in micrometastases should, therefore, be more sensitive to anticancer drugs active against anabolizing cells than are tumor cells in the larger, grossly apparent primary tumor from which they were derived. This indicates the probability that micrometastases will be effectively responsive to more drugs than is the primary and clinically apparent tumor from which they came. Studies with at least four metastatic and uniformly fatal murine solid tumors (lung, breast, colon, and melanoma) have demonstrated significantly improved cure rates with drug treatment following surgical removal of the grossly apparent primary tumor than can be obtained with either surgery or drug treatment when used alone. Further, both disease staging and drug dosage have been shown to influence cure rates of combined-modality treatment. With several mouse tumors, a significantly smaller number of viable tumor cells can establish lethal tumors in the presence of radiation-inactivated tumor cells than in their absence. This suggests that small numbers of residual viable tumor cells in radiation-treated tumor sites may be a greater threat to clinical cure than smaller tumor cell populations remaining in situ after surgery

  20. Expression, refolding and crystallization of murine MHC class I H-2Db in complex with human β2-microglobulin

    International Nuclear Information System (INIS)

    Sandalova, Tatyana; Michaëlsson, Jakob; Harris, Robert A.; Ljunggren, Hans-Gustaf; Kärre, Klas; Schneider, Gunter; Achour, Adnane

    2005-01-01

    Mouse MHC class I H-2Db in complex with human β2m and the LCMV-derived peptide gp33 has been produced and crystallized. Resolution of the structure of this complex combined with the structural comparison with the previously solved crystal structure of H-2Db/mβ2m/gp33 should lead to a better understanding of how the β2m subunit affects the overall conformation of MHC complexes as well as the stability of the presented peptides. β 2 -Microglobulin (β 2 m) is non-covalently linked to the major histocompatibility (MHC) class I heavy chain and interacts with CD8 and Ly49 receptors. Murine MHC class I can bind human β 2 m (hβ 2 m) and such hybrid molecules are often used in structural and functional studies. The replacement of mouse β 2 m (mβ 2 m) by hβ 2 m has important functional consequences for MHC class I complex stability and specificity, but the structural basis for this is unknown. To investigate the impact of species-specific β 2 m subunits on MHC class I conformation, murine MHC class I H-2D b in complex with hβ 2 m and the peptide gp33 derived from lymphocytic choriomeningitis virus (LCMV) has been expressed, refolded in vitro and crystallized. Crystals containing two complexes per asymmetric unit and belonging to the space group P2 1 , with unit-cell parameters a = 68.1, b = 65.2, c = 101.9 Å, β = 102.4°, were obtained

  1. Serial passaging of Candida albicans in systemic murine infection suggests that the wild type strain SC5314 is well adapted to the murine kidney.

    Directory of Open Access Journals (Sweden)

    Anja Lüttich

    Full Text Available The opportunistic fungal pathogen Candida albicans has a remarkable ability to adapt to unfavorable environments by different mechanisms, including microevolution. For example, a previous study has shown that passaging through the murine spleen can cause new phenotypic characteristics. Since the murine kidney is the main target organ in murine Candida sepsis and infection of the spleen differs from the kidney in several aspects, we tested whether C. albicans SC5314 could evolve to further adapt to infection and persistence within the kidney. Therefore, we performed a long-term serial passage experiment through the murine kidney of using a low infectious dose. We found that the overall virulence of the commonly used wild type strain SC5314 did not change after eight passages and that the isolated pools showed only very moderate changes of phenotypic traits on the population level. Nevertheless, the last passage showed a higher phenotypic variability and a few individual strains exhibited phenotypic alterations suggesting that microevolution has occurred. However, the majority of the tested single strains were phenotypically indistinguishable from SC5314. Thus, our findings indicate that characteristics of SC5314 which are important to establish and maintain kidney infection over a prolonged time are already well developed.

  2. Differential activation of murine herpesvirus 68- and Kaposi's sarcoma-associated herpesvirus-encoded ORF74 G protein-coupled receptors by human and murine chemokines

    NARCIS (Netherlands)

    Verzijl, D.; Fitzsimons, C.P.; Van Dijk, M.; Stewart, J.P.; Timmerman, H.; Smit, M.J.; Leurs, R.

    2004-01-01

    Infection of mice with murine gammaherpesvirus 68 (MHV-68) is a well-characterized small animal model for the study of gammaherpesvirus infection. MHV-68 belongs to the same herpesvirus family as herpesvirus saimiri (HVS) of New World squirrel monkeys and human herpesvirus 8 (HHV-8) (also referred

  3. Selection of optimal therapy for neuroblastoma: a study of the immunomodulatory effects of surgery and irradiation in the murine C1300 neuroblastoma model

    International Nuclear Information System (INIS)

    Topalian, S.L.; Ziegler, M.M.

    1987-01-01

    Human neuroblastoma is an immunogenic tumor for which therapy directed in an immunologic context may offer some advantage over conventional treatment. This study examines the immunomodulatory effects of surgery and irradiation in the murine C1300 neuroblastoma model. In vivo studies of primary tumor growth characteristics after treatment demonstrated no superiority of either therapeutic modality in control of local tumor or prolongation of host survival. However, irradiated hosts showed an increased ability to reject a secondary tumor challenge, compared to their surgical counterparts. That this phenomenon may be immune-related is suggested by in vitro studies of T lymphocyte function utilizing mixed lymphocyte-tumor cell cultures and PHA lymphoblastogenesis

  4. High fat diet accelerates pathogenesis of murine Crohn's disease-like ileitis independently of obesity.

    Directory of Open Access Journals (Sweden)

    Lisa Gruber

    Full Text Available BACKGROUND: Obesity has been associated with a more severe disease course in inflammatory bowel disease (IBD and epidemiological data identified dietary fats but not obesity as risk factors for the development of IBD. Crohn's disease is one of the two major IBD phenotypes and mostly affects the terminal ileum. Despite recent observations that high fat diets (HFD impair intestinal barrier functions and drive pathobiont selection relevant for chronic inflammation in the colon, mechanisms of high fat diets in the pathogenesis of Crohn's disease are not known. The aim of this study was to characterize the effect of HFD on the development of chronic ileal inflammation in a murine model of Crohn's disease-like ileitis. METHODS: TNF(ΔARE/WT mice and wildtype C57BL/6 littermates were fed a HFD compared to control diet for different durations. Intestinal pathology and metabolic parameters (glucose tolerance, mesenteric tissue characteristics were assessed. Intestinal barrier integrity was characterized at different levels including polyethylene glycol (PEG translocation, endotoxin in portal vein plasma and cellular markers of barrier function. Inflammatory activation of epithelial cells as well as immune cell infiltration into ileal tissue were determined and related to luminal factors. RESULTS: HFD aggravated ileal inflammation but did not induce significant overweight or typical metabolic disorders in TNF(ΔARE/WT. Expression of the tight junction protein Occludin was markedly reduced in the ileal epithelium of HFD mice independently of inflammation, and translocation of endotoxin was increased. Epithelial cells showed enhanced expression of inflammation-related activation markers, along with enhanced luminal factors-driven recruitment of dendritic cells and Th17-biased lymphocyte infiltration into the lamina propria. CONCLUSIONS: HFD feeding, independently of obesity, accelerated disease onset of small intestinal inflammation in Crohn's disease

  5. Neuroprotective effect of bilberry extract in a murine model of photo-stressed retina.

    Directory of Open Access Journals (Sweden)

    Hideto Osada

    Full Text Available Excessive exposure to light promotes degenerative and blinding retinal diseases such as age-related macular degeneration and retinitis pigmentosa. However, the underlying mechanisms of photo-induced retinal degeneration are not fully understood, and a generalizable preventive intervention has not been proposed. Bilberry extract is an antioxidant-rich supplement that ameliorates ocular symptoms. However, its effects on photo-stressed retinas have not been clarified. In this study, we examined the neuroprotective effects of bilberry extract against photo-stress in murine retinas. Light-induced visual function impairment recorded by scotopic and phototopic electroretinograms showing respective rod and cone photoreceptor function was attenuated by oral administration of bilberry extract through a stomach tube in Balb/c mice (750 mg/kg body weight. Bilberry extract also suppressed photo-induced apoptosis in the photoreceptor cell layer and shortening of the outer segments of rod and cone photoreceptors. Levels of photo-induced reactive oxygen species (ROS, oxidative and endoplasmic reticulum (ER stress markers, as measured by real-time reverse transcriptase polymerase chain reaction, were reduced by bilberry extract treatment. Reduction of ROS by N-acetyl-L-cysteine, a well-known antioxidant also suppressed ER stress. Immunohistochemical analysis of activating transcription factor 4 expression showed the presence of ER stress in the retina, and at least in part, in Müller glial cells. The photo-induced disruption of tight junctions in the retinal pigment epithelium was also attenuated by bilberry extract, repressing an oxidative stress marker, although ER stress markers were not repressed. Our results suggest that bilberry extract attenuates photo-induced apoptosis and visual dysfunction most likely, and at least in part, through ROS reduction, and subsequent ER stress attenuation in the retina. This study can help understand the mechanisms of photo

  6. Effects of copper nanoparticle exposure on host defense in a murine pulmonary infection model

    Directory of Open Access Journals (Sweden)

    Grassian Vicki H

    2011-09-01

    Full Text Available Abstract Background Human exposure to nanoparticles (NPs and environmental bacteria can occur simultaneously. NPs induce inflammatory responses and oxidative stress but may also have immune-suppressive effects, impairing macrophage function and altering epithelial barrier functions. The purpose of this study was to assess the potential pulmonary effects of inhalation and instillation exposure to copper (Cu NPs using a model of lung inflammation and host defense. Methods We used Klebsiella pneumoniae (K.p. in a murine lung infection model to determine if pulmonary bacterial clearance is enhanced or impaired by Cu NP exposure. Two different exposure modes were tested: sub-acute inhalation (4 hr/day, 5 d/week for 2 weeks, 3.5 mg/m3 and intratracheal instillation (24 hr post-exposure, 3, 35, and 100 μg/mouse. Pulmonary responses were evaluated by lung histopathology plus measurement of differential cell counts, total protein, lactate dehydrogenase (LDH activity, and inflammatory cytokines in bronchoalveolar lavage (BAL fluid. Results Cu NP exposure induced inflammatory responses with increased recruitment of total cells and neutrophils to the lungs as well as increased total protein and LDH activity in BAL fluid. Both inhalation and instillation exposure to Cu NPs significantly decreased the pulmonary clearance of K.p.-exposed mice measured 24 hr after bacterial infection following Cu NP exposure versus sham-exposed mice also challenged with K.p (1.4 × 105 bacteria/mouse. Conclusions Cu NP exposure impaired host defense against bacterial lung infections and induced a dose-dependent decrease in bacterial clearance in which even our lowest dose demonstrated significantly lower clearance than observed in sham-exposed mice. Thus, exposure to Cu NPs may increase the risk of pulmonary infection.

  7. Effect of Tityus serrulatus venom on cytokine production and the activity of murine macrophages

    Directory of Open Access Journals (Sweden)

    Vera L. Petricevich

    2002-01-01

    Full Text Available The purpose of this study was to investigate the effects of Tityus serrulatus venom (TSV on murine peritoneal macrophages evaluated in terms of activation. The effects of crude TSV were analysed by detection of cytokines, oxygen intermediate metabolites (H2O2 and nitric oxide (NO in supernatants of peritoneal macrophages. Several functional bioassays were employed including an in vitro model for envenomating: cytotoxicity of TSV was assessed using the lyses percentage. Tumor necrosis factor (TNF activity was assayed by measuring its cytotoxic activity on L-929 cells, and interleukin-6 (IL-6 and interferon-γ (IFN-γ were assayed by enzyme-linked immunosorbent assay, whereas NO levels were detected by Griess colorimetric reactions in culture supernatant of macrophages incubated with TSV and subsequently exposed to either lipopolysaccharide or IFN-γ. Incubation of macrophages with TSV increased production of IL-6 and IFN-γ in a dose-dependent manner. TNF production was not detected in supernatants treated with TSV at any concentration. The increase in IL-6 secretion was not associated with concentration-dependent cytoxicity of TSV on these cells. These data suggest that the cytotoxicity does not appear to be the main cause of an increased cytokine production by these cells. Although NO is an important effector molecule in macrophage microbicidal activity, the inducing potential of the test compounds for its release was found to be very moderate, ranging from 125 to 800 mM. Interestingly, NO levels of peritoneal macrophages were increased after IFN-γ. Moreover, NO production had an apparent effect on macrophage activity. The results obtained here also shown that the TSV induces an important elevation in H2O2 release. These results combined with NO production suggest that TSV possesses significant immunomodulatory activities capable of stimulating immune functions in vitro.

  8. Engraftment versus immunosuppression: cost-benefit analysis of immunosuppression after intrahepatic murine islet transplantation.

    Science.gov (United States)

    Marzorati, Simona; Melzi, Raffaella; Citro, Antonio; Cantarelli, Elisa; Mercalli, Alessia; Scavini, Marina; Piemonti, Lorenzo

    2014-05-27

    Immunosuppression (IS) in islet transplantation (Tx) is a double-edged sword: it prevents immunoreaction but has the potential to impair islet engraftment. The aim of this study was to identify in murine animal models the IS platform with the best balance between these two opposite effects. To study the impact of IS on islet engraftment diabetic C57BL/6 mice were transplanted with 350 syngeneic islets through the portal vein and treated once-daily with either rapamycin (RAPA; 0.1-0.5-1 mg/kg ip), tacrolimus (FK506; 0.1-0.5-1 mg/kg ip), mycophenolate mofetil (MMF; 60-120-300 mg/kg oral) or vehicle for 14 days. Islet function was evaluated by measuring not-fasting glycemia and by performing an IVGTT on days 15 and 30 post-Tx. RAPA ≥0.5 mg/Kg, FK506 ≥0.5 mg/Kg, and MMF ≥120 mg/kg had detrimental effects on islet engraftment but not on the function of islets already engrafted in the liver. The effect on engraftment was irreversible and persisted even after IS withdrawal. The lower dose of IS that did not affect engraftment was tested for preventing rejection in the full mismatch allogeneic Tx BALB/c to C57BL/6 model. RAPA and/or FK506 were inefficient in preventing rejection, even when anti-IL2R mAb was added to the IS regimen. On the other hand, MMF alone or in association with FK506 significantly prolonged the time to islet rejection. IS showed profound dose-dependent deleterious effects on islet cell engraftment. The MMF/FK506 combination proved the best balance with less toxicity at the time of engraftment and more efficacy in controlling graft rejection.

  9. Modulation of Active Gut Microbiota by Lactobacillus rhamnosus GG in a Diet Induced Obesity Murine Model

    Directory of Open Access Journals (Sweden)

    Yosep Ji

    2018-04-01

    Full Text Available Gut microbiota play a key role in the development of metabolic disorders. Defining and correlating structural shifts in gut microbial assemblages with conditions related to metabolic syndrome have, however, been proven difficult. Results from 16S genomic DNA and 16S ribosomal RNA analyses of fecal samples may differ widely, leading to controversial information on the whole microbial community and metabolically active microbiota. Using a C57BL/6J murine model, we compared data from 16S genomic DNA and ribosomal RNA of the fecal microbiota. The study included three groups of experimental animals comprising two groups with high fat diet induced obesity (DIO while a third group (control received a low fat diet. One of the DIO groups was treated with the probiotic Lactobacillus rhamnosus GG (LGG. Compared to the data obtained by DNA analysis, a significantly higher abundance of OTUs was accounted for by RNA analysis. Moreover, rRNA based analysis showed a modulation of the active gut microbial population in the DIO group receiving LGG, thus reflecting a change in the induced obesity status of the host. As one of the most widely studied probiotics the functionality of LGG has been linked to the alleviation of metabolic syndrome, and, in some cases, to an impact on the microbiome. Yet, it appears that no study has reported thus far on modulation of the active microbiota by LGG treatment. It is postulated that the resulting impact on calorie consumption affects weight gain concomitantly with modulation of the functional structure of the gut microbial population. Using the 16S rRNA based approach therefore decisively increased the precision of gut microbiota metagenome analysis.

  10. Modulation of Active Gut Microbiota by Lactobacillus rhamnosus GG in a Diet Induced Obesity Murine Model.

    Science.gov (United States)

    Ji, Yosep; Park, Soyoung; Park, Haryung; Hwang, Eunchong; Shin, Hyeunkil; Pot, Bruno; Holzapfel, Wilhelm H

    2018-01-01

    Gut microbiota play a key role in the development of metabolic disorders. Defining and correlating structural shifts in gut microbial assemblages with conditions related to metabolic syndrome have, however, been proven difficult. Results from 16S genomic DNA and 16S ribosomal RNA analyses of fecal samples may differ widely, leading to controversial information on the whole microbial community and metabolically active microbiota. Using a C57BL/6J murine model, we compared data from 16S genomic DNA and ribosomal RNA of the fecal microbiota. The study included three groups of experimental animals comprising two groups with high fat diet induced obesity (DIO) while a third group (control) received a low fat diet. One of the DIO groups was treated with the probiotic Lactobacillus rhamnosus GG (LGG). Compared to the data obtained by DNA analysis, a significantly higher abundance of OTUs was accounted for by RNA analysis. Moreover, rRNA based analysis showed a modulation of the active gut microbial population in the DIO group receiving LGG, thus reflecting a change in the induced obesity status of the host. As one of the most widely studied probiotics the functionality of LGG has been linked to the alleviation of metabolic syndrome, and, in some cases, to an impact on the microbiome. Yet, it appears that no study has reported thus far on modulation of the active microbiota by LGG treatment. It is postulated that the resulting impact on calorie consumption affects weight gain concomitantly with modulation of the functional structure of the gut microbial population. Using the 16S rRNA based approach therefore decisively increased the precision of gut microbiota metagenome analysis.

  11. Expression of human cationic trypsinogen (PRSS1) in murine acinar cells promotes pancreatitis and apoptotic cell death

    Science.gov (United States)

    Athwal, T; Huang, W; Mukherjee, R; Latawiec, D; Chvanov, M; Clarke, R; Smith, K; Campbell, F; Merriman, C; Criddle, D; Sutton, R; Neoptolemos, J; Vlatković, N

    2014-01-01

    Hereditary pancreatitis (HP) is an autosomal dominant disease that displays the features of both acute and chronic pancreatitis. Mutations in human cationic trypsinogen (PRSS1) are associated with HP and have provided some insight into the pathogenesis of pancreatitis, but mechanisms responsible for the initiation of pancreatitis have not been elucidated and the role of apoptosis and necrosis has been much debated. However, it has been generally accepted that trypsinogen, prematurely activated within the pancreatic acinar cell, has a major role in the initiation process. Functional studies of HP have been limited by the absence of an experimental system that authentically mimics disease development. We therefore developed a novel transgenic murine model system using wild-type (WT) human PRSS1 or two HP-associated mutants (R122H and N29I) to determine whether expression of human cationic trypsinogen in murine acinar cells promotes pancreatitis. The rat elastase promoter was used to target transgene expression to pancreatic acinar cells in three transgenic strains that were generated: Tg(Ela-PRSS1)NV, Tg(Ela-PRSS1*R122H)NV and Tg(Ela-PRSS1*N29I)NV. Mice were analysed histologically, immunohistochemically and biochemically. We found that transgene expression is restricted to pancreatic acinar cells and transgenic PRSS1 proteins are targeted to the pancreatic secretory pathway. Animals from all transgenic strains developed pancreatitis characterised by acinar cell vacuolisation, inflammatory infiltrates and fibrosis. Transgenic animals also developed more severe pancreatitis upon treatment with low-dose cerulein than controls, displaying significantly higher scores for oedema, inflammation and overall histopathology. Expression of PRSS1, WT or mutant, in acinar cells increased apoptosis in pancreatic tissues and isolated acinar cells. Moreover, studies of isolated acinar cells demonstrated that transgene expression promotes apoptosis rather than necrosis. We therefore

  12. Chest radiographic findings of tsutsugamushi disease and murine typhus in Chunchon

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Heung Chul; Han, Tae Giun; Jang, Won Ho; Hwang, Woo Chul; Park, Man Soo; Lee, Myoung Gu; Kim, Yoon Won [School of Medicine, Hallym University, Chuncheon (Korea, Republic of); Park, Choong Ki [College of Medicine, Hanyang University, Guri (Korea, Republic of)

    1995-06-15

    To evaluate the chest radiographic findings of rickettsial disease including murine typhus and tsutsugamushi disease in Chunchon. Chest radiographic films of 81 cases diagnosed as rickettsial disease(55 cases of tsutsugamushi disease, 26 cases of murine typhus) by immunofluorescence test were retrospectively analyzed. Main serotypes of Rickettsia tsutsugamushi were Gilliam and Karp. Incidence rate of tsutsugamushi disease was 2.1 times greater than that of murine typhus. Chest radiographs were abnormal in 63.6% of tsutsugamushi disease, and in 30.8% of murine typhus. Radiographic findings were Kerly's B line, reticulonodular densities, hilar enlargement, pleural effusion, and splenomegaly in both entities, but pulmonary consolidation was only found in tsutsugamushi disease. The patients with the abnormal radiographic findings were statistically well correlated with cardiomegaly ({rho} < 0.01) and azygos engorgement ({rho} < 0.05), as compared to the patients with normal radiographic findings. Radiographic findings of both murine typhus and tsutsugamushi disease were interstitial pattern. But the chest radiographs in patients with tsutsugamushi disease showed more severe pattern with higher rate of abnormality.

  13. Enhanced detection and study of murine norovirus-1 using a more efficient microglial cell line

    Directory of Open Access Journals (Sweden)

    Lu Yuanan

    2009-11-01

    Full Text Available Abstract Background Human Noroviruses are the predominant cause of non-bacterial gastroenteritis worldwide. To facilitate prevention and control, a norovirus isolated from mice can provide a model to understand human noroviruses. To establish optimal viral infectivity conditions for murine noroviruses, several cell lines of hematopoietic lineage, including murine BV-2, RAW 264.7, and TIB, as well as human CHME-5, were tested comparatively for their sensitivity to murine norovirus-1. Results Except for CHME-5, all three murine-derived cell lines were susceptible to MNV infection. Viral infection of these cells was confirmed by RT-PCR. Using both viral plaque and replication assays, BV-2 and RAW 264.7 cells were determined to have comparable sensitivities to MNV-1 infection. Comparisons of cell growth characteristics, general laboratory handling and potential in-field applications suggest the use of BV-2 to be more advantageous. Conclusion Results obtained from these studies demonstrate that an immortalized microglial cell line can support MNV-1 replication and provides a more efficient method to detect and study murine noroviruses, facilitating future investigations using MNV-1 as a model to study, detect, and control Human Norovirus.

  14. Chest radiographic findings of tsutsugamushi disease and murine typhus in Chunchon

    International Nuclear Information System (INIS)

    Kim, Heung Chul; Han, Tae Giun; Jang, Won Ho; Hwang, Woo Chul; Park, Man Soo; Lee, Myoung Gu; Kim, Yoon Won; Park, Choong Ki

    1995-01-01

    To evaluate the chest radiographic findings of rickettsial disease including murine typhus and tsutsugamushi disease in Chunchon. Chest radiographic films of 81 cases diagnosed as rickettsial disease(55 cases of tsutsugamushi disease, 26 cases of murine typhus) by immunofluorescence test were retrospectively analyzed. Main serotypes of Rickettsia tsutsugamushi were Gilliam and Karp. Incidence rate of tsutsugamushi disease was 2.1 times greater than that of murine typhus. Chest radiographs were abnormal in 63.6% of tsutsugamushi disease, and in 30.8% of murine typhus. Radiographic findings were Kerly's B line, reticulonodular densities, hilar enlargement, pleural effusion, and splenomegaly in both entities, but pulmonary consolidation was only found in tsutsugamushi disease. The patients with the abnormal radiographic findings were statistically well correlated with cardiomegaly (ρ < 0.01) and azygos engorgement (ρ < 0.05), as compared to the patients with normal radiographic findings. Radiographic findings of both murine typhus and tsutsugamushi disease were interstitial pattern. But the chest radiographs in patients with tsutsugamushi disease showed more severe pattern with higher rate of abnormality

  15. Chest radiographic findings of tsutsugamushi disease and murine typhus in Chunchon

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Heung Chul; Han, Tae Giun; Jang, Won Ho; Hwang, Woo Chul; Park, Man Soo; Lee, Myoung Gu; Kim, Yoon Won [School of Medicine, Hallym University, Chuncheon (Korea, Republic of); Park, Choong Ki [College of Medicine, Hanyang University, Guri (Korea, Republic of)

    1995-06-15

    To evaluate the chest radiographic findings of rickettsial disease including murine typhus and tsutsugamushi disease in Chunchon. Chest radiographic films of 81 cases diagnosed as rickettsial disease(55 cases of tsutsugamushi disease, 26 cases of murine typhus) by immunofluorescence test were retrospectively analyzed. Main serotypes of Rickettsia tsutsugamushi were Gilliam and Karp. Incidence rate of tsutsugamushi disease was 2.1 times greater than that of murine typhus. Chest radiographs were abnormal in 63.6% of tsutsugamushi disease, and in 30.8% of murine typhus. Radiographic findings were Kerly's B line, reticulonodular densities, hilar enlargement, pleural effusion, and splenomegaly in both entities, but pulmonary consolidation was only found in tsutsugamushi disease. The patients with the abnormal radiographic findings were statistically well correlated with cardiomegaly ({rho} < 0.01) and azygos engorgement ({rho} < 0.05), as compared to the patients with normal radiographic findings. Radiographic findings of both murine typhus and tsutsugamushi disease were interstitial pattern. But the chest radiographs in patients with tsutsugamushi disease showed more severe pattern with higher rate of abnormality.

  16. Temporal Regulation of fim Genes in Uropathogenic Escherichia coli during Infection of the Murine Urinary Tract

    Directory of Open Access Journals (Sweden)

    William R. Schwan

    2017-01-01

    Full Text Available Uropathogenic Escherichia coli (UPEC adhere to cells in the human urinary tract via type 1 pili that undergo phase variation where a 314-bp fimS DNA element flips between Phase-ON and Phase-OFF orientations through two site-specific recombinases, FimB and FimE. Three fim-lux operon transcriptional fusions were created and moved into the clinical UPEC isolate NU149 to determine their temporal regulation in UPEC growing in the urinary tract. Within murine urinary tracts, the UPEC strains demonstrated elevated transcription of fimA and fimB early in the infection, but lower transcription by the fifth day in murine kidneys. In contrast, fimE transcription was much lower than either fimA or fimB early, increased markedly at 24 h after inoculation, and then dropped five days after inoculation. Positioning of fimS was primarily in the Phase-ON position over the time span in UPEC infected bladders, whereas in UPEC infected murine kidneys the Phase-OFF orientation was favored by the fifth day after inoculation. Hemagglutination titers with guinea pig erythrocytes remained constant in UPEC growing in infected murine bladders but fell substantially in UPEC infected kidneys over time. Our results show temporal in vivo regulation of fim gene expression in different environmental niches when UPEC infects the murine urinary tract.

  17. Intrapulmonary Versus Nasal Transduction of Murine Airways With GP64-pseudotyped Viral Vectors

    Directory of Open Access Journals (Sweden)

    Mayumi Oakland

    2013-01-01

    Full Text Available Persistent viral vector-mediated transgene expression in the airways requires delivery to cells with progenitor capacity and avoidance of immune responses. Previously, we observed that GP64-pseudotyped feline immunodeficiency virus (FIV-mediated gene transfer was more efficient in the nasal airways than the large airways of the murine lung. We hypothesized that in vivo gene transfer was limited by immunological and physiological barriers in the murine intrapulmonary airways. Here, we systematically investigate multiple potential barriers to lentiviral gene transfer in the airways of mice. We show that GP64-FIV vector transduced primary cultures of well-differentiated murine nasal epithelia with greater efficiency than primary cultures of murine tracheal epithelia. We further demonstrate that neutrophils, type I interferon (IFN responses, as well as T and B lymphocytes are not the major factors limiting the transduction of murine conducting airways. In addition, we observed better transduction of GP64-pseudotyped vesicular stomatitis virus (VSV in the nasal epithelia compared with the intrapulmonary airways in mice. VSVG glycoprotein pseudotyped VSV transduced intrapulmonary epithelia with similar efficiency as nasal epithelia. Our results suggest that the differential transduction efficiency of nasal versus intrapulmonary airways by FIV vector is not a result of immunological barriers or surface area, but rather differential expression of cellular factors specific for FIV vector transduction.

  18. PIF1 disruption or NBS1 hypomorphism does not affect chromosome healing or fusion resulting from double-strand breaks near telomeres in murine embryonic stem cells.

    Science.gov (United States)

    Reynolds, Gloria E; Gao, Qing; Miller, Douglas; Snow, Bryan E; Harrington, Lea A; Murnane, John P

    2011-11-10

    Telomerase serves to maintain telomeric repeat sequences at the ends of chromosomes. However, telomerase can also add telomeric repeat sequences at DNA double-strand breaks (DSBs), a process called chromosome healing. Here, we employed a method of inducing DSBs near telomeres to query the role of two proteins, PIF1 and NBS1, in chromosome healing in mammalian cells. PIF1 was investigated because the PIF1 homolog in Saccharomyces cerevisiae inhibits chromosome healing, as shown by a 1000-fold increase in chromosome in PIF1-deficient cells. NBS1 was investigated because the functional homolog of NBS1 in S. cerevisiae, Xrs2, is part of the Mre11/Rad50/Xrs2 complex that is required for chromosome healing due to its role in the processing of DSBs and recruitment of telomerase. We found that disruption of mPif1 had no detectable effect on the frequency of chromosome healing at DSBs near telomeres in murine embryonic stem cells. Moreover, the Nbs1(ΔB) hypomorph, which is defective in the processing of DSBs, also had no detectable effect on the frequency of chromosome healing, DNA degradation, or gross chromosome rearrangements (GCRs) that result from telomeric DSBs. Although we cannot rule out small changes in chromosome healing using this system, it is clear from our results that knockout of PIF1 or the Nbs1(ΔB) hypomorph does not result in large differences in chromosome healing in murine cells. These results represent the first genetic assessment of the role of these proteins in chromosome healing in mammals, and suggest that murine cells have evolved mechanisms to ensure the functional redundancy of Pif1 or Nbs1 in the regulation of chromosome healing. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Critical transition in tissue homeostasis accompanies murine lung senescence.

    Directory of Open Access Journals (Sweden)

    Carla L Calvi

    Full Text Available BACKGROUND: Respiratory dysfunction is a major contributor to morbidity and mortality in aged populations. The susceptibility to pulmonary insults is attributed to "low pulmonary reserve", ostensibly reflecting a combination of age-related musculoskeletal, immunologic and intrinsic pulmonary dysfunction. METHODS/PRINCIPAL FINDINGS: Using a murine model of the aging lung, senescent DBA/2 mice, we correlated a longitudinal survey of airspace size and injury measures with a transcriptome from the aging lung at 2, 4, 8, 12, 16 and 20 months of age. Morphometric analysis demonstrated a nonlinear pattern of airspace caliber enlargement with a critical transition occurring between 8 and 12 months of age marked by an initial increase in oxidative stress, cell death and elastase activation which is soon followed by inflammatory cell infiltration, immune complex deposition and the onset of airspace enlargement. The temporally correlative transcriptome showed exuberant induction of immunoglobulin genes coincident with airspace enlargement. Immunohistochemistry, ELISA analysis and flow cytometry demonstrated increased immunoglobulin deposition in the lung associated with a contemporaneous increase in activated B-cells expressing high levels of TLR4 (toll receptor 4 and CD86 and macrophages during midlife. These midlife changes culminate in progressive airspace enlargement during late life stages. CONCLUSION/SIGNIFICANCE: Our findings establish that a tissue-specific aging program is evident during a presenescent interval which involves early oxidative stress, cell death and elastase activation, followed by B lymphocyte and macrophage expansion/activation. This sequence heralds the progression to overt airspace enlargement in the aged lung. These signature events, during middle age, indicate that early stages of the aging immune system may have important correlates in the maintenance of tissue morphology. We further show that time-course analyses of aging

  20. Ribosomopathy-like properties of murine and human cancers.

    Directory of Open Access Journals (Sweden)

    Sucheta Kulkarni

    Full Text Available Ribosomopathies comprise a heterogeneous group of hematologic and developmental disorders, often characterized by bone marrow failure, skeletal and other developmental abnormalities and cancer predisposition. They are associated with mutations and/or haplo-insufficiencies of ribosomal proteins (RPs and inefficient ribosomal RNA (rRNA processing. The resulting ribosomal stress induces the canonical p19ARF/Mdm2/p53 tumor suppressor pathway leading to proliferative arrest and/or apoptosis. It has been proposed that this pathway is then inactivated during subsequent neoplastic evolution. We show here that two murine models of hepatoblastoma (HB and hepatocellular carcinoma (HCC unexpectedly possess features that mimic the ribosomopathies. These include loss of the normal stoichiometry of RP transcripts and proteins and the accumulation of unprocessed rRNA precursors. Silencing of p19ARF, cytoplasmic sequestration of p53, binding to and inactivation of Mdm2 by free RPs, and up-regulation of the pro-survival protein Bcl-2 may further cooperate to drive tumor growth and survival. Consistent with this notion, re-instatement of constitutive p19ARF expression in the HB model completely suppressed tumorigenesis. In >2000 cases of human HCC, colorectal, breast, and prostate cancer, RP transcript deregulation was a frequent finding. In HCC and breast cancer, the severity of this dysregulation was associated with inferior survival. In HCC, the presence of RP gene mutations, some of which were identical to those previously reported in ribosomopathies, were similarly negatively correlated with long-term survival. Taken together, our results indicate that many if not all cancers possess ribosomopathy-like features that may affect their biological behaviors.

  1. Induction and regulation of murine emphysema by elastin peptides.

    Science.gov (United States)

    Sellami, Mehdi; Meghraoui-Kheddar, Aïda; Terryn, Christine; Fichel, Caroline; Bouland, Nicole; Diebold, Marie-Daniele; Guenounou, Moncef; Héry-Huynh, Stéphanie; Le Naour, Richard

    2016-01-01

    Emphysema is the major component of chronic obstructive pulmonary disease (COPD). During emphysema, elastin breakdown in the lung tissue originates from the release of large amounts of elastase by inflammatory cells. Elevated levels of elastin-derived peptides (EP) reflect massive pulmonary elastin breakdown in COPD patients. Only the EP containing the GXXPG conformational motif with a type VIII β-turn are elastin receptor ligands inducing biological activities. In addition, the COOH-terminal glycine residue of the GXXPG motif seems a prerequisite to the biological activity. In this study, we endotracheally instilled C57BL/6J mice with GXXPG EP and/or COOH-terminal glycine deleted-EP whose sequences were designed by molecular dynamics and docking simulations. We investigated their effect on all criteria associated with the progression of murine emphysema. Bronchoalveolar lavages were recovered to analyze cell profiles by flow cytometry and lungs were prepared to allow morphological and histological analysis by immunostaining and confocal microscopy. We observed that exposure of mice to EP elicited hallmark features of emphysema with inflammatory cell accumulation associated with increased matrix metalloproteinases and desmosine expression and of remodeling of parenchymal tissue. We also identified an inactive COOH-terminal glycine deleted-EP that retains its binding-activity to EBP and that is able to inhibit the in vitro and in vivo activities of emphysema-inducing EP. This study demonstrates that EP are key actors in the development of emphysema and that they represent pharmacological targets for an alternative treatment of emphysema based on the identification of EP analogous antagonists by molecular modeling studies. Copyright © 2016 the American Physiological Society.

  2. Inactivation of murine norovirus by chemical biocides on stainless steel

    Science.gov (United States)

    2009-01-01

    Background Human norovirus (NoV) causes more than 80% of nonbacterial gastroenteritis in Europe and the United States. NoV transmission via contaminated surfaces may be significant for the spread of viruses. Therefore, measures for prevention and control, such as surface disinfection, are necessary to interrupt the dissemination of human NoV. Murine norovirus (MNV) as a surrogate for human NoV was used to study the efficacy of active ingredients of chemical disinfectants for virus inactivation on inanimate surfaces. Methods The inactivating properties of different chemical biocides were tested in a quantitative carrier test with stainless steel discs without mechanical action. Vacuum-dried MNV was exposed to different concentrations of alcohols, peracetic acid (PAA) or glutaraldehyde (GDA) for 5 minutes exposure time. Detection of residual virus was determined by endpoint-titration on RAW 264.7 cells. Results PAA [1000 ppm], GDA [2500 ppm], ethanol [50% (v/v)] and 1-propanol [30% (v/v)] were able to inactivate MNV under clean conditions (0.03% BSA) on the carriers by ≥ 4 log10 within 5 minutes exposure time, whereas 2-propanol showed a reduced effectiveness even at 60% (v/v). Furthermore, there were no significant differences in virus reduction whatever interfering substances were used. When testing with ethanol, 1- and 2-propanol, results under clean conditions were nearly the same as in the presence of dirty conditions (0.3% BSA plus 0.3% erythrocytes). Conclusion Products based upon PAA, GDA, ethanol and 1-propanol should be used for NoV inactivation on inanimate surfaces. Our data provide valuable information for the development of strategies to control NoV transmission via surfaces. PMID:19583832

  3. Inactivation of murine norovirus by chemical biocides on stainless steel

    Directory of Open Access Journals (Sweden)

    Steinmann Jörg

    2009-07-01

    Full Text Available Abstract Background Human norovirus (NoV causes more than 80% of nonbacterial gastroenteritis in Europe and the United States. NoV transmission via contaminated surfaces may be significant for the spread of viruses. Therefore, measures for prevention and control, such as surface disinfection, are necessary to interrupt the dissemination of human NoV. Murine norovirus (MNV as a surrogate for human NoV was used to study the efficacy of active ingredients of chemical disinfectants for virus inactivation on inanimate surfaces. Methods The inactivating properties of different chemical biocides were tested in a quantitative carrier test with stainless steel discs without mechanical action. Vacuum-dried MNV was exposed to different concentrations of alcohols, peracetic acid (PAA or glutaraldehyde (GDA for 5 minutes exposure time. Detection of residual virus was determined by endpoint-titration on RAW 264.7 cells. Results PAA [1000 ppm], GDA [2500 ppm], ethanol [50% (v/v] and 1-propanol [30% (v/v] were able to inactivate MNV under clean conditions (0.03% BSA on the carriers by ≥ 4 log10 within 5 minutes exposure time, whereas 2-propanol showed a reduced effectiveness even at 60% (v/v. Furthermore, there were no significant differences in virus reduction whatever interfering substances were used. When testing with ethanol, 1- and 2-propanol, results under clean conditions were nearly the same as in the presence of dirty conditions (0.3% BSA plus 0.3% erythrocytes. Conclusion Products based upon PAA, GDA, ethanol and 1-propanol should be used for NoV inactivation on inanimate surfaces. Our data provide valuable information for the development of strategies to control NoV transmission via surfaces.

  4. Effect of bleaching agent extracts on murine macrophages.

    Science.gov (United States)

    Fernandes, Aletéia M M; Vilela, Polyana G F; Valera, Marcia C; Bolay, Carola; Hiller, Karl Anton; Schweikl, Helmut; Schmalz, Gottfried

    2018-05-01

    The aim of this study was to evaluate the cytotoxicity and the influence of bleaching agents on immunologically cell surface antigens of murine macrophages in vitro. RAW 264.7 cells were exposed to bleaching gel extracts (40% hydrogen peroxide or 20% carbamide peroxide) and different H 2 O 2 concentrations after 1 and 24-h exposure periods and 1-h exposure and 23-h recovery. Tests were performed with and without N-acetyl cysteine (NAC) and buthionine sulfoximine (BSO). Cell viability was determined by MTT assay. The expression of surface markers CD14, CD40, and CD54 with and without LPS stimulation was detected by flow cytometry, while the production of TNF-α was measured by ELISA. Statistical analysis was performed using the Mann-Whitney U test (α = 0.05). Extracts of bleaching agents were cytotoxic for cells after a 1-h exposure; cells could not recover after 24 h. This effect can be mitigated by the antioxidant NAC and increased by BSO, an inhibitor of glutathione (GSH) synthesis. LPS stimulated expression of all surface markers and TNF-α production. Exposure to bleaching agent extracts and H 2 O 2 leads to a reduction of TNF-α, CD14, and CD40 expression, while the expression of CD54 was upregulated at non-cytotoxic concentrations. Whereas NAC reduced this effect, it was increased in the presence of BSO. Extracts of bleaching agents were irreversibly cytotoxic to macrophages after a 1-h exposure. Only the expression of CD54 was upregulated. The reactions are mediated by the non-enzymatic antioxidant GSH. The addition of an antioxidant can downregulate unfavorable effects of dental bleaching.

  5. In vitro assessment of curcumin against murine neuroblastoma cells.

    Science.gov (United States)

    Vanisree, Arambakkam Janardhanam; Ramanan, Ramya

    2007-04-01

    Neuroblastoma (NB) is a well-known malignant disease in infants, which comprises 10% of childhood malignancies. Despite recent advances in understanding the neuro-oncology, NB still accounts for more death in childhood than any other cancer. Research in childhood tumors should not only be focused on the malignant signatures of cancer cells but also novel drug prototypes using phytochemicals. The present study was aimed to determine the role of curcumin against murine neuroblastoma cell line (N2a). The in vitro assessment of curcumin against was made in N2a cell line in a dose-dependent manner (group I (control) and group II - IX (10 microM-80 microM). The efficacy of the drug was evaluated by estimating the levels of protein bound carbohydrates, glycoprotein, genomic DNA, total RNA levels, and inhibition of MMP-9 were studied. The gap junctional communication in the cells was also assessed. The levels of protein bound carbohydrates, DNA, RNA levels, glycoprotein were found to be altered on drug supplementation in NB cells. Inhibition of MMP-9 in curcumin-supplemented N2a cells was revealed by zymographic analysis. Assessment of Lucifer yellow dye uptake in curcumin-supplemented N2a cells showed the up-regulation of GJIC. These observations suggest that the curcumin, the active principle of curcuma longa, could be developed into an effective chemo preventive and chemotherapeutic agent. This selected concentration range needs further studies at molecular level, for conforming its role and its action against uncontrolled proliferation of NB.

  6. Murine macrophage heparanase: inhibition and comparison with metastatic tumor cells

    International Nuclear Information System (INIS)

    Savion, N.; Disatnik, M.H.; Nevo, Z.

    1987-01-01

    Circulating macrophages and metastatic tumor cells can penetrate the vascular endothelium and migrate from the circulatory system to extravascular compartments. Both activated murine macrophages and different metastatic tumor cells attach, invade, and penetrate confluent vascular endothelial cell monolayer in vitro, by degrading heparan sulfate proteoglycans in the subendothelial extracellular matrix. The sensitivity of the enzymes from the various sources degrading the heparan sulfate proteoglycan was challenged and compared by a series of inhibitors. Activated macrophages demonstrate a heparanase with an endoglycosidase activity that cleaves from the [ 35 S]O 4 - -labeled heparan sulfate proteoglycans of the extracellular matrix 10 kDa glycosaminoglycan fragments. The degradation of [ 35 S]O 4 - -labeled extracellular matrix proteoglycans by the macrophages' heparanase is significantly inhibited in the presence of heparan sulfate (10μg/ml), arteparon (10μg/ml), and heparin at a concentration of 3 μg/ml. Degradation of this heparan sulfate proteoglycan is a two-step sequential process involving protease activity followed by heparanase activity. B16-BL6 metastatic melanoma cell heparanase, which is also a cell-associated enzyme, was inhibited by heparin to the same extent as the macrophage haparanase. On the other hand, heparanase of the highly metastatic variant (ESb) of a methylcholanthrene-induced T lymphoma, which is an extracellular enzyme released by the cells to the incubation medium, was more sensitive to heparin and arteparon than the macrophages' heparanase. These results may indicate the potential use of heparin or other glycosaminoglycans as specific and differential inhibitors for the formation in certain cases of blood-borne tumor metastasis

  7. Radiobiologic effect of intermittent radiation exposure in murine tumors

    International Nuclear Information System (INIS)

    Sugie, Chikao; Shibamoto, Yuta; Ito, Masato; Ogino, Hiroyuki; Miyamoto, Akihiko; Fukaya, Nobuyuki; Niimi, Hiroshige; Hashizume, Takuya

    2006-01-01

    Purpose: In stereotactic irradiation using a linear accelerator, the effect of radiation may be reduced during intermittent exposures owing to recovery from sublethal damage in tumor cells. After our previous in vitro study suggesting this phenomenon, we investigated the issue in murine tumors. Methods and Materials: We used EMT6 and SCCVII tumors approximately 1 cm in diameter growing in the hind legs of syngeneic mice. Three schedules of intermittent radiation were investigated. First, 2 fractions of 10 Gy were given at an interval of 15-360 min to investigate the pattern of recovery from sublethal damage. Second, 5 fractions of 4 Gy were given with interfraction intervals of 2.5-15 min each. Third, 10 fractions of 2 Gy were given with interfraction intervals of 1-7 min each. Doses of 15-20 Gy were also given without interruption to estimate the dose-modifying factors. Tumors were excised 20 h later, and tumor cell survival was determined by an in vivo-in vitro assay. Results: In the 2-fraction experiment, the increase in cell survival with elongation of the interval was much less than that observed in our previous in vitro study. In the 5- and 10-fraction experiments, no significant increase in cell survival was observed after the intermittent exposures. Moreover, cell survival decreased at most points of the 5-fraction experiments by interruption of radiation in both EMT6 and SCCVII tumors. In the 10-fraction experiment, cell survival also decreased when the interruption was 3 or 7 min in EMT6 tumors. Conclusion: The results of the present in vivo studies were different from those of our in vitro studies in which cell survival increased significantly when a few minutes or longer intervals were posed between fractions. This suggests that recovery from sublethal damage in vivo may be counterbalanced by other phenomena such as reoxygenation that sensitizes tumor cells to subsequent irradiation

  8. Development of a murine model of blunt hepatic trauma.

    Science.gov (United States)

    Nemzek-Hamlin, Jean A; Hwang, Haejin; Hampel, Joseph A; Yu, Bi; Raghavendran, Krishnan

    2013-10-01

    Despite the prevalence of blunt hepatic trauma in humans, there are few rodent models of blunt trauma that can be used to study the associated inflammatory responses. We present a mouse model of blunt hepatic trauma that was created by using a cortical contusion device. Male mice were anesthetized with ketamine-xylazine-buprenorphine and placed in left lateral recumbency. A position of 2 mm ventral to the posterior axillary line and 5 mm caudal to the costal margin on the right side was targeted for impact. An impact velocity of 6 m/s and a piston depth of 12 mm produced a consistent pattern of hepatic injury with low mortality. All mice that recovered from anesthesia survived without complication for the length of the study. Mice were euthanized at various time points (n = 5 per group) until 7 d after injury for gross examination and collection of blood and peritoneal lavage fluids. Some mice were reanesthetized for serial monitoring of hepatic lesions via MRI. At 2 h after trauma, mice consistently displayed laceration, hematoma, and discoloration of the right lateral and caudate liver lobes, with intraabdominal hemorrhage but no other gross injuries. Blood and peritoneal lavage fluid were collected from all mice for cytokine analysis. At 2 h after trauma, there were significant increases in plasma IL10 as well as peritoneal lavage fluid IL6 and CXCL1/KC; however, these levels decreased within 24 h. At 7 d after trauma, the mice had regained body weight, and the hepatic lesions, which initially had increased in size during the first 48 h, had returned to their original size. In summary, this technique produced a reliable, low mortality, murine model that recreates features of blunt abdominal liver injury in human subjects with similar acute inflammatory response.

  9. Ureaplasma parvum causes hyperammonemia in a pharmacologically immunocompromised murine model.

    Science.gov (United States)

    Wang, X; Greenwood-Quaintance, K E; Karau, M J; Block, D R; Mandrekar, J N; Cunningham, S A; Mallea, J M; Patel, R

    2017-03-01

    A relationship between hyperammonemia and Ureaplasma infection has been shown in lung transplant recipients. We have demonstrated that Ureaplasma urealyticum causes hyperammonemia in a novel immunocompromised murine model. Herein, we determined whether Ureaplasma parvum can do the same. Male C3H mice were given mycophenolate mofetil, tacrolimus, and prednisone for 7 days, and then challenged with U. parvum intratracheally (IT) and/or intraperitoneally (IP), while continuing immunosuppression over 6 days. Plasma ammonia concentrations were determined and compared using Wilcoxon rank-sum tests. Plasma ammonia concentrations of immunosuppressed mice challenged IT/IP with spent broth (median, 188 μmol/L; range, 102-340 μmol/L) were similar to those of normal (median, 226 μmol/L; range, 154-284 μmol/L, p > 0.05), uninfected immunosuppressed (median, 231 μmol/L; range, 122-340 μmol/L, p > 0.05), and U. parvum IT/IP challenged immunocompetent (median, 226 μmol/L; range, 130-330 μmol/L, p > 0.05) mice. Immunosuppressed mice challenged with U. parvum IT/IP (median 343 μmol/L; range 136-1,000 μmol/L) or IP (median 307 μmol/L; range 132-692 μmol/L) had higher plasma ammonia concentrations than those challenged IT/IP with spent broth (p < 0.001). U. parvum can cause hyperammonemia in pharmacologically immunocompromised mice.

  10. Discrete innervation of murine taste buds by peripheral taste neurons.

    Science.gov (United States)

    Zaidi, Faisal N; Whitehead, Mark C

    2006-08-09

    The peripheral taste system likely maintains a specific relationship between ganglion cells that signal a particular taste quality and taste bud cells responsive to that quality. We have explored a measure of the receptoneural relationship in the mouse. By injecting single fungiform taste buds with lipophilic retrograde neuroanatomical markers, the number of labeled geniculate ganglion cells innervating single buds on the tongue were identified. We found that three to five ganglion cells innervate a single bud. Injecting neighboring buds with different color markers showed that the buds are primarily innervated by separate populations of geniculate cells (i.e., multiply labeled ganglion cells are rare). In other words, each taste bud is innervated by a population of neurons that only connects with that bud. Palate bud injections revealed a similar, relatively exclusive receptoneural relationship. Injecting buds in different regions of the tongue did not reveal a topographic representation of buds in the geniculate ganglion, despite a stereotyped patterned arrangement of fungiform buds as rows and columns on the tongue. However, ganglion cells innervating the tongue and palate were differentially concentrated in lateral and rostral regions of the ganglion, respectively. The principal finding that small groups of ganglion cells send sensory fibers that converge selectively on a single bud is a new-found measure of specific matching between the two principal cellular elements of the mouse peripheral taste system. Repetition of the experiments in the hamster showed a more divergent innervation of buds in this species. The results indicate that whatever taste quality is signaled by a murine geniculate ganglion neuron, that signal reflects the activity of cells in a single taste bud.

  11. Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration

    Science.gov (United States)

    De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.

    2014-01-01

    ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411

  12. Generation of murine tumor cell lines deficient in MHC molecule surface expression using the CRISPR/Cas9 system.

    Directory of Open Access Journals (Sweden)

    Krishna Das

    Full Text Available In this study, the CRISPR/Cas9 technology was used to establish murine tumor cell lines, devoid of MHC I or MHC II surface expression, respectively. The melanoma cell line B16F10 and the murine breast cancer cell line EO-771, the latter stably expressing the tumor antigen NY-BR-1 (EO-NY, were transfected with an expression plasmid encoding a β2m-specific single guide (sgRNA and Cas9. The resulting MHC I negative cells were sorted by flow cytometry to obtain single cell clones, and loss of susceptibility of peptide pulsed MHC I negative clones to peptide-specific CTL recognition was determined by IFNγ ELISpot assay. The β2m knockout (KO clones did not give rise to tumors in syngeneic mice (C57BL/6N, unless NK cells were depleted, suggesting that outgrowth of the β2m KO cell lines was controlled by NK cells. Using sgRNAs targeting the β-chain encoding locus of the IAb molecule we also generated several B16F10 MHC II KO clones. Peptide loaded B16F10 MHC II KO cells were insusceptible to recognition by OT-II cells and tumor growth was unaltered compared to parental B16F10 cells. Thus, in our hands the CRISPR/Cas9 system has proven to be an efficient straight forward strategy for the generation of MHC knockout cell lines. Such cell lines could serve as parental cells for co-transfection of compatible HLA alleles together with human tumor antigens of interest, thereby facilitating the generation of HLA matched transplantable tumor models, e.g. in HLAtg mouse strains of the newer generation, lacking cell surface expression of endogenous H2 molecules. In addition, our tumor cell lines established might offer a useful tool to investigate tumor reactive T cell responses that function independently from MHC molecule surface expression by the tumor.

  13. Tissue- and agonist-specific regulation of human and murine plasminogen activator inhibitor-1 promoters in transgenic mice.

    Science.gov (United States)

    Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E

    2003-11-01

    Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.

  14. Skeletal muscle fibrosis in the mdx/utrn+/- mouse validates its suitability as a murine model of Duchenne muscular dystrophy.

    Science.gov (United States)

    Gutpell, Kelly M; Hrinivich, William T; Hoffman, Lisa M

    2015-01-01

    Various therapeutic approaches have been studied for the treatment of Duchenne muscular dystrophy (DMD), but none of these approaches have led to significant long-term effects in patients. One reason for this observed inefficacy may be the use of inappropriate animal models for the testing of therapeutic agents. The mdx mouse is the most widely used murine model of DMD, yet it does not model the fibrotic progression observed in patients. Other murine models of DMD are available that lack one or both alleles of utrophin, a functional analog of dystrophin. The aim of this study was to compare fibrosis and myofiber damage in the mdx, mdx/utrn+/- and double knockout (dko) mouse models. We used Masson's trichrome stain and percentage of centrally-nucleated myofibers as indicators of fibrosis and myofiber regeneration, respectively, to assess disease progression in diaphragm and gastrocnemius muscles harvested from young and aged wild-type, mdx, mdx/utrn+/- and dko mice. Our results indicated that eight week-old gastrocnemius muscles of both mdx/utrn+/- and dko hind limb developed fibrosis whereas age-matched mdx gastrocnemius muscle did not (p = 0.002). The amount of collagen found in the mdx/utrn+/- diaphragm was significantly higher than that found in the corresponding diaphragm muscles of wild-type animals, but not of mdx animals (p = 0.0003). Aged mdx/utrn+/- mice developed fibrosis in both diaphragm and gastrocnemius muscles compared to wild-type controls (p = 0.003). Mdx diaphragm was fibrotic in aged mice as well (p = 0.0235), whereas the gastrocnemius muscle in these animals was not fibrotic. We did not measure a significant difference in collagen staining between wild-type and mdx gastrocnemius muscles. The results of this study support previous reports that the moderately-affected mdx/utrn+/- mouse is a better model of DMD, and we show here that this difference is apparent by 2 months of age.

  15. Recurrent milk aspiration produces changes in airway mechanics, lung eosinophilia, and goblet cell hyperplasia in a murine model.

    Science.gov (United States)

    Janahi, I A; Elidemir, O; Shardonofsky, F R; Abu-Hassan, M N; Fan, L L; Larsen, G L; Blackburn, M R; Colasurdo, G N

    2000-12-01

    Recurrent aspiration of milk into the respiratory tract has been implicated in the pathogenesis of a variety of inflammatory lung disorders including asthma. However, the lack of animal models of aspiration-induced lung injury has limited our knowledge of the pathophysiological characteristics of this disorder. This study was designed to evaluate the effects of recurrent milk aspiration on airway mechanics and lung cells in a murine model. Under light anesthesia, BALB/c mice received daily intranasal instillations of whole cow's milk (n = 7) or sterile physiologic saline (n = 9) for 10 d. Respiratory system resistance (Rrs) and dynamic elastance (Edyn,rs) were measured in anesthetized, tracheotomized, paralyzed and mechanically ventilated mice 24 h after the last aspiration of milk. Rrs and Edyn,rs were derived from transrespiratory and plethysmographic pressure signals. In addition, airway responses to increasing concentrations of i.v. methacholine (Mch) were determined. Airway responses were measured in terms of PD(100) (dose of Mch causing 100% increase from baseline Rrs) and Rrs,max (% increase from baseline at the maximal plateau response) and expressed as % control (mean +/- SE). We found recurrent milk aspiration did not affect Edyn and baseline Rrs values. However, airway responses to Mch were increased after milk aspiration when compared with control mice. These changes in airway mechanics were associated with an increased percentage of lymphocytes and eosinophils in the bronchoalveolar lavage, mucus production, and lung inflammation. Our findings suggest that recurrent milk aspiration leads to alterations in airway function, lung eosinophilia, and goblet cell hyperplasia in a murine model.

  16. Impact of physiological variables and genetic background on myocardial frequency-resistivity relations in the intact beating murine heart.

    Science.gov (United States)

    Reyes, Maricela; Steinhelper, Mark E; Alvarez, Jorge A; Escobedo, Daniel; Pearce, John; Valvano, Jonathan W; Pollock, Brad H; Wei, Chia-Ling; Kottam, Anil; Altman, David; Bailey, Steven; Thomsen, Sharon; Lee, Shuko; Colston, James T; Oh, Jung Hwan; Freeman, Gregory L; Feldman, Marc D

    2006-10-01

    Conductance measurements for generation of an instantaneous left ventricular (LV) volume signal in the mouse are limited, because the volume signal is a combination of blood and LV muscle, and only the blood signal is desired. We have developed a conductance system that operates at two simultaneous frequencies to identify and remove the myocardial contribution to the instantaneous volume signal. This system is based on the observation that myocardial resistivity varies with frequency, whereas blood resistivity does not. For calculation of LV blood volume with the dual-frequency conductance system in mice, in vivo murine myocardial resistivity was measured and combined with an analytic approach. The goals of the present study were to identify and minimize the sources of error in the measurement of myocardial resistivity to enhance the accuracy of the dual-frequency conductance system. We extended these findings to a gene-altered mouse model to determine the impact of measured myocardial resistivity on the calculation of LV pressure-volume relations. We examined the impact of temperature, timing of the measurement during the cardiac cycle, breeding strain, anisotropy, and intrameasurement and interanimal variability on the measurement of intact murine myocardial resistivity. Applying this knowledge to diabetic and nondiabetic 11- and 20- to 24-wk-old mice, we demonstrated differences in myocardial resistivity at low frequencies, enhancement of LV systolic function at 11 wk and LV dilation at 20-24 wk, and histological and electron-microscopic studies demonstrating greater glycogen deposition in the diabetic mice. This study demonstrated the accurate technique of measuring myocardial resistivity and its impact on the determination of LV pressure-volume relations in gene-altered mice.

  17. A natural human IgM that binds to gangliosides is therapeutic in murine models of amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Xiaohua Xu

    2015-08-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a devastating, fatal neurological disease that primarily affects spinal cord anterior horn cells and their axons for which there is no treatment. Here we report the use of a recombinant natural human IgM that binds to the surface of neurons and supports neurite extension, rHIgM12, as a therapeutic strategy in murine models of human ALS. A single 200 µg intraperitoneal dose of rHIgM12 increases survival in two independent genetic-based mutant SOD1 mouse strains (SOD1G86R and SOD1G93A by 8 and 10 days, delays the onset of neurological deficits by 16 days, delays the onset of weight loss by 5 days, and preserves spinal cord axons and anterior horn neurons. Immuno-overlay of thin layer chromatography and surface plasmon resonance show that rHIgM12 binds with high affinity to the complex gangliosides GD1a and GT1b. Addition of rHIgM12 to neurons in culture increases α-tubulin tyrosination levels, suggesting an alteration of microtubule dynamics. We previously reported that a single peripheral dose of rHIgM12 preserved neurological function in a murine model of demyelination with axon loss. Because rHIgM12 improves three different models of neurological disease, we propose that the IgM might act late in the cascade of neuronal stress and/or death by a broad mechanism.

  18. Dermal white adipose tissue undergoes major morphological changes during the spontaneous and induced murine hair follicle cycling: a reappraisal.

    Science.gov (United States)

    Foster, April R; Nicu, Carina; Schneider, Marlon R; Hinde, Eleanor; Paus, Ralf

    2018-07-01

    In murine skin, dermal white adipose tissue (DWAT) undergoes major changes in thickness in synchrony with the hair cycle (HC); however, the underlying mechanisms remain unclear. We sought to elucidate whether increased DWAT thickness during anagen is mediated by adipocyte hypertrophy or adipogenesis, and whether lipolysis or apoptosis can explain the decreased DWAT thickness during catagen. In addition, we compared HC-associated DWAT changes between spontaneous and depilation-induced hair follicle (HF) cycling to distinguish between spontaneous and HF trauma-induced events. We show that HC-dependent DWAT remodelling is not an artefact caused by fluctuations in HF down-growth, and that dermal adipocyte (DA) proliferation and hypertrophy are HC-dependent, while classical DA apoptosis is absent. However, none of these changes plausibly accounts for HC-dependent oscillations in DWAT thickness. Contrary to previous studies, in vivo BODIPY uptake suggests that increased DWAT thickness during anagen occurs via hypertrophy rather than hyperplasia. From immunohistomorphometry, DWAT thickness likely undergoes thinning during catagen by lipolysis. Hence, we postulate that progressive, lipogenesis-driven DA hypertrophy followed by dynamic switches between lipogenesis and lipolysis underlie DWAT fluctuations in the spontaneous HC, and dismiss apoptosis as a mechanism of DWAT reduction. Moreover, the depilation-induced HC displays increased DWAT thickness, area, and DA number, but decreased DA volume/area compared to the spontaneous HC. Thus, DWAT shows additional, novel HF wounding-related responses during the induced HC. This systematic reappraisal provides important pointers for subsequent functional and mechanistic studies, and introduces the depilation-induced murine HC as a model for dissecting HF-DWAT interactions under conditions of wounding/stress.

  19. Murine interleukin 1 receptor. Direct identification by ligand blotting and purification to homogeneity of an interleukin 1-binding glycoprotein

    International Nuclear Information System (INIS)

    Bird, T.A.; Gearing, A.J.; Saklatvala, J.

    1988-01-01

    Functional receptors (IL1-R) for the proinflammatory cytokine interleukin 1 (IL1) were solubilized from plasma membranes of the NOB-1 subclone of murine EL4 6.1 thymoma cells using the zwitterionic detergent 3[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS). Membrane extracts were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and ligand blotted with 125 I-labeled recombinant human IL1 alpha in order to reveal proteins capable of specifically binding IL1. A single polydisperse polypeptide of Mr approximately equal to 80,000 was identified in this way, which bound IL1 alpha and IL1 beta with the same affinity as the IL1-R on intact NOB-1 cells (approximately equal to 10(-10) M). The IL1-binding polypeptide was only seen in membranes from IL1-R-bearing cells and did not react with interleukin 2, tumor necrosis factor alpha, or interferon. IL1-R was purified to apparent homogeneity from solubilized NOB-1 membranes by affinity chromatography on wheat germ agglutinin-Sepharose and IL1 alpha-Sepharose. Gel electrophoresis and silver staining of purified preparations revealed a single protein of Mr approximately equal to 80,000 which reacted positively in the ligand-blotting procedure and which we identify as the ligand-binding moiety of the murine IL1-R. Purified IL1-R exhibited the same affinity and specificity as the receptor on intact cells. The relationship of this protein to proteins identified by covalent cross-linking studies is discussed

  20. Murine T cell activation is regulated by surfen (bis-2-methyl-4-amino-quinolyl-6-carbamide)

    Energy Technology Data Exchange (ETDEWEB)

    Warford, Jordan, E-mail: jordan.warford@dal.ca [Department of Pathology, Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada); Doucette, Carolyn D., E-mail: carolyn.doucette@dal.ca [Department of Microbiology and Immunology, Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada); Hoskin, David W., E-mail: d.w.hoskin@dal.ca [Department of Pathology, Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada); Department of Microbiology and Immunology, Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada); Easton, Alexander S., E-mail: alexander.easton@dal.ca [Department of Pathology, Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada); Department of Microbiology and Immunology, Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada); Department of Surgery (Neurosurgery), Dalhousie University, Tupper Building, 5850 College Street, Halifax, Nova Scotia B3H 4R2 (Canada)

    2014-01-10

    Highlights: •Surfen is the first inhibitor of glycosaminoglycan function to be studied in murine T cells. •Surfen reduces T cell proliferation stimulated in vitro and in vivo. •Surfen reduces CD25 expression in T cells activated in vivo but not in vitro. •Surfen increases T cell proliferation when T cell receptor activation is bypassed. •Surfen’s effects are blocked by co-administration of heparin sulfate. -- Abstract: Surfen (bis-2-methyl-4-amino-quinolyl-6-carbamide) binds to glycosaminoglycans (GAGs) and has been shown to influence their function, and the function of proteoglycans (complexes of GAGs linked to a core protein). T cells synthesize, secrete and express GAGs and proteoglycans which are involved in several aspects of T cell function. However, there are as yet no studies on the effect of GAG-binding agents such as surfen on T cell function. In this study, surfen was found to influence murine T cell activation. Doses between 2.5 and 20 μM produced a graduated reduction in the proliferation of T cells activated with anti-CD3/CD28 antibody-coated T cell expander beads. Surfen (20 mg/kg) was also administered to mice treated with anti-CD3 antibody to activate T cells in vivo. Lymphocytes from surfen-treated mice also showed reduced proliferation and lymph node cell counts were reduced. Surfen reduced labeling with a cell viability marker (7-ADD) but to a much lower extent than its effect on proliferation. Surfen also reduced CD25 (the α-subunit of the interleukin (IL)-2 receptor) expression with no effect on CD69 expression in T cells treated in vivo but not in vitro. When receptor activation was bypassed by treating T cells in vitro with phorbyl myristate acetate (10 ng/ml) and ionomycin (100 ng/ml), surfen treatment either increased proliferation (10 μM) or had no effect (2.5, 5 and 20 μM). In vitro treatment of T cells with surfen had no effect on IL-2 or interferon-γ synthesis and did not alter proliferation of the IL-2 dependent cell

  1. Proteolytically modified human beta 2-microglobulin augments the specific cytotoxic activity in murine mixed lymphocyte culture

    DEFF Research Database (Denmark)

    Nissen, Mogens Holst; Claësson, M H

    1987-01-01

    the endogenous production of interleukin 2 in the MLC culture; monoclonal antibody which reacts with both the native beta 2-m and M-beta 2-m molecule blocks the augmentation of cytotoxic T lymphocyte production induced by M-beta 2-m; murine as well as human MLC responder cells can proteolytically modify native......A proteolytically modified form of beta 2-microglobulin (beta 2-m) present in the serum of patients suffering from autoimmune, immunodeficient diseases and cancer has been reported in the literature. In the present study we show that human beta 2-m as well as the proteolytically modified human form...... (M-beta 2-m) bind to murine lymphocytes expressing H-2 class I antigens; M-beta 2-m, when added at day 0 and 1 of culture in nanomolar concentrations to a one-way murine allogeneic mixed lymphocyte culture (MLC) augments the generation of specific cytotoxic T lymphocytes; M-beta 2-m increases...

  2. Characterization of an immunodominant cancer-specific O-glycopeptide epitope in murine podoplanin (OTS8)

    DEFF Research Database (Denmark)

    Steentoft, Catharina; Schjoldager, Katrine T; Cló, Emiliano

    2010-01-01

    antibody 237, developed to a spontaneous murine fibrosarcoma, was shown to be directed to murine podoplanin (OTS8) with truncated Tn O-glycans. Our understanding of such cancer-specific auto-antibodies to truncated glycoforms of glycoproteins is limited. Here we have investigated immunogenicity...... of a chemoenzymatically produced Tn-glycopeptide derived from the putative murine podoplanin O-glycopeptide epitope. We found that the Tn O-glycopeptide was highly immunogenic in mice and produced a Tn-glycoform specific response with no reactivity against unglycosylated peptides or the O-glycopeptide with extended O......-glycan (STn and T glycoforms). The immunodominant epitope was strictly dependent on the peptide sequence, required Tn at a specific single Thr residue (Thr(77)), and antibodies to the epitope were not found in naive mice. We further tested a Tn O-glycopeptide library derived from human podoplanin...

  3. Murine models of H. pylori-induced gastritis and gastric adenocarcinoma.

    Science.gov (United States)

    Krueger, Sabine; Roessner, Albert; Kuester, Doerthe

    2011-10-15

    Laboratory mice have become one of the best animal species for mechanistic studies in gastrointestinal research. Their abundant genetic information, the way of causing carcinogenesis easily by transgenic and gene knockout techniques, limited effort in time and costs, and their practicability provide advantages over other animal models. Meanwhile, several murine practical models have been established for the investigation of the initiation, expansion, and progression of gastritis and gastric carcinoma, for assessing the effects of bacterial, genetic and environmental factors, and for evaluating therapeutic and preventive strategies in gastric diseases. This article gives a review of murine models of gastritis and gastric cancer, placing emphasis on the models associated with Helicobacter pylori infection and techniques used in our laboratory. We discuss matters of murine gastric anatomy, as well as techniques of infection, tissue preparation, and histology. Copyright © 2011 Elsevier GmbH. All rights reserved.

  4. Reconstitution of mammary epithelial morphogenesis by murine embryonic stem cells undergoing hematopoietic stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Shuxian Jiang

    2010-03-01

    Full Text Available Mammary stem cells are maintained within specific microenvironments and recruited throughout lifetime to reconstitute de novo the mammary gland. Mammary stem cells have been isolated through the identification of specific cell surface markers and in vivo transplantation into cleared mammary fat pads. Accumulating evidence showed that during the reformation of mammary stem cell niches by dispersed epithelial cells in the context of the intact epithelium-free mammary stroma, non-mammary epithelial cells may be sequestered and reprogrammed to perform mammary epithelial cell functions and to adopt mammary epithelial characteristics during reconstruction of mammary epithelium in regenerating mammary tissue in vivo.To examine whether other types of progenitor cells are able to contribute to mammary branching morphogenesis, we examined the potential of murine embryonic stem (mES cells, undergoing hematopoietic differentiation, to support mammary reconstitution in vivo. We observed that cells from day 14 embryoid bodies (EBs under hematopoietic differentiation condition, but not supernatants derived from these cells, when transplanted into denuded mammary fat pads, were able to contribute to both the luminal and myoepithelial lineages in branching ductal structures resembling the ductal-alveolar architecture of the mammary tree. No teratomas were observed when these cells were transplanted in vivo.Our data provide evidence for the dominance of the tissue-specific mammary stem cell niche and its role in directing mES cells, undergoing hematopoietic differentiation, to reprogram into mammary epithelial cells and to promote mammary epithelial morphogenesis. These studies should also provide insights into regeneration of damaged mammary gland and the role of the mammary microenvironment in reprogramming cell fate.

  5. High-fat diet determines the composition of the murine gut microbiome independently of obesity.

    Science.gov (United States)

    Hildebrandt, Marie A; Hoffmann, Christian; Sherrill-Mix, Scott A; Keilbaugh, Sue A; Hamady, Micah; Chen, Ying-Yu; Knight, Rob; Ahima, Rexford S; Bushman, Frederic; Wu, Gary D

    2009-11-01

    The composition of the gut microbiome is affected by host phenotype, genotype, immune function, and diet. Here, we used the phenotype of RELMbeta knockout (KO) mice to assess the influence of these factors. Both wild-type and RELMbeta KO mice were lean on a standard chow diet, but, upon switching to a high-fat diet, wild-type mice became obese, whereas RELMbeta KO mice remained comparatively lean. To investigate the influence of diet, genotype, and obesity on microbiome composition, we used deep sequencing to characterize 25,790 16S rDNA sequences from uncultured bacterial communities from both genotypes on both diets. We found large alterations associated with switching to the high-fat diet, including a decrease in Bacteroidetes and an increase in both Firmicutes and Proteobacteria. This was seen for both genotypes (ie, in the presence and absence of obesity), indicating that the high-fat diet itself, and not the obese state, mainly accounted for the observed changes in the gut microbiota. The RELMbeta genotype also modestly influenced microbiome composition independently of diet. Metagenomic analysis of 537,604 sequence reads documented extensive changes in gene content because of a high-fat diet, including an increase in transporters and 2-component sensor responders as well as a general decrease in metabolic genes. Unexpectedly, we found a substantial amount of murine DNA in our samples that increased in proportion on a high-fat diet. These results demonstrate the importance of diet as a determinant of gut microbiome composition and suggest the need to control for dietary variation when evaluating the composition of the human gut microbiome.

  6. Transcriptomic analysis of the effects of a fish oil enriched diet on murine brains.

    Directory of Open Access Journals (Sweden)

    Rasha Hammamieh

    Full Text Available The health benefits of fish oil enriched with high omega-3 polyunsaturated fatty acids (n-3 PUFA are widely documented. Fish oil as dietary supplements, however, show moderate clinical efficacy, highlighting an immediate scope of systematic in vitro feedback. Our transcriptomic study was designed to investigate the genomic shift of murine brains fed on fish oil enriched diets. A customized fish oil enriched diet (FD and standard lab diet (SD were separately administered to two randomly chosen populations of C57BL/6J mice from their weaning age until late adolescence. Statistical analysis mined 1,142 genes of interest (GOI differentially altered in the hemibrains collected from the FD- and SD-fed mice at the age of five months. The majority of identified GOI (∼ 40% encodes proteins located in the plasma membrane, suggesting that fish oil primarily facilitated the membrane-oriented biofunctions. FD potentially augmented the nervous system's development and functions by selectively stimulating the Src-mediated calcium-induced growth cascade and the downstream PI3K-AKT-PKC pathways. FD reduced the amyloidal burden, attenuated oxidative stress, and assisted in somatostatin activation-the signatures of attenuation of Alzheimer's disease, Parkinson's disease, and affective disorder. FD induced elevation of FKBP5 and suppression of BDNF, which are often linked with the improvement of anxiety disorder, depression, and post-traumatic stress disorder. Hence we anticipate efficacy of FD in treating illnesses such as depression that are typically triggered by the hypoactivities of dopaminergic, adrenergic, cholinergic, and GABAergic networks. Contrastingly, FD's efficacy could be compromised in treating illnesses such as bipolar disorder and schizophrenia, which are triggered by hyperactivities of the same set of neuromodulators. A more comprehensive investigation is recommended to elucidate the implications of fish oil on disease pathomechanisms, and the

  7. Hematopoietic Stem and Progenitor Cell Migration After Hypofractionated Radiation Therapy in a Murine Model

    Energy Technology Data Exchange (ETDEWEB)

    Kane, Jonathan [Department of Biological Sciences, Oakland University, Rochester, Michigan (United States); Radiation Oncology, William Beaumont Health System, Royal Oak, Michigan (United States); Krueger, Sarah A.; Dilworth, Joshua T.; Torma, John T.; Wilson, George D.; Marples, Brian [Radiation Oncology, William Beaumont Health System, Royal Oak, Michigan (United States); Madlambayan, Gerard J., E-mail: madlamba@oakland.edu [Department of Biological Sciences, Oakland University, Rochester, Michigan (United States)

    2013-12-01

    Purpose: To characterize the recruitment of bone marrow (BM)-derived hematopoietic stem and progenitor cells (HSPCs) within tumor microenvironment after radiation therapy (RT) in a murine, heterotopic tumor model. Methods and Materials: Lewis lung carcinoma tumors were established in C57BL/6 mice and irradiated with 30 Gy given as 2 fractions over 2 days. Tumors were imaged with positron emission tomography/computed tomography (PET/CT) and measured daily with digital calipers. The HSPC and myelomonocytic cell content was assessed via immunofluorescent staining and flow cytometry. Functionality of tumor-associated HSPCs was verified in vitro using colony-forming cell assays and in vivo by rescuing lethally irradiated C57BL/6 recipients. Results: Irradiation significantly reduced tumor volumes and tumor regrowth rates compared with nonirradiated controls. The number of CD133{sup +} HSPCs present in irradiated tumors was higher than in nonirradiated tumors during all stages of regrowth. CD11b{sup +} counts were similar. PET/CT imaging and growth rate analysis based on standardized uptake value indicated that HSPC recruitment directly correlated to the extent of regrowth and intratumor cell activity after irradiation. The BM-derived tumor-associated HSPCs successfully formed hematopoietic colonies and engrafted irradiated mice. Finally, targeted treatment with a small animal radiation research platform demonstrated localized HSPC recruitment to defined tumor subsites exposed to radiation. Conclusions: Hypofractionated irradiation resulted in a pronounced and targeted recruitment of BM-derived HSPCs, possibly as a mechanism to promote tumor regrowth. These data indicate for the first time that radiation therapy regulates HSPC content within regrowing tumors.

  8. Hematopoietic Stem and Progenitor Cell Migration After Hypofractionated Radiation Therapy in a Murine Model

    International Nuclear Information System (INIS)

    Kane, Jonathan; Krueger, Sarah A.; Dilworth, Joshua T.; Torma, John T.; Wilson, George D.; Marples, Brian; Madlambayan, Gerard J.

    2013-01-01

    Purpose: To characterize the recruitment of bone marrow (BM)-derived hematopoietic stem and progenitor cells (HSPCs) within tumor microenvironment after radiation therapy (RT) in a murine, heterotopic tumor model. Methods and Materials: Lewis lung carcinoma tumors were established in C57BL/6 mice and irradiated with 30 Gy given as 2 fractions over 2 days. Tumors were imaged with positron emission tomography/computed tomography (PET/CT) and measured daily with digital calipers. The HSPC and myelomonocytic cell content was assessed via immunofluorescent staining and flow cytometry. Functionality of tumor-associated HSPCs was verified in vitro using colony-forming cell assays and in vivo by rescuing lethally irradiated C57BL/6 recipients. Results: Irradiation significantly reduced tumor volumes and tumor regrowth rates compared with nonirradiated controls. The number of CD133 + HSPCs present in irradiated tumors was higher than in nonirradiated tumors during all stages of regrowth. CD11b + counts were similar. PET/CT imaging and growth rate analysis based on standardized uptake value indicated that HSPC recruitment directly correlated to the extent of regrowth and intratumor cell activity after irradiation. The BM-derived tumor-associated HSPCs successfully formed hematopoietic colonies and engrafted irradiated mice. Finally, targeted treatment with a small animal radiation research platform demonstrated localized HSPC recruitment to defined tumor subsites exposed to radiation. Conclusions: Hypofractionated irradiation resulted in a pronounced and targeted recruitment of BM-derived HSPCs, possibly as a mechanism to promote tumor regrowth. These data indicate for the first time that radiation therapy regulates HSPC content within regrowing tumors

  9. Methamphetamine and HIV-Tat alter murine cardiac DNA methylation and gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Koczor, Christopher A., E-mail: ckoczor@emory.edu; Fields, Earl; Jedrzejczak, Mark J.; Jiao, Zhe; Ludaway, Tomika; Russ, Rodney; Shang, Joan; Torres, Rebecca A.; Lewis, William

    2015-11-01

    This study addresses the individual and combined effects of HIV-1 and methamphetamine (N-methyl-1-phenylpropan-2-amine, METH) on cardiac dysfunction in a transgenic mouse model of HIV/AIDS. METH is abused epidemically and is frequently associated with acquisition of HIV-1 infection or AIDS. We employed microarrays to identify mRNA differences in cardiac left ventricle (LV) gene expression following METH administration (10 d, 3 mg/kg/d, subcutaneously) in C57Bl/6 wild-type littermates (WT) and Tat-expressing transgenic (TG) mice. Arrays identified 880 differentially expressed genes (expression fold change > 1.5, p < 0.05) following METH exposure, Tat expression, or both. Using pathway enrichment analysis, mRNAs encoding polypeptides for calcium signaling and contractility were altered in the LV samples. Correlative DNA methylation analysis revealed significant LV DNA methylation changes following METH exposure and Tat expression. By combining these data sets, 38 gene promoters (27 related to METH, 11 related to Tat) exhibited differences by both methods of analysis. Among those, only the promoter for CACNA1C that encodes L-type calcium channel Cav1.2 displayed DNA methylation changes concordant with its gene expression change. Quantitative PCR verified that Cav1.2 LV mRNA abundance doubled following METH. Correlative immunoblots specific for Cav1.2 revealed a 3.5-fold increase in protein abundance in METH LVs. Data implicate Cav1.2 in calcium dysregulation and hypercontractility in the murine LV exposed to METH. They suggest a pathogenetic role for METH exposure to promote LV dysfunction that outweighs Tat-induced effects. - Highlights: • HIV-1 Tat and methamphetamine (METH) alter cardiac gene expression and epigenetics. • METH impacts gene expression or epigenetics more significantly than Tat expression. • METH alters cardiac mitochondrial function and calcium signaling independent of Tat. • METH alters DNA methylation, expression, and protein abundance of

  10. Methamphetamine and HIV-Tat alter murine cardiac DNA methylation and gene expression

    International Nuclear Information System (INIS)

    Koczor, Christopher A.; Fields, Earl; Jedrzejczak, Mark J.; Jiao, Zhe; Ludaway, Tomika; Russ, Rodney; Shang, Joan; Torres, Rebecca A.; Lewis, William

    2015-01-01

    This study addresses the individual and combined effects of HIV-1 and methamphetamine (N-methyl-1-phenylpropan-2-amine, METH) on cardiac dysfunction in a transgenic mouse model of HIV/AIDS. METH is abused epidemically and is frequently associated with acquisition of HIV-1 infection or AIDS. We employed microarrays to identify mRNA differences in cardiac left ventricle (LV) gene expression following METH administration (10 d, 3 mg/kg/d, subcutaneously) in C57Bl/6 wild-type littermates (WT) and Tat-expressing transgenic (TG) mice. Arrays identified 880 differentially expressed genes (expression fold change > 1.5, p < 0.05) following METH exposure, Tat expression, or both. Using pathway enrichment analysis, mRNAs encoding polypeptides for calcium signaling and contractility were altered in the LV samples. Correlative DNA methylation analysis revealed significant LV DNA methylation changes following METH exposure and Tat expression. By combining these data sets, 38 gene promoters (27 related to METH, 11 related to Tat) exhibited differences by both methods of analysis. Among those, only the promoter for CACNA1C that encodes L-type calcium channel Cav1.2 displayed DNA methylation changes concordant with its gene expression change. Quantitative PCR verified that Cav1.2 LV mRNA abundance doubled following METH. Correlative immunoblots specific for Cav1.2 revealed a 3.5-fold increase in protein abundance in METH LVs. Data implicate Cav1.2 in calcium dysregulation and hypercontractility in the murine LV exposed to METH. They suggest a pathogenetic role for METH exposure to promote LV dysfunction that outweighs Tat-induced effects. - Highlights: • HIV-1 Tat and methamphetamine (METH) alter cardiac gene expression and epigenetics. • METH impacts gene expression or epigenetics more significantly than Tat expression. • METH alters cardiac mitochondrial function and calcium signaling independent of Tat. • METH alters DNA methylation, expression, and protein abundance of

  11. Characterization of the murine orthotopic adamantinomatous craniopharyngioma PDX model by MRI in correlation with histology.

    Science.gov (United States)

    Hölsken, Annett; Schwarz, Marc; Gillmann, Clarissa; Pfister, Christina; Uder, Michael; Doerfler, Arnd; Buchfelder, Michael; Schlaffer, Sven; Fahlbusch, Rudolf; Buslei, Rolf; Bäuerle, Tobias

    2018-01-01

    Adamantinomatous craniopharyngiomas (ACP) as benign sellar brain tumors are challenging to treat. In order to develop robust in vivo drug testing methodology, the murine orthotopic craniopharyngioma model (PDX) was characterized by magnetic resonance imaging (MRI) and histology in xenografts from three patients (ACP1-3). In ACP PDX, multiparametric MRI was conducted to assess morphologic characteristics such as contrast-enhancing tumor volume (CETV) as well as functional parameters from dynamic contrast-enhanced MRI (DCE-MRI) and diffusion-weighted imaging (DWI) including area-under-the-curve (AUC), peak enhancement (PE), time-to-peak (TTP) and apparent diffusion coefficient (ADC). These MRI parameters evaluated in 27 ACP PDX were correlated to histological features and percentage of vital tumor cell content. Qualitative analysis of MRI and histology from PDX revealed a similar phenotype as seen in patients, although the MRI appearance in mice resulted in a more solid tumor growth than in humans. CETV were significantly higher in ACP2 xenografts relative to ACP1 and ACP3 which correspond to respective average vitality of 41%, <10% and 26% determined histologically. Importantly, CETV prove tumor growth of ACP2 PDX as it significantly increases in longitudinal follow-up of 110 days. Furthermore, xenografts from ACP2 revealed a significantly higher AUC, PE and TTP in comparison to ACP3, and significantly increased ADC relative to ACP1 and ACP3 respectively. Overall, DCE-MRI and DWI can be used to distinguish vital from non-vital grafts, when using a cut off value of 15% for vital tumor cell content. MRI enables the assessment of craniopharyngioma PDX vitality in vivo as validated histologically.

  12. Diclofenac induces proteasome and mitochondrial dysfunction in murine cardiomyocytes and hearts.

    Science.gov (United States)

    Ghosh, Rajeshwary; Goswami, Sumanta K; Feitoza, Luis Felipe B B; Hammock, Bruce; Gomes, Aldrin V

    2016-11-15

    One of the most common nonsteroidal anti-inflammatory drugs (NSAIDs) used worldwide, diclofenac (DIC), has been linked to increased risk of cardiovascular disease (CVD). The molecular mechanism(s) by which DIC causes CVD is unknown. Proteasome activities were studied in hearts, livers, and kidneys from male Swiss Webster mice treated with either 100mg/kg DIC for 18h (acute treatment) or 10mg/kg DIC for 28days (chronic treatment). Cultured H9c2 cells and neonatal cardiomyocytes were also treated with different concentrations of DIC and proteasome function, cell death and ROS generation studied. Isolated mouse heart mitochondria were utilized to determine the effect of DIC on various electron transport chain complex activities. DIC significantly inhibited the chymotrypsin-like proteasome activity in rat cardiac H9c2 cells, murine neonatal cardiomyocytes, and mouse hearts, but did not affect proteasome subunit expression levels. Proteasome activity was also affected in liver and kidney tissues from DIC treated animals. The levels of polyubiquitinated proteins increased in hearts from DIC treated mice. Importantly, the levels of oxidized proteins increased while the β5i immunoproteasome activity decreased in hearts from DIC treated mice. DIC increased ROS production and cell death in H9c2 cells and neonatal cardiomyocytes while the cardioprotective NSAID, aspirin, had no effect on ROS levels or cell viability. DIC inhibited mitochondrial Complex III, a major source of ROS, and impaired mitochondrial membrane potential suggesting that mitochondria are the major sites of ROS generation. These results suggest that DIC induces cardiotoxicity by a ROS dependent mechanism involving mitochondrial and proteasome dysfunction. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. A novel murine T-cell receptor targeting NY-ESO-1.

    Science.gov (United States)

    Rosati, Shannon F; Parkhurst, Maria R; Hong, Young; Zheng, Zhili; Feldman, Steven A; Rao, Mahadev; Abate-Daga, Daniel; Beard, Rachel E; Xu, Hui; Black, Mary A; Robbins, Paul F; Schrump, David A; Rosenberg, Steven A; Morgan, Richard A

    2014-04-01

    Cancer testis antigens, such as NY-ESO-1, are expressed in a variety of prevalent tumors and represent potential targets for T-cell receptor (TCR) gene therapy. DNA encoding a murine anti-NY-ESO-1 TCR gene (mTCR) was isolated from immunized HLA-A*0201 transgenic mice and inserted into a γ-retroviral vector. Two mTCR vectors were produced and used to transduce human PBL. Transduced cells were cocultured with tumor target cell lines and T2 cells pulsed with the NY-ESO-1 peptide, and assayed for cytokine release and cell lysis activity. The most active TCR construct was selected for production of a master cell bank for clinical use. mTCR-transduced PBL maintained TCR expression in short-term and long-term culture, ranging from 50% to 90% efficiency 7-11 days after stimulation and 46%-82% 10-20 days after restimulation. High levels of interferon-γ secretion were observed (1000-12000 pg/mL), in tumor coculture assays and recognition of peptide-pulsed cells was observed at 0.1 ng/mL, suggesting that the new mTCR had high avidity for antigen recognition. mTCR-transduced T cells also specifically lysed human tumor targets. In all assays, the mTCR was equivalent or better than the comparable human TCR. As the functional activity of TCR-transduced cells may be affected by the formation of mixed dimers, mTCRs, which are less likely to form mixed dimers with endogenous hTCRs, may be more effective in vivo. This new mTCR targeted to NY-ESO-1 represents a novel potential therapeutic option for adoptive cell-transfer therapy for a variety of malignancies.

  14. Matrix Metalloproteinase 9 (MMP-9 Regulates Vein Wall Biomechanics in Murine Thrombus Resolution.

    Directory of Open Access Journals (Sweden)

    Khanh P Nguyen

    Full Text Available Deep venous thrombosis is a common vascular problem with long-term complications including post-thrombotic syndrome. Post-thrombotic syndrome consists of leg pain, swelling and ulceration that is related to incomplete or maladaptive resolution of the venous thrombus as well as loss of compliance of the vein wall. We examine the role of metalloproteinase-9 (MMP-9, a gene important in extracellular remodeling in other vascular diseases, in mediating thrombus resolution and biomechanical changes of the vein wall.The effects of targeted deletion of MMP-9 were studied in an in vivo murine model of thrombus resolution using the FVB strain of mice. MMP-9 expression and activity significantly increased on day 3 after DVT. The lack of MMP-9 impaired thrombus resolution by 27% and this phenotype was rescued by the transplantation of wildtype bone marrow cells. Using novel biomechanical techniques, we demonstrated that the lack of MMP-9 significantly decreased thrombus-induced loss of vein wall compliance. Biomechanical analysis of the contribution of individual structural components showed that MMP-9 affected the elasticity of the extracellular matrix and collagen-elastin fibers. Biochemical and histological analyses correlated with these biomechanical effects as thrombi of mice lacking MMP-9 had significantly fewer macrophages and collagen as compared to those of wildtype mice.MMP-9 mediates thrombus-induced loss of vein wall compliance by increasing stiffness of the extracellular matrix and collagen-elastin fibers during thrombus resolution. MMP-9 also mediates macrophage and collagen content of the resolving thrombus and bone-marrow derived MMP-9 plays a role in resolution of thrombus mass. These disparate effects of MMP-9 on various aspects of thrombus illustrate the complexity of individual protease function on biomechanical and morphometric aspects of thrombus resolution.

  15. Matrix Metalloproteinase 9 (MMP-9) Regulates Vein Wall Biomechanics in Murine Thrombus Resolution

    Science.gov (United States)

    Nguyen, Khanh P.; McGilvray, Kirk C.; Puttlitz, Christian M.; Mukhopadhyay, Subhradip; Chabasse, Christine; Sarkar, Rajabrata

    2015-01-01

    Objective Deep venous thrombosis is a common vascular problem with long-term complications including post-thrombotic syndrome. Post-thrombotic syndrome consists of leg pain, swelling and ulceration that is related to incomplete or maladaptive resolution of the venous thrombus as well as loss of compliance of the vein wall. We examine the role of metalloproteinase-9 (MMP-9), a gene important in extracellular remodeling in other vascular diseases, in mediating thrombus resolution and biomechanical changes of the vein wall. Methods and Results The effects of targeted deletion of MMP-9 were studied in an in vivo murine model of thrombus resolution using the FVB strain of mice. MMP-9 expression and activity significantly increased on day 3 after DVT. The lack of MMP-9 impaired thrombus resolution by 27% and this phenotype was rescued by the transplantation of wildtype bone marrow cells. Using novel biomechanical techniques, we demonstrated that the lack of MMP-9 significantly decreased thrombus-induced loss of vein wall compliance. Biomechanical analysis of the contribution of individual structural components showed that MMP-9 affected the elasticity of the extracellular matrix and collagen-elastin fibers. Biochemical and histological analyses correlated with these biomechanical effects as thrombi of mice lacking MMP-9 had significantly fewer macrophages and collagen as compared to those of wildtype mice. Conclusions MMP-9 mediates thrombus-induced loss of vein wall compliance by increasing stiffness of the extracellular matrix and collagen-elastin fibers during thrombus resolution. MMP-9 also mediates macrophage and collagen content of the resolving thrombus and bone-marrow derived MMP-9 plays a role in resolution of thrombus mass. These disparate effects of MMP-9 on various aspects of thrombus illustrate the complexity of individual protease function on biomechanical and morphometric aspects of thrombus resolution. PMID:26406902

  16. Expansion of murine gammaherpesvirus latently infected B cells requires T follicular help.

    Directory of Open Access Journals (Sweden)

    Christopher M Collins

    2014-05-01

    Full Text Available X linked lymphoproliferative disease (XLP is an inherited immunodeficiency resulting from mutations in the gene encoding the slam associated protein (SAP. One of the defining characteristics of XLP is extreme susceptibility to infection with Epstein-Barr virus (EBV, a gammaherpesvirus belonging to the genus Lymphocryptovirus, often resulting in fatal infectious mononucleosis (FIM. However, infection of SAP deficient mice with the related Murine gammaherpesvirus 68 (MHV68, a gammaherpesvirus in the genus Rhadinovirus, does not recapitulate XLP. Here we show that MHV68 inefficiently establishes latency in B cells in SAP deficient mice due to insufficient CD4 T cell help during the germinal center response. Although MHV68 infected B cells can be found in SAP-deficient mice, significantly fewer of these cells had a germinal center phenotype compared to SAP-sufficient mice. Furthermore, we show that infected germinal center B cells in SAP-deficient mice fail to proliferate. This failure to proliferate resulted in significantly lower viral loads, and likely accounts for the inability of MHV68 to induce a FIM-like syndrome. Finally, inhibiting differentiation of T follicular helper (TFH cells in SAP-sufficient C57Bl/6 mice resulted in decreased B cell latency, and the magnitude of the TFH response directly correlated with the level of infection in B cells. This requirement for CD4 T cell help during the germinal center reaction by MHV68 is in contrast with EBV, which is thought to be capable of bypassing this requirement by expressing viral proteins that mimic signals provided by TFH cells. In conclusion, the outcome of MHV68 infection in mice in the setting of loss of SAP function is distinct from that observed in SAP-deficient patients infected with EBV, and may identify a fundamental difference between the strategies employed by the rhadinoviruses and lymphocryptoviruses to expand B cell latency during the early phase of infection.

  17. Micro-RNAs in regenerating lungs: an integrative systems biology analysis of murine influenza pneumonia.

    Science.gov (United States)

    Tan, Kai Sen; Choi, Hyungwon; Jiang, Xiaoou; Yin, Lu; Seet, Ju Ee; Patzel, Volker; Engelward, Bevin P; Chow, Vincent T

    2014-07-11

    Tissue regeneration in the lungs is gaining increasing interest as a potential influenza management strategy. In this study, we explored the role of microRNAs, short non-coding RNAs involved in post-transcriptional regulation, during pulmonary regeneration after influenza infection. We profiled miRNA and mRNA expression levels following lung injury and tissue regeneration using a murine influenza pneumonia model. BALB/c mice were infected with a sub-lethal dose of influenza A/PR/8(H1N1) virus, and their lungs were harvested at 7 and 15 days post-infection to evaluate the expression of ~300 miRNAs along with ~36,000 genes using microarrays. A global network was constructed between differentially expressed miRNAs and their potential target genes with particular focus on the pulmonary repair and regeneration processes to elucidate the regulatory role of miRNAs in the lung repair pathways. The miRNA arrays revealed a global down-regulation of miRNAs. TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi. The significantly differentially regulated miRNAs are implicated in the activation or suppression of cellular proliferation and stem cell maintenance, which are required during the repair of the damaged lungs. These findings provide opportunities in the development of novel repair strategies in influenza-induced pulmonary injury.

  18. Correlation of Klebsiella pneumoniae comparative genetic analyses with virulence profiles in a murine respiratory disease model.

    Directory of Open Access Journals (Sweden)

    Ramy A Fodah

    Full Text Available Klebsiella pneumoniae is a bacterial pathogen of worldwide importance and a significant contributor to multiple disease presentations associated with both nosocomial and community acquired disease. ATCC 43816 is a well-studied K. pneumoniae strain which is capable of causing an acute respiratory disease in surrogate animal models. In this study, we performed sequencing of the ATCC 43816 genome to support future efforts characterizing genetic elements required for disease. Furthermore, we performed comparative genetic analyses to the previously sequenced genomes from NTUH-K2044 and MGH 78578 to gain an understanding of the conservation of known virulence determinants amongst the three strains. We found that ATCC 43816 and NTUH-K2044 both possess the known virulence determinant for yersiniabactin, as well as a Type 4 secretion system (T4SS, CRISPR system, and an acetonin catabolism locus, all absent from MGH 78578. While both NTUH-K2044 and MGH 78578 are clinical isolates, little is known about the disease potential of these strains in cell culture and animal models. Thus, we also performed functional analyses in the murine macrophage cell lines RAW264.7 and J774A.1 and found that MGH 78578 (K52 serotype was internalized at higher levels than ATCC 43816 (K2 and NTUH-K2044 (K1, consistent with previous characterization of the antiphagocytic properties of K1 and K2 serotype capsules. We also examined the three K. pneumoniae strains in a novel BALB/c respiratory disease model and found that ATCC 43816 and NTUH-K2044 are highly virulent (LD50<100 CFU while MGH 78578 is relatively avirulent.

  19. An Archaeosome-Adjuvanted Vaccine and Checkpoint Inhibitor Therapy Combination Significantly Enhances Protection from Murine Melanoma

    Directory of Open Access Journals (Sweden)

    Felicity C. Stark

    2017-10-01

    Full Text Available Archaeosomes constitute archaeal lipid vesicle vaccine adjuvants that evoke a strong CD8+ T cell response to antigenic cargo. Therapeutic treatment of murine B16-ovalbumin (B16-OVA melanoma with archaeosome-OVA eliminates small subcutaneous solid tumors; however, they eventually resurge despite an increased frequency of circulating and tumor infiltrating OVA-CD8+ T cells. Herein, a number of different approaches were evaluated to improve responses, including dose number, interval, and the combination of vaccine with checkpoint inhibitors. Firstly, we found that tumor protection could not be enhanced by repetitive and/or delayed boosting to maximize the CD8+ T cell number and/or phenotype. The in vivo cytotoxicity of vaccine-induced OVA-CD8+ T cells was impaired in tumor-bearing mice. Additionally, tumor-infiltrating OVA-CD8+ T cells had an increased expression of programmed cell death protein-1 (PD-1 compared to other organ compartments, suggesting impaired function. Combination therapy of tumor-bearing mice with the vaccine archaeosome-OVA, and α-CTLA-4 administered concurrently as well as α-PD-1 and an α-PD-L1 antibody administered starting 9 days after tumor challenge given on a Q3Dx4 schedule (days 9, 12, 15 and 18, significantly enhanced survival. Following multi-combination therapy ~70% of mice had rapid tumor recession, with no detectable tumor mass after >80 days in comparison to a median survival of 17–22 days for untreated or experimental groups receiving single therapies. Overall, archaeosomes offer a powerful platform for delivering cancer antigens when used in combination with checkpoint inhibitor immunotherapies.

  20. Thy-1+ dendritic cells in murine epidermis are bone marrow-derived

    International Nuclear Information System (INIS)

    Breathnach, S.M.; Katz, S.I.

    1984-01-01

    Thy-1+, Ly-5+ dendritic cells have recently been described as a resident cell population in murine epidermis, but their ontogeny and function are unknown. The origin and turnover of epidermal Thy-1+ cells utilizing chimeric mice were investigated. Lethally x-irradiated AKR/J (Thy-1.1+) and AKR/Cum (Thy-1.2+) mice were reconstituted with allogeneic bone marrow cells with or without thymocytes from congenic AKR/Cum or AKR/J mice, respectively. The density of residual indigenous Thy-1.1+ cells in AKR/J chimeras and Thy-1.2+ cells in AKR/Cum chimeras was substantially reduced following x-irradiation, as determined by immunofluorescence staining of epidermal sheets. Epidermal repopulation by allogeneic Thy-1+ dendritic epidermal cells was first observed at 5 weeks in AKR/J chimeras and at 7 weeks in AKR/Cum chimeras and progressed slowly. Repopulation was not enhanced by increasing the number of allogeneic bone marrow cells injected from 2 X 10(7) to 10(8) cells or by the addition of 8 X 10(7) allogeneic thymocytes to the donor inoculate. Epidermal repopulation by allogeneic Thy-1.2+ cells was not seen in AKR/J mice reconstituted with syngeneic bone marrow cells and allogeneic Thy-1.2+ AKR/Cum thymocytes. Taken together, these results indicate that Thy-1+ dendritic epidermal cells are derived from the bone marrow and suggest that they are not related to conventional peripheral T-lymphocytes

  1. Virus Delivery of CRISPR Guides to the Murine Prostate for Gene Alteration.

    Science.gov (United States)

    Riedel, Maria; Berthelsen, Martin F; Bakiri, Latifa; Wagner, Erwin F; Thomsen, Martin K

    2018-04-27

    With an increasing incidence of prostate cancer, identification of new tumor drivers or modulators is crucial. Genetically engineered mouse models (GEMM) for prostate cancer are hampered by tumor heterogeneity and its complex microevolution dynamics. Traditional prostate cancer mouse models include, amongst others, germline and conditional knockouts, transgenic expression of oncogenes, and xenograft models. Generation of de novo mutations in these models is complex, time-consuming, and costly. In addition, most of traditional models target the majority of the prostate epithelium, whereas human prostate cancer is well known to evolve as an isolated event in only a small subset of cells. Valuable models need to simulate not only prostate cancer initiation, but also progression to advanced disease. Here we describe a method to target a few cells in the prostate epithelium by transducing cells by viral particles. The delivery of an engineered virus to the murine prostate allows alteration of gene expression in the prostate epithelia. Virus type and quantity will hereby define the number of targeted cells for gene alteration by transducing a few cells for cancer initiation and many cells for gene therapy. Through surgery-based injection in the anterior lobe, distal from the urinary track, the tumor in this model can expand without impairing the urinary function of the animal. Furthermore, by targeting only a subset of prostate epithelial cells the technique enables clonal expansion of the tumor, and therefore mimics human tumor initiation, progression, as well as invasion through the basal membrane. This novel technique provides a powerful prostate cancer model with improved physiological relevance. Animal suffering is limited, and since no additional breeding is required, overall animal count is reduced. At the same time, analysis of new candidate genes and pathways is accelerated, which in turn is more cost efficient.

  2. A high-resolution anatomical ontology of the developing murine genitourinary tract

    Science.gov (United States)

    Little, Melissa H.; Brennan, Jane; Georgas, Kylie; Davies, Jamie A.; Davidson, Duncan R.; Baldock, Richard A.; Beverdam, Annemiek; Bertram, John F.; Capel, Blanche; Chiu, Han Sheng; Clements, Dave; Cullen-McEwen, Luise; Fleming, Jean; Gilbert, Thierry; Houghton, Derek; Kaufman, Matt H.; Kleymenova, Elena; Koopman, Peter A.; Lewis, Alfor G.; McMahon, Andrew P.; Mendelsohn, Cathy L.; Mitchell, Eleanor K.; Rumballe, Bree A.; Sweeney, Derina E.; Valerius, M. Todd; Yamada, Gen; Yang, Yiya; Yu., Jing

    2007-01-01

    Cataloguing gene expression during development of the genitourinary tract will increase our understanding not only of this process but also of congenital defects and disease affecting this organ system. We have developed a high-resolution ontology with which to describe the subcompartments of the developing murine genitourinary tract. This ontology incorporates what can be defined histologically and begins to encompass other structures and cell types already identified at the molecular level. The ontology is being used to annotate in situ hybridisation data generated as part of the Genitourinary Development Molecular Anatomy Project (GUDMAP), a publicly available data resource on gene and protein expression during genitourinary development. The GUDMAP ontology encompasses Theiler stage (TS) 17 to 27 of development as well as the sexually mature adult. It has been written as a partonomic, text-based, hierarchical ontology that, for the embryological stages, has been developed as a high-resolution expansion of the existing Edinburgh Mouse Atlas Project (EMAP) ontology. It also includes group terms for well-characterised structural and/or functional units comprising several sub-structures, such as the nephron and juxtaglomerular complex. Each term has been assigned a unique identification number. Synonyms have been used to improve the success of query searching and maintain wherever possible existing EMAP terms relating to this organ system. We describe here the principles and structure of the ontology and provide representative diagrammatic, histological, and whole mount and section RNA in situ hybridisation images to clarify the terms used within the ontology. Visual examples of how terms appear in different specimen types are also provided. PMID:17452023

  3. Biotin deficiency up-regulates TNF-alpha production in murine macrophages.

    Science.gov (United States)

    Kuroishi, Toshinobu; Endo, Yasuo; Muramoto, Koji; Sugawara, Shunji

    2008-04-01

    Biotin, a water-soluble vitamin of the B complex, functions as a cofactor of carboxylases that catalyze an indispensable cellular metabolism. Although significant decreases in serum biotin levels have been reported in patients with chronic inflammatory diseases, the biological roles of biotin in inflammatory responses are unclear. In this study, we investigated the effects of biotin deficiency on TNF-alpha production. Mice were fed a basal diet or a biotin-deficient diet for 8 weeks. Serum biotin levels were significantly lower in biotin-deficient mice than biotin-sufficient mice. After i.v. administration of LPS, serum TNF-alpha levels were significantly higher in biotin-deficient mice than biotin-sufficient mice. A murine macrophage-like cell line, J774.1, was cultured in a biotin-sufficient or -deficient medium for 4 weeks. Cell proliferation and biotinylation of intracellular proteins were decreased significantly in biotin-deficient cells compared with biotin-sufficient cells. Significantly higher production and mRNA expression of TNF-alpha were detected in biotin-deficient J774.1 cells than biotin-sufficient cells in response to LPS and even without LPS stimulation. Intracellular TNF-alpha expression was inhibited by actinomycin D, indicating that biotin deficiency up-regulates TNF-alpha production at the transcriptional level. However, the expression levels of TNF receptors, CD14, and TLR4/myeloid differentiation protein 2 complex were similar between biotin-sufficient and -deficient cells. No differences were detected in the activities of the NF-kappaB family or AP-1. The TNF-alpha induction by biotin deficiency was down-regulated by biotin supplementation in vitro and in vivo. These results indicate that biotin deficiency may up-regulate TNF-alpha production or that biotin excess down-regulates TNF-alpha production, suggesting that biotin status may influence inflammatory diseases.

  4. Adherence of murine lymphocytes to high endothelial venules in vitro and its radiation effect

    Energy Technology Data Exchange (ETDEWEB)

    Lixin, Liu; Zijun, Mao; Zhiwei, Yin [Suzhou Medical Coll., JS (China). Dept. of Pathophysiology

    1991-02-01

    Using the assay of specific adhesion of lymphocytes to high endothelial venules (HEV) on cryostat sections of mesenteric lymph nodes (MLN), the effects of different doses (0, 1, 2, 4, 8 Gy) of {sup 60}Co {gamma}-ray irradiation of murine MLN lymphocytes in vitro on adhesion to normal HEV was observed. The results showed that in the irradiated murine MLN lymphocytes the ability to adhere to HEV of normal MLN was reduced. Statistical significance was revealed at 2, 4, 8 Gy irradiations. This results suggests that irradiation can inhibit the specific recognition and adhesion of lymphocytes to HEV to a certain extent.

  5. The Cloning, Characterization, and Functional Analysis of Murine Pregnancy Specific Glycoproteins

    Science.gov (United States)

    1999-07-23

    wash at 550 C Sense AS Probe CTCCTCTCI I IrCATCTGT TCACTCATTT(AG~CACAGCCAG CTGGTACAAAGGGCTGATTG Cloni"gflllll~"gtltPsg19 5861 (AceS) 5859 ( AccAS ) 8050...12p40, iNOS, orTGF-1J mRNA. In RAW 264.7 cells, LPS upregulated mRNA expression for all cytokines examined, except for TGF- f3 mRNA. However, treatment

  6. ICAM-1-expressing neutrophils exhibit enhanced effector functions in murine models of endotoxemia

    NARCIS (Netherlands)

    Woodfin, Abigail; Beyrau, Martina; Voisin, Mathieu-Benoit; Ma, Bin; Whiteford, James R.; Hordijk, Peter L.; Hogg, Nancy; Nourshargh, Sussan

    2016-01-01

    Intracellular adhesion molecule-1 (ICAM-1) is a transmembrane glycoprotein expressed on the cell surface of numerous cell types such as endothelial and epithelial cells, vascular smooth muscle cells, and certain leukocyte subsets. With respect to the latter, ICAM-1 has been detected on neutrophils

  7. The expression and function of fatty acid transport protein-2 and -4 in the murine placenta.

    Directory of Open Access Journals (Sweden)

    Takuya Mishima

    Full Text Available The uptake and trans-placental trafficking of fatty acids from the maternal blood into the fetal circulation are essential for embryonic development, and involve several families of proteins. Fatty acid transport proteins (FATPs uniquely transport fatty acids into cells. We surmised that placental FATPs are germane for fetal growth, and are regulated during hypoxic stress, which is associated with reduced fat supply to the fetus.Using cultured primary term human trophoblasts we found that FATP2, FATP4 and FATP6 were highly expressed in trophoblasts. Hypoxia enhanced the expression of trophoblastic FATP2 and reduced the expression of FATP4, with no change in FATP6. We also found that Fatp2 and Fatp4 are expressed in the mouse amnion and placenta, respectively. Mice deficient in Fatp2 or Fatp4 did not deviate from normal Mendelian distribution, with both embryos and placentas exhibiting normal weight and morphology, triglyceride content, and expression of genes related to fatty acid mobilization.We conclude that even though hypoxia regulates the expression of FATP2 and FATP4 in human trophoblasts, mouse Fatp2 and Fatp4 are not essential for intrauterine fetal growth.

  8. MHC class I phenotype and function of human beta 2-microglobulin transgenic murine lymphocytes

    DEFF Research Database (Denmark)

    Bjerager, L; Pedersen, L O; Bregenholt, S

    1996-01-01

    . Based on data from cellular binding studies, Scatchard analyses and flow cytometry, it is concluded that exogenous h beta 2m does not bind to hybrid MHC class I (MHC-I) molecules composed of mouse heavy chain/h beta 2m molecules expressed on lymphocytes of transgenic mice. Immunoprecipitation and SDS......-PAGE analysis of metabolically labelled normal C57BL/6 lymph node cells showed binding of exogenous h beta 2m to MHC-I, in particular, to the H-2Db molecule through an exchange with endogenous mouse beta 2m. In contrast to normal H-2Db molecules, hybrid H-2Db expressed on the surface of transgenic lymphocytes...... binds radiolabelled peptide in the absence of exogenous added h beta 2m suggesting that a stable fraction of hybrid H-2Db molecules is empty or contain peptides with very low affinity. In a one-way allogenic mixed lymphocyte culture, transgenic splenocytes were found to be far less stimulatory than...

  9. Functional Genomics to Identify Therapeutic Targets in Cancer Stem Cells Using a Novel Murine CRPC Model

    Science.gov (United States)

    2015-11-01

    age, serial CyTOF analyses using an expanded antibody panel of 17 surface markers (Supplementary Table S1) were performed on single cells from...CD19 + ), natural killer (NK) cells (CD45 + NK1.1 + ), dendritic cells (CD45 + CD11c + ), putative MDSCs (CD45 + CD11b + Gr1 + ), and macrophages...Fig.  S3C). This MDSC depletion was accompanied by an increase of CD8 + T cells (so-called killer T cells; Fig. 4A ), consistent with elimination

  10. Reliable and inexpensive expression of large, tagged, exogenous proteins in murine bone marrow-derived macrophages using a second generation lentiviral system

    Directory of Open Access Journals (Sweden)

    Matthew R. Miller

    2015-08-01

    Full Text Available Over the past two decades, researchers have struggled to efficiently express foreign DNA in primary macrophages, impeding research progress. The applications of lipofection, electroporation, microinjection, and viral-mediated transfer typically result in disruptions in macrophage differentiation and function, low expression levels of exogenous proteins, limited efficiency and high cell mortality. In this report, after extensive optimization, we present a method of expressing large tagged proteins at high efficiency, consistency, and low cost using lentiviral infection. This method utilizes laboratory-propagated second generation plasmids to produce efficient virus that can be stored for later use. The expression of proteins up to 150 kDa in size is achieved in 30–70% of cells while maintaining normal macrophage differentiation and morphology as determined by fluorescence microscopy and Western blot analysis. This manuscript delineates the reagents and methods used to produce lentivirus to express exogenous DNA in murine bone marrow-derived macrophages sufficient for single cell microscopy as well as functional assays requiring large numbers of murine bone marrow-derived macrophages.

  11. Tick-Borne Transmission of Murine Gammaherpesvirus 68

    Directory of Open Access Journals (Sweden)

    Valeria Hajnická

    2017-10-01

    Full Text Available Herpesviruses are a large group of DNA viruses infecting mainly vertebrates. Murine gammaherpesvirus 68 (MHV68 is often used as a model in studies of the pathogenesis of clinically important human gammaherpesviruses such as Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus. This rodent virus appears to be geographically widespread; however, its natural transmission cycle is unknown. Following detection of MHV68 in field-collected ticks, including isolation of the virus from tick salivary glands and ovaries, we investigated whether MHV68 is a tick-borne virus. Uninfected Ixodes ricinus ticks were shown to acquire the virus by feeding on experimentally infected laboratory mice. The virus survived tick molting, and the molted ticks transmitted the virus to uninfected laboratory mice on which they subsequently fed. MHV68 was isolated from the tick salivary glands, consistent with transmission via tick saliva. The virus survived in ticks without loss of infectivity for at least 120 days, and subsequently was transmitted vertically from one tick generation to the next, surviving more than 500 days. Furthermore, the F1 generation (derived from F0 infected females transmitted MHV68 to uninfected mice on which they fed, with MHV68 M3 gene transcripts detected in blood, lung, and spleen tissue of mice on which F1 nymphs and F1 adults engorged. These experimental data fulfill the transmission criteria that define an arthropod-borne virus (arbovirus, the largest biological group of viruses. Currently, African swine fever virus (ASFV is the only DNA virus recognized as an arbovirus. Like ASFV, MHV68 showed evidence of pathogenesis in ticks. Previous studies have reported MHV68 in free-living ticks and in mammals commonly infested with I. ricinus, and neutralizing antibodies to MHV68 have been detected in large mammals (e.g., deer including humans. Further studies are needed to determine if these reports are the result of tick-borne transmission

  12. Transcriptome analysis of the ependymal barrier during murine neurocysticercosis

    Directory of Open Access Journals (Sweden)

    Mishra Pramod

    2012-06-01

    to be upregulated at the protein level using immunofluorescence microcopy. This is important, because these molecules are members of the most significant pathways by IPA analyses. Conclusion Thus, our study indicates that ependymal cells actively express immune mediators and likely contribute to the observed immunopathogenesis during infection. Of particular interest is the major upregulation of antigen presentation pathway-related genes and chemokines/cytokines. This could explain how the ependyma is a prominent source of leukocyte infiltration into ventricles through the disrupted ependymal lining by way of pial vessels present in the internal leptomeninges in murine NCC.

  13. Botulinum Toxin Confers Radioprotection in Murine Salivary Glands

    Energy Technology Data Exchange (ETDEWEB)

    Zeidan, Youssef H., E-mail: zeidan@miami.edu [Department of Radiation Oncology, University of Miami Miller School of Medicine, Miami, Florida (United States); Xiao, Nan; Cao, Hongbin [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Kong, Christina [Department of Otolaryngology-Head and Neck Surgery, Stanford University School of Medicine, Stanford, California (United States); Department of Pathology, Stanford University School of Medicine, Stanford, California (United States); Le, Quynh-Thu; Sirjani, Davud [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States)

    2016-04-01

    Purpose: Xerostomia is a common radiation sequela, which has a negative impact on the quality of life of patients with head and neck cancer. Current treatment strategies offer only partial relief. Botulinum toxins (BTX) have been successfully used in treating a variety of radiation sequelae such as cystitis, proctitis, fibrosis, and facial pain. The purpose of this study was to evaluate the effect of BTX on radiation-induced salivary gland damage. Methods and Materials: We used a previously established model for murine salivary gland irradiation (IR). The submandibular glands (SMGs) of C5BL/6 mice (n=6/group) were injected with saline or BTX 72 hours before receiving 15 Gy of focal irradiation. Saliva flow was measured 3, 7, and 28 days after treatment. The SMGs were collected for immunohistochemistry, confocal microscopy, and Western blotting. A cytokine array consisting of 40 different mouse cytokines was used to evaluate cytokine profiles after radiation treatment. Results: Irradiated mice showed a 50% reduction in saliva flow after 3 days, whereas mice preinjected with BTX had 25% reduction in saliva flow (P<.05). Cell death detected by TUNEL staining was similar in SMG sections of both groups. However, neutrophil infiltrate, detected by myeloperoxidase staining, was 3-fold lower for the BTX treated mice. A cytokine array showed a 2-fold upregulation of LPS-induced chemokine (LIX/CXCL5) 3 days after IR. BTX pretreatment reduced LIX levels by 40%. At 4 weeks after IR, the saline (control) group showed a 40% reduction in basal SMG weight, compared with 20% in the BTX group. Histologically, BTX-pretreated glands showed relative preservation of acinar structures after radiation. Conclusions: These data suggest that BTX pretreatment ameliorates radiation-induced saliva dysfunction. Moreover, we demonstrate a novel role for CXCL5 in the acute phase of salivary gland damage after radiation. These results carry important clinical implications for the treatment of

  14. Immunomodulatory Role of Ocimum gratissimum and Ascorbic Acid against Nicotine-Induced Murine Peritoneal Macrophages In Vitro

    Directory of Open Access Journals (Sweden)

    Santanu Kar Mahapatra

    2011-01-01

    Full Text Available The aim of this present study was to evaluate the immune functions and immune responses in nicotine-induced (10 mM macrophages and concurrently establish the immunomodulatory role of aqueous extract of Ocimum gratissimum (Ae-Og and ascorbic acid. In this study, nitrite generations and some phenotype functions by macrophages were studied. Beside that, release of Th1 cytokines (TNF-α, IL-12 and Th2 cytokines (IL-10, TGF-β was measured by ELISA, and the expression of these cytokines at mRNA level was analyzed by real-time PCR. Ae-Og, at a dose of 10 μg/mL, significantly reduced the nicotine-induced NO generation and iNOSII expression. Similar kinds of response were observed with supplementation of ascorbic acid (0.01 mM. The administration of Ae-Og and ascorbic acid increased the decreased adherence, chemotaxis, phagocytosis, and intracellular killing of bacteria in nicotine-treated macrophages. Ae-Og and ascorbic acid were found to protect the murine peritoneal macrophages through downregulation of Th1 cytokines in nicotine-treated macrophages with concurrent activation of Th2 responses. These findings strongly enhanced our understanding of the molecular mechanism leading to nicotine-induced suppression of immune functions and provide additional rationale for application of anti-inflammatory therapeutic approaches by O. gratissimum and ascorbic acid for different inflammatory disease prevention and treatment during nicotine toxicity.

  15. B700, a murine melanoma-specific antigen, binds Vitamin D3; conservation of binding among albuminoid molecules

    International Nuclear Information System (INIS)

    Farzaneh, N.K.; Walden, T.L. Jr.; Hearing, V.J.; Gersten, D.M.

    1990-01-01

    B700, a murine melanoma-specific antigen, is a member of the serum albumin protein family. Other members of this family include serum albumin (SMA), a-fetoprotein (AFP), vitamin D binding protein (DBP), and C700. The primary structure and biochemical functions of B700, as well as its in vivo metabolic fate are largely unknown. The authors examined the functional characteristics of MSA, AFP, and DBP, and for their ability to specifically bind [ 3 H]-1,25-dihydroxy-vitamin D 3 . Scatchard analysis revealed a single binding site for B700 with a Kd of 51,000 M and a Bmax of 4.51 x 10 -7 . There is no significant difference between the Kd and Bmax values among the albuminoid proteins. However, differences in the binding sites could be distinguished by competition of the 1,25-dihydroxy vitamin D 3 with other steroids. 2nM of vitamin D 3 , vitamin D 2 , or estrogen competed for the specific binding of 1,25-dihydroxy vitamin D 3 by B700 but not by DBP. The MSA binding site for 1,25 dihydroxy vitamin D 3 more closely resembles that of DBP than B700. These data indicate that the binding function of the albuminoid proteins has been conserved in the B700 melanoma antigen

  16. Amla Enhances Mitochondrial Spare Respiratory Capacity by Increasing Mitochondrial Biogenesis and Antioxidant Systems in a Murine Skeletal Muscle Cell Line

    Directory of Open Access Journals (Sweden)

    Hirotaka Yamamoto

    2016-01-01

    Full Text Available Amla is one of the most important plants in Indian traditional medicine and has been shown to improve various age-related disorders while decreasing oxidative stress. Mitochondrial dysfunction is a proposed cause of aging through elevated oxidative stress. In this study, we investigated the effects of Amla on mitochondrial function in C2C12 myotubes, a murine skeletal muscle cell model with abundant mitochondria. Based on cell flux analysis, treatment with an extract of Amla fruit enhanced mitochondrial spare respiratory capacity, which enables cells to overcome various stresses. To further explore the mechanisms underlying these effects on mitochondrial function, we analyzed mitochondrial biogenesis and antioxidant systems, both proposed regulators of mitochondrial spare respiratory capacity. We found that Amla treatment stimulated both systems accompanied by AMPK and Nrf2 activation. Furthermore, we found that Amla treatment exhibited cytoprotective effects and lowered reactive oxygen species (ROS levels in cells subjected to t-BHP-induced oxidative stress. These effects were accompanied by increased oxygen consumption, suggesting that Amla protected cells against oxidative stress by using enhanced spare respiratory capacity to produce more energy. Thus we identified protective effects of Amla, involving activation of mitochondrial function, which potentially explain its various effects on age-related disorders.

  17. In vitro recapitulation of the urea cycle using murine embryonic stem cell-derived in vitro liver model.

    Science.gov (United States)

    Tamai, Miho; Aoki, Mami; Nishimura, Akihito; Morishita, Koji; Tagawa, Yoh-ichi

    2013-12-01

    Ammonia, a toxic metabolite, is converted to urea in hepatocytes via the urea cycle, a process necessary for cell/organismal survival. In liver, hepatocytes, polygonal and multipolar structures, have a few sides which face hepatic sinusoids and adjacent hepatocytes to form intercellular bile canaliculi connecting to the ductules. The critical nature of this three-dimensional environment should be related to the maintenance of hepatocyte function such as urea synthesis. Recently, we established an in vitro liver model derived from murine embryonic stem cells, IVL(mES), which included the hepatocyte layer and a surrounding sinusoid vascular-like network. The IVL(mES) culture, where the hepatocyte is polarized in a similar fashion to its in vivo counterpart, could successfully recapitulate in vivo results. L-Ornithine is an intermediate of the urea cycle, but supplemental L-ornithine does not activate the urea cycle in the apolar primary hepatocyte of monolayer culture. In the IVL(mES), supplemental L-ornithine could activate the urea cycle, and also protect against ammonium/alcohol-induced hepatocyte death. While the IVL(mES) displays architectural and functional properties similar to the liver, primary hepatocyte of monolayer culture fail to model critical functional aspects of liver physiology. We propose that the IVL(mES) will represent a useful, humane alternative to animal studies for drug toxicity and mechanistic studies of liver injury.

  18. Monoclonal antibodies to murine thrombospondin-1 and thrombospondin-2 reveal differential expression patterns in cancer and low antigen expression in normal tissues

    International Nuclear Information System (INIS)

    Bujak, Emil; Pretto, Francesca; Ritz, Danilo; Gualandi, Laura; Wulhfard, Sarah; Neri, Dario

    2014-01-01

    There is a considerable interest for the discovery and characterization of tumor-associated antigens, which may facilitate antibody-based pharmacodelivery strategies. Thrombospondin-1 and thrombospondin-2 are homologous secreted proteins, which have previously been reported to be overexpressed during remodeling typical for wound healing and tumor progression and to possibly play a functional role in cell proliferation, migration and apoptosis. To our knowledge, a complete immunohistochemical characterization of thrombospondins levels in normal rodent tissues has not been reported so far. Using antibody phage technology, we have generated and characterized monoclonal antibodies specific to murine thrombospondin-1 and thrombospondin-2, two antigens which share 62% aminoacid identity. An immunofluorescence analysis revealed that both antigens are virtually undetectable in normal mouse tissues, except for a weak staining of heart tissue by antibodies specific to thrombospondin-1. The analysis also showed that thrombospondin-1 was strongly expressed in 5/7 human tumors xenografted in nude mice, while it was only barely detectable in 3/8 murine tumors grafted in immunocompetent mice. By contrast, a high-affinity antibody to thrombospondin-2 revealed a much lower level of expression of this antigen in cancer specimens. Our analysis resolves ambiguities related to conflicting reports on thrombosponding expression in health and disease. Based on our findings, thrombospondin-1 (and not thrombospondin-2) may be considered as a target for antibody-based pharmacodelivery strategies, in consideration of its low expression in normal tissues and its upregulation in cancer. - Highlights: • High affinity monoclonal antibodies to murine and human TSP1 and 2 were raised. • Both antigens are virtually undetectable in normal mouse tissues. • Strong positivity of human tumor xenografts for TSP1 was detected. • Study revealed much lower level of TSP2 expression in cancer specimens

  19. A Novel Murine Candidiasis Model with Severe Colonization in the Stomach Induced by N-acetylglucosamine-treatment and Its Scoring System Based on Local Characteristic Stomach Symptoms.

    Science.gov (United States)

    Ishijima, Sanae A; Abe, Shigeru

    2015-01-01

    We developed a novel murine candidiasis model of the gastrointestinal tract using N-acetylglucosamine ( GlcNAc ) as a tool to aggravate symptoms. Forty-eight hours after intragastrically inoculating Candida albicans cells to immunosuppressed and GlcNAc-treated mice, vigorously accumulating patchy whitish plaques were observed on their inner stomach surface. Candida cells colonizing the plaques consisted of both yeast and mycelia, and were directly stained with Calcofluor White M2R. Aggravation of the candidiasis symptoms was dependent on GlcNAc concentration in drinking water, wherein administration of 50 mM GlcNAc not only severely worsened stomach symptoms, but also significantly increased Candida cell number in the stomach and small intestine. The aggravation effect of GlcNAc was enhanced by addition of sedative chemical chlorpromazine chloride after inoculation. In order to semi-quantitatively assess colonization by Candida in the stomach, we devised a new symptom scoring system that represents the extent of the patchy whitish plaques on the mucosal epithelium of the stomach. Histochemical analysis of Candida-infected tissues revealed not only a large amount of thick Candida mycelia invading mucosal epithelial stomach tissues but also infiltrating inflammatory cells. These results suggest that this murine gastrointestinal candidiasis model could serve as a useful tool for evaluating the protective activity of antifungal agents, probiotics, or functional foods against gastrointestinal candidiasis. Furthermore, from another point of view, this novel murine model could also be used to analyze the pathological mechanisms behind the translocation of C. albicans across intestinal barriers, which results in systemic Candida dissemination and infection.

  20. Asbestos Induces Oxidative Stress and Activation of Nrf2 Signaling in Murine Macrophages: Chemopreventive Role of the Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605

    Directory of Open Access Journals (Sweden)

    Ralph A. Pietrofesa

    2016-03-01

    Full Text Available The interaction of asbestos fibers with macrophages generates harmful reactive oxygen species (ROS and subsequent oxidative cell damage that are key processes linked to malignancy. Secoisolariciresinol diglucoside (SDG is a non-toxic, flaxseed-derived pluripotent compound that has antioxidant properties and may thus function as a chemopreventive agent for asbestos-induced mesothelioma. We thus evaluated synthetic SDG (LGM2605 in asbestos-exposed, elicited murine peritoneal macrophages as an in vitro model of tissue phagocytic response to the presence of asbestos in the pleural space. Murine peritoneal macrophages (MFs were exposed to crocidolite asbestos fibers (20 µg/cm2 and evaluated at various times post exposure for cytotoxicity, ROS generation, malondialdehyde (MDA, and levels of 8-iso Prostaglandin F2α (8-isoP. We then evaluated the ability of LGM2605 to mitigate asbestos-induced oxidative stress by administering LGM2605 (50 µM 4-h prior to asbestos exposure. We observed a significant (p < 0.0001, time-dependent increase in asbestos-induced cytotoxicity, ROS generation, and the release of MDA and 8-iso Prostaglandin F2α, markers of lipid peroxidation, which increased linearly over time. LGM2605 treatment significantly (p < 0.0001 reduced asbestos-induced cytotoxicity and ROS generation, while decreasing levels of MDA and 8-isoP by 71%–88% and 41%–73%, respectively. Importantly, exposure to asbestos fibers induced cell protective defenses, such as cellular Nrf2 activation and the expression of phase II antioxidant enzymes, HO-1 and Nqo1 that were further enhanced by LGM2605 treatment. LGM2605 boosted antioxidant defenses, as well as reduced asbestos-induced ROS generation and markers of oxidative stress in murine peritoneal macrophages, supporting its possible use as a chemoprevention agent in the development of asbestos-induced malignant mesothelioma.

  1. Plasma membrane Ca2+-ATPase 4 in murine epididymis: secretion of splice variants in the luminal fluid and a role in sperm maturation.

    Science.gov (United States)

    Patel, Ramkrishna; Al-Dossary, Amal A; Stabley, Deborah L; Barone, Carol; Galileo, Deni S; Strehler, Emanuel E; Martin-DeLeon, Patricia A

    2013-07-01

    Plasma membrane Ca(2+)-ATPase isoform 4 (PMCA4) is the primary Ca(2+) efflux pump in murine sperm, where it regulates motility. In Pmca4 null sperm, motility loss results in infertility. We have shown that murine sperm PMCA4b interacts with Ca(2+)/CaM-dependent serine kinase (CASK) in regulating Ca(2+) homeostasis and motility. However, recent work indicated that the bovine PMCA4a splice variant (missing in testis) is epididymally expressed, along with 4b, and may be transferred to sperm. Here we show, via conventional and in situ RT-PCR, that both the splice variants of Pmca4 mRNA are expressed in murine testis and throughout the epididymis. Immunofluorescence localized PMCA4a to the apical membrane of the epididymal epithelium, and Western analysis not only confirmed its presence but showed for the first time that PMCA4a and PMCA4b are secreted in the epididymal luminal fluid (ELF), from which epididymosomes containing PMCA4a were isolated. Flow cytometry indicated the presence of PMCA4a on mature caudal sperm where it was increased ~5-fold compared to caput sperm (detected by Western blotting) and ~2-fold after incubation in ELF, revealing in vitro uptake and implicating PMCA4a in epididymal sperm maturation. Coimmunoprecipitation using pan-PMCA4 antibodies, revealed that both variants associate with CASK, suggesting their presence in a complex. Because they have different kinetic properties for Ca(2+) transport and different abilities to bind to CASK, our study suggests a mechanism for combining the functional attributes of both PMCA4 variants, leading to heightened efficiency of the pump in the maintenance of Ca(2+) homeostasis, which is crucial for normal motility and male fertility.

  2. Monoclonal antibodies to murine thrombospondin-1 and thrombospondin-2 reveal differential expression patterns in cancer and low antigen expression in normal tissues

    Energy Technology Data Exchange (ETDEWEB)

    Bujak, Emil [Department of Chemistry and Applied Biosciences, Swiss Federal Institute of Technology (ETH Zürich), Vladimir-Prelog-Weg 2, CH-8093 Zurich (Switzerland); Pretto, Francesca; Ritz, Danilo; Gualandi, Laura; Wulhfard, Sarah [Philochem AG, Libernstrasse 3, CH-8112 Otelfingen (Switzerland); Neri, Dario, E-mail: neri@pharma.ethz.ch [Department of Chemistry and Applied Biosciences, Swiss Federal Institute of Technology (ETH Zürich), Vladimir-Prelog-Weg 2, CH-8093 Zurich (Switzerland)

    2014-09-10

    There is a considerable interest for the discovery and characterization of tumor-associated antigens, which may facilitate antibody-based pharmacodelivery strategies. Thrombospondin-1 and thrombospondin-2 are homologous secreted proteins, which have previously been reported to be overexpressed during remodeling typical for wound healing and tumor progression and to possibly play a functional role in cell proliferation, migration and apoptosis. To our knowledge, a complete immunohistochemical characterization of thrombospondins levels in normal rodent tissues has not been reported so far. Using antibody phage technology, we have generated and characterized monoclonal antibodies specific to murine thrombospondin-1 and thrombospondin-2, two antigens which share 62% aminoacid identity. An immunofluorescence analysis revealed that both antigens are virtually undetectable in normal mouse tissues, except for a weak staining of heart tissue by antibodies specific to thrombospondin-1. The analysis also showed that thrombospondin-1 was strongly expressed in 5/7 human tumors xenografted in nude mice, while it was only barely detectable in 3/8 murine tumors grafted in immunocompetent mice. By contrast, a high-affinity antibody to thrombospondin-2 revealed a much lower level of expression of this antigen in cancer specimens. Our analysis resolves ambiguities related to conflicting reports on thrombosponding expression in health and disease. Based on our findings, thrombospondin-1 (and not thrombospondin-2) may be considered as a target for antibody-based pharmacodelivery strategies, in consideration of its low expression in normal tissues and its upregulation in cancer. - Highlights: • High affinity monoclonal antibodies to murine and human TSP1 and 2 were raised. • Both antigens are virtually undetectable in normal mouse tissues. • Strong positivity of human tumor xenografts for TSP1 was detected. • Study revealed much lower level of TSP2 expression in cancer specimens

  3. Postprandial triglyceride-rich lipoproteins promote lipid accumulation and apolipoprotein B-48 receptor transcriptional activity in human circulating and murine bone marrow neutrophils in a fatty acid-dependent manner.

    Science.gov (United States)

    Ortega-Gómez, Almudena; Varela, Lourdes M; López, Sergio; Montserrat de la Paz, Sergio; Sánchez, Rosario; Muriana, Francisco J G; Bermúdez, Beatriz; Abia, Rocío

    2017-09-01

    Postprandial triglyceride-rich lipoproteins (TRLs) promote atherosclerosis. Recent research points the bone marrow (BM) as a primary site in atherosclerosis. We elucidated how the acute administration of monounsaturated fatty acids (MUFAs) MUFAs, omega-3 polyunsaturated fatty acids (PUFAs) PUFAs and saturated fatty acids (SFAs) affects human circulating and murine BM neutrophil lipid accumulation and functionality. Postprandial hypertriglyceridemia was induced in healthy subjects and Apoe -/- mice by the acute administration of dietary fats enriched in MUFAs, PUFAs, or SFAs. Postprandial hypertriglyceridemia increased apolipoprotein-B48 receptor (ApoB48R) transcriptional activity that was linearly correlated with intracellular triglycerides (TGs) TGs accumulation in human circulating and murine BM neutrophils. MUFA and omega-3 PUFAs attenuated ApoB48R gene expression and intracellular TG accumulation compared to SFAs. TRLs induced apoB48R-dependent TG accumulation in human neutrophils ex vivo. Murine BM neutrophils showed a decrease in surface L-selectin and an increase in TNF-α and IL-1β mRNA expressions only after SFAs administration. TRLs enriched in SFAs induced BM neutrophil degranulation ex vivo suggesting cell priming/activation. Postprandial TRLs disrupts the normal biology and function of circulating and BM neutrophils. MUFA- and omega-3 PUFA-rich dietary fats such as virgin olive oil or fish oil has the potential to prevent excessive neutrophil lipid accumulation and activation by targeting the fatty acid composition of TRLs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Effects of Lactobacillus plantarum Strain OLL2712 Culture Conditions on the Anti-inflammatory Activities for Murine Immune Cells and Obese and Type 2 Diabetic Mice.

    Science.gov (United States)

    Toshimitsu, T; Ozaki, S; Mochizuki, J; Furuichi, K; Asami, Y

    2017-04-01

    Studies on the health-promoting effects of lactic acid bacteria (LAB) are numerous, but few provide examples of the relationship between LAB function and culture conditions. We verified the effect of differences in culture conditions on Lactobacillus plantarum OLL2712 functionality; this strain exhibits anti-inflammatory activity and preventive effects against metabolic disorders. We measured interleukin-10 (IL-10) and IL-12 production in murine immune cells treated with OLL2712 cells prepared under various culture conditions. The results showed that the IL-10-inducing activities of OLL2712 cells on murine immune cells differed dramatically between OLL2712 groups at different culture phases and using different culture medium components, temperatures, and neutralizing pHs. In particular, exponential-phase cells had much more IL-10-inducing activity than stationary-phase cells. We confirmed that the Toll-like receptor 2 (TLR2) stimulation activity of OLL2712 cells depended on culture conditions in conjunction with IL-10-inducing activity. We also demonstrated functional differences by culture phases in vivo ; OLL2712 cells at exponential phase had more anti-inflammatory activity and anti-metabolic-disorder effects on obese and diabetic mice than those by their stationary-phase counterparts. These results suggest that culture conditions affect the functionality of anti-inflammatory LAB. IMPORTANCE While previous studies demonstrated that culture conditions affected the immunomodulatory properties of lactic acid bacteria (LAB), few have comprehensively investigated the relationship between culture conditions and LAB functionality. In this study, we demonstrated several culture conditions of Lactobacillus plantarum OLL2712 for higher anti-inflammatory activity. We also showed that culture conditions concretely influenced the health-promoting functions of OLL2712 in vivo , particularly against metabolic disorders. Further, we characterized a novel mechanism by which

  5. Phage-display libraries of murine and human antibody Fab fragments

    DEFF Research Database (Denmark)

    Engberg, J; Andersen, P S; Nielsen, L K

    1996-01-01

    We provide efficient and detailed procedures for construction, expression, and screening of comprehensive libraries of murine or human antibody Fab fragments displayed on the surface of filamentous phage. In addition, protocols for producing and using ultra-electrocompetent cells, for producing Fab...

  6. Coagulation and inflammation in scrub typhus and murine typhusu-a prospective comparative study from Laos

    NARCIS (Netherlands)

    Paris, D. H.; Chansamouth, V.; Nawtaisong, P.; Löwenberg, E. C.; Phetsouvanh, R.; Blacksell, S. D.; Lee, S. J.; Dondorp, A. M.; van der Poll, T.; Newton, P. N.; Levi, M. [=Marcel M.; Day, N. P. J.

    2012-01-01

    Scrub typhus (caused by Orientia tsutsugamushi) and murine typhus (caused by Rickettsia typhi) cause up to 28% of febrile episodes in Thailand and Laos. The current understanding of coagulation and inflammation in the pathogenesis of these clinically very similar vasculotropic diseases is limited.

  7. Characterization of murine melanocortin receptors mediating adipocyte lipolysis and examination of signalling pathways involved

    DEFF Research Database (Denmark)

    Møller, Cathrine Laustrup; Raun, Kirsten; Jacobsen, Marianne Lambert

    2011-01-01

    hormone (a-MSH) generated from proopiomelanocortin (POMC), as well as synthetic MSH analogues to stimulate lipolysis in murine 3T3-L1 adipocytes it is shown that MC2R and MC5R are lipolytic mediators in differentiated 3T3-L1 adipocytes. Involvement of cAMP, phosphorylated extracellular signal...

  8. Effect of fucoidan on B16 murine melanoma cell melanin formation ...

    African Journals Online (AJOL)

    Background:Fucoidan is a complex sulfated polysaccharide extracted from brown seaweed and has a wide variety of biological activities. It not only inhibits cancer cell growth but also inhibits tyrosinase in vitro. Therefore, it is of interest to investigate the effect of fucoidan on B16 murine melanoma cells as the findings may ...

  9. GPBAR1/TGR5 mediates bile acid-induced cytokine expression in murine Kupffer cells.

    Directory of Open Access Journals (Sweden)

    Guiyu Lou

    Full Text Available GPBAR1/TGR5 is a novel plasma membrane-bound G protein-coupled bile acid (BA receptor. BAs are known to induce the expression of inflammatory cytokines in the liver with unknown mechanism. Here we show that without other external stimuli, TGR5 activation alone induced the expression of interleukin 1β (IL-1β and tumor necrosis factor-α (TNF-α in murine macrophage cell line RAW264.7 or murine Kupffer cells. The TGR5-mediated increase of pro-inflammatory cytokine expression was suppressed by JNK inhibition. Moreover, the induced pro-inflammatory cytokine expression in mouse liver by 1% cholic acid (CA diet was blunted in JNK-/- mice. TGR5 activation by its ligands enhanced the phosphorylation levels, DNA-binding and trans-activities of c-Jun and ATF2 transcription factors. Finally, the induced pro-inflammatory cytokine expression in Kupffer cells by TGR5 activation correlated with the suppression of Cholesterol 7α-hydroxylase (Cyp7a1 expression in murine hepatocytes. These results suggest that TGR5 mediates the BA-induced pro-inflammatory cytokine production in murine Kupffer cells through JNK-dependent pathway. This novel role of TGR5 may correlate to the suppression of Cyp7a1 expression in hepatocytes and contribute to the delicate BA feedback regulation.

  10. In vitro activation of murine DRG neurons by CGRP-mediated mucosal mast cell degranulation

    NARCIS (Netherlands)

    De Jonge, F; De Laet, A; Van Nassauw, L; Miller, HRP; van Bogaert, PP; Timmermans, JP; Kroese, ABA

    Upregulation of CGRP-immunoreactive (IR) primary afferent nerve fibers accompanied by mastocytosis is characteristic for the Schistosoma mansoni-infected murine ileum. These mucosal mast cells (MMC) and CGRP-IR fibers, which originate from dorsal root (DRG) and nodose ganglia, are found in close

  11. Adipocytes enhance murine pancreatic cancer growth via a hepatocyte growth factor (HGF)-mediated mechanism.

    Science.gov (United States)

    Ziegler, Kathryn M; Considine, Robert V; True, Eben; Swartz-Basile, Deborah A; Pitt, Henry A; Zyromski, Nicholas J

    2016-04-01

    Obesity accelerates the development and progression of pancreatic cancer, though the mechanisms underlying this association are unclear. Adipocytes are biologically active, producing factors such as hepatocyte growth factor (HGF) that may influence tumor progression. We therefore sought to test the hypothesis that adipocyte-secreted factors including HGF accelerate pancreatic cancer cell proliferation. Murine pancreatic cancer cells (Pan02 and TGP-47) were grown in a) conditioned medium (CM) from murine F442A preadipocytes, b) HGF-knockdown preadipocyte CM, c) recombinant murine HGF at increasing doses, and d) CM plus HGF-receptor (c-met) inhibitor. Cell proliferation was measured using the MTT assay. ANOVA and t-test were applied; p TGP-47 cell proliferation relative to control (59 ± 12% and 34 ± 12%, p TGP-47 cells remained unchanged. Recombinant HGF dose-dependently increased Pan02, but not TGP-47, proliferation (p TGP-47 cells. These experiments demonstrate that adipocyte-derived factors accelerate murine pancreatic cancer proliferation. In the case of Pan02 cells, HGF is responsible, in part, for this proliferation. Copyright © 2016 IJS Publishing Group Limited. Published by Elsevier Ltd. All rights reserved.

  12. Gastrointestinal expression and partial cDNA cloning of murine Muc2

    NARCIS (Netherlands)

    van Klinken, B. J.; Einerhand, A. W.; Duits, L. A.; Makkink, M. K.; Tytgat, K. M.; Renes, I. B.; Verburg, M.; Büller, H. A.; Dekker, J.

    1999-01-01

    To help us investigate the role of mucin in the protection of the colonic epithelium in the mouse, we aimed to identify the murine colonic mucin (MCM) and its encoding gene. We isolated MCM, raised an anti-MCM antiserum, and studied the biosynthesis of MCM in the gastrointestinal tract. Isolated MCM

  13. Erythropoietin treatment alleviates ultrastructural myelin changes induced by murine cerebral malaria

    DEFF Research Database (Denmark)

    Hempel, Casper; Hyttel, Poul; Staalsø, Trine

    2012-01-01

    the effects of EPO treatment in this context. METHODS: The study consisted of two groups of Plasmodium berghei-infected mice and two groups of uninfected controls that were either treated with EPO or placebo (n = 4 mice/group). In the terminal phase of murine CM the brains were removed and processed...

  14. Development of an ex vivo BrdU labeling procedure for the murine LLNA

    Science.gov (United States)

    The murine local lymph node assay (LLNA) is widely used to identify chemicals that may cause allergic contact dermatitis. Exposure to a dermal sensitizer results in proliferation of local lymph node T cells, which has traditionally been measured by in vivo incorporation of [3H]m...

  15. Modeling of Chronic Myeloid Leukemia : An Overview of In Vivo Murine and Human Xenograft Models

    NARCIS (Netherlands)

    Sontakke, Pallavi; Jaques, Jenny; Vellenga, Edo; Schuringa, Jan Jacob

    2016-01-01

    Over the past years, a wide variety of in vivo mouse models have been generated in order to unravel the molecular pathology of Chronic Myeloid Leukemia (CML) and to develop and improve therapeutic approaches. These models range from (conditional) transgenic models, knock-in models, and murine bone

  16. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene

    DEFF Research Database (Denmark)

    Xu, H; Wu, X R; Wewer, U M

    1994-01-01

    The classic murine muscular dystrophy strain, dy, was first described almost 40 years ago. We have identified the molecular basis of an allele of dy, called dy2J, by detecting a mutation in the laminin alpha 2 chain gene--the first identified mutation in laminin-2. The G to A mutation in a splice...

  17. Dual Role of Host Par2 in a Murine Model of Spontaneous Metastatic B16 Melanoma

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Větvička, D.; Zadinová, M.; Poučková, P.; Kukal, J.; Ježek, Petr; Matěj, R.

    2014-01-01

    Roč. 34, č. 7 (2014), s. 3511-3515 ISSN 0250-7005 R&D Projects: GA ČR(CZ) GAP302/10/0346 Institutional support: RVO:67985823 Keywords : PAR2 * melanoma * metastasis * murine model Subject RIV: EA - Cell Biology Impact factor: 1.826, year: 2014

  18. The murine retinoblastoma homolog maps to chromosome 14 near Es-10

    NARCIS (Netherlands)

    Stone, J.C.; Crosby, J.J.; Kozak, C.A.; Schievella, A.R.; Bernards, R.A.; Nadeau, J.H.

    1989-01-01

    Restriction fragment length variants have been exploited to map genetically Rb-1, the murine homolog of the human retinoblastoma gene. Rb-1 localized to mouse chromosome 14 on the basis of results from analysis of somatic cell hybrids. In an interspecific backcross involving Mus spretus, Rb-1 and

  19. Porcine humoral immune responses to multiple injections of murine monoclonal antibodies

    DEFF Research Database (Denmark)

    Lohse, Louise; Nielsen, Jens; Kamstrup, Søren

    2005-01-01

    In humans and cattle, multiple injections of murine monoclonal antibodies (m-mAbs) induce anti-mouse antibody responses. The objectives of the present. study were to investigate whether a similar response could be seen when pigs were subjected to m-mAb therapy, and to study the kinetics of such a...

  20. Coinfection with Borrelia burgdorferi sensu stricto and Borrelia garinii alters the course of murine Lyme borreliosis

    NARCIS (Netherlands)

    Hovius, Joppe W. R.; Li, Xin; Ramamoorthi, Nandhini; van Dam, Alje P.; Barthold, Stephen W.; van der Poll, Tom; Speelman, Peter; Fikrig, Erol

    2007-01-01

    Ixodes ricinus ticks and mice can be infected with both Borrelia burgdorferi sensu stricto and Borrelia garinii. The effect of coinfection with these two Borrelia species on the development of murine Lyme borreliosis is unknown. Therefore, we investigated whether coinfection with the

  1. Major differences between human atopic dermatitis and murine models as determined by global transcriptomic profiling

    DEFF Research Database (Denmark)

    Ewald, David Adrian; Noda, Shinji; Oliva, Margeaux

    2017-01-01

    , and a comparison of these models with the human AD transcriptomic fingerprint is lacking. We sought to evaluate the transcriptomic profiles of six common murine models and determine how they relate to human AD skin. Transcriptomic profiling was performed using microarrays and qRT-PCR on biopsies from NC/Nga, flaky...

  2. Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.

    Directory of Open Access Journals (Sweden)

    Alejo Efeyan

    Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.

  3. Gender and dose dependent ovalbumin induced hypersensitivity responses in murine model of food allergy

    Science.gov (United States)

    While federal regulations mandate the labeling of major food allergens, allowable food allergen thresholds have yet to be determined. Therefore the aim of this project was to identify the lowest egg allergen ovalbumin (OVA) dose causing hypersensitization using a validated murine model. Mice were or...

  4. Novel Application of Micro-Computerized Tomography for Morphologic Characterization of the Murine Penis.

    Science.gov (United States)

    O'Neill, Marisol; Huang, Gene O; Lamb, Dolores J

    2017-12-01

    The murine penis model has enriched our understanding of anomalous penile development. The morphologic characterization of the murine penis using conventional serial sectioning methods is labor intensive and prone to errors. To develop a novel application of micro-computerized tomography (micro-CT) with iodine staining for rapid, non-destructive morphologic study of murine penis structure. Penises were dissected from 10 adult wild-type mice and imaged using micro-CT with iodine staining. Images were acquired at 5-μm spatial resolution on a Bruker SkyScan 1272 micro-CT system. After images were acquired, the specimens were washed of any remaining iodine and embedded in paraffin for conventional histologic examination. Histologic and micro-CT measurements for all specimens were made by 2 independent observers. Measurements of penile structures were made on virtual micro-CT sections and histologic slides. The Lin concordance correlation coefficient demonstrated almost perfect strength of agreement for interobserver variability for histologic section (0.9995, 95% CI = 0.9990-0.9997) and micro-CT section (0.9982, 95% CI = 0.9963-0.9991) measurements. Bland-Altman analysis for agreement between the 2 modalities of measurement demonstrated mean differences of -0.029, 0.022, and -0.068 mm for male urogenital mating protuberance, baculum, and penile glans length, respectively. There did not appear to be a bias for overestimation or underestimation of measured lengths and limits of agreement were narrow. The enhanced ability offered by micro-CT to phenotype the murine penis has the potential to improve translational studies examining the molecular pathways contributing to anomalous penile development. The present study describes the first reported use of micro-CT with iodine staining for imaging the murine penis. Producing repeated histologic sections of identical orientation was limited by inherent imperfections in mounting and tissue sectioning, but this was

  5. ICAM-1-based rabies virus vaccine shows increased infection and activation of primary murine B cells in vitro and enhanced antibody titers in-vivo.

    Directory of Open Access Journals (Sweden)

    James E Norton

    Full Text Available We have previously shown that live-attenuated rabies virus (RABV-based vaccines infect and directly activate murine and human primary B cells in-vitro, which we propose can be exploited to help develop a single-dose RABV-based vaccine. Here we report on a novel approach to utilize the binding of Intracellular Adhesion Molecule-1 (ICAM-1 to its binding partner, Lymphocyte Function-associated Antigen-1 (LFA-1, on B cells to enhance B cell activation and RABV-specific antibody responses. We used a reverse genetics approach to clone, recover, and characterize a live-attenuated recombinant RABV-based vaccine expressing the murine Icam1 gene (rRABV-mICAM-1. We show that the murine ICAM-1 gene product is incorporated into virus particles, potentially exposing ICAM-1 to extracellular binding partners. While rRABV-mICAM-1 showed 10-100-fold decrease in viral titers on baby hamster kidney cells compared to the parental virus (rRABV, rRABV-mICAM-1 infected and activated primary murine B cells in-vitro more efficiently than rRABV, as indicated by significant upregulation of CD69, CD40, and MHCII on the surface of infected B cells. ICAM-1 expression on the virus surface was responsible for enhanced B cell infection since pre-treating rRABV-mICAM-1 with a neutralizing anti-ICAM-1 antibody reduced B cell infection to levels observed with rRABV alone. Furthermore, 100-fold less rRABV-mICAM-1 was needed to induce antibody titers in immunized mice equivalent to antibody titers observed in rRABV-immunized mice. Of note, only 10(3 focus forming units (ffu/mouse of rRABV-mICAM-1 was needed to induce significant anti-RABV antibody titers as early as five days post-immunization. As both speed and potency of antibody responses are important in controlling human RABV infection in a post-exposure setting, these data show that expression of Icam1 from the RABV genome, which is then incorporated into the virus particle, is a promising strategy for the development of a

  6. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  7. Complete functional rescue of the ABCA1(-/-) mouse by human BAC transgenesis

    NARCIS (Netherlands)

    Coutinho, Jonathan M.; Singaraja, Roshni R.; Kang, Martin; Arenillas, David J.; Bertram, Lisa N.; Bissada, Nagat; Staels, Bart; Fruchart, Jean-Charles; Fievet, Catherine; Joseph-George, Ann M.; Wasserman, Wyeth W.; Hayden, Michael R.

    2005-01-01

    Humanized mouse models are useful tools to explore the functional and regulatory differences between human and murine orthologous genes. We have combined a bioinformatics approach and an in vivo approach to assess the functional and regulatory differences between the human and mouse ABCA1 genes.

  8. Dose-effect relationship of apoptosis induced by fission-neutron in murine thymocytes

    International Nuclear Information System (INIS)

    Yuan Bin; Li Liang; Xue Wencheng; Sun Jianmin; Wang Baoqin

    2000-01-01

    Objective: To investigate the effectiveness of high LET fission-neutron to induce apoptosis in murine thymocytes and to compare it with that of low LET 60 Co γ-ray. Methods: Apoptosis induction was studied qualitatively by light and transmission electron microscopy and DNA gel electrophoresis,also quantitatively by flow cytometry(FCM) and diphenylamine (DPA)methods. Results: DNA ladders of murine thymocytes were detectable, the typical apoptosis of thymocytes could be observed morphologically by means of light and electron microscopy at 6 h after fission-neutron irradiation with doses ranging from 0.5 to 5.0 Gy, meanwhile the percentages of apoptosis increased with increasing doses. After exposure to γ-rays with doses ranging from 1.0 to 30 Gy, the experimental results were similar to those from neutron radiation. The incidence of apoptosis peaked at about 20 Gy, the percentages did not increase further when doses increased. Conclusion: Apoptosis of murine thymocytes can be induced when mice are exposed to either fission-neutron (0.5-5.0 Gy) or to γ-ray (1-30 Gy). Although the relationship between apoptosis and radiation doses is similar, the percentage of apoptosis induced by neutron irradiation is higher than that induced by γ-irradiation. The RBE values of fission-neutron for inducing apoptosis murine thymocytes are 2.09 (by FCM method) and 2.37 (by DPA method), respectively. These results also suggest that fission-neutron-induced murine immune tissue is more severe than that induced by γ-rays at several hours post-irradiation and this might be the basis for heavy damage to immune tissues induced by fission-neutron-irradiation in later period

  9. Characterization of the binding of radioiodinated hybrid recombinant IFN-alpha A/D to murine and human lymphoid cell lines

    International Nuclear Information System (INIS)

    Faltynek, C.R.; Princler, G.L.; Schwabe, M.; Shata, M.T.; Lewis, G.K.; Kamin-Lewis, R.M.

    1990-01-01

    The hybrid recombinant human interferon (IFN) rIFN-alpha A/D was radioiodinated. Specific binding of [125I]rIFN-alpha A/D was observed with both human and murine cell lines. The binding of [125I]rIFN-alpha A/D to human Daudi cells had similar characteristics to the previously described binding of [125I]rIFN-alpha A or -alpha 2. The following lines of evidence demonstrated that [125I]rIFN-alpha A/D bound with high affinity to the same receptor on murine cells as murine IFN-alpha and -beta: (i) the binding of [125I]rIFN-alpha A/D to murine LBRM cells was inhibited to a similar extent by natural murine IFN-alpha, natural murine IFN-beta, and rIFN-A/D; (ii) the Kd (approximately 2 X 10(-10) M) obtained from both competition experiments and saturation binding experiments with [125I]rIFN-alpha A/D was comparable to the previously reported Kd for the binding of natural murine IFN-alpha and -beta to other murine cell lines; (iii) the size of the cross-linked [125I]rIFN-alpha A/D receptor complex formed on murine LBRM cells was similar to the previously reported cross-linked complex formed after binding radioiodinated natural murine IFN-beta to other murine cell lines. Due to the current lack of readily available recombinant murine IFN-alpha or -beta for radiolabeling and the previously demonstrated biological activity of rIFN-alpha A/D on murine cells, [125I]rIFN-alpha A/D should prove to be a useful reagent for further studies of murine IFN receptors

  10. The POZ-ZF transcription factor Kaiso (ZBTB33 induces inflammation and progenitor cell differentiation in the murine intestine.

    Directory of Open Access Journals (Sweden)

    Roopali Chaudhary

    Full Text Available Since its discovery, several studies have implicated the POZ-ZF protein Kaiso in both developmental and tumorigenic processes. However, most of the information regarding Kaiso's function to date has been gleaned from studies in Xenopus laevis embryos and mammalian cultured cells. To examine Kaiso's role in a relevant, mammalian organ-specific context, we generated and characterized a Kaiso transgenic mouse expressing a murine Kaiso transgene under the control of the intestine-specific villin promoter. Kaiso transgenic mice were viable and fertile but pathological examination of the small intestine revealed distinct morphological changes. Kaiso transgenics (Kaiso(Tg/+ exhibited a crypt expansion phenotype that was accompanied by increased differentiation of epithelial progenitor cells into secretory cell lineages; this was evidenced by increased cell populations expressing Goblet, Paneth and enteroendocrine markers. Paradoxically however, enhanced differentiation in Kaiso(Tg/+ was accompanied by reduced proliferation, a phenotype reminiscent of Notch inhibition. Indeed, expression of the Notch signalling target HES-1 was decreased in Kaiso(Tg/+ animals. Finally, our Kaiso transgenics exhibited several hallmarks of inflammation, including increased neutrophil infiltration and activation, villi fusion and crypt hyperplasia. Interestingly, the Kaiso binding partner and emerging anti-inflammatory mediator p120(ctn is recruited to the nucleus in Kaiso(Tg/+ mice intestinal cells suggesting that Kaiso may elicit inflammation by antagonizing p120(ctn function.

  11. Acute administration of n-3 rich triglyceride emulsions provides cardioprotection in murine models after ischemia-reperfusion.

    Science.gov (United States)

    Zirpoli, Hylde; Abdillahi, Mariane; Quadri, Nosirudeen; Ananthakrishnan, Radha; Wang, Lingjie; Rosario, Rosa; Zhu, Zhengbin; Deckelbaum, Richard J; Ramasamy, Ravichandran

    2015-01-01

    Dietary n-3 fatty acids (FAs) may reduce cardiovascular disease risk. We questioned whether acute administration of n-3 rich triglyceride (TG) emulsions could preserve cardiac function and decrease injury after ischemia/reperfusion (I/R) insult. We used two different experimental models: in vivo, C57BL/6 mice were exposed to acute occlusion of the left anterior descending coronary artery (LAD), and ex-vivo, C57BL/6 murine hearts were perfused using Langendorff technique (LT). In the LAD model, mice treated with n-3 TG emulsion (1.5 g/kg body weight), immediately after ischemia and 1 h later during reperfusion, significantly reduced infarct size and maintained cardiac function (plevels, as a marker of injury, were significantly reduced by n-3 TG emulsion. To investigate the mechanisms by which n-3 FAs protects hearts from I/R injury, we investigated changes in key pathways linked to cardioprotection. In the ex-vivo model, we showed that n-3 FAs increased phosphorylation of AKT and GSK3β proteins (plevel and reduced an autophagy marker, Beclin-1 (pGSK3β inhibitor plus n-3 TG significantly inhibited LDH release. We conclude that acute n-3 TG injection during reperfusion provides cardioprotection. This may prove to be a novel acute adjunctive reperfusion therapy after treating patients with myocardial infarction.

  12. Dopamine inhibits lipopolysaccharide-induced nitric oxide production through the formation of dopamine quinone in murine microglia BV-2 cells

    Directory of Open Access Journals (Sweden)

    Yasuhiro Yoshioka

    2016-02-01

    Full Text Available Dopamine (DA has been suggested to modulate functions of glial cells including microglial cells. To reveal the regulatory role of DA in microglial function, in the present study, we investigated the effect of DA on lipopolysaccharide (LPS-induced nitric oxide (NO production in murine microglial cell line BV-2. Pretreatment with DA for 24 h concentration-dependently attenuated LPS-induced NO production in BV-2 cells. The inhibitory effect of DA on LPS-induced NO production was not inhibited by SCH-23390 and sulpiride, D1-like and D2-like DA receptor antagonists, respectively. In addition, pretreatment with (−-(6aR,12bR-4,6,6a,7,8,12b-Hexahydro-7-methylindolo[4,3-a]phenanthridin (CY 208–243 and bromocriptine, D1-like and D2-like DA receptor agonists, respectively, did not affect the LPS-induced NO production. N-Acetylcysteine, which inhibits DA oxidation, completely inhibited the effect of DA. Tyrosinase, which catalyzes the oxidation of DA to DA quionone (DAQ, accelerated the inhibitory effect of DA on LPS-induced NO production. These results suggest that DA attenuates LPS-induced NO production through the formation of DAQ in BV-2 cells.

  13. Tensile Mechanical Properties and Dynamic Collagen Fiber Re-Alignment of the Murine Cervix are Dramatically Altered Throughout Pregnancy.

    Science.gov (United States)

    Barnum, Carrie E; Fey, Jennifer L; Weiss, Stephanie N; Barila, Guillermo; Brown, Amy G; Connizzo, Brianne K; Shetye, Snehal S; Elovitz, Michal A; Soslowsky, Louis J

    2017-06-01

    The cervix is a unique organ able to dramatically change its shape and function by serving as a physical barrier for the growing fetus and then undergoing dramatic dilation allowing for delivery of a term infant. As a result, the cervix endures changing mechanical forces from the growing fetus. There is an emerging concept that the cervix may change or remodel "early" in many cases of spontaneous preterm birth (sPTB). However, the mechanical role of the cervix in both normal and preterm birth remains unclear. Therefore, the primary objective of this study was to determine the mechanical and structural responses of murine cervical tissue throughout a normal gestational time course. In this study, both tissue structural and material properties were determined via a quasi-static tensile load-to-failure test, while simultaneously obtaining dynamic collagen fiber re-alignment via cross-polarization imaging. This study demonstrated that the majority of the mechanical properties evaluated decreased at midgestation and not just at term, while collagen fiber re-alignment occurred earlier in the loading curve for cervices at term. This suggests that although structural changes in the cervix occur throughout gestation, the differences in material properties function in combination with collagen fiber re-alignment as mechanical precursors to regulate term gestation. This work lays a foundation for investigating cervical biomechanics and the role of the cervix in preterm birth.

  14. The Role of Tumor Protein 53 Mutations in Common Human Cancers and Targeting the Murine Double Minute 2–P53 Interaction for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Tayebeh Hamzehloie

    2012-03-01

    Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.

  15. Generation of Murine Cardiac Pacemaker Cell Aggregates Based on ES-Cell-Programming in Combination with Myh6-Promoter-Selection

    Science.gov (United States)

    Rimmbach, Christian; Jung, Julia J.; David, Robert

    2015-01-01

    Treatment of the “sick sinus syndrome” is based on artificial pacemakers. These bear hazards such as battery failure and infections. Moreover, they lack hormone responsiveness and the overall procedure is cost-intensive. “Biological pacemakers” generated from PSCs may become an alternative, yet the typical content of pacemaker cells in Embryoid Bodies (EBs) is extremely low. The described protocol combines “forward programming” of murine PSCs via the sinus node inducer TBX3 with Myh6-promoter based antibiotic selection. This yields cardiomyocyte aggregates consistent of >80% physiologically functional pacemaker cells. These “induced-sinoatrial-bodies” (“iSABs”) are spontaneously contracting at yet unreached frequencies (400-500 bpm) corresponding to nodal cells isolated from mouse hearts and are able to pace murine myocardium ex vivo. Using the described protocol highly pure sinus nodal single cells can be generated which e.g. can be used for in vitro drug testing. Furthermore, the iSABs generated according to this protocol may become a crucial step towards heart tissue engineering. PMID:25742394

  16. Trans-10, cis 12-Conjugated Linoleic Acid-Induced Milk Fat Depression Is Associated with Inhibition of PPARγ Signaling and Inflammation in Murine Mammary Tissue

    Directory of Open Access Journals (Sweden)

    Anil K. G. Kadegowda

    2013-01-01

    Full Text Available Exogenous trans-10, cis-12-CLA (CLA reduces lipid synthesis in murine adipose and mammary (MG tissues. However, genomewide alterations in MG and liver (LIV associated with dietary CLA during lactation remain unknown. We fed mice (n=5/diet control or control + trans-10, cis-12-CLA (37 mg/day between d 6 and d 10 postpartum. The 35,302 annotated murine exonic evidence-based oligo (MEEBO microarray and quantitative RT-PCR were used for transcript profiling. Milk fat concentration was 44% lower on d 10 versus d 6 due to CLA. The CLA diet resulted in differential expression of 1,496 genes. Bioinformatics analyses underscored that a major effect of CLA on MG encompassed alterations in cellular signaling pathways and phospholipid species biosynthesis. Dietary CLA induced genes related to ER stress (Xbp1, apoptosis (Bcl2, and inflammation (Orm1, Saa2, and Cp. It also induced marked inhibition of PPARγ signaling, including downregulation of Pparg and Srebf1 and several lipogenic target genes (Scd, Fasn, and Gpam. In LIV, CLA induced hepatic steatosis probably through perturbations in the mitochondrial functions and induction of ER stress. Overall, results from this study underscored the role of PPARγ signaling on mammary lipogenic target regulation. The proinflammatory effect due to CLA could be related to inhibition of PPARγ signaling.

  17. Prevention of lethal murine graft versus host disease by treatment of donor cells with L-leucyl-L-leucine methyl ester

    International Nuclear Information System (INIS)

    Charley, M.; Thiele, D.L.; Bennett, M.; Lipsky, P.E.

    1986-01-01

    Graft vs. host disease (GVHD) remains one of the main problems associated with bone marrow transplantation. The current studies were undertaken to determine whether treatment of the donor inoculum with the anticytotoxic cell compound L-leucyl-L-leucine methyl ester (Leu-Leu-OMe) would alter the development of GVHD in a murine model. Irradiated recipient mice transplanted with a mixture of control bone marrow and spleen cells from naive semiallogeneic donors died rapidly from GVHD, whereas the recipients of cells incubated with 250 microM Leu-Leu-OMe all survived. In addition, Leu-Leu-OMe treatment of cells obtained from donors immunized against host alloantigens resulted in significantly prolonged survival. Phenotypic characterization of spleen cells from the various groups of mice that had received Leu-Leu-OMe-treated cells and survived consistently revealed the donor phenotype. Treatment of marrow cells with 250 microM Leu-Leu-OMe appeared to have no adverse effects on stem cell function. Erythropoiesis was undiminished, as assayed by splenic 5-iodo-2'-deoxyuridine- 125 I uptake. Moreover, granulocytic and megakaryocytic regeneration were histologically equivalent in the spleens of recipients of control or Leu-Leu-OMe-treated cells. Treatment of the donor inoculum with Leu-Leu-OMe thus prevents GVHD in this murine strain combination with no apparent stem cell toxicity

  18. A novel role for APOBEC3: Susceptibility to sexual transmission of murine acquired immunodeficiency virus (mAIDS) is aggravated in APOBEC3 deficient mice

    Science.gov (United States)

    2012-01-01

    Background APOBEC3 proteins are host factors that restrict infection by retroviruses like HIV, MMTV, and MLV and are variably expressed in hematopoietic and non-hematopoietic cells, such as macrophages, lymphocytes, dendritic, and epithelia cells. Previously, we showed that APOBEC3 expressed in mammary epithelia cells function to limit milk-borne transmission of the beta-retrovirus, mouse mammary tumor virus. In this present study, we used APOBEC3 knockout mice and their wild type counterpart to query the role of APOBEC3 in sexual transmission of LP-BM5 MLV – the etiological agent of murine AIDs (mAIDs). Results We show that mouse APOBEC3 is expressed in murine genital tract tissues and gametes and that genital tract tissue of APOBEC3-deficient mice are more susceptible to infection by LP-BM5 virus. APOBEC3 expressed in genital tract tissues most likely plays a role in decreasing virus transmission via the sexual route, since mice deficient in APOBEC3 gene have higher genitalia and seminal plasma virus load and sexually transmit the virus more efficiently to their partners compared to APOBEC3+ mice. Moreover, we show that female mice sexually infected with LP-BM5 virus transmit the virus to their off-spring in APOBEC3-dependent manner. Conclusion Our data indicate that genital tissue intrinsic APOBEC3 restricts genital tract infection and limits sexual transmission of LP-BM5 virus. PMID:22691411

  19. A murine model for developmental dysplasia of the hip: ablation of CX3CR1 affects acetabular morphology and gait

    Directory of Open Access Journals (Sweden)

    George Feldman

    2017-11-01

    Full Text Available Abstract Background Developmental dysplasia of the hip (DDH is a debilitating condition whose distinguishing signs include incomplete formation of the acetabulum leading to dislocation of the femur, accelerated wear of the articular cartilage and joint laxity resulting in osteoarthritis. It is a complex disorder having environmental and genetic causes. Existing techniques fail to detect milder forms of DDH in newborns leading to hip osteoarthritis in young adults. A sensitive, specific and cost effective test would allow identification of newborns that could be non-invasively corrected by the use of a Pavlik harness. Previously, we identified a 2.5 MB candidate region on human chromosome 3 by using linkage analysis of a 4 generation, 72 member family. Whole exome sequencing of the DNA of 4 severely affected members revealed a single nucleotide polymorphism variant, rs3732378 co-inherited by all 11 affected family members. This variant causes a threonine to methionine amino acid change in the coding sequence of the CX3CR1 chemokine receptor and is predicted to be harmful to the function of the protein To gain further insight into the function of this mutation we examined the effect of CX3CR1 ablation on the architecture of the mouse acetabulum and on the murine gait. Methods The hips of 5 and 8 weeks old wild type and CX3CR1 KO mice were analyzed using micro-CT to measure acetabular diameter and ten additional dimensional parameters. Eight week old mice were gait tested using an inclined treadmill with and without load and then underwent micro-CT analysis. Results (1 KO mice showed larger a 5–17% larger diameter left acetabula than WT mice at both ages. (2 At 8 weeks the normalized area of space (i.e. size discrepancy between the femur head and acetabulum is significantly larger [38% (p = 0.001–21% (p = 0.037] in the KO mice. (3 At 8 weeks gait analysis of these same mice shows several metrics that are consistent with impairment in

  20. [Modern biomaterials as hemostatic dressings in kidney nephron sparing surgery (NSS)--murine model. A preliminary report].

    Science.gov (United States)

    Nowacki, Maciej; Jundziłł, Arkadiusz; Bieniek, Miłosz; Kowalczyk, Tomasz; Kloskowski, Tomasz; Drewa, Tomasz

    2012-01-01

    Kidney cancer is now days, one of the main problems in oncological urology. More frequent cases detection of this type of cancer and the implementation of modern methods of treatment, involves the public and good diagnostic radiological imaging methods. Approximately 40% of renal tumors are detected clinically as a changes in T1N0M0 stage. This means that in these patients, surgery can be performed using the method of nephron sparing surgery (NSS), far from consisting the implementation of radical nephrectomy. Unfortunately, despite the saving nature of this type of treatment, NSS methods are associated with local recurrence of tumor formation. Another problem is intra operative bleeding, that's why in order to stop this negative process surgeons currently use hemostatic dressings. Potentially and clinically significant solution could be a combination of this two main problematics points of concern, through the use of modern biomaterials coated on oncostatic substances as a haemostatic dressings, to the prevention of tumor recurrence. The aim of this work, was to present preliminary report of the use of advanced biomaterials, as haemostatic dressings in an experimental technique of nephron sparing surgery on an murine model. In the experiment we use two types of biomaterials and the standard haemostatic dressing used in the nephron sparing surgery (NSS) as a control. We use a polycaprolactone biomaterial obtained by electrospinning. As a second type of biomaterial, we use a homogeneous material with a structure similar to wool, also obtained from medical polycaprolactone by electrospinning. As an murine (in vivo) model in the study, we use 10 C57BL/J mice (with the local ethical committee permission). 8 mice were used in the present study, 2 mice were constituted as a separate control for obtaining the bleeding data. Kidney melanoma cells were implanted under the C57B1/J B16 mouse kidney fibrous capsule, one week before NSS. After 3 weeks the animals were

  1. Delayed contrast enhancement imaging of a murine model for ischemia reperfusion with carbon nanotube micro-CT.

    Directory of Open Access Journals (Sweden)

    Laurel M Burk

    Full Text Available We aim to demonstrate the application of free-breathing prospectively gated carbon nanotube (CNT micro-CT by evaluating a myocardial infarction model with a delayed contrast enhancement technique. Evaluation of murine cardiac models using micro-CT imaging has historically been limited by extreme imaging requirements. Newly-developed CNT-based x-ray sources offer precise temporal resolution, allowing elimination of physiological motion through prospective gating. Using free-breathing, cardiac-gated CNT micro-CT, a myocardial infarction model can be studied non-invasively and with high resolution. Myocardial infarction was induced in eight male C57BL/6 mice aged 8-12 weeks. The ischemia reperfusion model was achieved by surgically occluding the LAD artery for 30 minutes followed by 24 hours of reperfusion. Tail vein catheters were placed for contrast administration. Iohexol 300 mgI/mL was administered followed by images obtained in diastole. Iodinated lipid blood pool contrast agent was then administered, followed with images at systole and diastole. Respiratory and cardiac signals were monitored externally and used to gate the scans of free-breathing subjects. Seven control animals were scanned using the same imaging protocol. After imaging, the heart was harvested, cut into 1mm slices and stained with TTC. Post-processing analysis was performed using ITK-Snap and MATLAB. All animals demonstrated obvious delayed contrast enhancement in the left ventricular wall following the Iohexol injection. The blood pool contrast agent revealed significant changes in cardiac function quantified by 3-D volume ejection fractions. All subjects demonstrated areas of myocardial infarct in the LAD distribution on both TTC staining and micro-CT imaging. The CNT micro-CT system aids straightforward, free-breathing, prospectively-gated 3-D murine cardiac imaging. Delayed contrast enhancement allows identification of infarcted myocardium after a myocardial ischemic

  2. Metformin therapy in a hyperandrogenic anovulatory mutant murine model with polycystic ovarian syndrome characteristics improves oocyte maturity during superovulation

    Directory of Open Access Journals (Sweden)

    Sabatini Mary E

    2011-05-01

    Full Text Available Abstract Background Metformin, an oral biguanide traditionally used for the treatment of type 2 diabetes, is widely used for the management of polycystic ovary syndrome (PCOS-related anovulation. Because of the significant prevalence of insulin resistance and glucose intolerance in PCOS patients, and their putative role in ovulatory dysfunction, the use of metformin was touted as a means to improve ovulatory function and reproductive outcomes in PCOS patients. To date, there has been inconsistent evidence to demonstrate a favorable effect of metformin on oocyte quality and competence in women with PCOS. Given the heterogeneous nature of this disorder, we hypothesized that metformin may be beneficial in mice with aberrant metabolic characteristics similar to a significant number of PCOS patients. The aim of this study was to gain insight into the in vitro and in vivo effects of metformin on oocyte development and ovulatory function. Methods We utilized metformin treatment in the transgenic ob/ob and db/db mutant murine models which demonstrate metabolic and reproductive characteristics similar to women with PCOS. Results: Metformin did not improve in vitro oocyte maturation nor did it have an appreciable effect on in vitro granulosa cell luteinization (progesterone production in any genotype studied. Although both mutant strains have evidence of hyperandrogenemia, anovulation, and hyperinsulinemia, only db/db mice treated with metformin had a greater number of mature oocytes and total overall oocytes compared to control. There was no observed impact on body mass, or serum glucose and androgens in any genotype. Conclusions Our data provide evidence to suggest that metformin may optimize ovulatory performance in mice with a specific reproductive and metabolic phenotype shared by women with PCOS. The only obvious difference between the mutant murine models is that the db/db mice have elevated leptin levels raising the questions of whether their

  3. Lineage-specific responses of tooth shape in murine rodents (murinae, rodentia) to late Miocene dietary change in the Siwaliks of Pakistan.

    Science.gov (United States)

    Kimura, Yuri; Jacobs, Louis L; Flynn, Lawrence J

    2013-01-01

    Past ecological responses of mammals to climate change are recognized in the fossil record by adaptive significance of morphological variations. To understand the role of dietary behavior on functional adaptations of dental morphology in rodent evolution, we examine evolutionary change of tooth shape in late Miocene Siwalik murine rodents, which experienced a dietary shift toward C4 diets during late Miocene ecological change indicated by carbon isotopic evidence. Geometric morphometric analysis in the outline of upper first molars captures dichotomous lineages of Siwalik murines, in agreement with phylogenetic hypotheses of previous studies (two distinct clades: the Karnimata and Progonomys clades), and indicates lineage-specific functional responses to mechanical properties of their diets. Tooth shapes of the two clades are similar at their sympatric origin but deviate from each other with decreasing overlap through time. Shape change in the Karnimata clade is associated with greater efficiency of propalinal chewing for tough diets than in the Progonomys clade. Larger body mass in Karnimata may be related to exploitation of lower-quality food items, such as grasses, than in smaller-bodied Progonomys. The functional and ecophysiological aspects of Karnimata exploiting C4 grasses are concordant with their isotopic dietary preference relative to Progonomys. Lineage-specific selection was differentially greater in Karnimata, and a faster rate of shape change toward derived Karnimata facilitated inclusion of C4 grasses in the diet. Sympatric speciation in these clades is most plausibly explained by interspecific competition on resource utilization between the two, based on comparisons of our results with the carbon isotope data. Interspecific competition with Karnimata may have suppressed morphological innovation of the Progonomys clade. Pairwise analyses of morphological and carbon isotope data can uncover ecological causes of sympatric speciation and define

  4. Lineage-specific responses of tooth shape in murine rodents (murinae, rodentia to late Miocene dietary change in the Siwaliks of Pakistan.

    Directory of Open Access Journals (Sweden)

    Yuri Kimura

    Full Text Available Past ecological responses of mammals to climate change are recognized in the fossil record by adaptive significance of morphological variations. To understand the role of dietary behavior on functional adaptations of dental morphology in rodent evolution, we examine evolutionary change of tooth shape in late Miocene Siwalik murine rodents, which experienced a dietary shift toward C4 diets during late Miocene ecological change indicated by carbon isotopic evidence. Geometric morphometric analysis in the outline of upper first molars captures dichotomous lineages of Siwalik murines, in agreement with phylogenetic hypotheses of previous studies (two distinct clades: the Karnimata and Progonomys clades, and indicates lineage-specific functional responses to mechanical properties of their diets. Tooth shapes of the two clades are similar at their sympatric origin but deviate from each other with decreasing overlap through time. Shape change in the Karnimata clade is associated with greater efficiency of propalinal chewing for tough diets than in the Progonomys clade. Larger body mass in Karnimata may be related to exploitation of lower-quality food items, such as grasses, than in smaller-bodied Progonomys. The functional and ecophysiological aspects of Karnimata exploiting C4 grasses are concordant with their isotopic dietary preference relative to Progonomys. Lineage-specific selection was differentially greater in Karnimata, and a faster rate of shape change toward derived Karnimata facilitated inclusion of C4 grasses in the diet. Sympatric speciation in these clades is most plausibly explained by interspecific competition on resource utilization between the two, based on comparisons of our results with the carbon isotope data. Interspecific competition with Karnimata may have suppressed morphological innovation of the Progonomys clade. Pairwise analyses of morphological and carbon isotope data can uncover ecological causes of sympatric speciation

  5. Atomic structure of the murine norovirus protruding domain and sCD300lf receptor complex.

    Science.gov (United States)

    Kilic, Turgay; Koromyslova, Anna; Malak, Virginie; Hansman, Grant S

    2018-03-21

    Human noroviruses are the leading cause of acute gastroenteritis in human. Noroviruses also infect animals such as cow, mice, cat, and dog. How noroviruses bind and enter host cells is still incompletely understood. Recently, the type I transmembrane protein CD300lf was recently identified as the murine norovirus receptor, yet it is unclear how the virus capsid and receptor interact at the molecular level. In this study, we determined the X-ray crystal structure of the soluble CD300lf (sCD300lf) and murine norovirus capsid-protruding domain complex at 2.05 Å resolution. We found that the sCD300lf binding site is located on the topside of the protruding domain and involves a network of hydrophilic and hydrophobic interactions. The sCD300lf locked nicely into a complementary cavity on the protruding domain that is additionally coordinated with a positive surface charge on the sCD300lf and a negative surface charge on the protruding domain. Five of six protruding domain residues interacting with sCD300lf were maintained between different murine norovirus strains, suggesting that the sCD300lf was capable of binding to a highly conserved pocket. Moreover, a sequence alignment with other CD300 paralogs showed that the sCD300lf interacting residues were partially conserved in CD300ld, but variable in other CD300 family members, consistent with previously reported infection selectivity. Overall, these data provide insights into how a norovirus engages a protein receptor and will be important for a better understanding of selective recognition and norovirus attachment and entry mechanisms. IMPORTANCE Noroviruses exhibit exquisite host-range specificity due to species-specific interactions between the norovirus capsid protein and host molecules. Given this strict host-range restriction it has been unclear how the viruses are maintained within a species between relatively sporadic epidemics. While much data demonstrates that noroviruses can interact with carbohydrates

  6. Efficacy of paracetamol on patent ductus arteriosus closure may be dose dependent: evidence from human and murine studies.

    LENUS (Irish Health Repository)

    El-Khuffash, Afif

    2014-09-01

    We evaluated the clinical effectiveness of variable courses of paracetamol on patent ductus arteriosus (PDA) closure and examined its effect on the in vitro term and preterm murine ductus arteriosus (DA).

  7. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Science.gov (United States)

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J.; Lemmermann, Niels A. W.

    2013-01-01

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q), we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1γ complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1γ interface. PMID:24351798

  8. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Directory of Open Access Journals (Sweden)

    Annette Fink

    2013-12-01

    Full Text Available The MHC-class I (MHC-I-like viral (MHC-Iv m152 gene product of murine cytomegalovirus (mCMV was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q, we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1g complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1g interface.

  9. Distinct signalling pathways of murine histamine H1- and H4-receptors expressed at comparable levels in HEK293 cells.<