WorldWideScience

Sample records for function regulate epidermal

  1. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  2. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure.

    Science.gov (United States)

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-10-23

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.

  3. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure

    OpenAIRE

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-01-01

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...

  4. The DAF-16/FOXO transcription factor functions as a regulator of epidermal innate immunity.

    Science.gov (United States)

    Zou, Cheng-Gang; Tu, Qiu; Niu, Jie; Ji, Xing-Lai; Zhang, Ke-Qin

    2013-01-01

    The Caenorhabditis elegans DAF-16 transcription factor is critical for diverse biological processes, particularly longevity and stress resistance. Disruption of the DAF-2 signaling cascade promotes DAF-16 activation, and confers resistance to killing by pathogenic bacteria, such as Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis. However, daf-16 mutants exhibit similar sensitivity to these bacteria as wild-type animals, suggesting that DAF-16 is not normally activated by these bacterial pathogens. In this report, we demonstrate that DAF-16 can be directly activated by fungal infection and wounding in wild-type animals, which is independent of the DAF-2 pathway. Fungal infection and wounding initiate the Gαq signaling cascade, leading to Ca(2+) release. Ca(2+) mediates the activation of BLI-3, a dual-oxidase, resulting in the production of reactive oxygen species (ROS). ROS then activate DAF-16 through a Ste20-like kinase-1/CST-1. Our results indicate that DAF-16 in the epidermis is required for survival after fungal infection and wounding. Thus, the EGL-30-Ca(2+)-BLI-3-CST-1-DAF-16 signaling represents a previously unknown pathway to regulate epidermal damage response.

  5. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  6. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  7. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  8. Phosphorylation of Rac1 T108 by Extracellular Signal-Regulated Kinase in Response to Epidermal Growth Factor: a Novel Mechanism To Regulate Rac1 Function

    Science.gov (United States)

    Tong, Junfeng; Li, Laiji; Ballermann, Barbara

    2013-01-01

    Accumulating evidence has implicated Rho GTPases, including Rac1, in many aspects of cancer development. Recent findings suggest that phosphorylation might further contribute to the tight regulation of Rho GTPases. Interestingly, sequence analysis of Rac1 shows that Rac1 T108 within the 106PNTP109 motif is likely an extracellular signal-regulated kinase (ERK) phosphorylation site and that Rac1 also has an ERK docking site, 183KKRKRKCLLL192 (D site), at the C terminus. Indeed, we show here that both transfected and endogenous Rac1 interacts with ERK and that this interaction is mediated by its D site. Green fluorescent protein (GFP)-Rac1 is threonine (T) phosphorylated in response to epidermal growth factor (EGF), and EGF-induced Rac1 threonine phosphorylation is dependent on the activation of ERK. Moreover, mutant Rac1 with the mutation of T108 to alanine (A) is not threonine phosphorylated in response to EGF. In vitro ERK kinase assay further shows that pure active ERK phosphorylates purified Rac1 but not mutant Rac1 T108A. We also show that Rac1 T108 phosphorylation decreases Rac1 activity, partially due to inhibiting its interaction with phospholipase C-γ1 (PLC-γ1). T108 phosphorylation targets Rac1 to the nucleus, which isolates Rac1 from other guanine nucleotide exchange factors (GEFs) and hinders Rac1's role in cell migration. We conclude that Rac1 T108 is phosphorylated by ERK in response to EGF, which plays an important role in regulating Rac1. PMID:24043306

  9. The role of CYP11A1 in the production of vitamin D metabolites and their role in the regulation of epidermal functions

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Li, Wei; Yi, Ae-Kyung; Postlethwaite, Arnold; Tuckey, Robert C.

    2014-01-01

    Research over the last decade has revealed that CYP11A1 can hydroxylate the side chain of vitamin D3 at carbons 17, 20, 22 and 23 to produce at least 10 metabolites, with 20(OH)D3, 20,23(OH)2D3, 20,22(OH)2D3, 17,20(OH)2D3 and 17,20,23(OH)3D3 being the main products. However, CYP11A1 does not act on 25(OH)D3. The placenta, adrenal glands and epidermal keratinocytes have been shown to metabolize vitamin D3 via this CYP11A1-mediated pathway that is modified by the activity of CYP27B1, with 20(OH)D3 (the major metabolite), 20,23(OH)2D3, 1,20(OH)2D3, 1,20,23(OH)3D3 and 17,20,23(OH)3D3 being detected, defining these secosteroids as endogenous regulators/natural products. This is supported by the detection of a mono-hydroxyvitamin D3 with the retention time of 20(OH)D3 in human serum. In new work presented here we demonstrate that the CYP11A1-initiated pathways also occurs in Caco-2 colon cells. Our previous studies show that 20(OH)D3 and 20,23(OH)2D3 are non-calcemic at pharmacological doses, dependent in part on their lack of a C1α hydroxyl group. In epidermal keratinocytes, 20(OH)D3, 20(OH)D2 and 20,23(OH)2D3 inhibited cell proliferation, stimulated differentiation and inhibited NF-κB activity with potencies comparable to 1,25(OH)2D3, acting as partial agonists on the VDR. 22(OH)D3 and 20,22(OH)2D3, as well as secosteroids with a short or no side chain, showed antiproliferative and prodifferentiation effects, however, with lower potency than 20(OH)D3 and 20,23(OH)2D3. The CYP11A1-derived secosteroids also inhibited melanocyte proliferation while having no effect on melano-genesis, and showed anti-melanoma activities in terms of inhibiting proliferation and the ability to grow in soft agar. Furthermore, 20(OH)D3 and 20,23(OH)2D3 showed anti-fibrosing effects in vitro, and also in vivo for the former. New data presented here shows that 20(OH)D3 inhibits LPS-induced production of TNFα in the J774 line, TNFα and IL-6 in peritoneal macrophages and suppresses the

  10. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  11. Neural cell adhesion molecule-180-mediated homophilic binding induces epidermal growth factor receptor (EGFR) down-regulation and uncouples the inhibitory function of EGFR in neurite outgrowth

    DEFF Research Database (Denmark)

    Povlsen, Gro Klitgaard; Berezin, Vladimir; Bock, Elisabeth

    2008-01-01

    The neural cell adhesion molecule (NCAM) plays important roles in neuronal development, regeneration, and synaptic plasticity. NCAM homophilic binding mediates cell adhesion and induces intracellular signals, in which the fibroblast growth factor receptor plays a prominent role. Recent studies...... this NCAM-180-induced EGFR down-regulation involves increased EGFR ubiquitination and lysosomal EGFR degradation. Furthermore, NCAM-180-mediated EGFR down-regulation requires NCAM homophilic binding and interactions of the cytoplasmic domain of NCAM-180 with intracellular interaction partners, but does...

  12. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

  13. Functional and structural stability of the epidermal growth factor receptor in detergent micelles and phospholipid nanodiscs

    DEFF Research Database (Denmark)

    Mi, Li-Zhi; Grey, Michael J; Nishida, Noritaka

    2008-01-01

    Cellular signaling mediated by the epidermal growth factor receptor (EGFR or ErbB) family of receptor tyrosine kinases plays an important role in regulating normal and oncogenic cellular physiology. While structures of isolated EGFR extracellular domains and intracellular protein tyrosine kinase...... differential functional stability in Triton X-100 versus dodecyl maltoside. Furthermore, the kinase activity can be significantly stabilized by reconstituting purified EGF-bound EGFR dimers in phospholipid nanodiscs or vesicles, suggesting that the environment around the hydrophobic transmembrane...

  14. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  15. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  16. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  17. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  18. Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.

    Science.gov (United States)

    Tsai, Chang-Ru; Anderson, Aimee E; Burra, Sirisha; Jo, Juyeon; Galko, Michael J

    2017-07-01

    Yorkie (Yki), the transcriptional co-activator of the Hippo signaling pathway, has well-characterized roles in balancing apoptosis and cell division during organ growth control. Yki is also required in diverse tissue regenerative contexts. In most cases this requirement reflects its well-characterized roles in balancing apoptosis and cell division. Whether Yki has repair functions outside of the control of cell proliferation, death, and growth is not clear. Here we show that Yki and Scalloped (Sd) are required for epidermal wound closure in the Drosophila larval epidermis. Using a GFP-tagged Yki transgene we show that Yki transiently translocates to some epidermal nuclei upon wounding. Genetic analysis strongly suggests that Yki interacts with the known wound healing pathway, Jun N-terminal kinase (JNK), but not with Platelet Derived Growth Factor/Vascular-Endothelial Growth Factor receptor (Pvr). Yki likely acts downstream of or parallel to JNK signaling and does not appear to regulate either proliferation or apoptosis in the larval epidermis during wound repair. Analysis of actin structures after wounding suggests that Yki and Sd promote wound closure through actin regulation. In sum, we found that Yki regulates an epithelial tissue repair process independently of its previously documented roles in balancing proliferation and apoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Palmitoylation regulates epidermal homeostasis and hair follicle differentiation.

    Directory of Open Access Journals (Sweden)

    Pleasantine Mill

    2009-11-01

    Full Text Available Palmitoylation is a key post-translational modification mediated by a family of DHHC-containing palmitoyl acyl-transferases (PATs. Unlike other lipid modifications, palmitoylation is reversible and thus often regulates dynamic protein interactions. We find that the mouse hair loss mutant, depilated, (dep is due to a single amino acid deletion in the PAT, Zdhhc21, resulting in protein mislocalization and loss of palmitoylation activity. We examined expression of Zdhhc21 protein in skin and find it restricted to specific hair lineages. Loss of Zdhhc21 function results in delayed hair shaft differentiation, at the site of expression of the gene, but also leads to hyperplasia of the interfollicular epidermis (IFE and sebaceous glands, distant from the expression site. The specific delay in follicle differentiation is associated with attenuated anagen propagation and is reflected by decreased levels of Lef1, nuclear beta-catenin, and Foxn1 in hair shaft progenitors. In the thickened basal compartment of mutant IFE, phospho-ERK and cell proliferation are increased, suggesting increased signaling through EGFR or integrin-related receptors, with a parallel reduction in expression of the key differentiation factor Gata3. We show that the Src-family kinase, Fyn, involved in keratinocyte differentiation, is a direct palmitoylation target of Zdhhc21 and is mislocalized in mutant follicles. This study is the first to demonstrate a key role for palmitoylation in regulating developmental signals in mammalian tissue homeostasis.

  20. Epidermal Expression and Regulation of Interleukin-33 during Homeostasis and Inflammation: Strong Species Differences.

    Science.gov (United States)

    Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis

    2015-07-01

    IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.

  1. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  3. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  4. Epidermal growth factor regulates apoptosis and oxidative stress in a rat model of spinal cord injury.

    Science.gov (United States)

    Ozturk, Anil Murat; Sozbilen, Murat Celal; Sevgili, Elvin; Dagci, Taner; Özyalcin, Halit; Armagan, Guliz

    2018-03-22

    Spinal cord injury (SCI) leads to vascular damage and disruption of blood-spinal cord barrier which participates in secondary nerve injury. Epidermal growth factor (EGF) is an endogenous protein which regulates cell proliferation, growth and differention. Previous studies reported that EGF exerts neuroprotective effect in spinal cord after SCI. However, the molecular mechanisms underlying EGF-mediated protection in different regions of nervous system have not shown yet. In this study, we aimed to examine possible anti-apoptotic and protective roles of EGF not only in spinal cord but also in brain following SCI. Twenty-eight adult rats were divided into four groups of seven animals each as follows: sham, trauma (SCI), SCI + EGF and SCI + methylprednisolone (MP) groups. The functional neurological deficits due to the SCI were assessed by behavioral analysis using the Basso, Beattie and Bresnahan (BBB) open-field locomotor test. The alterations in pro-/anti-apoptotic protein levels and antioxidant enzyme activities were measured in spinal cord and frontal cortex. In our study, EGF promoted locomotor recovery and motor neuron survival of SCI rats. EGF treatment significantly decreased Bax and increased Bcl-2 protein expressions both in spinal cord and brain when compared to SCI group. Moreover, antioxidant enzyme activities including catalase, superoxide dismutase (SOD) and glutathione peroxidase (GPx) were increased following EGF treatment similar to MP treatment. Our experiment also suggests that alteration of the ratio of Bcl-2 to Bax may result from decreased apoptosis following EGF treatment. As a conclusion, these results show, for the first time, that administration of EGF exerts its protection via regulating apoptotic and oxidative pathways in response to spinal cord injury in different regions of central nervous system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  6. Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism

    International Nuclear Information System (INIS)

    He, D.; Lim, H.W.

    1991-01-01

    This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes

  7. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  8. Regulation of the ligand-dependent activation of the epidermal growth factor receptor by calmodulin

    DEFF Research Database (Denmark)

    Li, Hongbing; Panina, Svetlana; Kaur, Amandeep

    2012-01-01

    Calmodulin (CaM) is the major component of calcium signaling pathways mediating the action of various effectors. Transient increases in the intracellular calcium level triggered by a variety of stimuli lead to the formation of Ca2+/CaM complexes, which interact with and activate target proteins....... In the present study the role of Ca2+/CaM in the regulation of the ligand-dependent activation of the epidermal growth factor receptor (EGFR) has been examined in living cells. We show that addition of different cell permeable CaM antagonists to cultured cells or loading cells with a Ca2+ chelator inhibited...

  9. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  10. Abnormalities of lymphocyte function and phenotypic pattern in a case of toxic epidermal necrolysis

    DEFF Research Database (Denmark)

    Hagdrup, H; Tønnesen, E; Clemmensen, O

    1992-01-01

    We examined the blood lymphocyte function and phenotypic pattern in a patient with toxic epidermal necrolysis after taking salazopyrin. We studied cell surface markers, natural killer cell activity and mitogen-induced lymphocyte transformation. Our results point to temporary immunosuppression...... as evidenced by lymphopenia with a large "null cell" population, reduced natural killer cell activity, and impaired lymphocyte response to mitogens....

  11. Nuclear functions and subcellular trafficking mechanisms of the epidermal growth factor receptor family

    Science.gov (United States)

    2012-01-01

    Accumulating evidence suggests that various diseases, including many types of cancer, result from alteration of subcellular protein localization and compartmentalization. Therefore, it is worthwhile to expand our knowledge in subcellular trafficking of proteins, such as epidermal growth factor receptor (EGFR) and ErbB-2 of the receptor tyrosine kinases, which are highly expressed and activated in human malignancies and frequently correlated with poor prognosis. The well-characterized trafficking of cell surface EGFR is routed, via endocytosis and endosomal sorting, to either the lysosomes for degradation or back to the plasma membrane for recycling. A novel nuclear mode of EGFR signaling pathway has been gradually deciphered in which EGFR is shuttled from the cell surface to the nucleus after endocytosis, and there, it acts as a transcriptional regulator, transmits signals, and is involved in multiple biological functions, including cell proliferation, tumor progression, DNA repair and replication, and chemo- and radio-resistance. Internalized EGFR can also be transported from the cell surface to several intracellular compartments, such as the Golgi apparatus, the endoplasmic reticulum, and the mitochondria, in addition to the nucleus. In this review, we will summarize the functions of nuclear EGFR family and the potential pathways by which EGFR is trafficked from the cell surface to a variety of cellular organelles. A better understanding of the molecular mechanism of EGFR trafficking will shed light on both the receptor biology and potential therapeutic targets of anti-EGFR therapies for clinical application. PMID:22520625

  12. Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

    2010-07-20

    The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

  13. Optimal experimental design in an epidermal growth factor receptor signalling and down-regulation model.

    Science.gov (United States)

    Casey, F P; Baird, D; Feng, Q; Gutenkunst, R N; Waterfall, J J; Myers, C R; Brown, K S; Cerione, R A; Sethna, J P

    2007-05-01

    We apply the methods of optimal experimental design to a differential equation model for epidermal growth factor receptor signalling, trafficking and down-regulation. The model incorporates the role of a recently discovered protein complex made up of the E3 ubiquitin ligase, Cbl, the guanine exchange factor (GEF), Cool-1 (beta -Pix) and the Rho family G protein Cdc42. The complex has been suggested to be important in disrupting receptor down-regulation. We demonstrate that the model interactions can accurately reproduce the experimental observations, that they can be used to make predictions with accompanying uncertainties, and that we can apply ideas of optimal experimental design to suggest new experiments that reduce the uncertainty on unmeasurable components of the system.

  14. Ontogeny and function of murine epidermal Langerhans cells.

    Science.gov (United States)

    Kaplan, Daniel H

    2017-09-19

    Langerhans cells (LCs) are epidermis-resident antigen-presenting cells that share a common ontogeny with macrophages but function as dendritic cells (DCs). Their development, recruitment and retention in the epidermis is orchestrated by interactions with keratinocytes through multiple mechanisms. LC and dermal DC subsets often show functional redundancy, but LCs are required for specific types of adaptive immune responses when antigen is concentrated in the epidermis. This Review will focus on those developmental and functional properties that are unique to LCs.

  15. Using scale and feather traits for module construction provides a functional approach to chicken epidermal development.

    Science.gov (United States)

    Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H

    2017-11-01

    Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.

  16. Regulated functions and integrability

    Directory of Open Access Journals (Sweden)

    Ján Gunčaga

    2009-04-01

    Full Text Available Properties of functions defined on a bounded closed interval, weaker than continuity, have been considered by many mathematicians. Functions having both sides limits at each point are called regulated and were considered by J. Dieudonné [2], D. Fraňková [3] and others (see for example S. Banach [1], S. Saks [8]. The main class of functions we deal with consists of piece-wise constant ones. These functions play a fundamental role in the integration theory which had been developed by Igor Kluvanek (see Š. Tkacik [9]. We present an outline of this theory.

  17. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  18. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  19. Andrographolide regulates epidermal growth factor receptor and transferrin receptor trafficking in epidermoid carcinoma (A-431) cells

    Science.gov (United States)

    Tan, Y; Chiow, KH; Huang, D; Wong, SH

    2010-01-01

    Background and purpose: Andrographolide is the active component of Andrographis paniculata, a plant used in both Indian and Chinese traditional medicine, and it has been demonstrated to induce apoptosis in different cancer cell lines. However, not much is known about how it may affect the key receptors implicated in cancer. Knowledge of how andrographolide affects receptor trafficking will allow us to better understand new mechanisms by which andrographolide may cause death in cancer cells. Experimental approach: We utilized the well-characterized epidermal growth factor receptor (EGFR) and transferrin receptor (TfR) expressed in epidermoid carcinoma (A-431) cells as a model to study the effect of andrographolide on receptor trafficking. Receptor distribution, the total number of receptors and surface receptors were analysed by immunofluorescence, Western blot as well as flow-cytometry respectively. Key results: Andrographolide treatment inhibited cell growth, down-regulated EGFRs on the cell surface and affected the degradation of EGFRs and TfRs. The EGFR was internalized into the cell at an increased rate, and accumulated in a compartment that co-localizes with the lysosomal-associated membrane protein in the late endosomes. Conclusion and implications: This study sheds light on how andrographolide may affect receptor trafficking by inhibiting receptor movement from the late endosomes to lysosomes. The down-regulation of EGFR from the cell surface also indicates a new mechanism by which andrographolide may induce cancer cell death. PMID:20233216

  20. Thyroid hormone regulation of epidermal growth factor receptor levels in mouse mammary glands

    International Nuclear Information System (INIS)

    Vonderhaar, B.K.; Tang, E.; Lyster, R.R.; Nascimento, M.C.

    1986-01-01

    The specific binding of iodinated epidermal growth factor ([ 125 I]iodo-EGF) to membranes prepared from the mammary glands and spontaneous breast tumors of euthyroid and hypothyroid mice was measured in order to determine whether thyroid hormones regulate the EGF receptor levels in vivo. Membranes from hypothyroid mammary glands of mice at various developmental ages bound 50-65% less EGF than those of age-matched euthyroid controls. Treatment of hypothyroid mice with L-T4 before killing restored binding to the euthyroid control level. Spontaneous breast tumors arising in hypothyroid mice also bound 30-40% less EGF than tumors from euthyroid animals even after in vitro desaturation of the membranes of endogenous growth factors with 3 M MgCl2 treatment. The decrease in binding in hypothyroid membranes was due to a decrease in the number of binding sites, not to a change in affinity of the growth factor for its receptor, as determined by Scatchard analysis of the binding data. Both euthyroid and hypothyroid membranes bound EGF primarily to a single class of high affinity sites [dissociation constant (Kd) = 0.7-1.8 nM]. Euthyroid membranes bound 28.4 +/- (SE) 0.6 fmol/mg protein, whereas hypothyroid membranes bound 15.5 +/- 1.0 fmol/mg protein. These data indicate that EGF receptor levels in normal mammary glands and spontaneous breast tumors in mice are subject to regulation by thyroid status

  1. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  2. αPIX Is a Trafficking Regulator that Balances Recycling and Degradation of the Epidermal Growth Factor Receptor.

    Directory of Open Access Journals (Sweden)

    Fanny Kortüm

    Full Text Available Endosomal sorting is an essential control mechanism for signaling through the epidermal growth factor receptor (EGFR. We report here that the guanine nucleotide exchange factor αPIX, which modulates the activity of Rho-GTPases, is a potent bimodal regulator of EGFR trafficking. αPIX interacts with the E3 ubiquitin ligase c-Cbl, an enzyme that attaches ubiquitin to EGFR, thereby labelling this tyrosine kinase receptor for lysosomal degradation. We show that EGF stimulation induces αPIX::c-Cbl complex formation. Simultaneously, αPIX and c-Cbl protein levels decrease, which depends on both αPIX binding to c-Cbl and c-Cbl ubiquitin ligase activity. Through interaction αPIX sequesters c-Cbl from EGFR and this results in reduced EGFR ubiquitination and decreased EGFR degradation upon EGF treatment. However, quantitatively more decisive for cellular EGFR distribution than impaired EGFR degradation is a strong stimulating effect of αPIX on EGFR recycling to the cell surface. This function depends on the GIT binding domain of αPIX but not on interaction with c-Cbl or αPIX exchange activity. In summary, our data demonstrate a previously unappreciated function of αPIX as a strong promoter of EGFR recycling. We suggest that the novel recycling regulator αPIX and the degradation factor c-Cbl closely cooperate in the regulation of EGFR trafficking: uncomplexed αPIX and c-Cbl mediate a positive and a negative feedback on EGFR signaling, respectively; αPIX::c-Cbl complex formation, however, results in mutual inhibition, which may reflect a stable condition in the homeostasis of EGF-induced signal flow.

  3. Dynein and EFF-1 control dendrite morphology by regulating the localization pattern of SAX-7 in epidermal cells.

    Science.gov (United States)

    Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang

    2017-12-01

    Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.

  4. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  5. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (danio rerio.

    Directory of Open Access Journals (Sweden)

    Shelly Abad Cruz

    Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.

  6. Regulators of floral fragrance production and their target genes in petunia are not exclusively active in the epidermal cells of petals.

    Science.gov (United States)

    Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C

    2012-05-01

    In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.

  7. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  8. Murine epidermal Langerhans cells and langerin-expressing dermal dendritic cells are unrelated and exhibit distinct functions

    NARCIS (Netherlands)

    Nagao, Keisuke; Ginhoux, Florent; Leitner, Wolfgang W.; Motegi, Sei-Ichiro; Bennett, Clare L.; Clausen, Björn E.; Merad, Miriam; Udey, Mark C.

    2009-01-01

    A new langerin(+) DC subset has recently been identified in murine dermis (langerin(+) dDC), but the lineage and functional relationships between these cells and langerin(+) epidermal Langerhans cells (LC) are incompletely characterized. Selective expression of the cell adhesion molecule EpCAM by LC

  9. Ticagrelor Improves Endothelial Function by Decreasing Circulating Epidermal Growth Factor (EGF

    Directory of Open Access Journals (Sweden)

    Francesco Vieceli Dalla Sega

    2018-04-01

    Full Text Available Ticagrelor is one of the most powerful P2Y12 inhibitor. We have recently reported that, in patients with concomitant Stable Coronary Artery Disease (SCAD and Chronic Obstructive Pulmonary Disease (COPD undergoing percutaneous coronary intervention (PCI, treatment with ticagrelor, as compared to clopidogrel, is associated with an improvement of the endothelial function (Clinical Trial NCT02519608. In the present study, we showed that, in the same population, after 1 month treatment with ticagrelor, but not with clopidogrel, there is a decrease of the circulating levels of epidermal growth factor (EGF and that these changes in circulating levels of EGF correlate with on-treatment platelet reactivity. Furthermore, in human umbilical vein endothelial cells (HUVEC incubated with sera of the patients treated with ticagrelor, but not with clopidogrel there is an increase of p-eNOS levels. Finally, analyzing the changes in EGF and p-eNOS levels after treatment, we observed an inverse correlation between p-eNOS and EGF changes only in the ticagrelor group. Causality between EGF and eNOS activation was assessed in vitro in HUVEC where we showed that EGF decreases eNOS activity in a dose dependent manner. Taken together our data indicate that ticagrelor improves endothelial function by lowering circulating EGF that results in the activation of eNOS in the vascular endothelium.

  10. Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

    Science.gov (United States)

    Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2013-12-01

    The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration.

    Science.gov (United States)

    Bögel, Gábor; Gujdár, Annamária; Geiszt, Miklós; Lányi, Árpád; Fekete, Anna; Sipeki, Szabolcs; Downward, Julian; Buday, László

    2012-09-07

    Mutations in the SH3PXD2B gene coding for the Tks4 protein are responsible for the autosomal recessive Frank-ter Haar syndrome. Tks4, a substrate of Src tyrosine kinase, is implicated in the regulation of podosome formation. Here, we report a novel role for Tks4 in the EGF signaling pathway. In EGF-treated cells, Tks4 is tyrosine-phosphorylated and associated with the activated EGF receptor. This association is not direct but requires the presence of Src tyrosine kinase. In addition, treatment of cells with LY294002, an inhibitor of PI 3-kinase, or mutations of the PX domain reduces tyrosine phosphorylation and membrane translocation of Tks4. Furthermore, a PX domain mutant (R43W) Tks4 carrying a reported point mutation in a Frank-ter Haar syndrome patient showed aberrant intracellular expression and reduced phosphoinositide binding. Finally, silencing of Tks4 was shown to markedly inhibit HeLa cell migration in a Boyden chamber assay in response to EGF or serum. Our results therefore reveal a new function for Tks4 in the regulation of growth factor-dependent cell migration.

  12. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  13. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  14. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  15. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  16. CD147, CD44, and the epidermal growth factor receptor (EGFR) signaling pathway cooperate to regulate breast epithelial cell invasiveness.

    Science.gov (United States)

    Grass, G Daniel; Tolliver, Lauren B; Bratoeva, Momka; Toole, Bryan P

    2013-09-06

    The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777-788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer.

  17. CD147, CD44, and the Epidermal Growth Factor Receptor (EGFR) Signaling Pathway Cooperate to Regulate Breast Epithelial Cell Invasiveness*

    Science.gov (United States)

    Grass, G. Daniel; Tolliver, Lauren B.; Bratoeva, Momka; Toole, Bryan P.

    2013-01-01

    The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777–788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer. PMID:23888049

  18. Epidermal growth factor receptor (EGFR) and EGFR mutations, function and possible role in clinical trials

    DEFF Research Database (Denmark)

    Voldborg, B R; Damstrup, L; Spang-Thomsen, M

    1997-01-01

    The epidermal growth factor receptor (EGFR) is a growth factor receptor that induces cell differentiation and proliferation upon activation through the binding of one of its ligands. The receptor is located at the cell surface, where the binding of a ligand activates a tyrosine kinase in the intr...... aspects of therapeutic targeting of EGFR....

  19. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  20. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P

    1991-01-01

    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  1. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.

    2005-10-01

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  2. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  3. Epidermal growth factor receptor mediated proliferation depends on increased lipid droplet density regulated via a negative regulatory loop with FOXO3/Sirtuin6

    International Nuclear Information System (INIS)

    Penrose, Harrison; Heller, Sandra; Cable, Chloe; Makboul, Rania; Chadalawada, Gita; Chen, Ying; Crawford, Susan E.; Savkovic, Suzana D.

    2016-01-01

    The proliferation of colon cancer cells is mediated in part by epidermal growth factor receptor (EGFR) signaling and requires sustained levels of cellular energy to meet its high metabolic needs. Intracellular lipid droplets (LDs) are a source of energy used for various cellular functions and they are elevated in density in human cancer, yet their regulation and function are not well understood. Here, in human colon cancer cells, EGF stimulates increases in LD density, which depends on EGFR expression and activation as well as the individual cellular capacity for lipid synthesis. Increases in LDs are blockaded by inhibition of PI3K/mTOR and PGE2 synthesis, supporting their dependency on select upstream pathways. In colon cancer cells, silencing of the FOXO3 transcription factor leads to down regulation of SIRT6, a negative regulator of lipid synthesis, and consequent increases in the LD coat protein PLIN2, revealing that increases in LDs depend on loss of FOXO3/SIRT6. Moreover, EGF stimulates loss of FOXO3/SIRT6, which is blockaded by the inhibition of upstream pathways as well as lipid synthesis, revealing existence of a negative regulatory loop between LDs and FOXO3/SIRT6. Elevated LDs are utilized by EGF treatment and their depletion through the inhibition of lipid synthesis or silencing of PLIN2 significantly attenuates proliferation. This novel mechanism of proliferative EGFR signaling leading to elevated LD density in colon cancer cells could potentially be therapeutically targeted for the treatment of tumor progression. - Highlights: • In colon cancer cells, EGFR activation leads to increases in LD density. • EGFR signaling includes PI3K/mTOR and PGE2 leading to lipid synthesis. • Increases in LDs are controlled by a negative regulatory loop with FOXO3/SIRT6. • EGFR mediated colon cancer cell proliferation depends on increased LD density.

  4. Epidermal growth factor receptor mediated proliferation depends on increased lipid droplet density regulated via a negative regulatory loop with FOXO3/Sirtuin6

    Energy Technology Data Exchange (ETDEWEB)

    Penrose, Harrison; Heller, Sandra; Cable, Chloe [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Makboul, Rania [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Pathology Department, Assiut University, Assiut (Egypt); Chadalawada, Gita; Chen, Ying [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Crawford, Susan E. [Department of Pathology, Saint Louis University School of Medicine, 1402 South Grand Blvd, Saint Louis, MO 63104 (United States); Savkovic, Suzana D., E-mail: ssavkovi@tulane.edu [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States)

    2016-01-15

    The proliferation of colon cancer cells is mediated in part by epidermal growth factor receptor (EGFR) signaling and requires sustained levels of cellular energy to meet its high metabolic needs. Intracellular lipid droplets (LDs) are a source of energy used for various cellular functions and they are elevated in density in human cancer, yet their regulation and function are not well understood. Here, in human colon cancer cells, EGF stimulates increases in LD density, which depends on EGFR expression and activation as well as the individual cellular capacity for lipid synthesis. Increases in LDs are blockaded by inhibition of PI3K/mTOR and PGE2 synthesis, supporting their dependency on select upstream pathways. In colon cancer cells, silencing of the FOXO3 transcription factor leads to down regulation of SIRT6, a negative regulator of lipid synthesis, and consequent increases in the LD coat protein PLIN2, revealing that increases in LDs depend on loss of FOXO3/SIRT6. Moreover, EGF stimulates loss of FOXO3/SIRT6, which is blockaded by the inhibition of upstream pathways as well as lipid synthesis, revealing existence of a negative regulatory loop between LDs and FOXO3/SIRT6. Elevated LDs are utilized by EGF treatment and their depletion through the inhibition of lipid synthesis or silencing of PLIN2 significantly attenuates proliferation. This novel mechanism of proliferative EGFR signaling leading to elevated LD density in colon cancer cells could potentially be therapeutically targeted for the treatment of tumor progression. - Highlights: • In colon cancer cells, EGFR activation leads to increases in LD density. • EGFR signaling includes PI3K/mTOR and PGE2 leading to lipid synthesis. • Increases in LDs are controlled by a negative regulatory loop with FOXO3/SIRT6. • EGFR mediated colon cancer cell proliferation depends on increased LD density.

  5. An epidermal microRNA regulates neuronal migration through control of the cellular glycosylation state

    DEFF Research Database (Denmark)

    Pedersen, Mikael Egebjerg; Snieckute, Goda; Kagias, Konstantinos

    2013-01-01

    An appropriate balance in glycosylation of proteoglycans is crucial for their ability to regulate animal development. Here, we report that the Caenorhabditis elegans microRNA mir-79, an ortholog of mammalian miR-9, controls sugar-chain homeostasis by targeting two proteins in the proteoglycan bio...... that impinges on a LON-2/glypican pathway and disrupts neuronal migration. Our results identify a regulatory axis controlled by a conserved microRNA that maintains proteoglycan homeostasis in cells....

  6. PDK1 Is a Regulator of Epidermal Differentiation that Activates and Organizes Asymmetric Cell Division

    Directory of Open Access Journals (Sweden)

    Teruki Dainichi

    2016-05-01

    Full Text Available Asymmetric cell division (ACD in a perpendicular orientation promotes cell differentiation and organizes the stratified epithelium. However, the upstream cues regulating ACD have not been identified. Here, we report that phosphoinositide-dependent kinase 1 (PDK1 plays a critical role in establishing ACD in the epithelium. Production of phosphatidyl inositol triphosphate (PIP3 is localized to the apical side of basal cells. Asymmetric recruitment of atypical protein kinase C (aPKC and partitioning defective (PAR 3 is impaired in PDK1 conditional knockout (CKO epidermis. PDK1CKO keratinocytes do not undergo calcium-induced activation of aPKC or IGF1-induced activation of AKT and fail to differentiate. PDK1CKO epidermis shows decreased expression of Notch, a downstream effector of ACD, and restoration of Notch rescues defective expression of differentiation-induced Notch targets in vitro. We therefore propose that PDK1 signaling regulates the basal-to-suprabasal switch in developing epidermis by acting as both an activator and organizer of ACD and the Notch-dependent differentiation program.

  7. Epidermal growth factor-containing fibulin-like extracellular matrix protein 1 expression and regulation in uterine leiomyoma.

    Science.gov (United States)

    Marsh, Erica E; Chibber, Shani; Wu, Ju; Siegersma, Kendra; Kim, Julie; Bulun, Serdar

    2016-04-01

    To determine the presence, differential expression, and regulation of epidermal growth factor-containing fibulin-like extracellular matrix protein 1 (EFEMP1) in uterine leiomyomas. Laboratory in vivo and in vitro study with the use of human leiomyoma and myometrial tissue and primary cells. Academic medical center. Leiomyoma and myometrial tissue samples and cultured cells. 5-Aza-2'-deoxycytidine (5-aza-dC) treatment. Fold-change difference between EFEMP1 and fibulin-3 expression in leiomyoma tissue and cells compared with matched myometrial samples, and fold-change difference in EFEMP1 expression with 5-Aza-dC treatment. In vivo, EFEMP1 expression was 3.19-fold higher in myometrial tissue than in leiomyoma tissue. EFEMP1 expression in vitro was 5.03-fold higher in myometrial cells than in leiomyoma cells. Western blot and immunohistochemistry staining of tissue and cells confirmed similar findings in protein expression. Treatment of leiomyoma cells with 5-Aza-dC resulted in increased expression of EFEMP1 in vitro. The EFEMP1 gene and its protein product, fibulin-3, are both significantly down-regulated in leiomyoma compared with myometrium when studied both in vivo and in vitro. The increase in EFEMP1 expression in leiomyoma cells with 5-Aza-dC treatment suggest that differential methylation is responsible, in part, for the differences seen in gene expression. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  8. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

    Science.gov (United States)

    Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

    2018-02-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Regulation of epidermal growth factor receptor signaling and erlotinib sensitivity in head and neck cancer cells by miR-7.

    Directory of Open Access Journals (Sweden)

    Felicity C Kalinowski

    Full Text Available Elevated expression and activity of the epidermal growth factor receptor (EGFR/protein kinase B (Akt signaling pathway is associated with development, progression and treatment resistance of head and neck cancer (HNC. Several studies have demonstrated that microRNA-7 (miR-7 regulates EGFR expression and Akt activity in a range of cancer cell types via its specific interaction with the EGFR mRNA 3'-untranslated region (3'-UTR. In the present study, we found that miR-7 regulated EGFR expression and Akt activity in HNC cell lines, and that this was associated with reduced growth in vitro and in vivo of cells (HN5 that were sensitive to the EGFR tyrosine kinase inhibitor (TKI erlotinib (Tarceva. miR-7 acted synergistically with erlotinib to inhibit growth of erlotinib-resistant FaDu cells, an effect associated with increased inhibition of Akt activity. Microarray analysis of HN5 and FaDu cell lines transfected with miR-7 identified a common set of downregulated miR-7 target genes, providing insight into the tumor suppressor function of miR-7. Furthermore, we identified several target miR-7 mRNAs with a putative role in the sensitization of FaDu cells to erlotinib. Together, these data support the coordinate regulation of Akt signaling by miR-7 in HNC cells and suggest the therapeutic potential of miR-7 alone or in combination with EGFR TKIs in this disease.

  10. Lasp-1 regulates podosome function.

    Directory of Open Access Journals (Sweden)

    Miriam Stölting

    Full Text Available Eukaryotic cells form a variety of adhesive structures to connect with their environment and to regulate cell motility. In contrast to classical focal adhesions, podosomes, highly dynamic structures of different cell types, are actively engaged in matrix remodelling and degradation. Podosomes are composed of an actin-rich core region surrounded by a ring-like structure containing signalling molecules, motor proteins as well as cytoskeleton-associated proteins. Lasp-1 is a ubiquitously expressed, actin-binding protein that is known to regulate cytoskeleton architecture and cell migration. This multidomain protein is predominantely present at focal adhesions, however, a second pool of Lasp-1 molecules is also found at lamellipodia and vesicle-like microdomains in the cytosol.In this report, we show that Lasp-1 is a novel component and regulator of podosomes. Immunofluorescence studies reveal a localization of Lasp-1 in the podosome ring structure, where it colocalizes with zyxin and vinculin. Life cell imaging experiments demonstrate that Lasp-1 is recruited in early steps of podosome assembly. A siRNA-mediated Lasp-1 knockdown in human macrophages affects podosome dynamics as well as their matrix degradation capacity. In summary, our data indicate that Lasp-1 is a novel component of podosomes and is involved in the regulation of podosomal function.

  11. Redox Regulation of Mitochondrial Function

    Science.gov (United States)

    Handy, Diane E.

    2012-01-01

    Abstract Redox-dependent processes influence most cellular functions, such as differentiation, proliferation, and apoptosis. Mitochondria are at the center of these processes, as mitochondria both generate reactive oxygen species (ROS) that drive redox-sensitive events and respond to ROS-mediated changes in the cellular redox state. In this review, we examine the regulation of cellular ROS, their modes of production and removal, and the redox-sensitive targets that are modified by their flux. In particular, we focus on the actions of redox-sensitive targets that alter mitochondrial function and the role of these redox modifications on metabolism, mitochondrial biogenesis, receptor-mediated signaling, and apoptotic pathways. We also consider the role of mitochondria in modulating these pathways, and discuss how redox-dependent events may contribute to pathobiology by altering mitochondrial function. Antioxid. Redox Signal. 16, 1323–1367. PMID:22146081

  12. Internalization and down-regulation of the human epidermal growth factor receptor are regulated by the carboxyl-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Beguinot, L

    1991-01-01

    with receptors in which 1, 2, or all 3 tyrosines were changed to phenylalanines. The triple point mutant EGF-R, expressed in NIH-3T3, exhibited low autophosphorylation in vivo, low biological and reduced kinase activities. Single and double point mutants were down-regulated, as well as wild type EGF......-R in response to EGF showing a half-life of about 1 h. Degradation of the triple point mutant, however, was impaired and resulted in a half-life of 4 h in the presence of EGF. EGF-dependent down-regulation of surface receptors was decreased in the triple point mutant EGF-R as was internalization and degradation...... of EGF. The specific rate of internalization of the triple point mutant was reduced. By contrast, intracellular processing of ligand previously internalized at 20 degrees C was similar between wild type and mutant receptors. Taken together the data indicate that the delay in degradation observed in cells...

  13. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  15. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  16. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  17. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  18. Blockade of epidermal growth factor receptors chemosensitizes breast cancer cells through up-regulation of Bnip3L

    NARCIS (Netherlands)

    Real, PJ; Benito, A; Cuevas, J; Berciano, MT; de Juan, A; Coffer, P; Gomez-Roman, J; Lafarga, M; Lopez-Vega, JM; Fernandez-Luna, JL

    2005-01-01

    Epidermal growth factor receptor-1 (EGFR) and EGFR-2 (HER2) have become major targets for cancer treatment. Blocking antibodies and small-molecule inhibitors are being used to silence the activity of these receptors in different tumors with varying efficacy. Thus, a better knowledge on the signaling

  19. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Phosphorylation regulates SIRT1 function.

    Directory of Open Access Journals (Sweden)

    Tsutomu Sasaki

    Full Text Available BACKGROUND: SIR2 is an NAD(+-dependent deacetylase [1]-[3] implicated in the regulation of lifespan in species as diverse as yeast [4], worms [5], and flies [6]. We previously reported that the level of SIRT1, the mammalian homologue of SIR2 [7], [8], is coupled to the level of mitotic activity in cells both in vitro and in vivo[9]. Cells from long-lived mice maintained SIRT1 levels of young mice in tissues that undergo continuous cell replacement by proliferating stem cells. Changes in SIRT1 protein level were not associated with changes in mRNA level, suggesting that SIRT1 could be regulated post-transcriptionally. However, other than a recent report on sumoylation [10] and identification of SIRT1 as a nuclear phospho-protein by mass spectrometry [11], post-translational modifications of this important protein have not been reported. METHODOLOGY/PRINCIPAL FINDINGS: We identified 13 residues in SIRT1 that are phosphorylated in vivo using mass spectrometry. Dephosphorylation by phosphatases in vitro resulted in decreased NAD(+-dependent deacetylase activity. We identified cyclinB/Cdk1 as a cell cycle-dependent kinase that forms a complex with and phosphorylates SIRT1. Mutation of two residues phosphorylated by Cyclin B/Cdk1 (threonine 530 and serine 540 disturbs normal cell cycle progression and fails to rescue proliferation defects in SIRT1-deficient cells [12], [13]. CONCLUSIONS/SIGNIFICANCE: Pharmacological manipulation of SIRT1 activity is currently being tested as a means of extending lifespan in mammals. Treatment of obese mice with resveratrol, a pharmacological activator of SIRT1, modestly but significantly improved longevity and, perhaps more importantly, offered some protection against the development of type 2 diabetes mellitus and metabolic syndrome [14]-[16]. Understanding the endogenous mechanisms that regulate the level and activity of SIRT1, therefore, has obvious relevance to human health and disease. Our results identify

  1. Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

    Science.gov (United States)

    Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

    2011-09-01

    Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

  2. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  3. Epigenetic regulation of macrophage function

    NARCIS (Netherlands)

    Hoeksema, M.A.

    2016-01-01

    Atherosclerosis is a lipid-driven chronic inflammatory disorder with a key role for macrophages in all disease stages. Macrophages are involved as scavengers of lipids, regulate inflammation, attract other immune cells and contribute to the resolution of inflammation, fibrosis and plaque stability.

  4. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  5. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  6. Calcium-dependent depletion zones in the cortical microtubule array coincide with sites of, but do not regulate, wall ingrowth papillae deposition in epidermal transfer cells

    Science.gov (United States)

    Zhang, Hui-ming; Talbot, Mark J.; McCurdy, David W.; Patrick, John W.; Offler, Christina E.

    2015-01-01

    Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca2+ levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane–microtubule inter-relationship is discussed. PMID:26136268

  7. Epigenetic Regulation of Monocyte and Macrophage Function

    NARCIS (Netherlands)

    Hoeksema, Marten A.; de Winther, Menno P. J.

    2016-01-01

    Monocytes and macrophages are key players in tissue homeostasis and immune responses. Epigenetic processes tightly regulate cellular functioning in health and disease. Recent Advances: Recent technical developments have allowed detailed characterizations of the transcriptional circuitry underlying

  8. Executive functions and self-regulation.

    Science.gov (United States)

    Hofmann, Wilhelm; Schmeichel, Brandon J; Baddeley, Alan D

    2012-03-01

    Self-regulation is a core aspect of adaptive human behavior that has been studied, largely in parallel, through the lenses of social and personality psychology as well as cognitive psychology. Here, we argue for more communication between these disciplines and highlight recent research that speaks to their connection. We outline how basic facets of executive functioning (working memory operations, behavioral inhibition, and task-switching) may subserve successful self-regulation. We also argue that temporary reductions in executive functions underlie many of the situational risk factors identified in the social psychological research on self-regulation and review recent evidence that the training of executive functions holds significant potential for improving poor self-regulation in problem populations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  10. Calcium-dependent depletion zones in the cortical microtubule array coincide with sites of, but do not regulate, wall ingrowth papillae deposition in epidermal transfer cells.

    Science.gov (United States)

    Zhang, Hui-ming; Talbot, Mark J; McCurdy, David W; Patrick, John W; Offler, Christina E

    2015-09-01

    Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca(2+) levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane-microtubule inter-relationship is discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  11. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  12. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Directory of Open Access Journals (Sweden)

    David Judah

    Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  13. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Science.gov (United States)

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  14. Essential function of linoleic acid esterified in acylglucosylceramide and acylceramide in maintaining the epidermal water permeability barrier. Evidence from feeding studies with oleate, linoleate, arachidonate, columbinate and a-linolenate

    DEFF Research Database (Denmark)

    Hansen, Harald S.; Jensen, B.

    1985-01-01

    sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...

  15. Lipids in the cell: organisation regulates function.

    Science.gov (United States)

    Santos, Ana L; Preta, Giulio

    2018-06-01

    Lipids are fundamental building blocks of all cells and play important roles in the pathogenesis of different diseases, including inflammation, autoimmune disease, cancer, and neurodegeneration. The lipid composition of different organelles can vary substantially from cell to cell, but increasing evidence demonstrates that lipids become organised specifically in each compartment, and this organisation is essential for regulating cell function. For example, lipid microdomains in the plasma membrane, known as lipid rafts, are platforms for concentrating protein receptors and can influence intra-cellular signalling. Lipid organisation is tightly regulated and can be observed across different model organisms, including bacteria, yeast, Drosophila, and Caenorhabditis elegans, suggesting that lipid organisation is evolutionarily conserved. In this review, we summarise the importance and function of specific lipid domains in main cellular organelles and discuss recent advances that investigate how these specific and highly regulated structures contribute to diverse biological processes.

  16. The SRC homology 2 domain of Rin1 mediates its binding to the epidermal growth factor receptor and regulates receptor endocytosis.

    Science.gov (United States)

    Barbieri, M Alejandro; Kong, Chen; Chen, Pin-I; Horazdovsky, Bruce F; Stahl, Philip D

    2003-08-22

    Activated epidermal growth factor receptors (EGFRs) recruit intracellular proteins that mediate receptor signaling and endocytic trafficking. Rin1, a multifunctional protein, has been shown to regulate EGFR internalization (1). Here we show that EGF stimulation induces a specific, rapid, and transient membrane recruitment of Rin1 and that recruitment is dependent on the Src homology 2 (SH2) domain of Rin1. Immunoprecipitation of EGFR is accompanied by co-immunoprecipitation of Rin1 in a time- and ligand-dependent manner. Association of Rin1 and specifically the SH2 domain of Rin1 with the EGFR was dependent on tyrosine phosphorylation of the intracellular domain of the EGFR. The recruitment of Rin1, observed by light microscopy, indicated that although initially cytosolic, Rin1 was recruited to both plasma membrane and endosomes following EGF addition. Moreover, the expression of the SH2 domain of Rin1 substantially impaired the internalization of EGF without affecting internalization of transferrin. Finally, we found that Rin1 co-immunoprecipitated with a number of tyrosine kinase receptors but not with cargo endocytic receptors. These results indicate that Rin1 provides a link via its SH2 domain between activated tyrosine kinase receptors and the endocytic pathway through the recruitment and activation of Rab5a.

  17. Transmembrane signalling at the epidermal growth factor receptor. Positive regulation by the C-terminal phosphotyrosine residues

    DEFF Research Database (Denmark)

    Magni, M; Pandiella, A; Helin, K

    1991-01-01

    a positive role in the regulation of transmembrane signalling at the EGF receptor. The stepwise decrease in signal generation observed in single, double and triple point mutants suggest that the role of phosphotyrosine residues is not in the participation in specific amino acid sequences, but rather...... in the double and the triple mutants. In the latter mutant, expression of the EGF-receptor-activated lipolytic enzyme phospholipase C gamma was unchanged, whereas its tyrosine phosphorylation induced by the growth factor was lowered to approx. 25% of that in the controls. In all of the cell clones employed......, the accumulation of inositol phosphates induced by treatment with fetal calf serum varied only slightly, whereas the same effect induced by EGF was consistently lowered in those lines expressing mutated receptors. This decrease was moderate for those receptors missing only the distal tyrosine (point and deletion...

  18. Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is increased in osteoarthritis and regulates chondrocyte catabolic and anabolic activities

    Science.gov (United States)

    Long, D.L.; Ulici, V.; Chubinskaya, S.; Loeser, R.F.

    2015-01-01

    Objective We determined if the epidermal growth factor receptor ligand HB-EGF is produced in cartilage and if it regulates chondrocyte anabolic or catabolic activity. Methods HB-EGF expression was measured by quantitative PCR using RNA isolated from mouse knee joint tissues and from normal and OA human chondrocytes. Immunohistochemistry was performed on normal and OA human cartilage and meniscus sections. Cultured chondrocytes were treated with fibronectin fragments (FN-f) as a catabolic stimulus and osteogenic protein 1 (OP-1) as an anabolic stimulus. Effects of HB-EGF on cell signaling were analyzed by immunoblotting of selected signaling proteins. MMP-13 was measured in conditioned media, proteoglycan synthesis was measured by sulfate incorporation, and matrix gene expression by quantitative PCR. Results HB-EGF expression was increased in 12-month old mice at 8 weeks after surgery to induce OA and increased amounts of HB-EGF were noted in human articular cartilage from OA knees. FN-f stimulated chondrocyte HB-EGF expression and HB-EGF stimulated chondrocyte MMP-13 production. However, HB-EGF was not required for FN-f stimulation of MMP-13 production. HB-EGF activated the ERK and p38 MAP kinases and stimulated phosphorylation of Smad1 at an inhibitory serine site which was associated with inhibition of OP-1 mediated proteoglycan synthesis and reduced aggrecan (ACAN) but not COL2A1 expression. Conclusion HB-EGF is a new factor identified in OA cartilage that promotes chondrocyte catabolic activity while inhibiting anabolic activity suggesting it could contribute to the catabolic-anabolic imbalance seen in OA cartilage. PMID:25937027

  19. Regulation of satellite cell function in sarcopenia

    Directory of Open Access Journals (Sweden)

    Stephen E Alway

    2014-09-01

    Full Text Available The mechanisms contributing to sarcopenia include reduced satellite cell (myogenic stem cell function that is impacted by the environment (niche of these cells. Satellite cell function is affected by oxidative stress, which is elevated in aged muscles, and this along with changes in largely unknown systemic factors, likely contribute to the manner in which satellite cells respond to stressors such as exercise, disuse or rehabilitation in sarcopenic muscles. Nutritional intervention provides one therapeutic strategy to improve the satellite cell niche and systemic factors, with the goal of improving satellite cell function in aging muscles. Although many elderly persons consume various nutraceuticals with the hope of improving health, most of these compounds have not been thoroughly tested, and the impacts that they might have on sarcopenia, and satellite cell function are not clear. This review discusses data pertaining to the satellite cell responses and function in aging skeletal muscle, and the impact that three compounds: resveratrol, green tea catechins and β-Hydroxy-β-methylbutyrate have on regulating satellite cell function and therefore contributing to reducing sarcopenia or improving muscle mass after disuse in aging. The data suggest that these nutraceutical compounds improve satellite cell function during rehabilitative loading in animal models of aging after disuse (i.e., muscle regeneration. While these compounds have not been rigorously tested in humans, the data from animal models of aging provide a strong basis for conducting additional focused work to determine if these or other nutraceuticals can offset the muscle losses, or improve regeneration in sarcopenic muscles of older humans via improving satellite cell function.

  20. Regulation of Satellite Cell Function in Sarcopenia

    Science.gov (United States)

    Alway, Stephen E.; Myers, Matthew J.; Mohamed, Junaith S.

    2014-01-01

    The mechanisms contributing to sarcopenia include reduced satellite cell (myogenic stem cell) function that is impacted by the environment (niche) of these cells. Satellite cell function is affected by oxidative stress, which is elevated in aged muscles, and this along with changes in largely unknown systemic factors, likely contribute to the manner in which satellite cells respond to stressors such as exercise, disuse, or rehabilitation in sarcopenic muscles. Nutritional intervention provides one therapeutic strategy to improve the satellite cell niche and systemic factors, with the goal of improving satellite cell function in aging muscles. Although many elderly persons consume various nutraceuticals with the hope of improving health, most of these compounds have not been thoroughly tested, and the impacts that they might have on sarcopenia and satellite cell function are not clear. This review discusses data pertaining to the satellite cell responses and function in aging skeletal muscle, and the impact that three compounds: resveratrol, green tea catechins, and β-Hydroxy-β-methylbutyrate have on regulating satellite cell function and therefore contributing to reducing sarcopenia or improving muscle mass after disuse in aging. The data suggest that these nutraceutical compounds improve satellite cell function during rehabilitative loading in animal models of aging after disuse (i.e., muscle regeneration). While these compounds have not been rigorously tested in humans, the data from animal models of aging provide a strong basis for conducting additional focused work to determine if these or other nutraceuticals can offset the muscle losses, or improve regeneration in sarcopenic muscles of older humans via improving satellite cell function. PMID:25295003

  1. Regulators of floral fragrance production and their target genes in petunia are not exclusively active in the epidermal cells of petals.

    NARCIS (Netherlands)

    Van Moerkercke, A.; Galván-Ampudia, C.S.; Verdonk, J.C.; Haring, M.A.; Schuurink, R.C.

    2012-01-01

    In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds

  2. Identification of Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function

    Science.gov (United States)

    2017-09-01

    Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function September 2017 x 1Sep2016...31Aug2017 Email: mbirrer@partners.org 6 Identification of Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function xx

  3. Peptide regulators of peripheral taste function.

    Science.gov (United States)

    Dotson, Cedrick D; Geraedts, Maartje C P; Munger, Steven D

    2013-03-01

    The peripheral sensory organ of the gustatory system, the taste bud, contains a heterogeneous collection of sensory cells. These taste cells can differ in the stimuli to which they respond and the receptors and other signaling molecules they employ to transduce and encode those stimuli. This molecular diversity extends to the expression of a varied repertoire of bioactive peptides that appear to play important functional roles in signaling taste information between the taste cells and afferent sensory nerves and/or in processing sensory signals within the taste bud itself. Here, we review studies that examine the expression of bioactive peptides in the taste bud and the impact of those peptides on taste functions. Many of these peptides produced in taste buds are known to affect appetite, satiety or metabolism through their actions in the brain, pancreas and other organs, suggesting a functional link between the gustatory system and the neural and endocrine systems that regulate feeding and nutrient utilization. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P

    2015-03-01

    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  5. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET.

    Science.gov (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A

    2014-01-01

    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  6. Epidermal growth factor regulation of glutathione S-transferase gene expression in the rat is mediated by class Pi glutathione S-transferase enhancer I.

    OpenAIRE

    Matsumoto, M; Imagawa, M; Aoki, Y

    2000-01-01

    Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did no...

  7. Dendritic Actin Cytoskeleton: Structure, Functions, and Regulations

    Directory of Open Access Journals (Sweden)

    Anja Konietzny

    2017-05-01

    Full Text Available Actin is a versatile and ubiquitous cytoskeletal protein that plays a major role in both the establishment and the maintenance of neuronal polarity. For a long time, the most prominent roles that were attributed to actin in neurons were the movement of growth cones, polarized cargo sorting at the axon initial segment, and the dynamic plasticity of dendritic spines, since those compartments contain large accumulations of actin filaments (F-actin that can be readily visualized using electron- and fluorescence microscopy. With the development of super-resolution microscopy in the past few years, previously unknown structures of the actin cytoskeleton have been uncovered: a periodic lattice consisting of actin and spectrin seems to pervade not only the whole axon, but also dendrites and even the necks of dendritic spines. Apart from that striking feature, patches of F-actin and deep actin filament bundles have been described along the lengths of neurites. So far, research has been focused on the specific roles of actin in the axon, while it is becoming more and more apparent that in the dendrite, actin is not only confined to dendritic spines, but serves many additional and important functions. In this review, we focus on recent developments regarding the role of actin in dendrite morphology, the regulation of actin dynamics by internal and external factors, and the role of F-actin in dendritic protein trafficking.

  8. Functional Role of Milk Fat Globule-Epidermal Growth Factor VIII in Macrophage-Mediated Inflammatory Responses and Inflammatory/Autoimmune Diseases

    Directory of Open Access Journals (Sweden)

    Young-Su Yi

    2016-01-01

    Full Text Available Inflammation involves a series of complex biological processes mediated by innate immunity for host defense against pathogen infection. Chronic inflammation is considered to be one of the major causes of serious diseases, including a number of autoimmune/inflammatory diseases, cancers, cardiovascular diseases, and neurological diseases. Milk fat globule-epidermal growth factor 8 (MFG-E8 is a secreted protein found in vertebrates and was initially discovered as a critical component of the milk fat globule. Previously, a number of studies have reported that MFG-E8 contributes to various biological functions including the phagocytic removal of damaged and apoptotic cells from tissues, the induction of VEGF-mediated neovascularization, the maintenance of intestinal epithelial homeostasis, and the promotion of mucosal healing. Recently, emerging studies have reported that MFG-E8 plays a role in inflammatory responses and inflammatory/autoimmune diseases. This review describes the characteristics of MFG-E8-mediated signaling pathways, summarizes recent findings supporting the roles of MFG-E8 in inflammatory responses and inflammatory/autoimmune diseases, and discusses MFG-E8 targeting as a potential therapeutic strategy for the development of anti-inflammatory/autoimmune disease drugs.

  9. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Directory of Open Access Journals (Sweden)

    Delfina Costa

    2018-05-01

    Full Text Available Mesenchymal stromal cells (MSC present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF] can exert immunosuppressive effects on T and natural killer (NK lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16. In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR; thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy.

  10. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Science.gov (United States)

    Costa, Delfina; Venè, Roberta; Benelli, Roberto; Romairone, Emanuele; Scabini, Stefano; Catellani, Silvia; Rebesco, Barbara; Mastracci, Luca; Grillo, Federica; Minghelli, Simona; Loiacono, Fabrizio; Zocchi, Maria Raffaella; Poggi, Alessandro

    2018-01-01

    Mesenchymal stromal cells (MSC) present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF)] can exert immunosuppressive effects on T and natural killer (NK) lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC) and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16). In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR); thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF) of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy. PMID:29910806

  11. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  12. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis

    DEFF Research Database (Denmark)

    List, Karin; Haudenschild, Christian C; Szabo, Roman

    2002-01-01

    of Matriptase/MT-SP1 also seriously affected hair follicle development resulting in generalized follicular hypoplasia, absence of erupted vibrissae, lack of vibrissal hair canal formation, ingrown vibrissae, and wholesale abortion of vibrissal follicles. Furthermore, Matriptase/MT-SP1-deficiency resulted...... in dramatically increased thymocyte apoptosis, and depletion of thymocytes. This study demonstrates that Matriptase/MT-SP1 has pleiotropic functions in the development of the epidermis, hair follicles, and cellular immune system....

  15. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  16. Topiramate improves neurovascular function, epidermal nerve fiber morphology, and metabolism in patients with type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Boyd A

    2010-12-01

    Full Text Available Amanda L Boyd, Patricia M Barlow, Gary L Pittenger, Kathryn F Simmons, Aaron I VinikDepartment of Internal Medicine, Eastern Virginia Medical School, Norfolk, VA, USAPurpose: To assess the effects of topiramate on C-fiber function, nerve fiber morphology, and metabolism (including insulin sensitivity, obesity, and dyslipidemia in type 2 diabetes.Patients and methods: We conducted an 18-week, open-label trial treating patients with topiramate. Twenty subjects with type 2 diabetes and neuropathy (61.5 ± 1.29 years; 15 male, 5 female were enrolled and completed the trial. Neuropathy was evaluated by total neuropathy scores, nerve conduction studies, quantitative sensory tests, laser Doppler skin blood flow, and intraepidermal nerve fibers in skin biopsies.Results: Topiramate treatment improved symptoms compatible with C-fiber dysfunction. Weight, blood pressure, and hemoglobin A1c also improved. Laser Doppler skin blood flow improved significantly after 12 weeks of treatment, but returned to baseline at 18 weeks. After 18 weeks of treatment there was a significant increase in intraepidermal nerve fiber length at the forearm, thigh, and proximal leg. Intraepidermal nerve fiber density was significantly increased by topiramate in the proximal leg.Conclusion: This study is the first to demonstrate that it is possible to induce skin intraepidermal nerve fiber regeneration accompanied by enhancement of neurovascular function, translating into improved symptoms as well as sensory nerve function. The simultaneous improvement of selective metabolic indices may play a role in this effect, but this remains to be determined.Keywords: diabetic neuropathy, skin blood flow, skin biopsy, diabetes

  17. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

    DEFF Research Database (Denmark)

    Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

    2006-01-01

    most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

  18. A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

    Science.gov (United States)

    Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

    2015-08-01

    The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

  19. Matrix regulators in neural stem cell functions.

    Science.gov (United States)

    Wade, Anna; McKinney, Andrew; Phillips, Joanna J

    2014-08-01

    Neural stem/progenitor cells (NSPCs) reside within a complex and dynamic extracellular microenvironment, or niche. This niche regulates fundamental aspects of their behavior during normal neural development and repair. Precise yet dynamic regulation of NSPC self-renewal, migration, and differentiation is critical and must persist over the life of an organism. In this review, we summarize some of the major components of the NSPC niche and provide examples of how cues from the extracellular matrix regulate NSPC behaviors. We use proteoglycans to illustrate the many diverse roles of the niche in providing temporal and spatial regulation of cellular behavior. The NSPC niche is comprised of multiple components that include; soluble ligands, such as growth factors, morphogens, chemokines, and neurotransmitters, the extracellular matrix, and cellular components. As illustrated by proteoglycans, a major component of the extracellular matrix, the NSPC, niche provides temporal and spatial regulation of NSPC behaviors. The factors that control NSPC behavior are vital to understand as we attempt to modulate normal neural development and repair. Furthermore, an improved understanding of how these factors regulate cell proliferation, migration, and differentiation, crucial for malignancy, may reveal novel anti-tumor strategies. This article is part of a Special Issue entitled Matrix-mediated cell behaviour and properties. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. A role for calcium in the regulation of ATP-binding cassette, sub-family C, member 3 (ABCC3) gene expression in a model of epidermal growth factor-mediated breast cancer epithelial-mesenchymal transition.

    Science.gov (United States)

    Stewart, Teneale A; Azimi, Iman; Thompson, Erik W; Roberts-Thomson, Sarah J; Monteith, Gregory R

    2015-03-13

    Epithelial-mesenchymal transition (EMT), a process implicated in cancer metastasis, is associated with the transcriptional regulation of members of the ATP-binding cassette superfamily of efflux pumps, and drug resistance in breast cancer cells. Epidermal growth factor (EGF)-induced EMT in MDA-MB-468 breast cancer cells is calcium signal dependent. In this study induction of EMT was shown to result in the transcriptional up-regulation of ATP-binding cassette, subfamily C, member 3 (ABCC3), a member of the ABC transporter superfamily, which has a recognized role in multidrug resistance. Buffering of cytosolic free calcium inhibited EGF-mediated ABCC3 increases, indicating a calcium-dependent mode of regulation. Silencing of TRPM7 (an ion channel involved in EMT associated vimentin induction) did not inhibit ABCC3 up-regulation. Silencing of the store operated calcium entry (SOCE) pathway components ORAI1 and STIM1 also did not alter ABCC3 induction by EGF. However, the calcium permeable ion channel transient receptor potential cation channel, subfamily C, member 1 (TRPC1) appears to contribute to the regulation of both basal and EGF-induced ABCC3 mRNA. Improved understanding of the relationship between calcium signaling, EMT and the regulation of genes important in therapeutic resistance may help identify novel therapeutic targets for breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Family roles as family functioning regulators

    OpenAIRE

    STEPANYAN ARMINE

    2015-01-01

    The author examines the problems of formation and functioning of family roles. Having social roots, family roles appear on individual level by performing the social function of the formation of family as a social institute.

  2. Longitudinal Associations among Child Maltreatment, Social Functioning, and Cortisol Regulation

    Science.gov (United States)

    Alink, Lenneke R. A.; Cicchetti, Dante; Kim, Jungmeen; Rogosch, Fred A.

    2012-01-01

    Child maltreatment increases the risk for impaired social functioning and cortisol regulation. However, the longitudinal interplay among these factors is still unclear. This study aimed to shed light on the effect of maltreatment on social functioning and cortisol regulation over time. The sample consisted of 236 children (mean age 7.64 years, SD…

  3. Conformational regulation of urokinase receptor function

    DEFF Research Database (Denmark)

    Gårdsvoll, Henrik; Jacobsen, Benedikte; Kriegbaum, Mette C

    2011-01-01

    PA per se into the hydrophobic ligand binding cavity of uPAR that modulates the function of this receptor. Based on these data, we now propose a model in which the inherent interdomain mobility in uPAR plays a major role in modulating its function. Particularly one uPAR conformation, which is stabilized...

  4. The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology

    DEFF Research Database (Denmark)

    Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J

    2017-01-01

    The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....

  5. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  6. Function and regulation of the Mediator complex.

    Science.gov (United States)

    Conaway, Ronald C; Conaway, Joan Weliky

    2011-04-01

    Over the past few years, advances in biochemical and genetic studies of the structure and function of the Mediator complex have shed new light on its subunit architecture and its mechanism of action in transcription by RNA polymerase II (pol II). The development of improved methods for reconstitution of recombinant Mediator subassemblies is enabling more in-depth analyses of basic features of the mechanisms by which Mediator interacts with and controls the activity of pol II and the general initiation factors. The discovery and characterization of multiple, functionally distinct forms of Mediator characterized by the presence or absence of the Cdk8 kinase module have led to new insights into how Mediator functions in both Pol II transcription activation and repression. Finally, progress in studies of the mechanisms by which the transcriptional activation domains (ADs) of DNA binding transcription factors target Mediator have brought to light unexpected complexities in the way Mediator participates in signal transduction. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

    Directory of Open Access Journals (Sweden)

    Michelle T Juarez

    2011-12-01

    Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

  8. Epidermal growth factor regulation of glutathione S-transferase gene expression in the rat is mediated by class Pi glutathione S-transferase enhancer I.

    Science.gov (United States)

    Matsumoto, M; Imagawa, M; Aoki, Y

    2000-07-01

    Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did not stimulate GPEI-mediated gene expression. On the other hand, the antioxidant reagents butylhydroxyanisole and t-butylhydroquinone, stimulated GPEI-mediated gene expression, but the level of GSTP1 mRNA was not elevated. Our observations suggest that EGF and TGF alpha induce GSTP1 by the same signal transduction pathway as PenCB. Since the sequence of GPEI is similar to that of the antioxidant responsive element (ARE), some factors which bind to ARE might play a role in GPEI-mediated gene expression.

  9. Glucocorticoid regulation of astrocytic fate and function.

    Directory of Open Access Journals (Sweden)

    Shuang Yu

    Full Text Available Glial loss in the hippocampus has been suggested as a factor in the pathogenesis of stress-related brain disorders that are characterized by dysregulated glucocorticoid (GC secretion. However, little is known about the regulation of astrocytic fate by GC. Here, we show that astrocytes derived from the rat hippocampus undergo growth inhibition and display moderate activation of caspase 3 after exposure to GC. Importantly, the latter event, observed both in situ and in primary astrocytic cultures is not followed by either early- or late-stage apoptosis, as monitored by stage I or stage II DNA fragmentation. Thus, unlike hippocampal granule neurons, astrocytes are resistant to GC-induced apoptosis; this resistance is due to lower production of reactive oxygen species (ROS and a greater buffering capacity against the cytotoxic actions of ROS. We also show that GC influence hippocampal cell fate by inducing the expression of astrocyte-derived growth factors implicated in the control of neural precursor cell proliferation. Together, our results suggest that GC instigate a hitherto unknown dialog between astrocytes and neural progenitors, adding a new facet to understanding how GC influence the cytoarchitecture of the hippocampus.

  10. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  11. Multiple autophosphorylation sites of the epidermal growth factor receptor are essential for receptor kinase activity and internalization. Contrasting significance of tyrosine 992 in the native and truncated receptors

    DEFF Research Database (Denmark)

    Sorkin, A; Helin, K; Waters, C M

    1992-01-01

    The role of epidermal growth factor (EGF) receptor autophosphorylation sites in the regulation of receptor functions has been studied using cells transfected with mutant EGF receptors. Simultaneous point mutation of 4 tyrosines (Y1068, Y1086, Y1148, Y1173) to phenylalanine, as well as removal of ...

  12. Emerging Regulation and Function of Betatrophin

    Directory of Open Access Journals (Sweden)

    Yi-Hsin Tseng

    2014-12-01

    Full Text Available Betatrophin, also known as TD26/RIFL/lipasin/ANGPTL8/C19orf80, is a novel protein predominantly expressed in human liver. To date, several betatrophin orthologs have been identified in mammals. Increasing evidence has revealed an association between betatrophin expression and serum lipid profiles, particularly in patients with obesity or diabetes. Stimulators of betatrophin, such as insulin, thyroid hormone, irisin and caloric intake, are usually relevant to energy expenditure or thermogenesis. In murine models, serum triglyceride levels as well as pancreatic cell proliferation are potently enhanced by betatrophin. Intriguingly, conflicting phenomena have also been reported that betatrophin suppresses hepatic triglyceride levels, suggesting that betatrophin function is mediated by complex regulatory processes. However, its precise physiological role remains unclear at present. In this review, we have summarized the current findings on betatrophin and their implications.

  13. Emerging regulation and function of betatrophin.

    Science.gov (United States)

    Tseng, Yi-Hsin; Yeh, Yung-Hsin; Chen, Wei-Jan; Lin, Kwang-Huei

    2014-12-18

    Betatrophin, also known as TD26/RIFL/lipasin/ANGPTL8/C19orf80, is a novel protein predominantly expressed in human liver. To date, several betatrophin orthologs have been identified in mammals. Increasing evidence has revealed an association between betatrophin expression and serum lipid profiles, particularly in patients with obesity or diabetes. Stimulators of betatrophin, such as insulin, thyroid hormone, irisin and caloric intake, are usually relevant to energy expenditure or thermogenesis. In murine models, serum triglyceride levels as well as pancreatic cell proliferation are potently enhanced by betatrophin. Intriguingly, conflicting phenomena have also been reported that betatrophin suppresses hepatic triglyceride levels, suggesting that betatrophin function is mediated by complex regulatory processes. However, its precise physiological role remains unclear at present. In this review, we have summarized the current findings on betatrophin and their implications.

  14. Neurotrophin signaling endosomes; biogenesis, regulation, and functions

    Science.gov (United States)

    Yamashita, Naoya; Kuruvilla, Rejji

    2016-01-01

    In the nervous system, communication between neurons and their post-synaptic target cells is critical for the formation, refinement and maintenance of functional neuronal connections. Diffusible signals secreted by target tissues, exemplified by the family of neurotrophins, impinge on nerve terminals to influence diverse developmental events including neuronal survival and axonal growth. Key mechanisms of action of target-derived neurotrophins include the cell biological processes of endocytosis and retrograde trafficking of their Trk receptors from growth cones to cell bodies. In this review, we summarize the molecular mechanisms underlying this endosome-mediated signaling, focusing on the instructive role of neurotrophin signaling itself in directing its own trafficking. Recent studies have linked impaired neurotrophin trafficking to neurodevelopmental disorders, highlighting the relevance of neurotrophin endosomes in human health. PMID:27327126

  15. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  16. A homolog of Drosophila grainy head is essential for epidermal integrity in mice.

    Science.gov (United States)

    Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M

    2005-04-15

    The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.

  17. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  18. Insulin Action in Brain Regulates Systemic Metabolism and Brain Function

    OpenAIRE

    Kleinridders, Andr?; Ferris, Heather A.; Cai, Weikang; Kahn, C. Ronald

    2014-01-01

    Insulin receptors, as well as IGF-1 receptors and their postreceptor signaling partners, are distributed throughout the brain. Insulin acts on these receptors to modulate peripheral metabolism, including regulation of appetite, reproductive function, body temperature, white fat mass, hepatic glucose output, and response to hypoglycemia. Insulin signaling also modulates neurotransmitter channel activity, brain cholesterol synthesis, and mitochondrial function. Disruption of insulin action in t...

  19. Effects of in Utero Exposure of C57BL/6J Mice to 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Epidermal Permeability Barrier Development and Function

    Science.gov (United States)

    Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.

    2014-01-01

    Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982

  20. Human neural progenitors express functional lysophospholipid receptors that regulate cell growth and morphology

    Directory of Open Access Journals (Sweden)

    Callihan Phillip

    2008-12-01

    Full Text Available Abstract Background Lysophospholipids regulate the morphology and growth of neurons, neural cell lines, and neural progenitors. A stable human neural progenitor cell line is not currently available in which to study the role of lysophospholipids in human neural development. We recently established a stable, adherent human embryonic stem cell-derived neuroepithelial (hES-NEP cell line which recapitulates morphological and phenotypic features of neural progenitor cells isolated from fetal tissue. The goal of this study was to determine if hES-NEP cells express functional lysophospholipid receptors, and if activation of these receptors mediates cellular responses critical for neural development. Results Our results demonstrate that Lysophosphatidic Acid (LPA and Sphingosine-1-phosphate (S1P receptors are functionally expressed in hES-NEP cells and are coupled to multiple cellular signaling pathways. We have shown that transcript levels for S1P1 receptor increased significantly in the transition from embryonic stem cell to hES-NEP. hES-NEP cells express LPA and S1P receptors coupled to Gi/o G-proteins that inhibit adenylyl cyclase and to Gq-like phospholipase C activity. LPA and S1P also induce p44/42 ERK MAP kinase phosphorylation in these cells and stimulate cell proliferation via Gi/o coupled receptors in an Epidermal Growth Factor Receptor (EGFR- and ERK-dependent pathway. In contrast, LPA and S1P stimulate transient cell rounding and aggregation that is independent of EGFR and ERK, but dependent on the Rho effector p160 ROCK. Conclusion Thus, lysophospholipids regulate neural progenitor growth and morphology through distinct mechanisms. These findings establish human ES cell-derived NEP cells as a model system for studying the role of lysophospholipids in neural progenitors.

  1. The Relationship Between Emotion Regulation, Executive Functioning, and Aggressive Behaviors.

    Science.gov (United States)

    Holley, Sarah R; Ewing, Scott T; Stiver, Jordan T; Bloch, Lian

    2015-06-30

    Emotion regulation deficits and executive functioning deficits have independently been shown to increase vulnerability toward engaging in aggressive behaviors. The effects of these risk factors, however, have not been evaluated in relation to one another. This study evaluated the degree to which each was associated with aggressive behaviors in a sample of 168 undergraduate students. Executive functioning (cognitive inhibition and mental flexibility) was assessed with a Stroop-like neuropsychological task. Emotion regulation and aggressive behaviors were assessed via self-report inventories. Results showed main effects for both emotion regulation and executive functioning, as well as a significant interaction, indicating that those who scored lowest in both domains reported engaging in aggressive behaviors the most frequently. When different types of aggression were examined, this interaction was only significant for acts of physical aggression, not for acts of verbal aggression. Therefore, for physical aggression, emotion regulation and executive functioning exerted a moderating effect on one another. The implications are that, at least for acts of physical aggression, relatively strong capabilities in either domain may buffer against tendencies to engage in aggressive behaviors. Thus, both emotion regulation skills and executive functioning abilities may be valuable targets for interventions aiming to reduce aggressive behaviors. © The Author(s) 2015.

  2. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  3. Interrelationship of brain-functions with cardiovascular regulations

    International Nuclear Information System (INIS)

    Rahman, M.K.

    1993-03-01

    Neurotransmitters and neuropeptides are involved in the regulation of nervous function, behaviour, emotion, sex, sleep, mood of higher animals including the humans. They act and they occur simultaneously in the brain as neurotransmitters or neuromodulators and in plasma as circulating hormones. The direct regulatory interactions of a given substance in the blood and in the brain are still unknown, but some results have already been published regarding these relationships. The present paper briefly describes the systematic review-type studies on the interrelationship of the brain functions and the cardiovascular regulation. 35 refs, 7 figs, 1 tab

  4. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  5. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  7. Regulation of macrophage development and function in peripheral tissues

    Science.gov (United States)

    Lavin, Yonit; Mortha, Arthur; Rahman, Adeeb; Merad, Miriam

    2015-01-01

    Macrophages are immune cells of haematopoietic origin that provide crucial innate immune defence and have tissue-specific functions in the regulation and maintenance of organ homeostasis. Recent studies of macrophage ontogeny, as well as transcriptional and epigenetic identity, have started to reveal the decisive role of the tissue stroma in the regulation of macrophage function. These findings suggest that most macrophages seed the tissues during embryonic development and functionally specialize in response to cytokines and metabolites that are released by the stroma and drive the expression of unique transcription factors. In this Review, we discuss how recent insights into macrophage ontogeny and macrophage–stroma interactions contribute to our understanding of the crosstalk that shapes macrophage function and the maintenance of organ integrity. PMID:26603899

  8. Abnormal Default System Functioning in Depression: Implications for Emotion Regulation.

    Science.gov (United States)

    Messina, Irene; Bianco, Francesca; Cusinato, Maria; Calvo, Vincenzo; Sambin, Marco

    2016-01-01

    Depression is widely seen as the result of difficulties in regulating emotions. Based on neuroimaging studies on voluntary emotion regulation, neurobiological models have focused on the concept of cognitive control, considering emotion regulation as a shift toward involving controlled processes associated with activation of the prefrontal and parietal executive areas, instead of responding automatically to emotional stimuli. According to such models, the weaker executive area activation observed in depressed patients is attributable to a lack of cognitive control over negative emotions. Going beyond the concept of cognitive control, psychodynamic models describe the development of individuals' capacity to regulate their emotional states in mother-infant interactions during childhood, through the construction of the representation of the self, others, and relationships. In this mini-review, we link these psychodynamic models with recent findings regarding the abnormal functioning of the default system in depression. Consistently with psychodynamic models, psychological functions associated with the default system include self-related processing, semantic processes, and implicit forms of emotion regulation. The abnormal activation of the default system observed in depression may explain the dysfunctional aspects of emotion regulation typical of the condition, such as an exaggerated negative self-focus and rumination on self-esteem issues. We also discuss the clinical implications of these findings with reference to the therapeutic relationship as a key tool for revisiting impaired or distorted representations of the self and relational objects.

  9. Regulation of brain insulin signaling: A new function for tau.

    Science.gov (United States)

    Gratuze, Maud; Planel, Emmanuel

    2017-08-07

    In this issue of JEM, Marciniak et al. (https://doi.org/10.1084/jem.20161731) identify a putative novel function of tau protein as a regulator of insulin signaling in the brain. They find that tau deletion impairs hippocampal response to insulin through IRS-1 and PTEN dysregulation and suggest that, in Alzheimer's disease, impairment of brain insulin signaling might occur via tau loss of function. © 2017 Gratuze and Planel.

  10. Myostatin-like proteins regulate synaptic function and neuronal morphology.

    Science.gov (United States)

    Augustin, Hrvoje; McGourty, Kieran; Steinert, Joern R; Cochemé, Helena M; Adcott, Jennifer; Cabecinha, Melissa; Vincent, Alec; Halff, Els F; Kittler, Josef T; Boucrot, Emmanuel; Partridge, Linda

    2017-07-01

    Growth factors of the TGFβ superfamily play key roles in regulating neuronal and muscle function. Myostatin (or GDF8) and GDF11 are potent negative regulators of skeletal muscle mass. However, expression of myostatin and its cognate receptors in other tissues, including brain and peripheral nerves, suggests a potential wider biological role. Here, we show that Myoglianin (MYO), the Drosophila homolog of myostatin and GDF11, regulates not only body weight and muscle size, but also inhibits neuromuscular synapse strength and composition in a Smad2-dependent manner. Both myostatin and GDF11 affected synapse formation in isolated rat cortical neuron cultures, suggesting an effect on synaptogenesis beyond neuromuscular junctions. We also show that MYO acts in vivo to inhibit synaptic transmission between neurons in the escape response neural circuit of adult flies. Thus, these anti-myogenic proteins act as important inhibitors of synapse function and neuronal growth. © 2017. Published by The Company of Biologists Ltd.

  11. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  12. Recombinant epidermal growth factor-like domain-1 from coagulation factor VII functionalized iron oxide nanoparticles for targeted glioma magnetic resonance imaging.

    Science.gov (United States)

    Liu, Heng; Chen, Xiao; Xue, Wei; Chu, Chengchao; Liu, Yu; Tong, Haipeng; Du, Xuesong; Xie, Tian; Liu, Gang; Zhang, Weiguo

    The highly infiltrative and invasive nature of glioma cells often leads to blurred tumor margins, resulting in incomplete tumor resection and tumor recurrence. Accurate detection and precise delineation of glioma help in preoperative delineation, surgical planning and survival prediction. In this study, recombinant epidermal growth factor-like domain-1, derived from human coagulation factor VII, was conjugated to iron oxide nanoparticles (IONPs) for targeted glioma magnetic resonance (MR) imaging. The synthesized EGF1-EGFP-IONPs exhibited excellent targeting ability toward tissue factor (TF)-positive U87MG cells and human umbilical vein endothelial cells in vitro, and demonstrated persistent and efficient MR contrast enhancement up to 12 h for preclinical glioma models with high targeting specificity in vivo. They hold great potential for clinical translation and developing targeted theranostics against brain glioma.

  13. Thyroid hormone is required for hypothalamic neurons regulating cardiovascular functions

    NARCIS (Netherlands)

    Mittag, J.; Lyons, D.J.; Sällström, J.; Vujoviv, M.; Dudazy-Gralla, S.; Warner, A.; Wallis, K.; Alkemade, A.; Nordström, K.; Monyer, H.; Broberger, C.; Arner, A.; Vennström, B.

    2013-01-01

    Thyroid hormone is well known for its profound direct effects on cardiovascular function and metabolism. Recent evidence, however, suggests that the hormone also regulates these systems indirectly through the central nervous system. While some of the molecular mechanisms underlying the hormone’s

  14. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  15. Cellular regulation of the structure and function of aortic valves

    Directory of Open Access Journals (Sweden)

    Ismail El-Hamamsy

    2010-01-01

    Full Text Available The aortic valve was long considered a passive structure that opens and closes in response to changes in transvalvular pressure. Recent evidence suggests that the aortic valve performs highly sophisticated functions as a result of its unique microscopic structure. These functions allow it to adapt to its hemodynamic and mechanical environment. Understanding the cellular and molecular mechanisms involved in normal valve physiology is essential to elucidate the mechanisms behind valve disease. We here review the structure and developmental biology of aortic valves; we examine the role of its cellular parts in regulating its function and describe potential pathophysiological and clinical implications.

  16. Palmitoylation as a Functional Regulator of Neurotransmitter Receptors

    Directory of Open Access Journals (Sweden)

    Vladimir S. Naumenko

    2018-01-01

    Full Text Available The majority of neuronal proteins involved in cellular signaling undergo different posttranslational modifications significantly affecting their functions. One of these modifications is a covalent attachment of a 16-C palmitic acid to one or more cysteine residues (S-palmitoylation within the target protein. Palmitoylation is a reversible modification, and repeated cycles of palmitoylation/depalmitoylation might be critically involved in the regulation of multiple signaling processes. Palmitoylation also represents a common posttranslational modification of the neurotransmitter receptors, including G protein-coupled receptors (GPCRs and ligand-gated ion channels (LICs. From the functional point of view, palmitoylation affects a wide span of neurotransmitter receptors activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, recycling, and synaptic clustering. This review summarizes the current knowledge on the palmitoylation of neurotransmitter receptors and its role in the regulation of receptors functions as well as in the control of different kinds of physiological and pathological behavior.

  17. Regulator Loss Functions and Hierarchical Modeling for Safety Decision Making.

    Science.gov (United States)

    Hatfield, Laura A; Baugh, Christine M; Azzone, Vanessa; Normand, Sharon-Lise T

    2017-07-01

    Regulators must act to protect the public when evidence indicates safety problems with medical devices. This requires complex tradeoffs among risks and benefits, which conventional safety surveillance methods do not incorporate. To combine explicit regulator loss functions with statistical evidence on medical device safety signals to improve decision making. In the Hospital Cost and Utilization Project National Inpatient Sample, we select pediatric inpatient admissions and identify adverse medical device events (AMDEs). We fit hierarchical Bayesian models to the annual hospital-level AMDE rates, accounting for patient and hospital characteristics. These models produce expected AMDE rates (a safety target), against which we compare the observed rates in a test year to compute a safety signal. We specify a set of loss functions that quantify the costs and benefits of each action as a function of the safety signal. We integrate the loss functions over the posterior distribution of the safety signal to obtain the posterior (Bayes) risk; the preferred action has the smallest Bayes risk. Using simulation and an analysis of AMDE data, we compare our minimum-risk decisions to a conventional Z score approach for classifying safety signals. The 2 rules produced different actions for nearly half of hospitals (45%). In the simulation, decisions that minimize Bayes risk outperform Z score-based decisions, even when the loss functions or hierarchical models are misspecified. Our method is sensitive to the choice of loss functions; eliciting quantitative inputs to the loss functions from regulators is challenging. A decision-theoretic approach to acting on safety signals is potentially promising but requires careful specification of loss functions in consultation with subject matter experts.

  18. Phosphodiesterases regulate airway smooth muscle function in health and disease.

    Science.gov (United States)

    Krymskaya, Vera P; Panettieri, Reynold A

    2007-01-01

    On the basis of structure, regulation, and kinetic properties, phosphodiesterases (PDEs) represent a superfamily of enzymes divided into 11 subfamilies that catalyze cytosolic levels of 3',5'-cyclic adenosine monophosphate (cAMP) or 3',5'-cyclic guanosine monophosphate (cGMP) to 5'-AMP or 5'-GMP, respectively. PDE4 represents the major PDE expressed in inflammatory cells as well as airway smooth muscle (ASM), and selective PDE4 inhibitors provide a broad spectrum of anti-inflammatory effects such as abrogating cytokine and chemokine release from inflammatory cells and inhibiting inflammatory cell trafficking. Due to cell- and tissue-specific gene expression and regulation, PDEs modulate unique organ-based functions. New tools or compounds that selectively inhibit PDE subfamilies and genetically engineered mice deficient in selective isoforms have greatly enhanced our understanding of PDE function in airway inflammation and resident cell function. This chapter will focus on recent advances in our understanding of the role of PDE in regulating ASM function.

  19. Rac1 Regulates Endometrial Secretory Function to Control Placental Development.

    Directory of Open Access Journals (Sweden)

    Juanmahel Davila

    2015-08-01

    Full Text Available During placenta development, a succession of complex molecular and cellular interactions between the maternal endometrium and the developing embryo ensures reproductive success. The precise mechanisms regulating this maternal-fetal crosstalk remain unknown. Our study revealed that the expression of Rac1, a member of the Rho family of GTPases, is markedly elevated in mouse decidua on days 7 and 8 of gestation. To investigate its function in the uterus, we created mice bearing a conditional deletion of the Rac1 gene in uterine stromal cells. Ablation of Rac1 did not affect the formation of the decidua but led to fetal loss in mid gestation accompanied by extensive hemorrhage. To gain insights into the molecular pathways affected by the loss of Rac1, we performed gene expression profiling which revealed that Rac1 signaling regulates the expression of Rab27b, another GTPase that plays a key role in targeting vesicular trafficking. Consequently, the Rac1-null decidual cells failed to secrete vascular endothelial growth factor A, which is a critical regulator of decidual angiogenesis, and insulin-like growth factor binding protein 4, which regulates the bioavailability of insulin-like growth factors that promote proliferation and differentiation of trophoblast cell lineages in the ectoplacental cone. The lack of secretion of these key factors by Rac1-null decidua gave rise to impaired angiogenesis and dysregulated proliferation of trophoblast cells, which in turn results in overexpansion of the trophoblast giant cell lineage and disorganized placenta development. Further experiments revealed that RAC1, the human ortholog of Rac1, regulates the secretory activity of human endometrial stromal cells during decidualization, supporting the concept that this signaling G protein plays a central and conserved role in controlling endometrial secretory function. This study provides unique insights into the molecular mechanisms regulating endometrial secretions

  20. Rac1 Regulates Endometrial Secretory Function to Control Placental Development

    Science.gov (United States)

    Davila, Juanmahel; Laws, Mary J.; Kannan, Athilakshmi; Li, Quanxi; Taylor, Robert N.; Bagchi, Milan K.; Bagchi, Indrani C.

    2015-01-01

    During placenta development, a succession of complex molecular and cellular interactions between the maternal endometrium and the developing embryo ensures reproductive success. The precise mechanisms regulating this maternal-fetal crosstalk remain unknown. Our study revealed that the expression of Rac1, a member of the Rho family of GTPases, is markedly elevated in mouse decidua on days 7 and 8 of gestation. To investigate its function in the uterus, we created mice bearing a conditional deletion of the Rac1 gene in uterine stromal cells. Ablation of Rac1 did not affect the formation of the decidua but led to fetal loss in mid gestation accompanied by extensive hemorrhage. To gain insights into the molecular pathways affected by the loss of Rac1, we performed gene expression profiling which revealed that Rac1 signaling regulates the expression of Rab27b, another GTPase that plays a key role in targeting vesicular trafficking. Consequently, the Rac1-null decidual cells failed to secrete vascular endothelial growth factor A, which is a critical regulator of decidual angiogenesis, and insulin-like growth factor binding protein 4, which regulates the bioavailability of insulin-like growth factors that promote proliferation and differentiation of trophoblast cell lineages in the ectoplacental cone. The lack of secretion of these key factors by Rac1-null decidua gave rise to impaired angiogenesis and dysregulated proliferation of trophoblast cells, which in turn results in overexpansion of the trophoblast giant cell lineage and disorganized placenta development. Further experiments revealed that RAC1, the human ortholog of Rac1, regulates the secretory activity of human endometrial stromal cells during decidualization, supporting the concept that this signaling G protein plays a central and conserved role in controlling endometrial secretory function. This study provides unique insights into the molecular mechanisms regulating endometrial secretions that mediate stromal

  1. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  2. Regulation of T cell differentiation and function by EZH2

    Directory of Open Access Journals (Sweden)

    THEODOROS KARANTANOS

    2016-05-01

    Full Text Available The enhancer of zeste homologue 2 (EZH2, one of the polycomb group (PcG proteins, is the catalytic subunit of Polycomb-repressive complex 2 (PRC2 and induces the trimethylation of the histone H3 lysine 27 (H3K27me3 promoting epigenetic gene silencing. EZH2 contains a SET domain promoting the methyltransferase activity while the three other protein components of PRC2, namely EED, SUZ12 and RpAp46/48 induce compaction of the chromatin permitting EZH2 enzymatic activity. Numerous studies highlight the role of this evolutionary conserved protein as a master regulator of differentiation in humans involved in the repression of the homeotic (Hox gene and the inactivation of X-chromosome. Through its effects in the epigenetic regulation of critical genes, EZH2 has been strongly linked to cell cycle progression, stem cell pluripotency and cancer biology. Most recently, EZH2 has been associated with hematopoietic stem cell proliferation and differentiation, thymopoiesis and lymphopoiesis. Several studies have evaluated the role of EZH2 in the regulation of T cell differentiation and plasticity as well as its implications in the development of autoimmune diseases and graft versus host disease (GvHD. In this review we will briefly summarize the current knowledge regarding the role of EZH2 in the regulation of T cell differentiation, effector function and homing in the tumor microenvironment and we will discuss possible therapeutic targeting of EZH2 in order to alter T cell immune functions.

  3. Emotion regulation in Asperger's syndrome and high-functioning autism.

    Science.gov (United States)

    Samson, Andrea C; Huber, Oswald; Gross, James J

    2012-08-01

    It is generally thought that individuals with Asperger's syndrome and high-functioning autism (AS/HFA) have deficits in theory of mind. These deficits have been previously linked to problems with social cognition. However, we reasoned that AS/HFA individuals' Theory of Mind deficits also might lead to problems with emotion regulation. To assess emotional functioning in AS/HFA, 27 AS/HFA adults (16 women) and 27 age-, gender-, and education-matched typically developing (TD) participants completed a battery of measures of emotion experience, labeling, and regulation. With respect to emotion experience, individuals with AS/HFA reported higher levels of negative emotions, but similar levels of positive emotions, compared with TD individuals. With respect to emotion labeling, individuals with AS/HFA had greater difficulties identifying and describing their emotions, with approximately two-thirds exceeding the cutoff for alexithymia. With respect to emotion regulation, individuals with AS/HFA used reappraisal less frequently than TD individuals and reported lower levels of reappraisal self-efficacy. Although AS/HFA individuals used suppression more frequently than TD individuals, no difference in suppression self-efficacy was found. It is important to note that these differences in emotion regulation were evident even when controlling for emotion experience and labeling. Implications of these deficits are discussed, and future research directions are proposed.

  4. The adventitia: essential regulator of vascular wall structure and function.

    Science.gov (United States)

    Stenmark, Kurt R; Yeager, Michael E; El Kasmi, Karim C; Nozik-Grayck, Eva; Gerasimovskaya, Evgenia V; Li, Min; Riddle, Suzette R; Frid, Maria G

    2013-01-01

    The vascular adventitia acts as a biological processing center for the retrieval, integration, storage, and release of key regulators of vessel wall function. It is the most complex compartment of the vessel wall and is composed of a variety of cells, including fibroblasts, immunomodulatory cells (dendritic cells and macrophages), progenitor cells, vasa vasorum endothelial cells and pericytes, and adrenergic nerves. In response to vascular stress or injury, resident adventitial cells are often the first to be activated and reprogrammed to influence the tone and structure of the vessel wall; to initiate and perpetuate chronic vascular inflammation; and to stimulate expansion of the vasa vasorum, which can act as a conduit for continued inflammatory and progenitor cell delivery to the vessel wall. This review presents the current evidence demonstrating that the adventitia acts as a key regulator of vascular wall function and structure from the outside in.

  5. Time-dependent effect of orchidectomy on vascular nitric oxide and thromboxane A2 release. Functional implications to control cell proliferation through activation of the epidermal growth factor receptor.

    Directory of Open Access Journals (Sweden)

    Marta del Campo

    Full Text Available This study analyzes whether the release of nitric oxide (NO and thromboxane A2 (TXA2 depends on the time lapsed since gonadal function is lost, and their correlation with the proliferation of vascular smooth muscle cells (VSMC mediated by the epidermal growth factor receptor (EGFR. For this purpose, aortic and mesenteric artery segments from control and 6-weeks or 5-months orchidectomized rats were used to measure NO and TXA2 release. The results showed that the basal and acetylcholine (ACh-induced NO release were decreased 6 weeks post-orchidectomy both in aorta and mesenteric artery, but were recovered 5 months thereafter up to levels similar to those found in arteries from control rats. The basal and ACh-induced TXA2 release increased in aorta and mesenteric artery 6 weeks post-orchidectomy, and was maintained at high levels 5 months thereafter. Since we previously observed that orchidectomy, which decreased testosterone level, enlarged the muscular layer of mesenteric arteries, the effect of testosterone on VSMC proliferation was analyzed. The results showed that treatment of cultured VSMC with testosterone downregulated mitogenic signaling pathways initiated by the ligand-dependent activation of the EGFR. In contrast, the EGFR pathways were constitutively active in mesenteric arteries of long-term orchidectomized rats. Thus, the exposure of mesenteric arteries from control rats to epidermal growth factor (EGF induced the activation of EGFR signaling pathways. However, the addition of EGF to arteries from orchidectomized rats failed to induce a further activation of these pathways. In conclusion, this study shows that the release of NO depends on the time lapsed since the gonadal function is lost, while the release of TXA2 is already increased after short periods post-orchidectomy. The alterations in these signaling molecules could contribute to the constitutive activation of the EGFR and its downstream signaling pathways after long period

  6. Toward a functional analysis of private verbal self-regulation.

    OpenAIRE

    Taylor, I; O'Reilly, M F

    1997-01-01

    We developed a methodology, derived from the theoretical literatures on rule-governed behavior and private events, to experimentally investigate the relationship between covert verbal self-regulation and nonverbal behavior. The methodology was designed to assess whether (a) nonverbal behavior was under the control of covert rules and (b) verbal reports of these rules were functionally equivalent to the covert rules that control non-verbal behavior. The research was conducted in the context of...

  7. Development, regulation, metabolism and function of bone marrow adipose tissues.

    Science.gov (United States)

    Li, Ziru; Hardij, Julie; Bagchi, Devika P; Scheller, Erica L; MacDougald, Ormond A

    2018-05-01

    Most adipocytes exist in discrete depots throughout the body, notably in well-defined white and brown adipose tissues. However, adipocytes also reside within specialized niches, of which the most abundant is within bone marrow. Whereas bone marrow adipose tissue (BMAT) shares many properties in common with white adipose tissue, the distinct functions of BMAT are reflected by its development, regulation, protein secretion, and lipid composition. In addition to its potential role as a local energy reservoir, BMAT also secretes proteins, including adiponectin, RANK ligand, dipeptidyl peptidase-4, and stem cell factor, which contribute to local marrow niche functions and which may also influence global metabolism. The characteristics of BMAT are also distinct depending on whether marrow adipocytes are contained within yellow or red marrow, as these can be thought of as 'constitutive' and 'regulated', respectively. The rBMAT for instance can be expanded or depleted by myriad factors, including age, nutrition, endocrine status and pharmaceuticals. Herein we review the site specificity, age-related development, regulation and metabolic characteristics of BMAT under various metabolic conditions, including the functional interactions with bone and hematopoietic cells. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Ascorbate regulates haematopoietic stem cell function and leukaemogenesis.

    Science.gov (United States)

    Agathocleous, Michalis; Meacham, Corbin E; Burgess, Rebecca J; Piskounova, Elena; Zhao, Zhiyu; Crane, Genevieve M; Cowin, Brianna L; Bruner, Emily; Murphy, Malea M; Chen, Weina; Spangrude, Gerald J; Hu, Zeping; DeBerardinis, Ralph J; Morrison, Sean J

    2017-09-28

    Stem-cell fate can be influenced by metabolite levels in culture, but it is not known whether physiological variations in metabolite levels in normal tissues regulate stem-cell function in vivo. Here we describe a metabolomics method for the analysis of rare cell populations isolated directly from tissues and use it to compare mouse haematopoietic stem cells (HSCs) to restricted haematopoietic progenitors. Each haematopoietic cell type had a distinct metabolic signature. Human and mouse HSCs had unusually high levels of ascorbate, which decreased with differentiation. Systemic ascorbate depletion in mice increased HSC frequency and function, in part by reducing the function of Tet2, a dioxygenase tumour suppressor. Ascorbate depletion cooperated with Flt3 internal tandem duplication (Flt3 ITD ) leukaemic mutations to accelerate leukaemogenesis, through cell-autonomous and possibly non-cell-autonomous mechanisms, in a manner that was reversed by dietary ascorbate. Ascorbate acted cell-autonomously to negatively regulate HSC function and myelopoiesis through Tet2-dependent and Tet2-independent mechanisms. Ascorbate therefore accumulates within HSCs to promote Tet activity in vivo, limiting HSC frequency and suppressing leukaemogenesis.

  9. Tyrosine Residues Regulate Multiple Nuclear Functions of P54nrb.

    Science.gov (United States)

    Lee, Ahn R; Hung, Wayne; Xie, Ning; Liu, Liangliang; He, Leye; Dong, Xuesen

    2017-04-01

    The non-POU-domain-containing octamer binding protein (NONO; also known as p54nrb) has various nuclear functions ranging from transcription, RNA splicing, DNA synthesis and repair. Although tyrosine phosphorylation has been proposed to account for the multi-functional properties of p54nrb, direct evidence on p54nrb as a phosphotyrosine protein remains unclear. To investigate the tyrosine phosphorylation status of p54nrb, we performed site-directed mutagenesis on the five tyrosine residues of p54nrb, replacing the tyrosine residues with phenylalanine or alanine, and immunoblotted for tyrosine phosphorylation. We then preceded with luciferase reporter assays, RNA splicing minigene assays, co-immunoprecipitation, and confocal microscopy to study the function of p54nrb tyrosine residues on transcription, RNA splicing, protein-protein interaction, and cellular localization. We found that p54nrb was not phosphorylated at tyrosine residues. Rather, it has non-specific binding affinity to anti-phosphotyrosine antibodies. However, replacement of tyrosine with phenylalanine altered p54nrb activities in transcription co-repression and RNA splicing in gene context-dependent fashions by means of differential regulation of p54nrb protein association with its interacting partners and co-regulators of transcription and splicing. These results demonstrate that tyrosine residues, regardless of phosphorylation status, are important for p54nrb function. J. Cell. Physiol. 232: 852-861, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Regulation of T Cell Differentiation and Function by EZH2

    Science.gov (United States)

    Karantanos, Theodoros; Christofides, Anthos; Bardhan, Kankana; Li, Lequn; Boussiotis, Vassiliki A.

    2016-01-01

    The enhancer of zeste homolog 2 (EZH2), one of the polycomb-group proteins, is the catalytic subunit of Polycomb-repressive complex 2 (PRC2) and induces the trimethylation of the histone H3 lysine 27 (H3K27me3) promoting epigenetic gene silencing. EZH2 contains a SET domain promoting the methyltransferase activity, while the three other protein components of PRC2, namely EED, SUZ12, and RpAp46/48, induce compaction of the chromatin permitting EZH2 enzymatic activity. Numerous studies highlight the role of this evolutionary conserved protein as a master regulator of differentiation in humans involved in the repression of the homeotic gene and the inactivation of X-chromosome. Through its effects in the epigenetic regulation of critical genes, EZH2 has been strongly linked to cell cycle progression, stem cell pluripotency, and cancer biology, being currently at the cutting edge of research. Most recently, EZH2 has been associated with hematopoietic stem cell proliferation and differentiation, thymopoiesis and lymphopoiesis. Several studies have evaluated the role of EZH2 in the regulation of T cell differentiation and plasticity as well as its implications in the development of autoimmune diseases and graft-versus-host disease (GVHD). The aim of this review is to summarize the current knowledge regarding the role of EZH2 in the regulation of the differentiation and function of T cells focusing on possible applications in various immune-mediated conditions, including autoimmune disorders and GVHD. PMID:27199994

  11. TAK1 regulates skeletal muscle mass and mitochondrial function

    Science.gov (United States)

    Hindi, Sajedah M.; Sato, Shuichi; Xiong, Guangyan; Bohnert, Kyle R.; Gibb, Andrew A.; Gallot, Yann S.; McMillan, Joseph D.; Hill, Bradford G.

    2018-01-01

    Skeletal muscle mass is regulated by a complex array of signaling pathways. TGF-β–activated kinase 1 (TAK1) is an important signaling protein, which regulates context-dependent activation of multiple intracellular pathways. However, the role of TAK1 in the regulation of skeletal muscle mass remains unknown. Here, we report that inducible inactivation of TAK1 causes severe muscle wasting, leading to kyphosis, in both young and adult mice.. Inactivation of TAK1 inhibits protein synthesis and induces proteolysis, potentially through upregulating the activity of the ubiquitin-proteasome system and autophagy. Phosphorylation and enzymatic activity of AMPK are increased, whereas levels of phosphorylated mTOR and p38 MAPK are diminished upon inducible inactivation of TAK1 in skeletal muscle. In addition, targeted inactivation of TAK1 leads to the accumulation of dysfunctional mitochondria and oxidative stress in skeletal muscle of adult mice. Inhibition of TAK1 does not attenuate denervation-induced muscle wasting in adult mice. Finally, TAK1 activity is highly upregulated during overload-induced skeletal muscle growth, and inactivation of TAK1 prevents myofiber hypertrophy in response to functional overload. Overall, our study demonstrates that TAK1 is a key regulator of skeletal muscle mass and oxidative metabolism. PMID:29415881

  12. Structure and function of the cystic fibrosis transmembrane conductance regulator

    Directory of Open Access Journals (Sweden)

    M.M. Morales

    1999-08-01

    Full Text Available Cystic fibrosis (CF is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR. Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs, and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs.

  13. Regulation of immunological and inflammatory functions by biotin.

    Science.gov (United States)

    Kuroishi, Toshinobu

    2015-12-01

    Biotin is a water-soluble B-complex vitamin and is well-known as a co-factor for 5 indispensable carboxylases. Holocarboxylase synthetase (HLCS) catalyzes the biotinylation of carboxylases and other proteins, whereas biotinidase catalyzes the release of biotin from biotinylated peptides. Previous studies have reported that nutritional biotin deficiency and genetic defects in either HLCS or biotinidase induces cutaneous inflammation and immunological disorders. Since biotin-dependent carboxylases involve various cellular metabolic pathways including gluconeogenesis, fatty acid synthesis, and the metabolism of branched-chain amino acids and odd-chain fatty acids, metabolic abnormalities may play important roles in immunological and inflammatory disorders caused by biotin deficiency. Transcriptional factors, including NF-κB and Sp1/3, are also affected by the status of biotin, indicating that biotin regulates immunological and inflammatory functions independently of biotin-dependent carboxylases. An in-vivo analysis with a murine model revealed the therapeutic effects of biotin supplementation on metal allergies. The novel roles of biotinylated proteins and their related enzymes have recently been reported. Non-carboxylase biotinylated proteins induce chemokine production. HLCS is a nuclear protein involved in epigenetic and chromatin regulation. In this review, comprehensive knowledge on the regulation of immunological and inflammatory functions by biotin and its potential as a therapeutic agent is discussed.

  14. Insulin action in brain regulates systemic metabolism and brain function.

    Science.gov (United States)

    Kleinridders, André; Ferris, Heather A; Cai, Weikang; Kahn, C Ronald

    2014-07-01

    Insulin receptors, as well as IGF-1 receptors and their postreceptor signaling partners, are distributed throughout the brain. Insulin acts on these receptors to modulate peripheral metabolism, including regulation of appetite, reproductive function, body temperature, white fat mass, hepatic glucose output, and response to hypoglycemia. Insulin signaling also modulates neurotransmitter channel activity, brain cholesterol synthesis, and mitochondrial function. Disruption of insulin action in the brain leads to impairment of neuronal function and synaptogenesis. In addition, insulin signaling modulates phosphorylation of tau protein, an early component in the development of Alzheimer disease. Thus, alterations in insulin action in the brain can contribute to metabolic syndrome, and the development of mood disorders and neurodegenerative diseases. © 2014 by the American Diabetes Association.

  15. Regulation of K-Cl cotransport: from function to genes.

    Science.gov (United States)

    Adragna, N C; Di Fulvio, M; Lauf, P K

    2004-10-01

    This review intends to summarize the vast literature on K-Cl cotransport (COT) regulation from a functional and genetic viewpoint. Special attention has been given to the signaling pathways involved in the transporter's regulation found in several tissues and cell types, and more specifically, in vascular smooth muscle cells (VSMCs). The number of publications on K-Cl COT has been steadily increasing since its discovery at the beginning of the 1980s, with red blood cells (RBCs) from different species (human, sheep, dog, rabbit, guinea pig, turkey, duck, frog, rat, mouse, fish, and lamprey) being the most studied model. Other tissues/cell types under study are brain, kidney, epithelia, muscle/smooth muscle, tumor cells, heart, liver, insect cells, endothelial cells, bone, platelets, thymocytes and Leishmania donovani. One of the salient properties of K-Cl-COT is its activation by cell swelling and its participation in the recovery of cell volume, a process known as regulatory volume decrease (RVD). Activation by thiol modification with N-ethylmaleimide (NEM) has spawned investigations on the redox dependence of K-Cl COT, and is used as a positive control for the operation of the system in many tissues and cells. The most accepted model of K-Cl COT regulation proposes protein kinases and phosphatases linked in a chain of phosphorylation/dephosphorylation events. More recent studies include regulatory pathways involving the phosphatidyl inositol/protein kinase C (PKC)-mediated pathway for regulation by lithium (Li) in low-K sheep red blood cells (LK SRBCs), and the nitric oxide (NO)/cGMP/protein kinase G (PKG) pathway as well as the platelet-derived growth factor (PDGF)-mediated mechanism in VSMCs. Studies on VSM transfected cells containing the PKG catalytic domain demonstrated the participation of this enzyme in K-Cl COT regulation. Commonly used vasodilators activate K-Cl COT in a dose-dependent manner through the NO/cGMP/PKG pathway. Interaction between the

  16. Structural interaction and functional regulation of polycystin-2 by filamin.

    Directory of Open Access Journals (Sweden)

    Qian Wang

    Full Text Available Filamins are important actin cross-linking proteins implicated in scaffolding, membrane stabilization and signal transduction, through interaction with ion channels, receptors and signaling proteins. Here we report the physical and functional interaction between filamins and polycystin-2, a TRP-type cation channel mutated in 10-15% patients with autosomal dominant polycystic kidney disease. Yeast two-hybrid and GST pull-down experiments demonstrated that the C-termini of filamin isoforms A, B and C directly bind to both the intracellular N- and C-termini of polycystin-2. Reciprocal co-immunoprecipitation experiments showed that endogenous polycystin-2 and filamins are in the same complexes in renal epithelial cells and human melanoma A7 cells. We then examined the effect of filamin on polycystin-2 channel function by electrophysiology studies with a lipid bilayer reconstitution system and found that filamin-A substantially inhibits polycystin-2 channel activity. Our study indicates that filamins are important regulators of polycystin-2 channel function, and further links actin cytoskeletal dynamics to the regulation of this channel protein.

  17. Regulation of Central Nervous System Myelination in Higher Brain Functions

    Directory of Open Access Journals (Sweden)

    Mara Nickel

    2018-01-01

    Full Text Available The hippocampus and the prefrontal cortex are interconnected brain regions, playing central roles in higher brain functions, including learning and memory, planning complex cognitive behavior, and moderating social behavior. The axons in these regions continue to be myelinated into adulthood in humans, which coincides with maturation of personality and decision-making. Myelin consists of dense layers of lipid membranes wrapping around the axons to provide electrical insulation and trophic support and can profoundly affect neural circuit computation. Recent studies have revealed that long-lasting changes of myelination can be induced in these brain regions by experience, such as social isolation, stress, and alcohol abuse, as well as by neurological and psychiatric abnormalities. However, the mechanism and function of these changes remain poorly understood. Myelin regulation represents a new form of neural plasticity. Some progress has been made to provide new mechanistic insights into activity-independent and activity-dependent regulations of myelination in different experimental systems. More extensive investigations are needed in this important but underexplored research field, in order to shed light on how higher brain functions and myelination interplay in the hippocampus and prefrontal cortex.

  18. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  19. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  20. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford

    2016-05-01

    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  1. Glucose regulation and cognitive function after bariatric surgery.

    Science.gov (United States)

    Galioto, Rachel; Alosco, Michael L; Spitznagel, Mary Beth; Strain, Gladys; Devlin, Michael; Cohen, Ronald; Crosby, Ross D; Mitchell, James E; Gunstad, John

    2015-01-01

    Obesity is associated with cognitive impairment, and bariatric surgery has been shown to improve cognitive functioning. Rapid improvements in glycemic control are common after bariatric surgery and likely contribute to these cognitive gains. We examined whether improvements in glucose regulation are associated with better cognitive function following bariatric surgery. A total of 85 adult bariatric surgery patients underwent computerized cognitive testing and fasting blood draw for glucose, insulin, and glycated hemoglobin (HbA1c) at baseline and 12 months postoperatively. Significant improvements in both cognitive function and glycemic control were observed among patients. After controlling for baseline factors, 12-month homeostatic model assessment of insulin resistance HOMA-IR predicted 12-month digits backward (β = -.253, p cognitive flexibility improved. Decreases in HbA1c were not associated with postoperative cognitive improvements. After controlling for baseline cognitive test performance, changes in body mass index (BMI) were also not associated with 12-month cognitive function. Small effects of improved glycemic control on improved aspects of attention and executive function were observed following bariatric surgery among severely obese individuals. Future research is needed to identify the underlying mechanisms for the neurocognitive benefits of these procedures.

  2. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  3. Role of Estrogen in Thyroid Function and Growth Regulation

    Directory of Open Access Journals (Sweden)

    Ana Paula Santin

    2011-01-01

    Full Text Available Thyroid diseases are more prevalent in women, particularly between puberty and menopause. It is wellknown that estrogen (E has indirect effects on the thyroid economy. Direct effects of this steroid hormone on thyroid cells have been described more recently; so, the aim of the present paper was to review the evidences of these effects on thyroid function and growth regulation, and its mechanisms. The expression and ratios of the two E receptors, α and β, that mediate the genomic effects of E on normal and abnormal thyroid tissue were also reviewed, as well as nongenomic, distinct molecular pathways. Several evidences support the hypothesis that E has a direct role in thyroid follicular cells; understanding its influence on the growth and function of the thyroid in normal and abnormal conditions can potentially provide new targets for the treatment of thyroid diseases.

  4. Function and regulation of lipid biology in Caenorhabditis elegans aging

    Directory of Open Access Journals (Sweden)

    Nicole Shangming Hou

    2012-05-01

    Full Text Available Rapidly expanding aging populations and a concomitant increase in the prevalence of age-related diseases are global health problems today. Over the past three decades, a large body of work has led to the identification of genes and regulatory networks that affect longevity and health span, often benefitting from the tremendous power of genetics in vertebrate and invertebrate model organisms. Interestingly, many of these factors appear linked to lipids, important molecules that participate in cellular signaling, energy metabolism, and structural compartmentalization. Despite the putative link between lipids and longevity, the role of lipids in aging remains poorly understood. Emerging data from the model organism Caenorhabditis elegans suggest that lipid composition may change during aging, as several pathways that influence aging also regulate lipid metabolism enzymes; moreover, some of these enzymes apparently play key roles in the pathways that affect the rate of aging. By understanding how lipid biology is regulated during C. elegans aging, and how it impacts molecular, cellular and organismal function, we may gain insight into novel ways to delay aging using genetic or pharmacological interventions. In the present review we discuss recent insights into the roles of lipids in C. elegans aging, including regulatory roles played by lipids themselves, the regulation of lipid metabolic enzymes, and the roles of lipid metabolism genes in the pathways that affect aging.

  5. Progranulin regulates lysosomal function and biogenesis through acidification of lysosomes.

    Science.gov (United States)

    Tanaka, Yoshinori; Suzuki, Genjiro; Matsuwaki, Takashi; Hosokawa, Masato; Serrano, Geidy; Beach, Thomas G; Yamanouchi, Keitaro; Hasegawa, Masato; Nishihara, Masugi

    2017-03-01

    Progranulin (PGRN) haploinsufficiency resulting from loss-of-function mutations in the PGRN gene causes frontotemporal lobar degeneration accompanied by TDP-43 accumulation, and patients with homozygous mutations in the PGRN gene present with neuronal ceroid lipofuscinosis. Although it remains unknown why PGRN deficiency causes neurodegenerative diseases, there is increasing evidence that PGRN is implicated in lysosomal functions. Here, we show PGRN is a secretory lysosomal protein that regulates lysosomal function and biogenesis by controlling the acidification of lysosomes. PGRN gene expression and protein levels increased concomitantly with the increase of lysosomal biogenesis induced by lysosome alkalizers or serum starvation. Down-regulation or insufficiency of PGRN led to the increased lysosomal gene expression and protein levels, while PGRN overexpression led to the decreased lysosomal gene expression and protein levels. In particular, the level of mature cathepsin D (CTSDmat) dramatically changed depending upon PGRN levels. The acidification of lysosomes was facilitated in cells transfected with PGRN. Then, this caused degradation of CTSDmat by cathepsin B. Secreted PGRN is incorporated into cells via sortilin or cation-independent mannose 6-phosphate receptor, and facilitated the acidification of lysosomes and degradation of CTSDmat. Moreover, the change of PGRN levels led to a cell-type-specific increase of insoluble TDP-43. In the brain tissue of FTLD-TDP patients with PGRN deficiency, CTSD and phosphorylated TDP-43 accumulated in neurons. Our study provides new insights into the physiological function of PGRN and the role of PGRN insufficiency in the pathogenesis of neurodegenerative diseases. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Validation of a questionnaire measuring the regulation of autonomic function

    Directory of Open Access Journals (Sweden)

    Matthes H

    2008-06-01

    Full Text Available Abstract Background To broaden the range of outcomes that we can measure for patients undergoing treatment for oncological and other chronic conditions, we aimed to validate a questionnaire measuring self-reported autonomic regulation (aR, i.e. to characterise a subject's autonomic functioning by questions on sleeping and waking, vertigo, morningness-eveningness, thermoregulation, perspiration, bowel movements and digestion. Methods We administered the questionnaire to 440 participants (♀: N = 316, ♂: N = 124: 95 patients with breast cancer, 49 with colorectal cancer, 60 with diabetes mellitus, 39 with coronary heart disease, 28 with rheumatological conditions, 32 with Hashimoto's disease, 22 with multiple morbidities and 115 healthy people. We administered the questionnaire a second time to 50.2% of the participants. External convergence criteria included the German version of the Hospital Anxiety and Depression Scale (HADS-D, a short questionnaire on morningness-eveningness, the Herdecke Quality of Life Questionnaire (HLQ and a short version questionnaire on self-regulation. Results A principal component analysis yielded a three dimensional 18-item inventory of aR. The subscales orthostatic-circulatory, rest/activity and digestive regulation had internal consistency (Cronbach-α: rα = 0.65 – 0.75 and test-retest reliability (rrt = 0.70 – 85. AR was negatively associated with anxiety, depression, and dysmenorrhoea but positively correlated to HLQ, self-regulation and in part to morningness (except digestive aR (0.49 – 0.13, all p Conclusion An internal validation of the long-version scale of aR yielded consistent relationships with health versus illness, quality of life and personality. Further studies are required to clarify the issues of external validity, clinical and physiological relevance.

  7. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  8. What Health-Related Functions Are Regulated by the Nervous System?

    Science.gov (United States)

    ... What health-related functions are regulated by the nervous system? The nervous system plays a role in nearly every aspect of ... feeling emotions. Functions that are regulated by the nervous system include (but are not limited to): Brain growth ...

  9. Functional Imaging of Autonomic Regulation: Methods and Key Findings

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    2016-01-01

    Full Text Available Central nervous system processing of autonomic function involves a network of regions throughout the brain which can be visualized and measured with neuroimaging techniques, notably functional magnetic resonance imaging (fMRI. The development of fMRI procedures has both confirmed and extended earlier findings from animal models, and human stroke and lesion studies. Assessments with fMRI can elucidate interactions between different central sites in regulating normal autonomic patterning, and demonstrate how disturbed systems can interact to produce aberrant regulation during autonomic challenges. Understanding autonomic dysfunction in various illnesses reveals mechanisms that potentially lead to interventions in the impairments. The objectives here are to: 1 describe the fMRI neuroimaging methodology for assessment of autonomic neural control, 2 outline the widespread, lateralized distribution of function in autonomic sites in the normal brain which includes structures from the neocortex through the medulla and cerebellum, 3 illustrate the importance of the time course of neural changes when coordinating responses, and how those patterns are impacted in conditions of sleep-disordered breathing, and 4 highlight opportunities for future research studies with emerging methodologies. Methodological considerations specific to autonomic testing include timing of challenges relative to the underlying fMRI signal, spatial resolution sufficient to identify autonomic brainstem nuclei, blood pressure and blood oxygenation influences on the fMRI signal, and the sustained timing, often measured in minutes of challenge periods and recovery. Key findings include the lateralized nature of autonomic organization, which is reminiscent of asymmetric motor, sensory and language pathways. Testing brain function during autonomic challenges demonstrate closely-integrated timing of responses in connected brain areas during autonomic challenges, and the involvement with

  10. Glucose metabolism regulates T cell activation, differentiation and functions

    Directory of Open Access Journals (Sweden)

    Clovis Steve Palmer

    2015-01-01

    Full Text Available The adaptive immune system is equipped to eliminate both tumors and pathogenic microorganisms. It requires a series of complex and coordinated signals to drive the activation, proliferation and differentiation of appropriate T cell subsets. It is now established that changes in cellular activation are coupled to profound changes in cellular metabolism. In addition, emerging evidence now suggest that specific metabolic alterations associated with distinct T cell subsets may be ancillary to their differentiation and influential in their immune functions. The Warburg effect originally used to describe a phenomenon in which most cancer cells relied on aerobic glycolysis for their growth is a key process that sustain T cell activation and differentiation. Here we review how different aspects of metabolism in T cells influence their functions, focusing on the emerging role of key regulators of glucose metabolism such as HIF-1α. A thorough understanding of the role of metabolism in T cell function could provide insights into mechanisms involved in inflammatory-mediated conditions, with the potential for developing novel therapeutic approaches to treat these diseases.

  11. Serotonin regulates osteoblast proliferation and function in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Dai, S.Q.; Yu, L.P. [Department of Orthopedic Surgery, The First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu (China); Shi, X. [Department of Obstetrics and Gynecology, The First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu (China); Wu, H. [Emergency Department, The First Affiliated Hospital, Soochow University, Suzhou (China); Shao, P.; Yin, G.Y.; Wei, Y.Z. [Department of Orthopedic Surgery, The First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu (China)

    2014-08-01

    The monoamine serotonin (5-hydroxytryptamine, 5-HT), a well-known neurotransmitter, also has important functions outside the central nervous system. The objective of this study was to investigate the role of 5-HT in the proliferation, differentiation, and function of osteoblasts in vitro. We treated rat primary calvarial osteoblasts with various concentrations of 5-HT (1 nM to 10 µM) and assessed the rate of osteoblast proliferation, expression levels of osteoblast-specific proteins and genes, and the ability to form mineralized nodules. Next, we detected which 5-HT receptor subtypes were expressed in rat osteoblasts at different stages of osteoblast differentiation. We found that 5-HT could inhibit osteoblast proliferation, differentiation, and mineralization at low concentrations, but this inhibitory effect was mitigated at relatively high concentrations. Six of the 5-HT receptor subtypes (5-HT{sub 1A}, 5-HT{sub 1B}, 5-HT{sub 1D}, 5-HT{sub 2A}, 5-HT{sub 2B}, and 5-HT{sub 2C}) were found to exist in rat osteoblasts. Of these, 5-HT{sub 2A} and 5-HT{sub 1B} receptors had the highest expression levels, at both early and late stages of differentiation. Our results indicated that 5-HT can regulate osteoblast proliferation and function in vitro.

  12. Mammalian enabled (Mena) is a critical regulator of cardiac function.

    Science.gov (United States)

    Aguilar, Frédérick; Belmonte, Stephen L; Ram, Rashmi; Noujaim, Sami F; Dunaevsky, Olga; Protack, Tricia L; Jalife, Jose; Todd Massey, H; Gertler, Frank B; Blaxall, Burns C

    2011-05-01

    Mammalian enabled (Mena) of the Drosophila enabled/vasodilator-stimulated phosphoprotein gene family is a cytoskeletal protein implicated in actin regulation and cell motility. Cardiac Mena expression is enriched in intercalated discs (ICD), the critical intercellular communication nexus between adjacent muscle cells. We previously identified Mena gene expression to be a key predictor of human and murine heart failure (HF). To determine the in vivo function of Mena in the heart, we assessed Mena protein expression in multiple HF models and characterized the effects of genetic Mena deletion on cardiac structure and function. Immunoblot analysis revealed significant upregulation of Mena protein expression in left ventricle tissue from patients with end-stage HF, calsequestrin-overexpressing mice, and isoproterenol-infused mice. Characterization of the baseline cardiac function of adult Mena knockout mice (Mena(-/-)) via echocardiography demonstrated persistent cardiac dysfunction, including a significant reduction in percent fractional shortening compared with wild-type littermates. Electrocardiogram PR and QRS intervals were significantly prolonged in Mena(-/-) mice, manifested by slowed conduction on optical mapping studies. Ultrastructural analysis of Mena(-/-) hearts revealed disrupted organization and widening of ICD structures, mislocalization of the gap junction protein connexin 43 (Cx43) to the lateral borders of cardiomyoycytes, and increased Cx43 expression. Furthermore, the expression of vinculin (an adherens junction protein) was significantly reduced in Mena(-/-) mice. We report for the first time that genetic ablation of Mena results in cardiac dysfunction, highlighted by diminished contractile performance, disrupted ICD structure, and slowed electrical conduction.

  13. Roquin Paralogs Differentially Regulate Functional NKT Cell Subsets.

    Science.gov (United States)

    Drees, Christoph; Vahl, J Christoph; Bortoluzzi, Sabrina; Heger, Klaus D; Fischer, Julius C; Wunderlich, F Thomas; Peschel, Christian; Schmidt-Supprian, Marc

    2017-04-01

    NKT cells represent a small subset of glycolipid-recognizing T cells that are heavily implicated in human allergic, autoimmune, and malignant diseases. In the thymus, precursor cells recognize self-glycolipids by virtue of their semi-invariant TCR, which triggers NKT cell lineage commitment and maturation. During their development, NKT cells are polarized into the NKT1, NKT2, and NKT17 subsets, defined through their cytokine-secretion patterns and the expression of key transcription factors. However, we have largely ignored how the differentiation into the NKT cell subsets is regulated. In this article, we describe the mRNA-binding Roquin-1 and -2 proteins as central regulators of murine NKT cell fate decisions. In the thymus, T cell-specific ablation of the Roquin paralogs leads to a dramatic expansion of NKT17 cells, whereas peripheral mature NKT cells are essentially absent. Roquin-1/2-deficient NKT17 cells show exaggerated lineage-specific expression of nearly all NKT17-defining proteins tested. We show through mixed bone marrow chimera experiments that NKT17 polarization is mediated through cell-intrinsic mechanisms early during NKT cell development. In contrast, the loss of peripheral NKT cells is due to cell-extrinsic factors. Surprisingly, Roquin paralog-deficient NKT cells are, in striking contrast to conventional T cells, compromised in their ability to secrete cytokines. Altogether, we show that Roquin paralogs regulate the development and function of NKT cell subsets in the thymus and periphery. Copyright © 2017 by The American Association of Immunologists, Inc.

  14. Polyamines Function in Stress Tolerance: From Synthesis to Regulation

    Directory of Open Access Journals (Sweden)

    Ji-Hong eLiu

    2015-10-01

    Full Text Available Plants are challenged by a variety of biotic or abiotic stresses, which can affect their growth and development, productivity and geographic distribution. In order to survive adverse environmental conditions, plants have evolved various adaptive strategies, among which is the accumulation of metabolites that play protective roles. A well-established example of the metabolites that are involved in stress responses, or stress tolerance, is the low-molecular-weight aliphatic polyamines, including putrescine,spermidine and spermine. The critical role of polyamines in stress tolerance is suggested by several lines of evidence: firstly, the transcript levels of polyamine biosynthetic genes, as well as the activities of the corresponding enzymes, are induced by stresses; secondly, elevation of endogenous polyamine levels by exogenous supply of polyamines, or overexpression of polyamine biosynthetic genes, results in enhanced stress tolerance; and thirdly, a reduction of endogenous polyamines is accompanied by compromised stress tolerance. A number of studies have demonstrated that polyamines function in stress tolerance largely by modulating the homeostasis of reactive oxygen species (ROS due to their direct, or indirect, roles in regulating antioxidant systems or suppressing ROS production. The transcriptional regulation of polyamine synthesis by transcription factors is also reviewed here. Meanwhile, future perspectives on polyamine research are also suggested.

  15. MEIS1 functions as a potential AR negative regulator

    International Nuclear Information System (INIS)

    Cui, Liang; Li, Mingyang; Feng, Fan; Yang, Yutao; Hang, Xingyi; Cui, Jiajun; Gao, Jiangping

    2014-01-01

    The androgen receptor (AR) plays critical roles in human prostate carcinoma progression and transformation. However, the activation of AR is regulated by co-regulators. MEIS1 protein, the homeodomain transcription factor, exhibited a decreased level in poor-prognosis prostate tumors. In this study, we investigated a potential interaction between MEIS1 and AR. We found that overexpression of MEIS1 inhibited the AR transcriptional activity and reduced the expression of AR target gene. A potential protein–protein interaction between AR and MEIS1 was identified by the immunoprecipitation and GST pull-down assays. Furthermore, MEIS1 modulated AR cytoplasm/nucleus translocation and the recruitment to androgen response element in prostate specific antigen (PSA) gene promoter sequences. In addition, MEIS1 promoted the recruitment of NCoR and SMRT in the presence of R1881. Finally, MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells. Taken together, our data suggests that MEIS1 functions as a novel AR co-repressor. - Highlights: • A potential interaction was identified between MEIS1 and AR signaling. • Overexpression of MEIS1 reduced the expression of AR target gene. • MEIS1 modulated AR cytoplasm/nucleus translocation. • MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells

  16. MEIS1 functions as a potential AR negative regulator

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Liang [Department of Urology, Chinese PLA Medical School/Chinese PLA General Hospital, Beijing 100853 (China); Department of Urology, Civil Aviation General Hospital/Civil Aviation Medical College of Peking University, Beijing 100123 (China); Li, Mingyang [Department of Gastroenterology, Nan Lou Division, Chinese PLA Medical School/Chinese PLA General Hospital, Beijing 100853 (China); Feng, Fan [Department of Pharmacy, General Hospital of Shenyang Military Command, Shenyang 110016 (China); Yang, Yutao [Beijing Institute for Neuroscience, Capital Medical University, Beijing 100069 (China); Hang, Xingyi [National Scientific Data Sharing Platform for Population and Health, Beijing 100730 (China); Cui, Jiajun, E-mail: cuijn@ucmail.uc.edu [Department of Cancer and Cell Biology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 (United States); Gao, Jiangping, E-mail: jpgao@163.com [Department of Urology, Chinese PLA Medical School/Chinese PLA General Hospital, Beijing 100853 (China)

    2014-10-15

    The androgen receptor (AR) plays critical roles in human prostate carcinoma progression and transformation. However, the activation of AR is regulated by co-regulators. MEIS1 protein, the homeodomain transcription factor, exhibited a decreased level in poor-prognosis prostate tumors. In this study, we investigated a potential interaction between MEIS1 and AR. We found that overexpression of MEIS1 inhibited the AR transcriptional activity and reduced the expression of AR target gene. A potential protein–protein interaction between AR and MEIS1 was identified by the immunoprecipitation and GST pull-down assays. Furthermore, MEIS1 modulated AR cytoplasm/nucleus translocation and the recruitment to androgen response element in prostate specific antigen (PSA) gene promoter sequences. In addition, MEIS1 promoted the recruitment of NCoR and SMRT in the presence of R1881. Finally, MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells. Taken together, our data suggests that MEIS1 functions as a novel AR co-repressor. - Highlights: • A potential interaction was identified between MEIS1 and AR signaling. • Overexpression of MEIS1 reduced the expression of AR target gene. • MEIS1 modulated AR cytoplasm/nucleus translocation. • MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells.

  17. RNA-Mediated Regulation of HMGA1 Function

    Directory of Open Access Journals (Sweden)

    Arndt G. Benecke

    2015-05-01

    Full Text Available The high mobility group protein A1 (HMGA1 is a master regulator of chromatin structure mediating its major gene regulatory activity by direct interactions with A/T-rich DNA sequences located in the promoter and enhancer regions of a large variety of genes. HMGA1 DNA-binding through three AT-hook motifs results in an open chromatin structure and subsequently leads to changes in gene expression. Apart from its significant expression during development, HMGA1 is over-expressed in virtually every cancer, where HMGA1 expression levels correlate with tumor malignancy. The exogenous overexpression of HMGA1 can lead to malignant cell transformation, assigning the protein a key role during cancerogenesis. Recent studies have unveiled highly specific competitive interactions of HMGA1 with cellular and viral RNAs also through an AT-hook domain of the protein, significantly impacting the HMGA1-dependent gene expression. In this review, we discuss the structure and function of HMGA1-RNA complexes during transcription and epigenomic regulation and their implications in HMGA1-related diseases.

  18. Regulation and function of DNA methylation in plants and animals

    KAUST Repository

    He, Xinjian

    2011-02-15

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

  19. Pro-Resolving Mediators in Regulating and Conferring Macrophage Function

    Directory of Open Access Journals (Sweden)

    Jesmond Dalli

    2017-11-01

    Full Text Available Macrophages are central in coordinating the host response to both sterile and infective insults. Clearance of apoptotic cells and cellular debris is a key biological action preformed by macrophages that paves the way to the resolution of local inflammation, repair and regeneration of damaged tissues, and re-establishment of function. The essential fatty acid-derived autacoids termed specialized pro-resolving mediators (SPM play central roles in promoting these processes. In the present article, we will review the role of microvesicles in controlling macrophage efferocytosis and SPM production. We will also discuss the role of both apoptotic cells and microvesicles in providing substrate for transcellular biosynthesis of several SPM families during efferocyotsis. In addition, this article will discuss the biological actions of the recently uncovered macrophage-derived SPM termed maresins. These mediators are produced via 14-lipoxygenation of docosahexaenoic acid that is either enzymatically converted to mediators carrying two hydroxyl groups or to autacoids that are peptide-lipid conjugates, coined maresin conjugates in tissue regeneration. The formation of these mediators is temporally regulated during acute self-limited infectious-inflammation where they promote the uptake and clearance of apoptotic cells, regulate several aspects of the tissue repair and regeneration, and display potent anti-nociceptive actions.

  20. Cyclic guanosine monophosphate in the regulation of the cell function

    Directory of Open Access Journals (Sweden)

    Małgorzata Zbrojkiewicz

    2016-12-01

    Full Text Available Intracellular concentration of cGMP depends on the activity of guanylate cyclase, responsible for its synthesis, on the activity of cyclic nucleotide degrading enzymes - phosphodiesterases (PDEs. There are two forms of guanylate cyclase: the membrane-bound cyclase and the soluble form. The physiological activators of the membrane guanylate cyclase are natriuretic peptides (NPs, and of the cytosolic guanylate cyclase - nitric oxide (NO and carbon monoxide (CO. Intracellular cGMP signaling pathways arise from its direct effect on the activity of G protein kinases, phosphodiesterases and cyclic nucleotide dependent cation channels. It has been shown in recent years that cGMP can also affect other signal pathways in cell signaling activity involving Wnt proteins and sex hormones. The increased interest in the research on the role of cGMP, resulted also in the discovery of its role in the regulation of phototransduction in the eye, neurotransmission, calcium homeostasis, platelet aggregation, heartbeat, bone remodeling, lipid metabolism and the activity of the cation channels. Better understanding of the mechanisms of action of cGMP in the regulation of cell function can create new opportunities for the cGMP affecting drugs use in the pharmacotherapy.

  1. Class IIa histone deacetylases are conserved regulators of circadian function.

    Science.gov (United States)

    Fogg, Paul C M; O'Neill, John S; Dobrzycki, Tomasz; Calvert, Shaun; Lord, Emma C; McIntosh, Rebecca L L; Elliott, Christopher J H; Sweeney, Sean T; Hastings, Michael H; Chawla, Sangeeta

    2014-12-05

    Class IIa histone deacetylases (HDACs) regulate the activity of many transcription factors to influence liver gluconeogenesis and the development of specialized cells, including muscle, neurons, and lymphocytes. Here, we describe a conserved role for class IIa HDACs in sustaining robust circadian behavioral rhythms in Drosophila and cellular rhythms in mammalian cells. In mouse fibroblasts, overexpression of HDAC5 severely disrupts transcriptional rhythms of core clock genes. HDAC5 overexpression decreases BMAL1 acetylation on Lys-537 and pharmacological inhibition of class IIa HDACs increases BMAL1 acetylation. Furthermore, we observe cyclical nucleocytoplasmic shuttling of HDAC5 in mouse fibroblasts that is characteristically circadian. Mutation of the Drosophila homolog HDAC4 impairs locomotor activity rhythms of flies and decreases period mRNA levels. RNAi-mediated knockdown of HDAC4 in Drosophila clock cells also dampens circadian function. Given that the localization of class IIa HDACs is signal-regulated and influenced by Ca(2+) and cAMP signals, our findings offer a mechanism by which extracellular stimuli that generate these signals can feed into the molecular clock machinery. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Executive function and self-regulated exergaming adherence

    Directory of Open Access Journals (Sweden)

    Cay eAnderson-Hanley

    2014-12-01

    Full Text Available The rise in dementia and the evidence of cognitive benefits of exercise for the older adult population together make salient the research into variables affecting cognitive benefit and exercise behavior. One promising avenue for increasing exercise participation has been the introduction of exergaming, a type of exercise that works in combination with virtual reality to enhance both the exercise experience and health outcomes. Past research has revealed that executive function (EF was related to greater use of self-regulatory strategies, which in turn was related to greater adherence to exercise following an intervention (McAuley et al., 2011. Best et al. (2014 found improvement in EF related to adherence to exercise post- intervention. Anderson-Hanley et al. (2012 found that for older adults aerobic exergaming yielded greater cognitive benefit than traditional exercise alone; however, questions remain as to the possible impact of greater cognitive benefit and other factors on participants’ involvement in exercise following the end of an intervention. The current study presents follow-up data exploring the relationship between change in EF, self-regulation, and exercise adherence in the post-intervention (naturalistic period. Herein, it was predicted that improvement in EF during an exercise intervention, would predict subsequent exercise with an exergame during the naturalistic window. Contrary to expectations, results suggest that those with EF decline during the intervention used the exergame more frequently. The results of this study contradict previous literature, but suggest an interesting relationship between change in executive function, self-regulation, and exercise behaviors when exergaming is employed, particularly with older adults with some cognitive decline. We hypothesize that other factors may be at work; perhaps expectation of cognitive benefit might act as a unique motivator or caregivers may be instrumental in adherence.

  3. Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

    Science.gov (United States)

    von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

    2017-11-06

    The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  5. Roles of p63 in epidermal development and tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeng-Yuan Yao

    2012-12-01

    Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

  6. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  7. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  8. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  10. The Development of Self-Regulation and Executive Function in Young Children

    Science.gov (United States)

    McClelland, Megan M.; Tominey, Shauna L.

    2014-01-01

    Self-regulation lays the foundation for positive social relationships and academic success. In this article, we provide an overview of self-regulation and the key terms related to selfregulation, such as executive function. We discuss research on how self-regulation develops and connections between self-regulation and social and academic outcomes.…

  11. Structure, Function and Regulation of the Hsp90 Machinery

    Directory of Open Access Journals (Sweden)

    Jing Li

    2013-06-01

    Full Text Available Heat shock protein 90 (Hsp90 is an ATP-dependent molecular chaperone which is essential in eukaryotes. It is required for the activation and stabilization of a wide variety of client proteins and many of them are involved in important cellular pathways. Since Hsp90 affects numerous physiological processes such as signal transduction, intracellular transport, and protein degradation, it became an interesting target for cancer therapy. Structurally, Hsp90 is a flexible dimeric protein composed of three different domains which adopt structurally distinct conformations. ATP binding triggers directionality in these conformational changes and leads to a more compact state. To achieve its function, Hsp90 works together with a large group of cofactors, termed co-chaperones. Co-chaperones form defined binary or ternary complexes with Hsp90, which facilitate the maturation of client proteins. In addition, posttranslational modifications of Hsp90, such as phosphorylation and acetylation, provide another level of regulation. They influence the conformational cycle, co-chaperone interaction, and inter-domain communications. In this review, we discuss the recent progress made in understanding the Hsp90 machinery.

  12. Nature and regulation of the insulin receptor: structure and function

    International Nuclear Information System (INIS)

    Czech, M.P.

    1985-01-01

    Native, cell-surface insulin receptor consists of two glycoprotein subunit types with apparent masses of about 125,000 daltons (alpha subunit) and 90,000 daltons (beta subunit). The alpha and beta insulin-receptor subunits seem to have distinct functions such that alpha appears to bind hormone whereas beta appears to possess intrinsic tyrosine kinase activity. In detergent extracts, insulin activates receptor autophosphorylation of tyrosine residues on its beta subunit, whereas in the presence of reductant, the alpha subunit is also phosphorylated. In intact cells, insulin activates serine/threonine phosphorylation of insulin receptor beta subunit as well as tyrosine phosphorylation. The biological role of the receptor-associated tyrosine kinase is not known. The insulin receptor kinase is regulated by beta-adrenergic agonists and other agents that elevate cAMP in adipocytes, presumably via the cAMP-dependent protein kinase. Such agents decrease receptor affinity for insulin and partially uncouple receptor tyrosine kinase activity from activation by insulin. These effects appear to contribute to the biological antagonism between insulin and beta-agonists. These data suggest the hypothesis that a complex network of tyrosine and serine/threonine phosphorylations on the insulin receptor modulate its binding and kinase activities in an antagonistic manner

  13. Human endometrial milk fat globule-epidermal growth factor 8 (MFGE8) is up regulated by estradiol at the transcriptional level, and its secretion via microvesicles is stimulated by human chorionic gonadotropin (hCG)

    KAUST Repository

    Sarhan, Abbaa; Bocca, Silvina; Yu, Liang; Anderson, Sandra; Jacot, Terry; Burch, Tanya; Nyalwidhe, Julius O; Sullivan, Claretta; Kaur, Mandeep; Bajic, Vladimir B.; Oehninger, Sergio

    2013-01-01

    Conclusions: We demonstrated (i) dual effects of E2 and hCG on the regulation of MFGE8, and (ii) MFGE8 protein secretion in association with microvesicles. MFGE8 has the potential to modulate endometrial function and implantation via exocrine and/ or paracrine-autocrine effects. To the best of our knowledge, this is the first demonstration of microvesicular secretion of any regulatory protein by endometrial epithelial cells, providing initial evidence suggestive of microvesicular participation in cellular trafficking information in the non-pregnant and pregnant endometrium.

  14. Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

    Directory of Open Access Journals (Sweden)

    Shadmehr Demehri

    2008-05-01

    Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

  15. The Mediating Role of Metacognition in the Relationship between Executive Function and Self-Regulated Learning

    Science.gov (United States)

    Follmer, D. Jake; Sperling, Rayne A.

    2016-01-01

    Background: Researchers have demonstrated significant relations among executive function, metacognition, and self-regulated learning. However, prior research emphasized the use of indirect measures of executive function and did not evaluate how specific executive functions are related to participants' self-regulated learning. Aims: The primary…

  16. Regulation of adult neural progenitor cell functions by purinergic signaling.

    Science.gov (United States)

    Tang, Yong; Illes, Peter

    2017-02-01

    Extracellular purines are signaling molecules in the neurogenic niches of the brain and spinal cord, where they activate cell surface purinoceptors at embryonic neural stem cells (NSCs) and adult neural progenitor cells (NPCs). Although mRNA and protein are expressed at NSCs/NPCs for almost all subtypes of the nucleotide-sensitive P2X/P2Y, and the nucleoside-sensitive adenosine receptors, only a few of those have acquired functional significance. ATP is sequentially degraded by ecto-nucleotidases to ADP, AMP, and adenosine with agonistic properties for distinct receptor-classes. Nucleotides/nucleosides facilitate or inhibit NSC/NPC proliferation, migration and differentiation. The most ubiquitous effect of all agonists (especially of ATP and ADP) appears to be the facilitation of cell proliferation, usually through P2Y1Rs and sometimes through P2X7Rs. However, usually P2X7R activation causes necrosis/apoptosis of NPCs. Differentiation can be initiated by P2Y2R-activation or P2X7R-blockade. A key element in the transduction mechanism of either receptor is the increase of the intracellular free Ca 2+ concentration, which may arise due to its release from intracellular storage sites (G protein-coupling; P2Y) or due to its passage through the receptor-channel itself from the extracellular space (ATP-gated ion channel; P2X). Further research is needed to clarify how purinergic signaling controls NSC/NPC fate and how the balance between the quiescent and activated states is established with fine and dynamic regulation. GLIA 2017;65:213-230. © 2016 Wiley Periodicals, Inc.

  17. Regulation of Cellular and Molecular Functions by Protein ...

    Indian Academy of Sciences (India)

    ... a high-energy linkage. The free energy of hydrolysis 1 of protein bound tyrosine phosphate ... protein kinases, cdc2 kinase (which regulates cell division cycle) and related cdc ... residues in response to extracellular signals such as hormones or growth factors. ... involved in regulating glycogen metabolism. The activity of.

  18. Functional foods: regulation and innovations in the EU

    NARCIS (Netherlands)

    Moors, E.H.M.

    2012-01-01

    Worldwide consumers are becoming more interested in the relation between food and health. In order to harmonize regulation on foods throughout the EU, the Regulation EC1924/2006 on nutrition and health claims came into force, as a first specific set of EU legal rules dealing with nutrition and

  19. Proteomics of red and white corolla limbs in petunia reveals a novel function of the anthocyanin regulator ANTHOCYANIN1 in determining flower longevity

    NARCIS (Netherlands)

    Prinsi, B.; Negri, A.S.; Quattrocchio, F.; Koes, R.E.; Espen, L.

    2016-01-01

    The Petunia hybrida ANTHOCYANIN1 (AN1) gene encodes a transcription factor that regulates both the expression of genes involved in anthocyanin synthesis and the acidification of the vacuolar lumen in corolla epidermal cells. In this work, the comparison between the red flowers of the R27 line with

  20. DMPD: New insights into NF-kappaB regulation and function. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18775672 New insights into NF-kappaB regulation and function. Sun SC, Ley SC. Trend...ction. PubmedID 18775672 Title New insights into NF-kappaB regulation and function....s Immunol. 2008 Oct;29(10):469-78. Epub 2008 Sep 3. (.png) (.svg) (.html) (.csml) Show New insights into NF-kappaB regulation and fun

  1. Regulation of PPARγ function by TNF-α

    International Nuclear Information System (INIS)

    Ye Jianping

    2008-01-01

    The nuclear receptor PPARγ is a lipid sensor that regulates lipid metabolism through gene transcription. Inhibition of PPARγ activity by TNF-α is involved in pathogenesis of insulin resistance, atherosclerosis, inflammation, and cancer cachexia. PPARγ activity is regulated by TNF-α at pre-translational and post-translational levels. Activation of serine kinases including IKK, ERK, JNK, and p38 may be involved in the TNF-regulation of PPARγ. Of the four kinases, IKK is a dominant signaling molecule in the TNF-regulation of PPARγ. IKK acts through at least two mechanisms: inhibition of PPARγ expression and activation of PPARγ corepressor. In this review article, literature is reviewed with a focus on the mechanisms of PPARγ inhibition by TNF-α

  2. Regulation of PPAR{gamma} function by TNF-{alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Ye Jianping [Pennington Biomedical Research Center, Louisiana State University System, 6400 Perkins Road, Baton Rouge, LA 70808 (United States)], E-mail: yej@pbrc.edu

    2008-09-26

    The nuclear receptor PPAR{gamma} is a lipid sensor that regulates lipid metabolism through gene transcription. Inhibition of PPAR{gamma} activity by TNF-{alpha} is involved in pathogenesis of insulin resistance, atherosclerosis, inflammation, and cancer cachexia. PPAR{gamma} activity is regulated by TNF-{alpha} at pre-translational and post-translational levels. Activation of serine kinases including IKK, ERK, JNK, and p38 may be involved in the TNF-regulation of PPAR{gamma}. Of the four kinases, IKK is a dominant signaling molecule in the TNF-regulation of PPAR{gamma}. IKK acts through at least two mechanisms: inhibition of PPAR{gamma} expression and activation of PPAR{gamma} corepressor. In this review article, literature is reviewed with a focus on the mechanisms of PPAR{gamma} inhibition by TNF-{alpha}.

  3. Prepaid cards: how do they function? how are they regulated?

    OpenAIRE

    Mark Furletti

    2004-01-01

    This conference, sponsored by the Payment Cards Center, brought together prepaid card industry leaders and regulators to discuss how various prepaid-card systems work and the ways in which different state and federal laws can affect them. The conference featured sessions on bank- and merchant-issued gift cards, payroll cards, and flexible spending account cards. It also featured presentations by experts on Regulation E, the Federal Deposit Insurance Act, state money transmitter laws, and stat...

  4. Cdkal1, a type 2 diabetes susceptibility gene, regulates mitochondrial function in adipose tissue

    Directory of Open Access Journals (Sweden)

    Colin J. Palmer

    2017-10-01

    Conclusions: Cdkal1 is necessary for normal mitochondrial morphology and function in adipose tissue. These results suggest that the type 2 diabetes susceptibility gene CDKAL1 has novel functions in regulating mitochondrial activity.

  5. Emotional Expressivity and Emotion Regulation: Relation to Academic Functioning among Elementary School Children

    Science.gov (United States)

    Kwon, Kyongboon; Hanrahan, Amanda R.; Kupzyk, Kevin A.

    2017-01-01

    We examined emotional expressivity (i.e., happiness, sadness, and anger) and emotion regulation (regulation of exuberance, sadness, and anger) as they relate to academic functioning (motivation, engagement, and achievement). Also, we tested the premise that emotional expressivity and emotion regulation are indirectly associated with achievement…

  6. Functioning of spontaneous and induced Con A regulators of T-cell proliferation. Modifying factors

    International Nuclear Information System (INIS)

    Kuz'mina, E.G.

    1989-01-01

    It is shown that active spontaneous non-specific regulators of T-cell proliferation are activated in peripheral blood ''in vivo'' by endogenous metabolites; non-specific regulator action can be induced ''in vitro'' by Con A, FGA. Non-specific regulators suppress and increase lymphocyte proliferation. Cyclic character of their functioning is revealed. 4 refs.; 1 tab

  7. Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

    International Nuclear Information System (INIS)

    Wakshull, E.; Kraemer, P.M.; Wharton, W.

    1985-01-01

    Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

  8. [Regulation on EGFR function via its interacting proteins and its potential application].

    Science.gov (United States)

    Zheng, Jun-Fang; Chen, Hui-Min; He, Jun-Qi

    2013-12-01

    Epidermal growth factor receptor (EGFR) is imptortant for cell activities, oncogenesis and cell migration, and EGFR inhibitor can treat cancer efficiently, but its side effects, for example, in skin, limited its usage. On the other hand, EGFR interacting proteins may also lead to oncogenesis and its interacting protein as drug targets can avoid cutaneous side effect, which implies possibly a better outcome and life quality of cancer patients. For the multiple EGFR interaction proteins, B1R enhances Erk/MAPK signaling, while PTPN12, Kek1, CEACAM1 and NHERF repress Erk/MAPK signaling. CaM may alter charge of EGFR juxamembrane domain and regulate activation of PI3K/Akt and PLC-gamma/PKC. STAT1, STAT5b are widely thought to be activated by EGFR, while there is unexpectedly inhibiting sequence within EGFR to repress the activity of STATs. LRIG1 and ACK1 enhance the internalization and degration of EGFR, while NHERF and HIP1 repress it. In this article, proteins interacting with EGFR, their interacting sites and their regulation on EGFR signal transduction will be reviewed.

  9. Internalization mechanisms of the epidermal growth factor receptor after activation with different ligands.

    Directory of Open Access Journals (Sweden)

    Lasse Henriksen

    Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.

  10. Internalization Mechanisms of the Epidermal Growth Factor Receptor after Activation with Different Ligands

    Science.gov (United States)

    Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther

    2013-01-01

    The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148

  11. Emotional Regulation and Executive Function Deficits in Unmedicated Chinese Children with Oppositional Defiant Disorder

    OpenAIRE

    Jiang, Wenqing; Li, Yan; Du, Yasong; Fan, Juan

    2016-01-01

    Objective This study aims to explore the feature of emotional regulation and executive functions in oppositional defiant disorder (ODD) children. Methods The emotional regulation and executive functions of adolescents with ODD, as well as the relationship between the two factors were analyzed using tools including Adolescent Daily Emotional Regulation Questionnaire (ADERQ), Wisconsin Card Sorting Test (WCST) and Cambridge Neuropsychological Test Automated Battery (CANTAB), in comparison with ...

  12. The Role of ATP in the Regulation of NCAM Function

    DEFF Research Database (Denmark)

    Hübschmann, Martin; Skladchikova, Galina

    2008-01-01

    overlaps with the site of NCAM-FGFR interaction, and ATP is capable of disrupting NCAM-FGFR binding. This implies that NCAM signaling through FGFR can be regulated by ATP, which is supported by the observation that ATP can abrogate NCAM-induced neurite outgrowth. Finally, ATP can induce NCAM ectodomain...... shedding, possibly affecting the structural plasticity associated with learning and memory....

  13. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  14. Differential Regulation of Galectin Expression/Reactivity during Wound Healing in Porcine Skin and in Cultures if Epidermal Cells with Functional Impact on Migration

    Czech Academy of Sciences Publication Activity Database

    Klíma, Jiří; Lacina, L.; Dvořánková, B.; Hermann, D.; Carnwath, J. W.; Niemann, H.; Kaltner, H.; André, S.; Motlík, Jan; Gabius, H. J.; Smetana Jr., K.

    2009-01-01

    Roč. 58, č. 6 (2009), s. 873-884 ISSN 0862-8408 R&D Projects: GA MŠk 1M0538 Institutional research plan: CEZ:AV0Z50450515 Keywords : Epidermis * Keratinocytes * Lecitin Subject RIV: FH - Neurology Impact factor: 1.430, year: 2009

  15. Regulation of Hematopoietic Cell Development and Function Through Phosphoinositides

    Directory of Open Access Journals (Sweden)

    Mila Elich

    2018-05-01

    Full Text Available One of the most paramount receptor-induced signal transduction mechanisms in hematopoietic cells is production of the lipid second messenger phosphatidylinositol(3,4,5trisphosphate (PIP3 by class I phosphoinositide 3 kinases (PI3K. Defective PIP3 signaling impairs almost every aspect of hematopoiesis, including T cell development and function. Limiting PIP3 signaling is particularly important, because excessive PIP3 function in lymphocytes can transform them and cause blood cancers. Here, we review the key functions of PIP3 and related phosphoinositides in hematopoietic cells, with a special focus on those mechanisms dampening PIP3 production, turnover, or function. Recent studies have shown that beyond “canonical” turnover by the PIP3 phosphatases and tumor suppressors phosphatase and tensin homolog (PTEN and SH2 domain-containing inositol-5-phosphatase-1 (SHIP-1/2, PIP3 function in hematopoietic cells can also be dampened through antagonism with the soluble PIP3 analogs inositol(1,3,4,5tetrakisphosphate (IP4 and inositol-heptakisphosphate (IP7. Other evidence suggests that IP4 can promote PIP3 function in thymocytes. Moreover, IP4 or the kinases producing it limit store-operated Ca2+ entry through Orai channels in B cells, T cells, and neutrophils to control cell survival and function. We discuss current models for how soluble inositol phosphates can have such diverse functions and can govern as distinct processes as hematopoietic stem cell homeostasis, neutrophil macrophage and NK cell function, and development and function of B cells and T cells. Finally, we will review the pathological consequences of dysregulated IP4 activity in immune cells and highlight contributions of impaired inositol phosphate functions in disorders such as Kawasaki disease, common variable immunodeficiency, or blood cancer.

  16. Diverse microRNAs with convergent functions regulate tumorigenesis.

    Science.gov (United States)

    Zhu, Min-Yan; Zhang, Wei; Yang, Tao

    2016-02-01

    MicroRNAs (miRNAs) regulate several biological processes, including tumorigenesis. In order to comprehend the roles of miRNAs in cancer, various screens were performed to investigate the changes in the expression levels of miRNAs that occur in different types of cancer. The present review focuses on the results of five recent screens, whereby a number of overlapping miRNAs were identified to be downregulated or differentially regulated, whereas no miRNAs were observed to be frequently upregulated. Furthermore, the majority of the miRNAs that were common to >1 screen were involved in signaling networks, including wingless-related integration site, receptor tyrosine kinase and transforming growth factor-β, or in cell cycle checkpoint control. The present review will discuss the aforementioned miRNAs implicated in cell cycle checkpoint control and signaling networks.

  17. Functionality of the baroreceptor nerves in heart rate regulation

    DEFF Research Database (Denmark)

    Ottesen, Johnny T.; Olufsen, Mette

    2011-01-01

    are a consequence of the memory encapsulated by the models, and the nonlinearity gives rise to sigmoidal response curves. The nonlinear afferent baroreceptor models are coupled with an effector model, and the coupled model has been used to predict baroreceptor feedback regulation of heart rate during postural...... change from sitting to standing and during head-up tilt. The efferent model couples the afferent nerve paths to the sympathetic and parasympathetic outflow, and subsequently predicts the build up of an action potential at the sinus knot of the heart. In this paper, we analyze the nonlinear afferent model...... and show that the coupled model is able to predict heart rate regulation using blood pressure data as an input...

  18. Aurora-A regulates MCRS1 function during mitosis.

    Science.gov (United States)

    Meunier, Sylvain; Timón, Krystal; Vernos, Isabelle

    2016-07-02

    The mitotic spindle is made of microtubules (MTs) nucleated through different pathways involving the centrosomes, the chromosomes or the walls of pre-existing MTs. MCRS1 is a RanGTP target that specifically associates with the chromosome-driven MTs protecting them from MT depolymerases. MCRS1 is also needed for the control of kinetochore fiber (K-fiber) MT minus-ends dynamics in metaphase. Here, we investigated the regulation of MCRS1 activity in M-phase. We show that MCRS1 is phosphorylated by the Aurora-A kinase in mitosis on Ser35/36. Although this phosphorylation has no role on MCRS1 localization to chromosomal MTs and K-fiber minus-ends, we show that it regulates MCRS1 activity in mitosis. We conclude that Aurora-A activity is particularly important in the tuning of K-fiber minus-ends dynamics in mitosis.

  19. Small-molecule WNK inhibition regulates cardiovascular and renal function

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Ken; Park, Hyi-Man; Rigel, Dean F.; DiPetrillo, Keith; Whalen, Erin J.; Anisowicz, Anthony; Beil, Michael; Berstler, James; Brocklehurst, Cara Emily; Burdick, Debra A.; Caplan, Shari L.; Capparelli, Michael P.; Chen, Guanjing; Chen, Wei; Dale, Bethany; Deng, Lin; Fu, Fumin; Hamamatsu, Norio; Harasaki, Kouki; Herr, Tracey; Hoffmann, Peter; Hu, Qi-Ying; Huang, Waan-Jeng; Idamakanti, Neeraja; Imase, Hidetomo; Iwaki, Yuki; Jain, Monish; Jeyaseelan, Jey; Kato, Mitsunori; Kaushik, Virendar K.; Kohls, Darcy; Kunjathoor, Vidya; LaSala, Daniel; Lee, Jongchan; Liu, Jing; Luo, Yang; Ma, Fupeng; Mo, Ruowei; Mowbray, Sarah; Mogi, Muneto; Ossola, Flavio; Pandey, Pramod; Patel, Sejal J.; Raghavan, Swetha; Salem, Bahaa; Shanado, Yuka H.; Trakshel, Gary M.; Turner, Gordon; Wakai, Hiromichi; Wang, Chunhua; Weldon, Stephen; Wielicki, Jennifer B.; Xie, Xiaoling; Xu, Lingfei; Yagi, Yukiko I.; Yasoshima, Kayo; Yin, Jianning; Yowe, David; Zhang, Ji-Hu; Monovich, Gang Zheng Lauren (Novartis)

    2016-09-05

    The With-No-Lysine (K) (WNK) kinases play a critical role in blood pressure regulation and body fluid and electrolyte homeostasis. Herein, we introduce the first orally bioavailable pan-WNK-kinase inhibitor, WNK463, that exploits unique structural features of the WNK kinases for both affinity and kinase selectivity. In rodent models of hypertension, WNK463 affects blood pressure and body fluid and electro-lyte homeostasis, consistent with WNK-kinase-associated physiology and pathophysiology.

  20. Human endometrial milk fat globule-epidermal growth factor 8 (MFGE8) is up regulated by estradiol at the transcriptional level, and its secretion via microvesicles is stimulated by human chorionic gonadotropin (hCG)

    KAUST Repository

    Sarhan, Abbaa

    2013-10-17

    Objective: We have recently showed that MFGE8, a novel epithelial cell protein in the human endometrium, upregulated during the window of implantation. We hypothesized that MFGE8 may act as a key modulator of endometrial remodeling and trophoblast invasion. The aims of this study were (i) to investigate the in vitro regulation of human endometrial epithelial cells MFGE8 transcription, translation, and secretion by sex steroids and hCG; and (ii) to examine the possibility of MFGE8 secretion via microvesicles. Design: Experimental in vitro study using Ishikawa cells. Setting: University center. Interventions: Treatment with estradiol (E2), progesterone (P4), and human chorionic gonatropin (hCG). Main outcome measures: MFGE8 mRNA and protein expression, and identification of secreted microvesicles by mass spectrometry (MS) and immunoblotting. Results: E2, but not P4 or hCG, significantly upregulated MFGE8 mRNA expression. hCG significantly increased MFGE8 secretion. Microvesicels obtained after ultracentrifugation were visualized with atomic force microscopy ranging from ~100 to 200 nm. In addition to the expected 46 kD protein, the microvesicles contained a second form of secreted MFGE8 measuring ~30 kD which was confirmed by MS. Conclusions: We demonstrated (i) dual effects of E2 and hCG on the regulation of MFGE8, and (ii) MFGE8 protein secretion in association with microvesicles. MFGE8 has the potential to modulate endometrial function and implantation via exocrine and/ or paracrine-autocrine effects. To the best of our knowledge, this is the first demonstration of microvesicular secretion of any regulatory protein by endometrial epithelial cells, providing initial evidence suggestive of microvesicular participation in cellular trafficking information in the non-pregnant and pregnant endometrium.

  1. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  2. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  3. Apparatus and test method for characterizing the temperature regulating properties of thermal functional porous polymeric materials.

    Science.gov (United States)

    Yao, Bao-Guo; Zhang, Shan; Zhang, De-Pin

    2017-05-01

    In order to evaluate the temperature regulating properties of thermal functional porous polymeric materials such as fabrics treated with phase change material microcapsules, a new apparatus was developed. The apparatus and the test method can measure the heat flux, temperature, and displacement signals during the dynamic contact and then quickly give an evaluation for the temperature regulating properties by simulating the dynamic heat transfer and temperature regulating process when the materials contact the body skin. A series of indices including the psychosensory intensity, regulating capability index, and relative regulating index were defined to characterize the temperature regulating properties. The measurement principle, the evaluation criteria and grading method, the experimental setup and the test results discussion, and the gage capability analysis of the apparatus are presented. The new apparatus provides a method for the objective measurement and evaluation of the temperature regulating properties of thermal functional porous polymeric materials.

  4. PTP1B regulates Eph receptor function and trafficking

    OpenAIRE

    Nievergall, Eva; Janes, Peter W.; Stegmayer, Carolin; Vail, Mary E.; Haj, Fawaz G.; Teng, Shyh Wei; Neel, Benjamin G.; Bastiaens, Philippe I.; Lackmann, Martin

    2010-01-01

    Eph receptors orchestrate cell positioning during normal and oncogenic development. Their function is spatially and temporally controlled by protein tyrosine phosphatases (PTPs), but the underlying mechanisms are unclear and the identity of most regulatory PTPs are unknown. We demonstrate here that PTP1B governs signaling and biological activity of EphA3. Changes in PTP1B expression significantly affect duration and amplitude of EphA3 phosphorylation and biological function, whereas confocal ...

  5. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  6. Kindlin1 regulates microtubule function to ensure normal mitosis.

    Science.gov (United States)

    Patel, Hitesh; Stavrou, Ifigeneia; Shrestha, Roshan L; Draviam, Viji; Frame, Margaret C; Brunton, Valerie G

    2016-08-01

    Loss of Kindlin 1 (Kin1) results in the skin blistering disorder Kindler Syndrome (KS), whose symptoms also include skin atrophy and reduced keratinocyte proliferation. Kin1 binds to integrins to modulate their activation and more recently it has been shown to regulate mitotic spindles and cell survival in a Plk1-dependent manner. Here we report that short-term Kin1 deletion in mouse skin results in impaired mitosis, which is associated with reduced acetylated tubulin (ac-tub) levels and cell proliferation. In cells, impaired mitosis and reduced ac-tub levels are also accompanied by reduced microtubule stability, all of which are rescued by HDAC6 inhibition. The ability of Kin1 to regulate HDAC6-dependent cellular ac-tub levels is dependent on its phosphorylation by Plk1. Taken together, these data define a novel role for Kin1 in microtubule acetylation and stability and offer a mechanistic insight into how certain KS phenotypes, such as skin atrophy and reduced cell proliferation, arise. © The Author (2016). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS.

  7. Functions and regulation of quorum-sensing in Agrobacterium tumefaciens

    Directory of Open Access Journals (Sweden)

    Denis eFaure

    2014-01-01

    Full Text Available In Agrobacterium tumefaciens, horizontal transfer and vegetative replication of oncogenic Ti plasmids involve a cell-to-cell communication process called quorum-sensing (QS. The determinants of the QS-system belong to the LuxR/LuxI class. The LuxI-like protein TraI synthesizes N-acyl-homoserine lactone molecules which act as diffusible QS-signals. Beyond a threshold concentration, these molecules bind and activate the LuxR-like transcriptional regulator TraR, thereby initiating the QS-regulatory pathway. For the last twenty years, A. tumefaciens has stood as a prominent model in the understanding of the LuxR/LuxI type of QS systems. A number of studies also unveiled features which are unique to A. tumefaciens QS, some of them being directly related to the phytopathogenic lifestyle of the bacteria. In this review we will present the current knowledge of QS in A. tumefaciens at both the genetic and molecular levels. We will also describe how interactions with plant host modulate the QS pathway of A. tumefaciens, and discuss what could be the advantages for the agrobacteria to use such a tightly regulated QS-system to disseminate the Ti plasmids.

  8. Regulations on health/functional foods in Korea

    International Nuclear Information System (INIS)

    Kim, Ji Yeon; Kim, Dai Byung; Lee, Hyong Joo

    2006-01-01

    The term 'health/functional food' (HFF) refers to food supplements containing nutrients or other substances (in a concentrated form) that have a nutritional or physiological effect whose purpose is to supplement the normal diet. The Korean Health/Functional Food Act that came into effect in 2004 requires these products to be marketed in measured doses, such as in pills, tablets, capsules, and liquids. HFFs are of two types: generic and product-specific. There are 37 ingredients listed in the act for generic HFFs, and if an HFF contains a new active ingredient that is not included in the generic 37 products, it is considered a product-specific HFF. The standardization, safety, and efficacy of a new active ingredient are reviewed by the Korean Food and Drug Administration in order to receive approval as a product-specific HFF. Conforming with international standards and protecting public health requires constant upgrading of the Health/Functional Food Act

  9. The epidermal biosynthesis of cholecalciferol (vitamin D3)

    International Nuclear Information System (INIS)

    Beadle, P.C.

    1977-01-01

    An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

  10. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  11. Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

    Science.gov (United States)

    Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2014-02-01

    We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  12. Retinol Dehydrogenases Regulate Vitamin A Metabolism for Visual Function

    Directory of Open Access Journals (Sweden)

    Bhubanananda Sahu

    2016-11-01

    Full Text Available The visual system produces visual chromophore, 11-cis-retinal from dietary vitamin A, all-trans-retinol making this vitamin essential for retinal health and function. These metabolic events are mediated by a sequential biochemical process called the visual cycle. Retinol dehydrogenases (RDHs are responsible for two reactions in the visual cycle performed in retinal pigmented epithelial (RPE cells, photoreceptor cells and Müller cells in the retina. RDHs in the RPE function as 11-cis-RDHs, which oxidize 11-cis-retinol to 11-cis-retinal in vivo. RDHs in rod photoreceptor cells in the retina work as all-trans-RDHs, which reduce all-trans-retinal to all-trans-retinol. Dysfunction of RDHs can cause inherited retinal diseases in humans. To facilitate further understanding of human diseases, mouse models of RDHs-related diseases have been carefully examined and have revealed the physiological contribution of specific RDHs to visual cycle function and overall retinal health. Herein we describe the function of RDHs in the RPE and the retina, particularly in rod photoreceptor cells, their regulatory properties for retinoid homeostasis and future therapeutic strategy for treatment of retinal diseases.

  13. Regulation of adipocyte differentiation and function by polyunsaturated fatty acids

    DEFF Research Database (Denmark)

    Madsen, Lise; Petersen, Rasmus Koefoed; Kristiansen, Karsten

    2005-01-01

    factors currently implicated as key players in adipocyte differentiation and function, including peroxisome proliferator activated receptors (PPARs) (alpha, beta and gamma), sterol regulatory element binding proteins (SREBPs) and liver X receptors (LXRs). We review evidence that dietary n-3 PUFAs decrease...

  14. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  15. Epigenetic regulation of vascular smooth muscle cell function in atherosclerosis.

    Science.gov (United States)

    Findeisen, Hannes M; Kahles, Florian K; Bruemmer, Dennis

    2013-04-01

    Epigenetics involve heritable and acquired changes in gene transcription that occur independently of the DNA sequence. Epigenetic mechanisms constitute a hierarchic upper-level of transcriptional control through complex modifications of chromosomal components and nuclear structures. These modifications include, for example, DNA methylation or post-translational modifications of core histones; they are mediated by various chromatin-modifying enzymes; and ultimately they define the accessibility of a transcriptional complex to its target DNA. Integrating epigenetic mechanisms into the pathophysiologic concept of complex and multifactorial diseases such as atherosclerosis may significantly enhance our understanding of related mechanisms and provide promising therapeutic approaches. Although still in its infancy, intriguing scientific progress has begun to elucidate the role of epigenetic mechanisms in vascular biology, particularly in the control of smooth muscle cell phenotypes. In this review, we will summarize epigenetic pathways in smooth muscle cells, focusing on mechanisms involved in the regulation of vascular remodeling.

  16. FIG4 regulates lysosome membrane homeostasis independent of phosphatase function.

    Science.gov (United States)

    Bharadwaj, Rajnish; Cunningham, Kathleen M; Zhang, Ke; Lloyd, Thomas E

    2016-02-15

    FIG4 is a phosphoinositide phosphatase that is mutated in several diseases including Charcot-Marie-Tooth Disease 4J (CMT4J) and Yunis-Varon syndrome (YVS). To investigate the mechanism of disease pathogenesis, we generated Drosophila models of FIG4-related diseases. Fig4 null mutant animals are viable but exhibit marked enlargement of the lysosomal compartment in muscle cells and neurons, accompanied by an age-related decline in flight ability. Transgenic animals expressing Drosophila Fig4 missense mutations corresponding to human pathogenic mutations can partially rescue lysosomal expansion phenotypes, consistent with these mutations causing decreased FIG4 function. Interestingly, Fig4 mutations predicted to inactivate FIG4 phosphatase activity rescue lysosome expansion phenotypes, and mutations in the phosphoinositide (3) phosphate kinase Fab1 that performs the reverse enzymatic reaction also causes a lysosome expansion phenotype. Since FIG4 and FAB1 are present together in the same biochemical complex, these data are consistent with a model in which FIG4 serves a phosphatase-independent biosynthetic function that is essential for lysosomal membrane homeostasis. Lysosomal phenotypes are suppressed by genetic inhibition of Rab7 or the HOPS complex, demonstrating that FIG4 functions after endosome-to-lysosome fusion. Furthermore, disruption of the retromer complex, implicated in recycling from the lysosome to Golgi, does not lead to similar phenotypes as Fig4, suggesting that the lysosomal defects are not due to compromised retromer-mediated recycling of endolysosomal membranes. These data show that FIG4 plays a critical noncatalytic function in maintaining lysosomal membrane homeostasis, and that this function is disrupted by mutations that cause CMT4J and YVS. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Chondrocytic Atf4 regulates osteoblast differentiation and function via Ihh.

    Science.gov (United States)

    Wang, Weiguang; Lian, Na; Ma, Yun; Li, Lingzhen; Gallant, Richard C; Elefteriou, Florent; Yang, Xiangli

    2012-02-01

    Atf4 is a leucine zipper-containing transcription factor that activates osteocalcin (Ocn) in osteoblasts and indian hedgehog (Ihh) in chondrocytes. The relative contribution of Atf4 in chondrocytes and osteoblasts to the regulation of skeletal development and bone formation is poorly understood. Investigations of the Atf4(-/-);Col2a1-Atf4 mouse model, in which Atf4 is selectively overexpressed in chondrocytes in an Atf4-null background, demonstrate that chondrocyte-derived Atf4 regulates osteogenesis during development and bone remodeling postnatally. Atf4 overexpression in chondrocytes of the Atf4(-/-);Col2a1-Atf4 double mutants corrects the reduction in stature and limb in Atf4(-/-) embryos and rectifies the decrease in Ihh expression, Hh signaling, proliferation and accelerated hypertrophy that characterize the Atf4(-/-) developing growth plate cartilages. Unexpectedly, this genetic manipulation also restores the expression of osteoblastic marker genes, namely Ocn and bone sialoprotein, in Atf4(-/-) developing bones. In Atf4(-/-);Col2a1-Atf4 adult mice, all the defective bone parameters found in Atf4(-/-) mice, including bone volume, trabecular number and thickness, and bone formation rate, are rescued. In addition, the conditioned media of ex vivo cultures from wild-type or Atf4(-/-);Col2a1-Atf4, but not Atf4(-/-) cartilage, corrects the differentiation defects of Atf4(-/-) bone marrow stromal cells and Ihh-blocking antibody eliminates this effect. Together, these data indicate that Atf4 in chondrocytes is required for normal Ihh expression and for its paracrine effect on osteoblast differentiation. Therefore, the cell-autonomous role of Atf4 in chondrocytes dominates the role of Atf4 in osteoblasts during development for the control of early osteogenesis and skeletal growth.

  18. [Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

    Science.gov (United States)

    Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

    1992-07-01

    Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

  19. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  20. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  1. Surface regulated arsenenes as Dirac materials: From density functional calculations

    International Nuclear Information System (INIS)

    Yuan, Junhui; Xie, Qingxing; Yu, Niannian; Wang, Jiafu

    2017-01-01

    Highlights: • The presence of Dirac cones in chemically decorated buckled arsenene AsX (X = CN, NC, NCO, NCS, and NCSe) has been revealed. • First-principles calculations show that all these chemically decorated arsenenes are kinetically stable in defending thermal fluctuations in room temperature. - Abstract: Using first principle calculations based on density functional theory (DFT), we have systematically investigated the structure stability and electronic properties of chemically decorated arsenenes, AsX (X = CN, NC, NCO, NCS and NCSe). Phonon dispersion and formation energy analysis reveal that all the five chemically decorated buckled arsenenes are energetically favorable and could be synthesized. Our study shows that wide-bandgap arsenene would turn into Dirac materials when functionalized by -X (X = CN, NC, NCO, NCS and NCSe) groups, rendering new promises in next generation high-performance electronic devices.

  2. Regulation and Functional Expression of Cinnamate 4-Hydroxylase from Parsley

    Science.gov (United States)

    Koopmann, Edda; Logemann, Elke; Hahlbrock, Klaus

    1999-01-01

    A previously isolated parsley (Petroselinum crispum) cDNA with high sequence similarity to cinnamate 4-hydroxylase (C4H) cDNAs from several plant sources was expressed in yeast (Saccharomyces cerevisiae) containing a plant NADPH:cytochrome P450 oxidoreductase and verified as encoding a functional C4H (CYP73A10). Low genomic complexity and the occurrence of a single type of cDNA suggest the existence of only one C4H gene in parsley. The encoded mRNA and protein, in contrast to those of a functionally related NADPH:cytochrome P450 oxidoreductase, were strictly coregulated with phenylalanine ammonia-lyase mRNA and protein, respectively, as demonstrated by coinduction under various conditions and colocalization in situ in cross-sections from several different parsley tissues. These results support the hypothesis that the genes encoding the core reactions of phenylpropanoid metabolism form a tight regulatory unit. PMID:9880345

  3. PRRT2: from Paroxysmal Disorders to Regulation of Synaptic Function.

    Science.gov (United States)

    Valtorta, Flavia; Benfenati, Fabio; Zara, Federico; Meldolesi, Jacopo

    2016-10-01

    In the past few years, proline-rich transmembrane protein (PRRT)2 has been identified as the causative gene for several paroxysmal neurological disorders. Recently, an important role of PRRT2 in synapse development and function has emerged. Knock down of the protein strongly impairs the formation of synaptic contacts and neurotransmitter release. At the nerve terminal, PRRT2 endows synaptic vesicle exocytosis with Ca 2+ sensitivity by interacting with proteins of the fusion complex and with the Ca 2+ sensors synaptotagmins (Syts). In the postsynaptic compartment, PRRT2 interacts with glutamate receptors. The study of PRRT2 and of its mutations may help in refining our knowledge of the process of synaptic transmission and elucidating the pathogenetic mechanisms leading to derangement of network function in paroxysmal disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Regulation of Central Nervous System Myelination in Higher Brain Functions

    OpenAIRE

    Nickel, Mara; Gu, Chen

    2018-01-01

    The hippocampus and the prefrontal cortex are interconnected brain regions, playing central roles in higher brain functions, including learning and memory, planning complex cognitive behavior, and moderating social behavior. The axons in these regions continue to be myelinated into adulthood in humans, which coincides with maturation of personality and decision-making. Myelin consists of dense layers of lipid membranes wrapping around the axons to provide electrical insulation and trophic sup...

  5. Beyond Emotion Regulation: Emotion Utilization and Adaptive Functioning

    OpenAIRE

    Izard, Carroll; Stark, Kevin; Trentacosta, Christopher; Schultz, David

    2008-01-01

    Recent research indicates that emotionality, emotion information processing, emotion knowledge, and discrete emotion experiences may influence and interact with emotion utilization, that is, the effective use of the inherently adaptive and motivational functions of emotions. Strategies individuals learn for emotion modulation and emotion utilization become stabilized in emerging affective-cognitive structures, or emotion schemas. In these emotion schemas, the feeling/motivational component of...

  6. Regulation and Function of TIFAB in Myelodysplastic Syndrome

    Science.gov (United States)

    2014-08-01

    observation that del(5q) results in inappropriate activation of TRAF6 provides a strong rationale to study the contribution of TIFAB to deregulation of the...rationale to study the contribution of TIFAB to deregulation of the TRAF6 pathway in MDS. BODY Task 1. Plasmid constructs and validation...2011 Lecturer, Ulm University, Germany 2005-2010 Postdoctoral Fellow Research Focus: Identification and functional analysis of genetic and molecular

  7. A structural self-regulation of functioning macromolecules

    International Nuclear Information System (INIS)

    Khristoforov, L.N.

    1998-01-01

    An approach to describing the functional structural changes of macromolecules processing the flows of low-mass agents is formulated. The latter appear as a source of a discrete noise whose defining parameters depend on structural variables. We derive a forward evolution equation and then, by adiabatic elimination, effective Fokker-Planck's equation for the structural modes. Within the dichotomous case, we discuss noise-induced nonequilibrium phase transitions reflecting the regulatory role of the structural subsystem

  8. Swelling-activated ion channels: functional regulation in cell-swelling, proliferation and apoptosis

    DEFF Research Database (Denmark)

    Stutzin, A; Hoffmann, E K

    2006-01-01

    Cell volume regulation is one of the most fundamental homeostatic mechanisms and essential for normal cellular function. At the same time, however, many physiological mechanisms are associated with regulatory changes in cell size meaning that the set point for cell volume regulation is under phys...... as key players in the maintenance of normal steady-state cell volume, with particular emphasis on the intracellular signalling pathways responsible for their regulation during hypotonic stress, cell proliferation and apoptosis....

  9. Hormonal regulation of alveolarization: structure-function correlation

    Directory of Open Access Journals (Sweden)

    Godinez Marye H

    2006-03-01

    Full Text Available Abstract Background Dexamethasone (Dex limits and all-trans-retinoic acid (RA promotes alveolarization. While structural changes resulting from such hormonal exposures are known, their functional consequences are unclear. Methods Neonatal rats were treated with Dex and/or RA during the first two weeks of life or were given RA after previous exposure to Dex. Morphology was assessed by light microscopy and radial alveolar counts. Function was evaluated by plethysmography at d13, pressure volume curves at d30, and exercise swim testing and arterial blood gases at both d15 and d30. Results Dex-treated animals had simplified lung architecture without secondary septation. Animals given RA alone had smaller, more numerous alveoli. Concomitant treatment with Dex + RA prevented the Dex-induced changes in septation. While the results of exposure to Dex + RA were sustained, the effects of RA alone were reversed two weeks after treatment was stopped. At d13, Dex-treated animals had increased lung volume, respiratory rate, tidal volume, and minute ventilation. On d15, both RA- and Dex-treated animals had hypercarbia and low arterial pH. By d30, the RA-treated animals resolved this respiratory acidosis, but Dex-treated animals continued to demonstrate blood gas and lung volume abnormalities. Concomitant RA treatment improved respiratory acidosis, but failed to normalize Dex-induced changes in pulmonary function and lung volumes. No differences in exercise tolerance were noted at either d15 or d30. RA treatment after the period of alveolarization also corrected the effects of earlier Dex exposure, but the structural changes due to RA alone were again lost two weeks after treatment. Conclusion We conclude that both RA- and corticosteroid-treatments are associated with respiratory acidosis at d15. While RA alone-induced changes in structure andrespiratory function are reversed, Dex-treated animals continue to demonstrate increased respiratory rate, minute

  10. Regulating social interactions: Developing a functional theory of collaboration

    Science.gov (United States)

    Borge, Marcela

    A role-playing intervention was developed and implemented in a fifth grade classroom. The goal of the intervention was to address serious problems that researchers have connected to dysfunctional collaborative interactions. These problems include an inability to: engage in important aspects of argumentation and communication, monitor and regulate group processes, and ensure equity in participation. To this end, a comprehensive theory of collaboration was presented to students through the use of four sociocognitive roles: mediation manager, collaboration manager, communication manager, and productivity manager. Each role came with a written guide that included specific goals and strategies related to the role. Metacognitive activities, including planning and reflection, were also used during class sessions to support students' understanding and role-use. Each of the students in the class was assigned one of the roles to manage during a two part collaborative science project. Students took quizzes on the roles and provided verbal and written feedback about their role-use and metacognitive activities. Students from one of the video-recorded groups were also interviewed after the intervention. Analyses of data from video sessions, quizzes, and interviews supported three important findings: (1) students were able to learn goals, and strategies for all of the roles, even though they only managed a single role, (2) students demonstrated the ability to take the information they learned and put it into practice, and (3) when students employed the roles while their group was working, members of the group accepted the role-use. These findings related to the learning and utilization of the roles are important because they: (1) imply that the intervention was successful at developing students' knowledge of the theory of collaboration that the roles represented, (2) indicate that students used this knowledge to monitor and regulate behaviors in an authentic context, and (3

  11. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  12. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  13. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  14. Lactate dehydrogenase regulation in aged skeletal muscle: Regulation by anabolic steroids and functional overload.

    Science.gov (United States)

    Washington, Tyrone A; Healey, Julie M; Thompson, Raymond W; Lowe, Larry L; Carson, James A

    2014-09-01

    Aging alters the skeletal muscle response to overload-induced growth. The onset of functional overload is characterized by increased myoblast proliferation and an altered muscle metabolic profile. The onset of functional overload is associated with increased energy demands that are met through the interconversion of lactate and pyruvate via the activity of lactate dehydrogenase (LDH). Testosterone targets many of the processes activated at the onset of functional overload. However, the effect of aging on this metabolic plasticity at the onset of functional overload and how anabolic steroid administration modulates this response is not well understood. The purpose of this study was to determine if aging would alter overload-induced LDH activity and expression at the onset of functional overload and whether anabolic steroid administration would modulate this response. Five-month and 25-month male Fischer 344xF1 BRN were given nandrolone decanoate (ND) or sham injections for 14days and then the plantaris was functionally overloaded (OV) for 3days by synergist ablation. Aging reduced muscle LDH-A & LDH-B activity 70% (pyoung muscle. Our study provides evidence that aging alters aspects of skeletal muscle metabolic plasticity normally induced by overload and anabolic steroid administration. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. MicroRNAs as regulators of beta-cell function and dysfunction

    DEFF Research Database (Denmark)

    Osmai, Mirwais; Osmai, Yama; Bang-Berthelsen, Claus Heiner

    2016-01-01

    , recent studies have demonstrated that miRNAs are important regulators of the islet transcriptome, controlling apoptosis, differentiation and proliferation, as well as regulating unique islet and beta-cell functions and pathways such as insulin expression, processing and secretion. Furthermore, a large...

  16. Predictors of Behavioral Regulation in Kindergarten: Household Chaos, Parenting, and Early Executive Functions

    Science.gov (United States)

    Vernon-Feagans, Lynne; Garrett-Peters, Patricia; Willoughby, Michael

    2016-01-01

    Behavioral regulation is an important school readiness skill that has been linked to early executive function (EF) and later success in learning and school achievement. Although poverty and related risks, as well as negative parenting, have been associated with poorer EF and behavioral regulation, chaotic home environments may also play a role in…

  17. Insulin regulates brain function, but how does it get there?

    Science.gov (United States)

    Gray, Sarah M; Meijer, Rick I; Barrett, Eugene J

    2014-12-01

    We have learned over the last several decades that the brain is an important target for insulin action. Insulin in the central nervous system (CNS) affects feeding behavior and body energy stores, the metabolism of glucose and fats in the liver and adipose, and various aspects of memory and cognition. Insulin may even influence the development or progression of Alzheimer disease. Yet, a number of seemingly simple questions (e.g., What is the pathway for delivery of insulin to the brain? Is insulin's delivery to the brain mediated by the insulin receptor and is it a regulated process? Is brain insulin delivery affected by insulin resistance?) are unanswered. Here we briefly review accumulated findings affirming the importance of insulin as a CNS regulatory peptide, examine the current understanding of how peripheral insulin is delivered to the brain, and identify key gaps in the current understanding of this process. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  18. The regulation of smart grids. Towards smarter, more functional or in particular more complex regulations?

    International Nuclear Information System (INIS)

    Vedder, H.H.B.

    2011-01-01

    In current energy regulation, legal aspects of smart grids and smart meters seemed to be limited to the protection of the privacy of the energy users in the mandatory rollout of the smart meter. The current status of the implementation is that the small-scale rollout will start on 1 January 2012. According to the author, the current regulatory framework is insufficient for actual implementation of a smart grid. According to him it is possible to mark a testing ground smart grid as a closed distribution system as is to be implemented according to the Electricity Directive 2009/72. [nl

  19. Regulation of PCNA Function by Tyrosine Phosphorylation in Prostate Cancer

    Science.gov (United States)

    2012-10-01

    ylated wild-type sequence did not bind to any of the functional domains. In contrast, incubation with the phosphorylated peptide identified the SH2 domain...Recently, He et al. reported that c-Abl interacted with PCNA through a putative PCNA-binding motif in the SH2 domain of c- Abl [22]. This proposed motif...motif of c-Abl may play a role in anti-apoptosis, interaction between Abl/ SH2 with PCNA/phospho-Y211 can confer a signaling for growth advantage in

  20. Building robust functionality in synthetic circuits using engineered feedback regulation.

    Science.gov (United States)

    Chen, Susan; Harrigan, Patrick; Heineike, Benjamin; Stewart-Ornstein, Jacob; El-Samad, Hana

    2013-08-01

    The ability to engineer novel functionality within cells, to quantitatively control cellular circuits, and to manipulate the behaviors of populations, has many important applications in biotechnology and biomedicine. These applications are only beginning to be explored. In this review, we advocate the use of feedback control as an essential strategy for the engineering of robust homeostatic control of biological circuits and cellular populations. We also describe recent works where feedback control, implemented in silico or with biological components, was successfully employed for this purpose. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Cdc42 regulates epithelial cell polarity and cytoskeletal function during kidney tubule development

    DEFF Research Database (Denmark)

    Elias, Bertha C; Das, Amrita; Parekh, Diptiben V

    2015-01-01

    The Rho GTPase Cdc42 regulates key signaling pathways required for multiple cell functions, including maintenance of shape, polarity, proliferation, migration, differentiation and morphogenesis. Although previous studies have shown that Cdc42 is required for proper epithelial development and main......The Rho GTPase Cdc42 regulates key signaling pathways required for multiple cell functions, including maintenance of shape, polarity, proliferation, migration, differentiation and morphogenesis. Although previous studies have shown that Cdc42 is required for proper epithelial development...

  2. Emotion regulation and Residual Depression Predict Psychosocial Functioning in Bipolar Disorder: Preliminary Study

    OpenAIRE

    Becerra, Rodrigo; Cruise, Kate; Harms, Craig; Allan, Alfred; Bassett, Darryl; Hood, Sean; Murray, Greg

    2015-01-01

    This study explores the predictive value of various clinical, neuropsychological, functional, and emotion regulation processes for recovery in Bipolar Disorder. Clinical and demographic information was collected for 27 euthymic or residually depressed BD participants. Seventy one percent of the sample reported some degree of impairment in psychosocial functioning. Both residual depression and problems with emotion regulation were identified as significant predictors of poor psychosocial funct...

  3. Tissue architecture: the ultimate regulator of breast epithelial function

    Energy Technology Data Exchange (ETDEWEB)

    Bissell, Mina J; Rizki, Aylin; Mian, Saira

    2003-10-20

    A problem in developmental biology that continues to take center stage is how higher organisms generate diverse tissues and organs given the same cellular genotype. In cell and tumor biology, the key question is not the production of form, but its preservation: how do tissues and organs maintain homeostasis, and how do cells within tissues lose or overcome these controls in cancer? Undoubtedly, mechanisms that maintain tissue specificity should share features with those employed to drive formation of the tissues. However, they are unlikely to be identical. At a simplistic level, developmental pathways may be thought of as a series of extremely rapid short-term events. Each new step depends on what came before, and the outcome is the organism itself at birth. All organs, with a few notable exceptions, such as the mammary gland and the brain, 'arrive' together and are complete when the organism is born. In mice and humans, these events occur in a mere 21 days and 9 months respectively. The stability of the differentiated state and the homeostasis of the organism, on the other hand, will last 40-110 times longer. How does the organism achieve this feat? How are tissues maintained? These questions also relate fundamentally to how tissues become malignant and, although not discussed here, to aging. While there is much literature on differentiation - loosely defined as the gain of a single or a series of functions - we know much less about the forces and the pathways that maintain organ morphology and function as a unit. This may be partly because it is difficult to study a tissue as a unit in vivo and there are few techniques that allow maintenance of organs in vitro long enough and in such a way as to make cell and molecular biology experiments possible. Techniques for culturing cells in three-dimensional gels (3D) as a surrogate for tissues, however, have been steadily improving and the method is now used by several laboratories. In this commentary we

  4. Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

    Science.gov (United States)

    Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

    2018-01-01

    Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

  5. Plant Mediator complex and its critical functions in transcription regulation.

    Science.gov (United States)

    Yang, Yan; Li, Ling; Qu, Li-Jia

    2016-02-01

    The Mediator complex is an important component of the eukaryotic transcriptional machinery. As an essential link between transcription factors and RNA polymerase II, the Mediator complex transduces diverse signals to genes involved in different pathways. The plant Mediator complex was recently purified and comprises conserved and specific subunits. It functions in concert with transcription factors to modulate various responses. In this review, we summarize the recent advances in understanding the plant Mediator complex and its diverse roles in plant growth, development, defense, non-coding RNA production, response to abiotic stresses, flowering, genomic stability and metabolic homeostasis. In addition, the transcription factors interacting with the Mediator complex are also highlighted. © 2015 Institute of Botany, Chinese Academy of Sciences.

  6. Diversity, Function and Transcriptional Regulation of Gut Innate Lymphocytes

    Directory of Open Access Journals (Sweden)

    Lucille eRankin

    2013-03-01

    Full Text Available The innate immune system plays a critical early role in host defense against viruses, bacteria and tumour cells. Until recently, natural killer (NK cells and lymphoid tissue inducer (LTi cells were the primary members of the innate lymphocyte family: NK cells form the front-line interface between the external environment and the adaptive immune system, while LTi cells are essential for secondary lymphoid tissue formation. More recently, it has become apparent that the composition of this family is much more diverse than previously appreciated and newly recognized populations play distinct and essential functions in tissue protection. Despite the importance of these cells, the developmental relationships between different innate lymphocyte populations (ILCs remain unclear. Here we review recent advances in our understanding of the development of different innate immune cell subsets, the transcriptional programs that might be involved in driving fate decisions during development, and their relationship to NK cells.

  7. Caveolae regulation of mechanosensitive channel function in myotubes.

    Directory of Open Access Journals (Sweden)

    Haixia Huang

    Full Text Available Mutations that lead to muscular dystrophy often create deficiencies in cytoskeletal support of the muscle sarcolemma causing hyperactive mechanosensitive cation channel (MSC activity and elevated intracellular Ca(2+. Caveolae are cholesterol-rich microdomains that form mechanically deformable invaginations of the sarcolemma. Mutations to caveolin-3, the main scaffolding protein of caveolae in muscle, cause Limbe-Girdle muscular dystrophy. Using genetic and acute chemical perturbations of developing myotubes we investigated whether caveolae are functionally linked to MSCs. MSC sensitivity was assayed using suction application to patches and probe-induced indentation during whole-cell recordings. Membrane mechanical stress in patches was monitored using patch capacitance/impedance. Cholesterol depletion disrupted caveolae and caused a large increase in MSC current. It also decreased the membrane mechanical relaxation time, likely reflecting cytoskeleton dissociation from the bilayer. Reduction of Cav3 expression with miRNA also increased MSC current and decreased patch relaxation time. In contrast Cav3 overexpression produced a small decrease in MSC currents. To acutely and specifically inhibit Cav3 interactions, we made a chimeric peptide containing the antennapedia membrane translocation domain and the Cav3 scaffolding domain (A-CSD3. A-CSD3 action was time dependent initially producing a mild Ca(2+ leak and increased MSC current, while longer exposures decreased MSC currents coinciding with increased patch stiffening. Images of GFP labeled Cav3 in patches showed that Cav3 doesn't enter the pipette, showing patch composition differed from the cell surface. However, disruption via cholesterol depletion caused Cav3 to become uniformly distributed over the sarcolemma and Cav3 appearance in the patch dome. The whole-cell indentation currents elicited under the different caveolae modifying conditions mirror the patch response supporting the role of

  8. Invariant NKT cells: regulation and function during viral infection.

    Directory of Open Access Journals (Sweden)

    Jennifer A Juno

    Full Text Available Natural killer T cells (NKT cells represent a subset of T lymphocytes that express natural killer (NK cell surface markers. A subset of NKT cells, termed invariant NKT cells (iNKT, express a highly restricted T cell receptor (TCR and respond to CD1d-restricted lipid ligands. iNKT cells are now appreciated to play an important role in linking innate and adaptive immune responses and have been implicated in infectious disease, allergy, asthma, autoimmunity, and tumor surveillance. Advances in iNKT identification and purification have allowed for the detailed study of iNKT activity in both humans and mice during a variety of chronic and acute infections. Comparison of iNKT function between non-pathogenic simian immunodeficiency virus (SIV infection models and chronic HIV-infected patients implies a role for iNKT activity in controlling immune activation. In vitro studies of influenza infection have revealed novel effector functions of iNKT cells including IL-22 production and modulation of myeloid-derived suppressor cells, but ex vivo characterization of human iNKT cells during influenza infection are lacking. Similarly, as recent evidence suggests iNKT involvement in dengue virus pathogenesis, iNKT cells may modulate responses to a number of emerging pathogens. This Review will summarize current knowledge of iNKT involvement in responses to viral infections in both human and mouse models and will identify critical gaps in knowledge and opportunities for future study. We will also highlight recent efforts to harness iNKT ligands as vaccine adjuvants capable of improving vaccination-induced cellular immune responses.

  9. Prion Protein Regulates Iron Transport by Functioning as a Ferrireductase

    Science.gov (United States)

    Singh, Ajay; Haldar, Swati; Horback, Katharine; Tom, Cynthia; Zhou, Lan; Meyerson, Howard; Singh, Neena

    2017-01-01

    Prion protein (PrPC) is implicated in the pathogenesis of prion disorders, but its normal function is unclear. We demonstrate that PrPC is a ferrireductase (FR), and its absence causes systemic iron deficiency in PrP knock-out mice (PrP−/−). When exposed to non-transferrin-bound (NTB) radioactive-iron (59FeCl3) by gastric-gavage, PrP−/− mice absorb significantly more 59Fe from the intestinal lumen relative to controls, indicating appropriate systemic response to the iron deficiency. Chronic exposure to excess dietary iron corrects this deficiency, but unlike wild-type (PrP+/+) controls that remain iron over-loaded, PrP−/− mice revert back to the iron deficient phenotype after 5 months of chase on normal diet. Bone marrow (BM) preparations of PrP−/− mice on normal diet show relatively less stainable iron, and this phenotype is only partially corrected by intraperitoneal administration of excess iron-dextran. Cultured PrP−/− BM-macrophages incorporate significantly less NTB-59Fe in the absence or presence of excess extracellular iron, indicating reduced uptake and/or storage of available iron in the absence of PrPC. When expressed in neuroblastoma cells, PrPC exhibits NAD(P)H-dependent cell-surface and intracellular FR activity that requires the copper-binding octa-peptide-repeat region and linkage to the plasma membrane for optimal function. Incorporation of NTB-59Fe by neuroblastoma cells correlates with FR activity of PrPC, implicating PrPC in cellular iron uptake and metabolism. These observations explain the correlation between PrPC expression and cellular iron levels, and the cause of iron imbalance in sporadic-Creutzfeldt-Jakob-disease brains where PrPC accumulates as insoluble aggregates. PMID:23478311

  10. Oxygen Tension Regulates Human Mesenchymal Stem Cell Paracrine Functions.

    Science.gov (United States)

    Paquet, Joseph; Deschepper, Mickael; Moya, Adrien; Logeart-Avramoglou, Delphine; Boisson-Vidal, Catherine; Petite, Hervé

    2015-07-01

    : Mesenchymal stem cells (MSCs) have captured the attention and research endeavors of the scientific world because of their differentiation potential. However, there is accumulating evidence suggesting that the beneficial effects of MSCs are predominantly due to the multitude of bioactive mediators secreted by these cells. Because the paracrine potential of MSCs is closely related to their microenvironment, the present study investigated and characterized select aspects of the human MSC (hMSC) secretome and assessed its in vitro and in vivo bioactivity as a function of oxygen tension, specifically near anoxia (0.1% O2) and hypoxia (5% O2), conditions that reflect the environment to which MSCs are exposed during MSC-based therapies in vivo. In contrast to supernatant conditioned media (CM) obtained from hMSCs cultured at either 5% or 21% of O2, CM from hMSCs cultured under near anoxia exhibited significantly (p mesenchymal stem cell (hMSC) secretome and assessed its in vitro and in vivo biological bioactivity as a function of oxygen tension, specifically near anoxia (0.1% O2) and hypoxia (5% O2), conditions that reflect the environment to which MSCs are exposed during MSC-based therapies in vivo. The present study provided the first evidence of a shift of the hMSC cytokine signature induced by oxygen tension, particularly near anoxia (0.1% O2). Conditioned media obtained from hMSCs cultured under near anoxia exhibited significantly enhanced chemotactic and proangiogenic properties and a significant decrease in the inflammatory mediator content. These findings provide new evidence that elucidates aspects of great importance for the use of MSCs in regenerative medicine, could contribute to improving the efficacy of such therapies, and most importantly highlighted the interest in using conditioned media in therapeutic modalities. ©AlphaMed Press.

  11. From External Regulation to Self-Regulation: Early Parenting Precursors of Young Children's Executive Functioning

    Science.gov (United States)

    Bernier, Annie; Carlson, Stephanie M.; Whipple, Natasha

    2010-01-01

    In keeping with proposals emphasizing the role of early experience in infant brain development, this study investigated the prospective links between quality of parent-infant interactions and subsequent child executive functioning (EF), including working memory, impulse control, and set shifting. Maternal sensitivity, mind-mindedness and autonomy…

  12. [Development and validation of an inventory of ego functions and self regulation (Hannover Self-Regulation Inventory, HSRI)].

    Science.gov (United States)

    Jäger, B; Schmid-Ott, G; Ernst, G; Dölle-Lange, E; Sack, M

    2012-06-01

    The aim of this study was to construct and validate a short self-rating questionnaire for the assessment of ego functions and ability of self regulation. An item pool of 120 items covering 6 postulated dimensions was reduced by two steps in independent samples (n = 136 + 470) via factor and item analyses to the final version consisting of 35 items. The 5 resulting questionnaire scales "interpersonal disturbances", "frustration tolerance and impulse control", "identity disturbances", "affect differentiation and affect tolerance" and "self-esteem" were well interpretable and showed in confirmatory factor analysis the best fit to the data (CHI²/df = 3.48; RMSEA = 0.73). Total scores were found to differentiate well between diagnostic groups of patients with more or less ego pathology (FANOVA = 9.8; df = 11; p self-regulation questionnaire" (HSRQ) evidently is an appropriate and reliable screening instrument in order to assess ego functions and capacities of self regulation in an economic and user-friendly means. The scale structure allows differentiated diagnostics of weak vs. stable ego functions and may be used for detailed therapy planning. © Georg Thieme Verlag KG Stuttgart · New York.

  13. Structure and functional regulation of the CD38 promoter

    International Nuclear Information System (INIS)

    Sun Li; Iqbal, Jameel; Zaidi, Samir; Zhu Linglng; Zhang Xuefeng; Peng Yuanzheng; Moonga, Baljit S.; Zaidi, Mone

    2006-01-01

    CD38 has multiple roles in biology, including T lymphocyte signaling, neutrophil migration, neurotransmission, cell proliferation, apoptosis, and bone remodeling. To study the transcriptional control of the CD38 gene, we cloned a putative 1.8 kb promoter fragment from a rabbit genomic DNA library. Primer extension analysis indicated two transcription start sites consistent with the absence of a TATA box. Sequence analysis revealed several AP-1, AP-4, myo-D, GATA, and SP-1 sequences. MC3T3.E1 (osteoblast) or RAW-C3 (osteoclast precursor macrophage) cells were then transfected with the CD38 promoter or its deletion fragments ligated to the luciferase reporter gene. Except for the shortest 41 bp fragment, all fragments showed significant luciferase activity. There was a marked stimulation of basal activity in the 93 bp fragment that contained a GC box and SP-1 site. Furthermore, there were significant differences in the activity of the fragments in MC3T3.E1 and RAW-C3 cells. Intracellular Ca 2+ elevations by ionomycin (10 μM) in MC3T3.E1 cells inhibited promoter activity, except in the short 41 bp. In contrast, cAMP elevation by exposure to forskolin (100 μM) inhibited activation of all fragments, except the 0.6 and 1.2 kb fragments. Finally, TNF-α stimulated promoter activity in RAW-C3 cells transfected with the 93 bp and 1.0 kb fragments, consistent with the stimulation of CD38 mRNA by TNF-α. Physiologically, therefore, modulation of the expression of the NAD + -sensing enzyme, CD38, by Ca 2+ , cAMP, and cytokines, such as TNF-α may contribute to coupling the intense metabolic activity of osteoclasts and osteoblasts to their respective bone-resorbing and bone-forming functions

  14. Lipid Bilayer – mediated Regulation of Ion Channel Function by Amphiphilic Drugs

    DEFF Research Database (Denmark)

    Lundbæk, Jens August

    2008-01-01

    that are transforming it into a subject of quantitative science. It is described how the hydrophobic interactions between a membrane protein and the host lipid bilayer provide the basis for a mechanism, whereby protein function is regulated by the bilayer physical properties. The use of gramicidin channels as single-molecule......Drugs that at pico- to nanomolar concentration regulate ion channel function by high-affi nity binding to their cognate receptor often have a “ secondary pharmacology, ” in which the same molecule at low micromolar concentrations regulates a diversity of membrane proteins in an apparently...... nonspecifi c manner. It has long been suspected that this promiscuous regulation of membrane protein function could be due to changes in the physical properties of the host lipid bilayer, but the underlying mechanisms have been poorly understood. Given that pharmacological research often involves drug...

  15. DMPD: Structure, function and regulation of the Toll/IL-1 receptor adaptor proteins. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17667936 Structure, function and regulation of the Toll/IL-1 receptor adaptor prote... (.svg) (.html) (.csml) Show Structure, function and regulation of the Toll/IL-1 receptor adaptor proteins. ...PubmedID 17667936 Title Structure, function and regulation of the Toll/IL-1 recep

  16. THE SYNTHESIS AND ANALYSIS INFORMATION TECHNOLOGY OF INTERACTIVE REGULATIONS FUNCTIONAL MODELS

    Directory of Open Access Journals (Sweden)

    Владимир Александрович ТИМОФЕЕВ

    2016-02-01

    Full Text Available A person has no ability to capture entirely and to estimate correctly the logical coherence and consistency of Regulations in the Text Form. It leads to mistakes in a work of an Enterprise Staff and to the impossibility of mastering of the Regulations with considerable volume. Presented Information Technology allows the Regulations Executor to receive on-line proper information of the Optimum Actions in any possible Situation, which can arise in the course of the work. Leading Experts of any Enterprise may create the full-fledged Expert System by themselves with the help of Specialized Software. Such a System will contain the knowledge in the Functional Model of Regulations (the Optimum Business Process. Stages of realization of the represented Information Technology and the peculiarities of on-line data displaying for the Regulations Executor are illustrated by the Pharmacy Customer Service Regulations.

  17. Dynamic regulation of NMDAR function in the adult brain by the stress hormone corticosterone

    Directory of Open Access Journals (Sweden)

    Yiu Chung eTse

    2012-03-01

    Full Text Available Stress and corticosteroids dynamically modulate the expression of synaptic plasticity at glutamatergic synapses in the developed brain. Together with alpha-amino-3-hydroxy-methyl-4-isoxazole propionic acid receptors (AMPAR, N-methyl-D-aspartate receptors (NMDAR are critical mediators of synaptic function and are essential for the induction of many forms of synaptic plasticity. Regulation of NMDAR function by cortisol/corticosterone (CORT may be fundamental to the effects of stress on synaptic plasticity. Recent reports of the efficacy of NMDAR antagonists in treating certain stress-associated psychopathologies further highlight the importance of understanding the regulation of NMDAR function by CORT. Knowledge of how corticosteroids regulate NMDAR function within the adult brain is relatively sparse, perhaps due to a common belief that NMDAR function is relatively stable in the adult brain. We review recent results from our laboratory and others demonstrating dynamic regulation of NMDAR function by CORT in the adult brain. In addition, we consider the issue of how differences in the early life environment may program differential sensitivity to modulation of NMDAR function by CORT and how this may influence synaptic function during stress. Findings from these studies demonstrate that NMDAR function in the adult hippocampus remains sensitive to even brief exposures to CORT and that the capacity for modulation of NMDAR may be programmed, in part, by the early life environment. Modulation of NMDAR function may contribute to dynamic regulation of synaptic plasticity and adaptation in the face of stress, however enhanced NMDAR function may be implicated in mechanisms of stress related psychopathologies including depression.

  18. THE CONTRADICTIONS OF THE FORMATION OF FUNCTIONAL AND TARGET REGULATION OF THE STOCK MARKET OF UKRAINE

    Directory of Open Access Journals (Sweden)

    A. Kalach

    2013-07-01

    Full Text Available The characteristics of formation of the inversion type of the stock market and its contradictions were investigated, the necessity of transition to a functional-target regulation of the stock market was proved the ways of optimization of the institutional system by integrating the functions of regulatory authorities were proposed.

  19. 12 CFR 265.7 - Functions delegated to Director of Division of Banking Supervision and Regulation.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Functions delegated to Director of Division of Banking Supervision and Regulation. 265.7 Section 265.7 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RULES REGARDING DELEGATION OF AUTHORITY § 265.7 Functions delegated to Director of Division...

  20. GABA_A receptor function is regulated by lipid bilayer elasticity

    DEFF Research Database (Denmark)

    Søgaard, Rikke; Werge, Thomas; Berthelsen, Camilla

    2006-01-01

    ( s) underlying these effects are poorly understood. DHA and Triton X-100, at concentrations that affect GABAA receptor function, increase the elasticity of lipid bilayers measured as decreased bilayer stiffness using gramicidin channels as molecular force transducers. We have previously shown...... reduced the peak amplitude of the GABA-induced currents and increased the rate of receptor desensitization. The effects of the amphiphiles did not correlate with the expected changes in monolayer spontaneous curvature. We conclude that GABAA receptor function is regulated by lipid bilayer elasticity....... PUFAs may generally regulate membrane protein function by affecting the elasticity of the host lipid bilayer....

  1. The FKBP51 Glucocorticoid Receptor Co-Chaperone: Regulation, Function, and Implications in Health and Disease.

    Science.gov (United States)

    Fries, Gabriel R; Gassen, Nils C; Rein, Theo

    2017-12-05

    Among the chaperones and co-chaperones regulating the glucocorticoid receptor (GR), FK506 binding protein (FKBP) 51 is the most intensely investigated across different disciplines. This review provides an update on the role of the different co-chaperones of Hsp70 and Hsp90 in the regulation of GR function. The development leading to the focus on FKBP51 is outlined. Further, a survey of the vast literature on the mechanism and function of FKBP51 is provided. This includes its structure and biochemical function, its regulation on different levels-transcription, post-transcription, and post-translation-and its function in signaling pathways. The evidence portraying FKBP51 as a scaffolding protein organizing protein complexes rather than a chaperone contributing to the folding of individual proteins is collated. Finally, FKBP51's involvement in physiology and disease is outlined, and the promising efforts in developing drugs targeting FKBP51 are discussed.

  2. The interactive roles of parenting, emotion regulation and executive functioning in moral reasoning during middle childhood.

    Science.gov (United States)

    Hinnant, J Benjamin; Nelson, Jackie A; O'Brien, Marion; Keane, Susan P; Calkins, Susan D

    2013-01-01

    We examined mother-child co-operative behaviour, children's emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic co-operation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more co-operative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood.

  3. The Interactive Roles of Parenting, Emotion Regulation and Executive Functioning in Moral Reasoning during Middle Childhood

    Science.gov (United States)

    Hinnant, J. Benjamin; Nelson, Jackie A.; O’Brien, Marion; Keane, Susan P.; Calkins, Susan D.

    2013-01-01

    We examined mother-child cooperative behavior, children’s emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic cooperation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more cooperative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood. PMID:23650955

  4. Executive functioning, emotion regulation, eating self-regulation, and weight status in low-income preschool children: how do they relate?

    Science.gov (United States)

    Hughes, Sheryl O; Power, Thomas G; O'Connor, Teresia M; Orlet Fisher, Jennifer

    2015-06-01

    The purpose of the present study was to examine relationships between child eating self-regulation, child non-eating self-regulation, and child BMIz in a low-income sample of Hispanic families with preschoolers. The eating in the absence of hunger task as well as parent-report of child satiety responsiveness and food responsiveness were used to assess child eating self-regulation. Two laboratory tasks assessing executive functioning, a parent questionnaire assessing child effortful control (a temperament dimension related to executive functioning), and the delay of gratification and gift delay tasks assessing child emotion regulation were used to assess child non-eating self-regulation. Bivariate correlations were run among all variables in the study. Hierarchical linear regression analyses assessed: (1) child eating self-regulation associations with the demographic, executive functioning, effortful control, and emotion regulation measures; and (2) child BMI z-score associations with executive functioning, effortful control, emotion regulation measures, and eating self-regulation measures. Within child eating self-regulation, only the two parent-report measures were related. Low to moderate positive correlations were found between measures of executive functioning, effortful control, and emotion regulation. Only three relationships were found between child eating self-regulation and other forms of child self-regulation: eating in the absence of hunger was positively associated with delay of gratification, and poor regulation on the gift delay task was associated positively with maternal reports of food responsiveness and negatively with parent-reports of satiety responsiveness. Regression analyses showed that child eating self-regulation was associated with child BMIz but other forms of child self-regulation were not. Implications for understanding the role of self-regulation in the development of child obesity are discussed. Copyright © 2015 Elsevier Ltd. All

  5. Maternal Emotion Regulation and Adolescent Behaviors: The Mediating Role of Family Functioning and Parenting.

    Science.gov (United States)

    Crandall, AliceAnn; Ghazarian, Sharon R; Day, Randal D; Riley, Anne W

    2016-11-01

    Prior research links poor maternal emotion regulation to maladaptive parenting and child behaviors, but little research is available on these relationships during the adolescent period. We use structural equation modeling to assess the influence of poor maternal emotion regulation, measured as emotional reactivity and distancing, on adolescent behaviors (measured as aggression and prosocial behaviors) among 478 adolescents (53 % female; baseline age 10-13 years) and their mothers over a 5 year period. We also tested the possible mediating roles of family functioning and parenting behaviors between maternal emotion regulation and adolescent behaviors. Results indicated that higher baseline maternal emotional distancing and reactivity were not directly predictive of adolescents' behaviors, but they were indirectly related through family functioning and parenting. Specifically, indulgent parenting mediated the relationship between maternal emotional reactivity and adolescent aggression. Maternal-reported family functioning significantly mediated the relationship between maternal emotional distancing and adolescent aggression. Family functioning also mediated the relationship between emotional distancing and regulation parenting. The results imply that poor maternal emotion regulation during their child's early adolescence leads to more maladaptive parenting and problematic behaviors during the later adolescent period. However, healthy family processes may ameliorate the negative impact of low maternal emotion regulation on parenting and adolescent behavioral outcomes. The implications for future research and interventions to improve parenting and adolescent outcomes are discussed.

  6. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  7. Mitochondrial function in engineered cardiac tissues is regulated by extracellular matrix elasticity and tissue alignment.

    Science.gov (United States)

    Lyra-Leite, Davi M; Andres, Allen M; Petersen, Andrew P; Ariyasinghe, Nethika R; Cho, Nathan; Lee, Jezell A; Gottlieb, Roberta A; McCain, Megan L

    2017-10-01

    Mitochondria in cardiac myocytes are critical for generating ATP to meet the high metabolic demands associated with sarcomere shortening. Distinct remodeling of mitochondrial structure and function occur in cardiac myocytes in both developmental and pathological settings. However, the factors that underlie these changes are poorly understood. Because remodeling of tissue architecture and extracellular matrix (ECM) elasticity are also hallmarks of ventricular development and disease, we hypothesize that these environmental factors regulate mitochondrial function in cardiac myocytes. To test this, we developed a new procedure to transfer tunable polydimethylsiloxane disks microcontact-printed with fibronectin into cell culture microplates. We cultured Sprague-Dawley neonatal rat ventricular myocytes within the wells, which consistently formed tissues following the printed fibronectin, and measured oxygen consumption rate using a Seahorse extracellular flux analyzer. Our data indicate that parameters associated with baseline metabolism are predominantly regulated by ECM elasticity, whereas the ability of tissues to adapt to metabolic stress is regulated by both ECM elasticity and tissue alignment. Furthermore, bioenergetic health index, which reflects both the positive and negative aspects of oxygen consumption, was highest in aligned tissues on the most rigid substrate, suggesting that overall mitochondrial function is regulated by both ECM elasticity and tissue alignment. Our results demonstrate that mitochondrial function is regulated by both ECM elasticity and myofibril architecture in cardiac myocytes. This provides novel insight into how extracellular cues impact mitochondrial function in the context of cardiac development and disease. NEW & NOTEWORTHY A new methodology has been developed to measure O 2 consumption rates in engineered cardiac tissues with independent control over tissue alignment and matrix elasticity. This led to the findings that matrix

  8. Emotion regulation strategies mediate the associations of positive and negative affect to upper extremity physical function.

    Science.gov (United States)

    Talaei-Khoei, Mojtaba; Nemati-Rezvani, Hora; Fischerauer, Stefan F; Ring, David; Chen, Neal; Vranceanu, Ana-Maria

    2017-05-01

    The Gross process model of emotion regulation holds that emotion-eliciting situations (e.g. musculoskeletal illness) can be strategically regulated to determine the final emotional and behavioral response. Also, there is some evidence that innate emotional traits may predispose an individual to a particular regulating coping style. We enrolled 107 patients with upper extremity musculoskeletal illness in this cross-sectional study. They completed self-report measures of positive and negative affect, emotion regulation strategies (cognitive reappraisal and expressive suppression), upper extremity physical function, pain intensity, and demographics. We used Preacher and Hayes' bootstrapping approach to process analysis to infer the direct effect of positive and negative affect on physical function as well as their indirect effects through activation of emotion regulation strategies. Negative affect was associated with decreased physical function. The association was partly mediated by expressive suppression (b (SE)=-.10 (.05), 95% BCa CI [-.21, -.02]). Positive affect was associated with increased physical function. Cognitive reappraisal partially mediated this association (b (SE)=.11 (.05), 95% BCa CI [.03, .24]). After controlling for pain intensity, the ratio of the mediated effect to total effect grew even larger in controlled model comparing to uncontrolled model (33% vs. 26% for expressive suppression and 32% vs. 30% for cognitive reappraisal). The relationships between affect, emotion regulation strategies and physical function appear to be more dependent on the emotional response to an orthopedic condition rather than the intensity of the nociceptive stimulation of the pain. Findings support integration of emotion regulation training in skill-based psychotherapy in this population to mitigate the effect of negative affect and enhance the influence of positive affect on physical function. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Grass Carp Follisatin: Molecular Cloning, Functional Characterization, Dopamine D1 Regulation at Pituitary Level, and Implication in Growth Hormone Regulation

    Directory of Open Access Journals (Sweden)

    Roger S. K. Fung

    2017-08-01

    Full Text Available Activin is involved in pituitary hormone regulation and its pituitary actions can be nullified by local production of its binding protein follistatin. In our recent study with grass carp, local release of growth hormone (GH was shown to induce activin expression at pituitary level, which in turn could exert an intrapituitary feedback to inhibit GH synthesis and secretion. To further examine the activin/follistatin system in the carp pituitary, grass carp follistatin was cloned and confirmed to be single-copy gene widely expressed at tissue level. At the pituitary level, follistatin signals could be located in carp somatotrophs, gonadotrophs, and lactotrophs. Functional expression also revealed that carp follistatin was effective in neutralizing activin’s action in stimulating target promoter with activin-responsive elements. In grass carp pituitary cells, follistatin co-treatment was found to revert activin inhibition on GH mRNA expression. Meanwhile, follistatin mRNA levels could be up-regulated by local production of activin but the opposite was true for dopaminergic activation with dopamine (DA or its agonist apomorphine. Since GH stimulation by DA via pituitary D1 receptor is well-documented in fish models, the receptor specificity for follistatin regulation by DA was also investigated. Using a pharmacological approach, the inhibitory effect of DA on follistatin gene expression was confirmed to be mediated by pituitary D1 but not D2 receptor. Furthermore, activation of D1 receptor by the D1-specific agonist SKF77434 was also effective in blocking follistatin mRNA expression induced by activin and GH treatment both in carp pituitary cells as well as in carp somatotrophs enriched by density gradient centrifugation. These results, as a whole, suggest that activin can interact with dopaminergic input from the hypothalamus to regulate follistatin expression in carp pituitary, which may contribute to GH regulation by activin/follistatin system

  10. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  11. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  12. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  13. A walk into the LuxR regulators of Actinobacteria: phylogenomic distribution and functional diversity.

    Directory of Open Access Journals (Sweden)

    Catarina Lopes Santos

    Full Text Available LuxR regulators are a widely studied group of bacterial helix-turn-helix (HTH transcription factors involved in the regulation of many genes coding for important traits at an ecological and medical level. This regulatory family is particularly known by their involvement in quorum-sensing (QS mechanisms, i.e., in the bacterial ability to communicate through the synthesis and binding of molecular signals. However, these studies have been mainly focused on gram-negative organisms, and the presence of LuxR regulators in the gram-positive Actinobacteria phylum is still poorly explored. In this manuscript, the presence of LuxR regulators among Actinobacteria was assayed using a domain-based strategy. A total of 991 proteins having one LuxR domain were identified in 53 genome-sequenced actinobacterial species, of which 59% had an additional domain. In most cases (53% this domain was REC (receiver domain, suggesting that LuxR regulators in Actinobacteria may either function as single transcription factors or as part of two-component systems. The frequency, distribution and evolutionary stability of each of these sub-families of regulators was analyzed and contextualized regarding the ecological niche occupied by each organism. The results show that the presence of extra-domains in the LuxR-regulators was likely driven by a general need to physically uncouple the signal sensing from the signal transduction. Moreover, the total frequency of LuxR regulators was shown to be dependent on genetic, metabolic and ecological variables. Finally, the functional annotation of the LuxR regulators revealed that the bacterial ecological niche has biased the specialization of these proteins. In the case of pathogens, our results suggest that LuxR regulators can be involved in virulence and are therefore promising targets for future studies in the health-related biotechnology field.

  14. A Walk into the LuxR Regulators of Actinobacteria: Phylogenomic Distribution and Functional Diversity

    Science.gov (United States)

    Santos, Catarina Lopes; Correia-Neves, Margarida; Moradas-Ferreira, Pedro; Mendes, Marta Vaz

    2012-01-01

    LuxR regulators are a widely studied group of bacterial helix-turn-helix (HTH) transcription factors involved in the regulation of many genes coding for important traits at an ecological and medical level. This regulatory family is particularly known by their involvement in quorum-sensing (QS) mechanisms, i.e., in the bacterial ability to communicate through the synthesis and binding of molecular signals. However, these studies have been mainly focused on Gram-negative organisms, and the presence of LuxR regulators in the Gram-positive Actinobacteria phylum is still poorly explored. In this manuscript, the presence of LuxR regulators among Actinobacteria was assayed using a domain-based strategy. A total of 991 proteins having one LuxR domain were identified in 53 genome-sequenced actinobacterial species, of which 59% had an additional domain. In most cases (53%) this domain was REC (receiver domain), suggesting that LuxR regulators in Actinobacteria may either function as single transcription factors or as part of two-component systems. The frequency, distribution and evolutionary stability of each of these sub-families of regulators was analyzed and contextualized regarding the ecological niche occupied by each organism. The results show that the presence of extra-domains in the LuxR-regulators was likely driven by a general need to physically uncouple the signal sensing from the signal transduction. Moreover, the total frequency of LuxR regulators was shown to be dependent on genetic, metabolic and ecological variables. Finally, the functional annotation of the LuxR regulators revealed that the bacterial ecological niche has biased the specialization of these proteins. In the case of pathogens, our results suggest that LuxR regulators can be involved in virulence and are therefore promising targets for future studies in the health-related biotechnology field. PMID:23056438

  15. Functional genomics identifies regulators of the phototransduction machinery in the Drosophila larval eye and adult ocelli.

    Science.gov (United States)

    Mishra, Abhishek Kumar; Bargmann, Bastiaan O R; Tsachaki, Maria; Fritsch, Cornelia; Sprecher, Simon G

    2016-02-15

    Sensory perception of light is mediated by specialized Photoreceptor neurons (PRs) in the eye. During development all PRs are genetically determined to express a specific Rhodopsin (Rh) gene and genes mediating a functional phototransduction pathway. While the genetic and molecular mechanisms of PR development is well described in the adult compound eye, it remains unclear how the expression of Rhodopsins and the phototransduction cascade is regulated in other visual organs in Drosophila, such as the larval eye and adult ocelli. Using transcriptome analysis of larval PR-subtypes and ocellar PRs we identify and study new regulators required during PR differentiation or necessary for the expression of specific signaling molecules of the functional phototransduction pathway. We found that the transcription factor Krüppel (Kr) is enriched in the larval eye and controls PR differentiation by promoting Rh5 and Rh6 expression. We also identified Camta, Lola, Dve and Hazy as key genes acting during ocellar PR differentiation. Further we show that these transcriptional regulators control gene expression of the phototransduction cascade in both larval eye and adult ocelli. Our results show that PR cell type-specific transcriptome profiling is a powerful tool to identify key transcriptional regulators involved during several aspects of PR development and differentiation. Our findings greatly contribute to the understanding of how combinatorial action of key transcriptional regulators control PR development and the regulation of a functional phototransduction pathway in both larval eye and adult ocelli. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  17. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  18. Epidermal growth factor and growth in vivo

    International Nuclear Information System (INIS)

    Rhodes, J.A.

    1986-01-01

    Epidermal growth factor (EGF) causes a dose-dependent thickening of the epidermis in suckling mice. The cellular mechanisms underlying this thickening were analyzed by measuring the effect of EGF on the cell-cycle. Neonatal mice were given daily injections of either 2ug EGF/g body weight/day or an equivalent volume of saline, and on the seventh day received a single injection of 3 H-thymidine. At various times the mice were perfused with fixative; 1um sections of skin were stained with a modification of Harris' hematoxylin and were autoradiographed. The sections were analyzed using three methods based on the dependence on time after injection of 3 H-thymidine of: frequency of labelled mitoses, labelling index, and reciprocal grains/nucleus. It was found that EGF caused a two-fold increase in the cell production rate. The effect of exogenous EGF on the morphology of gastric mucosa and incisors of suckling mice was also studied. The gastric mucosa appeared thicker in EGF-treated animals, but the effect was not statistically significant. In contrast to its effect on epidermis and gastric mucosa, EGF caused a significant, dose-dependent decrease in the size of the incisors. Because the mouse submandibular salivary gland is the major source of EGF the effect of sialoadenectomy on female reproductive functions was examined. Ablation of the submandibular gland had no effect on: length of estrus cycle, ability of the female to produce litters, length of the gestation period, litter size, and weight of the litter at birth. There was also no effect on survival of the offspring or on age at which the eyelids separated

  19. Protein profiling of single epidermal cell types from Arabidopsis thaliana using surface-enhanced laser desorption and ionization technology.

    Science.gov (United States)

    Ebert, Berit; Melle, Christian; Lieckfeldt, Elke; Zöller, Daniela; von Eggeling, Ferdinand; Fisahn, Joachim

    2008-08-25

    Here, we describe a novel approach for investigating differential protein expression within three epidermal cell types. In particular, 3000 single pavement, basal, and trichome cells from leaves of Arabidopsis thaliana were harvested by glass micro-capillaries. Subsequently, these single cell samples were joined to form pools of 100 individual cells and analyzed using the ProteinChip technology; SELDI: surface-enhanced laser desorption and ionization. As a result, numerous protein signals that were differentially expressed in the three epidermal cell types could be detected. One of these proteins was characterized by tryptical digestion and subsequent identification via tandem quadrupole-time of flight (Q-TOF) mass spectrometry. Down regulation of this sequenced small subunit precursor of ribulose-1,5 bisphosphate carboxylase(C) oxygenase(O) (RuBisCo) in trichome and basal cells indicates the sink status of these cell types that are located on the surface of A. thaliana source leaves. Based on the obtained protein profiles, we suggest a close functional relationship between basal and trichome cells at the protein level.

  20. Trafficking and function of the cystic fibrosis transmembrane conductance regulator: a complex network of posttranslational modifications

    Science.gov (United States)

    McClure, Michelle L.; Barnes, Stephen; Brodsky, Jeffrey L.

    2016-01-01

    Posttranslational modifications add diversity to protein function. Throughout its life cycle, the cystic fibrosis transmembrane conductance regulator (CFTR) undergoes numerous covalent posttranslational modifications (PTMs), including glycosylation, ubiquitination, sumoylation, phosphorylation, and palmitoylation. These modifications regulate key steps during protein biogenesis, such as protein folding, trafficking, stability, function, and association with protein partners and therefore may serve as targets for therapeutic manipulation. More generally, an improved understanding of molecular mechanisms that underlie CFTR PTMs may suggest novel treatment strategies for CF and perhaps other protein conformational diseases. This review provides a comprehensive summary of co- and posttranslational CFTR modifications and their significance with regard to protein biogenesis. PMID:27474090

  1. Emotional Regulation and Executive Function Deficits in Unmedicated Chinese Children with Oppositional Defiant Disorder.

    Science.gov (United States)

    Jiang, Wenqing; Li, Yan; Du, Yasong; Fan, Juan

    2016-05-01

    This study aims to explore the feature of emotional regulation and executive functions in oppositional defiant disorder (ODD) children. The emotional regulation and executive functions of adolescents with ODD, as well as the relationship between the two factors were analyzed using tools including Adolescent Daily Emotional Regulation Questionnaire (ADERQ), Wisconsin Card Sorting Test (WCST) and Cambridge Neuropsychological Test Automated Battery (CANTAB), in comparison with attention deficit hyperactivity disorder (ADHD) children without behavioral problem and healthy children; the ADERQ assessed emotional regulation ability and others were used to assess executive function. Compared to normal children, the ODD group displayed significant differences in the scores of cognitive reappraisal, rumination, expressive suppression, and revealing of negative emotions, as well as in the score of cognitive reappraisal of positive emotions. WCST perseverative errors were well correlated with rumination of negative emotions (r=0.47). Logistic regression revealed that the minimum number of moves in the Stocking of Cambridge (SOC) test (one test in CANTAB) and negative emotion revealing, were strongly associated with ODD diagnosis. Children with ODD showed emotion dysregulation, with negative emotion dysregulation as the main feature. Emotion dysregulation and the lack of ability to plan lead to executive function deficits. The executive function deficits may guide us to understand the deep mechanism under ODD.

  2. Predicting athletes' functional and dysfunctional emotions: The role of the motivational climate and motivation regulations.

    Science.gov (United States)

    Ruiz, Montse C; Haapanen, Saara; Tolvanen, Asko; Robazza, Claudio; Duda, Joan L

    2017-08-01

    This study examined the relationships between perceptions of the motivational climate, motivation regulations, and the intensity and functionality levels of athletes' pleasant and unpleasant emotional states. Specifically, we examined the hypothesised mediational role of motivation regulations in the climate-emotion relationship. We also tested a sequence in which emotions were assumed to be predicted by the motivational climate dimensions and then served as antecedents to variability in motivation regulations. Participants (N = 494) completed a multi-section questionnaire assessing targeted variables. Structural equation modelling (SEM) revealed that a perceived task-involving climate was a positive predictor of autonomous motivation and of the impact of functional anger, and a negative predictor of the intensity of anxiety and dysfunctional anger. Autonomous motivation was a partial mediator of perceptions of a task-involving climate and the impact of functional anger. An ego-involving climate was a positive predictor of controlled motivation, and of the intensity and impact of functional anger and the intensity of dysfunctional anger. Controlled motivation partially mediated the relationship between an ego-involving climate and the intensity of dysfunctional anger. Good fit to the data also emerged for the motivational climate, emotional states, and motivation regulations sequence. Findings provide support for the consideration of hedonic tone and functionality distinctions in the assessment of athletes' emotional states.

  3. Emotion regulation ability varies in relation to intrinsic functional brain architecture.

    Science.gov (United States)

    Uchida, Mai; Biederman, Joseph; Gabrieli, John D E; Micco, Jamie; de Los Angeles, Carlo; Brown, Ariel; Kenworthy, Tara; Kagan, Elana; Whitfield-Gabrieli, Susan

    2015-12-01

    This study investigated the neural basis of individual variation in emotion regulation, specifically the ability to reappraise negative stimuli so as to down-regulate negative affect. Brain functions in young adults were measured with functional Magnetic Resonance Imaging during three conditions: (i) attending to neutral pictures; (ii) attending to negative pictures and (iii) reappraising negative pictures. Resting-state functional connectivity was measured with amygdala and dorsolateral prefrontal cortical (DLPFC) seed regions frequently associated with emotion regulation. Participants reported more negative affect after attending to negative than neutral pictures, and less negative affect following reappraisal. Both attending to negative vs neutral pictures and reappraising vs attending to negative pictures yielded widespread activations that were significantly right-lateralized for attending to negative pictures and left-lateralized for reappraising negative pictures. Across participants, more successful reappraisal correlated with less trait anxiety and more positive daily emotion, greater activation in medial and lateral prefrontal regions, and lesser resting-state functional connectivity between (a) right amygdala and both medial prefrontal and posterior cingulate cortices, and (b) bilateral DLPFC and posterior visual cortices. The ability to regulate emotion, a source of resilience or of risk for distress, appears to vary in relation to differences in intrinsic functional brain architecture. © The Author (2015). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  4. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  5. Probing molecular mechanisms of the Hsp90 chaperone: biophysical modeling identifies key regulators of functional dynamics.

    Directory of Open Access Journals (Sweden)

    Anshuman Dixit

    Full Text Available Deciphering functional mechanisms of the Hsp90 chaperone machinery is an important objective in cancer biology aiming to facilitate discovery of targeted anti-cancer therapies. Despite significant advances in understanding structure and function of molecular chaperones, organizing molecular principles that control the relationship between conformational diversity and functional mechanisms of the Hsp90 activity lack a sufficient quantitative characterization. We combined molecular dynamics simulations, principal component analysis, the energy landscape model and structure-functional analysis of Hsp90 regulatory interactions to systematically investigate functional dynamics of the molecular chaperone. This approach has identified a network of conserved regions common to the Hsp90 chaperones that could play a universal role in coordinating functional dynamics, principal collective motions and allosteric signaling of Hsp90. We have found that these functional motifs may be utilized by the molecular chaperone machinery to act collectively as central regulators of Hsp90 dynamics and activity, including the inter-domain communications, control of ATP hydrolysis, and protein client binding. These findings have provided support to a long-standing assertion that allosteric regulation and catalysis may have emerged via common evolutionary routes. The interaction networks regulating functional motions of Hsp90 may be determined by the inherent structural architecture of the molecular chaperone. At the same time, the thermodynamics-based "conformational selection" of functional states is likely to be activated based on the nature of the binding partner. This mechanistic model of Hsp90 dynamics and function is consistent with the notion that allosteric networks orchestrating cooperative protein motions can be formed by evolutionary conserved and sparsely connected residue clusters. Hence, allosteric signaling through a small network of distantly connected

  6. The unique and cooperative roles of the Grainy head-like transcription factors in epidermal development reflect unexpected target gene specificity.

    Science.gov (United States)

    Boglev, Yeliz; Wilanowski, Tomasz; Caddy, Jacinta; Parekh, Vishwas; Auden, Alana; Darido, Charbel; Hislop, Nikki R; Cangkrama, Michael; Ting, Stephen B; Jane, Stephen M

    2011-01-15

    The Grainy head-like 3 (Grhl3) gene encodes a transcription factor that plays essential roles in epidermal morphogenesis during embryonic development, with deficient mice exhibiting failed skin barrier formation, defective wound repair, and loss of eyelid fusion. Despite sharing significant sequence homology, overlapping expression patterns, and an identical core consensus DNA binding site, the other members of the Grhl family (Grhl1 and -2) fail to compensate for the loss of Grhl3 in these processes. Here, we have employed diverse genetic models, coupled with biochemical studies, to define the inter-relationships of the Grhl factors in epidermal development. We show that Grhl1 and Grhl3 have evolved complete functional independence, as evidenced by a lack of genetic interactions in embryos carrying combinations of targeted alleles of these genes. In contrast, compound heterozygous Grhl2/Grhl3 embryos displayed failed wound repair, and loss of a single Grhl2 allele in Grhl3-null embryos results in fully penetrant eyes open at birth. Expression of Grhl2 from the Grhl3 locus in homozygous knock-in mice corrects the wound repair defect, but these embryos still display a complete failure of skin barrier formation. This functional dissociation is due to unexpected differences in target gene specificity, as both GRHL2 and GRHL3 bind to and regulate expression of the wound repair gene Rho GEF 19, but regulation of the barrier forming gene, Transglutaminase 1 (TGase1), is unique to GRHL3. Our findings define the mechanisms underpinning the unique and cooperative roles of the Grhl genes in epidermal development. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

  8. FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

    African Journals Online (AJOL)

    Administrator

    alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

  9. Stevens Johnsons syndrom og toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

    2013-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

  10. Function and Regulation of Yeast Ribonucleotide Reductase: Cell Cycle, Genotoxic Stress, and Iron Bioavailability

    Directory of Open Access Journals (Sweden)

    Nerea Sanvisens

    2013-04-01

    Full Text Available Ribonucleotide reductases (RNRs are essential enzymes that catalyze the reduction of ribonucleotides to desoxyribonucleotides, thereby providing the building blocks required for de novo DNA biosynthesis. The RNR function is tightly regulated because an unbalanced or excessive supply of deoxyribonucleoside triphosphates (dNTPs dramatically increases the mutation rates during DNA replication and repair that can lead to cell death or genetic anomalies. In this review, we focus on Saccharomyces cerevisiae class Ia RNR as a model to understand the different mechanisms controlling RNR function and regulation in eukaryotes. Many studies have contributed to our current understanding of RNR allosteric regulation and, more recently, to its link to RNR oligomerization. Cells have developed additional mechanisms that restrict RNR activity to particular periods when dNTPs are necessary, such as the S phase or upon genotoxic stress. These regulatory strategies include the transcriptional control of the RNR gene expression, inhibition of RNR catalytic activity, and the subcellular redistribution of RNR subunits. Despite class Ia RNRs requiring iron as an essential cofactor for catalysis, little is known about RNR function regulation depending on iron bioavailability. Recent studies into yeast have deciphered novel strategies for the delivery of iron to RNR and for its regulation in response to iron deficiency. Taken together, these studies open up new possibilities to explore in order to limit uncontrolled tumor cell proliferation via RNR.

  11. The relations of children's dispositional prosocial behavior to emotionality, regulation, and social functioning.

    Science.gov (United States)

    Eisenberg, N; Fabes, R A; Karbon, M; Murphy, B C; Wosinski, M; Polazzi, L; Carlo, G; Juhnke, C

    1996-06-01

    The purpose of this study was to examine the relations of a measure of children's dispositional prosocial behavior (i.e., peer nominations) to individual differences in children's negative emotionality, regulation, and social functioning. Children with prosocial reputations tended to be high in constructive social skills (i.e., socially appropriate behavior and constructive coping) and attentional regulation, and low in negative emotionality. The relations of children's negative emotionality to prosocial reputation were moderated by level of dispositional attentional regulation. In addition, the relations of prosocial reputation to constructive social skills and parent-reported negative emotionality (for girls) increased with age. Vagal tone, a marker of physiological regulation, was negatively related to girls' prosocial reputation.

  12. Computational Approaches Reveal New Insights into Regulation and Function of Non; coding RNAs and their Targets

    KAUST Repository

    Alam, Tanvir

    2016-01-01

    Regulation and function of protein-coding genes are increasingly well-understood, but no comparable evidence exists for non-coding RNA (ncRNA) genes, which appear to be more numerous than protein-coding genes. We developed a novel machine

  13. Functional properties of Virus-Encoded and Virus-Regulated 7TM Receptors

    DEFF Research Database (Denmark)

    Spiess, Katja; Rosenkilde, Mette Marie

    2014-01-01

    During co-evolution with their hosts, viruses have developed several survival strategies that involve exploitation of 7TM receptors. These include virus-encoded 7TM receptors and ligands and viral regulation of endogenous receptors. Many functional properties have been ascribed to virus-exploited...

  14. Emotional Reactivity and Regulation in Infancy Interact to Predict Executive Functioning in Early Childhood

    Science.gov (United States)

    Ursache, Alexandra; Blair, Clancy; Stifter, Cynthia; Voegtline, Kristin

    2013-01-01

    The relation of observed emotional reactivity and regulation in infancy to executive function in early childhood was examined in a prospective longitudinal sample of 1,292 children from predominantly low-income and rural communities. Children participated in a fear eliciting task at ages 7, 15, and 24 months and completed an executive function…

  15. 49 CFR 171.1 - Applicability of Hazardous Materials Regulations (HMR) to persons and functions.

    Science.gov (United States)

    2010-10-01

    ... $250 for each violation, except the maximum civil penalty is $110,000 if the violation results in death... and functions. Federal hazardous materials transportation law (49 U.S.C. 5101 et seq.) directs the... regulations to persons who transport hazardous materials in commerce. In addition, the law authorizes the...

  16. Parent emotional expressiveness and children's self-regulation: Associations with abused children's school functioning

    Science.gov (United States)

    Haskett, Mary E.; Stelter, Rebecca; Proffit, Katie; Nice, Rachel

    2012-01-01

    Objective Identifying factors associated with school functioning of abused children is important in prevention of long-term negative outcomes associated with school failure. The purpose of this study was to examine the degree to which parent emotional expressiveness and children's self-regulation predicted early school behavior of abused children. Methods The sample included 92 physically abused children ages 4-7 and one of their parents (95.7% mothers). Parents completed a measure of their own emotional expressiveness, and parents and teachers provided reports of children's self-regulatory skills. Children's school functioning was measured by observations of playground aggression and teacher reports of aggression and classroom behavior. Results Parents’ expression of positive and negative emotions was associated with various aspects of children's self-regulation and functioning in the school setting. Links between self-regulation and children's school adjustment were robust; poor self-regulation was associated with higher aggression and lower cooperation and self-directed behavior in the classroom. There was minimal support for a mediating role of children's self-regulation in links between parent expressiveness and children's behavior. Practice implications Findings point to the relevance of parent emotional expressivity and children's self-regulatory processes in understanding physically abused children's functioning at the transition to school. Although further research is needed, findings indicate that increasing parental expression of positive emotion should be a focus in treatment along with reduction in negativity of abusive parents. Further, addressing children's self-regulation could be important in efforts to reduce aggression and enhance children's classroom competence. PMID:22565040

  17. Demonstration of epidermal growth factor binding sites in the adult rat pancreas by light microscopic autoradiography

    International Nuclear Information System (INIS)

    Chabot, J.G.; Walker, P.; Pelletier, G.

    1987-01-01

    The distribution of epidermal growth factor (EGF) receptors was studied in the pancreas using light microscopic autoradiography, which was performed at different time intervals (2-60 min) after injecting 125 I-labeled EGF intravenously into the adult rat. In the exocrine pancreas, a labeling was found to occur over the pyramidal cells of the acini and cells lining the intercalated ducts. Moreover, substantial binding of EGF to cells of the islets of Langerhans was also revealed. At the 2-min time interval, most silver grains were found at the periphery of the target cells. The localization, as well as the diminution of silver grains over the cytoplasm of these cells, between 7 and 60 min, suggested the internalization and degradation of 125 I-labeled EGF. Control experiments indicated that the autoradiography reaction was due to specific interaction of 125 I-labeled EGF with its receptor. These results clearly indicate that EGF receptors are present in the acinar cells and the cells of intercalated ducts of the exocrine pancreas, as well as the cells of the endocrine pancreas. Finding that there are EGF binding sites in pancreatic acinar cells supports the physiological role of EGF in the regulation of pancreatic exocrine function. The presence of EGF receptors in cells of the islets of Langerhans suggests that EGF may play a role in the regulation of the endocrine pancreas

  18. Functions and regulation of the multitasking FANCM family of DNA motor proteins.

    Science.gov (United States)

    Xue, Xiaoyu; Sung, Patrick; Zhao, Xiaolan

    2015-09-01

    Members of the conserved FANCM family of DNA motor proteins play key roles in genome maintenance processes. FANCM supports genome duplication and repair under different circumstances and also functions in the ATR-mediated DNA damage checkpoint. Some of these roles are shared among lower eukaryotic family members. Human FANCM has been linked to Fanconi anemia, a syndrome characterized by cancer predisposition, developmental disorder, and bone marrow failure. Recent studies on human FANCM and its orthologs from other organisms have provided insights into their biological functions, regulation, and collaboration with other genome maintenance factors. This review summarizes the progress made, with the goal of providing an integrated view of the functions and regulation of these enzymes in humans and model organisms and how they advance our understanding of genome maintenance processes. © 2015 Xue et al.; Published by Cold Spring Harbor Laboratory Press.

  19. Diacylglycerol Kinases: Regulated Controllers of T Cell Activation, Function, and Development

    Directory of Open Access Journals (Sweden)

    Gary A. Koretzky

    2013-03-01

    Full Text Available Diacylglycerol kinases (DGKs are a diverse family of enzymes that catalyze the conversion of diacylglycerol (DAG, a crucial second messenger of receptor-mediated signaling, to phosphatidic acid (PA. Both DAG and PA are bioactive molecules that regulate a wide set of intracellular signaling proteins involved in innate and adaptive immunity. Clear evidence points to a critical role for DGKs in modulating T cell activation, function, and development. More recently, studies have elucidated factors that control DGK function, suggesting an added complexity to how DGKs act during signaling. This review summarizes the available knowledge of the function and regulation of DGK isoforms in signal transduction with a particular focus on T lymphocytes.

  20. The Prohormone VGF Regulates β Cell Function via Insulin Secretory Granule Biogenesis

    Directory of Open Access Journals (Sweden)

    Samuel B. Stephens

    2017-09-01

    Full Text Available The prohormone VGF is expressed in neuroendocrine and endocrine tissues and regulates nutrient and energy status both centrally and peripherally. We and others have shown that VGF-derived peptides have direct action on the islet β cell as secretagogues and cytoprotective agents; however, the endogenous function of VGF in the β cell has not been described. Here, we demonstrate that VGF regulates secretory granule formation. VGF loss-of-function studies in both isolated islets and conditional knockout mice reveal a profound decrease in stimulus-coupled insulin secretion. Moreover, VGF is necessary to facilitate efficient exit of granule cargo from the trans-Golgi network and proinsulin processing. It also functions to replenish insulin granule stores following nutrient stimulation. Our data support a model in which VGF operates at a critical node of granule biogenesis in the islet β cell to coordinate insulin biosynthesis with β cell secretory capacity.

  1. Blimp-1 controls plasma cell function through regulation of immunoglobulin secretion and the unfolded protein response

    Science.gov (United States)

    Tellier, Julie; Shi, Wei; Minnich, Martina; Liao, Yang; Crawford, Simon; Smyth, Gordon K; Kallies, Axel; Busslinger, Meinrad; Nutt, Stephen L

    2015-01-01

    Plasma cell differentiation requires silencing of B cell transcription, while establishing antibody-secretory function and long-term survival. The transcription factors Blimp-1 and IRF4 are essential for plasma cell generation, however their function in mature plasma cells has remained elusive. We have found that while IRF4 was essential for plasma cell survival, Blimp-1 was dispensable. Blimp-1-deficient plasma cells retained their transcriptional identity, but lost the ability to secrete antibody. Blimp-1 regulated many components of the unfolded protein response (UPR), including XBP-1 and ATF6. The overlap of Blimp-1 and XBP-1 function was restricted to the UPR, with Blimp-1 uniquely regulating mTOR activity and plasma cell size. Thus, Blimp-1 is required for the unique physiological capacity of plasma cells that enables the secretion of protective antibody. PMID:26779600

  2. Mast cells regulate myofilament calcium sensitization and heart function after myocardial infarction.

    Science.gov (United States)

    Ngkelo, Anta; Richart, Adèle; Kirk, Jonathan A; Bonnin, Philippe; Vilar, Jose; Lemitre, Mathilde; Marck, Pauline; Branchereau, Maxime; Le Gall, Sylvain; Renault, Nisa; Guerin, Coralie; Ranek, Mark J; Kervadec, Anaïs; Danelli, Luca; Gautier, Gregory; Blank, Ulrich; Launay, Pierre; Camerer, Eric; Bruneval, Patrick; Menasche, Philippe; Heymes, Christophe; Luche, Elodie; Casteilla, Louis; Cousin, Béatrice; Rodewald, Hans-Reimer; Kass, David A; Silvestre, Jean-Sébastien

    2016-06-27

    Acute myocardial infarction (MI) is a severe ischemic disease responsible for heart failure and sudden death. Inflammatory cells orchestrate postischemic cardiac remodeling after MI. Studies using mice with defective mast/stem cell growth factor receptor c-Kit have suggested key roles for mast cells (MCs) in postischemic cardiac remodeling. Because c-Kit mutations affect multiple cell types of both immune and nonimmune origin, we addressed the impact of MCs on cardiac function after MI, using the c-Kit-independent MC-deficient (Cpa3(Cre/+)) mice. In response to MI, MC progenitors originated primarily from white adipose tissue, infiltrated the heart, and differentiated into mature MCs. MC deficiency led to reduced postischemic cardiac function and depressed cardiomyocyte contractility caused by myofilament Ca(2+) desensitization. This effect correlated with increased protein kinase A (PKA) activity and hyperphosphorylation of its targets, troponin I and myosin-binding protein C. MC-specific tryptase was identified to regulate PKA activity in cardiomyocytes via protease-activated receptor 2 proteolysis. This work reveals a novel function for cardiac MCs modulating cardiomyocyte contractility via alteration of PKA-regulated force-Ca(2+) interactions in response to MI. Identification of this MC-cardiomyocyte cross-talk provides new insights on the cellular and molecular mechanisms regulating the cardiac contractile machinery and a novel platform for therapeutically addressable regulators. ©2016 Ngkelo et al.

  3. Chronic treatment with epidermal growth factor causes esophageal epithelial hyperplasia in pigs and rats

    DEFF Research Database (Denmark)

    Juhl, C O; Vinter-Jensen, Lars; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) is an important factor for maintaining the esophageal functional integrity. Goettingen minipigs were treated with either placebo or subcutaneous EGF (30 micrograms/kg/day) for four weeks. Wistar rats were treated with either placebo or subcutaneous EGF (150 microgram...

  4. Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.

    NARCIS (Netherlands)

    Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der

    2003-01-01

    The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol

  5. Graphene-Based Functional Architectures: Sheets Regulation and Macrostructure Construction toward Actuators and Power Generators.

    Science.gov (United States)

    Cheng, Huhu; Huang, Yaxin; Shi, Gaoquan; Jiang, Lan; Qu, Liangti

    2017-07-18

    Graphene, with large delocalized π electron cloud on a two-dimensional (2D) atom-thin plane, possesses excellent carrier mobility, large surface area, high light transparency, high mechanical strength, and superior flexibility. However, the lack of intrinsic band gap, poor dispersibility, and weak reactivity of graphene hinder its application scope. Heteroatom-doping regulation and surface modification of graphene can effectively reconstruct the sp 2 bonded carbon atoms and tailor the surface chemistry and interfacial interaction, while microstructure mediation on graphene can induce the special chemical and physical properties because of the quantum confinement, edge effect, and unusual mass transport process. Based on these regulations on graphene, series of methods and techniques are developed to couple the promising characters of graphene into the macroscopic architectures for potential and practical applications. In this Account, we present our effort on graphene regulation from chemical modification to microstructure control, from the morphology-designed macroassemblies to their applications in functional systems excluding the energy-storage devices. We first introduce the chemically regulative graphene with incorporated heteroatoms into the honeycomb lattice, which could open the intrinsic band gap and provide many active sites. Then the surface modification of graphene with functional components will improve dispersibility, prevent aggregation, and introduce new functions. On the other hand, microstructure mediation on graphene sheets (e.g., 0D quantum dots, 1D nanoribbons, and 2D nanomeshes) is demonstrated to induce special chemical and physical properties. Benefiting from the effective regulation on graphene sheets, diverse methods including dimension-confined strategy, filtration assembly, and hydrothermal treatment have been developed to assemble individual graphene sheets to macroscopic graphene fibers, films, and frameworks. These rationally

  6. Lipid bilayer regulation of membrane protein function: gramicidin channels as molecular force probes

    DEFF Research Database (Denmark)

    Lundbæk, Jens August; Collingwood, S.A.; Ingolfsson, H.I.

    2010-01-01

    with collective physical properties (e.g. thickness, intrinsic monolayer curvature or elastic moduli). Studies in physico-chemical model systems have demonstrated that changes in bilayer physical properties can regulate membrane protein function by altering the energetic cost of the bilayer deformation associated...... with a protein conformational change. This type of regulation is well characterized, and its mechanistic elucidation is an interdisciplinary field bordering on physics, chemistry and biology. Changes in lipid composition that alter bilayer physical properties (including cholesterol, polyunsaturated fatty acids...... channels as molecular force probes for studying this mechanism, with a unique ability to discriminate between consequences of changes in monolayer curvature and bilayer elastic moduli....

  7. RhoGDI: multiple functions in the regulation of Rho family GTPase activities

    DEFF Research Database (Denmark)

    Dovas, Athanassios; Couchman, John R

    2005-01-01

    necessary for the correct targeting and regulation of Rho activities by conferring cues for spatial restriction, guidance and availability to effectors. These potential functions are discussed in the context of RhoGDI-associated multimolecular complexes, the newly emerged shuttling capability...... insight as to how RhoGDI exerts its effects on nucleotide binding, the membrane association-dissociation cycling of the GTPase and how these activities are controlled. Despite the initial negative roles attributed to RhoGDI, recent evidence has come to suggest that it may also act as a positive regulator...... of activities....

  8. Posttranslational regulation of phosphatase and tensin homolog (PTEN and its functional impact on cancer behaviors

    Directory of Open Access Journals (Sweden)

    Xu WT

    2014-10-01

    Full Text Available Wenting Xu,1 Zhen Yang,1 Shu-Feng Zhou,2 Nonghua Lu1 1Department of Gastroenterology, The First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, People’s Republic of China; 2Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA Abstract: The incidence of cancer is increasing worldwide, but the biochemical mechanisms for the occurrence of cancer is not fully understood, and there is no cure for advanced tumors. Defects of posttranslational modifications of proteins are linked to a number of important diseases, such as cancer. This review will update our knowledge on the critical role of posttranscriptional regulation of phosphatase and tensin homolog (PTEN and its activities and the functional impact on cancer behaviors. PTEN is a tumor suppressor gene that occupies a key position in regulating cell growth, proliferation, apoptosis, mobility, signal transduction, and other crucial cellular processes. The activity and function of PTEN are regulated by coordinated epigenetic, transcriptional, posttranscriptional, and posttranslational modifications. In particular, PTEN is subject to phosphorylation, ubiquitylation, somoylation, acetylation, and active site oxidation. Posttranslational modifications of PTEN can dynamically change its activity and function. Deficiency in the posttranslational regulation of PTEN leads to abnormal cell proliferation, apoptosis, migration, and adhesion, which are associated with cancer initiation, progression, and metastasis. With increasing information on how PTEN is regulated by multiple mechanisms and networked proteins, its exact role in cancer initiation, growth, and metastasis will be revealed. PTEN and its functionally related proteins may represent useful targets for the discovery of new anticancer drugs, and gene therapy and the therapeutic potentials should be fully explored. Keywords: phosphorylation, ubiquitination, acetylation, oxidation

  9. Embryonic maturation of epidermal Merkel cells is controlled by a redundant transcription factor network.

    Science.gov (United States)

    Perdigoto, Carolina N; Bardot, Evan S; Valdes, Victor J; Santoriello, Francis J; Ezhkova, Elena

    2014-12-01

    Merkel cell-neurite complexes are located in touch-sensitive areas of the mammalian skin and are involved in recognition of the texture and shape of objects. Merkel cells are essential for these tactile discriminations, as they generate action potentials in response to touch stimuli and induce the firing of innervating afferent nerves. It has been shown that Merkel cells originate from epidermal stem cells, but the cellular and molecular mechanisms of their development are largely unknown. In this study, we analyzed Merkel cell differentiation during development and found that it is a temporally regulated maturation process characterized by a sequential activation of Merkel cell-specific genes. We uncovered key transcription factors controlling this process and showed that the transcription factor Atoh1 is required for initial Merkel cell specification. The subsequent maturation steps of Merkel cell differentiation are controlled by cooperative function of the transcription factors Sox2 and Isl1, which physically interact and work to sustain Atoh1 expression. These findings reveal the presence of a robust transcriptional network required to produce functional Merkel cells that are required for tactile discrimination. © 2014. Published by The Company of Biologists Ltd.

  10. Distinct functions of Crumbs regulating slit diaphragms and endocytosis in Drosophila nephrocytes.

    Science.gov (United States)

    Hochapfel, Florian; Denk, Lucia; Mendl, Gudrun; Schulze, Ulf; Maaßen, Christine; Zaytseva, Yulia; Pavenstädt, Hermann; Weide, Thomas; Rachel, Reinhard; Witzgall, Ralph; Krahn, Michael P

    2017-12-01

    Mammalian podocytes, the key determinants of the kidney's filtration barrier, differentiate from columnar epithelial cells and several key determinants of apical-basal polarity in the conventional epithelia have been shown to regulate podocyte morphogenesis and function. However, little is known about the role of Crumbs, a conserved polarity regulator in many epithelia, for slit-diaphragm formation and podocyte function. In this study, we used Drosophila nephrocytes as model system for mammalian podocytes and identified a conserved function of Crumbs proteins for cellular morphogenesis, nephrocyte diaphragm assembly/maintenance, and endocytosis. Nephrocyte-specific knock-down of Crumbs results in disturbed nephrocyte diaphragm assembly/maintenance and decreased endocytosis, which can be rescued by Drosophila Crumbs as well as human Crumbs2 and Crumbs3, which were both expressed in human podocytes. In contrast to the extracellular domain, which facilitates nephrocyte diaphragm assembly/maintenance, the intracellular FERM-interaction motif of Crumbs is essential for regulating endocytosis. Moreover, Moesin, which binds to the FERM-binding domain of Crumbs, is essential for efficient endocytosis. Thus, we describe here a new mechanism of nephrocyte development and function, which is likely to be conserved in mammalian podocytes.

  11. Transcription Factor Foxo1 Is a Negative Regulator of NK Cell Maturation and Function

    Science.gov (United States)

    Deng, Youcai; Kerdiles, Yann; Chu, Jianhong; Yuan, Shunzong; Wang, Youwei; Chen, Xilin; Mao, Hsiaoyin; Zhang, Lingling; Zhang, Jianying; Hughes, Tiffany; Deng, Yafei; Zhang, Qi; Wang, Fangjie; Zou, Xianghong; Liu, Chang-Gong; Freud, Aharon G.; Li, Xiaohui; Caligiuri, Michael A; Vivier, Eric; Yu, Jianhua

    2015-01-01

    SUMMARY Little is known about the role of negative regulators in controlling natural killer (NK) cell development and effector functions. Foxo1 is a multifunctional transcription factor of the forkhead family. Using a mouse model of conditional deletion in NK cells, we found that Foxo1 negatively controlled NK cell differentiation and function. Immature NK cells expressed abundant Foxo1 and little Tbx21 relative to mature NK cells, but these two transcription factors reversed their expression as NK cells proceeded through development. Foxo1 promoted NK cell homing to lymph nodes through upregulating CD62L expression, and impaired late-stage maturation and effector functions by repressing Tbx21 expression. Loss of Foxo1 rescued the defect in late-stage NK cell maturation in heterozygous Tbx21+/− mice. Collectively, our data reveal a regulatory pathway by which the negative regulator Foxo1 and the positive regulator Tbx21 play opposing roles in controlling NK cell development and effector functions. PMID:25769609

  12. microRNAs in the regulation of dendritic cell functions in inflammation and atherosclerosis.

    Science.gov (United States)

    Busch, Martin; Zernecke, Alma

    2012-08-01

    Atherosclerosis has been established as a chronic inflammatory disease of the vessel wall. Among the mononuclear cell types recruited to the lesions, specialized dendritic cells (DCs) have gained increasing attention, and their secretory products and interactions shape the progression of atherosclerotic plaques. The regulation of DC functions by microRNAs (miRNAs) may thus be of primary importance in disease. We here systematically summarize the biogenesis and functions of miRNAs and provide an overview of miRNAs in DCs, their targets, and potential implications for atherosclerosis, with a particular focus on the best characterized miRNAs in DCs, namely, miR-155 and miR-146. MiRNA functions in DCs range from regulation of lipid uptake to cytokine production and T cell responses with a complex picture emerging, in which miRNAs cooperate or antagonize DC behavior, thereby promoting or counterbalancing inflammatory responses. As miRNAs regulate key functions of DCs known to control atherosclerotic vascular disease, their potential as a therapeutic target holds promise and should be attended to in future research.

  13. Novel function of the retinoblastoma protein in fat: regulation of white versus brown adipocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Jacob B; te Riele, Hein; Kristiansen, Karsten

    2004-01-01

    the major energy store and brown adipocytes being potent energy-dissipaters through thermogenesis. Yet, little is known about factors differentially regulating the formation of white and brown fat cells. Members of the retinoblastoma protein family (pRB, p107, p130) have been implicated in the regulation...... of adipocyte differentiation, and expression and phosphorylation of the three retinoblastoma family proteins oscillate in a characteristic manner during differentiation of the white preadipocyte cell line 3T3-L1. We have recently demonstrated a surprising function of the retinoblastoma protein...... in the regulation of white versus brown adipocyte differentiation in vitro and possibly in vivo. Here we summarize the current knowledge on the retinoblastoma protein in fat cells, with particular emphasis on its potential role in adipocyte lineage commitment and differentiation....

  14. Vascular Function and Regulation of Blood Flow in Resting and Contracting Skeletal Muscle

    DEFF Research Database (Denmark)

    Nyberg, Michael Permin

    importance. The present work provides new insight in to vasodilator interactions important for exercise hyperemia and sheds light on mechanisms important for vascular function and regulation of skeletal muscle blood flow in essential hypertension (high blood pressure) and aging and identifies mechanisms......The precise matching of blood flow, oxygen delivery and metabolism is essential as it ensures that any increase in muscle work is precisely matched by increases in oxygen delivery. Therefore, understanding the control mechanisms of skeletal muscle blood flow regulation is of great biological...... in the regulation of exercise hyperemia. Furthermore, blood flow to contracting leg skeletal muscles is reduced both in essential hypertension and with aging. The potential difference in vasoactive system(s) responsible for the reduction in blood flow in the two conditions is in agreement with the suggestion...

  15. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  16. The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae

    Directory of Open Access Journals (Sweden)

    René Hans-Jürgen Heim

    2015-12-01

    Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.

  17. Membrane-localized ubiquitin ligase ATL15 functions in sugar-responsive growth regulation in Arabidopsis.

    Science.gov (United States)

    Aoyama, Shoki; Terada, Saki; Sanagi, Miho; Hasegawa, Yoko; Lu, Yu; Morita, Yoshie; Chiba, Yukako; Sato, Takeo; Yamaguchi, Junji

    2017-09-09

    Ubiquitin ligases play important roles in regulating various cellular processes by modulating the protein function of specific ubiquitination targets. The Arabidopsis Tóxicos en Levadura (ATL) family is a group of plant-specific RING-type ubiquitin ligases that localize to membranes via their N-terminal transmembrane-like domains. To date, 91 ATL isoforms have been identified in the Arabidopsis genome, with several ATLs reported to be involved in regulating plant responses to environmental stresses. However, the functions of most ATLs remain unknown. This study, involving transcriptome database analysis, identifies ATL15 as a sugar responsive ATL gene in Arabidopsis. ATL15 expression was rapidly down-regulated in the presence of sugar. The ATL15 protein showed ubiquitin ligase activity in vitro and localized to plasma membrane and endomembrane compartments. Further genetic analyses demonstrated that the atl15 knockout mutants are insensitive to high glucose concentrations, whereas ATL15 overexpression depresses plant growth. In addition, endogenous glucose and starch amounts were reciprocally affected in the atl15 knockout mutants and the ATL15 overexpressors. These results suggest that ATL15 protein plays a significant role as a membrane-localized ubiquitin ligase that regulates sugar-responsive plant growth in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. YY1 regulates melanocyte development and function by cooperating with MITF.

    Directory of Open Access Journals (Sweden)

    Juying Li

    Full Text Available Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP-seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1 gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF-a general mechanism which may confer tissue-specific gene expression in multiple lineages.

  19. Functional adaptation to loading of a single bone is neuronally regulated and involves multiple bones.

    Science.gov (United States)

    Sample, Susannah J; Behan, Mary; Smith, Lesley; Oldenhoff, William E; Markel, Mark D; Kalscheur, Vicki L; Hao, Zhengling; Miletic, Vjekoslav; Muir, Peter

    2008-09-01

    Regulation of load-induced bone formation is considered a local phenomenon controlled by osteocytes, although it has also been hypothesized that functional adaptation may be neuronally regulated. The aim of this study was to examine bone formation in multiple bones, in response to loading of a single bone, and to determine whether adaptation may be neuronally regulated. Load-induced responses in the left and right ulnas and humeri were determined after loading of the right ulna in male Sprague-Dawley rats (69 +/- 16 days of age). After a single period of loading at -760-, -2000-, or -3750-microepsilon initial peak strain, rats were given calcein to label new bone formation. Bone formation and bone neuropeptide concentrations were determined at 10 days. In one group, temporary neuronal blocking was achieved by perineural anesthesia of the brachial plexus with bupivicaine during loading. We found right ulna loading induces adaptive responses in other bones in both thoracic limbs compared with Sham controls and that neuronal blocking during loading abrogated bone formation in the loaded ulna and other thoracic limb bones. Skeletal adaptation was more evident in distal long bones compared with proximal long bones. We also found that the single period of loading modulated bone neuropeptide concentrations persistently for 10 days. We conclude that functional adaptation to loading of a single bone in young rapidly growing rats is neuronally regulated and involves multiple bones. Persistent changes in bone neuropeptide concentrations after a single loading period suggest that plasticity exists in the innervation of bone.

  20. Altered emotion regulation capacity in social phobia as a function of comorbidity.

    Science.gov (United States)

    Burklund, Lisa J; Craske, Michelle G; Taylor, Shelley E; Lieberman, Matthew D

    2015-02-01

    Social phobia (SP) has been associated with amygdala hyperreactivity to fear-relevant stimuli. However, little is known about the neural basis of SP individuals' capacity to downregulate their responses to such stimuli and how such regulation varies as a function of comorbid depression and anxiety. We completed an functional magnetic resonance imaging (fMRI) study wherein SP participants without comorbidity (n = 30), with comorbid depression (n = 18) and with comorbid anxiety (n = 19) and healthy controls (n = 15) were scanned while completing an affect labeling emotion regulation task. Individuals with SP as a whole exhibited a reversal of the pattern observed in healthy controls in that they showed upregulation of amygdala activity during affect labeling. However, subsequent analyses revealed a more complex picture based on comorbidity type. Although none of the SP subgroups showed the normative pattern of amygdala downregulation, it was those with comorbid depression specifically who showed significant upregulation. Effects could not be attributed to differences in task performance, amygdala reactivity or right ventral lateral prefrontal cortex (RVLPFC) engagement, but may stem from dysfunctional communication between amygdala and RVLPFC. Furthermore, the particularly altered emotion regulation seen in those with comorbid depression could not be fully explained by symptom severity or state anxiety. Results reveal altered emotion regulation in SP, especially when comorbid with depression. © The Author (2014). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  1. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  2. Intermediate Filaments Play a Pivotal Role in Regulating Cell Architecture and Function.

    Science.gov (United States)

    Lowery, Jason; Kuczmarski, Edward R; Herrmann, Harald; Goldman, Robert D

    2015-07-10

    Intermediate filaments (IFs) are composed of one or more members of a large family of cytoskeletal proteins, whose expression is cell- and tissue type-specific. Their importance in regulating the physiological properties of cells is becoming widely recognized in functions ranging from cell motility to signal transduction. IF proteins assemble into nanoscale biopolymers with unique strain-hardening properties that are related to their roles in regulating the mechanical integrity of cells. Furthermore, mutations in the genes encoding IF proteins cause a wide range of human diseases. Due to the number of different types of IF proteins, we have limited this short review to cover structure and function topics mainly related to the simpler homopolymeric IF networks composed of vimentin, and specifically for diseases, the related muscle-specific desmin IF networks. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Conserved properties of Drosophila Insomniac link sleep regulation and synaptic function.

    Science.gov (United States)

    Li, Qiuling; Kellner, David A; Hatch, Hayden A M; Yumita, Tomohiro; Sanchez, Sandrine; Machold, Robert P; Frank, C Andrew; Stavropoulos, Nicholas

    2017-05-01

    Sleep is an ancient animal behavior that is regulated similarly in species ranging from flies to humans. Various genes that regulate sleep have been identified in invertebrates, but whether the functions of these genes are conserved in mammals remains poorly explored. Drosophila insomniac (inc) mutants exhibit severely shortened and fragmented sleep. Inc protein physically associates with the Cullin-3 (Cul3) ubiquitin ligase, and neuronal depletion of Inc or Cul3 strongly curtails sleep, suggesting that Inc is a Cul3 adaptor that directs the ubiquitination of neuronal substrates that impact sleep. Three proteins similar to Inc exist in vertebrates-KCTD2, KCTD5, and KCTD17-but are uncharacterized within the nervous system and their functional conservation with Inc has not been addressed. Here we show that Inc and its mouse orthologs exhibit striking biochemical and functional interchangeability within Cul3 complexes. Remarkably, KCTD2 and KCTD5 restore sleep to inc mutants, indicating that they can substitute for Inc in vivo and engage its neuronal targets relevant to sleep. Inc and its orthologs localize similarly within fly and mammalian neurons and can traffic to synapses, suggesting that their substrates may include synaptic proteins. Consistent with such a mechanism, inc mutants exhibit defects in synaptic structure and physiology, indicating that Inc is essential for both sleep and synaptic function. Our findings reveal that molecular functions of Inc are conserved through ~600 million years of evolution and support the hypothesis that Inc and its orthologs participate in an evolutionarily conserved ubiquitination pathway that links synaptic function and sleep regulation.

  4. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  5. Effects of sulekang capsule in enhancement of resistance to radiation and regulating immunological function in mice

    International Nuclear Information System (INIS)

    Zhao Naikun; Zhou Ouliang; Du Weixia

    1990-01-01

    The effects of Sulekang capsule in enhancing the resistance to radiation and regulating the immunological function in mice were described. The results show that Sulekang capsule may lengthen the survival time (p 60 Co gamma rays. The experimental results of ANAE reaction show that the activety of T cells of normal or exposed mice may be enhanced by Sulekang capsule, which can control the decrease of both ANAE-positive cells and T cells in exposed mice. So it may enhance the immunological function on exposed animals

  6. Ventral medial prefrontal functional connectivity and emotion regulation in chronic schizophrenia: A pilot study

    Institute of Scientific and Technical Information of China (English)

    Feng-Mei Fan; Shu-Ping Tan; Fu-De Yang; Yun-Long Tan; Yan-Li Zhao; Nan Chen; Bin-Bin Li

    2013-01-01

    People with schizophrenia exhibit impaired social cognitive functions,particularly emotion regulation.Abnormal activations of the ventral medial prefrontal cortex (vMPFC) during emotional tasks have been demonstrated in schizophrenia,suggesting its important role in emotion processing in patients.We used the resting-state functional connectivity approach,setting a functionally relevant region,the vMPFC,as a seed region to examine the intrinsic functional interactions and communication between the vMPFC and other brain regions in schizophrenic patients.We found hypo-connectivity between the vMPFC and the medial frontal cortex,right middle temporal lobe (MTL),right hippocampus,parahippocampal cortex (PHC) and amygdala.Further,there was a decreased strength of the negative connectivity (or anticorrelation) between the vMPFC and the bilateral dorsal lateral prefrontal cortex (DLPFC) and pre-supplementary motor areas.Among these connectivity alterations,reduced vMPFCDLPFC connectivity was positively correlated with positive symptoms on the Positive and Negative Syndrome Scale,while vMPFC-right MTL/PHC/amygdala functional connectivity was positively correlated with the performance of emotional regulation in patients.These findings imply that communication and coordination throughout the brain networks are disrupted in schizophrenia.The emotional correlates of vMPFC connectivity suggest a role of the hypo-connectivity between these regions in the neuropathology of abnormal social cognition in chronic schizophrenia.

  7. Molecular regulation of dendritic cell development and function in homeostasis, inflammation, and cancer.

    Science.gov (United States)

    Chrisikos, Taylor T; Zhou, Yifan; Slone, Natalie; Babcock, Rachel; Watowich, Stephanie S; Li, Haiyan S

    2018-03-14

    Dendritic cells (DCs) are the principal antigen-presenting cells of the immune system and play key roles in controlling immune tolerance and activation. As such, DCs are chief mediators of tumor immunity. DCs can regulate tolerogenic immune responses that facilitate unchecked tumor growth. Importantly, however, DCs also mediate immune-stimulatory activity that restrains tumor progression. For instance, emerging evidence indicates the cDC1 subset has important functions in delivering tumor antigens to lymph nodes and inducing antigen-specific lymphocyte responses to tumors. Moreover, DCs control specific therapeutic responses in cancer including those resulting from immune checkpoint blockade. DC generation and function is influenced profoundly by cytokines, as well as their intracellular signaling proteins including STAT transcription factors. Regardless, our understanding of DC regulation in the cytokine-rich tumor microenvironment is still developing and must be better defined to advance cancer treatment. Here, we review literature focused on the molecular control of DCs, with a particular emphasis on cytokine- and STAT-mediated DC regulation. In addition, we highlight recent studies that delineate the importance of DCs in anti-tumor immunity and immune therapy, with the overall goal of improving knowledge of tumor-associated factors and intrinsic DC signaling cascades that influence DC function in cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Regulation of Histone Acetyltransferase TIP60 Function by Histone Deacetylase 3

    Science.gov (United States)

    Yi, Jingjie; Huang, Xiangyang; Yang, Yuxia; Zhu, Wei-Guo; Gu, Wei; Luo, Jianyuan

    2014-01-01

    The key member of the MOZ (monocyticleukaemia zinc finger protein), Ybf2/Sas3, Sas2, and TIP60 acetyltransferases family, Tat-interactive protein, 60 kD (TIP60), tightly modulates a wide array of cellular processes, including chromatin remodeling, gene transcription, apoptosis, DNA repair, and cell cycle arrest. The function of TIP60 can be regulated by SIRT1 through deacetylation. Here we found that TIP60 can also be functionally regulated by HDAC3. We identified six lysine residues as its autoacetylation sites. Mutagenesis of these lysines to arginines completely abolishes the autoacetylation of TIP60. Overexpression of HDAC3 increases TIP60 ubiquitination levels. However, unlike SIRT1, HDAC3 increased the half-life of TIP60. Further study found that HDAC3 colocalized with TIP60 both in the nucleus and the cytoplasm, which could be the reason why HDAC3 can stabilize TIP60. The deacetylation of TIP60 by both SIRT1 and HDAC3 reduces apoptosis induced by DNA damage. Knockdown of HDAC3 in cells increased TIP60 acetylation levels and increased apoptosis after DNA damage. Together, our findings provide a better understanding of TIP60 regulation mechanisms, which is a significant basis for further studies of its cellular functions. PMID:25301942

  9. Mono- and Digalactosyldiacylglycerol Lipids Function Nonredundantly to Regulate Systemic Acquired Resistance in Plants

    Directory of Open Access Journals (Sweden)

    Qing-ming Gao

    2014-12-01

    Full Text Available Summary: The plant galactolipids monogalactosyldiacylglycerol (MGDG and digalactosyldiacylglycerol (DGDG have been linked to the anti-inflammatory and cancer benefits of a green leafy vegetable diet in humans due to their ability to regulate the levels of free radicals like nitric oxide (NO. Here, we show that DGDG contributes to plant NO as well as salicylic acid biosynthesis and is required for the induction of systemic acquired resistance (SAR. In contrast, MGDG regulates the biosynthesis of the SAR signals azelaic acid (AzA and glycerol-3-phosphate (G3P that function downstream of NO. Interestingly, DGDG is also required for AzA-induced SAR, but MGDG is not. Notably, transgenic expression of a bacterial glucosyltransferase is unable to restore SAR in dgd1 plants even though it does rescue their morphological and fatty acid phenotypes. These results suggest that MGDG and DGDG are required at distinct steps and function exclusively in their individual roles during the induction of SAR. : The galactolipids monogalactosyldiacylglycerol (MGDG and digalactosyldiacylglycerol (DGDG constitute ∼80% of total membrane lipids in plants. Gao et al. now show that these galactolipids function nonredundantly to regulate systemic acquired resistance (SAR. Furthermore, they show that the terminal galactose on the α-galactose-β-galactose head group of DGDG is critical for SAR.

  10. Distinct functions and regulation of epithelial progesterone receptor in the mouse cervix, vagina, and uterus.

    Science.gov (United States)

    Mehta, Fabiola F; Son, Jieun; Hewitt, Sylvia C; Jang, Eunjung; Lydon, John P; Korach, Kenneth S; Chung, Sang-Hyuk

    2016-04-05

    While the function of progesterone receptor (PR) has been studied in the mouse vagina and uterus, its regulation and function in the cervix has not been described. We selectively deleted epithelial PR in the female reproductive tracts using the Cre/LoxP recombination system. We found that epithelial PR was required for induction of apoptosis and suppression of cell proliferation by progesterone (P4) in the cervical and vaginal epithelium. We also found that epithelial PR was dispensable for P4 to suppress apoptosis and proliferation in the uterine epithelium. PR is encoded by the Pgr gene, which is regulated by estrogen receptor α (ERα) in the female reproductive tracts. Using knock-in mouse models expressing ERα mutants, we determined that the DNA-binding domain (DBD) and AF2 domain of ERα were required for upregulation of Pgr in the cervix and vagina as well as the uterine stroma. The ERα AF1 domain was required for upregulation of Pgr in the vaginal stroma and epithelium and cervical epithelium, but not in the uterine and cervical stroma. ERα DBD, AF1, and AF2 were required for suppression of Pgr in the uterine epithelium, which was mediated by stromal ERα. Epithelial ERα was responsible for upregulation of epithelial Pgr in the cervix and vagina. Our results indicate that regulation and functions of epithelial PR are different in the cervix, vagina, and uterus.

  11. 19 CFR 0.1 - Customs revenue function regulations issued under the authority of the Departments of the...

    Science.gov (United States)

    2010-04-01

    ... the authority of the Departments of the Treasury and Homeland Security. 0.1 Section 0.1 Customs Duties... TRANSFERRED OR DELEGATED AUTHORITY § 0.1 Customs revenue function regulations issued under the authority of... authority to prescribe all CBP regulations relating to customs revenue functions, except that the Secretary...

  12. A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.

    Science.gov (United States)

    Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi

    2016-04-01

    Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.

  13. A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

    Directory of Open Access Journals (Sweden)

    Lance K. Blevins

    2017-11-01

    Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

  14. Executive Cognitive Functioning and Cardiovascular Autonomic Regulation in a Population-Based sample of Working Adults

    Directory of Open Access Journals (Sweden)

    Cecilia Ulrika Dagsdotter Stenfors

    2016-10-01

    Full Text Available Objective: Executive cognitive functioning is essential in private and working life and is sensitive to stress and aging. Cardiovascular (CV health factors are related to cognitive decline and dementia, but there is relatively few studies of the role of CV autonomic regulation, a key component in stress responses and risk factor for cardiovascular disease (CVD, and executive processes. An emerging pattern of results from previous studies suggest that different executive processes may be differentially associated with CV autonomic regulationThe aim was thus to study the associations between multiple measures of CV autonomic regulation and measures of different executive cognitive processes. Method: Participants were 119 healthy working adults (79% women, from the Swedish Longitudinal Occupational Survey of Health. Electrocardiogram was sampled for analysis of heart rate variability measures, including the Standard Deviation of NN, here heart beats (SDNN, root of the mean squares of successive differences (RMSSD, high frequency (HF power band from spectral analyses, and QT variability index (QTVI, a measure of myocardial repolarization patterns. Executive cognitive functioning was measured by 7 neuropsychological tests. The relationships between CV autonomic regulation measures and executive cognitive measures were tested with bivariate and partial correlational analyses, controlling for demographic variables and mental health symptoms.Results: Higher SDNN and RMSSD and lower QTVI were significantly associated with better performance on cognitive tests tapping inhibition, updating, shifting and psychomotor speed. After adjustments for demographic factors however (age being the greatest confounder, only QTVI was clearly associated with these executive tests. No such associations were seen for working memory capacity. Conclusion: Poorer cardiovascular autonomic regulation in terms of lower SDNN & RMSSD and higher QTVI was associated with poorer

  15. Executive Cognitive Functioning and Cardiovascular Autonomic Regulation in a Population-Based Sample of Working Adults.

    Science.gov (United States)

    Stenfors, Cecilia U D; Hanson, Linda M; Theorell, Töres; Osika, Walter S

    2016-01-01

    Objective: Executive cognitive functioning is essential in private and working life and is sensitive to stress and aging. Cardiovascular (CV) health factors are related to cognitive decline and dementia, but there is relatively few studies of the role of CV autonomic regulation, a key component in stress responses and risk factor for cardiovascular disease (CVD), and executive processes. An emerging pattern of results from previous studies suggest that different executive processes may be differentially associated with CV autonomic regulation. The aim was thus to study the associations between multiple measures of CV autonomic regulation and measures of different executive cognitive processes. Method: Participants were 119 healthy working adults (79% women), from the Swedish Longitudinal Occupational Survey of Health. Electrocardiogram was sampled for analysis of heart rate variability (HRV) measures, including the Standard Deviation of NN, here heart beats (SDNN), root of the mean squares of successive differences (RMSSD), high frequency (HF) power band from spectral analyses, and QT variability index (QTVI), a measure of myocardial repolarization patterns. Executive cognitive functioning was measured by seven neuropsychological tests. The relationships between CV autonomic regulation measures and executive cognitive measures were tested with bivariate and partial correlational analyses, controlling for demographic variables, and mental health symptoms. Results: Higher SDNN and RMSSD and lower QTVI were significantly associated with better performance on cognitive tests tapping inhibition, updating, shifting, and psychomotor speed. After adjustments for demographic factors however (age being the greatest confounder), only QTVI was clearly associated with these executive tests. No such associations were seen for working memory capacity . Conclusion: Poorer CV autonomic regulation in terms of lower SDNN and RMSSD and higher QTVI was associated with poorer executive

  16. Coordinated Evolution of Transcriptional and Post-Transcriptional Regulation for Mitochondrial Functions in Yeast Strains.

    Directory of Open Access Journals (Sweden)

    Xuepeng Sun

    Full Text Available Evolution of gene regulation has been proposed to play an important role in environmental adaptation. Exploring mechanisms underlying coordinated evolutionary changes at various levels of gene regulation could shed new light on how organism adapt in nature. In this study, we focused on regulatory differences between a laboratory Saccharomyces cerevisiae strain BY4742 and a pathogenic S. cerevisiae strain, YJM789. The two strains diverge in many features, including growth rate, morphology, high temperature tolerance, and pathogenicity. Our RNA-Seq and ribosomal footprint profiling data showed that gene expression differences are pervasive, and genes functioning in mitochondria are mostly divergent between the two strains at both transcriptional and translational levels. Combining functional genomics data from other yeast strains, we further demonstrated that significant divergence of expression for genes functioning in the electron transport chain (ETC was likely caused by differential expression of a transcriptional factor, HAP4, and that post-transcriptional regulation mediated by an RNA-binding protein, PUF3, likely led to expression divergence for genes involved in mitochondrial translation. We also explored mito-nuclear interactions via mitochondrial DNA replacement between strains. Although the two mitochondrial genomes harbor substantial sequence divergence, neither growth nor gene expression were affected by mitochondrial DNA replacement in both fermentative and respiratory growth media, indicating compatible mitochondrial and nuclear genomes between these two strains in the tested conditions. Collectively, we used mitochondrial functions as an example to demonstrate for the first time that evolution at both transcriptional and post-transcriptional levels could lead to coordinated regulatory changes underlying strain specific functional variations.

  17. Rbfox-regulated alternative splicing is critical for zebrafish cardiac and skeletal muscle function

    Science.gov (United States)

    Gallagher, Thomas L.; Arribere, Joshua A.; Geurts, Paul A.; Exner, Cameron R. T.; McDonald, Kent L.; Dill, Kariena K.; Marr, Henry L.; Adkar, Shaunak S.; Garnett, Aaron T.; Amacher, Sharon L.; Conboy, John G.

    2012-01-01

    Rbfox RNA binding proteins are implicated as regulators of phylogenetically-conserved alternative splicing events important for muscle function. To investigate the function of rbfox genes, we used morpholino-mediated knockdown of muscle-expressed rbfox1l and rbfox2 in zebrafish embryos. Single and double morphant embryos exhibited changes in splicing of overlapping sets of bioinformatically-predicted rbfox target exons, many of which exhibit a muscle-enriched splicing pattern that is conserved in vertebrates. Thus, conservation of intronic Rbfox binding motifs is a good predictor of Rbfox-regulated alternative splicing. Morphology and development of single morphant embryos was strikingly normal; however, muscle development in double morphants was severely disrupted. Defects in cardiac muscle were marked by reduced heart rate and in skeletal muscle by complete paralysis. The predominance of wavy myofibers and abnormal thick and thin filaments in skeletal muscle revealed that myofibril assembly is defective and disorganized in double morphants. Ultra-structural analysis revealed that although sarcomeres with electron dense M- and Z-bands are present in muscle fibers of rbfox1l/rbox2 morphants, they are substantially reduced in number and alignment. Importantly, splicing changes and morphological defects were rescued by expression of morpholino-resistant rbfox cDNA. Additionally, a target-blocking MO complementary to a single UGCAUG motif adjacent to an rbfox target exon of fxr1 inhibited inclusion in a similar manner to rbfox knockdown, providing evidence that Rbfox regulates the splicing of target exons via direct binding to intronic regulatory motifs. We conclude that Rbfox proteins regulate an alternative splicing program essential for vertebrate heart and skeletal muscle function. PMID:21925157

  18. Rbfox-regulated alternative splicing is critical for zebrafish cardiac and skeletal muscle functions.

    Science.gov (United States)

    Gallagher, Thomas L; Arribere, Joshua A; Geurts, Paul A; Exner, Cameron R T; McDonald, Kent L; Dill, Kariena K; Marr, Henry L; Adkar, Shaunak S; Garnett, Aaron T; Amacher, Sharon L; Conboy, John G

    2011-11-15

    Rbfox RNA binding proteins are implicated as regulators of phylogenetically-conserved alternative splicing events important for muscle function. To investigate the function of rbfox genes, we used morpholino-mediated knockdown of muscle-expressed rbfox1l and rbfox2 in zebrafish embryos. Single and double morphant embryos exhibited changes in splicing of overlapping sets of bioinformatically-predicted rbfox target exons, many of which exhibit a muscle-enriched splicing pattern that is conserved in vertebrates. Thus, conservation of intronic Rbfox binding motifs is a good predictor of Rbfox-regulated alternative splicing. Morphology and development of single morphant embryos were strikingly normal; however, muscle development in double morphants was severely disrupted. Defects in cardiac muscle were marked by reduced heart rate and in skeletal muscle by complete paralysis. The predominance of wavy myofibers and abnormal thick and thin filaments in skeletal muscle revealed that myofibril assembly is defective and disorganized in double morphants. Ultra-structural analysis revealed that although sarcomeres with electron dense M- and Z-bands are present in muscle fibers of rbfox1l/rbox2 morphants, they are substantially reduced in number and alignment. Importantly, splicing changes and morphological defects were rescued by expression of morpholino-resistant rbfox cDNA. Additionally, a target-blocking MO complementary to a single UGCAUG motif adjacent to an rbfox target exon of fxr1 inhibited inclusion in a similar manner to rbfox knockdown, providing evidence that Rbfox regulates the splicing of target exons via direct binding to intronic regulatory motifs. We conclude that Rbfox proteins regulate an alternative splicing program essential for vertebrate heart and skeletal muscle functions. Published by Elsevier Inc.

  19. Regulation of Plant Microprocessor Function in Shaping microRNA Landscape

    Directory of Open Access Journals (Sweden)

    Jakub Dolata

    2018-06-01

    Full Text Available MicroRNAs are small molecules (∼21 nucleotides long that are key regulators of gene expression. They originate from long stem–loop RNAs as a product of cleavage by a protein complex called Microprocessor. The core components of the plant Microprocessor are the RNase type III enzyme Dicer-Like 1 (DCL1, the zinc finger protein Serrate (SE, and the double-stranded RNA binding protein Hyponastic Leaves 1 (HYL1. Microprocessor assembly and its processing of microRNA precursors have been reported to occur in discrete nuclear bodies called Dicing bodies. The accessibility of and modifications to Microprocessor components affect microRNA levels and may have dramatic consequences in plant development. Currently, numerous lines of evidence indicate that plant Microprocessor activity is tightly regulated. The cellular localization of HYL1 is dependent on a specific KETCH1 importin, and the E3 ubiquitin ligase COP1 indirectly protects HYL1 from degradation in a light-dependent manner. Furthermore, proper localization of HYL1 in Dicing bodies is regulated by MOS2. On the other hand, the Dicing body localization of DCL1 is regulated by NOT2b, which also interacts with SE in the nucleus. Post-translational modifications are substantial factors that contribute to protein functional diversity and provide a fine-tuning system for the regulation of protein activity. The phosphorylation status of HYL1 is crucial for its activity/stability and is a result of the interplay between kinases (MPK3 and SnRK2 and phosphatases (CPL1 and PP4. Additionally, MPK3 and SnRK2 are known to phosphorylate SE. Several other proteins (e.g., TGH, CDF2, SIC, and RCF3 that interact with Microprocessor have been found to influence its RNA-binding and processing activities. In this minireview, recent findings on the various modes of Microprocessor activity regulation are discussed.

  20. Eps8 regulates hair bundle length and functional maturation of mammalian auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Valeria Zampini

    2011-04-01

    Full Text Available Hair cells of the mammalian cochlea are specialized for the dynamic coding of sound stimuli. The transduction of sound waves into electrical signals depends upon mechanosensitive hair bundles that project from the cell's apical surface. Each stereocilium within a hair bundle is composed of uniformly polarized and tightly packed actin filaments. Several stereociliary proteins have been shown to be associated with hair bundle development and function and are known to cause deafness in mice and humans when mutated. The growth of the stereociliar actin core is dynamically regulated at the actin filament barbed ends in the stereociliary tip. We show that Eps8, a protein with actin binding, bundling, and barbed-end capping activities in other systems, is a novel component of the hair bundle. Eps8 is localized predominantly at the tip of the stereocilia and is essential for their normal elongation and function. Moreover, we have found that Eps8 knockout mice are profoundly deaf and that IHCs, but not OHCs, fail to mature into fully functional sensory receptors. We propose that Eps8 directly regulates stereocilia growth in hair cells and also plays a crucial role in the physiological maturation of mammalian cochlear IHCs. Together, our results indicate that Eps8 is critical in coordinating the development and functionality of mammalian auditory hair cells.

  1. Eps8 regulates hair bundle length and functional maturation of mammalian auditory hair cells.

    Science.gov (United States)

    Zampini, Valeria; Rüttiger, Lukas; Johnson, Stuart L; Franz, Christoph; Furness, David N; Waldhaus, Jörg; Xiong, Hao; Hackney, Carole M; Holley, Matthew C; Offenhauser, Nina; Di Fiore, Pier Paolo; Knipper, Marlies; Masetto, Sergio; Marcotti, Walter

    2011-04-01

    Hair cells of the mammalian cochlea are specialized for the dynamic coding of sound stimuli. The transduction of sound waves into electrical signals depends upon mechanosensitive hair bundles that project from the cell's apical surface. Each stereocilium within a hair bundle is composed of uniformly polarized and tightly packed actin filaments. Several stereociliary proteins have been shown to be associated with hair bundle development and function and are known to cause deafness in mice and humans when mutated. The growth of the stereociliar actin core is dynamically regulated at the actin filament barbed ends in the stereociliary tip. We show that Eps8, a protein with actin binding, bundling, and barbed-end capping activities in other systems, is a novel component of the hair bundle. Eps8 is localized predominantly at the tip of the stereocilia and is essential for their normal elongation and function. Moreover, we have found that Eps8 knockout mice are profoundly deaf and that IHCs, but not OHCs, fail to mature into fully functional sensory receptors. We propose that Eps8 directly regulates stereocilia growth in hair cells and also plays a crucial role in the physiological maturation of mammalian cochlear IHCs. Together, our results indicate that Eps8 is critical in coordinating the development and functionality of mammalian auditory hair cells.

  2. ARF6-dependent regulation of P2Y receptor traffic and function in human platelets.

    Science.gov (United States)

    Kanamarlapudi, Venkateswarlu; Owens, Sian E; Saha, Keya; Pope, Robert J; Mundell, Stuart J

    2012-01-01

    Adenosine diphosphate (ADP) is a critical regulator of platelet activation, mediating its actions through two G protein-coupled receptors, the P2Y(1) and P2Y(12) purinoceptors. Recently, we demonstrated that P2Y(1) and P2Y(12) purinoceptor activities are rapidly and reversibly modulated in human platelets, revealing that the underlying mechanism requires receptor internalization and subsequent trafficking as an essential part of this process. In this study we investigated the role of the small GTP-binding protein ADP ribosylation factor 6 (ARF6) in the internalization and function of P2Y(1) and P2Y(12) purinoceptors in human platelets. ARF6 has been implicated in the internalization of a number of GPCRs, although its precise molecular mechanism in this process remains unclear. In this study we show that activation of either P2Y(1) or P2Y(12) purinoceptors can stimulate ARF6 activity. Further blockade of ARF6 function either in cell lines or human platelets blocks P2Y purinoceptor internalization. This blockade of receptor internalization attenuates receptor resensitization. Furthermore, we demonstrate that Nm23-H1, a nucleoside diphosphate (NDP) kinase regulated by ARF6 which facilitates dynamin-dependent fission of coated vesicles during endocytosis, is also required for P2Y purinoceptor internalization. These data describe a novel function of ARF6 in the internalization of P2Y purinoceptors and demonstrate the integral importance of this small GTPase upon platelet ADP receptor function.

  3. ARF6-dependent regulation of P2Y receptor traffic and function in human platelets.

    Directory of Open Access Journals (Sweden)

    Venkateswarlu Kanamarlapudi

    Full Text Available Adenosine diphosphate (ADP is a critical regulator of platelet activation, mediating its actions through two G protein-coupled receptors, the P2Y(1 and P2Y(12 purinoceptors. Recently, we demonstrated that P2Y(1 and P2Y(12 purinoceptor activities are rapidly and reversibly modulated in human platelets, revealing that the underlying mechanism requires receptor internalization and subsequent trafficking as an essential part of this process. In this study we investigated the role of the small GTP-binding protein ADP ribosylation factor 6 (ARF6 in the internalization and function of P2Y(1 and P2Y(12 purinoceptors in human platelets. ARF6 has been implicated in the internalization of a number of GPCRs, although its precise molecular mechanism in this process remains unclear. In this study we show that activation of either P2Y(1 or P2Y(12 purinoceptors can stimulate ARF6 activity. Further blockade of ARF6 function either in cell lines or human platelets blocks P2Y purinoceptor internalization. This blockade of receptor internalization attenuates receptor resensitization. Furthermore, we demonstrate that Nm23-H1, a nucleoside diphosphate (NDP kinase regulated by ARF6 which facilitates dynamin-dependent fission of coated vesicles during endocytosis, is also required for P2Y purinoceptor internalization. These data describe a novel function of ARF6 in the internalization of P2Y purinoceptors and demonstrate the integral importance of this small GTPase upon platelet ADP receptor function.

  4. The role of oligomerization and cooperative regulation in protein function: the case of tryptophan synthase.

    Directory of Open Access Journals (Sweden)

    M Qaiser Fatmi

    Full Text Available The oligomerization/co-localization of protein complexes and their cooperative regulation in protein function is a key feature in many biological systems. The synergistic regulation in different subunits often enhances the functional properties of the multi-enzyme complex. The present study used molecular dynamics and Brownian dynamics simulations to study the effects of allostery, oligomerization and intermediate channeling on enhancing the protein function of tryptophan synthase (TRPS. TRPS uses a set of α/β-dimeric units to catalyze the last two steps of L-tryptophan biosynthesis, and the rate is remarkably slower in the isolated monomers. Our work shows that without their binding partner, the isolated monomers are stable and more rigid. The substrates can form fairly stable interactions with the protein in both forms when the protein reaches the final ligand-bound conformations. Our simulations also revealed that the α/β-dimeric unit stabilizes the substrate-protein conformation in the ligand binding process, which lowers the conformation transition barrier and helps the protein conformations shift from an open/inactive form to a closed/active form. Brownian dynamics simulations with a coarse-grained model illustrate how protein conformations affect substrate channeling. The results highlight the complex roles of protein oligomerization and the fine balance between rigidity and dynamics in protein function.

  5. Ihh/Gli2 signaling promotes osteoblast differentiation by regulating Runx2 expression and function.

    Science.gov (United States)

    Shimoyama, Atsuko; Wada, Masahiro; Ikeda, Fumiyo; Hata, Kenji; Matsubara, Takuma; Nifuji, Akira; Noda, Masaki; Amano, Katsuhiko; Yamaguchi, Akira; Nishimura, Riko; Yoneda, Toshiyuki

    2007-07-01

    Genetic and cell biological studies have indicated that Indian hedgehog (Ihh) plays an important role in bone development and osteoblast differentiation. However, the molecular mechanism by which Ihh regulates osteoblast differentiation is complex and remains to be fully elucidated. In this study, we investigated the role of Ihh signaling in osteoblast differentiation using mesenchymal cells and primary osteoblasts. We observed that Ihh stimulated alkaline phosphatase (ALP) activity, osteocalcin expression, and calcification. Overexpression of Gli2- but not Gli3-induced ALP, osteocalcin expression, and calcification of these cells. In contrast, dominant-negative Gli2 markedly inhibited Ihh-dependent osteoblast differentiation. Ihh treatment or Gli2 overexpression also up-regulated the expression of Runx2, an essential transcription factor for osteoblastogenesis, and enhanced the transcriptional activity and osteogenic action of Runx2. Coimmunoprecipitation analysis demonstrated a physical interaction between Gli2 and Runx2. Moreover, Ihh or Gli2 overexpression failed to increase ALP activity in Runx2-deficient mesenchymal cells. Collectively, these results suggest that Ihh regulates osteoblast differentiation of mesenchymal cells through up-regulation of the expression and function of Runx2 by Gli2.

  6. Original article The regulative function of mentalization and mindfulness in borderline personality organization

    Directory of Open Access Journals (Sweden)

    Monika Marszał

    2015-03-01

    Full Text Available Background The aim of this study was to broaden the understanding of the emotional difficulties of borderline personality organization (BPO by reference to a meta-ability named ‘orientation on the internal world’, here conceptualized as mentalization and mindfulness, in the framework of object relation theory. It was assumed that it is not mentalization “in itself”, but mainly its regulatory function, that is important for BPO. Participants and procedure The clinical and control groups (30 individuals each were examined using The Mental States Task, The Difficulties of Emotion Regulation Scale and The Mindful Attention Awareness Scale. Results Individuals with BPO functioned worse than the control group in terms of mentalization, mindfulness, and emotion regulation. The relationship between BPO and the meta-abilities was mediated by emotional dysregulation: total mediation was revealed for one mentalization dimension, and partial mediation was observed for mindfulness. Conclusions Orientation on emotional experience and emotional dysregulation are not independent predictors of BPO, but they can be treated as levels in the hierarchical model. Mentalization determines and influences emotion regulation in BPO.

  7. TASK-2: a K2P K+ channel with complex regulation and diverse physiological functions

    Directory of Open Access Journals (Sweden)

    Luis Pablo Cid

    2013-07-01

    Full Text Available TASK-2 (K2P5.1 is a two-pore domain K+ channel belonging to the TALK subgroup of the K2P family of proteins. TASK-2 has been shown to be activated by extra- and intracellular alkalinisation. Extra- and intracellular pH-sensors reside at arginine 224 and lysine 245 and might affect separate selectivity filter and inner gates respectively. TASK-2 is modulated by changes in cell volume and a regulation by direct G-protein interaction has also been proposed. Activation by extracellular alkalinisation has been associated with a role of TASK-2 in kidney proximal tubule bicarbonate reabsorption, whilst intracellular pH-sensitivity might be the mechanism for its participation in central chemosensitive neurons. In addition to these functions TASK-2 has been proposed to play a part in apoptotic volume decrease in kidney cells and in volume regulation of glial cells and T-lymphocytes. TASK-2 is present in chondrocytes of hyaline cartilage, where it is proposed to play a central role in stabilizing the membrane potential. Additional sites of expression are dorsal root ganglion neurons, endocrine and exocrine pancreas and intestinal smooth muscle cells. TASK-2 has been associated with the regulation of proliferation of breast cancer cells and could become target for breast cancer therapeutics. Further work in native tissues and cells together with genetic modification will no doubt reveal the details of TASK-2 functions that we are only starting to suspect.

  8. KLF2 in Regulation of NF-κB-Mediated Immune Cell Function and Inflammation

    Directory of Open Access Journals (Sweden)

    Prerana Jha

    2017-11-01

    Full Text Available KLF2 (Kruppel-like factor 2 is a member of the zinc finger transcription factor family, which critically regulates embryonic lung development, function of endothelial cells and maintenance of quiescence in T-cells and monocytes. It is expressed in naïve T-cells and monocytes, however its level of expression decreases during activation and differentiation. KLF2 also plays critical regulatory role in various inflammatory diseases and their pathogenesis. Nuclear factor-kappaB (NF-κB is an important inducer of inflammation and the inflammation is mediated through the transcription of several proinflammatory cytokines, chemokines and adhesion molecules. So, both transcriptional factors KLF2 and NF-κB are being associated with the similar cellular functions and their maintenance. It was shown that KLF2 regulates most of the NF-κB-mediated activities. In this review, we focused on emphasizing the involvement of KLF2 in health and disease states and how they interact with transcriptional master regulator NF-κB.

  9. Systematic Analysis of the Functions of Lysine Acetylation in the Regulation of Tat Activity.

    Directory of Open Access Journals (Sweden)

    Minghao He

    Full Text Available The Tat protein of HIV-1 has several well-known properties, such as nucleocytoplasmic trafficking, transactivation of transcription, interaction with tubulin, regulation of mitotic progression, and induction of apoptosis. Previous studies have identified a couple of lysine residues in Tat that are essential for its functions. In order to analyze the functions of all the lysine residues in Tat, we mutated them individually to alanine, glutamine, and arginine. Through systematic analysis of the lysine mutants, we discovered several previously unidentified characteristics of Tat. We found that lysine acetylation could modulate the subcellular localization of Tat, in addition to the regulation of its transactivation activity. Our data also revealed that lysine mutations had distinct effects on microtubule assembly and Tat binding to bromodomain proteins. By correlation analysis, we further found that the effects of Tat on apoptosis and mitotic progression were not entirely attributed to its effect on microtubule assembly. Our findings suggest that Tat may regulate diverse cellular activities through binding to different proteins and that the acetylation of distinct lysine residues in Tat may modulate its interaction with various partners.

  10. Functions of TAM RTKs in regulating spermatogenesis and male fertility in mice.

    Science.gov (United States)

    Chen, Yongmei; Wang, Huizhen; Qi, Nan; Wu, Hui; Xiong, Weipeng; Ma, Jing; Lu, Qingxian; Han, Daishu

    2009-10-01

    Mice lacking TYRO3, AXL and MER (TAM) receptor tyrosine kinases (RTKs) are male sterile. The mechanism of TAM RTKs in regulating male fertility remains unknown. In this study, we analyzed in more detail the testicular phenotype of TAM triple mutant (TAM(-/-)) mice with an effort to understand the mechanism. We demonstrate that the three TAM RTKs cooperatively regulate male fertility, and MER appears to be more important than AXL and TYRO3. TAM(-/-) testes showed a progressive loss of germ cells from elongated spermatids to spermatogonia. Young adult TAM(-/-) mice exhibited oligo-astheno-teratozoospermia and various morphological malformations of sperm cells. As the mice aged, the germ cells were eventually depleted from the seminiferous tubules. Furthermore, we found that TAM(-/-) Sertoli cells have an impaired phagocytic activity and a large number of differentially expressed genes compared to wild-type controls. By contrast, the function of Leydig cells was not apparently affected by the mutation of TAM RTKs. Therefore, we conclude that the suboptimal function of Sertoli cells leads to the impaired spermatogenesis in TAM(-/-) mice. The results provide novel insight into the mechanism of TAM RTKs in regulating male fertility.

  11. L-tyrosine and L-DOPA as hormone-like regulators of melanocytes functions

    Science.gov (United States)

    Slominski, Andrzej; Zmijewski, Michal; Pawelek, John

    2011-01-01

    Summary Evidence reveals that L-tyrosine and L-DOPA, besides serving as substrates and intermediates of melanogenesis, are also bioregulatory agents acting not only as inducers and positive regulators of melanogenesis but also as regulators of other cellular functions. These can be mediated through action on specific receptors or through non-receptor mediated mechanisms. The substrate induced (L-tyrosine and/or L-DOPA) melanogenic pathway would autoregulate itself as well as it would regulate the melanocyte functions through activity of its structural or regulatory proteins and through intermediates of melanogenesis and melanin itself. Dissection of regulatory and autoregulatory elements of this process may elucidate how substrate induced autoregulatory pathways have evolved from prokaryotic or simple eukaryotic organisms to complex systems in vertebrates. This could substantiate older theory proposing that receptors for amino-acid derived hormones arose from the receptors for those amino acids, and that nuclear receptors evolved from primitive intracellular receptors binding nutritional factors or metabolic intermediates. PMID:21834848

  12. Axon-Axon Interactions Regulate Topographic Optic Tract Sorting via CYFIP2-Dependent WAVE Complex Function.

    Science.gov (United States)

    Cioni, Jean-Michel; Wong, Hovy Ho-Wai; Bressan, Dario; Kodama, Lay; Harris, William A; Holt, Christine E

    2018-03-07

    The axons of retinal ganglion cells (RGCs) are topographically sorted before they arrive at the optic tectum. This pre-target sorting, typical of axon tracts throughout the brain, is poorly understood. Here, we show that cytoplasmic FMR1-interacting proteins (CYFIPs) fulfill non-redundant functions in RGCs, with CYFIP1 mediating axon growth and CYFIP2 specifically involved in axon sorting. We find that CYFIP2 mediates homotypic and heterotypic contact-triggered fasciculation and repulsion responses between dorsal and ventral axons. CYFIP2 associates with transporting ribonucleoprotein particles in axons and regulates translation. Axon-axon contact stimulates CYFIP2 to move into growth cones where it joins the actin nucleating WAVE regulatory complex (WRC) in the periphery and regulates actin remodeling and filopodial dynamics. CYFIP2's function in axon sorting is mediated by its binding to the WRC but not its translational regulation. Together, these findings uncover CYFIP2 as a key regulatory link between axon-axon interactions, filopodial dynamics, and optic tract sorting. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Regulator of G protein signaling 5 (RGS5) inhibits sonic hedgehog function in mouse cortical neurons.

    Science.gov (United States)

    Liu, Chuanliang; Hu, Qiongqiong; Jing, Jia; Zhang, Yun; Jin, Jing; Zhang, Liulei; Mu, Lili; Liu, Yumei; Sun, Bo; Zhang, Tongshuai; Kong, Qingfei; Wang, Guangyou; Wang, Dandan; Zhang, Yao; Liu, Xijun; Zhao, Wei; Wang, Jinghua; Feng, Tao; Li, Hulun

    2017-09-01

    Regulator of G protein signaling 5 (RGS5) acts as a GTPase-activating protein (GAP) for the Gαi subunit and negatively regulates G protein-coupled receptor signaling. However, its presence and function in postmitotic differentiated primary neurons remains largely uncharacterized. During neural development, sonic hedgehog (Shh) signaling is involved in cell signaling pathways via Gαi activity. In particular, Shh signaling is essential for embryonic neural tube patterning, which has been implicated in neuronal polarization involving neurite outgrowth. Here, we examined whether RGS5 regulates Shh signaling in neurons. RGS5 transcripts were found to be expressed in cortical neurons and their expression gradually declined in a time-dependent manner in culture system. When an adenovirus expressing RGS5 was introduced into an in vitro cell culture model of cortical neurons, RGS5 overexpression significantly reduced neurite outgrowth and FM4-64 uptake, while cAMP-PKA signaling was also affected. These findings suggest that RGS5 inhibits Shh function during neurite outgrowth and the presynaptic terminals of primary cortical neurons mature via modulation of cAMP. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Transcription factor RBP-J-mediated signalling regulates basophil immunoregulatory function in mouse asthma model.

    Science.gov (United States)

    Qu, Shuo-Yao; He, Ya-Long; Zhang, Jian; Wu, Chang-Gui

    2017-09-01

    Basophils (BA) play an important role in the promotion of aberrant T helper type 2 (Th2) immune responses in asthma. It is not only the effective cell, but also modulates the initiation of Th2 immune responses. We earlier demonstrated that Notch signalling regulates the biological function of BAin vitro. However, whether this pathway plays the same role in vivo is not clear. The purpose of the present study was to investigate the effect of Notch signalling on BA function in the regulation of allergic airway inflammation in a murine model of asthma. Bone marrow BA were prepared by bone marrow cell culture in the presence of recombinant interleukin-3 (rIL-3; 300 pg/ml) for 7 days, followed by isolation of the CD49b + microbeads. The recombination signal binding protein J (RBP-J -/- ) BA were co-cultured with T cells, and the supernatant and the T-cell subtypes were examined. The results indicated disruption of the capacity of BA for antigen presentation alongside an up-regulation of the immunoregulatory function. This was possibly due to the low expression of OX40L in the RBP-J -/- BA. Basophils were adoptively transferred to ovalbumin-sensitized recipient mice, to establish an asthma model. Lung pathology, cytokine profiles of brobchoalveolar fluid, airway hyperactivity and the absolute number of Th1/Th2 cells in lungs were determined. Overall, our results indicate that the RBP-J-mediated Notch signalling is critical for BA-dependent immunoregulation. Deficiency of RBP-J influences the immunoregulatory functions of BA, which include activation of T cells and their differentiation into T helper cell subtypes. The Notch signalling pathway is a potential therapeutic target for BA-based immunotherapy against asthma. © 2017 John Wiley & Sons Ltd.

  15. NFAT5-Regulated Macrophage Polarization Supports the Proinflammatory Function of Macrophages and T Lymphocytes.

    Science.gov (United States)

    Tellechea, Mónica; Buxadé, Maria; Tejedor, Sonia; Aramburu, Jose; López-Rodríguez, Cristina

    2018-01-01

    Macrophages are exquisite sensors of tissue homeostasis that can rapidly switch between pro- and anti-inflammatory or regulatory modes to respond to perturbations in their microenvironment. This functional plasticity involves a precise orchestration of gene expression patterns whose transcriptional regulators have not been fully characterized. We had previously identified the transcription factor NFAT5 as an activator of TLR-induced responses, and in this study we explore its contribution to macrophage functions in different polarization settings. We found that both in classically and alternatively polarized macrophages, NFAT5 enhanced functions associated with a proinflammatory profile such as bactericidal capacity and the ability to promote Th1 polarization over Th2 responses. In this regard, NFAT5 upregulated the Th1-stimulatory cytokine IL-12 in classically activated macrophages, whereas in alternatively polarized ones it enhanced the expression of the pro-Th1 mediators Fizz-1 and arginase 1, indicating that it could promote proinflammatory readiness by regulating independent genes in differently polarized macrophages. Finally, adoptive transfer assays in vivo revealed a reduced antitumor capacity in NFAT5-deficient macrophages against syngeneic Lewis lung carcinoma and ID8 ovarian carcinoma cells, a defect that in the ID8 model was associated with a reduced accumulation of effector CD8 T cells at the tumor site. Altogether, detailed analysis of the effect of NFAT5 in pro- and anti-inflammatory macrophages uncovered its ability to regulate distinct genes under both polarization modes and revealed its predominant role in promoting proinflammatory macrophage functions. Copyright © 2017 by The American Association of Immunologists, Inc.

  16. MicroRNAs: not ‘fine-tuners’ but key regulators of neuronal development and function

    Directory of Open Access Journals (Sweden)

    Gregory eDavis

    2015-11-01

    Full Text Available microRNAs (miRNAs are a class of short non-coding RNAs that operate as prominent post-transcriptional regulators of eukaryotic gene expression. miRNAs are abundantly expressed in the brain of most animals and exert diverse roles. The anatomical and functional complexity of brain requires the precise coordination of multi-layered gene regulatory networks. The flexibility, speed and reversibility of miRNA function provide precise temporal and spatial gene regulatory capabilities that are crucial for the correct functioning of the brain. Studies have shown that the underlying molecular mechanisms controlled by miRNAs in the nervous systems of invertebrate and vertebrate models are remarkably conserved in humans. We endeavour to provide insight into the roles of miRNAs in the nervous systems of these model organisms and discuss how such information may be used to inform regarding diseases of the human brain.

  17. Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

    International Nuclear Information System (INIS)

    Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

    2006-01-01

    Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

  18. Cancer metabolism meets systems biology: Pyruvate kinase isoform PKM2 is a metabolic master regulator

    OpenAIRE

    Fabian V Filipp

    2013-01-01

    Pyruvate kinase activity is controlled by a tightly woven regulatory network. The oncofetal isoform of pyruvate kinase (PKM2) is a master regulator of cancer metabolism. PKM2 engages in parallel, feed-forward, positive and negative feedback control contributing to cancer progression. Besides its metabolic role, non-metabolic functions of PKM2 as protein kinase and transcriptional coactivator for c-MYC and hypoxia-inducible factor 1-alpha are essential for epidermal growth factor receptor acti...

  19. Exercise protects from cancer through regulation of immune function and inflammation

    DEFF Research Database (Denmark)

    Hojman, Pernille

    2017-01-01

    Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...

  20. Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase.

    Science.gov (United States)

    Watashi, Koichi; Ishii, Naoto; Hijikata, Makoto; Inoue, Daisuke; Murata, Takayuki; Miyanari, Yusuke; Shimotohno, Kunitada

    2005-07-01

    Viruses depend on host-derived factors for their efficient genome replication. Here, we demonstrate that a cellular peptidyl-prolyl cis-trans isomerase (PPIase), cyclophilin B (CyPB), is critical for the efficient replication of the hepatitis C virus (HCV) genome. CyPB interacted with the HCV RNA polymerase NS5B to directly stimulate its RNA binding activity. Both the RNA interference (RNAi)-mediated reduction of endogenous CyPB expression and the induced loss of NS5B binding to CyPB decreased the levels of HCV replication. Thus, CyPB functions as a stimulatory regulator of NS5B in HCV replication machinery. This regulation mechanism for viral replication identifies CyPB as a target for antiviral therapeutic strategies.

  1. The functional role for condensin in the regulation of chromosomal organization during the cell cycle.

    Science.gov (United States)

    Kagami, Yuya; Yoshida, Kiyotsugu

    2016-12-01

    In all organisms, the control of cell cycle progression is a fundamental process that is essential for cell growth, development, and survival. Through each cell cycle phase, the regulation of chromatin organization is essential for natural cell proliferation and maintaining cellular homeostasis. During mitosis, the chromatin morphology is dramatically changed to have a "thread-like" shape and the condensed chromosomes are segregated equally into two daughter cells. Disruption of the mitotic chromosome architecture physically impedes chromosomal behaviors, such as chromosome alignment and chromosome segregation; therefore, the proper mitotic chromosome structure is required to maintain chromosomal stability. Accumulating evidence has demonstrated that mitotic chromosome condensation is induced by condensin complexes. Moreover, recent studies have shown that condensin also modulates interphase chromatin and regulates gene expression. This review mainly focuses on the molecular mechanisms that condensin uses to exert its functions during the cell cycle progression. Moreover, we discuss the condensin-mediated chromosomal organization in cancer cells.

  2. The regulation of function, growth and survival of GLP-1-producing L-cells

    DEFF Research Database (Denmark)

    Kuhre, Rune Ehrenreich; Holst, Jens Juul; Kappe, Camilla

    2016-01-01

    that regulate the growth, survival and function of these cells are largely unknown. We recently showed that prolonged exposure to high concentrations of the fatty acid palmitate induced lipotoxic effects, similar to those operative in insulin-producing cells, in an in vitro model of GLP-1-producing cells...... absorption and disposal, as well as cell proliferation and survival. In Type 2 Diabetes (T2D) reduced plasma levels of GLP-1 have been observed, and plasma levels of GLP-1, as well as reduced numbers of GLP-1 producing cells, have been correlated to obesity and insulin resistance. Increasing endogenous...... secretion of GLP-1 by selective targeting of the molecular mechanisms regulating secretion from the L-cell has been the focus of much recent research. An additional and promising strategy for enhancing endogenous secretion may be to increase the L-cell mass in the intestinal epithelium, but the mechanisms...

  3. Epidermal growth factor pathway substrate 15, Eps15

    DEFF Research Database (Denmark)

    Salcini, A E; Chen, H; Iannolo, G

    1999-01-01

    Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...

  4. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  5. Functional properties and differential mode of regulation of the nitrate transporter from a plant symbiotic ascomycete

    Science.gov (United States)

    Montanini, Barbara; Viscomi, Arturo R.; Bolchi, Angelo; Martin, Yusé; Siverio, José M.; Balestrini, Raffaella; Bonfante, Paola; Ottonello, Simone

    2005-01-01

    Nitrogen assimilation by plant symbiotic fungi plays a central role in the mutualistic interaction established by these organisms, as well as in nitrogen flux in a variety of soils. In the present study, we report on the functional properties, structural organization and distinctive mode of regulation of TbNrt2 (Tuber borchii NRT2 family transporter), the nitrate transporter of the mycorrhizal ascomycete T. borchii. As revealed by experiments conducted in a nitrate-uptake-defective mutant of the yeast Hansenula polymorpha, TbNrt2 is a high-affinity transporter (Km=4.7 μM nitrate) that is bispecific for nitrate and nitrite. It is expressed in free-living mycelia and in mycorrhizae, where it preferentially accumulates in the plasma membrane of root-contacting hyphae. The TbNrt2 mRNA, which is transcribed from a single-copy gene clustered with the nitrate reductase gene in the T. borchii genome, was specifically up-regulated following transfer of mycelia to nitrate- (or nitrite)-containing medium. However, at variance with the strict nitrate-dependent induction commonly observed in other organisms, TbNrt2 was also up-regulated (at both the mRNA and the protein level) following transfer to a nitrogen-free medium. This unusual mode of regulation differs from that of the adjacent nitrate reductase gene, which was expressed at basal levels under nitrogen deprivation conditions and required nitrate for induction. The functional and expression properties, described in the present study, delineate TbNrt2 as a versatile transporter that may be especially suited to cope with the fluctuating (and often low) mineral nitrogen concentrations found in most natural, especially forest, soils. PMID:16201972

  6. Rasputin functions as a positive regulator of orb in Drosophila oogenesis.

    Directory of Open Access Journals (Sweden)

    Alexandre Costa

    Full Text Available The determination of cell fate and the establishment of polarity axes during Drosophila oogenesis depend upon pathways that localize mRNAs within the egg chamber and control their on-site translation. One factor that plays a central role in regulating on-site translation of mRNAs is Orb. Orb is a founding member of the conserved CPEB family of RNA-binding proteins. These proteins bind to target sequences in 3' UTRs and regulate mRNA translation by modulating poly(A tail length. In addition to controlling the translation of axis-determining mRNAs like grk, fs(1K10, and osk, Orb protein autoregulates its own synthesis by binding to orb mRNA and activating its translation. We have previously shown that Rasputin (Rin, the Drosophila homologue of Ras-GAP SH3 Binding Protein (G3BP, associates with Orb in a messenger ribonucleoprotein (mRNP complex. Rin is an evolutionarily conserved RNA-binding protein believed to function as a link between Ras signaling and RNA metabolism. Here we show that Orb and Rin form a complex in the female germline. Characterization of a new rin allele shows that rin is essential for oogenesis. Co-localization studies suggest that Orb and Rin form a complex in the oocyte at different stages of oogenesis. This is supported by genetic and biochemical analyses showing that rin functions as a positive regulator in the orb autoregulatory pathway by increasing Orb protein expression. Tandem Mass Spectrometry analysis shows that several canonical stress granule proteins are associated with the Orb-Rin complex suggesting that a conserved mRNP complex regulates localized translation during oogenesis in Drosophila.

  7. Rasputin functions as a positive regulator of orb in Drosophila oogenesis.

    Science.gov (United States)

    Costa, Alexandre; Pazman, Cecilia; Sinsimer, Kristina S; Wong, Li Chin; McLeod, Ian; Yates, John; Haynes, Susan; Schedl, Paul

    2013-01-01

    The determination of cell fate and the establishment of polarity axes during Drosophila oogenesis depend upon pathways that localize mRNAs within the egg chamber and control their on-site translation. One factor that plays a central role in regulating on-site translation of mRNAs is Orb. Orb is a founding member of the conserved CPEB family of RNA-binding proteins. These proteins bind to target sequences in 3' UTRs and regulate mRNA translation by modulating poly(A) tail length. In addition to controlling the translation of axis-determining mRNAs like grk, fs(1)K10, and osk, Orb protein autoregulates its own synthesis by binding to orb mRNA and activating its translation. We have previously shown that Rasputin (Rin), the Drosophila homologue of Ras-GAP SH3 Binding Protein (G3BP), associates with Orb in a messenger ribonucleoprotein (mRNP) complex. Rin is an evolutionarily conserved RNA-binding protein believed to function as a link between Ras signaling and RNA metabolism. Here we show that Orb and Rin form a complex in the female germline. Characterization of a new rin allele shows that rin is essential for oogenesis. Co-localization studies suggest that Orb and Rin form a complex in the oocyte at different stages of oogenesis. This is supported by genetic and biochemical analyses showing that rin functions as a positive regulator in the orb autoregulatory pathway by increasing Orb protein expression. Tandem Mass Spectrometry analysis shows that several canonical stress granule proteins are associated with the Orb-Rin complex suggesting that a conserved mRNP complex regulates localized translation during oogenesis in Drosophila.

  8. Advances in the Function and Regulation of Hydrogenase in the Cyanobacterium Synechocystis PCC6803

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Veaudor, Théo; Chauvat, Franck

    2014-01-01

    In order to use cyanobacteria for the biological production of hydrogen, it is important to thoroughly study the function and the regulation of the hydrogen-production machine in order to better understand its role in the global cell metabolism and identify bottlenecks limiting H2 production. Most of the recent advances in our understanding of the bidirectional [Ni-Fe] hydrogenase (Hox) came from investigations performed in the widely-used model cyanobacterium Synechocystis PCC6803 where Hox is the sole enzyme capable of combining electrons with protons to produce H2 under specific conditions. Recent findings suggested that the Hox enzyme can receive electrons from not only NAD(P)H as usually shown, but also, or even preferentially, from ferredoxin. Furthermore, plasmid-encoded functions and glutathionylation (the formation of a mixed-disulfide between the cysteines residues of a protein and the cysteine residue of glutathione) are proposed as possible new players in the function and regulation of hydrogen production. PMID:25365180

  9. Cysteine regulation of protein function--as exemplified by NMDA-receptor modulation.

    Science.gov (United States)

    Lipton, Stuart A; Choi, Yun-Beom; Takahashi, Hiroto; Zhang, Dongxian; Li, Weizhong; Godzik, Adam; Bankston, Laurie A

    2002-09-01

    Until recently cysteine residues, especially those located extracellularly, were thought to be important for metal coordination, catalysis and protein structure by forming disulfide bonds - but they were not thought to regulate protein function. However, this is not the case. Crucial cysteine residues can be involved in modulation of protein activity and signaling events via other reactions of their thiol (sulfhydryl; -SH) groups. These reactions can take several forms, such as redox events (chemical reduction or oxidation), chelation of transition metals (chiefly Zn(2+), Mn(2+) and Cu(2+)) or S-nitrosylation [the catalyzed transfer of a nitric oxide (NO) group to a thiol group]. In several cases, these disparate reactions can compete with one another for the same thiol group on a single cysteine residue, forming a molecular switch composed of a latticework of possible redox, NO or Zn(2+) modifications to control protein function. Thiol-mediated regulation of protein function can also involve reactions of cysteine residues that affect ligand binding allosterically. This article reviews the basis for these molecular cysteine switches, drawing on the NMDA receptor as an exemplary protein, and proposes a molecular model for the action of S-nitrosylation based on recently derived crystal structures.

  10. Hypoxia and hypoxia-inducible factors as regulators of T cell development, differentiation, and function

    Science.gov (United States)

    McNamee, Eóin N.; Johnson, Darlynn Korns; Homann, Dirk

    2014-01-01

    Oxygen is a molecule that is central to cellular respiration and viability, yet there are multiple physiologic and pathological contexts in which cells experience conditions of insufficient oxygen availability, a state known as hypoxia. Given the metabolic challenges of a low oxygen environment, hypoxia elicits a range of adaptive responses at the cellular, tissue, and systemic level to promote continued survival and function. Within this context, T lymphocytes are a highly migratory cell type of the adaptive immune system that frequently encounters a wide range of oxygen tensions in both health and disease. It is now clear that oxygen availability regulates T cell differentiation and function, a response orchestrated in large part by the hypoxia-inducible factor transcription factors. Here, we discuss the physiologic scope of hypoxia and hypoxic signaling, the contribution of these pathways in regulating T cell biology, and current gaps in our understanding. Finally, we discuss how emerging therapies that modulate the hypoxic response may offer new modalities to alter T cell function and the outcome of acute and chronic pathologies. PMID:22961658

  11. Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence.

    Science.gov (United States)

    Bassler, B L; Wright, M; Showalter, R E; Silverman, M R

    1993-08-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of an extracellular signal molecule (autoinducer) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode functions necessary for the synthesis of, and response to, a signal molecule. Sequence analysis of the region encoding these functions revealed three open reading frames, two (luxL and luxM) that are required for production of an autoinducer substance and a third (luxN) that is required for response to this signal substance. The LuxL and LuxM proteins are not similar in amino acid sequence to other proteins in the database, but the LuxN protein contains regions of sequence resembling both the histidine protein kinase and the response regulator domains of the family of two-component, signal transduction proteins. The phenotypes of mutants with luxL, luxM and luxN defects indicated that an additional signal-response system controlling density-dependent expression of luminescence remains to be identified.

  12. Podoplanin regulates mammary stem cell function and tumorigenesis by potentiating Wnt/β-catenin signaling.

    Science.gov (United States)

    Bresson, Laura; Faraldo, Marisa M; Di-Cicco, Amandine; Quintanilla, Miguel; Glukhova, Marina A; Deugnier, Marie-Ange

    2018-02-21

    Stem cells (SCs) drive mammary development, giving rise postnatally to an epithelial bilayer composed of luminal and basal myoepithelial cells. Dysregulation of SCs is thought to be at the origin of certain breast cancers; however, the molecular identity of SCs and the factors regulating their function remain poorly defined. We identified the transmembrane protein podoplanin (Pdpn) as a specific marker of the basal compartment, including multipotent SCs, and found Pdpn localized at the basal-luminal interface. Embryonic deletion of Pdpn targeted to basal cells diminished basal and luminal SC activity and affected the expression of several Wnt/β-catenin signaling components in basal cells. Moreover, Pdpn loss attenuated mammary tumor formation in a mouse model of β-catenin-induced breast cancer, limiting tumor-initiating cell expansion and promoting molecular features associated with mesenchymal-to-epithelial cell transition. In line with the loss-of-function data, we demonstrated that mechanistically Pdpn enhances Wnt/β-catenin signaling in mammary basal cells. Overall, this study uncovers a role for Pdpn in mammary SC function and, importantly, identifies Pdpn as a new regulator of Wnt/β-catenin signaling, a key pathway in mammary development and tumorigenesis. © 2018. Published by The Company of Biologists Ltd.

  13. X-linked inhibitor of apoptosis regulates T cell effector function

    DEFF Research Database (Denmark)

    Zehntner, Simone P; Bourbonnière, Lyne; Moore, Craig S

    2007-01-01

    To understand how the balance between pro- and anti-apoptotic signals influences effector function in the immune system, we studied the X-linked inhibitor of apoptosis (XIAP), an endogenous regulator of cellular apoptosis. Real-time PCR showed increased XIAP expression in blood of mice with exper......To understand how the balance between pro- and anti-apoptotic signals influences effector function in the immune system, we studied the X-linked inhibitor of apoptosis (XIAP), an endogenous regulator of cellular apoptosis. Real-time PCR showed increased XIAP expression in blood of mice...... dramatically reduced within the CNS. Flow cytometry showed an 88-93% reduction in T cells. The proportion of TUNEL(+) apoptotic CD4(+) T cells in the CNS was increased from Neurons...... and oligodendrocytes were not affected; neither did apoptosis increase in liver, where XIAP knockdown also occurred. ASO-XIAP increased susceptibility of T cells to activation-induced apoptosis in vitro. Our results identify XIAP as a critical controller of apoptotic susceptibility of effector T cell function...

  14. Genetic evidence suggests that GIS functions downstream of TCL1 to regulate trichome formation in Arabidopsis.

    Science.gov (United States)

    Zhang, Na; Yang, Li; Luo, Sha; Wang, Xutong; Wang, Wei; Cheng, Yuxin; Tian, Hainan; Zheng, Kaijie; Cai, Ling; Wang, Shucai

    2018-04-13

    Trichome formation in Arabidopsis is regulated by a MBW complex formed by MYB, bHLH and WD40 transcriptional factors, which can activate GLABRA2 (GL2) and the R3 MYB transcription factor genes. GL2 promotes trichome formation, whereas R3 MYBs are able to block the formation of the MBW complex. It has been reported that the C2H2 transcription factor GIS (GLABROUS INFLORESCENCE STEMS) functions upstream of the MBW activator complex to regulate trichome formation, and that the expression of TCL1 is not regulated by the MBW complex. However, gis and the R3 MYB gene mutant tcl1 (trichomeless 1) have opposite inflorescence trichome phenotypes, but their relationship in regulating trichome formation remained unknown. By generating and characterization of the gis tcl1 double mutant, we found that trichome formation in the gis tcl1double and the tcl1 single mutants were largely indistinguishable, but the trichome formation in the 35S:TCL1/gis transgenic plant was similar to that in the gis mutant. By using quantitative RT-PCR analysis, we showed that expression level of GIS was increased in the triple mutant tcl1 try cpc, but the expression level of TCL1 was not affected in the gis mutant. On the other hand, trichome morphology in both gis tcl1 and 35S:TCL1/gis plants was similar to that in the gis mutant. In summary, our results indicate that GIS may work downstream of TCL1 to regulate trichome formation, and GIS has a dominant role in controlling trichome morphology.

  15. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  16. Phosphorylation regulates human T-cell leukemia virus type 1 Rex function

    Directory of Open Access Journals (Sweden)

    Ward Michael

    2009-11-01

    Full Text Available Abstract Background Human T-cell leukemia virus type 1 (HTLV-1 is a pathogenic complex deltaretrovirus, which is the causative agent of adult T-cell leukemia/lymphoma (ATL and HTLV-1-associated myelopathy/tropical spastic paraparesis. In addition to the structural and enzymatic viral gene products, HTLV-1 encodes the positive regulatory proteins Tax and Rex along with viral accessory proteins. Tax and Rex proteins orchestrate the timely expression of viral genes important in viral replication and cellular transformation. Rex is a nucleolar-localizing shuttling protein that acts post-transcriptionally by binding and facilitating the export of the unspliced and incompletely spliced viral mRNAs from the nucleus to the cytoplasm. HTLV-1 Rex (Rex-1 is a phosphoprotein and general protein kinase inhibition correlates with reduced function. Therefore, it has been proposed that Rex-1 function may be regulated through site-specific phosphorylation. Results We conducted a phosphoryl mapping of Rex-1 over-expressed in transfected 293 T cells using a combination of affinity purification and liquid chromatography tandem mass spectrometry. We achieved 100% physical coverage of the Rex-1 polypeptide and identified five novel phosphorylation sites at Thr-22, Ser-36, Thr-37, Ser-97, and Ser-106. We also confirmed evidence of two previously identified residues, Ser-70 and Thr-174, but found no evidence of phosphorylation at Ser-177. The functional significance of these phosphorylation events was evaluated using a Rex reporter assay and site-directed mutational analysis. Our results indicate that phosphorylation at Ser-97 and Thr-174 is critical for Rex-1 function. Conclusion We have mapped completely the site-specific phosphorylation of Rex-1 identifying a total of seven residues; Thr-22, Ser-36, Thr-37, Ser-70, Ser-97, Ser-106, and Thr-174. Overall, this work is the first to completely map the phosphorylation sites in Rex-1 and provides important insight into

  17. High Endothelial Venules and Other Blood Vessels: Critical Regulators of Lymphoid Organ Development and Function

    Science.gov (United States)

    Ager, Ann

    2017-01-01

    The blood vasculature regulates both the development and function of secondary lymphoid organs by providing a portal for entry of hemopoietic cells. During the development of lymphoid organs in the embryo, blood vessels deliver lymphoid tissue inducer cells that initiate and sustain the development of lymphoid tissues. In adults, the blood vessels are structurally distinct from those in other organs due to the requirement for high levels of lymphocyte recruitment under non-inflammatory conditions. In lymph nodes (LNs) and Peyer’s patches, high endothelial venules (HEVs) especially adapted for lymphocyte trafficking form a spatially organized network of blood vessels, which controls both the type of lymphocyte and the site of entry into lymphoid tissues. Uniquely, HEVs express vascular addressins that regulate lymphocyte entry into lymphoid organs and are, therefore, critical to the function of lymphoid organs. Recent studies have demonstrated important roles for CD11c+ dendritic cells in the induction, as well as the maintenance, of vascular addressin expression and, therefore, the function of HEVs. Tertiary lymphoid organs (TLOs) are HEV containing LN-like structures that develop inside organized tissues undergoing chronic immune-mediated inflammation. In autoimmune lesions, the development of TLOs is thought to exacerbate disease. In cancerous tissues, the development of HEVs and TLOs is associated with improved patient outcomes in several cancers. Therefore, it is important to understand what drives the development of HEVs and TLOs and how these structures contribute to pathology. In several human diseases and experimental animal models of chronic inflammation, there are some similarities between the development and function of HEVs within LN and TLOs. This review will summarize current knowledge of how hemopoietic cells with lymphoid tissue-inducing, HEV-inducing, and HEV-maintaining properties are recruited from the bloodstream to induce the development and

  18. Function and expression of cystic fibrosis transmembrane conductance regulator after small intestinal transplantation in mice.

    Directory of Open Access Journals (Sweden)

    Penghong Song

    Full Text Available The secretion function of intestinal graft is one of the most important factors for successful intestinal transplantation. Cystic fibrosis transmembrane conductance regulator (CFTR mediates HCO3(- and Cl(- secretions in intestinal epithelial cells. In this study, we made investigation on the expression and function of CFTR in an experimental model of murine small intestinal transplantation. Heterotopic intestinal transplantations were performed in syngeneic mice. The mRNA and protein expressions of CFTR were analyzed by real time PCR and western blot. Murine intestinal mucosal HCO3(- and Cl(- secretions were examined in vitro in Ussing chambers by the pH stat and short circuit current (I(sc techniques. The results showed that forskolin, an activator of CFTR, stimulated jejunal mucosal epithelial HCO3(- and Cl(- secretions in mice, but forskolin-stimulated HCO3(- and Cl(- secretions in donor and recipient jejunal mucosae of mice after heterotopic jejunal transplantation were markedly decreased, compared with controls (P<0.001. The mRNA and protein expression levels of CFTR in donor and recipient jejunal mucosae of mice were also markedly lower than those in controls (P<0.001, and the mRNA and protein expression levels of tumor necrosis factor α (TNFα were markedly increased in donor jejunal mucosae of mice (P<0.001, compared with controls. Further experiments showed that TNFα down-regulated the expression of CFTR mRNA in murine jejunal mucosa. In conclusion, after intestinal transplantation, the function of CFTR was impaired, and its mRNA and protein expressions were down-regulated, which may be induced by TNFα.

  19. Grhl3 and Lmo4 play coordinate roles in epidermal migration.

    Science.gov (United States)

    Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

    2008-09-01

    In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

  20. Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)

    1997-01-01

    Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.

  1. Transcription factors involved in the regulation of natural killer cell development and function: an update

    Directory of Open Access Journals (Sweden)

    Martha Elia Luevano

    2012-10-01

    Full Text Available Natural Killer (NK cells belong to the innate immune system and are key effectors in the immune response against cancer and infection. Recent studies have contributed to the knowledge of events controlling NK cell fate. The use of knockout mice has enabled the discovery of key transcription factors (TFs essential for NK cell development and function. Yet, unwrapping the downstream targets of these TFs and their influence on NK cells remains a challenge. In this review we discuss the latest TFs described to be involved in the regulation of NK cell development and maturation.

  2. The Effects of Epidermal Neural Crest Stem Cells on Local Inflammation Microenvironment in the Defected Sciatic Nerve of Rats

    Directory of Open Access Journals (Sweden)

    Yue Li

    2017-05-01

    Full Text Available Cell-based therapy is a promising strategy for the repair of peripheral nerve injuries (PNIs. epidermal neural crest stems cells (EPI-NCSCs are thought to be important donor cells for repairing PNI in different animal models. Following PNI, inflammatory response is important to regulate the repair process. However, the effects of EPI-NCSCs on regulation of local inflammation microenviroment have not been investigated extensively. In the present study, these effects were studied by using 10 mm defected sciatic nerve, which was bridged with 15 mm artificial nerve composed of EPI-NCSCs, extracellular matrix (ECM and poly (lactide-co-glycolide (PLGA. Then the expression of pro- and anti-inflammatory cytokines, polarization of macrophages, regulation of fibroblasts and shwann cells (SCs were assessed by western blot, immunohistochemistry, immunofluorescence staining at 1, 3, 7 and 21 days after bridging. The structure and the function of the bridged nerve were determined by observation under light microscope and by examination of right lateral foot retraction time (LFRT, sciatic function index (SFI, gastrocnemius wet weight and electrophysiology at 9 weeks. After bridging with EPI-NCSCs, the expression of anti-inflammatory cytokines (IL-4 and IL-13 was increased, but decreased for pro-inflammatory cytokines (IL-6 and TNF-α compared to the control bridging, which was consistent with increase of M2 macrophages and decrease of M1 macrophages at 7 days after transplantation. Likewise, myelin-formed SCs were significantly increased, but decreased for the activated fibroblasts in their number at 21 days. The recovery of structure and function of nerve bridged with EPI-NCSCs was significantly superior to that of DMEM. These results indicated that EPI-NCSCs could be able to regulate and provide more suitable inflammation microenvironment for the repair of defected sciatic nerve.

  3. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  4. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  5. The role of the cerebellum in the regulation of language functions.

    Science.gov (United States)

    Starowicz-Filip, Anna; Chrobak, Adrian Andrzej; Moskała, Marek; Krzyżewski, Roger M; Kwinta, Borys; Kwiatkowski, Stanisław; Milczarek, Olga; Rajtar-Zembaty, Anna; Przewoźnik, Dorota

    2017-08-29

    The present paper is a review of studies on the role of the cerebellum in the regulation of language functions. This brain structure until recently associated chiefly with motor skills, visual-motor coordination and balance, proves to be significant also for cognitive functioning. With regard to language functions, studies show that the cerebellum determines verbal fluency (both semantic and formal) expressive and receptive grammar processing, the ability to identify and correct language mistakes, and writing skills. Cerebellar damage is a possible cause of aphasia or the cerebellar mutism syndrome (CMS). Decreased cerebellocortical connectivity as well as anomalies in the structure of the cerebellum are emphasized in numerous developmental dyslexia theories. The cerebellum is characterized by linguistic lateralization. From the neuroanatomical perspective, its right hemisphere and dentate nucleus, having multiple cerebellocortical connections with the cerebral cortical language areas, are particularly important for language functions. Usually, language deficits developed as a result of a cerebellar damage have subclinical intensity and require applying sensitive neuropsychological diagnostic tools designed to assess higher verbal functions.

  6. The Influence of Work-Related Chronic Stress on the Regulation of Emotion and on Functional Connectivity in the Brain

    Science.gov (United States)

    Golkar, Armita; Johansson, Emilia; Kasahara, Maki; Osika, Walter; Perski, Aleksander; Savic, Ivanka

    2014-01-01

    Despite mounting reports about the negative effects of chronic occupational stress on cognitive and emotional functions, the underlying mechanisms are unknown. Recent findings from structural MRI raise the question whether this condition could be associated with a functional uncoupling of the limbic networks and an impaired modulation of emotional stress. To address this, 40 subjects suffering from burnout symptoms attributed to chronic occupational stress and 70 controls were investigated using resting state functional MRI. The participants' ability to up- regulate, down-regulate, and maintain emotion was evaluated by recording their acoustic startle response while viewing neutral and negatively loaded images. Functional connectivity was calculated from amygdala seed regions, using explorative linear correlation analysis. Stressed subjects were less capable of down-regulating negative emotion, but had normal acoustic startle responses when asked to up-regulate or maintain emotion and when no regulation was required. The functional connectivity between the amygdala and the anterior cingulate cortex correlated with the ability to down-regulate negative emotion. This connectivity was significantly weaker in the burnout group, as was the amygdala connectivity with the dorsolateral prefrontal cortex and the motor cortex, whereas connectivity from the amygdala to the cerebellum and the insular cortex were stronger. In subjects suffering from chronic occupational stress, the functional couplings within the emotion- and stress-processing limbic networks seem to be altered, and associated with a reduced ability to down-regulate the response to emotional stress, providing a biological substrate for a further facilitation of the stress condition. PMID:25184294

  7. Etanercept therapy for toxic epidermal necrolysis.

    Science.gov (United States)

    Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio

    2014-08-01

    Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  8. Use of neurotransmitter regulators in functional gastrointestinal disorders based on symptom analysis.

    Science.gov (United States)

    Luo, Qing Qing; Chen, Sheng Liang

    2017-04-01

    It has been a great challenge for gastroenterologists to cope with functional gastrointestinal disorders (FGIDs) in clinical practice due to the contemporary increase in stressful events. A growing body of evidence has shown that neuroregulators such as anti-anxiety agents and antidepressants function well on FGIDs, particularly in cases that are refractory to classical gastrointestinal (GI) medications. Among these central-acting agents, small individualized doses of tricyclic antidepressants and selective serotonin reuptake inhibitors are usually recommended as a complement to routine GI management. When these drugs are chosen to treat FGIDs, both their central effects and the modulation of peripheral neurotransmitters should be taken into consideration. In this article we recommend strategies for choosing drugs based on an analysis of psychosomatic GI symptoms. The variety and dosage of the neurotransmitter regulators are also discussed. © 2017 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

  9. Regulation of myelin genes implicated in psychiatric disorders by functional activity in axons

    Directory of Open Access Journals (Sweden)

    Philip R Lee

    2009-06-01

    Full Text Available Myelination is a highly dynamic process that continues well into adulthood in humans. Several recent gene expression studies have found abnormal expression of genes involved in myelination in the prefrontal cortex of brains from patients with schizophrenia and other psychiatric illnesses. Defects in myelination could contribute to the pathophysiology of psychiatric illness by impairing information processing as a consequence of altered impulse conduction velocity and synchrony between cortical regions carrying out higher level cognitive functions. Myelination can be altered by impulse activity in axons and by environmental experience. Psychiatric illness is treated by psychotherapy, behavioral modification, and drugs affecting neurotransmission, raising the possibility that myelinating glia may not only contribute to such disorders, but that activity-dependent effects on myelinating glia could provide one of the cellular mechanisms contributing to the therapeutic effects of these treatments. This review examines evidence showing that genes and gene networks important for myelination can be regulated by functional activity in axons.

  10. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

    Directory of Open Access Journals (Sweden)

    Kathryn M. Lenz

    2018-04-01

    Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  11. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

    Science.gov (United States)

    Lenz, Kathryn M; Nelson, Lars H

    2018-01-01

    Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  12. Engineered hybrid cardiac patches with multifunctional electronics for online monitoring and regulation of tissue function

    Science.gov (United States)

    Feiner, Ron; Engel, Leeya; Fleischer, Sharon; Malki, Maayan; Gal, Idan; Shapira, Assaf; Shacham-Diamand, Yosi; Dvir, Tal

    2016-06-01

    In cardiac tissue engineering approaches to treat myocardial infarction, cardiac cells are seeded within three-dimensional porous scaffolds to create functional cardiac patches. However, current cardiac patches do not allow for online monitoring and reporting of engineered-tissue performance, and do not interfere to deliver signals for patch activation or to enable its integration with the host. Here, we report an engineered cardiac patch that integrates cardiac cells with flexible, freestanding electronics and a 3D nanocomposite scaffold. The patch exhibited robust electronic properties, enabling the recording of cellular electrical activities and the on-demand provision of electrical stimulation for synchronizing cell contraction. We also show that electroactive polymers containing biological factors can be deposited on designated electrodes to release drugs in the patch microenvironment on demand. We expect that the integration of complex electronics within cardiac patches will eventually provide therapeutic control and regulation of cardiac function.

  13. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  14. Eosinophils are key regulators of perivascular adipose tissue and vascular functionality

    DEFF Research Database (Denmark)

    Withers, Sarah B.; Forman, Ruth; Meza-Perez, Selene

    2017-01-01

    Obesity impairs the relaxant capacity of adipose tissue surrounding the vasculature (PVAT) and has been implicated in resultant obesity-related hypertension and impaired glucose intolerance. Resident immune cells are thought to regulate adipocyte activity. We investigated the role of eosinophils...... in mediating normal PVAT function. Healthy PVAT elicits an anti-contractile effect, which was lost in mice deficient in eosinophils, mimicking the obese phenotype, and was restored upon eosinophil reconstitution. Ex vivo studies demonstrated that the loss of PVAT function was due to reduced bioavailability...... of adiponectin and adipocyte-derived nitric oxide, which was restored after eosinophil reconstitution. Mechanistic studies demonstrated that adiponectin and nitric oxide are released after activation of adipocyte-expressed β3 adrenoceptors by catecholamines, and identified eosinophils as a novel source...

  15. Engineered hybrid cardiac patches with multifunctional electronics for online monitoring and regulation of tissue function

    Science.gov (United States)

    Feiner, Ron; Engel, Leeya; Fleischer, Sharon; Malki, Maayan; Gal, Idan; Shapira, Assaf; Shacham-Diamand, Yosi; Dvir, Tal

    2016-01-01

    In cardiac tissue engineering approaches to treat myocardial infarction, cardiac cells are seeded within three-dimensional porous scaffolds to create functional cardiac patches. However, current cardiac patches do not allow for online monitoring and reporting of engineered-tissue performance, and do not interfere to deliver signals for patch activation or to enable its integration with the host. Here, we report an engineered cardiac patch that integrates cardiac cells with flexible, free-standing electronics and a 3D nanocomposite scaffold. The patch exhibited robust electronic properties, enabling the recording of cellular electrical activities and the on-demand provision of electrical stimulation for synchronizing cell contraction. We also show that electroactive polymers containing biological factors can be deposited on designated electrodes to release drugs in the patch microenvironment on-demand. We expect that the integration of complex electronics within cardiac patches will eventually provide therapeutic control and regulation of cardiac function. PMID:26974408

  16. Chloroplast Translation: Structural and Functional Organization, Operational Control, and Regulation[OPEN

    Science.gov (United States)

    2018-01-01

    Chloroplast translation is essential for cellular viability and plant development. Its positioning at the intersection of organellar RNA and protein metabolism makes it a unique point for the regulation of gene expression in response to internal and external cues. Recently obtained high-resolution structures of plastid ribosomes, the development of approaches allowing genome-wide analyses of chloroplast translation (i.e., ribosome profiling), and the discovery of RNA binding proteins involved in the control of translational activity have greatly increased our understanding of the chloroplast translation process and its regulation. In this review, we provide an overview of the current knowledge of the chloroplast translation machinery, its structure, organization, and function. In addition, we summarize the techniques that are currently available to study chloroplast translation and describe how translational activity is controlled and which cis-elements and trans-factors are involved. Finally, we discuss how translational control contributes to the regulation of chloroplast gene expression in response to developmental, environmental, and physiological cues. We also illustrate the commonalities and the differences between the chloroplast and bacterial translation machineries and the mechanisms of protein biosynthesis in these two prokaryotic systems. PMID:29610211

  17. Codon usage regulates protein structure and function by affecting translation elongation speed in Drosophila cells.

    Science.gov (United States)

    Zhao, Fangzhou; Yu, Chien-Hung; Liu, Yi

    2017-08-21

    Codon usage biases are found in all eukaryotic and prokaryotic genomes and have been proposed to regulate different aspects of translation process. Codon optimality has been shown to regulate translation elongation speed in fungal systems, but its effect on translation elongation speed in animal systems is not clear. In this study, we used a Drosophila cell-free translation system to directly compare the velocity of mRNA translation elongation. Our results demonstrate that optimal synonymous codons speed up translation elongation while non-optimal codons slow down translation. In addition, codon usage regulates ribosome movement and stalling on mRNA during translation. Finally, we show that codon usage affects protein structure and function in vitro and in Drosophila cells. Together, these results suggest that the effect of codon usage on translation elongation speed is a conserved mechanism from fungi to animals that can affect protein folding in eukaryotic organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Plant phospholipase C family: Regulation and functional role in lipid signaling.

    Science.gov (United States)

    Singh, Amarjeet; Bhatnagar, Nikita; Pandey, Amita; Pandey, Girdhar K

    2015-08-01

    Phospholipase C (PLC), a major membrane phospholipid hydrolyzing enzyme generates signaling messengers such as diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) in animals, and their phosphorylated forms such as phosphatidic acid (PA) and inositol hexakisphosphate (IP6) are thought to regulate various cellular processes in plants. Based on substrate specificity, plant PLC family is sub-divided into phosphatidylinositol-PLC (PI-PLC) and phosphatidylcholine-PLC (PC-PLC) groups. The activity of plant PLCs is regulated by various factors and the major ones include, Ca(2+) concentration, phospholipid substrate, post-translational modifications and interacting proteins. Most of the PLC members have been localized at the plasma membrane, suited for their function of membrane lipid hydrolysis. Several PLC members have been implicated in various cellular processes and signaling networks, triggered in response to a number of environmental cues and developmental events in different plant species, which makes them potential candidates for genetically engineering the crop plants for stress tolerance and enhancing the crop productivity. In this review article, we are focusing mainly on the plant PLC signaling and regulation, potential cellular and physiological role in different abiotic and biotic stresses, nutrient deficiency, growth and development. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. OCA-B regulation of B-cell development and function.

    Science.gov (United States)

    Teitell, Michael A

    2003-10-01

    The transcriptional co-activator OCA-B [for Oct co-activator from B cells, also known as OBF-1 (OCT-binding factor-1) and Bob1] is not required for B-cell genesis but does regulate subsequent B-cell development and function. OCA-B deficient mice show strain-specific, partial blocks at multiple stages of B-cell maturation and a complete disruption of germinal center formation in all strains, causing humoral immune deficiency and susceptibility to infection. OCA-B probably exerts its effects through the regulation of octamer-motif controlled gene expression. The OCA-B gene encodes two proteins of distinct molecular weight, designated p34 and p35. The p34 isoform localizes in the nucleus, whereas the p35 isoform is myristoylated and is bound to the cytoplasmic membrane. p35 can traffic to the nucleus and probably activates octamer-dependent transcription, although this OCA-B isoform might regulate B cells through membrane-related signal transduction.

  20. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  1. The role of COBRA-LIKE 2 function, as part of the complex network of interacting pathways regulating Arabidopsis seed mucilage polysaccharide matrix organization.

    Science.gov (United States)

    Ben-Tov, Daniela; Idan-Molakandov, Anat; Hugger, Anat; Ben-Shlush, Ilan; Günl, Markus; Yang, Bo; Usadel, Björn; Harpaz-Saad, Smadar

    2018-05-01

    The production of hydrophilic mucilage along the course of seed coat epidermal cell differentiation is a common adaptation in angiosperms. Previous studies have identified COBRA-LIKE 2 (COBL2), a member of the COBRA-LIKE gene family, as a novel component required for crystalline cellulose deposition in seed coat epidermal cells. In recent years, Arabidopsis seed coat epidermal cells (SCEs), also called mucilage secretory cells, have emerged as a powerful model system for the study of plant cell wall components biosynthesis, secretion, assembly and de muro modification. Despite accumulating data, the molecular mechanism of COBL function remains largely unknown. In the current research, we utilized genetic interactions to study the role of COBL2 as part of the protein network required for seed mucilage production. Using correlative phenotyping of structural and biochemical characteristics, unique features of the cobl2 extruded mucilage are revealed, including: 'unraveled' ray morphology, loss of primary cell wall 'pyramidal' organization, reduced Ruthenium red staining intensity of the adherent mucilage layer, and increased levels of the monosaccharides arabinose and galactose. Examination of the cobl2cesa5 double mutant provides insight into the interface between COBL function and cellulose deposition. Additionally, genetic interactions between cobl2 and fei1fei2 as well as between each of these mutants to mucilage-modified 2 (mum2) suggest that COBL2 functions independently of the FEI-SOS pathway. Altogether, the presented data place COBL2 within the complex protein network required for cell wall deposition in the context of seed mucilage and introduce new methodology expending the seed mucilage phenotyping toolbox. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

  2. Regulation of antiapoptotic MCL-1 function by gossypol: mechanistic insights from in vitro reconstituted systems.

    Science.gov (United States)

    Etxebarria, Aitor; Landeta, Olatz; Antonsson, Bruno; Basañez, Gorka

    2008-12-01

    Small-molecule drugs that induce apoptosis in tumor cells by activation of the BCL-2-regulated mitochondrial outer membrane permeabilization (MOMP) pathway hold promise for rational anticancer therapies. Accumulating evidence indicates that the natural product gossypol and its derivatives can kill tumor cells by targeting antiapoptotic BCL-2 family members in such a manner as to trigger MOMP. However, due to the inherent complexity of the cellular apoptotic network, the precise mechanisms by which interactions between gossypol and individual BCL-2 family members lead to MOMP remain poorly understood. Here, we used simplified systems bearing physiological relevance to examine the impact of gossypol on the function of MCL-1, a key determinant for survival of various human malignancies that has become a highly attractive target for anticancer drug design. First, using a reconstituted liposomal system that recapitulates basic aspects of the BCL-2-regulated MOMP pathway, we demonstrate that MCL-1 inhibits BAX permeabilizing function via a "dual-interaction" mechanism, while submicromolar concentrations of gossypol reverse MCL-1-mediated inhibition of functional BAX activation. Solution-based studies showed that gossypol competes with BAX/BID BH3 ligands for binding to MCL-1 hydrophobic groove, thereby providing with a mechanistic explanation for how gossypol restores BAX permeabilizing function in the presence of MCL-1. By contrast, no evidence was found indicating that gossypol transforms MCL-1 into a BAX-like pore-forming molecule. Altogether, our findings validate MCL-1 as a direct target of gossypol, and highlight that making this antiapoptotic protein unable to inhibit BAX-driven MOMP may represent one important mechanism by which gossypol exerts its cytotoxic effect in selected cancer cells.

  3. Function and regulation of Vibrio campbellii proteorhodopsin: acquired phototrophy in a classical organoheterotroph.

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    Full Text Available Proteorhodopsins (PRs are retinal-binding photoproteins that mediate light-driven proton translocation across prokaryotic cell membranes. Despite their abundance, wide distribution and contribution to the bioenergy budget of the marine photic zone, an understanding of PR function and physiological significance in situ has been hampered as the vast majority of PRs studied to date are from unculturable bacteria or culturable species that lack the tools for genetic manipulation. In this study, we describe the presence and function of a horizontally acquired PR and retinal biosynthesis gene cluster in the culturable and genetically tractable bioluminescent marine bacterium Vibrio campbellii. Pigmentation analysis, absorption spectroscopy and photoinduction assays using a heterologous over-expression system established the V. campbellii PR as a functional green light absorbing proton pump. In situ analyses comparing PR expression and function in wild type (WT V. campbellii with an isogenic ΔpR deletion mutant revealed a marked absence of PR membrane localization, pigmentation and light-induced proton pumping in the ΔpR mutant. Comparative photoinduction assays demonstrated the distinct upregulation of pR expression in the presence of light and PR-mediated photophosphorylation in WT cells that resulted in the enhancement of cellular survival during respiratory stress. In addition, we demonstrate that the master regulator of adaptive stress response and stationary phase, RpoS1, positively regulates pR expression and PR holoprotein pigmentation. Taken together, the results demonstrate facultative phototrophy in a classical marine organoheterotrophic Vibrio species and provide a salient example of how this organism has exploited lateral gene transfer to further its adaptation to the photic zone.

  4. The epigenetic regulator Smchd1 contains a functional GHKL-type ATPase domain.

    Science.gov (United States)

    Chen, Kelan; Dobson, Renwick C J; Lucet, Isabelle S; Young, Samuel N; Pearce, F Grant; Blewitt, Marnie E; Murphy, James M

    2016-06-15

    Structural maintenance of chromosomes flexible hinge domain containing 1 (Smchd1) is an epigenetic regulator that plays critical roles in gene regulation during development. Mutations in SMCHD1 were recently implicated in the pathogenesis of facioscapulohumeral muscular dystrophy (FSHD), although the mechanistic basis remains of outstanding interest. We have previously shown that Smchd1 associates with chromatin via its homodimeric C-terminal hinge domain, yet little is known about the function of the putative GHKL (gyrase, Hsp90, histidine kinase, MutL)-type ATPase domain at its N-terminus. To formally assess the structure and function of Smchd1's ATPase domain, we have generated recombinant proteins encompassing the predicted ATPase domain and the adjacent region. Here, we show that the Smchd1 N-terminal region exists as a monomer and adopts a conformation resembling that of monomeric full-length heat shock protein 90 (Hsp90) protein in solution, even though the two proteins share only ∼8% overall sequence identity. Despite being monomeric, the N-terminal region of Smchd1 exhibits ATPase activity, which can be antagonized by the reaction product, ADP, or the Hsp90 inhibitor, radicicol, at a nanomolar concentration. Interestingly, introduction of an analogous mutation to that identified in SMCHD1 of an FSHD patient compromised protein stability, suggesting a possible molecular basis for loss of protein function and pathogenesis. Together, these results reveal important structure-function characteristics of Smchd1 that may underpin its mechanistic action at the chromatin level. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  5. Shavenbaby couples patterning to epidermal cell shape control.

    Directory of Open Access Journals (Sweden)

    Hélène Chanut-Delalande

    2006-09-01

    Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.

  6. Regulation of Reentrainment Function Is Dependent on a Certain Minimal Number of Intact Functional ipRGCs in rd Mice

    Directory of Open Access Journals (Sweden)

    Jingxue Zhang

    2017-01-01

    Full Text Available Purpose. To investigate the effect of partial ablation of melanopsin-containing retinal ganglion cells (mcRGCs on nonimage-forming (NIF visual functions in rd mice lacking rods. Methods. The rd mice were intravitreally injected with different doses (100 ng/μl, 200 ng/μl, and 400 ng/μl of immunotoxin melanopsin-SAP. And then, the density of ipRGCs was examined. After establishing the animal models with different degrees of ipRGC damage, a wheel-running system was used to evaluate their reentrainment response. Results. Intravitreal injection of melanopsin-SAP led to partial ablation of ipRGCs in a dose-dependent manner. The survival rates of ipRGCs in the 100 ng/μl, 200 ng/μl, and 400 ng/μl groups were 74.14% ± 4.15%, 39.25% ± 2.29%, and 38.38% ± 3.74%, respectively. The wheel-running experiments showed that more severe ipRGC loss was associated with a longer time needed for reentrainment. When the light/dark cycle was delayed by 8 h, the rd mice in the PBS control group took 4.67 ± 0.79 days to complete the synchronization with the shifted cycle, while those in the 100 ng/μl and 200 ng/μl groups required 7.90 ± 0.55 days and 11.00 ± 0.79 days to complete the synchronization with the new light/dark cycle, respectively. Conclusion. Our study indicates that the regulation of some NIF visual functions is dependent on a certain minimal number of intact functional ipRGCs.

  7. The systematic functional analysis of plasmodium protein kinases identifies essential regulators of mosquito transmission

    KAUST Repository

    Tewari, Rita; Straschil, Ursula; Bateman, Alex; Bö hme, Ulrike; Cherevach, Inna; Gong, Peng; Pain, Arnab; Billker, Oliver

    2010-01-01

    Although eukaryotic protein kinases (ePKs) contribute to many cellular processes, only three Plasmodium falciparum ePKs have thus far been identified as essential for parasite asexual blood stage development. To identify pathways essential for parasite transmission between their mammalian host and mosquito vector, we undertook a systematic functional analysis of ePKs in the genetically tractable rodent parasite Plasmodium berghei. Modeling domain signatures of conventional ePKs identified 66 putative Plasmodium ePKs. Kinomes are highly conserved between Plasmodium species. Using reverse genetics, we show that 23 ePKs are redundant for asexual erythrocytic parasite development in mice. Phenotyping mutants at four life cycle stages in Anopheles stephensi mosquitoes revealed functional clusters of kinases required for sexual development and sporogony. Roles for a putative SR protein kinase (SRPK) in microgamete formation, a conserved regulator of clathrin uncoating (GAK) in ookinete formation, and a likely regulator of energy metabolism (SNF1/KIN) in sporozoite development were identified. 2010 Elsevier Inc.

  8. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Joanna Bandoła

    2017-08-01

    Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  9. The systematic functional analysis of plasmodium protein kinases identifies essential regulators of mosquito transmission

    KAUST Repository

    Tewari, Rita

    2010-10-21

    Although eukaryotic protein kinases (ePKs) contribute to many cellular processes, only three Plasmodium falciparum ePKs have thus far been identified as essential for parasite asexual blood stage development. To identify pathways essential for parasite transmission between their mammalian host and mosquito vector, we undertook a systematic functional analysis of ePKs in the genetically tractable rodent parasite Plasmodium berghei. Modeling domain signatures of conventional ePKs identified 66 putative Plasmodium ePKs. Kinomes are highly conserved between Plasmodium species. Using reverse genetics, we show that 23 ePKs are redundant for asexual erythrocytic parasite development in mice. Phenotyping mutants at four life cycle stages in Anopheles stephensi mosquitoes revealed functional clusters of kinases required for sexual development and sporogony. Roles for a putative SR protein kinase (SRPK) in microgamete formation, a conserved regulator of clathrin uncoating (GAK) in ookinete formation, and a likely regulator of energy metabolism (SNF1/KIN) in sporozoite development were identified. 2010 Elsevier Inc.

  10. Possible Roles of CC- and CXC-Chemokines in Regulating Bovine Endometrial Function during Early Pregnancy

    Directory of Open Access Journals (Sweden)

    Ryosuke Sakumoto

    2017-03-01

    Full Text Available The aim of the present study was to determine the possible roles of chemokines in regulating bovine endometrial function during early pregnancy. The expression of six chemokines, including CCL2, CCL8, CCL11, CCL14, CCL16, and CXCL10, was higher in the endometrium at 15 and 18 days of pregnancy than at the same days in non-pregnant animals. Immunohistochemical staining showed that chemokine receptors (CCR1, CCR2, CCR3, and CXCR3 were expressed in the epithelial cells and glandular epithelial cells of the bovine endometrium as well as in the fetal trophoblast obtained from a cow on day 18 of pregnancy. The addition of interferon-τ (IFNT to an endometrial tissue culture system increased CCL8 and CXCL10 expression in the tissues, but did not affect CCL2, CCL11, and CCL16 expression. CCL14 expression by these tissues was inhibited by IFNT. CCL16, but not other chemokines, clearly stimulated interferon-stimulated gene 15 (ISG15 and myxovirus-resistance gene 1 (MX1 expression in these tissues. Cyclooxygenase 2 (COX2 expression decreased after stimulation with CCL8 and CCL14, and oxytocin receptor (OTR expression was decreased by CCL2, CCL8, CCL14, and CXCL10. Collectively, the expression of chemokine genes is increased in the endometrium during early pregnancy. These genes may contribute to the regulation of endometrial function by inhibiting COX2 and OTR expression, subsequently decreasing prostaglandin production and preventing luteolysis in cows.

  11. Functional Analysis of the Nitrogen Metabolite Repression Regulator Gene nmrA in Aspergillus flavus

    Directory of Open Access Journals (Sweden)

    Xiaoyun Han

    2016-11-01

    Full Text Available In Aspergillus nidulans, the nitrogen metabolite repression regulator NmrA plays a major role in regulating the activity of the GATA transcription factor AreA during nitrogen metabolism. However, the function of nmrA in Aspergillus flavus has notbeen previously studied. Here, we report the identification and functional analysis of nmrA in A. flavus. Our work showed that the amino acid sequences of NmrA are highly conserved among Aspergillus species and that A. flavus NmrA protein contains a canonical Rossmann fold motif. Deletion of nmrA slowed the growth of A. flavus but significantly increased conidiation and sclerotia production. Moreover, seed infection experiments indicated that nmrA is required for the invasive virulence of A. flavus. In addition, the ΔnmrA mutant showed increased sensitivity to rapamycin and methyl methanesulfonate, suggesting that nmrA could be responsive to target of rapamycin signaling and DNA damage. Furthermore, quantitative real-time reverse transcription polymerase chain reaction analysis suggested that nmrA might interact with other nitrogen regulatory and catabolic genes. Our study provides a better understanding of nitrogen metabolite repression and the nitrogen metabolism network in fungi.

  12. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  13. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

    Science.gov (United States)

    Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

    2017-01-01

    Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  14. A p300 and SIRT1 Regulated Acetylation Switch of C/EBPα Controls Mitochondrial Function

    Directory of Open Access Journals (Sweden)

    Mohamad A. Zaini

    2018-01-01

    Full Text Available Summary: Cellular metabolism is a tightly controlled process in which the cell adapts fluxes through metabolic pathways in response to changes in nutrient supply. Among the transcription factors that regulate gene expression and thereby cause changes in cellular metabolism is the basic leucine-zipper (bZIP transcription factor CCAAT/enhancer-binding protein alpha (C/EBPα. Protein lysine acetylation is a key post-translational modification (PTM that integrates cellular metabolic cues with other physiological processes. Here, we show that C/EBPα is acetylated by the lysine acetyl transferase (KAT p300 and deacetylated by the lysine deacetylase (KDAC sirtuin1 (SIRT1. SIRT1 is activated in times of energy demand by high levels of nicotinamide adenine dinucleotide (NAD+ and controls mitochondrial biogenesis and function. A hypoacetylated mutant of C/EBPα induces the transcription of mitochondrial genes and results in increased mitochondrial respiration. Our study identifies C/EBPα as a key mediator of SIRT1-controlled adaption of energy homeostasis to changes in nutrient supply. : Zaini et al. show that the transcription factor C/EBPα is acetylated by p300 and deacetylated by the lysine deacetylase SIRT1. Hypoacetylated C/EBPα induces the transcription of mitochondrial genes and results in increased mitochondrial respiration. C/EBPα is a key mediator of SIRT1-controlled adaption of energy homeostasis to changes in nutrient supply. Keywords: C/EBPα, SIRT1, p300, lysine acetylation, mitochondrial function, cellular metabolism, NAD+, gene regulation

  15. Epigenetic regulation of transcription and possible functions of mammalian short interspersed elements, SINEs.

    Science.gov (United States)

    Ichiyanagi, Kenji

    2013-01-01

    Short interspersed elements (SINEs) are a class of retrotransposons, which amplify their copy numbers in their host genomes by retrotransposition. More than a million copies of SINEs are present in a mammalian genome, constituting over 10% of the total genomic sequence. In contrast to the other two classes of retrotransposons, long interspersed elements (LINEs) and long terminal repeat (LTR) elements, SINEs are transcribed by RNA polymerase III. However, like LINEs and LTR elements, the SINE transcription is likely regulated by epigenetic mechanisms such as DNA methylation, at least for human Alu and mouse B1. Whereas SINEs and other transposable elements have long been thought as selfish or junk DNA, recent studies have revealed that they play functional roles at their genomic locations, for example, as distal enhancers, chromatin boundaries and binding sites of many transcription factors. These activities imply that SINE retrotransposition has shaped the regulatory network and chromatin landscape of their hosts. Whereas it is thought that the epigenetic mechanisms were originated as a host defense system against proliferation of parasitic elements, this review discusses a possibility that the same mechanisms are also used to regulate the SINE-derived functions.

  16. Sequence and function of LuxO, a negative regulator of luminescence in Vibrio harveyi.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-05-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode a function required for the density-dependent response. Transposon Tn5 insertions in the recombinant clone were isolated, and the mutations were transferred to the genome of V. harveyi for examination of mutant phenotypes. Expression of luminescence in V. harveyi strains with transposon insertions in one locus, luxO, was independent of the density of the culture and was similar in intensity to the maximal level observed in wild-type bacteria. Sequence analysis of luxO revealed one open reading frame that encoded a protein, LuxO, similar in amino acid sequence to the response regulator domain of the family of two-component, signal transduction proteins. The constitutive phenotype of LuxO- mutants indicates that LuxO acts negatively to control expression of luminescence, and relief of repression by LuxO in the wild type could result from interactions with other components in the Lux signalling system.

  17. Regulation of defensive function on gingival epithelial cells can prevent periodontal disease.

    Science.gov (United States)

    Fujita, Tsuyoshi; Yoshimoto, Tetsuya; Kajiya, Mikihito; Ouhara, Kazuhisa; Matsuda, Shinji; Takemura, Tasuku; Akutagawa, Keiichi; Takeda, Katsuhiro; Mizuno, Noriyoshi; Kurihara, Hidemi

    2018-05-01

    Periodontal disease is a bacterial biofilm-associated inflammatory disease that has been implicated in many systemic diseases. A new preventive method for periodontal disease needs to be developed in order to promote the health of the elderly in a super-aged society. The gingival epithelium plays an important role as a mechanical barrier against bacterial invasion and a part of the innate immune response to infectious inflammation in periodontal tissue. The disorganization of cell-cell interactions and subsequent inflammation contribute to the initiation of periodontal disease. These make us consider that regulation of host defensive functions, epithelial barrier and neutrophil activity, may become novel preventive methods for periodontal inflammation. Based on this concept, we have found that several agents regulate the barrier function of gingival epithelial cells and suppress the accumulation of neutrophils in the gingival epithelium. We herein introduce the actions of irsogladine maleate, azithromycin, amphotericin B, and Houttuynia cordata (dokudami in Japanese), which is commonly used in traditional medicine, on the epithelial barrier and neutrophil migration in gingival epithelial cells in vivo and in vitro , in order to provide support for the clinical application of these agents to the prevention of periodontal inflammation.

  18. PPARγ Ligands Regulate Noncontractile and Contractile Functions of Airway Smooth Muscle: Implications for Asthma Therapy

    Directory of Open Access Journals (Sweden)

    Chantal Donovan

    2012-01-01

    Full Text Available In asthma, the increase in airway smooth muscle (ASM can contribute to inflammation, airway wall remodeling and airway hyperresponsiveness (AHR. Targetting peroxisome proliferator-activated receptor γ (PPARγ, a receptor upregulated in ASM in asthmatic airways, may provide a novel approach to regulate these contributions. This review summarises experimental evidence that PPARγ ligands, such as rosiglitazone (RGZ and pioglitazone (PGZ, inhibit proliferation and inflammatory cytokine production from ASM in vitro. In addition, inhaled administration of these ligands reduces inflammatory cell infiltration and airway remodelling in mouse models of allergen-induced airways disease. PPARγ ligands can also regulate ASM contractility, with acute treatment eliciting relaxation of mouse trachea in vitro through a PPARγ-independent mechanism. Chronic treatment can protect against the loss of bronchodilator sensitivity to β2-adrenoceptor agonists and inhibit the development of AHR associated with exposure to nicotine in utero or following allergen challenge. Of particular interest, a small clinical trial has shown that oral RGZ treatment improves lung function in smokers with asthma, a group that is generally unresponsive to conventional steroid treatment. These combined findings support further investigation of the potential for PPARγ agonists to target the noncontractile and contractile functions of ASM to improve outcomes for patients with poorly controlled asthma.

  19. STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT

    Directory of Open Access Journals (Sweden)

    V.F. Zhernosek

    2011-01-01

    Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.

  20. Tsc1 is a Critical Regulator of Macrophage Survival and Function

    Directory of Open Access Journals (Sweden)

    Chunmin Fang

    2015-07-01

    Full Text Available Background/Aims: Tuberous sclerosis complex 1 (Tsc1 has been shown to regulate M1/M2 polarization of macrophages, but the precise roles of Tsc1 in the function and stability of macrophages are not fully understood. Here we show that Tsc1 is required for regulating the survival, migration and phagocytosis of macrophages. Methods: Mice with Tsc1 homozygous deletion in myeloid cells (LysMCreTsc1flox/flox; Tsc1 KO were obtained by crossing Tsc1flox/flox mice with mice expressing Cre recombinase under the control of Lysozyme promoter (LysMCre. The apoptosis and growth of macrophages were determined by flow cytometry and Real-time PCR (RT-PCR. The phagocytosis was determined using a Vybrant™ phagocytosis assay kit. The migration of macrophages was determined using transwell migration assay. Results: Peritoneal macrophages of Tsc1 KO mice exhibited increased apoptosis and enlarged cell size. Both M1 and M2 phenotypes in Tsc1-deficient macrophages were elevated in steady-state as well as in inflammatory conditions. Tsc1-deficient macrophages demonstrated impaired migration and reduced expression of chemokine receptors including CCR2 and CCR5. Phagocytosis activity and ROS production were enhanced in Tsc1-deficient macrophages. Furthermore, pharmacological inhibition of the mammalian target of rapamycin complex 1 (mTORC1 partially reversed the aberrance of Tsc1-deficient macrophages. Conclusion: Tsc1 plays a critical role in regulating macrophage survival, function and polarization via inhibition of mTORC1 activity.

  1. Versatile function of the circadian protein CIPC as a regulator of Erk activation

    International Nuclear Information System (INIS)

    Matsunaga, Ryota; Nishino, Tasuku; Yokoyama, Atsushi; Nakashima, Akio; Kikkawa, Ushio; Konishi, Hiroaki

    2016-01-01

    The CLOCK-interacting protein, Circadian (CIPC), has been identified as an additional negative-feedback regulator of the circadian clock. However, recent study on CIPC knockout mice has shown that CIPC is not critically required for basic circadian clock function, suggesting other unknown biological roles for CIPC. In this study, we focused on the cell cycle dependent nuclear-cytoplasmic shuttling function of CIPC and on identifying its binding proteins. Lys186 and 187 were identified as the essential amino acid residues within the nuclear localization signal (NLS) of CIPC. We identified CIPC-binding proteins such as the multifunctional enzyme CAD protein (carbamoyl-phosphate synthetase 2, aspartate transcarbamoylase, and dihydroorotase), which is a key enzyme for de novo pyrimidine synthesis. Compared to control cells, HEK293 cells overexpressing wild-type CIPC showed suppressed cell proliferation and retardation of cell cycle. We also found that PMA-induced Erk activation was inhibited with expression of wild-type CIPC. In contrast, the NLS mutant of CIPC, which reduced the ability of CIPC to translocate into the nucleus, did not exhibit these biological effects. Since CAD and Erk have significant roles in cell proliferation and cell cycle, CIPC may work as a cell cycle regulator by interacting with these binding proteins. - Highlights: • CIPC is a cell cycle dependent nuclear-cytoplasmic shuttling protein. • K186 and 187are the essential amino acid residues within the NLS of CIPC. • CAD was identified as a novel CIPC-binding protein. • CIPC might regulate the activity and translocation of CAD in the cells.

  2. Peroxiredoxin II is an antioxidant enzyme that negatively regulates collagen-stimulated platelet function.

    Science.gov (United States)

    Jang, Ji Yong; Wang, Su Bin; Min, Ji Hyun; Chae, Yun Hee; Baek, Jin Young; Yu, Dae-Yeul; Chang, Tong-Shin

    2015-05-01

    Collagen-induced platelet signaling is mediated by binding to the primary receptor glycoprotein VI (GPVI). Reactive oxygen species produced in response to collagen have been found to be responsible for the propagation of GPVI signaling pathways in platelets. Therefore, it has been suggested that antioxidant enzymes could down-regulate GPVI-stimulated platelet activation. Although the antioxidant enzyme peroxiredoxin II (PrxII) has emerged as having a role in negatively regulating signaling through various receptors by eliminating H2O2 generated upon receptor stimulation, the function of PrxII in collagen-stimulated platelets is not known. We tested the hypothesis that PrxII negatively regulates collagen-stimulated platelet activation. We analyzed PrxII-deficient murine platelets. PrxII deficiency enhanced GPVI-mediated platelet activation through the defective elimination of H2O2 and the impaired protection of SH2 domain-containing tyrosine phosphatase 2 (SHP-2) against oxidative inactivation, which resulted in increased tyrosine phosphorylation of key components for the GPVI signaling cascade, including Syk, Btk, and phospholipase Cγ2. Interestingly, PrxII-mediated antioxidative protection of SHP-2 appeared to occur in the lipid rafts. PrxII-deficient platelets exhibited increased adhesion and aggregation upon collagen stimulation. Furthermore, in vivo experiments demonstrated that PrxII deficiency facilitated platelet-dependent thrombus formation in injured carotid arteries. This study reveals that PrxII functions as a protective antioxidant enzyme against collagen-stimulated platelet activation and platelet-dependent thrombosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  4. Versatile function of the circadian protein CIPC as a regulator of Erk activation

    Energy Technology Data Exchange (ETDEWEB)

    Matsunaga, Ryota; Nishino, Tasuku [Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Shobara, Hiroshima 727-0023 (Japan); Yokoyama, Atsushi [Department of Molecular Endocrinology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Nakashima, Akio; Kikkawa, Ushio [Biosignal Research Center, Kobe University, Kobe 657-8501 (Japan); Konishi, Hiroaki, E-mail: hkonishi@pu-hiroshima.ac.jp [Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Shobara, Hiroshima 727-0023 (Japan)

    2016-01-15

    The CLOCK-interacting protein, Circadian (CIPC), has been identified as an additional negative-feedback regulator of the circadian clock. However, recent study on CIPC knockout mice has shown that CIPC is not critically required for basic circadian clock function, suggesting other unknown biological roles for CIPC. In this study, we focused on the cell cycle dependent nuclear-cytoplasmic shuttling function of CIPC and on identifying its binding proteins. Lys186 and 187 were identified as the essential amino acid residues within the nuclear localization signal (NLS) of CIPC. We identified CIPC-binding proteins such as the multifunctional enzyme CAD protein (carbamoyl-phosphate synthetase 2, aspartate transcarbamoylase, and dihydroorotase), which is a key enzyme for de novo pyrimidine synthesis. Compared to control cells, HEK293 cells overexpressing wild-type CIPC showed suppressed cell proliferation and retardation of cell cycle. We also found that PMA-induced Erk activation was inhibited with expression of wild-type CIPC. In contrast, the NLS mutant of CIPC, which reduced the ability of CIPC to translocate into the nucleus, did not exhibit these biological effects. Since CAD and Erk have significant roles in cell proliferation and cell cycle, CIPC may work as a cell cycle regulator by interacting with these binding proteins. - Highlights: • CIPC is a cell cycle dependent nuclear-cytoplasmic shuttling protein. • K186 and 187are the essential amino acid residues within the NLS of CIPC. • CAD was identified as a novel CIPC-binding protein. • CIPC might regulate the activity and translocation of CAD in the cells.

  5. Nicotinic receptors and functional regulation of GABA cell microcircuitry in bipolar disorder and schizophrenia.

    Science.gov (United States)

    Benes, Francine M

    2012-01-01

    Studies of the hippocampus in postmortem brains from patients with schizophrenia and bipolar disorder have provided evidence for a defect of GABAergic interneurons. Significant decreases in the expression of GAD67, a marker for GABA cell function, have been found repeatedly in several different brain regions that include the hippocampus. In this region, nicotinic receptors are thought to play an important role in modulating the activity of GABAergic interneurons by influences of excitatory cholinergic afferents on their activity. In bipolar disorder, this influence appears to be particularly prominent in the stratum oriens of sectors CA3/2 and CA1, two sites where these cells constitute the exclusive neuronal cell type. In sector CA3/2, this layer receives a robust excitatory projection from the basolateral amygdala (BLA) and this is thought to play a central role in regulating GABA cells at this locus. Using laser microdissection, recent studies have focused selectively on these two layers and their associated GABA cells using microarray technology. The results have provided support for the idea that nicotinic cholinergic receptors play a particularly important role in regulating the activity of GABA neurons at these loci by regulating the progression of cell cycle and the repair of damaged DNA. In bipolar disorder, there is a prominent reduction in the expression of mRNAs for several different nicotinic subunit isoforms. These decreases could reflect a diminished influence of this receptor system on these GABA cells, particularly in sector CA3/2 where a preponderance of abnormalities have been observed in postmortem studies. In patients with bipolar disorder, excitatory nicotinic cholinergic fibers from the medial septum may converge with glutamatergic fibers from the BLA on GABAergic interneurons in the stratum oriens of CA3/2 and result in disturbances of their genomic and functional integrity, ones that may induce disruptions of the integration of

  6. Preschoolers' Cognitive and Emotional Self-Regulation in Pretend Play: Relations with Executive Functions and Quality of Play

    Science.gov (United States)

    Slot, Pauline Louise; Mulder, Hanna; Verhagen, Josje; Leseman, Paul P. M.

    2017-01-01

    The preschool period is marked by rapid growth of children's self-regulation and related executive functions. Self-regulation is considered an important aspect of school readiness and is related to academic and social--emotional outcomes in childhood. Pretend play, as part of the early childhood curriculum, is hypothesized to support…

  7. Preschoolers' cognitive and emotional self-regulation in pretend play : Relations with executive functions and quality of play

    NARCIS (Netherlands)

    Slot, Pauline Louise; Mulder, Hanna; Verhagen, Josje; Leseman, Paul

    2017-01-01

    The preschool period is marked by rapid growth of children's self-regulation and related executive functions. Self-regulation is considered an important aspect of school readiness and is related to academic and social–emotional outcomes in childhood. Pretend play, as part of the early childhood

  8. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  9. Effects of phosphodiesterase III inhibition on length-dependent regulation of myocardial function in coronary surgery patients

    NARCIS (Netherlands)

    de Hert, S. G.; ten Broecke, P. W.; Mertens, E.; Rodrigus, I. E.; Stockman, B. A.

    2002-01-01

    BACKGROUND: Phosphodiesterase III inhibitors increase myocardial contractility and decrease left ventricular (LV) afterload. We studied whether these effects altered LV response to an increase in cardiac load and affected length-dependent regulation of myocardial function. METHODS: Before the start

  10. Viral and cellular SOS-regulated motor proteins: dsDNA translocation mechanisms with divergent functions.

    Science.gov (United States)

    Wolfe, Annie; Phipps, Kara; Weitao, Tao

    2014-01-01

    DNA damage attacks on bacterial cells have been known to activate the SOS response, a transcriptional response affecting chromosome replication, DNA recombination and repair, cell division and prophage induction. All these functions require double-stranded (ds) DNA translocation by ASCE hexameric motors. This review seeks to delineate the structural and functional characteristics of the SOS response and the SOS-regulated DNA translocases FtsK and RuvB with the phi29 bacteriophage packaging motor gp16 ATPase as a prototype to study bacterial motors. While gp16 ATPase, cellular FtsK and RuvB are similarly comprised of hexameric rings encircling dsDNA and functioning as ATP-driven DNA translocases, they utilize different mechanisms to accomplish separate functions, suggesting a convergent evolution of these motors. The gp16 ATPase and FtsK use a novel revolution mechanism, generating a power stroke between subunits through an entropy-DNA affinity switch and pushing dsDNA inward without rotation of DNA and the motor, whereas RuvB seems to employ a rotation mechanism that remains to be further characterized. While FtsK and RuvB perform essential tasks during the SOS response, their roles may be far more significant as SOS response is involved in antibiotic-inducible bacterial vesiculation and biofilm formation as well as the perspective of the bacteria-cancer evolutionary interaction.

  11. Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions.

    Science.gov (United States)

    Mailloux, Ryan J; Jin, Xiaolei; Willmore, William G

    2014-01-01

    Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling.

  12. Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions☆

    Science.gov (United States)

    Mailloux, Ryan J.; Jin, Xiaolei; Willmore, William G.

    2013-01-01

    Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling. PMID:24455476

  13. Red Blood Cell Function and Dysfunction: Redox Regulation, Nitric Oxide Metabolism, Anemia

    Science.gov (United States)

    Kuhn, Viktoria; Diederich, Lukas; Keller, T.C. Stevenson; Kramer, Christian M.; Lückstädt, Wiebke; Panknin, Christina; Suvorava, Tatsiana; Isakson, Brant E.; Kelm, Malte

    2017-01-01

    Abstract Significance: Recent clinical evidence identified anemia to be correlated with severe complications of cardiovascular disease (CVD) such as bleeding, thromboembolic events, stroke, hypertension, arrhythmias, and inflammation, particularly in elderly patients. The underlying mechanisms of these complications are largely unidentified. Recent Advances: Previously, red blood cells (RBCs) were considered exclusively as transporters of oxygen and nutrients to the tissues. More recent experimental evidence indicates that RBCs are important interorgan communication systems with additional functions, including participation in control of systemic nitric oxide metabolism, redox regulation, blood rheology, and viscosity. In this article, we aim to revise and discuss the potential impact of these noncanonical functions of RBCs and their dysfunction in the cardiovascular system and in anemia. Critical Issues: The mechanistic links between changes of RBC functional properties and cardiovascular complications related to anemia have not been untangled so far. Future Directions: To allow a better understanding of the complications associated with anemia in CVD, basic and translational science studies should be focused on identifying the role of noncanonical functions of RBCs in the cardiovascular system and on defining intrinsic and/or systemic dysfunction of RBCs in anemia and its relationship to CVD both in animal models and clinical settings. Antioxid. Redox Signal. 26, 718–742. PMID:27889956

  14. Increased Global Interaction Across Functional Brain Modules During Cognitive Emotion Regulation.

    Science.gov (United States)

    Brandl, Felix; Mulej Bratec, Satja; Xie, Xiyao; Wohlschläger, Afra M; Riedl, Valentin; Meng, Chun; Sorg, Christian

    2017-07-13

    Cognitive emotion regulation (CER) enables humans to flexibly modulate their emotions. While local theories of CER neurobiology suggest interactions between specialized local brain circuits underlying CER, e.g., in subparts of amygdala and medial prefrontal cortices (mPFC), global theories hypothesize global interaction increases among larger functional brain modules comprising local circuits. We tested the global CER hypothesis using graph-based whole-brain network analysis of functional MRI data during aversive emotional processing with and without CER. During CER, global between-module interaction across stable functional network modules increased. Global interaction increase was particularly driven by subregions of amygdala and cuneus-nodes of highest nodal participation-that overlapped with CER-specific local activations, and by mPFC and posterior cingulate as relevant connector hubs. Results provide evidence for the global nature of human CER, complementing functional specialization of embedded local brain circuits during successful CER. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  16. Long-Term Follow-Up of Cardiac Function and Quality of Life for Patients in NSABP Protocol B-31/NRG Oncology: A Randomized Trial Comparing the Safety and Efficacy of Doxorubicin and Cyclophosphamide (AC) Followed by Paclitaxel With AC Followed by Paclitaxel and Trastuzumab in Patients With Node-Positive Breast Cancer With Tumors Overexpressing Human Epidermal Growth Factor Receptor 2.

    Science.gov (United States)

    Ganz, Patricia A; Romond, Edward H; Cecchini, Reena S; Rastogi, Priya; Geyer, Charles E; Swain, Sandra M; Jeong, Jong-Hyeon; Fehrenbacher, Louis; Gross, Howard M; Brufsky, Adam M; Flynn, Patrick J; Wahl, Tanya A; Seay, Thomas E; Wade, James L; Biggs, David D; Atkins, James N; Polikoff, Jonathan; Zapas, John L; Mamounas, Eleftherios P; Wolmark, Norman

    2017-12-10

    Purpose Early cardiac toxicity is a risk associated with adjuvant chemotherapy plus trastuzumab. However, objective measures of cardiac function and health-related quality of life are lacking in long-term follow-up of patients who remain cancer free after completion of adjuvant treatment. Patients and Methods Patients in NSABP Protocol B-31 received anthracycline and taxane chemotherapy with or without trastuzumab for adjuvant treatment of node-positive, human epidermal growth factor receptor 2-positive early-stage breast cancer. A long-term follow-up assessment was undertaken for patients who were alive and disease free, which included measurement of left ventricular ejection fraction by multigated acquisition scan along with patient-reported outcomes using the Duke Activity Status Index (DASI), the Medical Outcomes Study questionnaire, and a review of current medications and comorbid conditions. Results At a median follow-up of 8.8 years among eligible participants, five (4.5%) of 110 in the control group and 10 (3.4%) of 297 in the trastuzumab group had a > 10% decline in left ventricular ejection fraction from baseline to a value < 50%. Lower DASI scores correlated with age and use of medications for hypertension, cardiac conditions, diabetes, and hyperlipidemia, but not with whether patients had received trastuzumab. Conclusion In patients without underlying cardiac disease at baseline, the addition of trastuzumab to adjuvant anthracycline and taxane-based chemotherapy does not result in long-term worsening of cardiac function, cardiac symptoms, or health-related quality of life. The DASI questionnaire may provide a simple and useful tool for monitoring patient-reported changes that reflect cardiac function.

  17. Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

    Science.gov (United States)

    Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

    2013-06-01

    In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  18. European regulations on nutraceuticals, dietary supplements and functional foods: A framework based on safety

    International Nuclear Information System (INIS)

    Coppens, Patrick; Fernandes da Silva, Miguel; Pettman, Simon

    2006-01-01

    This article describes the legislation that is relevant in the marketing of functional foods in the European Union (EU), how this legislation was developed as well as some practical consequences for manufacturers, marketers and consumers. It also addresses some concrete examples of how the EU's safety requirements for food products have impacted a range of product categories. In the late nineties, research into functional ingredients was showing promising prospects for the use of such ingredients in foodstuffs. Due mainly to safety concerns, these new scientific developments were accompanied by an urgent call for legislation. The European Commission 2000 White Paper on Food Safety announced some 80 proposals for new and improved legislation in this field. Among others, it foresaw the establishment of a General Food Law Regulation, laying down the principles of food law and the creation of an independent Food Authority endowed with the task of giving scientific advice on issues based upon scientific risk assessment with clearly separated responsibilities for risk assessment, risk management and risk communication. Since then, more than 90% of the White Paper proposals have been implemented. However, there is not, as such, a regulatory framework for 'functional foods' or 'nutraceuticals' in EU Food Law. The rules to be applied are numerous and depend on the nature of the foodstuff. The rules of the general food law Regulation are applicable to all foods. In addition, legislation on dietetic foods, on food supplements or on novel foods may also be applicable to functional foods depending on the nature of the product and on their use. Finally, the two proposals on nutrition and health claims and on the addition of vitamins and minerals and other substances to foods, which are currently in the legislative process, will also be an important factor in the future marketing of 'nutraceuticals' in Europe. The cornerstone of EU legislation on food products, including

  19. Regulation of the activins-follistatins-inhibins axis by energy status: Impact on reproductive function.

    Science.gov (United States)

    Perakakis, Nikolaos; Upadhyay, Jagriti; Ghaly, Wael; Chen, Joyce; Chrysafi, Pavlina; Anastasilakis, Athanasios D; Mantzoros, Christos S

    2018-05-09

    We have previously demonstrated that the adipose tissue derived hormone leptin controls reproductive function by regulating the hypothalamic-pituitary-gonadal axis in response to energy deficiency. Here, we evaluate the activins-follistatins-inhibins (AFI) axis during acute (short-term fasting in healthy people) and chronic energy deficiency (women with hypothalamic amenorrhea due to strenuous exercise [HA]) and investigate their relation to leptin and reproductive function in healthy subjects and subjects with HA. The AFI axis was investigated in: a) A double-blinded study in healthy subjects having three randomly assigned admissions, each time for four days: in the isocaloric fed state, complete fasting with placebo treatment, complete fasting with leptin replacement, b) A case-control study comparing women with HA vs healthy controls, c) An open-label interventional study investigating leptin treatment in women with HA over a period of up to three months, d) A randomized interventional trial investigating leptin treatment vs placebo in women with HA for nine months. The circulating levels of activin A, activin B, follistatin and follistatin-like 3 change robustly in response to acute and chronic energy deficiency. Leptin replacement in acute energy deprivation does not affect the levels of these hormones suggesting an independent regulation by these two hormonal pathways. In chronic energy deficiency, leptin replacement restores only activin B levels, which are in turn associated with an increase in the number of dominant follicles. We demonstrate for the first time that the AFI axis is affected both by acute and chronic energy deficiency. Partial restoration of a component of the axis, i.e. activin B only, through leptin replacement is associated with improved reproductive function in women with HA. Copyright © 2018. Published by Elsevier Inc.

  20. High Endothelial Venules and Lymphatic Vessels in Tertiary Lymphoid Organs: Characteristics, Functions, and Regulation

    Directory of Open Access Journals (Sweden)

    Nancy H Ruddle

    2016-11-01

    Full Text Available High endothelial venules (HEVs and lymphatic vessels (LVs are essential for the function of the immune system, by providing communication between the body and lymph nodes (LNs, specialized sites of antigen presentation and recognition. HEVs bring in naïve and central memory cells and LVs transport antigen, antigen presenting cells, and lymphocytes in and out of LNs. Tertiary lymphoid organs (TLOs are accumulations of lymphoid and stromal cells that arise and organize at ectopic sites in response to chronic inflammation in autoimmunity, microbial infection, graft rejection, and cancer. TLOs are distinguished from primary lymphoid organs-the thymus and bone marrow, and secondary lymphoid organs (SLOs-the LNs, spleen, and Peyer’s patches, in that they arise in response to inflammatory signals, rather than in ontogeny. TLOs usually do not have a capsule, but are rather contained within the confines of another organ. Their structure, cellular composition, chemokine expression, and vascular and stromal support resemble SLOs and are the defining aspects of TLOs. T and B cells, antigen presenting cells, fibroblast reticular cells and other stromal cells and vascular elements including HEVs and LVs are all typical components of TLOS. A key question is whether the HEVs and LVs play comparable roles and are regulated similarly to those in LNs. Data are presented that support this concept, especially with regard to TLO HEVs. Emerging data suggest that the functions and regulation of TLO LVs are also similar to those in LNs. These observations support the concept that TLOs are not merely cellular accumulations, but are functional entities that provide sites to generate effector cells, and that their HEVs and LVs are crucial elements in those activities.

  1. Smooth Muscle Endothelin B Receptors Regulate Blood Pressure but Not Vascular Function or Neointimal Remodeling.

    Science.gov (United States)

    Miller, Eileen; Czopek, Alicja; Duthie, Karolina M; Kirkby, Nicholas S; van de Putte, Elisabeth E Fransen; Christen, Sibylle; Kimmitt, Robert A; Moorhouse, Rebecca; Castellan, Raphael F P; Kotelevtsev, Yuri V; Kuc, Rhoda E; Davenport, Anthony P; Dhaun, Neeraj; Webb, David J; Hadoke, Patrick W F

    2017-02-01

    The role of smooth muscle endothelin B (ET B ) receptors in regulating vascular function, blood pressure (BP), and neointimal remodeling has not been established. Selective knockout mice were generated to address the hypothesis that loss of smooth muscle ET B receptors would reduce BP, alter vascular contractility, and inhibit neointimal remodeling. ET B receptors were selectively deleted from smooth muscle by crossing floxed ET B mice with those expressing cre-recombinase controlled by the transgelin promoter. Functional consequences of ET B deletion were assessed using myography. BP was measured by telemetry, and neointimal lesion formation induced by femoral artery injury. Lesion size and composition (day 28) were analyzed using optical projection tomography, histology, and immunohistochemistry. Selective deletion of ET B was confirmed by genotyping, autoradiography, polymerase chain reaction, and immunohistochemistry. ET B -mediated contraction was reduced in trachea, but abolished from mesenteric veins, of knockout mice. Induction of ET B -mediated contraction in mesenteric arteries was also abolished in these mice. Femoral artery function was unaltered, and baseline BP modestly elevated in smooth muscle ET B knockout compared with controls (+4.2±0.2 mm Hg; P<0.0001), but salt-induced and ET B blockade-mediated hypertension were unaltered. Circulating endothelin-1 was not altered in knockout mice. ET B -mediated contraction was not induced in femoral arteries by incubation in culture medium or lesion formation, and lesion size was not altered in smooth muscle ET B knockout mice. In the absence of other pathology, ET B receptors in vascular smooth muscle make a small but significant contribution to ET B -dependent regulation of BP. These ET B receptors have no effect on vascular contraction or neointimal remodeling. © 2016 The Authors.

  2. Regulation

    International Nuclear Information System (INIS)

    Ballereau, P.

    1999-01-01

    The different regulations relative to nuclear energy since the first of January 1999 are given here. Two points deserve to be noticed: the decree of the third august 1999 authorizing the national Agency for the radioactive waste management to install and exploit on the commune of Bures (Meuse) an underground laboratory destined to study the deep geological formations where could be stored the radioactive waste. The second point is about the uranium residues and the waste notion. The judgment of the administrative tribunal of Limoges ( 9. july 1998) forbidding the exploitation of a storage installation of depleted uranium considered as final waste and qualifying it as an industrial waste storage facility has been annulled bu the Court of Appeal. It stipulated that, according to the law number 75663 of the 15. july 1965, no criteria below can be applied to depleted uranium: production residue (possibility of an ulterior enrichment), abandonment of a personal property or simple intention to do it ( future use aimed in the authorization request made in the Prefecture). This judgment has devoted the primacy of the waste notion on this one of final waste. (N.C.)

  3. Elucidating and Regulating the Acetoin Production Role of Microbial Functional Groups in Multispecies Acetic Acid Fermentation.

    Science.gov (United States)

    Lu, Zhen-Ming; Liu, Na; Wang, Li-Juan; Wu, Lin-Huan; Gong, Jin-Song; Yu, Yong-Jian; Li, Guo-Quan; Shi, Jin-Song; Xu, Zheng-Hong

    2016-10-01

    Acetoin (3-hydroxy-2-butanone) formation in vinegar microbiota is crucial for the flavor quality of Zhenjiang aromatic vinegar, a traditional vinegar produced from cereals. However, the specific microorganisms responsible for acetoin formation in this centuries-long repeated batch fermentation have not yet been clearly identified. Here, the microbial distribution discrepancy in the diacetyl/acetoin metabolic pathway of vinegar microbiota was revealed at the species level by a combination of metagenomic sequencing and clone library analysis. The results showed that Acetobacter pasteurianus and 4 Lactobacillus species (Lactobacillus buchneri, Lactobacillus reuteri, Lactobacillus fermentum, and Lactobacillus brevis) might be functional producers of acetoin from 2-acetolactate in vinegar microbiota. Furthermore, A. pasteurianus G3-2, L. brevis 4-22, L. fermentum M10-3, and L. buchneri F2-5 were isolated from vinegar microbiota by a culture-dependent method. The acetoin concentrations in two cocultures (L. brevis 4-22 plus A. pasteurianus G3-2 and L. fermentum M10-3 plus A. pasteurianus G3-2) were obviously higher than those in monocultures of lactic acid bacteria (LAB), while L. buchneri F2-5 did not produce more acetoin when coinoculated with A. pasteurianus G3-2. Last, the acetoin-producing function of vinegar microbiota was regulated in situ via augmentation with functional species in vinegar Pei After 72 h of fermentation, augmentation with A. pasteurianus G3-2 plus L. brevis 4-22, L. fermentum M10-3, or L. buchneri F2-5 significantly increased the acetoin content in vinegar Pei compared with the control group. This study provides a perspective on elucidating and manipulating different metabolic roles of microbes during flavor formation in vinegar microbiota. Acetoin (3-hydroxy-2-butanone) formation in vinegar microbiota is crucial for the flavor quality of Zhenjiang aromatic vinegar, a traditional vinegar produced from cereals. Thus, it is of interest to

  4. Computational Approaches Reveal New Insights into Regulation and Function of Non; coding RNAs and their Targets

    KAUST Repository

    Alam, Tanvir

    2016-11-28

    Regulation and function of protein-coding genes are increasingly well-understood, but no comparable evidence exists for non-coding RNA (ncRNA) genes, which appear to be more numerous than protein-coding genes. We developed a novel machine-learning model to distinguish promoters of long ncRNA (lncRNA) genes from those of protein-coding genes. This represents the first attempt to make this distinction based on properties of the associated gene promoters. From our analyses, several transcription factors (TFs), which are known to be regulated by lncRNAs, also emerged as potential global regulators of lncRNAs, suggesting that lncRNAs and TFs may participate in bidirectional feedback regulatory network. Our results also raise the possibility that, due to the historical dependence on protein-coding gene in defining the chromatin states of active promoters, an adjustment of these chromatin signature profiles to incorporate lncRNAs is warranted in the future. Secondly, we developed a novel method to infer functions for lncRNA and microRNA (miRNA) transcripts based on their transcriptional regulatory networks in 119 tissues and 177 primary cells of human. This method for the first time combines information of cell/tissueVspecific expression of a transcript and the TFs and transcription coVfactors (TcoFs) that control activation of that transcript. Transcripts were annotated using statistically enriched GO terms, pathways and diseases across cells/tissues and associated knowledgebase (FARNA) is developed. FARNA, having the most comprehensive function annotation of considered ncRNAs across the widest spectrum of cells/tissues, has a potential to contribute to our understanding of ncRNA roles and their regulatory mechanisms in human. Thirdly, we developed a novel machine-learning model to identify LD motif (a protein interaction motif) of paxillin, a ncRNA target that is involved in cell motility and cancer metastasis. Our recognition model identified new proteins not

  5. Hormonal regulation of Na+/K+-dependent ATPase activity and pump function in corneal endothelial cells.

    Science.gov (United States)

    Hatou, Shin

    2011-10-01

    Na- and K-dependent ATPase (Na,K-ATPase) in the basolateral membrane of corneal endothelial cells plays an important role in the pump function of the corneal endothelium. We investigated the role of dexamethasone in the r