Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean
2012-01-01
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.
Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina
2018-03-27
Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.
Epidermal Growth Factor and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Xiaopeng Tang
2016-01-01
Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-10-23
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.
Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing
Directory of Open Access Journals (Sweden)
Sabita N. Saldanha
2015-12-01
Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-01-01
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...
Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.
Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo
2018-05-01
The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.
Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun
2016-02-01
Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.
Tsai, Chang-Ru; Anderson, Aimee E; Burra, Sirisha; Jo, Juyeon; Galko, Michael J
2017-07-01
Yorkie (Yki), the transcriptional co-activator of the Hippo signaling pathway, has well-characterized roles in balancing apoptosis and cell division during organ growth control. Yki is also required in diverse tissue regenerative contexts. In most cases this requirement reflects its well-characterized roles in balancing apoptosis and cell division. Whether Yki has repair functions outside of the control of cell proliferation, death, and growth is not clear. Here we show that Yki and Scalloped (Sd) are required for epidermal wound closure in the Drosophila larval epidermis. Using a GFP-tagged Yki transgene we show that Yki transiently translocates to some epidermal nuclei upon wounding. Genetic analysis strongly suggests that Yki interacts with the known wound healing pathway, Jun N-terminal kinase (JNK), but not with Platelet Derived Growth Factor/Vascular-Endothelial Growth Factor receptor (Pvr). Yki likely acts downstream of or parallel to JNK signaling and does not appear to regulate either proliferation or apoptosis in the larval epidermis during wound repair. Analysis of actin structures after wounding suggests that Yki and Sd promote wound closure through actin regulation. In sum, we found that Yki regulates an epithelial tissue repair process independently of its previously documented roles in balancing proliferation and apoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.
Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.
Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M
2016-09-01
Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
David Judah
Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina
2012-01-01
Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
The organization of human epidermis: functional epidermal units and phi proportionality.
Hoath, Steven B; Leahy, D G
2003-12-01
The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.
Could tight junctions regulate the barrier function of the aged skin?
Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš
2016-03-01
The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Epidermal wound repair is regulated by the planar cell polarity signaling pathway.
Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M
2010-07-20
The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.
Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina
2016-02-01
A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Mi, Li-Zhi; Grey, Michael J; Nishida, Noritaka
2008-01-01
Cellular signaling mediated by the epidermal growth factor receptor (EGFR or ErbB) family of receptor tyrosine kinases plays an important role in regulating normal and oncogenic cellular physiology. While structures of isolated EGFR extracellular domains and intracellular protein tyrosine kinase...... differential functional stability in Triton X-100 versus dodecyl maltoside. Furthermore, the kinase activity can be significantly stabilized by reconstituting purified EGF-bound EGFR dimers in phospholipid nanodiscs or vesicles, suggesting that the environment around the hydrophobic transmembrane...
Tight junction regulates epidermal calcium ion gradient and differentiation
International Nuclear Information System (INIS)
Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki
2011-01-01
Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.
[Progress in epidermal stem cells].
Wang, Li-Juan; Wang, You-Liang; Yang, Xiao
2010-03-01
Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.
Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis
2015-07-01
IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.
Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism
International Nuclear Information System (INIS)
He, D.; Lim, H.W.
1991-01-01
This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes
The DAF-16/FOXO transcription factor functions as a regulator of epidermal innate immunity.
Zou, Cheng-Gang; Tu, Qiu; Niu, Jie; Ji, Xing-Lai; Zhang, Ke-Qin
2013-01-01
The Caenorhabditis elegans DAF-16 transcription factor is critical for diverse biological processes, particularly longevity and stress resistance. Disruption of the DAF-2 signaling cascade promotes DAF-16 activation, and confers resistance to killing by pathogenic bacteria, such as Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis. However, daf-16 mutants exhibit similar sensitivity to these bacteria as wild-type animals, suggesting that DAF-16 is not normally activated by these bacterial pathogens. In this report, we demonstrate that DAF-16 can be directly activated by fungal infection and wounding in wild-type animals, which is independent of the DAF-2 pathway. Fungal infection and wounding initiate the Gαq signaling cascade, leading to Ca(2+) release. Ca(2+) mediates the activation of BLI-3, a dual-oxidase, resulting in the production of reactive oxygen species (ROS). ROS then activate DAF-16 through a Ste20-like kinase-1/CST-1. Our results indicate that DAF-16 in the epidermis is required for survival after fungal infection and wounding. Thus, the EGL-30-Ca(2+)-BLI-3-CST-1-DAF-16 signaling represents a previously unknown pathway to regulate epidermal damage response.
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji
2016-01-01
To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.
Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C
2012-05-01
In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.
Fatty acids are required for epidermal permeability barrier function.
Mao-Qiang, M; Elias, P M; Feingold, K R
1993-08-01
The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.
Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics
International Nuclear Information System (INIS)
Ayyagari, R.R.; Khan-Dawood, F.S.
1987-01-01
Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function
Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H
2017-11-01
Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.
Epidermal stem cells: location, potential and contribution to cancer.
Ambler, C A; Määttä, A
2009-01-01
Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.
Acyl-CoA binding protein and epidermal barrier function
DEFF Research Database (Denmark)
Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J
2014-01-01
The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...
A homolog of Drosophila grainy head is essential for epidermal integrity in mice.
Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M
2005-04-15
The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.
Casey, F P; Baird, D; Feng, Q; Gutenkunst, R N; Waterfall, J J; Myers, C R; Brown, K S; Cerione, R A; Sethna, J P
2007-05-01
We apply the methods of optimal experimental design to a differential equation model for epidermal growth factor receptor signalling, trafficking and down-regulation. The model incorporates the role of a recently discovered protein complex made up of the E3 ubiquitin ligase, Cbl, the guanine exchange factor (GEF), Cool-1 (beta -Pix) and the Rho family G protein Cdc42. The complex has been suggested to be important in disrupting receptor down-regulation. We demonstrate that the model interactions can accurately reproduce the experimental observations, that they can be used to make predictions with accompanying uncertainties, and that we can apply ideas of optimal experimental design to suggest new experiments that reduce the uncertainty on unmeasurable components of the system.
Directory of Open Access Journals (Sweden)
Rachel Herndon Klein
2017-04-01
Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.
Directory of Open Access Journals (Sweden)
Shelly Abad Cruz
Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.
The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology
DEFF Research Database (Denmark)
Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J
2017-01-01
The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....
Tong, Junfeng; Li, Laiji; Ballermann, Barbara
2013-01-01
Accumulating evidence has implicated Rho GTPases, including Rac1, in many aspects of cancer development. Recent findings suggest that phosphorylation might further contribute to the tight regulation of Rho GTPases. Interestingly, sequence analysis of Rac1 shows that Rac1 T108 within the 106PNTP109 motif is likely an extracellular signal-regulated kinase (ERK) phosphorylation site and that Rac1 also has an ERK docking site, 183KKRKRKCLLL192 (D site), at the C terminus. Indeed, we show here that both transfected and endogenous Rac1 interacts with ERK and that this interaction is mediated by its D site. Green fluorescent protein (GFP)-Rac1 is threonine (T) phosphorylated in response to epidermal growth factor (EGF), and EGF-induced Rac1 threonine phosphorylation is dependent on the activation of ERK. Moreover, mutant Rac1 with the mutation of T108 to alanine (A) is not threonine phosphorylated in response to EGF. In vitro ERK kinase assay further shows that pure active ERK phosphorylates purified Rac1 but not mutant Rac1 T108A. We also show that Rac1 T108 phosphorylation decreases Rac1 activity, partially due to inhibiting its interaction with phospholipase C-γ1 (PLC-γ1). T108 phosphorylation targets Rac1 to the nucleus, which isolates Rac1 from other guanine nucleotide exchange factors (GEFs) and hinders Rac1's role in cell migration. We conclude that Rac1 T108 is phosphorylated by ERK in response to EGF, which plays an important role in regulating Rac1. PMID:24043306
Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.
Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui
2018-01-01
Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.
Regulation of the ligand-dependent activation of the epidermal growth factor receptor by calmodulin
DEFF Research Database (Denmark)
Li, Hongbing; Panina, Svetlana; Kaur, Amandeep
2012-01-01
Calmodulin (CaM) is the major component of calcium signaling pathways mediating the action of various effectors. Transient increases in the intracellular calcium level triggered by a variety of stimuli lead to the formation of Ca2+/CaM complexes, which interact with and activate target proteins....... In the present study the role of Ca2+/CaM in the regulation of the ligand-dependent activation of the epidermal growth factor receptor (EGFR) has been examined in living cells. We show that addition of different cell permeable CaM antagonists to cultured cells or loading cells with a Ca2+ chelator inhibited...
DEFF Research Database (Denmark)
Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar
2014-01-01
The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...
Directory of Open Access Journals (Sweden)
Fanny Kortüm
Full Text Available Endosomal sorting is an essential control mechanism for signaling through the epidermal growth factor receptor (EGFR. We report here that the guanine nucleotide exchange factor αPIX, which modulates the activity of Rho-GTPases, is a potent bimodal regulator of EGFR trafficking. αPIX interacts with the E3 ubiquitin ligase c-Cbl, an enzyme that attaches ubiquitin to EGFR, thereby labelling this tyrosine kinase receptor for lysosomal degradation. We show that EGF stimulation induces αPIX::c-Cbl complex formation. Simultaneously, αPIX and c-Cbl protein levels decrease, which depends on both αPIX binding to c-Cbl and c-Cbl ubiquitin ligase activity. Through interaction αPIX sequesters c-Cbl from EGFR and this results in reduced EGFR ubiquitination and decreased EGFR degradation upon EGF treatment. However, quantitatively more decisive for cellular EGFR distribution than impaired EGFR degradation is a strong stimulating effect of αPIX on EGFR recycling to the cell surface. This function depends on the GIT binding domain of αPIX but not on interaction with c-Cbl or αPIX exchange activity. In summary, our data demonstrate a previously unappreciated function of αPIX as a strong promoter of EGFR recycling. We suggest that the novel recycling regulator αPIX and the degradation factor c-Cbl closely cooperate in the regulation of EGFR trafficking: uncomplexed αPIX and c-Cbl mediate a positive and a negative feedback on EGFR signaling, respectively; αPIX::c-Cbl complex formation, however, results in mutual inhibition, which may reflect a stable condition in the homeostasis of EGF-induced signal flow.
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Abnormalities of lymphocyte function and phenotypic pattern in a case of toxic epidermal necrolysis
DEFF Research Database (Denmark)
Hagdrup, H; Tønnesen, E; Clemmensen, O
1992-01-01
We examined the blood lymphocyte function and phenotypic pattern in a patient with toxic epidermal necrolysis after taking salazopyrin. We studied cell surface markers, natural killer cell activity and mitogen-induced lymphocyte transformation. Our results point to temporary immunosuppression...... as evidenced by lymphopenia with a large "null cell" population, reduced natural killer cell activity, and impaired lymphocyte response to mitogens....
Nagao, Keisuke; Ginhoux, Florent; Leitner, Wolfgang W.; Motegi, Sei-Ichiro; Bennett, Clare L.; Clausen, Björn E.; Merad, Miriam; Udey, Mark C.
2009-01-01
A new langerin(+) DC subset has recently been identified in murine dermis (langerin(+) dDC), but the lineage and functional relationships between these cells and langerin(+) epidermal Langerhans cells (LC) are incompletely characterized. Selective expression of the cell adhesion molecule EpCAM by LC
Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang
2017-12-01
Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.
Epidermal cell death in frogs with chytridiomycosis
Directory of Open Access Journals (Sweden)
Laura A. Brannelly
2017-02-01
Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.
International Nuclear Information System (INIS)
Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.
2010-01-01
Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.
2012-01-01
Accumulating evidence suggests that various diseases, including many types of cancer, result from alteration of subcellular protein localization and compartmentalization. Therefore, it is worthwhile to expand our knowledge in subcellular trafficking of proteins, such as epidermal growth factor receptor (EGFR) and ErbB-2 of the receptor tyrosine kinases, which are highly expressed and activated in human malignancies and frequently correlated with poor prognosis. The well-characterized trafficking of cell surface EGFR is routed, via endocytosis and endosomal sorting, to either the lysosomes for degradation or back to the plasma membrane for recycling. A novel nuclear mode of EGFR signaling pathway has been gradually deciphered in which EGFR is shuttled from the cell surface to the nucleus after endocytosis, and there, it acts as a transcriptional regulator, transmits signals, and is involved in multiple biological functions, including cell proliferation, tumor progression, DNA repair and replication, and chemo- and radio-resistance. Internalized EGFR can also be transported from the cell surface to several intracellular compartments, such as the Golgi apparatus, the endoplasmic reticulum, and the mitochondria, in addition to the nucleus. In this review, we will summarize the functions of nuclear EGFR family and the potential pathways by which EGFR is trafficked from the cell surface to a variety of cellular organelles. A better understanding of the molecular mechanism of EGFR trafficking will shed light on both the receptor biology and potential therapeutic targets of anti-EGFR therapies for clinical application. PMID:22520625
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.
2005-01-01
The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides
Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi
2011-09-01
Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.
Slominski, Andrzej T.; Kim, Tae-Kang; Li, Wei; Yi, Ae-Kyung; Postlethwaite, Arnold; Tuckey, Robert C.
2014-01-01
Research over the last decade has revealed that CYP11A1 can hydroxylate the side chain of vitamin D3 at carbons 17, 20, 22 and 23 to produce at least 10 metabolites, with 20(OH)D3, 20,23(OH)2D3, 20,22(OH)2D3, 17,20(OH)2D3 and 17,20,23(OH)3D3 being the main products. However, CYP11A1 does not act on 25(OH)D3. The placenta, adrenal glands and epidermal keratinocytes have been shown to metabolize vitamin D3 via this CYP11A1-mediated pathway that is modified by the activity of CYP27B1, with 20(OH)D3 (the major metabolite), 20,23(OH)2D3, 1,20(OH)2D3, 1,20,23(OH)3D3 and 17,20,23(OH)3D3 being detected, defining these secosteroids as endogenous regulators/natural products. This is supported by the detection of a mono-hydroxyvitamin D3 with the retention time of 20(OH)D3 in human serum. In new work presented here we demonstrate that the CYP11A1-initiated pathways also occurs in Caco-2 colon cells. Our previous studies show that 20(OH)D3 and 20,23(OH)2D3 are non-calcemic at pharmacological doses, dependent in part on their lack of a C1α hydroxyl group. In epidermal keratinocytes, 20(OH)D3, 20(OH)D2 and 20,23(OH)2D3 inhibited cell proliferation, stimulated differentiation and inhibited NF-κB activity with potencies comparable to 1,25(OH)2D3, acting as partial agonists on the VDR. 22(OH)D3 and 20,22(OH)2D3, as well as secosteroids with a short or no side chain, showed antiproliferative and prodifferentiation effects, however, with lower potency than 20(OH)D3 and 20,23(OH)2D3. The CYP11A1-derived secosteroids also inhibited melanocyte proliferation while having no effect on melano-genesis, and showed anti-melanoma activities in terms of inhibiting proliferation and the ability to grow in soft agar. Furthermore, 20(OH)D3 and 20,23(OH)2D3 showed anti-fibrosing effects in vitro, and also in vivo for the former. New data presented here shows that 20(OH)D3 inhibits LPS-induced production of TNFα in the J774 line, TNFα and IL-6 in peritoneal macrophages and suppresses the
Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age
Directory of Open Access Journals (Sweden)
Zobiri O
2012-02-01
Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test
Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei
2017-05-01
Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.
Directory of Open Access Journals (Sweden)
Michelle T Juarez
2011-12-01
Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating
Genetic analysis of Ras genes in epidermal development and tumorigenesis
Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano
2013-01-01
Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175
Spatiotemporal Expression of p63 in Mouse Epidermal Commitment
Directory of Open Access Journals (Sweden)
Qian Zhao
2015-12-01
Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.
Directory of Open Access Journals (Sweden)
Felicity C Kalinowski
Full Text Available Elevated expression and activity of the epidermal growth factor receptor (EGFR/protein kinase B (Akt signaling pathway is associated with development, progression and treatment resistance of head and neck cancer (HNC. Several studies have demonstrated that microRNA-7 (miR-7 regulates EGFR expression and Akt activity in a range of cancer cell types via its specific interaction with the EGFR mRNA 3'-untranslated region (3'-UTR. In the present study, we found that miR-7 regulated EGFR expression and Akt activity in HNC cell lines, and that this was associated with reduced growth in vitro and in vivo of cells (HN5 that were sensitive to the EGFR tyrosine kinase inhibitor (TKI erlotinib (Tarceva. miR-7 acted synergistically with erlotinib to inhibit growth of erlotinib-resistant FaDu cells, an effect associated with increased inhibition of Akt activity. Microarray analysis of HN5 and FaDu cell lines transfected with miR-7 identified a common set of downregulated miR-7 target genes, providing insight into the tumor suppressor function of miR-7. Furthermore, we identified several target miR-7 mRNAs with a putative role in the sensitization of FaDu cells to erlotinib. Together, these data support the coordinate regulation of Akt signaling by miR-7 in HNC cells and suggest the therapeutic potential of miR-7 alone or in combination with EGFR TKIs in this disease.
Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo
2017-01-01
Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539
Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo
2017-03-09
Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.
Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.
Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De
2016-10-01
In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.
Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M
1992-07-01
Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.
International Nuclear Information System (INIS)
Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.
2005-10-01
The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor
Hybrid Enhanced Epidermal SpaceSuit Design Approaches
Jessup, Joseph M.
A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.
Thyroid hormone regulation of epidermal growth factor receptor levels in mouse mammary glands
International Nuclear Information System (INIS)
Vonderhaar, B.K.; Tang, E.; Lyster, R.R.; Nascimento, M.C.
1986-01-01
The specific binding of iodinated epidermal growth factor ([ 125 I]iodo-EGF) to membranes prepared from the mammary glands and spontaneous breast tumors of euthyroid and hypothyroid mice was measured in order to determine whether thyroid hormones regulate the EGF receptor levels in vivo. Membranes from hypothyroid mammary glands of mice at various developmental ages bound 50-65% less EGF than those of age-matched euthyroid controls. Treatment of hypothyroid mice with L-T4 before killing restored binding to the euthyroid control level. Spontaneous breast tumors arising in hypothyroid mice also bound 30-40% less EGF than tumors from euthyroid animals even after in vitro desaturation of the membranes of endogenous growth factors with 3 M MgCl2 treatment. The decrease in binding in hypothyroid membranes was due to a decrease in the number of binding sites, not to a change in affinity of the growth factor for its receptor, as determined by Scatchard analysis of the binding data. Both euthyroid and hypothyroid membranes bound EGF primarily to a single class of high affinity sites [dissociation constant (Kd) = 0.7-1.8 nM]. Euthyroid membranes bound 28.4 +/- (SE) 0.6 fmol/mg protein, whereas hypothyroid membranes bound 15.5 +/- 1.0 fmol/mg protein. These data indicate that EGF receptor levels in normal mammary glands and spontaneous breast tumors in mice are subject to regulation by thyroid status
Ozturk, Anil Murat; Sozbilen, Murat Celal; Sevgili, Elvin; Dagci, Taner; Özyalcin, Halit; Armagan, Guliz
2018-03-22
Spinal cord injury (SCI) leads to vascular damage and disruption of blood-spinal cord barrier which participates in secondary nerve injury. Epidermal growth factor (EGF) is an endogenous protein which regulates cell proliferation, growth and differention. Previous studies reported that EGF exerts neuroprotective effect in spinal cord after SCI. However, the molecular mechanisms underlying EGF-mediated protection in different regions of nervous system have not shown yet. In this study, we aimed to examine possible anti-apoptotic and protective roles of EGF not only in spinal cord but also in brain following SCI. Twenty-eight adult rats were divided into four groups of seven animals each as follows: sham, trauma (SCI), SCI + EGF and SCI + methylprednisolone (MP) groups. The functional neurological deficits due to the SCI were assessed by behavioral analysis using the Basso, Beattie and Bresnahan (BBB) open-field locomotor test. The alterations in pro-/anti-apoptotic protein levels and antioxidant enzyme activities were measured in spinal cord and frontal cortex. In our study, EGF promoted locomotor recovery and motor neuron survival of SCI rats. EGF treatment significantly decreased Bax and increased Bcl-2 protein expressions both in spinal cord and brain when compared to SCI group. Moreover, antioxidant enzyme activities including catalase, superoxide dismutase (SOD) and glutathione peroxidase (GPx) were increased following EGF treatment similar to MP treatment. Our experiment also suggests that alteration of the ratio of Bcl-2 to Bax may result from decreased apoptosis following EGF treatment. As a conclusion, these results show, for the first time, that administration of EGF exerts its protection via regulating apoptotic and oxidative pathways in response to spinal cord injury in different regions of central nervous system. Copyright © 2018 Elsevier Ltd. All rights reserved.
Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan
2015-03-01
The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.
Analysis of E2F factors during epidermal differentiation.
Chang, Wing Y; Dagnino, Lina
2005-01-01
The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
DEFF Research Database (Denmark)
Sorkin, A; Helin, K; Waters, C M
1992-01-01
The role of epidermal growth factor (EGF) receptor autophosphorylation sites in the regulation of receptor functions has been studied using cells transfected with mutant EGF receptors. Simultaneous point mutation of 4 tyrosines (Y1068, Y1086, Y1148, Y1173) to phenylalanine, as well as removal of ...
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.
Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G
1989-10-15
The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.
Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang
2018-02-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))
1988-03-01
The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.
Directory of Open Access Journals (Sweden)
Shadmehr Demehri
2008-05-01
Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.
Boglev, Yeliz; Wilanowski, Tomasz; Caddy, Jacinta; Parekh, Vishwas; Auden, Alana; Darido, Charbel; Hislop, Nikki R; Cangkrama, Michael; Ting, Stephen B; Jane, Stephen M
2011-01-15
The Grainy head-like 3 (Grhl3) gene encodes a transcription factor that plays essential roles in epidermal morphogenesis during embryonic development, with deficient mice exhibiting failed skin barrier formation, defective wound repair, and loss of eyelid fusion. Despite sharing significant sequence homology, overlapping expression patterns, and an identical core consensus DNA binding site, the other members of the Grhl family (Grhl1 and -2) fail to compensate for the loss of Grhl3 in these processes. Here, we have employed diverse genetic models, coupled with biochemical studies, to define the inter-relationships of the Grhl factors in epidermal development. We show that Grhl1 and Grhl3 have evolved complete functional independence, as evidenced by a lack of genetic interactions in embryos carrying combinations of targeted alleles of these genes. In contrast, compound heterozygous Grhl2/Grhl3 embryos displayed failed wound repair, and loss of a single Grhl2 allele in Grhl3-null embryos results in fully penetrant eyes open at birth. Expression of Grhl2 from the Grhl3 locus in homozygous knock-in mice corrects the wound repair defect, but these embryos still display a complete failure of skin barrier formation. This functional dissociation is due to unexpected differences in target gene specificity, as both GRHL2 and GRHL3 bind to and regulate expression of the wound repair gene Rho GEF 19, but regulation of the barrier forming gene, Transglutaminase 1 (TGase1), is unique to GRHL3. Our findings define the mechanisms underpinning the unique and cooperative roles of the Grhl genes in epidermal development. Copyright © 2010 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Penrose, Harrison; Heller, Sandra; Cable, Chloe [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Makboul, Rania [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Pathology Department, Assiut University, Assiut (Egypt); Chadalawada, Gita; Chen, Ying [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Crawford, Susan E. [Department of Pathology, Saint Louis University School of Medicine, 1402 South Grand Blvd, Saint Louis, MO 63104 (United States); Savkovic, Suzana D., E-mail: ssavkovi@tulane.edu [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States)
2016-01-15
The proliferation of colon cancer cells is mediated in part by epidermal growth factor receptor (EGFR) signaling and requires sustained levels of cellular energy to meet its high metabolic needs. Intracellular lipid droplets (LDs) are a source of energy used for various cellular functions and they are elevated in density in human cancer, yet their regulation and function are not well understood. Here, in human colon cancer cells, EGF stimulates increases in LD density, which depends on EGFR expression and activation as well as the individual cellular capacity for lipid synthesis. Increases in LDs are blockaded by inhibition of PI3K/mTOR and PGE2 synthesis, supporting their dependency on select upstream pathways. In colon cancer cells, silencing of the FOXO3 transcription factor leads to down regulation of SIRT6, a negative regulator of lipid synthesis, and consequent increases in the LD coat protein PLIN2, revealing that increases in LDs depend on loss of FOXO3/SIRT6. Moreover, EGF stimulates loss of FOXO3/SIRT6, which is blockaded by the inhibition of upstream pathways as well as lipid synthesis, revealing existence of a negative regulatory loop between LDs and FOXO3/SIRT6. Elevated LDs are utilized by EGF treatment and their depletion through the inhibition of lipid synthesis or silencing of PLIN2 significantly attenuates proliferation. This novel mechanism of proliferative EGFR signaling leading to elevated LD density in colon cancer cells could potentially be therapeutically targeted for the treatment of tumor progression. - Highlights: • In colon cancer cells, EGFR activation leads to increases in LD density. • EGFR signaling includes PI3K/mTOR and PGE2 leading to lipid synthesis. • Increases in LDs are controlled by a negative regulatory loop with FOXO3/SIRT6. • EGFR mediated colon cancer cell proliferation depends on increased LD density.
International Nuclear Information System (INIS)
Penrose, Harrison; Heller, Sandra; Cable, Chloe; Makboul, Rania; Chadalawada, Gita; Chen, Ying; Crawford, Susan E.; Savkovic, Suzana D.
2016-01-01
The proliferation of colon cancer cells is mediated in part by epidermal growth factor receptor (EGFR) signaling and requires sustained levels of cellular energy to meet its high metabolic needs. Intracellular lipid droplets (LDs) are a source of energy used for various cellular functions and they are elevated in density in human cancer, yet their regulation and function are not well understood. Here, in human colon cancer cells, EGF stimulates increases in LD density, which depends on EGFR expression and activation as well as the individual cellular capacity for lipid synthesis. Increases in LDs are blockaded by inhibition of PI3K/mTOR and PGE2 synthesis, supporting their dependency on select upstream pathways. In colon cancer cells, silencing of the FOXO3 transcription factor leads to down regulation of SIRT6, a negative regulator of lipid synthesis, and consequent increases in the LD coat protein PLIN2, revealing that increases in LDs depend on loss of FOXO3/SIRT6. Moreover, EGF stimulates loss of FOXO3/SIRT6, which is blockaded by the inhibition of upstream pathways as well as lipid synthesis, revealing existence of a negative regulatory loop between LDs and FOXO3/SIRT6. Elevated LDs are utilized by EGF treatment and their depletion through the inhibition of lipid synthesis or silencing of PLIN2 significantly attenuates proliferation. This novel mechanism of proliferative EGFR signaling leading to elevated LD density in colon cancer cells could potentially be therapeutically targeted for the treatment of tumor progression. - Highlights: • In colon cancer cells, EGFR activation leads to increases in LD density. • EGFR signaling includes PI3K/mTOR and PGE2 leading to lipid synthesis. • Increases in LDs are controlled by a negative regulatory loop with FOXO3/SIRT6. • EGFR mediated colon cancer cell proliferation depends on increased LD density.
The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae
Directory of Open Access Journals (Sweden)
René Hans-Jürgen Heim
2015-12-01
Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.
DEFF Research Database (Denmark)
Hansen, Harald S.; Jensen, B.
1985-01-01
sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...
Epidermal CYP2 family cytochromes P450
International Nuclear Information System (INIS)
Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.
2004-01-01
Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier
Epidermal Inclusion Cysts of The Breast
Directory of Open Access Journals (Sweden)
Amir R. Motabar
2009-02-01
Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.
Roles of p63 in epidermal development and tumorigenesis
Directory of Open Access Journals (Sweden)
Jeng-Yuan Yao
2012-12-01
Full Text Available pidermis is composed mainly of keratinocytes and is the major barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcription factor p63. The p63 gene encodes proteins with structures similar to that of p53, including an N-terminal transactivation (TA domain, a DNA-binding domain and a carboxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epidermal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis remains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.
A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.
Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi
2016-04-01
Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Vinter-Jensen, L
2000-01-01
BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...
Ticagrelor Improves Endothelial Function by Decreasing Circulating Epidermal Growth Factor (EGF
Directory of Open Access Journals (Sweden)
Francesco Vieceli Dalla Sega
2018-04-01
Full Text Available Ticagrelor is one of the most powerful P2Y12 inhibitor. We have recently reported that, in patients with concomitant Stable Coronary Artery Disease (SCAD and Chronic Obstructive Pulmonary Disease (COPD undergoing percutaneous coronary intervention (PCI, treatment with ticagrelor, as compared to clopidogrel, is associated with an improvement of the endothelial function (Clinical Trial NCT02519608. In the present study, we showed that, in the same population, after 1 month treatment with ticagrelor, but not with clopidogrel, there is a decrease of the circulating levels of epidermal growth factor (EGF and that these changes in circulating levels of EGF correlate with on-treatment platelet reactivity. Furthermore, in human umbilical vein endothelial cells (HUVEC incubated with sera of the patients treated with ticagrelor, but not with clopidogrel there is an increase of p-eNOS levels. Finally, analyzing the changes in EGF and p-eNOS levels after treatment, we observed an inverse correlation between p-eNOS and EGF changes only in the ticagrelor group. Causality between EGF and eNOS activation was assessed in vitro in HUVEC where we showed that EGF decreases eNOS activity in a dose dependent manner. Taken together our data indicate that ticagrelor improves endothelial function by lowering circulating EGF that results in the activation of eNOS in the vascular endothelium.
International Nuclear Information System (INIS)
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-01-01
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Energy Technology Data Exchange (ETDEWEB)
Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Li, Z; Hu, L; Elias, PM; Man, M-Q
2018-01-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...
International Nuclear Information System (INIS)
Olsen, W.M.; Elgjo, K.
1990-01-01
A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.
Directory of Open Access Journals (Sweden)
Lianghua Bin
Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.
International Nuclear Information System (INIS)
Wakshull, E.; Kraemer, P.M.; Wharton, W.
1985-01-01
Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells
Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming
2015-09-01
Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.
Directory of Open Access Journals (Sweden)
Daniela GUZMÁN-URIBE
Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.
Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.
Crawford, Melissa; Dagnino, Lina
2017-10-02
The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.
Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques
2015-06-01
Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.
Tan, Y; Chiow, KH; Huang, D; Wong, SH
2010-01-01
Background and purpose: Andrographolide is the active component of Andrographis paniculata, a plant used in both Indian and Chinese traditional medicine, and it has been demonstrated to induce apoptosis in different cancer cell lines. However, not much is known about how it may affect the key receptors implicated in cancer. Knowledge of how andrographolide affects receptor trafficking will allow us to better understand new mechanisms by which andrographolide may cause death in cancer cells. Experimental approach: We utilized the well-characterized epidermal growth factor receptor (EGFR) and transferrin receptor (TfR) expressed in epidermoid carcinoma (A-431) cells as a model to study the effect of andrographolide on receptor trafficking. Receptor distribution, the total number of receptors and surface receptors were analysed by immunofluorescence, Western blot as well as flow-cytometry respectively. Key results: Andrographolide treatment inhibited cell growth, down-regulated EGFRs on the cell surface and affected the degradation of EGFRs and TfRs. The EGFR was internalized into the cell at an increased rate, and accumulated in a compartment that co-localizes with the lysosomal-associated membrane protein in the late endosomes. Conclusion and implications: This study sheds light on how andrographolide may affect receptor trafficking by inhibiting receptor movement from the late endosomes to lysosomes. The down-regulation of EGFR from the cell surface also indicates a new mechanism by which andrographolide may induce cancer cell death. PMID:20233216
Marsh, Erica E; Chibber, Shani; Wu, Ju; Siegersma, Kendra; Kim, Julie; Bulun, Serdar
2016-04-01
To determine the presence, differential expression, and regulation of epidermal growth factor-containing fibulin-like extracellular matrix protein 1 (EFEMP1) in uterine leiomyomas. Laboratory in vivo and in vitro study with the use of human leiomyoma and myometrial tissue and primary cells. Academic medical center. Leiomyoma and myometrial tissue samples and cultured cells. 5-Aza-2'-deoxycytidine (5-aza-dC) treatment. Fold-change difference between EFEMP1 and fibulin-3 expression in leiomyoma tissue and cells compared with matched myometrial samples, and fold-change difference in EFEMP1 expression with 5-Aza-dC treatment. In vivo, EFEMP1 expression was 3.19-fold higher in myometrial tissue than in leiomyoma tissue. EFEMP1 expression in vitro was 5.03-fold higher in myometrial cells than in leiomyoma cells. Western blot and immunohistochemistry staining of tissue and cells confirmed similar findings in protein expression. Treatment of leiomyoma cells with 5-Aza-dC resulted in increased expression of EFEMP1 in vitro. The EFEMP1 gene and its protein product, fibulin-3, are both significantly down-regulated in leiomyoma compared with myometrium when studied both in vivo and in vitro. The increase in EFEMP1 expression in leiomyoma cells with 5-Aza-dC treatment suggest that differential methylation is responsible, in part, for the differences seen in gene expression. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Papiorek, Sarah; Junker, Robert R; Lunau, Klaus
2014-01-01
Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Directory of Open Access Journals (Sweden)
Sarah Papiorek
Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of
Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst
2013-02-01
Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.
Ebert, Berit; Melle, Christian; Lieckfeldt, Elke; Zöller, Daniela; von Eggeling, Ferdinand; Fisahn, Joachim
2008-08-25
Here, we describe a novel approach for investigating differential protein expression within three epidermal cell types. In particular, 3000 single pavement, basal, and trichome cells from leaves of Arabidopsis thaliana were harvested by glass micro-capillaries. Subsequently, these single cell samples were joined to form pools of 100 individual cells and analyzed using the ProteinChip technology; SELDI: surface-enhanced laser desorption and ionization. As a result, numerous protein signals that were differentially expressed in the three epidermal cell types could be detected. One of these proteins was characterized by tryptical digestion and subsequent identification via tandem quadrupole-time of flight (Q-TOF) mass spectrometry. Down regulation of this sequenced small subunit precursor of ribulose-1,5 bisphosphate carboxylase(C) oxygenase(O) (RuBisCo) in trichome and basal cells indicates the sink status of these cell types that are located on the surface of A. thaliana source leaves. Based on the obtained protein profiles, we suggest a close functional relationship between basal and trichome cells at the protein level.
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion
DEFF Research Database (Denmark)
Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore
2009-01-01
BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...
Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure
2013-12-01
The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.
2014-01-01
Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982
Executive functions and self-regulation.
Hofmann, Wilhelm; Schmeichel, Brandon J; Baddeley, Alan D
2012-03-01
Self-regulation is a core aspect of adaptive human behavior that has been studied, largely in parallel, through the lenses of social and personality psychology as well as cognitive psychology. Here, we argue for more communication between these disciplines and highlight recent research that speaks to their connection. We outline how basic facets of executive functioning (working memory operations, behavioral inhibition, and task-switching) may subserve successful self-regulation. We also argue that temporary reductions in executive functions underlie many of the situational risk factors identified in the social psychological research on self-regulation and review recent evidence that the training of executive functions holds significant potential for improving poor self-regulation in problem populations. Copyright © 2012 Elsevier Ltd. All rights reserved.
STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT
Directory of Open Access Journals (Sweden)
V.F. Zhernosek
2011-01-01
Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.
Grass, G Daniel; Tolliver, Lauren B; Bratoeva, Momka; Toole, Bryan P
2013-09-06
The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777-788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer.
Grass, G. Daniel; Tolliver, Lauren B.; Bratoeva, Momka; Toole, Bryan P.
2013-01-01
The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777–788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer. PMID:23888049
Palmitoylation regulates epidermal homeostasis and hair follicle differentiation.
Directory of Open Access Journals (Sweden)
Pleasantine Mill
2009-11-01
Full Text Available Palmitoylation is a key post-translational modification mediated by a family of DHHC-containing palmitoyl acyl-transferases (PATs. Unlike other lipid modifications, palmitoylation is reversible and thus often regulates dynamic protein interactions. We find that the mouse hair loss mutant, depilated, (dep is due to a single amino acid deletion in the PAT, Zdhhc21, resulting in protein mislocalization and loss of palmitoylation activity. We examined expression of Zdhhc21 protein in skin and find it restricted to specific hair lineages. Loss of Zdhhc21 function results in delayed hair shaft differentiation, at the site of expression of the gene, but also leads to hyperplasia of the interfollicular epidermis (IFE and sebaceous glands, distant from the expression site. The specific delay in follicle differentiation is associated with attenuated anagen propagation and is reflected by decreased levels of Lef1, nuclear beta-catenin, and Foxn1 in hair shaft progenitors. In the thickened basal compartment of mutant IFE, phospho-ERK and cell proliferation are increased, suggesting increased signaling through EGFR or integrin-related receptors, with a parallel reduction in expression of the key differentiation factor Gata3. We show that the Src-family kinase, Fyn, involved in keratinocyte differentiation, is a direct palmitoylation target of Zdhhc21 and is mislocalized in mutant follicles. This study is the first to demonstrate a key role for palmitoylation in regulating developmental signals in mammalian tissue homeostasis.
Regulation of PDGFC signalling and extracellular matrix composition by FREM1 in mice
Directory of Open Access Journals (Sweden)
Fenny Wiradjaja
2013-11-01
Fras1-related extracellular matrix protein 1 (FREM1 is required for epidermal adhesion during embryogenesis, and mice lacking the gene develop fetal skin blisters and a range of other developmental defects. Mutations in members of the FRAS/FREM gene family cause diseases of the Fraser syndrome spectrum. Embryonic epidermal blistering is also observed in mice lacking PdgfC and its receptor, PDGFRα. In this article, we show that FREM1 binds to PDGFC and that this interaction regulates signalling downstream of PDGFRα. Fibroblasts from Frem1-mutant mice respond to PDGFC stimulation, but with a shorter duration and amplitude than do wild-type cells. Significantly, PDGFC-stimulated expression of the metalloproteinase inhibitor Timp1 is reduced in cells with Frem1 mutations, leading to reduced basement membrane collagen I deposition. These results show that the physical interaction of FREM1 with PDGFC can regulate remodelling of the extracellular matrix downstream of PDGFRα. We propose that loss of FREM1 function promotes epidermal blistering in Fraser syndrome as a consequence of reduced PDGFC activity, in addition to its stabilising role in the basement membrane.
Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.
Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar
2012-09-01
Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole
2009-01-01
To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...
Grhl3 and Lmo4 play coordinate roles in epidermal migration.
Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M
2008-09-01
In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.
The epidermal biosynthesis of cholecalciferol (vitamin D3)
International Nuclear Information System (INIS)
Beadle, P.C.
1977-01-01
An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)
Toxic epidermal necrolysis successfully treated with etanercept.
Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio
2009-03-01
Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.
The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.
Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina
2004-12-03
The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.
Directory of Open Access Journals (Sweden)
Kai Kretzschmar
2014-10-01
Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.
The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.
Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J
2014-04-01
Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.
Directory of Open Access Journals (Sweden)
Lasse Henriksen
Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.
Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther
2013-01-01
The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148
Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.
von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J
2017-11-06
The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Helin, K; Velu, T; Martin, P
1991-01-01
mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...
Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.
Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira
2012-03-01
As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.
Real, PJ; Benito, A; Cuevas, J; Berciano, MT; de Juan, A; Coffer, P; Gomez-Roman, J; Lafarga, M; Lopez-Vega, JM; Fernandez-Luna, JL
2005-01-01
Epidermal growth factor receptor-1 (EGFR) and EGFR-2 (HER2) have become major targets for cancer treatment. Blocking antibodies and small-molecule inhibitors are being used to silence the activity of these receptors in different tumors with varying efficacy. Thus, a better knowledge on the signaling
Identification of Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function
2017-09-01
Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function September 2017 x 1Sep2016...31Aug2017 Email: mbirrer@partners.org 6 Identification of Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function xx
Directory of Open Access Journals (Sweden)
Yanase Toshihiko
2010-06-01
Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.
Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats
DEFF Research Database (Denmark)
Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.
2013-01-01
The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...
Epidermal growth factor in alkali-burned corneal epithelial wound healing.
Singh, G; Foster, C S
1987-06-15
We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.
Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.
Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J
2014-01-01
Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.
Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.
2006-01-01
Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these
Role of submandibular saliva and epidermal growth factor in gastric cytoprotection
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1984-01-01
without submandibular glands. Exogenous EGF and saliva with a high but still physiological concentration of EGF significantly reduced the median area in the stomach displaying ulcers and ulcerations, whereas saliva without EGF had no effect. Although EGF is a known inhibitor of gastric acid secretion......The role of submandibular epidermal growth factor in protection of the gastric mucosa was investigated in rats. Removal of the submandibular glands and thereby submandibular epidermal growth factor (EGF) caused rats to develop gastric lesions (ulcerations and ulcers) after administration......, the dose used in the present study had no effect on gastric acid secretion in chronic gastric fistula rats; removal of the submandibular glands also did not have any such effect. We conclude that exocrine secretion of submandibular EGF has a cytoprotective function in the stomach, an effect that may...
Tsai, Yuan-Chin; Chen, Wei-Yu; Siu, Man Kit; Tsai, Hong-Yuan; Yin, Juan Juan; Huang, Jiaoti; Liu, Yen-Nien
2017-01-01
It has been suggested that ETV6 serves as a tumor suppressor; however, its molecular regulation and cellular functions remain unclear. We used prostate cancer as a model system and demonstrated a molecular mechanism in which ETV6 can be regulated by epidermal growth factor receptor (EGFR) signaling through microRNA-96 (miR-96)-mediated downregulation. In addition, EGFR acts as a transcriptional coactivator that binds to the promoter of primary miR-96 and transcriptionally regulates miR-96 levels. We analyzed two sets of clinical prostate cancer samples, confirmed association patterns that were consistent with the EGFR-miR-96-ETV6 signaling model and demonstrated that the reduced ETV6 levels were associated with malignant prostate cancer. Based on results derived from multiple approaches, we identified the biological functions of ETV6 as a tumor suppressor that inhibits proliferation and metastasis in prostate cancer. We present a molecular mechanism in which EGFR activation leads to the induction of miR-96 expression and suppression of ETV6, which contributes to prostate cancer progression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Voldborg, B R; Damstrup, L; Spang-Thomsen, M
1997-01-01
The epidermal growth factor receptor (EGFR) is a growth factor receptor that induces cell differentiation and proliferation upon activation through the binding of one of its ligands. The receptor is located at the cell surface, where the binding of a ligand activates a tyrosine kinase in the intr...... aspects of therapeutic targeting of EGFR....
Epidermal growth factor in the rat prostate
DEFF Research Database (Denmark)
Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier
1998-01-01
Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....
Directory of Open Access Journals (Sweden)
Callihan Phillip
2008-12-01
Full Text Available Abstract Background Lysophospholipids regulate the morphology and growth of neurons, neural cell lines, and neural progenitors. A stable human neural progenitor cell line is not currently available in which to study the role of lysophospholipids in human neural development. We recently established a stable, adherent human embryonic stem cell-derived neuroepithelial (hES-NEP cell line which recapitulates morphological and phenotypic features of neural progenitor cells isolated from fetal tissue. The goal of this study was to determine if hES-NEP cells express functional lysophospholipid receptors, and if activation of these receptors mediates cellular responses critical for neural development. Results Our results demonstrate that Lysophosphatidic Acid (LPA and Sphingosine-1-phosphate (S1P receptors are functionally expressed in hES-NEP cells and are coupled to multiple cellular signaling pathways. We have shown that transcript levels for S1P1 receptor increased significantly in the transition from embryonic stem cell to hES-NEP. hES-NEP cells express LPA and S1P receptors coupled to Gi/o G-proteins that inhibit adenylyl cyclase and to Gq-like phospholipase C activity. LPA and S1P also induce p44/42 ERK MAP kinase phosphorylation in these cells and stimulate cell proliferation via Gi/o coupled receptors in an Epidermal Growth Factor Receptor (EGFR- and ERK-dependent pathway. In contrast, LPA and S1P stimulate transient cell rounding and aggregation that is independent of EGFR and ERK, but dependent on the Rho effector p160 ROCK. Conclusion Thus, lysophospholipids regulate neural progenitor growth and morphology through distinct mechanisms. These findings establish human ES cell-derived NEP cells as a model system for studying the role of lysophospholipids in neural progenitors.
Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal
Directory of Open Access Journals (Sweden)
Kynan T. Lawlor
2015-11-01
Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.
Effects of epidermal growth factor on neural crest cells in tissue culture
International Nuclear Information System (INIS)
Erickson, C.A.; Turley, E.A.
1987-01-01
Epidermal growth factor (EGF) stimulates the release of hyaluronic acid (HA) and chondroitin sulfate proteoglycan (CSPG) from quail trunk neural crest cultures in a dose-dependent fashion. It also promotes the expression of cell-associated heparan sulfate proteoglycan (HSPG) as detected by immunofluorescence and immunoprecipitation of the 3 H-labeled proteoglycan. Furthermore, EGF stimulates [ 3 H]thymidine incorporation into total cell DNA. These results raise the possibility that EGF or an analogous growth factor is involved in regulation of neural crest cell morphogenesis
Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report
International Nuclear Information System (INIS)
Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub
2006-01-01
Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.
Directory of Open Access Journals (Sweden)
Aleksandra Piwko-Czuchra
Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.
Immune sensitization against epidermal antigens in polymorphous light eruption
International Nuclear Information System (INIS)
Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.
1991-01-01
To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption
Prinsi, B.; Negri, A.S.; Quattrocchio, F.; Koes, R.E.; Espen, L.
2016-01-01
The Petunia hybrida ANTHOCYANIN1 (AN1) gene encodes a transcription factor that regulates both the expression of genes involved in anthocyanin synthesis and the acidification of the vacuolar lumen in corolla epidermal cells. In this work, the comparison between the red flowers of the R27 line with
Immunohistochemical localization of epidermal growth factor in rat and man
DEFF Research Database (Denmark)
Poulsen, Steen Seier; Nexø, Ebba
1986-01-01
Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...
Post-female-circumcision clitoral epidermal inclusion cyst: a case ...
African Journals Online (AJOL)
Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.
DEFF Research Database (Denmark)
Juhl, C O; Vinter-Jensen, Lars; Poulsen, Steen Seier
1995-01-01
Epidermal growth factor (EGF) is an important factor for maintaining the esophageal functional integrity. Goettingen minipigs were treated with either placebo or subcutaneous EGF (30 micrograms/kg/day) for four weeks. Wistar rats were treated with either placebo or subcutaneous EGF (150 microgram...
Regulated functions and integrability
Directory of Open Access Journals (Sweden)
Ján Gunčaga
2009-04-01
Full Text Available Properties of functions defined on a bounded closed interval, weaker than continuity, have been considered by many mathematicians. Functions having both sides limits at each point are called regulated and were considered by J. Dieudonné [2], D. Fraňková [3] and others (see for example S. Banach [1], S. Saks [8]. The main class of functions we deal with consists of piece-wise constant ones. These functions play a fundamental role in the integration theory which had been developed by Igor Kluvanek (see Š. Tkacik [9]. We present an outline of this theory.
Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina
2005-01-01
The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.
Zhang, Hui-ming; Talbot, Mark J.; McCurdy, David W.; Patrick, John W.; Offler, Christina E.
2015-01-01
Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca2+ levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane–microtubule inter-relationship is discussed. PMID:26136268
"Cut-and-paste" manufacture of multiparametric epidermal electronic systems
Lu, Nanshu; Yang, Shixuan; Wang, Pulin
2016-05-01
Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.
Foliar Epidermal Studies of Plants in Euphorbiaceae
Directory of Open Access Journals (Sweden)
H. A. Thakur
2014-03-01
Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.
Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.
Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der
2003-01-01
The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol
TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.
Directory of Open Access Journals (Sweden)
Aurélie Hayez
Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.
Perdigoto, Carolina N; Bardot, Evan S; Valdes, Victor J; Santoriello, Francis J; Ezhkova, Elena
2014-12-01
Merkel cell-neurite complexes are located in touch-sensitive areas of the mammalian skin and are involved in recognition of the texture and shape of objects. Merkel cells are essential for these tactile discriminations, as they generate action potentials in response to touch stimuli and induce the firing of innervating afferent nerves. It has been shown that Merkel cells originate from epidermal stem cells, but the cellular and molecular mechanisms of their development are largely unknown. In this study, we analyzed Merkel cell differentiation during development and found that it is a temporally regulated maturation process characterized by a sequential activation of Merkel cell-specific genes. We uncovered key transcription factors controlling this process and showed that the transcription factor Atoh1 is required for initial Merkel cell specification. The subsequent maturation steps of Merkel cell differentiation are controlled by cooperative function of the transcription factors Sox2 and Isl1, which physically interact and work to sustain Atoh1 expression. These findings reveal the presence of a robust transcriptional network required to produce functional Merkel cells that are required for tactile discrimination. © 2014. Published by The Company of Biologists Ltd.
[Regulation on EGFR function via its interacting proteins and its potential application].
Zheng, Jun-Fang; Chen, Hui-Min; He, Jun-Qi
2013-12-01
Epidermal growth factor receptor (EGFR) is imptortant for cell activities, oncogenesis and cell migration, and EGFR inhibitor can treat cancer efficiently, but its side effects, for example, in skin, limited its usage. On the other hand, EGFR interacting proteins may also lead to oncogenesis and its interacting protein as drug targets can avoid cutaneous side effect, which implies possibly a better outcome and life quality of cancer patients. For the multiple EGFR interaction proteins, B1R enhances Erk/MAPK signaling, while PTPN12, Kek1, CEACAM1 and NHERF repress Erk/MAPK signaling. CaM may alter charge of EGFR juxamembrane domain and regulate activation of PI3K/Akt and PLC-gamma/PKC. STAT1, STAT5b are widely thought to be activated by EGFR, while there is unexpectedly inhibiting sequence within EGFR to repress the activity of STATs. LRIG1 and ACK1 enhance the internalization and degration of EGFR, while NHERF and HIP1 repress it. In this article, proteins interacting with EGFR, their interacting sites and their regulation on EGFR signal transduction will be reviewed.
Zhang, Hui-ming; Talbot, Mark J; McCurdy, David W; Patrick, John W; Offler, Christina E
2015-09-01
Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca(2+) levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane-microtubule inter-relationship is discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C
2013-06-01
In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Biochemistry of epidermal stem cells.
Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace
2013-02-01
The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Biochemistry of epidermal stem cells☆
Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace
2014-01-01
Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019
Evolution of dinosaur epidermal structures.
Barrett, Paul M; Evans, David C; Campione, Nicolás E
2015-06-01
Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Directory of Open Access Journals (Sweden)
Susan John
Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.
Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.
Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F
2005-09-15
Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.
Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A
2013-09-07
Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Fabian V Filipp
2013-01-01
Pyruvate kinase activity is controlled by a tightly woven regulatory network. The oncofetal isoform of pyruvate kinase (PKM2) is a master regulator of cancer metabolism. PKM2 engages in parallel, feed-forward, positive and negative feedback control contributing to cancer progression. Besides its metabolic role, non-metabolic functions of PKM2 as protein kinase and transcriptional coactivator for c-MYC and hypoxia-inducible factor 1-alpha are essential for epidermal growth factor receptor acti...
Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes
International Nuclear Information System (INIS)
Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira
1997-01-01
Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding
Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.
Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un
2008-09-01
Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.
miRNA-mediated functional changes through co-regulating function related genes.
Directory of Open Access Journals (Sweden)
Jie He
Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.
Directory of Open Access Journals (Sweden)
Yue Li
2017-05-01
Full Text Available Cell-based therapy is a promising strategy for the repair of peripheral nerve injuries (PNIs. epidermal neural crest stems cells (EPI-NCSCs are thought to be important donor cells for repairing PNI in different animal models. Following PNI, inflammatory response is important to regulate the repair process. However, the effects of EPI-NCSCs on regulation of local inflammation microenviroment have not been investigated extensively. In the present study, these effects were studied by using 10 mm defected sciatic nerve, which was bridged with 15 mm artificial nerve composed of EPI-NCSCs, extracellular matrix (ECM and poly (lactide-co-glycolide (PLGA. Then the expression of pro- and anti-inflammatory cytokines, polarization of macrophages, regulation of fibroblasts and shwann cells (SCs were assessed by western blot, immunohistochemistry, immunofluorescence staining at 1, 3, 7 and 21 days after bridging. The structure and the function of the bridged nerve were determined by observation under light microscope and by examination of right lateral foot retraction time (LFRT, sciatic function index (SFI, gastrocnemius wet weight and electrophysiology at 9 weeks. After bridging with EPI-NCSCs, the expression of anti-inflammatory cytokines (IL-4 and IL-13 was increased, but decreased for pro-inflammatory cytokines (IL-6 and TNF-α compared to the control bridging, which was consistent with increase of M2 macrophages and decrease of M1 macrophages at 7 days after transplantation. Likewise, myelin-formed SCs were significantly increased, but decreased for the activated fibroblasts in their number at 21 days. The recovery of structure and function of nerve bridged with EPI-NCSCs was significantly superior to that of DMEM. These results indicated that EPI-NCSCs could be able to regulate and provide more suitable inflammation microenvironment for the repair of defected sciatic nerve.
Guthrie, O'neil W
2015-10-01
Xeroderma pigmentosum-A (XPA) is a C4-type zinc-finger scaffolding protein that regulates the removal of bulky-helix distorting DNA damage products from the genome. Phosphorylation of serine residues within the XPA protein is associated with improved protection of genomic DNA and cell death resistance. Therefore, kinase signaling is one important mechanism for regulating the protective function of XPA. Previous experiments have shown that spiral ganglion neurons (SGNs) may mobilize XPA as a general stress response to chemical and physical ototoxicants. Therapeutic optimization of XPA via kinase signaling could serve as a means to improve DNA repair capacity within neurons following injury. The kinase signaling activity of the epidermal growth factor receptor (EGFR) has been shown in tumor cell lines to increase the repair of DNA damage products that are primarily repaired by XPA. Such observations suggest that EGFR may regulate the protective function of XPA. However, it is not known whether SGNs in particular or neurons in general could co-express XPA and EGFR. In the current study gene and protein expression of XPA and EGFR were determined from cochlear homogenates. Immunofluorescence assays were then employed to localize neurons expressing both EGFR and XPA within the ganglion. This work was then confirmed with double-immunohistochemistry. Rosenthal's canal served as the reference space in these experiments and design-based stereology was employed in first-order stereology quantification of immunoreactive neurons. The results confirmed that a population of SGNs that constitutively express XPA may also express the EGFR. These results provide the basis for future experiments designed to therapeutically manipulate the EGFR in order to regulate XPA activity and restore gene function in neurons following DNA damage. Copyright © 2015 Elsevier GmbH. All rights reserved.
Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis
Directory of Open Access Journals (Sweden)
Kazuhiko Arima
2015-01-01
Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2001-01-01
...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Palazzo, E; Kellett, M; Cataisson, C; Gormley, A; Bible, P W; Pietroni, V; Radoja, N; Hwang, J; Blumenberg, M; Yuspa, S H; Morasso, M I
2016-06-16
Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinguished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis.
Optimal allocation of leaf epidermal area for gas exchange
de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.
2016-01-01
Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...
Energy Technology Data Exchange (ETDEWEB)
Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)
2016-07-08
Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2003-01-01
...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong
2016-12-01
: Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
International Nuclear Information System (INIS)
Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-01-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
Energy Technology Data Exchange (ETDEWEB)
Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-07-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.
Shavenbaby couples patterning to epidermal cell shape control.
Directory of Open Access Journals (Sweden)
Hélène Chanut-Delalande
2006-09-01
Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.
Van Moerkercke, A.; Galván-Ampudia, C.S.; Verdonk, J.C.; Haring, M.A.; Schuurink, R.C.
2012-01-01
In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds
Directory of Open Access Journals (Sweden)
Kyounghwan Lee
2015-04-01
Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.
Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei
2016-02-01
Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor
Possible role of epidermal keratinocytes in the construction of acupuncture meridians.
Denda, Mitsuhiro; Tsutsumi, Moe
2014-04-01
Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.
Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells
International Nuclear Information System (INIS)
Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui
2008-01-01
Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis
CO2 sensing and CO2 regulation of stomatal conductance: advances and open questions
Engineer, Cawas; Hashimoto-Sugimoto, Mimi; Negi, Juntaro; Israelsson-Nordstrom, Maria; Azoulay-Shemer, Tamar; Rappel, Wouter-Jan; Iba, Koh; Schroeder, Julian
2015-01-01
Guard cells form epidermal stomatal gas exchange valves in plants and regulate the aperture of stomatal pores in response to changes in the carbon dioxide (CO2) concentration in leaves. Moreover, the development of stomata is repressed by elevated CO2 in diverse plant species. Evidence suggests that plants can sense CO2 concentration changes via guard cells and via mesophyll tissues in mediating stomatal movements. We review new discoveries and open questions on mechanisms mediating CO2-regulated stomatal movements and CO2 modulation of stomatal development, which together function in CO2-regulation of stomatal conductance and gas exchange in plants. Research in this area is timely in light of the necessity of selecting and developing crop cultivars which perform better in a shifting climate. PMID:26482956
Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.
Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K
2011-10-01
Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.
Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks
Directory of Open Access Journals (Sweden)
Sang Wha Kim
2014-03-01
Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.
A novel role of RASSF9 in maintaining epidermal homeostasis.
Directory of Open Access Journals (Sweden)
Chiou-Mei Lee
Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.
Growth regulation in X-irradiated mouse skin
International Nuclear Information System (INIS)
Elgjo, K.; Devik, F.
1978-01-01
Extracts of hairless mouse skin were tested for their content of epidermal G 1 inhibitor and G 2 inhibitor at daily intervals after X-irradiation with 4 500 or 2 250 rad. After either dose the skin extracts lacked G 1 inhibitory activity on days 5 and 6 respectively after irradiation. This coincided with the time when the epidermal mitotic rate again became normal and started a period of over-shoot. The time interval of 5 to 6 days corresponds to the turnover time of the differentiating cells in hairless mouse back epidermis. The findings indicate that the proliferating cells in epidermis can respond to changes in local chalone concentration, even after X-irradiation at the tested doses, and that the irradiated epidermal cell population still retains some important properties inherent in a cybernetically regulated system. The local G 2 -inhibitory activity also varied after irradiation, but these variations could not be directly related to the corresponding mitotic rates. (author)
Interrelationship of brain-functions with cardiovascular regulations
International Nuclear Information System (INIS)
Rahman, M.K.
1993-03-01
Neurotransmitters and neuropeptides are involved in the regulation of nervous function, behaviour, emotion, sex, sleep, mood of higher animals including the humans. They act and they occur simultaneously in the brain as neurotransmitters or neuromodulators and in plasma as circulating hormones. The direct regulatory interactions of a given substance in the blood and in the brain are still unknown, but some results have already been published regarding these relationships. The present paper briefly describes the systematic review-type studies on the interrelationship of the brain functions and the cardiovascular regulation. 35 refs, 7 figs, 1 tab
The influence of tethered epidermal growth factor on connective tissue progenitor colony formation
Marcantonio, Nicholas A.; Boehm, Cynthia A.; Rozic, Richard J.; Au, Ada; Wells, Alan; Muschler, George F.; Griffith, Linda G.
2009-01-01
Strategies to combine aspirated marrow cells with scaffolds to treat connective tissue defects are gaining increasing clinical attention and use. In situations such as large defects where initial survival and proliferation of transplanted connective tissue progenitors (CTPs) are limiting, therapeutic outcomes might be improved by using the scaffold to deliver growth factors that promote the early stages of cell function in the graft. Signaling by the epidermal growth factor receptor (EGFR) pl...
Barbieri, M Alejandro; Kong, Chen; Chen, Pin-I; Horazdovsky, Bruce F; Stahl, Philip D
2003-08-22
Activated epidermal growth factor receptors (EGFRs) recruit intracellular proteins that mediate receptor signaling and endocytic trafficking. Rin1, a multifunctional protein, has been shown to regulate EGFR internalization (1). Here we show that EGF stimulation induces a specific, rapid, and transient membrane recruitment of Rin1 and that recruitment is dependent on the Src homology 2 (SH2) domain of Rin1. Immunoprecipitation of EGFR is accompanied by co-immunoprecipitation of Rin1 in a time- and ligand-dependent manner. Association of Rin1 and specifically the SH2 domain of Rin1 with the EGFR was dependent on tyrosine phosphorylation of the intracellular domain of the EGFR. The recruitment of Rin1, observed by light microscopy, indicated that although initially cytosolic, Rin1 was recruited to both plasma membrane and endosomes following EGF addition. Moreover, the expression of the SH2 domain of Rin1 substantially impaired the internalization of EGF without affecting internalization of transferrin. Finally, we found that Rin1 co-immunoprecipitated with a number of tyrosine kinase receptors but not with cargo endocytic receptors. These results indicate that Rin1 provides a link via its SH2 domain between activated tyrosine kinase receptors and the endocytic pathway through the recruitment and activation of Rab5a.
Inhibition of epidermal cell proliferation by borderline rays
Energy Technology Data Exchange (ETDEWEB)
Born, W [Freiburg Univ.; Daikeler, G
1976-08-01
Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.
Stewart, Teneale A; Azimi, Iman; Thompson, Erik W; Roberts-Thomson, Sarah J; Monteith, Gregory R
2015-03-13
Epithelial-mesenchymal transition (EMT), a process implicated in cancer metastasis, is associated with the transcriptional regulation of members of the ATP-binding cassette superfamily of efflux pumps, and drug resistance in breast cancer cells. Epidermal growth factor (EGF)-induced EMT in MDA-MB-468 breast cancer cells is calcium signal dependent. In this study induction of EMT was shown to result in the transcriptional up-regulation of ATP-binding cassette, subfamily C, member 3 (ABCC3), a member of the ABC transporter superfamily, which has a recognized role in multidrug resistance. Buffering of cytosolic free calcium inhibited EGF-mediated ABCC3 increases, indicating a calcium-dependent mode of regulation. Silencing of TRPM7 (an ion channel involved in EMT associated vimentin induction) did not inhibit ABCC3 up-regulation. Silencing of the store operated calcium entry (SOCE) pathway components ORAI1 and STIM1 also did not alter ABCC3 induction by EGF. However, the calcium permeable ion channel transient receptor potential cation channel, subfamily C, member 1 (TRPC1) appears to contribute to the regulation of both basal and EGF-induced ABCC3 mRNA. Improved understanding of the relationship between calcium signaling, EMT and the regulation of genes important in therapeutic resistance may help identify novel therapeutic targets for breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.
Lipids in the cell: organisation regulates function.
Santos, Ana L; Preta, Giulio
2018-06-01
Lipids are fundamental building blocks of all cells and play important roles in the pathogenesis of different diseases, including inflammation, autoimmune disease, cancer, and neurodegeneration. The lipid composition of different organelles can vary substantially from cell to cell, but increasing evidence demonstrates that lipids become organised specifically in each compartment, and this organisation is essential for regulating cell function. For example, lipid microdomains in the plasma membrane, known as lipid rafts, are platforms for concentrating protein receptors and can influence intra-cellular signalling. Lipid organisation is tightly regulated and can be observed across different model organisms, including bacteria, yeast, Drosophila, and Caenorhabditis elegans, suggesting that lipid organisation is evolutionarily conserved. In this review, we summarise the importance and function of specific lipid domains in main cellular organelles and discuss recent advances that investigate how these specific and highly regulated structures contribute to diverse biological processes.
Giant epidermal inclusion cyst in the male breast: A case report
Energy Technology Data Exchange (ETDEWEB)
KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)
2017-03-15
Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.
Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.
Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira
2014-02-01
We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
What Health-Related Functions Are Regulated by the Nervous System?
... What health-related functions are regulated by the nervous system? The nervous system plays a role in nearly every aspect of ... feeling emotions. Functions that are regulated by the nervous system include (but are not limited to): Brain growth ...
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
Directory of Open Access Journals (Sweden)
Oksana Tuchina
Full Text Available Crustaceans have successfully adapted to a variety of environments including fresh- and saltwater as well as land. Transition from an aquatic to a terrestrial lifestyle required adaptations of the sensory equipment of an animal, particularly in olfaction, where the stimulus itself changes from hydrophilic to mainly hydrophobic, air-borne molecules. Hermit crabs Coenobita spp. (Anomura, Coenobitidae have adapted to a fully terrestrial lifestyle as adults and have been shown to rely on olfaction in order to detect distant food items. We observed that the specialized olfactory sensilla in Coenobita, named aesthetascs, are immersed in a layer of mucous-like substance. We hypothesized that the mucous is produced by antennal glands and affects functioning of the aesthetascs. Using various microscopic and histochemical techniques we proved that the mucous is produced by aesthetasc-associated epidermal glands, which we consider to be modified rosette-type aesthetasc tegumental glands known from aquatic decapods. These epidermal glands in Coenobita are multicellular exocrine organs of the recto-canal type with tubulo-acinar arrangement of the secretory cells. Two distinct populations of secretory cells were clearly distinguishable with light and electron microscopy. At least part of the secretory cells contains specific enzymes, CUB-serine proteases, which are likely to be secreted on the surface of the aesthetasc pad and take part in antimicrobial defense. Proteomic analysis of the glandular tissue corroborates the idea that the secretions of the aesthetasc-associated epidermal glands are involved in immune responses. We propose that the mucous covering the aesthetascs in Coenobita takes part in antimicrobial defense and at the same time provides the moisture essential for odor perception in terrestrial hermit crabs. We conclude that the morphological modifications of the aesthetasc-associated epidermal glands as well as the functional characteristics
International Nuclear Information System (INIS)
Chabot, J.G.; Walker, P.; Pelletier, G.
1987-01-01
The distribution of epidermal growth factor (EGF) receptors was studied in the pancreas using light microscopic autoradiography, which was performed at different time intervals (2-60 min) after injecting 125 I-labeled EGF intravenously into the adult rat. In the exocrine pancreas, a labeling was found to occur over the pyramidal cells of the acini and cells lining the intercalated ducts. Moreover, substantial binding of EGF to cells of the islets of Langerhans was also revealed. At the 2-min time interval, most silver grains were found at the periphery of the target cells. The localization, as well as the diminution of silver grains over the cytoplasm of these cells, between 7 and 60 min, suggested the internalization and degradation of 125 I-labeled EGF. Control experiments indicated that the autoradiography reaction was due to specific interaction of 125 I-labeled EGF with its receptor. These results clearly indicate that EGF receptors are present in the acinar cells and the cells of intercalated ducts of the exocrine pancreas, as well as the cells of the endocrine pancreas. Finding that there are EGF binding sites in pancreatic acinar cells supports the physiological role of EGF in the regulation of pancreatic exocrine function. The presence of EGF receptors in cells of the islets of Langerhans suggests that EGF may play a role in the regulation of the endocrine pancreas
Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration
Directory of Open Access Journals (Sweden)
Jinyang Wang
2018-05-01
Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.
cFLIP Regulates Skin Homeostasis and Protects against TNF-Induced Keratinocyte Apoptosis
Directory of Open Access Journals (Sweden)
Diana Panayotova-Dimitrova
2013-10-01
Full Text Available FADD, caspase-8, and cFLIP regulate the outcome of cell death signaling. Mice that constitutively lack these molecules die at an early embryonic age, whereas tissue-specific constitutive deletion of FADD or caspase-8 results in inflammatory skin disease caused by increased necroptosis. The function of cFLIP in the skin in vivo is unknown. In contrast to tissue-specific caspase-8 knockout, we show that mice constitutively lacking cFLIP in the epidermis die around embryonic days 10 and 11. When cFLIP expression was abrogated in adult skin of cFLIPfl/fl-K14CreERtam mice, severe inflammation of the skin with concomitant caspase activation and apoptotic, but not necroptotic, cell death developed. Apoptosis was dependent of autocrine tumor necrosis factor production triggered by loss of cFLIP. In addition, epidermal cFLIP protein was lost in patients with severe drug reactions associated with epidermal apoptosis. Our data demonstrate the importance of cFLIP for the integrity of the epidermis and for silencing of spontaneous skin inflammation.
Directory of Open Access Journals (Sweden)
Rania Hassan Mohamed
Full Text Available Dendritic epidermal T cells, which express an invariant Vγ5Vδ1 T-cell receptor and account for 95% of all resident T cells in the mouse epidermis, play a critical role in skin immune surveillance. These γδ T cells are generated by positive selection in the fetal thymus, after which they migrate to the skin. The development of dendritic epidermal T cells is critically dependent on the Skint1 gene expressed specifically in keratinocytes and thymic epithelial cells, suggesting an indispensable role for Skint1 in the selection machinery for specific intraepithelial lymphocytes. Phylogenetically, rodents have functional SKINT1 molecules, but humans and chimpanzees have a SKINT1-like (SKINT1L gene with multiple inactivating mutations. In the present study, we analyzed SKINT1L sequences in representative primate species and found that all hominoid species have a common inactivating mutation, but that Old World monkeys such as olive baboons, green monkeys, cynomolgus macaques and rhesus macaques have apparently functional SKINT1L sequences, indicating that SKINT1L was inactivated in a common ancestor of hominoids. Interestingly, the epidermis of cynomolgus macaques contained a population of dendritic-shaped γδ T cells expressing a semi-invariant Vγ10/Vδ1 T-cell receptor. However, this population of macaque T cells differed from rodent dendritic epidermal T cells in that their Vγ10/Vδ1 T-cell receptors displayed junctional diversity and expression of Vγ10 was not epidermis-specific. Therefore, macaques do not appear to have rodent-type dendritic epidermal T cells despite having apparently functional SKINT1L. Comprehensive bioinformatics analysis indicates that SKINT1L emerged in an ancestor of placental mammals but was inactivated or lost multiple times in mammalian evolution and that Skint1 arose by gene duplication in a rodent lineage, suggesting that authentic dendritic epidermal T cells are presumably unique to rodents.
Hughes, Sheryl O; Power, Thomas G; O'Connor, Teresia M; Orlet Fisher, Jennifer
2015-06-01
The purpose of the present study was to examine relationships between child eating self-regulation, child non-eating self-regulation, and child BMIz in a low-income sample of Hispanic families with preschoolers. The eating in the absence of hunger task as well as parent-report of child satiety responsiveness and food responsiveness were used to assess child eating self-regulation. Two laboratory tasks assessing executive functioning, a parent questionnaire assessing child effortful control (a temperament dimension related to executive functioning), and the delay of gratification and gift delay tasks assessing child emotion regulation were used to assess child non-eating self-regulation. Bivariate correlations were run among all variables in the study. Hierarchical linear regression analyses assessed: (1) child eating self-regulation associations with the demographic, executive functioning, effortful control, and emotion regulation measures; and (2) child BMI z-score associations with executive functioning, effortful control, emotion regulation measures, and eating self-regulation measures. Within child eating self-regulation, only the two parent-report measures were related. Low to moderate positive correlations were found between measures of executive functioning, effortful control, and emotion regulation. Only three relationships were found between child eating self-regulation and other forms of child self-regulation: eating in the absence of hunger was positively associated with delay of gratification, and poor regulation on the gift delay task was associated positively with maternal reports of food responsiveness and negatively with parent-reports of satiety responsiveness. Regression analyses showed that child eating self-regulation was associated with child BMIz but other forms of child self-regulation were not. Implications for understanding the role of self-regulation in the development of child obesity are discussed. Copyright © 2015 Elsevier Ltd. All
EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...
African Journals Online (AJOL)
Administrator
stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...
The Relationship Between Emotion Regulation, Executive Functioning, and Aggressive Behaviors.
Holley, Sarah R; Ewing, Scott T; Stiver, Jordan T; Bloch, Lian
2015-06-30
Emotion regulation deficits and executive functioning deficits have independently been shown to increase vulnerability toward engaging in aggressive behaviors. The effects of these risk factors, however, have not been evaluated in relation to one another. This study evaluated the degree to which each was associated with aggressive behaviors in a sample of 168 undergraduate students. Executive functioning (cognitive inhibition and mental flexibility) was assessed with a Stroop-like neuropsychological task. Emotion regulation and aggressive behaviors were assessed via self-report inventories. Results showed main effects for both emotion regulation and executive functioning, as well as a significant interaction, indicating that those who scored lowest in both domains reported engaging in aggressive behaviors the most frequently. When different types of aggression were examined, this interaction was only significant for acts of physical aggression, not for acts of verbal aggression. Therefore, for physical aggression, emotion regulation and executive functioning exerted a moderating effect on one another. The implications are that, at least for acts of physical aggression, relatively strong capabilities in either domain may buffer against tendencies to engage in aggressive behaviors. Thus, both emotion regulation skills and executive functioning abilities may be valuable targets for interventions aiming to reduce aggressive behaviors. © The Author(s) 2015.
Ben-Tov, Daniela; Idan-Molakandov, Anat; Hugger, Anat; Ben-Shlush, Ilan; Günl, Markus; Yang, Bo; Usadel, Björn; Harpaz-Saad, Smadar
2018-05-01
The production of hydrophilic mucilage along the course of seed coat epidermal cell differentiation is a common adaptation in angiosperms. Previous studies have identified COBRA-LIKE 2 (COBL2), a member of the COBRA-LIKE gene family, as a novel component required for crystalline cellulose deposition in seed coat epidermal cells. In recent years, Arabidopsis seed coat epidermal cells (SCEs), also called mucilage secretory cells, have emerged as a powerful model system for the study of plant cell wall components biosynthesis, secretion, assembly and de muro modification. Despite accumulating data, the molecular mechanism of COBL function remains largely unknown. In the current research, we utilized genetic interactions to study the role of COBL2 as part of the protein network required for seed mucilage production. Using correlative phenotyping of structural and biochemical characteristics, unique features of the cobl2 extruded mucilage are revealed, including: 'unraveled' ray morphology, loss of primary cell wall 'pyramidal' organization, reduced Ruthenium red staining intensity of the adherent mucilage layer, and increased levels of the monosaccharides arabinose and galactose. Examination of the cobl2cesa5 double mutant provides insight into the interface between COBL function and cellulose deposition. Additionally, genetic interactions between cobl2 and fei1fei2 as well as between each of these mutants to mucilage-modified 2 (mum2) suggest that COBL2 functions independently of the FEI-SOS pathway. Altogether, the presented data place COBL2 within the complex protein network required for cell wall deposition in the context of seed mucilage and introduce new methodology expending the seed mucilage phenotyping toolbox. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics
Henrique Silva; Sara Aguiar Silva; Hugo Ferreira; L. Monteiro Rodrigues
2015-01-01
Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu). The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young ad...
Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome
International Nuclear Information System (INIS)
Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.
1997-01-01
Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures
Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases
Energy Technology Data Exchange (ETDEWEB)
Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)
2007-08-15
We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.
Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases
International Nuclear Information System (INIS)
Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran
2007-01-01
We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation
Lasp-1 regulates podosome function.
Directory of Open Access Journals (Sweden)
Miriam Stölting
Full Text Available Eukaryotic cells form a variety of adhesive structures to connect with their environment and to regulate cell motility. In contrast to classical focal adhesions, podosomes, highly dynamic structures of different cell types, are actively engaged in matrix remodelling and degradation. Podosomes are composed of an actin-rich core region surrounded by a ring-like structure containing signalling molecules, motor proteins as well as cytoskeleton-associated proteins. Lasp-1 is a ubiquitously expressed, actin-binding protein that is known to regulate cytoskeleton architecture and cell migration. This multidomain protein is predominantely present at focal adhesions, however, a second pool of Lasp-1 molecules is also found at lamellipodia and vesicle-like microdomains in the cytosol.In this report, we show that Lasp-1 is a novel component and regulator of podosomes. Immunofluorescence studies reveal a localization of Lasp-1 in the podosome ring structure, where it colocalizes with zyxin and vinculin. Life cell imaging experiments demonstrate that Lasp-1 is recruited in early steps of podosome assembly. A siRNA-mediated Lasp-1 knockdown in human macrophages affects podosome dynamics as well as their matrix degradation capacity. In summary, our data indicate that Lasp-1 is a novel component of podosomes and is involved in the regulation of podosomal function.
Epidermal growth factor in mammary glands and milk from rats
DEFF Research Database (Denmark)
Thulesen, J; Raaberg, Lasse; Nexø, Ebba
1993-01-01
Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...
Syndecan-2 regulates melanin synthesis via protein kinase C βII-mediated tyrosinase activation.
Jung, Hyejung; Chung, Heesung; Chang, Sung Eun; Choi, Sora; Han, Inn-Oc; Kang, Duk-Hee; Oh, Eok-Soo
2014-05-01
Syndecan-2, a transmembrane heparan sulfate proteoglycan that is highly expressed in melanoma cells, regulates melanoma cell functions (e.g. migration). Since melanoma is a malignant tumor of melanocytes, which largely function to synthesize melanin, we investigated the possible involvement of syndecan-2 in melanogenesis. Syndecan-2 expression was increased in human skin melanoma tissues compared with normal skin. In both mouse and human melanoma cells, siRNA-mediated knockdown of syndecan-2 was associated with reduced melanin synthesis, whereas overexpression of syndecan-2 increased melanin synthesis. Similar effects were also detected in human primary epidermal melanocytes. Syndecan-2 expression did not affect the expression of tyrosinase, a key enzyme in melanin synthesis, but instead enhanced the enzymatic activity of tyrosinase by increasing the membrane and melanosome localization of its regulator, protein kinase CβII. Furthermore, UVB caused increased syndecan-2 expression, and this up-regulation of syndecan-2 was required for UVB-induced melanin synthesis. Taken together, these data suggest that syndecan-2 regulates melanin synthesis and could be a potential therapeutic target for treating melanin-associated diseases. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Toxic epidermal necrolysis and Stevens-Johnson syndrome
Directory of Open Access Journals (Sweden)
French Lars E
2010-12-01
Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis
A review of toxic epidermal necrolysis management in Japan
Directory of Open Access Journals (Sweden)
Yuri Kinoshita
2017-01-01
Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.
Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...
African Journals Online (AJOL)
REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.
Longitudinal Associations among Child Maltreatment, Social Functioning, and Cortisol Regulation
Alink, Lenneke R. A.; Cicchetti, Dante; Kim, Jungmeen; Rogosch, Fred A.
2012-01-01
Child maltreatment increases the risk for impaired social functioning and cortisol regulation. However, the longitudinal interplay among these factors is still unclear. This study aimed to shed light on the effect of maltreatment on social functioning and cortisol regulation over time. The sample consisted of 236 children (mean age 7.64 years, SD…
Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis
Directory of Open Access Journals (Sweden)
Hugo Nodarse-Cuní
2013-03-01
Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.
Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B
2013-08-20
At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.
FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...
African Journals Online (AJOL)
Administrator
alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...
Stevens Johnsons syndrom og toksisk epidermal nekrolyse
DEFF Research Database (Denmark)
Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis
2013-01-01
Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...
Redox Regulation of Mitochondrial Function
Handy, Diane E.
2012-01-01
Abstract Redox-dependent processes influence most cellular functions, such as differentiation, proliferation, and apoptosis. Mitochondria are at the center of these processes, as mitochondria both generate reactive oxygen species (ROS) that drive redox-sensitive events and respond to ROS-mediated changes in the cellular redox state. In this review, we examine the regulation of cellular ROS, their modes of production and removal, and the redox-sensitive targets that are modified by their flux. In particular, we focus on the actions of redox-sensitive targets that alter mitochondrial function and the role of these redox modifications on metabolism, mitochondrial biogenesis, receptor-mediated signaling, and apoptotic pathways. We also consider the role of mitochondria in modulating these pathways, and discuss how redox-dependent events may contribute to pathobiology by altering mitochondrial function. Antioxid. Redox Signal. 16, 1323–1367. PMID:22146081
Epidermal growth factor pathway substrate 15, Eps15
DEFF Research Database (Denmark)
Salcini, A E; Chen, H; Iannolo, G
1999-01-01
Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...
Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique
2014-10-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment
Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice
Energy Technology Data Exchange (ETDEWEB)
Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)
2011-06-15
We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.
Standardized method to obtain dermo-epidermal junction samples from bovine hoof
Directory of Open Access Journals (Sweden)
H.M.F. Mendes
2015-04-01
Full Text Available As afecções podais em bovinos causam importante impacto econômico negativo na bovinocultura. Pesquisas têm sido realizadas com o objetivo de avançar no entendimento dos processos ocorridos na junção derme-epiderme do casco de bovinos com laminite e nos demais tecidos moles durante as lesões infecciosas. Apesar disso, não foram encontrados na literatura consultada estudos que descrevessem um método padronizado para a obtenção de amostras do tecido laminar do casco. Nesse contexto, foi necessário criar e estabelecer um método viável para a colheita de amostras da junção derme-epiderme, de modo a viabilizar o estudo de pós-graduação que originou esta comunicação. O objetivo é relatar um método padronizado, testado e bem-sucedido para obtenção de amostras da junção derme-epiderme do casco de bovinos em suas regiões solear, axial e dorsal. Foram obtidos fragmentos transversais das unhas de vacas abatidas em frigorífico. A espessura desses fragmentos foi de 1,5cm, aproximadamente, e contemplava as regiões solear, axial e dorsal do casco. De forma sistematizada, amostras da junção derme-epiderme de cada uma dessas regiões foram removidas, fixadas em formol, processadas e incluídas em parafina. A análise usando microscopia de luz demonstrou cortes histológicos íntegros e sem artefatos, que permitiram ampla avaliação das estruturas tanto da derme quanto da epiderme. Concluiu-se que o método proposto viabiliza a obtenção de amostras de padrão e qualidade adequados ao estudo do tecido laminar do casco bovino.
Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration.
Bögel, Gábor; Gujdár, Annamária; Geiszt, Miklós; Lányi, Árpád; Fekete, Anna; Sipeki, Szabolcs; Downward, Julian; Buday, László
2012-09-07
Mutations in the SH3PXD2B gene coding for the Tks4 protein are responsible for the autosomal recessive Frank-ter Haar syndrome. Tks4, a substrate of Src tyrosine kinase, is implicated in the regulation of podosome formation. Here, we report a novel role for Tks4 in the EGF signaling pathway. In EGF-treated cells, Tks4 is tyrosine-phosphorylated and associated with the activated EGF receptor. This association is not direct but requires the presence of Src tyrosine kinase. In addition, treatment of cells with LY294002, an inhibitor of PI 3-kinase, or mutations of the PX domain reduces tyrosine phosphorylation and membrane translocation of Tks4. Furthermore, a PX domain mutant (R43W) Tks4 carrying a reported point mutation in a Frank-ter Haar syndrome patient showed aberrant intracellular expression and reduced phosphoinositide binding. Finally, silencing of Tks4 was shown to markedly inhibit HeLa cell migration in a Boyden chamber assay in response to EGF or serum. Our results therefore reveal a new function for Tks4 in the regulation of growth factor-dependent cell migration.
Improvement of arbutin trans-epidermal delivery using ...
African Journals Online (AJOL)
Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...
Directory of Open Access Journals (Sweden)
Jian-Wei Zhang
2018-04-01
Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic
Regulation of macrophage development and function in peripheral tissues
Lavin, Yonit; Mortha, Arthur; Rahman, Adeeb; Merad, Miriam
2015-01-01
Macrophages are immune cells of haematopoietic origin that provide crucial innate immune defence and have tissue-specific functions in the regulation and maintenance of organ homeostasis. Recent studies of macrophage ontogeny, as well as transcriptional and epigenetic identity, have started to reveal the decisive role of the tissue stroma in the regulation of macrophage function. These findings suggest that most macrophages seed the tissues during embryonic development and functionally specialize in response to cytokines and metabolites that are released by the stroma and drive the expression of unique transcription factors. In this Review, we discuss how recent insights into macrophage ontogeny and macrophage–stroma interactions contribute to our understanding of the crosstalk that shapes macrophage function and the maintenance of organ integrity. PMID:26603899
Directory of Open Access Journals (Sweden)
Jong-Shiaw Jin
2006-01-01
Full Text Available Aim: Extracellular matrix metalloprotease inducer (EMMPRIN expression was demonstrated in several cancers, but its expression profile in colorectal cancers remains unclear. Epidermal growth factor receptor (EGFR was reported to regulate EMMPRIN expression in human epithelial cancers. Our purpose was to determine EMMPRIN expression and its relationship with EGFR in colorectal cancers.
Epigenetic Regulation of Monocyte and Macrophage Function
Hoeksema, Marten A.; de Winther, Menno P. J.
2016-01-01
Monocytes and macrophages are key players in tissue homeostasis and immune responses. Epigenetic processes tightly regulate cellular functioning in health and disease. Recent Advances: Recent technical developments have allowed detailed characterizations of the transcriptional circuitry underlying
Directory of Open Access Journals (Sweden)
Young-Su Yi
2016-01-01
Full Text Available Inflammation involves a series of complex biological processes mediated by innate immunity for host defense against pathogen infection. Chronic inflammation is considered to be one of the major causes of serious diseases, including a number of autoimmune/inflammatory diseases, cancers, cardiovascular diseases, and neurological diseases. Milk fat globule-epidermal growth factor 8 (MFG-E8 is a secreted protein found in vertebrates and was initially discovered as a critical component of the milk fat globule. Previously, a number of studies have reported that MFG-E8 contributes to various biological functions including the phagocytic removal of damaged and apoptotic cells from tissues, the induction of VEGF-mediated neovascularization, the maintenance of intestinal epithelial homeostasis, and the promotion of mucosal healing. Recently, emerging studies have reported that MFG-E8 plays a role in inflammatory responses and inflammatory/autoimmune diseases. This review describes the characteristics of MFG-E8-mediated signaling pathways, summarizes recent findings supporting the roles of MFG-E8 in inflammatory responses and inflammatory/autoimmune diseases, and discusses MFG-E8 targeting as a potential therapeutic strategy for the development of anti-inflammatory/autoimmune disease drugs.
International Nuclear Information System (INIS)
Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.
1975-01-01
Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin
Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat
Directory of Open Access Journals (Sweden)
Roberta Sartori
2016-06-01
Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.
Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan
2018-01-01
The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...
The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness
Directory of Open Access Journals (Sweden)
Jiyoung You
2015-09-01
Full Text Available Andrographis paniculata (A. paniculata, Chuanxinlian, a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE on human epidermal stem cells (EpSCs, and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29, the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor were measured using an enzyme-linked immunosorbent assay (ELISA. During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs. In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression
The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness.
You, Jiyoung; Roh, Kyung-Baeg; Li, Zidan; Liu, Guangrong; Tang, Jian; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun
2015-09-22
Andrographis paniculata (A. paniculata, Chuanxinlian), a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE) on human epidermal stem cells (EpSCs), and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29), the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor) were measured using an enzyme-linked immunosorbent assay (ELISA). During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE) on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs). In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression. The VEGF
International Nuclear Information System (INIS)
An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.
1996-01-01
Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas
Phosphodiesterases regulate airway smooth muscle function in health and disease.
Krymskaya, Vera P; Panettieri, Reynold A
2007-01-01
On the basis of structure, regulation, and kinetic properties, phosphodiesterases (PDEs) represent a superfamily of enzymes divided into 11 subfamilies that catalyze cytosolic levels of 3',5'-cyclic adenosine monophosphate (cAMP) or 3',5'-cyclic guanosine monophosphate (cGMP) to 5'-AMP or 5'-GMP, respectively. PDE4 represents the major PDE expressed in inflammatory cells as well as airway smooth muscle (ASM), and selective PDE4 inhibitors provide a broad spectrum of anti-inflammatory effects such as abrogating cytokine and chemokine release from inflammatory cells and inhibiting inflammatory cell trafficking. Due to cell- and tissue-specific gene expression and regulation, PDEs modulate unique organ-based functions. New tools or compounds that selectively inhibit PDE subfamilies and genetically engineered mice deficient in selective isoforms have greatly enhanced our understanding of PDE function in airway inflammation and resident cell function. This chapter will focus on recent advances in our understanding of the role of PDE in regulating ASM function.
Directory of Open Access Journals (Sweden)
Hassan Riad
2013-10-01
Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.
Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit
2015-12-01
Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.
Ascorbate regulates haematopoietic stem cell function and leukaemogenesis.
Agathocleous, Michalis; Meacham, Corbin E; Burgess, Rebecca J; Piskounova, Elena; Zhao, Zhiyu; Crane, Genevieve M; Cowin, Brianna L; Bruner, Emily; Murphy, Malea M; Chen, Weina; Spangrude, Gerald J; Hu, Zeping; DeBerardinis, Ralph J; Morrison, Sean J
2017-09-28
Stem-cell fate can be influenced by metabolite levels in culture, but it is not known whether physiological variations in metabolite levels in normal tissues regulate stem-cell function in vivo. Here we describe a metabolomics method for the analysis of rare cell populations isolated directly from tissues and use it to compare mouse haematopoietic stem cells (HSCs) to restricted haematopoietic progenitors. Each haematopoietic cell type had a distinct metabolic signature. Human and mouse HSCs had unusually high levels of ascorbate, which decreased with differentiation. Systemic ascorbate depletion in mice increased HSC frequency and function, in part by reducing the function of Tet2, a dioxygenase tumour suppressor. Ascorbate depletion cooperated with Flt3 internal tandem duplication (Flt3 ITD ) leukaemic mutations to accelerate leukaemogenesis, through cell-autonomous and possibly non-cell-autonomous mechanisms, in a manner that was reversed by dietary ascorbate. Ascorbate acted cell-autonomously to negatively regulate HSC function and myelopoiesis through Tet2-dependent and Tet2-independent mechanisms. Ascorbate therefore accumulates within HSCs to promote Tet activity in vivo, limiting HSC frequency and suppressing leukaemogenesis.
ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor
Energy Technology Data Exchange (ETDEWEB)
Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.; (UPENN-MED)
2009-09-25
The orphan receptor tyrosine kinase ErbB2 (also known as HER2 or Neu) transforms cells when overexpressed, and it is an important therapeutic target in human cancer. Structural studies have suggested that the oncogenic (and ligand-independent) signalling properties of ErbB2 result from the absence of a key intramolecular 'tether' in the extracellular region that autoinhibits other human ErbB receptors, including the epidermal growth factor (EGF) receptor. Although ErbB2 is unique among the four human ErbB receptors, here we show that it is the closest structural relative of the single EGF receptor family member in Drosophila melanogaster (dEGFR). Genetic and biochemical data show that dEGFR is tightly regulated by growth factor ligands, yet a crystal structure shows that it, too, lacks the intramolecular tether seen in human EGFR, ErbB3 and ErbB4. Instead, a distinct set of autoinhibitory interdomain interactions hold unliganded dEGFR in an inactive state. All of these interactions are maintained (and even extended) in ErbB2, arguing against the suggestion that ErbB2 lacks autoinhibition. We therefore suggest that normal and pathogenic ErbB2 signalling may be regulated by ligands in the same way as dEGFR. Our findings have important implications for ErbB2 regulation in human cancer, and for developing therapeutic approaches that target novel aspects of this orphan receptor.
Culture technique of rabbit primary epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Marini M
2012-10-01
Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.
Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.
1988-01-01
In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure
Optimal allocation of leaf epidermal area for gas exchange.
de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J
2016-06-01
A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.
GABA_A receptor function is regulated by lipid bilayer elasticity
DEFF Research Database (Denmark)
Søgaard, Rikke; Werge, Thomas; Berthelsen, Camilla
2006-01-01
( s) underlying these effects are poorly understood. DHA and Triton X-100, at concentrations that affect GABAA receptor function, increase the elasticity of lipid bilayers measured as decreased bilayer stiffness using gramicidin channels as molecular force transducers. We have previously shown...... reduced the peak amplitude of the GABA-induced currents and increased the rate of receptor desensitization. The effects of the amphiphiles did not correlate with the expected changes in monolayer spontaneous curvature. We conclude that GABAA receptor function is regulated by lipid bilayer elasticity....... PUFAs may generally regulate membrane protein function by affecting the elasticity of the host lipid bilayer....
The Development of Self-Regulation and Executive Function in Young Children
McClelland, Megan M.; Tominey, Shauna L.
2014-01-01
Self-regulation lays the foundation for positive social relationships and academic success. In this article, we provide an overview of self-regulation and the key terms related to selfregulation, such as executive function. We discuss research on how self-regulation develops and connections between self-regulation and social and academic outcomes.…
Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics
Directory of Open Access Journals (Sweden)
Henrique Silva
2015-03-01
Full Text Available Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu. The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young adult subjects (21.6 ± 2.6 years old were selected after informed consent. Subjects were asked to apply a commercially available alcohol gel sanitizer to one hand for 15 days. TEWL absolute values were measured on days 1, 8 and 15 and a plastic occlusion stress test (POST applied. Evaporation half-life (t1/2 evap and dynamic water mass (DWM values increased significantly on day 15 on the treated hand compared to the control hand suggesting that, in the present experimental conditions, the regular use of an alcohol-based gel sanitizer does changes the epidermal barrier. This study also confirms the usefulness of this kinetic model to detect subtle changes on in vivo TEWL dynamics.
Palmitoylation as a Functional Regulator of Neurotransmitter Receptors
Directory of Open Access Journals (Sweden)
Vladimir S. Naumenko
2018-01-01
Full Text Available The majority of neuronal proteins involved in cellular signaling undergo different posttranslational modifications significantly affecting their functions. One of these modifications is a covalent attachment of a 16-C palmitic acid to one or more cysteine residues (S-palmitoylation within the target protein. Palmitoylation is a reversible modification, and repeated cycles of palmitoylation/depalmitoylation might be critically involved in the regulation of multiple signaling processes. Palmitoylation also represents a common posttranslational modification of the neurotransmitter receptors, including G protein-coupled receptors (GPCRs and ligand-gated ion channels (LICs. From the functional point of view, palmitoylation affects a wide span of neurotransmitter receptors activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, recycling, and synaptic clustering. This review summarizes the current knowledge on the palmitoylation of neurotransmitter receptors and its role in the regulation of receptors functions as well as in the control of different kinds of physiological and pathological behavior.
Inflammatory linear verrucous epidermal naevus: Report of three ...
African Journals Online (AJOL)
Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...
Etanercept therapy for toxic epidermal necrolysis.
Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio
2014-08-01
Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Steroid hormone and epidermal growth factor receptors in meningiomas.
Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R
1989-11-01
A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.
Deregulation of epidermal stem cell niche contributes to pathogenesis of non-healing venous ulcers
Nusbaum, Aron G.; Vukelic, Sasa; Krzyzanowska, Agata; Tomic-Canic, Marjana
2014-01-01
The epidermis is maintained by epidermal stem cells (ESC) that reside in distinct niches and contribute to homeostasis and wound closure. Keratinocytes at the non-healing edges of venous ulcers (VUs) are healing-incompetent, hyper-proliferative and non-migratory suggesting deregulation of ESCs. To date genes which regulate ESC niches have been studied in mice only. Utilizing microarray analysis of VU non-healing edges, we identified changes in expression of genes harboring regulation of ESCs and their fate. In a prospective clinical study of ten VUs, we confirmed suppression of the bone morphogenetic protein receptor and GATA binding protein3 as well as inhibitors of DNA-binding proteins 2 and 4. We also found decreased levels of phosphorylated glycogen synthase kinase 3, nuclear presence of ß-catenin and overexpression of its transcriptional target, c-myc indicating activation of the Wnt pathway. Additionally, we found down-regulation of leucine-rich repeats and immunoglobulin-like domains protein 1, a gene important for maintaining ESCs in a quiescent state, and absence of keratin 15, a marker of the basal stem cell compartment suggesting local depletion of ESCs. Our study shows that loss of genes important for regulation of ESCs and their fate along with activation of ß-catenin and c-myc in the VU may contribute to ESC deprivation and a hyper-proliferative, non-migratory, healing incapable wound edge. PMID:24635172
DNMT1 maintains progenitor function in self-renewing somatic tissue.
Sen, George L; Reuter, Jason A; Webster, Daniel E; Zhu, Lilly; Khavari, Paul A
2010-01-28
Progenitor cells maintain self-renewing tissues throughout life by sustaining their capacity for proliferation while suppressing cell cycle exit and terminal differentiation. DNA methylation provides a potential epigenetic mechanism for the cellular memory needed to preserve the somatic progenitor state through repeated cell divisions. DNA methyltransferase 1 (DNMT1) maintains DNA methylation patterns after cellular replication. Although dispensable for embryonic stem cell maintenance, the role for DNMT1 in maintaining the progenitor state in constantly replenished somatic tissues, such as mammalian epidermis, is unclear. Here we show that DNMT1 is essential for epidermal progenitor cell function. DNMT1 protein was found enriched in undifferentiated cells, where it was required to retain proliferative stamina and suppress differentiation. In tissue, DNMT1 depletion led to exit from the progenitor cell compartment, premature differentiation and eventual tissue loss. Genome-wide analysis showed that a significant portion of epidermal differentiation gene promoters were methylated in self-renewing conditions but were subsequently demethylated during differentiation. Furthermore, UHRF1 (refs 9, 10), a component of the DNA methylation machinery that targets DNMT1 to hemi-methylated DNA, is also necessary to suppress premature differentiation and sustain proliferation. In contrast, Gadd45A and B, which promote active DNA demethylation, are required for full epidermal differentiation gene induction. These data demonstrate that proteins involved in the dynamic regulation of DNA methylation patterns are required for progenitor maintenance and self-renewal in mammalian somatic tissue.
Assessment of the Developmental Toxicity of Epidermal Growth ...
African Journals Online (AJOL)
Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...
MicroRNAs as regulators of beta-cell function and dysfunction
DEFF Research Database (Denmark)
Osmai, Mirwais; Osmai, Yama; Bang-Berthelsen, Claus Heiner
2016-01-01
, recent studies have demonstrated that miRNAs are important regulators of the islet transcriptome, controlling apoptosis, differentiation and proliferation, as well as regulating unique islet and beta-cell functions and pathways such as insulin expression, processing and secretion. Furthermore, a large...
Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis
... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...
Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum
2018-05-01
Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.
Long, D.L.; Ulici, V.; Chubinskaya, S.; Loeser, R.F.
2015-01-01
Objective We determined if the epidermal growth factor receptor ligand HB-EGF is produced in cartilage and if it regulates chondrocyte anabolic or catabolic activity. Methods HB-EGF expression was measured by quantitative PCR using RNA isolated from mouse knee joint tissues and from normal and OA human chondrocytes. Immunohistochemistry was performed on normal and OA human cartilage and meniscus sections. Cultured chondrocytes were treated with fibronectin fragments (FN-f) as a catabolic stimulus and osteogenic protein 1 (OP-1) as an anabolic stimulus. Effects of HB-EGF on cell signaling were analyzed by immunoblotting of selected signaling proteins. MMP-13 was measured in conditioned media, proteoglycan synthesis was measured by sulfate incorporation, and matrix gene expression by quantitative PCR. Results HB-EGF expression was increased in 12-month old mice at 8 weeks after surgery to induce OA and increased amounts of HB-EGF were noted in human articular cartilage from OA knees. FN-f stimulated chondrocyte HB-EGF expression and HB-EGF stimulated chondrocyte MMP-13 production. However, HB-EGF was not required for FN-f stimulation of MMP-13 production. HB-EGF activated the ERK and p38 MAP kinases and stimulated phosphorylation of Smad1 at an inhibitory serine site which was associated with inhibition of OP-1 mediated proteoglycan synthesis and reduced aggrecan (ACAN) but not COL2A1 expression. Conclusion HB-EGF is a new factor identified in OA cartilage that promotes chondrocyte catabolic activity while inhibiting anabolic activity suggesting it could contribute to the catabolic-anabolic imbalance seen in OA cartilage. PMID:25937027
HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis
2017-03-03
Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS
Clinical Studies on conformal radiotherapy combined with epidermal ...
African Journals Online (AJOL)
Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...
Epidermal growth factor receptor expression in urinary bladder cancer
Directory of Open Access Journals (Sweden)
Dayalu S.L. Naik
2011-01-01
Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.
Predicting human epidermal melanin concentrations for different skin tones
CSIR Research Space (South Africa)
Smit, Jacoba E
2011-07-01
Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...
Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma
Directory of Open Access Journals (Sweden)
J Gordon Millichap
2013-01-01
Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.
Directory of Open Access Journals (Sweden)
Donna Brennan
2010-01-01
Full Text Available Cell-cell adhesion mediated by desmosomes is crucial for maintaining proper epidermal structure and function, as evidenced by several severe and potentially fatal skin disorders involving impairment of desmosomal proteins. Pemphigus foliaceus (PF and staphylococcal scalded skin syndrome (SSSS are subcorneal blistering diseases resulting from loss of function of the desmosomal cadherin, desmoglein 1 (Dsg1. To further study the pathomechanism of these diseases and to assess the adhesive properties of Dsg2, we employed a recently established transgenic (Tg mouse model expressing Dsg2 in the superficial epidermis. Neonatal Tg and wild type (WT mice were injected with purified ETA or PF Ig. We showed that ectopic expression of Dsg2 reduced the extent of blister formation in response to both ETA and PF Ig. In response to PF Ig, we observed either a dramatic loss or a reorganization of Dsg1-α, Dsg1-β, and, to a lesser extent, Dsg1-γ, in WT mice. The Inv-Dsg2 Tg mice showed enhanced retention of Dsg1 at the cell-cell border. Collectively, our data support the role for Dsg2 in cell adhesion and suggest that ectopic superficial expression of Dsg2 can increase membrane preservation of Dsg1 and limit epidermal blister formation mediated by PF antibodies and exfoliative toxins.
International Nuclear Information System (INIS)
Vallian, S.; Chang, K.S.
2004-01-01
Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML
Knowledge-based analysis of functional impacts of mutations in ...
Indian Academy of Sciences (India)
2015-09-28
Sep 28, 2015 ... MicroRNAs are a class of important post-transcriptional regulators. ... In the analysis of a SNP in the seed region of hsa-miR-96 ... pathway' and 'Epidermal growth factor receptor signaling pathway' were significantly and ...
Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...
African Journals Online (AJOL)
ADOWIE PERE
ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...
Directory of Open Access Journals (Sweden)
Christian eFalter
2015-03-01
Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.
TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.
Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina
2012-10-01
Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.
Ontogeny and function of murine epidermal Langerhans cells.
Kaplan, Daniel H
2017-09-19
Langerhans cells (LCs) are epidermis-resident antigen-presenting cells that share a common ontogeny with macrophages but function as dendritic cells (DCs). Their development, recruitment and retention in the epidermis is orchestrated by interactions with keratinocytes through multiple mechanisms. LC and dermal DC subsets often show functional redundancy, but LCs are required for specific types of adaptive immune responses when antigen is concentrated in the epidermis. This Review will focus on those developmental and functional properties that are unique to LCs.
Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K
2017-04-01
The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Emotion regulation ability varies in relation to intrinsic functional brain architecture.
Uchida, Mai; Biederman, Joseph; Gabrieli, John D E; Micco, Jamie; de Los Angeles, Carlo; Brown, Ariel; Kenworthy, Tara; Kagan, Elana; Whitfield-Gabrieli, Susan
2015-12-01
This study investigated the neural basis of individual variation in emotion regulation, specifically the ability to reappraise negative stimuli so as to down-regulate negative affect. Brain functions in young adults were measured with functional Magnetic Resonance Imaging during three conditions: (i) attending to neutral pictures; (ii) attending to negative pictures and (iii) reappraising negative pictures. Resting-state functional connectivity was measured with amygdala and dorsolateral prefrontal cortical (DLPFC) seed regions frequently associated with emotion regulation. Participants reported more negative affect after attending to negative than neutral pictures, and less negative affect following reappraisal. Both attending to negative vs neutral pictures and reappraising vs attending to negative pictures yielded widespread activations that were significantly right-lateralized for attending to negative pictures and left-lateralized for reappraising negative pictures. Across participants, more successful reappraisal correlated with less trait anxiety and more positive daily emotion, greater activation in medial and lateral prefrontal regions, and lesser resting-state functional connectivity between (a) right amygdala and both medial prefrontal and posterior cingulate cortices, and (b) bilateral DLPFC and posterior visual cortices. The ability to regulate emotion, a source of resilience or of risk for distress, appears to vary in relation to differences in intrinsic functional brain architecture. © The Author (2015). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Autodegradation of 125I-labeled human epidermal cell surface proteins
International Nuclear Information System (INIS)
Hashimoto, K.; Singer, K.H.; Lazarus, G.S.
1982-01-01
Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)
DEFF Research Database (Denmark)
Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure
2003-01-01
alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...
Myostatin-like proteins regulate synaptic function and neuronal morphology.
Augustin, Hrvoje; McGourty, Kieran; Steinert, Joern R; Cochemé, Helena M; Adcott, Jennifer; Cabecinha, Melissa; Vincent, Alec; Halff, Els F; Kittler, Josef T; Boucrot, Emmanuel; Partridge, Linda
2017-07-01
Growth factors of the TGFβ superfamily play key roles in regulating neuronal and muscle function. Myostatin (or GDF8) and GDF11 are potent negative regulators of skeletal muscle mass. However, expression of myostatin and its cognate receptors in other tissues, including brain and peripheral nerves, suggests a potential wider biological role. Here, we show that Myoglianin (MYO), the Drosophila homolog of myostatin and GDF11, regulates not only body weight and muscle size, but also inhibits neuromuscular synapse strength and composition in a Smad2-dependent manner. Both myostatin and GDF11 affected synapse formation in isolated rat cortical neuron cultures, suggesting an effect on synaptogenesis beyond neuromuscular junctions. We also show that MYO acts in vivo to inhibit synaptic transmission between neurons in the escape response neural circuit of adult flies. Thus, these anti-myogenic proteins act as important inhibitors of synapse function and neuronal growth. © 2017. Published by The Company of Biologists Ltd.
Eosinophil peroxidase signals via epidermal growth factor-2 to induce cell proliferation.
LENUS (Irish Health Repository)
Walsh, Marie-Therese
2011-11-01
Eosinophils exert many of their inflammatory effects in allergic disorders through the degranulation and release of intracellular mediators, including a set of cationic granule proteins that include eosinophil peroxidase. Studies suggest that eosinophils are involved in remodeling. In previous studies, we showed that eosinophil granule proteins activate mitogen-activated protein kinase signaling. In this study, we investigated the receptor mediating eosinophil peroxidase-induced signaling and downstream effects. Human cholinergic neuroblastoma IMR32 and murine melanoma B16.F10 cultures, real-time polymerase chain reaction, immunoprecipitations, and Western blotting were used in the study. We showed that eosinophil peroxidase caused a sustained increase in both the expression of epidermal growth factor-2 (HER2) and its phosphorylation at tyrosine 1248, with the consequent activation of extracellular-regulated kinase 1\\/2. This, in turn, promoted a focal adhesion kinase-dependent egress of the cyclin-dependent kinase inhibitor p27(kip) from the nucleus to the cytoplasm. Eosinophil peroxidase induced a HER2-dependent up-regulation of cell proliferation, indicated by an up-regulation of the nuclear proliferation marker Ki67. This study identifies HER2 as a novel mediator of eosinophil peroxidase signaling. The results show that eosinophil peroxidase, at noncytotoxic levels, can drive cell-cycle progression and proliferation, and contribute to tissue remodeling and cell turnover in airway disease. Because eosinophils are a feature of many cancers, these findings also suggest a role for eosinophils in tumorigenesis.
Tseng, Ming-Tsung; Kong, Yazhuo; Chiang, Ming-Chang; Chao, Chi-Chao; Tseng, Wen-Yih I; Hsieh, Sung-Tsang
2015-11-15
Although the small-diameter primary afferent fibers in the skin promptly respond to nociceptive stimuli and convey sensory inputs to the central nervous system, the neural signatures that underpin the relationship between cutaneous afferent fibers and pain perception remain elusive. We combined skin biopsy at the lateral aspect of the distal leg, which is used to quantify cutaneous afferent fibers, with fMRI, which is used to assess brain responses and functional connectivity, to investigate the relationship between cutaneous sensory nerves and the corresponding pain perception in the brain after applying heat pain stimulation to the dorsum of the right foot in healthy subjects. During painful stimulation, the degree of cutaneous innervation, as measured by epidermal nerve fiber density, was correlated with individual blood oxygen level-dependent (BOLD) signals of the posterior insular cortex and of the thalamus, periaqueductal gray, and rostral ventromedial medulla. Pain perception was associated with the activation of the anterior insular cortex and with the functional connectivity from the anterior insular cortex to the primary somatosensory cortex during painful stimulation. Most importantly, both epidermal nerve fiber density and activity in the posterior insular cortex showed a positive correlation with the strength of coupling under pain between the anterior insular cortex and the primary somatosensory cortex. Thus, our findings support the notion that the neural circuitry subserving pain perception interacts with the cerebral correlates of peripheral nociceptive fibers, which implicates an indirect role for skin nerves in human pain perception. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Dorssers, Lambert CJ; Agthoven, Ton van; Brinkman, Arend; Veldscholte, Jos; Smid, Marcel; Dechering, Koen J
2005-01-01
Tamoxifen is effective for endocrine treatment of oestrogen receptor-positive breast cancers but ultimately fails due to the development of resistance. A functional screen in human breast cancer cells identified two BCAR genes causing oestrogen-independent proliferation. The BCAR1 and BCAR3 genes both encode components of intracellular signal transduction, but their direct effect on breast cancer cell proliferation is not known. The aim of this study was to investigate the growth control mediated by these BCAR genes by gene expression profiling. We have measured the expression changes induced by overexpression of the BCAR1 or BCAR3 gene in ZR-75-1 cells and have made direct comparisons with the expression changes after cell stimulation with oestrogen or epidermal growth factor (EGF). A comparison with published gene expression data of cell models and breast tumours is made. Relatively few changes in gene expression were detected in the BCAR-transfected cells, in comparison with the extensive and distinct differences in gene expression induced by oestrogen or EGF. Both BCAR1 and BCAR3 regulate discrete sets of genes in these ZR-75-1-derived cells, indicating that the proliferation signalling proceeds along distinct pathways. Oestrogen-regulated genes in our cell model showed general concordance with reported data of cell models and gene expression association with oestrogen receptor status of breast tumours. The direct comparison of the expression profiles of BCAR transfectants and oestrogen or EGF-stimulated cells strongly suggests that anti-oestrogen-resistant cell proliferation is not caused by alternative activation of the oestrogen receptor or by the epidermal growth factor receptor signalling pathway
Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori
2017-08-01
To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.
Lipid Bilayer – mediated Regulation of Ion Channel Function by Amphiphilic Drugs
DEFF Research Database (Denmark)
Lundbæk, Jens August
2008-01-01
that are transforming it into a subject of quantitative science. It is described how the hydrophobic interactions between a membrane protein and the host lipid bilayer provide the basis for a mechanism, whereby protein function is regulated by the bilayer physical properties. The use of gramicidin channels as single-molecule......Drugs that at pico- to nanomolar concentration regulate ion channel function by high-affi nity binding to their cognate receptor often have a “ secondary pharmacology, ” in which the same molecule at low micromolar concentrations regulates a diversity of membrane proteins in an apparently...... nonspecifi c manner. It has long been suspected that this promiscuous regulation of membrane protein function could be due to changes in the physical properties of the host lipid bilayer, but the underlying mechanisms have been poorly understood. Given that pharmacological research often involves drug...
Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald
2012-05-01
Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.
Regulator Loss Functions and Hierarchical Modeling for Safety Decision Making.
Hatfield, Laura A; Baugh, Christine M; Azzone, Vanessa; Normand, Sharon-Lise T
2017-07-01
Regulators must act to protect the public when evidence indicates safety problems with medical devices. This requires complex tradeoffs among risks and benefits, which conventional safety surveillance methods do not incorporate. To combine explicit regulator loss functions with statistical evidence on medical device safety signals to improve decision making. In the Hospital Cost and Utilization Project National Inpatient Sample, we select pediatric inpatient admissions and identify adverse medical device events (AMDEs). We fit hierarchical Bayesian models to the annual hospital-level AMDE rates, accounting for patient and hospital characteristics. These models produce expected AMDE rates (a safety target), against which we compare the observed rates in a test year to compute a safety signal. We specify a set of loss functions that quantify the costs and benefits of each action as a function of the safety signal. We integrate the loss functions over the posterior distribution of the safety signal to obtain the posterior (Bayes) risk; the preferred action has the smallest Bayes risk. Using simulation and an analysis of AMDE data, we compare our minimum-risk decisions to a conventional Z score approach for classifying safety signals. The 2 rules produced different actions for nearly half of hospitals (45%). In the simulation, decisions that minimize Bayes risk outperform Z score-based decisions, even when the loss functions or hierarchical models are misspecified. Our method is sensitive to the choice of loss functions; eliciting quantitative inputs to the loss functions from regulators is challenging. A decision-theoretic approach to acting on safety signals is potentially promising but requires careful specification of loss functions in consultation with subject matter experts.
Radiologic Findings of Epidermal Cysts in the Trunk
International Nuclear Information System (INIS)
Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi
2005-01-01
To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan
Identification of grazed grasses using epidermal characters | R ...
African Journals Online (AJOL)
The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...
Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.
Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi
2005-02-25
Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.
Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus
Directory of Open Access Journals (Sweden)
Naser Tayyebi Meibodi
2011-01-01
Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.
Growth of melanocytes in human epidermal cell cultures
International Nuclear Information System (INIS)
Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.
1990-01-01
Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient
Peptide regulators of peripheral taste function.
Dotson, Cedrick D; Geraedts, Maartje C P; Munger, Steven D
2013-03-01
The peripheral sensory organ of the gustatory system, the taste bud, contains a heterogeneous collection of sensory cells. These taste cells can differ in the stimuli to which they respond and the receptors and other signaling molecules they employ to transduce and encode those stimuli. This molecular diversity extends to the expression of a varied repertoire of bioactive peptides that appear to play important functional roles in signaling taste information between the taste cells and afferent sensory nerves and/or in processing sensory signals within the taste bud itself. Here, we review studies that examine the expression of bioactive peptides in the taste bud and the impact of those peptides on taste functions. Many of these peptides produced in taste buds are known to affect appetite, satiety or metabolism through their actions in the brain, pancreas and other organs, suggesting a functional link between the gustatory system and the neural and endocrine systems that regulate feeding and nutrient utilization. Copyright © 2013 Elsevier Ltd. All rights reserved.
LRRK2 regulates voltage-gated calcium channel function.
Directory of Open Access Journals (Sweden)
Cade eBedford
2016-05-01
Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how
Emotion regulation in Asperger's syndrome and high-functioning autism.
Samson, Andrea C; Huber, Oswald; Gross, James J
2012-08-01
It is generally thought that individuals with Asperger's syndrome and high-functioning autism (AS/HFA) have deficits in theory of mind. These deficits have been previously linked to problems with social cognition. However, we reasoned that AS/HFA individuals' Theory of Mind deficits also might lead to problems with emotion regulation. To assess emotional functioning in AS/HFA, 27 AS/HFA adults (16 women) and 27 age-, gender-, and education-matched typically developing (TD) participants completed a battery of measures of emotion experience, labeling, and regulation. With respect to emotion experience, individuals with AS/HFA reported higher levels of negative emotions, but similar levels of positive emotions, compared with TD individuals. With respect to emotion labeling, individuals with AS/HFA had greater difficulties identifying and describing their emotions, with approximately two-thirds exceeding the cutoff for alexithymia. With respect to emotion regulation, individuals with AS/HFA used reappraisal less frequently than TD individuals and reported lower levels of reappraisal self-efficacy. Although AS/HFA individuals used suppression more frequently than TD individuals, no difference in suppression self-efficacy was found. It is important to note that these differences in emotion regulation were evident even when controlling for emotion experience and labeling. Implications of these deficits are discussed, and future research directions are proposed.
International Nuclear Information System (INIS)
Tao Yongguang; Song Xing; Deng Xiyun; Xie Daxin; Lee, Leo M.; Liu Yiping; Li Wei; Li Lili; Deng Lin; Wu Qiao; Gong Jianping; Cao Ya
2005-01-01
Epstein-Barr virus (EBV)-encoded latent membrane protein 1 (LMP1) is considered to be the major oncogenic protein of EBV-encoded proteins and has always been the core of the oncogenic mechanism of EBV. Advanced studies on nuclear translocation of the epidermal growth factor receptor (EGFR) family have greatly improved our knowledge of the biological function of cell surface receptors. In this study, we used the Tet-on LMP1 HNE2 cell line as a cell model, which is a dual-stable LMP1-integrated nasopharyngeal carcinoma (NPC) cell line and the expression of LMP1 which could be regulated by the Tet system. We found that LMP1 could regulate the nuclear accumulation of EGFR in a dose-dependent manner quantitatively and qualitatively. We also demonstrated that the nuclear localization sequence of EGFR played some roles in the location of the protein within the nucleus under LMP1 regulation and EGFR in the nucleus could bind to the promoters of cyclinD1 and cyclinE, respectively. We further demonstrated that EGFR is involved in the acceleration of the G1/S phase transition by LMP1 through binding to cyclinD1 and cyclinE directly. These findings provided a novel view that the acceleration of LMP1 on the G1/S transition via the nuclear accumulation of EGFR was critical in the process of nasopharyngeal carcinoma
Abnormal Default System Functioning in Depression: Implications for Emotion Regulation.
Messina, Irene; Bianco, Francesca; Cusinato, Maria; Calvo, Vincenzo; Sambin, Marco
2016-01-01
Depression is widely seen as the result of difficulties in regulating emotions. Based on neuroimaging studies on voluntary emotion regulation, neurobiological models have focused on the concept of cognitive control, considering emotion regulation as a shift toward involving controlled processes associated with activation of the prefrontal and parietal executive areas, instead of responding automatically to emotional stimuli. According to such models, the weaker executive area activation observed in depressed patients is attributable to a lack of cognitive control over negative emotions. Going beyond the concept of cognitive control, psychodynamic models describe the development of individuals' capacity to regulate their emotional states in mother-infant interactions during childhood, through the construction of the representation of the self, others, and relationships. In this mini-review, we link these psychodynamic models with recent findings regarding the abnormal functioning of the default system in depression. Consistently with psychodynamic models, psychological functions associated with the default system include self-related processing, semantic processes, and implicit forms of emotion regulation. The abnormal activation of the default system observed in depression may explain the dysfunctional aspects of emotion regulation typical of the condition, such as an exaggerated negative self-focus and rumination on self-esteem issues. We also discuss the clinical implications of these findings with reference to the therapeutic relationship as a key tool for revisiting impaired or distorted representations of the self and relational objects.
Regulation of immunological and inflammatory functions by biotin.
Kuroishi, Toshinobu
2015-12-01
Biotin is a water-soluble B-complex vitamin and is well-known as a co-factor for 5 indispensable carboxylases. Holocarboxylase synthetase (HLCS) catalyzes the biotinylation of carboxylases and other proteins, whereas biotinidase catalyzes the release of biotin from biotinylated peptides. Previous studies have reported that nutritional biotin deficiency and genetic defects in either HLCS or biotinidase induces cutaneous inflammation and immunological disorders. Since biotin-dependent carboxylases involve various cellular metabolic pathways including gluconeogenesis, fatty acid synthesis, and the metabolism of branched-chain amino acids and odd-chain fatty acids, metabolic abnormalities may play important roles in immunological and inflammatory disorders caused by biotin deficiency. Transcriptional factors, including NF-κB and Sp1/3, are also affected by the status of biotin, indicating that biotin regulates immunological and inflammatory functions independently of biotin-dependent carboxylases. An in-vivo analysis with a murine model revealed the therapeutic effects of biotin supplementation on metal allergies. The novel roles of biotinylated proteins and their related enzymes have recently been reported. Non-carboxylase biotinylated proteins induce chemokine production. HLCS is a nuclear protein involved in epigenetic and chromatin regulation. In this review, comprehensive knowledge on the regulation of immunological and inflammatory functions by biotin and its potential as a therapeutic agent is discussed.
Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity
Directory of Open Access Journals (Sweden)
Harmit S. Ranhotra
2016-07-01
Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.
Pérez-Gutiérrez, J F; Argüelles, J C; Iglesias-Núñez, M; Oliveira, K S; De La Muela, M Sánchez
2011-07-01
To perform a histological and immunohistochemical study of epidermal growth factor, transforming growth factor-alpha and their receptor, as well as the apoptotic signal active caspase-3 in the levator ani muscle of dogs with and without perineal hernia. Biopsy specimens of the levator ani muscle were obtained from 25 dogs with perineal hernia and 4 non-affected dogs and were processed for Masson and immunohistochemical staining. The affected dogs exhibited myopathological features, internalised nuclei, destruction and abnormal size of muscle fibres, which were replaced by collagen. The immunohistochemical study revealed active caspase-3, epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor in the levator ani. Compared to the healthy muscle, transforming growth factor-alpha staining intensity was lower in the affected muscle, whereas epidermal growth factor receptor and active caspase-3 staining were higher. Pelvic diaphragm muscle weakening is the leading cause of perineal hernia in the dog. Survival and death signals expressed in these muscles may contribute to the pathogenesis of this disease. This study reports epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor immunohistochemical expression in the skeletal muscle and suggests that perineal hernia in the dog is accompanied by levator ani muscle atrophy, increased expression of epidermal growth factor receptor, caspase-3 activation, and decreased expression of transforming growth factor-alpha. © 2011 British Small Animal Veterinary Association.
Morphometric analysis of epidermal differentiation in primary roots of Zea mays
Moore, R.; Smith, H. S.
1990-01-01
Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.
Identification and comparative analysis of the epidermal differentiation complex in snakes
Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2017-01-01
The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630
Directory of Open Access Journals (Sweden)
Christley Scott
2010-08-01
Full Text Available Abstract Background Simulation of sophisticated biological models requires considerable computational power. These models typically integrate together numerous biological phenomena such as spatially-explicit heterogeneous cells, cell-cell interactions, cell-environment interactions and intracellular gene networks. The recent advent of programming for graphical processing units (GPU opens up the possibility of developing more integrative, detailed and predictive biological models while at the same time decreasing the computational cost to simulate those models. Results We construct a 3D model of epidermal development and provide a set of GPU algorithms that executes significantly faster than sequential central processing unit (CPU code. We provide a parallel implementation of the subcellular element method for individual cells residing in a lattice-free spatial environment. Each cell in our epidermal model includes an internal gene network, which integrates cellular interaction of Notch signaling together with environmental interaction of basement membrane adhesion, to specify cellular state and behaviors such as growth and division. We take a pedagogical approach to describing how modeling methods are efficiently implemented on the GPU including memory layout of data structures and functional decomposition. We discuss various programmatic issues and provide a set of design guidelines for GPU programming that are instructive to avoid common pitfalls as well as to extract performance from the GPU architecture. Conclusions We demonstrate that GPU algorithms represent a significant technological advance for the simulation of complex biological models. We further demonstrate with our epidermal model that the integration of multiple complex modeling methods for heterogeneous multicellular biological processes is both feasible and computationally tractable using this new technology. We hope that the provided algorithms and source code will be a
DMPD: New insights into NF-kappaB regulation and function. [Dynamic Macrophage Pathway CSML Database
Lifescience Database Archive (English)
Full Text Available 18775672 New insights into NF-kappaB regulation and function. Sun SC, Ley SC. Trend...ction. PubmedID 18775672 Title New insights into NF-kappaB regulation and function....s Immunol. 2008 Oct;29(10):469-78. Epub 2008 Sep 3. (.png) (.svg) (.html) (.csml) Show New insights into NF-kappaB regulation and fun
Pattern of hormone receptors and human epidermal growth factor ...
African Journals Online (AJOL)
Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen
2017-06-16
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen
2017-01-01
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Matsumoto, M; Imagawa, M; Aoki, Y
2000-01-01
Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did no...
Autocrine-paracrine regulation of the mammary gland.
Weaver, S R; Hernandez, L L
2016-01-01
The mammary gland has a remarkable capacity for regulation at a local level, particularly with respect to its main function: milk secretion. Regulation of milk synthesis has significant effects on animal and human health, at the level of both the mother and the neonate. Control by the mammary gland of its essential function, milk synthesis, is an evolutionary necessity and is therefore tightly regulated at a local level. For at least the last 60 yr, researchers have been interested in elucidating the mechanisms underpinning the mammary gland's ability to self-regulate, largely without the influence from systemic hormones or signals. By the 1960s, scientists realized the importance of milk removal in the capacity of the gland to produce milk and that the dynamics of this removal, including emptying of the alveolar spaces and frequency of milking, were controlled locally as opposed to traditional systemic hormonal regulation. Using both in vitro systems and various mammalian species, including goats, marsupials, humans, and dairy cows, it has been demonstrated that the mammary gland is largely self-regulating in its capacity to support the young, which is the evolutionary basis for milk production. Local control occurs at the level of the mammary epithelial cell through pressure and stretching negative-feedback mechanisms, and also in an autocrine fashion through bioactive factors within the milk which act as inhibitors, regulating milk secretion within the alveoli themselves. It is only within the last 20 to 30 yr that potential candidates for these bioactive factors have been examined at a molecular level. Several, including parathyroid hormone-related protein, growth factors (transforming growth factor, insulin-like growth factor, epidermal growth factor), and serotonin, are synthesized within and act upon the gland and possess dynamic receptor activity resulting in diverse effects on growth, calcium homeostasis, and milk composition. This review will focus on the
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2016-03-01
NAM, ATAF, and CUC (NAC) domain-containing proteins are plant-specific transcription factors involved in stress responses and developmental regulation. MusaVND2 and MusaVND3 are vascular-related NAC domain-containing genes encoding for nuclear-localized proteins. The transcript level of MusaVND2 and MusaVND3 are gradually induced after induction of lignification conditions in banana embryogenic cells. Banana embryogenic cells differentiated to tracheary element-like cells after overexpression of MusaVND2 and MusaVND3 with a differentiation frequency of 63.5 and 23.4 %, respectively, after ninth day. Transgenic banana plants overexpressing either of MusaVND2 or MusaVND3 showed ectopic secondary wall deposition as well as transdifferentiation of cells into tracheary elements. Transdifferentiation to tracheary element-like cells was observed in cortical cells of corm and in epidermal and mesophyll cells of leaves of transgenic plants. Elevated levels of lignin and crystalline cellulose were detected in the transgenic banana lines than control plants. The results obtained are useful for understanding the molecular regulation of secondary wall development in banana.
Dynamic regulation of NMDAR function in the adult brain by the stress hormone corticosterone
Directory of Open Access Journals (Sweden)
Yiu Chung eTse
2012-03-01
Full Text Available Stress and corticosteroids dynamically modulate the expression of synaptic plasticity at glutamatergic synapses in the developed brain. Together with alpha-amino-3-hydroxy-methyl-4-isoxazole propionic acid receptors (AMPAR, N-methyl-D-aspartate receptors (NMDAR are critical mediators of synaptic function and are essential for the induction of many forms of synaptic plasticity. Regulation of NMDAR function by cortisol/corticosterone (CORT may be fundamental to the effects of stress on synaptic plasticity. Recent reports of the efficacy of NMDAR antagonists in treating certain stress-associated psychopathologies further highlight the importance of understanding the regulation of NMDAR function by CORT. Knowledge of how corticosteroids regulate NMDAR function within the adult brain is relatively sparse, perhaps due to a common belief that NMDAR function is relatively stable in the adult brain. We review recent results from our laboratory and others demonstrating dynamic regulation of NMDAR function by CORT in the adult brain. In addition, we consider the issue of how differences in the early life environment may program differential sensitivity to modulation of NMDAR function by CORT and how this may influence synaptic function during stress. Findings from these studies demonstrate that NMDAR function in the adult hippocampus remains sensitive to even brief exposures to CORT and that the capacity for modulation of NMDAR may be programmed, in part, by the early life environment. Modulation of NMDAR function may contribute to dynamic regulation of synaptic plasticity and adaptation in the face of stress, however enhanced NMDAR function may be implicated in mechanisms of stress related psychopathologies including depression.
Regulation of VEGF signaling by membrane traffic.
Horowitz, Arie; Seerapu, Himabindu Reddy
2012-09-01
Recent findings have drawn attention to the role of membrane traffic in the signaling of vascular endothelial growth factor (VEGF). The significance of this development stems from the pivotal function of VEGF in vasculogenesis and angiogenesis. The outline of the regulation of VEGF receptor (VEGFR) signaling by membrane traffic is similar to that of the epidermal growth factor receptor (EGFR), a prototype of the intertwining between membrane traffic and signaling. There are, however, unique features in VEGFR signaling that are conferred in part by the involvement of the co-receptor neuropilin (Nrp). Nrp1 and VEGFR2 are integrated into membrane traffic through the adaptor protein synectin, which recruits myosin VI, a molecular motor that drives inward trafficking [17,21,64]. The recent detection of only mild vascular defects in a knockin mouse model that expresses Nrp1 lacking a cytoplasmic domain [104], questions the co-receptor's role in VEGF signaling and membrane traffic. The regulation of endocytosis by ephrin-B2 is another feature unique to VEGR2/3 [18,19], but it awaits a mechanistic explanation. Current models do not fully explain how membrane traffic bridges between VEGFR and the downstream effectors that produce its functional outcome, such as cell migration. VEGF-A appears to accomplish this task in part by recruiting endocytic vesicles carrying RhoA to internalized active VEGFR2 [58]. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Marta del Campo
Full Text Available This study analyzes whether the release of nitric oxide (NO and thromboxane A2 (TXA2 depends on the time lapsed since gonadal function is lost, and their correlation with the proliferation of vascular smooth muscle cells (VSMC mediated by the epidermal growth factor receptor (EGFR. For this purpose, aortic and mesenteric artery segments from control and 6-weeks or 5-months orchidectomized rats were used to measure NO and TXA2 release. The results showed that the basal and acetylcholine (ACh-induced NO release were decreased 6 weeks post-orchidectomy both in aorta and mesenteric artery, but were recovered 5 months thereafter up to levels similar to those found in arteries from control rats. The basal and ACh-induced TXA2 release increased in aorta and mesenteric artery 6 weeks post-orchidectomy, and was maintained at high levels 5 months thereafter. Since we previously observed that orchidectomy, which decreased testosterone level, enlarged the muscular layer of mesenteric arteries, the effect of testosterone on VSMC proliferation was analyzed. The results showed that treatment of cultured VSMC with testosterone downregulated mitogenic signaling pathways initiated by the ligand-dependent activation of the EGFR. In contrast, the EGFR pathways were constitutively active in mesenteric arteries of long-term orchidectomized rats. Thus, the exposure of mesenteric arteries from control rats to epidermal growth factor (EGF induced the activation of EGFR signaling pathways. However, the addition of EGF to arteries from orchidectomized rats failed to induce a further activation of these pathways. In conclusion, this study shows that the release of NO depends on the time lapsed since the gonadal function is lost, while the release of TXA2 is already increased after short periods post-orchidectomy. The alterations in these signaling molecules could contribute to the constitutive activation of the EGFR and its downstream signaling pathways after long period
Development, regulation, metabolism and function of bone marrow adipose tissues.
Li, Ziru; Hardij, Julie; Bagchi, Devika P; Scheller, Erica L; MacDougald, Ormond A
2018-05-01
Most adipocytes exist in discrete depots throughout the body, notably in well-defined white and brown adipose tissues. However, adipocytes also reside within specialized niches, of which the most abundant is within bone marrow. Whereas bone marrow adipose tissue (BMAT) shares many properties in common with white adipose tissue, the distinct functions of BMAT are reflected by its development, regulation, protein secretion, and lipid composition. In addition to its potential role as a local energy reservoir, BMAT also secretes proteins, including adiponectin, RANK ligand, dipeptidyl peptidase-4, and stem cell factor, which contribute to local marrow niche functions and which may also influence global metabolism. The characteristics of BMAT are also distinct depending on whether marrow adipocytes are contained within yellow or red marrow, as these can be thought of as 'constitutive' and 'regulated', respectively. The rBMAT for instance can be expanded or depleted by myriad factors, including age, nutrition, endocrine status and pharmaceuticals. Herein we review the site specificity, age-related development, regulation and metabolic characteristics of BMAT under various metabolic conditions, including the functional interactions with bone and hematopoietic cells. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Karen D. Cowden Dahl
2009-11-01
Full Text Available The epithelial-to-mesenchymal transition (EMT that occurs during embryonic development is recapitulated during tumor metastasis. Important regulators of this process include growth factors, transcription factors, and adhesion molecules. New evidence suggests that microRNA (miRNA activity contributes to metastatic progression and EMT; however, the mechanisms leading to altered miRNA expression during cancer progression remain poorly understood. Importantly, overexpression of the epidermal growth factor receptor (EGFR in ovarian cancer correlates with poor disease outcome and induces EMT in ovarian cancer cells. We report that EGFR signaling leads to transcriptional repression of the miRNA miR-125a through the ETS family transcription factor PEA3. Overexpression of miR-125a induces conversion of highly invasive ovarian cancer cells from a mesenchymal to an epithelial morphology, suggesting miR-125a is a negative regulator of EMT. We identify AT-rich interactive domain 3B (ARID3B as a target of miR-125a and demonstrate that ARID3B is overexpressed in human ovarian cancer. Repression of miR-125a through growth factor signaling represents a novel mechanism for regulating ovarian cancer invasive behavior.
The under-appreciated promiscuity of the epidermal growth factor receptor family.
Directory of Open Access Journals (Sweden)
Sean P Kennedy
2016-08-01
Full Text Available Each member of the epidermal growth factor receptor (EGFR family plays a key role in normal development, homeostasis and a variety of pathophysiological conditions, most notably in cancer. According to the prevailing dogma, these four receptor tyrosine kinases (RTKs; EGFR, ERBB2, ERBB3 and ERBB4 function exclusively through the formation of homodimers and heterodimers within the EGFR family. These combinatorial receptor interactions are known to generate increased interactome diversity and therefore influence signalling output, subcellular localization and function of the heterodimer. This molecular plasticity is also thought to play a role in the development of resistance towards targeted cancer therapies aimed at these known oncogenes. Interestingly, many studies now challenge this dogma and suggest that the potential for EGFR family receptors to interact with more distantly related RTKs is much greater than currently appreciated. Here we discuss how the promiscuity of these oncogenic receptors may lead to the formation of many unexpected receptor pairings and the significant implications for the efficiency of many targeted cancer therapies.
Differential Downregulation of E-Cadherin and Desmoglein by Epidermal Growth Factor
Directory of Open Access Journals (Sweden)
Miquella G. Chavez
2012-01-01
Full Text Available Modulation of cell : cell junctions is a key event in cutaneous wound repair. In this study we report that activation of the epidermal growth factor (EGF receptor disrupts cel : cell adhesion, but with different kinetics and fates for the desmosomal cadherin desmoglein and for E-cadherin. Downregulation of desmoglein preceded that of E-cadherin in vivo and in an EGF-stimulated in vitro wound reepithelialization model. Dual immunofluorescence staining revealed that neither E-cadherin nor desmoglein-2 internalized with the EGF receptor, or with one another. In response to EGF, desmoglein-2 entered a recycling compartment based on predominant colocalization with the recycling marker Rab11. In contrast, E-cadherin downregulation was accompanied by cleavage of the extracellular domain. A broad-spectrum matrix metalloproteinase inhibitor protected E-cadherin but not the desmosomal cadherin, desmoglein-2, from EGF-stimulated disruption. These findings demonstrate that although activation of the EGF receptor regulates adherens junction and desmosomal components, this stimulus downregulates associated cadherins through different mechanisms.
Lee, Hyun Young; Hae Choi, Jeong; Hong, Jin Woo; Kim, Gyoo Cheon; Lee, Hae June
2018-05-01
The effects of argon plasma (ArP) and helium plasma (HeP) jets on E-cadherin protein function have been tested in order to choose the working gas for a better plasma-mediated transdermal drug delivery. The plasma-mediated changes of the E-cadherin function and the skin penetration efficacies of epidermal growth factor (EGF) were monitored in vitro using HaCaT human keratinocytes and in vivo using hairless mice. The ArP showed higher efficacy for E-cadherin regulation and EGF absorption than HeP under the same applied voltage and the same gas flow rate. The ArP generates higher volume power density, higher discharge current peak, and more reactive species than HeP, especially for OH with the same operating parameters. Moreover, the effect of ArP on E-cadherin function was blocked by the use of a grounded metal mesh. Taken together, this study presents the possibility that the synergetic effect of negative charges with radicals plays an important role in plasma-mediated E-cadherin regulation, which leads to enhanced transdermal drug delivery.
Collard, J-F; Hinsenkamp, M
2015-05-01
We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung
2013-01-01
Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...
Epidermal response of rainbow trout to Ichthyobodo necator
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar
2014-01-01
Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...
Energy Technology Data Exchange (ETDEWEB)
Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))
1989-04-21
In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.
YY1 regulates melanocyte development and function by cooperating with MITF.
Directory of Open Access Journals (Sweden)
Juying Li
Full Text Available Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP-seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1 gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF-a general mechanism which may confer tissue-specific gene expression in multiple lineages.
Diacylglycerol Kinases: Regulated Controllers of T Cell Activation, Function, and Development
Directory of Open Access Journals (Sweden)
Gary A. Koretzky
2013-03-01
Full Text Available Diacylglycerol kinases (DGKs are a diverse family of enzymes that catalyze the conversion of diacylglycerol (DAG, a crucial second messenger of receptor-mediated signaling, to phosphatidic acid (PA. Both DAG and PA are bioactive molecules that regulate a wide set of intracellular signaling proteins involved in innate and adaptive immunity. Clear evidence points to a critical role for DGKs in modulating T cell activation, function, and development. More recently, studies have elucidated factors that control DGK function, suggesting an added complexity to how DGKs act during signaling. This review summarizes the available knowledge of the function and regulation of DGK isoforms in signal transduction with a particular focus on T lymphocytes.
Jäger, B; Schmid-Ott, G; Ernst, G; Dölle-Lange, E; Sack, M
2012-06-01
The aim of this study was to construct and validate a short self-rating questionnaire for the assessment of ego functions and ability of self regulation. An item pool of 120 items covering 6 postulated dimensions was reduced by two steps in independent samples (n = 136 + 470) via factor and item analyses to the final version consisting of 35 items. The 5 resulting questionnaire scales "interpersonal disturbances", "frustration tolerance and impulse control", "identity disturbances", "affect differentiation and affect tolerance" and "self-esteem" were well interpretable and showed in confirmatory factor analysis the best fit to the data (CHI²/df = 3.48; RMSEA = 0.73). Total scores were found to differentiate well between diagnostic groups of patients with more or less ego pathology (FANOVA = 9.8; df = 11; p self-regulation questionnaire" (HSRQ) evidently is an appropriate and reliable screening instrument in order to assess ego functions and capacities of self regulation in an economic and user-friendly means. The scale structure allows differentiated diagnostics of weak vs. stable ego functions and may be used for detailed therapy planning. © Georg Thieme Verlag KG Stuttgart · New York.
Directory of Open Access Journals (Sweden)
Yen-Hsi Liu
2010-09-01
Conclusions: Both aerobic and anaerobic microorganisms were present in the inflamed epidermal cysts, although the anaerobic bacteria, specifically, Propionibacterium spp and Peptostreptococcus spp, were isolated slightly more frequently. Antibiotics directed against anaerobes may be considered in the treatment regimen for inflamed epidermal cysts.
Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel
2006-08-01
Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
Directory of Open Access Journals (Sweden)
Raj Victor
2011-08-01
Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
2011-01-01
Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061
Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.
Bolívar-Flores, Y J; Kuri-Harcuch, W
1999-08-01
Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.
Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity
International Nuclear Information System (INIS)
Lowe, N.J.; Breeding, J.
1982-01-01
Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study
Intranasal epidermal growth factor treatment rescues neonatal brain injury
Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio
2014-02-01
There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.
Jiang, Wenqing; Li, Yan; Du, Yasong; Fan, Juan
2016-01-01
Objective This study aims to explore the feature of emotional regulation and executive functions in oppositional defiant disorder (ODD) children. Methods The emotional regulation and executive functions of adolescents with ODD, as well as the relationship between the two factors were analyzed using tools including Adolescent Daily Emotional Regulation Questionnaire (ADERQ), Wisconsin Card Sorting Test (WCST) and Cambridge Neuropsychological Test Automated Battery (CANTAB), in comparison with ...
DEFF Research Database (Denmark)
Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer
2007-01-01
Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...
Grafting of human epidermal cells, presence and perspectives
Czech Academy of Sciences Publication Activity Database
Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.
2001-01-01
Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry
Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice
Directory of Open Access Journals (Sweden)
Azahara Rodríguez-Luna
2017-12-01
Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.
Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata
2014-01-01
Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.
Kremer, M; Lang, E; Berger, A C
2000-09-01
Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human
Follmer, D. Jake; Sperling, Rayne A.
2016-01-01
Background: Researchers have demonstrated significant relations among executive function, metacognition, and self-regulated learning. However, prior research emphasized the use of indirect measures of executive function and did not evaluate how specific executive functions are related to participants' self-regulated learning. Aims: The primary…
Tumores dermóides e epidermóides intra-espinhas
Directory of Open Access Journals (Sweden)
Oscar Fontenelle Filho
1971-03-01
Full Text Available São relatados dois casos de tumores epidermóides e um de tumor dermóide, todos intrarraquianos. Este último era de localização epidural ao nível da coluna torácica (caso 3; os dois tumores epidermóides situavam-se na coluna tóraco-lombar (caso 1 e lombar (caso 2, respectivamente, sendo o primeiro intramedular e o segundo intradural. Em dois casos (casos 2 e 3 os tumores associavam-se a fístula dérmica congênita. Um paciente (caso 3 foi operado aos dois meses de idade; a descoberta do tumor deveu-se à realização da raquimanometria que revelou bloqueio, apesar do paciente não apresentar qualquer sinal neurológico de compressão medular. Os autores são de opinião que, em presença de fístula dérmica congênita ao nível da coluna vertebral, principalmente quando localizada acima do segmento lombosacro, deve-se sempre suspeitar da possibilidade do tumor epidermóide ou dermóide intrarraquiano, mesmo na ausência de sinais neurológicos. A combinação de sintomas neurológicos de longa duração, a evidência radiológica de erosão e alargamento do canal raquiano e a história de fístula dérmica congênita proporcionaram o diagnóstico pré-operatório correto no caso 2.
Essential role of integrin-linked kinase in regulation of phagocytosis in keratinocytes.
Sayedyahossein, Samar; Nini, Lylia; Irvine, Timothy S; Dagnino, Lina
2012-10-01
Phagocytic melanosome uptake by epidermal keratinocytes is a central protective mechanism against damage induced by ultraviolet radiation. Phagocytosis requires formation of pseudopodia via actin cytoskeleton rearrangements. Integrin-linked kinase (ILK) is an important modulator of actin cytoskeletal dynamics. We have examined the role of ILK in regulation of phagocytosis, using epidermal keratinocytes isolated from mice with epidermis-restricted Ilk gene inactivation. ILK-deficient cells exhibited severely impaired capacity to engulf fluorescent microspheres in response to stimulation of the keratinocyte growth factor (KGF) receptor or the protease-activated receptor-2. KGF induced ERK phosphorylation in ILK-expressing and ILK-deficient cells, suggesting that ILK is not essential for KGF receptor signaling. In contrast, KGF promoted activation of Rac1 and formation of pseudopodia in ILK-expressing, but not in ILK-deficient cells. Rac1-deficient keratinocytes also showed substantially impaired phagocytic ability, underlining the importance of ILK-dependent Rac1 function for particle engulfment. Finally, cross-modulation of KGF receptors by integrins may be another important element, as integrin β1-deficient keratinocytes also fail to show significant phagocytosis in response to KGF. Thus, we have identified a novel signaling pathway essential for phagocytosis in keratinocytes, which involves ILK-dependent activation of Rac1 in response to KGF, resulting in the formation of pseudopodia and particle uptake.
Lakshmanan, J; Landel, C P
1986-07-01
We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.
Epidermal hydration levels in rosacea patients improve after minocycline therapy.
LENUS (Irish Health Repository)
Ní Raghallaigh, S
2013-12-06
Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.
Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour
International Nuclear Information System (INIS)
Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.
1996-01-01
Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)
Energy Technology Data Exchange (ETDEWEB)
Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)
2014-08-29
Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in
International Nuclear Information System (INIS)
Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh; Elmets, Craig A.; Athar, Mohammad
2014-01-01
Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34 + /K15 + /p63 + keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in tumors induced
Kwon, Kyongboon; Hanrahan, Amanda R.; Kupzyk, Kevin A.
2017-01-01
We examined emotional expressivity (i.e., happiness, sadness, and anger) and emotion regulation (regulation of exuberance, sadness, and anger) as they relate to academic functioning (motivation, engagement, and achievement). Also, we tested the premise that emotional expressivity and emotion regulation are indirectly associated with achievement…
Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants
International Nuclear Information System (INIS)
Nishida, K.; Roksandic, Z.; Osmond, B.
1981-01-01
The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon
Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan
2010-01-01
This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed
Directory of Open Access Journals (Sweden)
Carolina N Perdigoto
2016-07-01
Full Text Available An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2 in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.
Perdigoto, Carolina N; Dauber, Katherine L; Bar, Carmit; Tsai, Pai-Chi; Valdes, Victor J; Cohen, Idan; Santoriello, Francis J; Zhao, Dejian; Zheng, Deyou; Hsu, Ya-Chieh; Ezhkova, Elena
2016-07-01
An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh) signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2) in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.
Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B
2000-01-01
Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.
Conserved properties of Drosophila Insomniac link sleep regulation and synaptic function.
Li, Qiuling; Kellner, David A; Hatch, Hayden A M; Yumita, Tomohiro; Sanchez, Sandrine; Machold, Robert P; Frank, C Andrew; Stavropoulos, Nicholas
2017-05-01
Sleep is an ancient animal behavior that is regulated similarly in species ranging from flies to humans. Various genes that regulate sleep have been identified in invertebrates, but whether the functions of these genes are conserved in mammals remains poorly explored. Drosophila insomniac (inc) mutants exhibit severely shortened and fragmented sleep. Inc protein physically associates with the Cullin-3 (Cul3) ubiquitin ligase, and neuronal depletion of Inc or Cul3 strongly curtails sleep, suggesting that Inc is a Cul3 adaptor that directs the ubiquitination of neuronal substrates that impact sleep. Three proteins similar to Inc exist in vertebrates-KCTD2, KCTD5, and KCTD17-but are uncharacterized within the nervous system and their functional conservation with Inc has not been addressed. Here we show that Inc and its mouse orthologs exhibit striking biochemical and functional interchangeability within Cul3 complexes. Remarkably, KCTD2 and KCTD5 restore sleep to inc mutants, indicating that they can substitute for Inc in vivo and engage its neuronal targets relevant to sleep. Inc and its orthologs localize similarly within fly and mammalian neurons and can traffic to synapses, suggesting that their substrates may include synaptic proteins. Consistent with such a mechanism, inc mutants exhibit defects in synaptic structure and physiology, indicating that Inc is essential for both sleep and synaptic function. Our findings reveal that molecular functions of Inc are conserved through ~600 million years of evolution and support the hypothesis that Inc and its orthologs participate in an evolutionarily conserved ubiquitination pathway that links synaptic function and sleep regulation.
Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation
M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)
1997-01-01
textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were
X-linked inhibitor of apoptosis regulates T cell effector function
DEFF Research Database (Denmark)
Zehntner, Simone P; Bourbonnière, Lyne; Moore, Craig S
2007-01-01
To understand how the balance between pro- and anti-apoptotic signals influences effector function in the immune system, we studied the X-linked inhibitor of apoptosis (XIAP), an endogenous regulator of cellular apoptosis. Real-time PCR showed increased XIAP expression in blood of mice with exper......To understand how the balance between pro- and anti-apoptotic signals influences effector function in the immune system, we studied the X-linked inhibitor of apoptosis (XIAP), an endogenous regulator of cellular apoptosis. Real-time PCR showed increased XIAP expression in blood of mice...... dramatically reduced within the CNS. Flow cytometry showed an 88-93% reduction in T cells. The proportion of TUNEL(+) apoptotic CD4(+) T cells in the CNS was increased from Neurons...... and oligodendrocytes were not affected; neither did apoptosis increase in liver, where XIAP knockdown also occurred. ASO-XIAP increased susceptibility of T cells to activation-induced apoptosis in vitro. Our results identify XIAP as a critical controller of apoptotic susceptibility of effector T cell function...
Metabolic epidermal necrosis in two dogs with different underlying diseases.
Bond, R; McNeil, P E; Evans, H; Srebernik, N
1995-05-06
Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.
The immigration delay disease: adermatoglyphia-inherited absence of epidermal ridges.
Burger, Bettina; Fuchs, Dana; Sprecher, Eli; Itin, Peter
2011-05-01
In the digital age, personal identification by fingerprints (epidermal ridges) has become more frequent and is often required for biometric passports. The more fingerprints are analyzed, the more variants in their formation are documented. Individuals completely missing fingerprints as an isolated finding are extremely rare. Only 4 kindreds have been described to date, with additional clinical features in most cases. We describe a female patient with missing epidermal ridges on the fingers, palms, toes, and soles as an isolated feature. Absent fingerprints, or adermatoglyphia, were inherited over 4 generations of her family in an autosomal dominant fashion. We present the clinical features of the index patient, and compare the case with previous reports in the literature. Because of problems in personal identification, this embryologic malformation caused the patient significant difficulties when traveling to other countries, which is why we name it the immigration delay disease. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Adam Paré
Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.
Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing
2018-03-01
Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.
Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)
International Nuclear Information System (INIS)
Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.
1997-01-01
This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist
Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes
Laporta, Robert F.; Taichman, Lorne B.
1982-06-01
Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.
DEFF Research Database (Denmark)
Mellergaard, Stig; Nielsen, Else
1997-01-01
and the disease prevalence in the present case, the disease pattern showed evident similarities with formerly described oxygen deficiency-induced outbreaks of lymphocystis and epidermal papilloma in dab in the Kattegat. In 1988, the prevalence of lymphocystis and epidermal papilloma increased significantly...
Structure and function of the cystic fibrosis transmembrane conductance regulator
Directory of Open Access Journals (Sweden)
M.M. Morales
1999-08-01
Full Text Available Cystic fibrosis (CF is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR. Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs, and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs.
Haskett, Mary E.; Stelter, Rebecca; Proffit, Katie; Nice, Rachel
2012-01-01
Objective Identifying factors associated with school functioning of abused children is important in prevention of long-term negative outcomes associated with school failure. The purpose of this study was to examine the degree to which parent emotional expressiveness and children's self-regulation predicted early school behavior of abused children. Methods The sample included 92 physically abused children ages 4-7 and one of their parents (95.7% mothers). Parents completed a measure of their own emotional expressiveness, and parents and teachers provided reports of children's self-regulatory skills. Children's school functioning was measured by observations of playground aggression and teacher reports of aggression and classroom behavior. Results Parents’ expression of positive and negative emotions was associated with various aspects of children's self-regulation and functioning in the school setting. Links between self-regulation and children's school adjustment were robust; poor self-regulation was associated with higher aggression and lower cooperation and self-directed behavior in the classroom. There was minimal support for a mediating role of children's self-regulation in links between parent expressiveness and children's behavior. Practice implications Findings point to the relevance of parent emotional expressivity and children's self-regulatory processes in understanding physically abused children's functioning at the transition to school. Although further research is needed, findings indicate that increasing parental expression of positive emotion should be a focus in treatment along with reduction in negativity of abusive parents. Further, addressing children's self-regulation could be important in efforts to reduce aggression and enhance children's classroom competence. PMID:22565040
Becerra, Rodrigo; Cruise, Kate; Harms, Craig; Allan, Alfred; Bassett, Darryl; Hood, Sean; Murray, Greg
2015-01-01
This study explores the predictive value of various clinical, neuropsychological, functional, and emotion regulation processes for recovery in Bipolar Disorder. Clinical and demographic information was collected for 27 euthymic or residually depressed BD participants. Seventy one percent of the sample reported some degree of impairment in psychosocial functioning. Both residual depression and problems with emotion regulation were identified as significant predictors of poor psychosocial funct...
Epidermal nevus syndrome associated with unusual neurological, ocular, and skeletal features
Directory of Open Access Journals (Sweden)
Reena Sharma
2012-01-01
Full Text Available Epidermal nevus syndrome (ENS is a rare disease, the pathogenesis of which is largely elusive. We, hereby, report an exclusive case of a 20-year-old man with verrucous ENS presented with dark colored papules and plaques along the Blaschko′s lines present over the head and neck area along with fleshy growth in both eyes since birth. Limb length discrepancy and kyphoscoliosis were remarkable. Skin biopsy was compatible with verrucous epidermal nevus while the biopsy of the ocular lesion confirmed complex choristoma. MRI brain revealed calcification in the right temporal lobe. Bilateral arachnoid cyst in the middle cranial fossa, scleral osteoma in the posterior part of the right eyeball, and deformed calvarium were evident on CECT skull and orbit. The present illustration emphasizes the importance of a punctilious work up of the case.
99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.
Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad
2017-04-01
Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.
An immunologic approach to induction of epidermal growth factor deficiency
DEFF Research Database (Denmark)
Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier
1995-01-01
Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....
International Nuclear Information System (INIS)
Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos
2010-01-01
Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.
Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase
Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.
1991-01-01
The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized
DEFF Research Database (Denmark)
Boone, Marc; Draye, Jean Pierre; Verween, Gunther
2014-01-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...
Crandall, AliceAnn; Ghazarian, Sharon R; Day, Randal D; Riley, Anne W
2016-11-01
Prior research links poor maternal emotion regulation to maladaptive parenting and child behaviors, but little research is available on these relationships during the adolescent period. We use structural equation modeling to assess the influence of poor maternal emotion regulation, measured as emotional reactivity and distancing, on adolescent behaviors (measured as aggression and prosocial behaviors) among 478 adolescents (53 % female; baseline age 10-13 years) and their mothers over a 5 year period. We also tested the possible mediating roles of family functioning and parenting behaviors between maternal emotion regulation and adolescent behaviors. Results indicated that higher baseline maternal emotional distancing and reactivity were not directly predictive of adolescents' behaviors, but they were indirectly related through family functioning and parenting. Specifically, indulgent parenting mediated the relationship between maternal emotional reactivity and adolescent aggression. Maternal-reported family functioning significantly mediated the relationship between maternal emotional distancing and adolescent aggression. Family functioning also mediated the relationship between emotional distancing and regulation parenting. The results imply that poor maternal emotion regulation during their child's early adolescence leads to more maladaptive parenting and problematic behaviors during the later adolescent period. However, healthy family processes may ameliorate the negative impact of low maternal emotion regulation on parenting and adolescent behavioral outcomes. The implications for future research and interventions to improve parenting and adolescent outcomes are discussed.
International Nuclear Information System (INIS)
Xu, Zekuan; Zhang, Guoxin; Zhang, Yi; Jiang, Jiakai; Yang, Yang; Shi, Ruihua; Hao, Bo; Zhang, Zhihong; Huang, Zuhu; Kim, Jin W
2010-01-01
Human cervical cancer oncoprotein 1 (HCCR-1), reported as a negative regulator of p53, is over-expressed in a variety of human cancers. However, it is yet unknown whether HCCR-1 plays any role in pancreatic cancer development. The aim of this study was to investigate the effect of epidermal growth factor on the expression of HCCR in pancreatic cancer cells, and to explore if PI3K/Akt/mTOR signaling pathway mediated this expression. A polyclonal antibody against HCCR protein was raised by immunizing Balb/c mice with the purified recombinant protein pMBPc-HCCR. Tissue samples were constructed on a tissue chip, and the expression of HCCR was investigated by immunohistochemistry assay and Western blotting. Pancreatic cell line, PANC-1 cells were stably transfected with plasmids containing sense-HCCR-1 fragment and HCCR siRNA fragment. MTT and transwell assay were used to investigate the proliferation and invasion of stable tansfectants. The specific inhibitor of PI3K and mTOR was used to see if PI3K/mTOR signal transduction was involved in the induction of HCCR gene expression. A Luciferase assay was used to see if Akt can enhance the HCCR promoter activity. HCCR was up-regulated in pancreatic tumor tissues (mean Allred score 4.51 ± 1.549 vs. 2.87 ± 2.193, P < 0.01), especially with high expression in poorly differentiated pancreatic cancer. The growth of cells decreased in HCCR-1 siRNA transfected cells compared with vector transfectants. The number of invasion cells was significantly lower in HCCR-1 siRNA transfected cells (24.4 ± 9.9) than that in vector transfectants (49.1 ± 15.4). Treatment of PANC-1 cells with epidermal growth factor increased HCCR protein level in a dose- and time-dependent manner. However, application of LY294002 and rapamycin caused a dramatic reduction of epidermal growth factor-induced HCCR expression. Over-expression of exogenous constitutively active Akt increased the HCCR promoter activity; in contrast, dominant negative Akt decreased
A function for Rac1 in the terminal differentiation and pigmentation of hair
DEFF Research Database (Denmark)
Behrendt, Kristina; Klatte, Jennifer; Pofahl, Ruth
2012-01-01
in the regulation of terminal hair follicle differentiation. To address this, we have expressed a constitutively active mutant of Rac1, L61Rac1, only in the basal epidermal layer and outer root sheath of mice possessing an epidermis-specific deletion of endogenous Rac1, which experience severe hair loss......The small GTPase Rac1 is ubiquitously expressed in proliferating and differentiating layers of the epidermis and hair follicles. Previously, Rac1 was shown to regulate stem cell behaviour in these compartments. We have asked whether Rac1 has, in addition, a specific, stem-cell-independent function....... The resulting 'rescue' mice exhibited a hair coat throughout their lives. Therefore, expression of Rac1 activity in the keratin-14-positive compartment of the skin is sufficient for the formation of hair follicles and hair in normal quantities. The quality of hair formed in rescue mice was, however, not normal...
Distinct functions of Crumbs regulating slit diaphragms and endocytosis in Drosophila nephrocytes.
Hochapfel, Florian; Denk, Lucia; Mendl, Gudrun; Schulze, Ulf; Maaßen, Christine; Zaytseva, Yulia; Pavenstädt, Hermann; Weide, Thomas; Rachel, Reinhard; Witzgall, Ralph; Krahn, Michael P
2017-12-01
Mammalian podocytes, the key determinants of the kidney's filtration barrier, differentiate from columnar epithelial cells and several key determinants of apical-basal polarity in the conventional epithelia have been shown to regulate podocyte morphogenesis and function. However, little is known about the role of Crumbs, a conserved polarity regulator in many epithelia, for slit-diaphragm formation and podocyte function. In this study, we used Drosophila nephrocytes as model system for mammalian podocytes and identified a conserved function of Crumbs proteins for cellular morphogenesis, nephrocyte diaphragm assembly/maintenance, and endocytosis. Nephrocyte-specific knock-down of Crumbs results in disturbed nephrocyte diaphragm assembly/maintenance and decreased endocytosis, which can be rescued by Drosophila Crumbs as well as human Crumbs2 and Crumbs3, which were both expressed in human podocytes. In contrast to the extracellular domain, which facilitates nephrocyte diaphragm assembly/maintenance, the intracellular FERM-interaction motif of Crumbs is essential for regulating endocytosis. Moreover, Moesin, which binds to the FERM-binding domain of Crumbs, is essential for efficient endocytosis. Thus, we describe here a new mechanism of nephrocyte development and function, which is likely to be conserved in mammalian podocytes.
Insulin Action in Brain Regulates Systemic Metabolism and Brain Function
Kleinridders, Andr?; Ferris, Heather A.; Cai, Weikang; Kahn, C. Ronald
2014-01-01
Insulin receptors, as well as IGF-1 receptors and their postreceptor signaling partners, are distributed throughout the brain. Insulin acts on these receptors to modulate peripheral metabolism, including regulation of appetite, reproductive function, body temperature, white fat mass, hepatic glucose output, and response to hypoglycemia. Insulin signaling also modulates neurotransmitter channel activity, brain cholesterol synthesis, and mitochondrial function. Disruption of insulin action in t...
Steven johnsons syndrome and toxic epidermal necrolysis: A review
Directory of Open Access Journals (Sweden)
Sri ram Anne
2014-12-01
Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.
Regulation of satellite cell function in sarcopenia
Directory of Open Access Journals (Sweden)
Stephen E Alway
2014-09-01
Full Text Available The mechanisms contributing to sarcopenia include reduced satellite cell (myogenic stem cell function that is impacted by the environment (niche of these cells. Satellite cell function is affected by oxidative stress, which is elevated in aged muscles, and this along with changes in largely unknown systemic factors, likely contribute to the manner in which satellite cells respond to stressors such as exercise, disuse or rehabilitation in sarcopenic muscles. Nutritional intervention provides one therapeutic strategy to improve the satellite cell niche and systemic factors, with the goal of improving satellite cell function in aging muscles. Although many elderly persons consume various nutraceuticals with the hope of improving health, most of these compounds have not been thoroughly tested, and the impacts that they might have on sarcopenia, and satellite cell function are not clear. This review discusses data pertaining to the satellite cell responses and function in aging skeletal muscle, and the impact that three compounds: resveratrol, green tea catechins and β-Hydroxy-β-methylbutyrate have on regulating satellite cell function and therefore contributing to reducing sarcopenia or improving muscle mass after disuse in aging. The data suggest that these nutraceutical compounds improve satellite cell function during rehabilitative loading in animal models of aging after disuse (i.e., muscle regeneration. While these compounds have not been rigorously tested in humans, the data from animal models of aging provide a strong basis for conducting additional focused work to determine if these or other nutraceuticals can offset the muscle losses, or improve regeneration in sarcopenic muscles of older humans via improving satellite cell function.
Regulation of Satellite Cell Function in Sarcopenia
Alway, Stephen E.; Myers, Matthew J.; Mohamed, Junaith S.
2014-01-01
The mechanisms contributing to sarcopenia include reduced satellite cell (myogenic stem cell) function that is impacted by the environment (niche) of these cells. Satellite cell function is affected by oxidative stress, which is elevated in aged muscles, and this along with changes in largely unknown systemic factors, likely contribute to the manner in which satellite cells respond to stressors such as exercise, disuse, or rehabilitation in sarcopenic muscles. Nutritional intervention provides one therapeutic strategy to improve the satellite cell niche and systemic factors, with the goal of improving satellite cell function in aging muscles. Although many elderly persons consume various nutraceuticals with the hope of improving health, most of these compounds have not been thoroughly tested, and the impacts that they might have on sarcopenia and satellite cell function are not clear. This review discusses data pertaining to the satellite cell responses and function in aging skeletal muscle, and the impact that three compounds: resveratrol, green tea catechins, and β-Hydroxy-β-methylbutyrate have on regulating satellite cell function and therefore contributing to reducing sarcopenia or improving muscle mass after disuse in aging. The data suggest that these nutraceutical compounds improve satellite cell function during rehabilitative loading in animal models of aging after disuse (i.e., muscle regeneration). While these compounds have not been rigorously tested in humans, the data from animal models of aging provide a strong basis for conducting additional focused work to determine if these or other nutraceuticals can offset the muscle losses, or improve regeneration in sarcopenic muscles of older humans via improving satellite cell function. PMID:25295003
Energy Technology Data Exchange (ETDEWEB)
Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)
2017-02-01
Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.
Kappus, H; Reinhold, C
1994-04-01
Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.
THE SYNTHESIS AND ANALYSIS INFORMATION TECHNOLOGY OF INTERACTIVE REGULATIONS FUNCTIONAL MODELS
Directory of Open Access Journals (Sweden)
Владимир Александрович ТИМОФЕЕВ
2016-02-01
Full Text Available A person has no ability to capture entirely and to estimate correctly the logical coherence and consistency of Regulations in the Text Form. It leads to mistakes in a work of an Enterprise Staff and to the impossibility of mastering of the Regulations with considerable volume. Presented Information Technology allows the Regulations Executor to receive on-line proper information of the Optimum Actions in any possible Situation, which can arise in the course of the work. Leading Experts of any Enterprise may create the full-fledged Expert System by themselves with the help of Specialized Software. Such a System will contain the knowledge in the Functional Model of Regulations (the Optimum Business Process. Stages of realization of the represented Information Technology and the peculiarities of on-line data displaying for the Regulations Executor are illustrated by the Pharmacy Customer Service Regulations.
Gastric luminal epidermal growth factor is affected by diet | Iputo ...
African Journals Online (AJOL)
Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...
Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme
2017-01-01
Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.
Structural interaction and functional regulation of polycystin-2 by filamin.
Directory of Open Access Journals (Sweden)
Qian Wang
Full Text Available Filamins are important actin cross-linking proteins implicated in scaffolding, membrane stabilization and signal transduction, through interaction with ion channels, receptors and signaling proteins. Here we report the physical and functional interaction between filamins and polycystin-2, a TRP-type cation channel mutated in 10-15% patients with autosomal dominant polycystic kidney disease. Yeast two-hybrid and GST pull-down experiments demonstrated that the C-termini of filamin isoforms A, B and C directly bind to both the intracellular N- and C-termini of polycystin-2. Reciprocal co-immunoprecipitation experiments showed that endogenous polycystin-2 and filamins are in the same complexes in renal epithelial cells and human melanoma A7 cells. We then examined the effect of filamin on polycystin-2 channel function by electrophysiology studies with a lipid bilayer reconstitution system and found that filamin-A substantially inhibits polycystin-2 channel activity. Our study indicates that filamins are important regulators of polycystin-2 channel function, and further links actin cytoskeletal dynamics to the regulation of this channel protein.
Regulation of brain insulin signaling: A new function for tau.
Gratuze, Maud; Planel, Emmanuel
2017-08-07
In this issue of JEM, Marciniak et al. (https://doi.org/10.1084/jem.20161731) identify a putative novel function of tau protein as a regulator of insulin signaling in the brain. They find that tau deletion impairs hippocampal response to insulin through IRS-1 and PTEN dysregulation and suggest that, in Alzheimer's disease, impairment of brain insulin signaling might occur via tau loss of function. © 2017 Gratuze and Planel.
Expression and analysis of exogenous proteins in epidermal cells.
Dagnino, Lina; Ho, Ernest; Chang, Wing Y
2010-01-01
In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.
"Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.
Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu
2015-11-04
Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lyra-Leite, Davi M; Andres, Allen M; Petersen, Andrew P; Ariyasinghe, Nethika R; Cho, Nathan; Lee, Jezell A; Gottlieb, Roberta A; McCain, Megan L
2017-10-01
Mitochondria in cardiac myocytes are critical for generating ATP to meet the high metabolic demands associated with sarcomere shortening. Distinct remodeling of mitochondrial structure and function occur in cardiac myocytes in both developmental and pathological settings. However, the factors that underlie these changes are poorly understood. Because remodeling of tissue architecture and extracellular matrix (ECM) elasticity are also hallmarks of ventricular development and disease, we hypothesize that these environmental factors regulate mitochondrial function in cardiac myocytes. To test this, we developed a new procedure to transfer tunable polydimethylsiloxane disks microcontact-printed with fibronectin into cell culture microplates. We cultured Sprague-Dawley neonatal rat ventricular myocytes within the wells, which consistently formed tissues following the printed fibronectin, and measured oxygen consumption rate using a Seahorse extracellular flux analyzer. Our data indicate that parameters associated with baseline metabolism are predominantly regulated by ECM elasticity, whereas the ability of tissues to adapt to metabolic stress is regulated by both ECM elasticity and tissue alignment. Furthermore, bioenergetic health index, which reflects both the positive and negative aspects of oxygen consumption, was highest in aligned tissues on the most rigid substrate, suggesting that overall mitochondrial function is regulated by both ECM elasticity and tissue alignment. Our results demonstrate that mitochondrial function is regulated by both ECM elasticity and myofibril architecture in cardiac myocytes. This provides novel insight into how extracellular cues impact mitochondrial function in the context of cardiac development and disease. NEW & NOTEWORTHY A new methodology has been developed to measure O 2 consumption rates in engineered cardiac tissues with independent control over tissue alignment and matrix elasticity. This led to the findings that matrix
DEFF Research Database (Denmark)
Zhou, F.S.; Andersen, C.H.; Burhenne, K.
2000-01-01
We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...
DEFF Research Database (Denmark)
Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe
2013-01-01
after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist....... Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown...... fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand...
Lifescience Database Archive (English)
Full Text Available 17667936 Structure, function and regulation of the Toll/IL-1 receptor adaptor prote... (.svg) (.html) (.csml) Show Structure, function and regulation of the Toll/IL-1 receptor adaptor proteins. ...PubmedID 17667936 Title Structure, function and regulation of the Toll/IL-1 recep
Vissers, W.H.P.M.; Muys, L.; Erp, P.E.J. van; Jong, E.M.G.J. de; Kerkhof, P.C.M. van de
2004-01-01
Inflammatory linear verrucous epidermal nevus (ILVEN) is a rare skin disorder with a clinical and histological resemblance to psoriasis. In the past clinical and histological criteria have been defined. However, there remains a discussion as to whether ILVEN is a disease entity distinct from linear
Amplification of epidermal growth factor receptor gene in renal cell carcinoma
DEFF Research Database (Denmark)
El-Hariry, Iman; Powles, Thomas; Lau, Mike R
2010-01-01
Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...
Jiang, Wenqing; Li, Yan; Du, Yasong; Fan, Juan
2016-05-01
This study aims to explore the feature of emotional regulation and executive functions in oppositional defiant disorder (ODD) children. The emotional regulation and executive functions of adolescents with ODD, as well as the relationship between the two factors were analyzed using tools including Adolescent Daily Emotional Regulation Questionnaire (ADERQ), Wisconsin Card Sorting Test (WCST) and Cambridge Neuropsychological Test Automated Battery (CANTAB), in comparison with attention deficit hyperactivity disorder (ADHD) children without behavioral problem and healthy children; the ADERQ assessed emotional regulation ability and others were used to assess executive function. Compared to normal children, the ODD group displayed significant differences in the scores of cognitive reappraisal, rumination, expressive suppression, and revealing of negative emotions, as well as in the score of cognitive reappraisal of positive emotions. WCST perseverative errors were well correlated with rumination of negative emotions (r=0.47). Logistic regression revealed that the minimum number of moves in the Stocking of Cambridge (SOC) test (one test in CANTAB) and negative emotion revealing, were strongly associated with ODD diagnosis. Children with ODD showed emotion dysregulation, with negative emotion dysregulation as the main feature. Emotion dysregulation and the lack of ability to plan lead to executive function deficits. The executive function deficits may guide us to understand the deep mechanism under ODD.
Regulation of Histone Acetyltransferase TIP60 Function by Histone Deacetylase 3
Yi, Jingjie; Huang, Xiangyang; Yang, Yuxia; Zhu, Wei-Guo; Gu, Wei; Luo, Jianyuan
2014-01-01
The key member of the MOZ (monocyticleukaemia zinc finger protein), Ybf2/Sas3, Sas2, and TIP60 acetyltransferases family, Tat-interactive protein, 60 kD (TIP60), tightly modulates a wide array of cellular processes, including chromatin remodeling, gene transcription, apoptosis, DNA repair, and cell cycle arrest. The function of TIP60 can be regulated by SIRT1 through deacetylation. Here we found that TIP60 can also be functionally regulated by HDAC3. We identified six lysine residues as its autoacetylation sites. Mutagenesis of these lysines to arginines completely abolishes the autoacetylation of TIP60. Overexpression of HDAC3 increases TIP60 ubiquitination levels. However, unlike SIRT1, HDAC3 increased the half-life of TIP60. Further study found that HDAC3 colocalized with TIP60 both in the nucleus and the cytoplasm, which could be the reason why HDAC3 can stabilize TIP60. The deacetylation of TIP60 by both SIRT1 and HDAC3 reduces apoptosis induced by DNA damage. Knockdown of HDAC3 in cells increased TIP60 acetylation levels and increased apoptosis after DNA damage. Together, our findings provide a better understanding of TIP60 regulation mechanisms, which is a significant basis for further studies of its cellular functions. PMID:25301942
microRNAs in the regulation of dendritic cell functions in inflammation and atherosclerosis.
Busch, Martin; Zernecke, Alma
2012-08-01
Atherosclerosis has been established as a chronic inflammatory disease of the vessel wall. Among the mononuclear cell types recruited to the lesions, specialized dendritic cells (DCs) have gained increasing attention, and their secretory products and interactions shape the progression of atherosclerotic plaques. The regulation of DC functions by microRNAs (miRNAs) may thus be of primary importance in disease. We here systematically summarize the biogenesis and functions of miRNAs and provide an overview of miRNAs in DCs, their targets, and potential implications for atherosclerosis, with a particular focus on the best characterized miRNAs in DCs, namely, miR-155 and miR-146. MiRNA functions in DCs range from regulation of lipid uptake to cytokine production and T cell responses with a complex picture emerging, in which miRNAs cooperate or antagonize DC behavior, thereby promoting or counterbalancing inflammatory responses. As miRNAs regulate key functions of DCs known to control atherosclerotic vascular disease, their potential as a therapeutic target holds promise and should be attended to in future research.
Swelling-activated ion channels: functional regulation in cell-swelling, proliferation and apoptosis
DEFF Research Database (Denmark)
Stutzin, A; Hoffmann, E K
2006-01-01
Cell volume regulation is one of the most fundamental homeostatic mechanisms and essential for normal cellular function. At the same time, however, many physiological mechanisms are associated with regulatory changes in cell size meaning that the set point for cell volume regulation is under phys...... as key players in the maintenance of normal steady-state cell volume, with particular emphasis on the intracellular signalling pathways responsible for their regulation during hypotonic stress, cell proliferation and apoptosis....
Cdc42 regulates epithelial cell polarity and cytoskeletal function during kidney tubule development
DEFF Research Database (Denmark)
Elias, Bertha C; Das, Amrita; Parekh, Diptiben V
2015-01-01
The Rho GTPase Cdc42 regulates key signaling pathways required for multiple cell functions, including maintenance of shape, polarity, proliferation, migration, differentiation and morphogenesis. Although previous studies have shown that Cdc42 is required for proper epithelial development and main......The Rho GTPase Cdc42 regulates key signaling pathways required for multiple cell functions, including maintenance of shape, polarity, proliferation, migration, differentiation and morphogenesis. Although previous studies have shown that Cdc42 is required for proper epithelial development...
International Nuclear Information System (INIS)
Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.
1996-01-01
UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1984-01-01
The effect of VIP and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands was investigated in the rat. Vasoactive intestinal polypeptide infused in doses of 10 and 100 ng/kg/h significantly increased epidermal growth factor and bicarbonate output......, but the concentrations did not change. Somatostatin infused at doses of 1, 10, 100 and 1000 ng/kg/h against a background of VIP 100 ng/kg/h inhibited in dose-dependent fashion the stimulated epidermal growth factor and bicarbonate outputs from rat Brunner's gland pouches. Also basal secretion was inhibited...... growth factor and bicarbonate from Brunner's glands, an effect which is inhibited by somatostatin. A possible role for somatostatin in the control of Brunner's gland secretion is suggested....
Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna
2015-08-01
The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.
Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Philpott Michael P
2010-02-01
Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant
Regulation of K-Cl cotransport: from function to genes.
Adragna, N C; Di Fulvio, M; Lauf, P K
2004-10-01
This review intends to summarize the vast literature on K-Cl cotransport (COT) regulation from a functional and genetic viewpoint. Special attention has been given to the signaling pathways involved in the transporter's regulation found in several tissues and cell types, and more specifically, in vascular smooth muscle cells (VSMCs). The number of publications on K-Cl COT has been steadily increasing since its discovery at the beginning of the 1980s, with red blood cells (RBCs) from different species (human, sheep, dog, rabbit, guinea pig, turkey, duck, frog, rat, mouse, fish, and lamprey) being the most studied model. Other tissues/cell types under study are brain, kidney, epithelia, muscle/smooth muscle, tumor cells, heart, liver, insect cells, endothelial cells, bone, platelets, thymocytes and Leishmania donovani. One of the salient properties of K-Cl-COT is its activation by cell swelling and its participation in the recovery of cell volume, a process known as regulatory volume decrease (RVD). Activation by thiol modification with N-ethylmaleimide (NEM) has spawned investigations on the redox dependence of K-Cl COT, and is used as a positive control for the operation of the system in many tissues and cells. The most accepted model of K-Cl COT regulation proposes protein kinases and phosphatases linked in a chain of phosphorylation/dephosphorylation events. More recent studies include regulatory pathways involving the phosphatidyl inositol/protein kinase C (PKC)-mediated pathway for regulation by lithium (Li) in low-K sheep red blood cells (LK SRBCs), and the nitric oxide (NO)/cGMP/protein kinase G (PKG) pathway as well as the platelet-derived growth factor (PDGF)-mediated mechanism in VSMCs. Studies on VSM transfected cells containing the PKG catalytic domain demonstrated the participation of this enzyme in K-Cl COT regulation. Commonly used vasodilators activate K-Cl COT in a dose-dependent manner through the NO/cGMP/PKG pathway. Interaction between the
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...
Ngkelo, Anta; Richart, Adèle; Kirk, Jonathan A; Bonnin, Philippe; Vilar, Jose; Lemitre, Mathilde; Marck, Pauline; Branchereau, Maxime; Le Gall, Sylvain; Renault, Nisa; Guerin, Coralie; Ranek, Mark J; Kervadec, Anaïs; Danelli, Luca; Gautier, Gregory; Blank, Ulrich; Launay, Pierre; Camerer, Eric; Bruneval, Patrick; Menasche, Philippe; Heymes, Christophe; Luche, Elodie; Casteilla, Louis; Cousin, Béatrice; Rodewald, Hans-Reimer; Kass, David A; Silvestre, Jean-Sébastien
2016-06-27
Acute myocardial infarction (MI) is a severe ischemic disease responsible for heart failure and sudden death. Inflammatory cells orchestrate postischemic cardiac remodeling after MI. Studies using mice with defective mast/stem cell growth factor receptor c-Kit have suggested key roles for mast cells (MCs) in postischemic cardiac remodeling. Because c-Kit mutations affect multiple cell types of both immune and nonimmune origin, we addressed the impact of MCs on cardiac function after MI, using the c-Kit-independent MC-deficient (Cpa3(Cre/+)) mice. In response to MI, MC progenitors originated primarily from white adipose tissue, infiltrated the heart, and differentiated into mature MCs. MC deficiency led to reduced postischemic cardiac function and depressed cardiomyocyte contractility caused by myofilament Ca(2+) desensitization. This effect correlated with increased protein kinase A (PKA) activity and hyperphosphorylation of its targets, troponin I and myosin-binding protein C. MC-specific tryptase was identified to regulate PKA activity in cardiomyocytes via protease-activated receptor 2 proteolysis. This work reveals a novel function for cardiac MCs modulating cardiomyocyte contractility via alteration of PKA-regulated force-Ca(2+) interactions in response to MI. Identification of this MC-cardiomyocyte cross-talk provides new insights on the cellular and molecular mechanisms regulating the cardiac contractile machinery and a novel platform for therapeutically addressable regulators. ©2016 Ngkelo et al.
Directory of Open Access Journals (Sweden)
Simon Krabbe
2016-01-01
Full Text Available This case report describes a patient with arthritis of the large joints, bilateral sacroiliitis, and positive anti-SSA and anti-dsDNA antibody, who received sulfasalazine and shortly thereafter became critically ill. He developed toxic epidermal necrolysis, hemolytic anemia, lymphopenia, markedly elevated ferritin, and muscle wasting. A diagnosis of systemic lupus erythematosus was made, and mycophenolate mofetil and systemic glucocorticoids brought this severe disease under control. Toxic epidermal necrolysis-like lesions and hemophagocytic syndrome have been reported as manifestations of systemic lupus erythematosus. This patient possibly had spondyloarthritis or an undifferentiated connective tissue disease at presentation, and we suggest, based on the timing of events, that sulfasalazine may have acted as a trigger of the severe disease manifestations.
Epidermal electronics with advanced capabilities in near-field communication.
Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A
2015-02-25
Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Toxic epidermal necrolysis due to concomitant use of lamotrigine and valproic acid
Directory of Open Access Journals (Sweden)
Sukhjot Kaur
2013-01-01
Full Text Available Anti-epileptic drugs can be associated with a wide spectrum of cutaneous adverse reactions ranging from simple maculopapular rashes to more severe and life threatening reactions like Stevens-Johnson syndrome and toxic epidermal necrolysis. These rashes are well documented with older antiepileptic drugs like phenytoin, phenobarbitone and carbamazapine. Lamotrigine is a newer, unrelated antiepileptic drug that causes skin rashes in 3-10% of new users. Higher starting dose or rapid escalation, concurrent treatment with valproic acid, and a previous history of a rash with other antiepileptic drugs are well recognized risk factors for lamotrigine related serious rashes. We report two patients with toxic epidermal necrolysis, resulting from concomitant use of lamotrigine and valproic acid. It is emphasized that clinicians adhere to the recommended dosage guidelines and adopt a slow dose titration when initiating treatment with lamotrigine.
Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells
International Nuclear Information System (INIS)
Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook
2011-01-01
Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.
Thyroid hormone is required for hypothalamic neurons regulating cardiovascular functions
Mittag, J.; Lyons, D.J.; Sällström, J.; Vujoviv, M.; Dudazy-Gralla, S.; Warner, A.; Wallis, K.; Alkemade, A.; Nordström, K.; Monyer, H.; Broberger, C.; Arner, A.; Vennström, B.
2013-01-01
Thyroid hormone is well known for its profound direct effects on cardiovascular function and metabolism. Recent evidence, however, suggests that the hormone also regulates these systems indirectly through the central nervous system. While some of the molecular mechanisms underlying the hormone’s
The adventitia: essential regulator of vascular wall structure and function.
Stenmark, Kurt R; Yeager, Michael E; El Kasmi, Karim C; Nozik-Grayck, Eva; Gerasimovskaya, Evgenia V; Li, Min; Riddle, Suzette R; Frid, Maria G
2013-01-01
The vascular adventitia acts as a biological processing center for the retrieval, integration, storage, and release of key regulators of vessel wall function. It is the most complex compartment of the vessel wall and is composed of a variety of cells, including fibroblasts, immunomodulatory cells (dendritic cells and macrophages), progenitor cells, vasa vasorum endothelial cells and pericytes, and adrenergic nerves. In response to vascular stress or injury, resident adventitial cells are often the first to be activated and reprogrammed to influence the tone and structure of the vessel wall; to initiate and perpetuate chronic vascular inflammation; and to stimulate expansion of the vasa vasorum, which can act as a conduit for continued inflammatory and progenitor cell delivery to the vessel wall. This review presents the current evidence demonstrating that the adventitia acts as a key regulator of vascular wall function and structure from the outside in.
Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors
International Nuclear Information System (INIS)
Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili
2013-01-01
High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors
OCA-B regulation of B-cell development and function.
Teitell, Michael A
2003-10-01
The transcriptional co-activator OCA-B [for Oct co-activator from B cells, also known as OBF-1 (OCT-binding factor-1) and Bob1] is not required for B-cell genesis but does regulate subsequent B-cell development and function. OCA-B deficient mice show strain-specific, partial blocks at multiple stages of B-cell maturation and a complete disruption of germinal center formation in all strains, causing humoral immune deficiency and susceptibility to infection. OCA-B probably exerts its effects through the regulation of octamer-motif controlled gene expression. The OCA-B gene encodes two proteins of distinct molecular weight, designated p34 and p35. The p34 isoform localizes in the nucleus, whereas the p35 isoform is myristoylated and is bound to the cytoplasmic membrane. p35 can traffic to the nucleus and probably activates octamer-dependent transcription, although this OCA-B isoform might regulate B cells through membrane-related signal transduction.
Transcription Factor Foxo1 Is a Negative Regulator of NK Cell Maturation and Function
Deng, Youcai; Kerdiles, Yann; Chu, Jianhong; Yuan, Shunzong; Wang, Youwei; Chen, Xilin; Mao, Hsiaoyin; Zhang, Lingling; Zhang, Jianying; Hughes, Tiffany; Deng, Yafei; Zhang, Qi; Wang, Fangjie; Zou, Xianghong; Liu, Chang-Gong; Freud, Aharon G.; Li, Xiaohui; Caligiuri, Michael A; Vivier, Eric; Yu, Jianhua
2015-01-01
SUMMARY Little is known about the role of negative regulators in controlling natural killer (NK) cell development and effector functions. Foxo1 is a multifunctional transcription factor of the forkhead family. Using a mouse model of conditional deletion in NK cells, we found that Foxo1 negatively controlled NK cell differentiation and function. Immature NK cells expressed abundant Foxo1 and little Tbx21 relative to mature NK cells, but these two transcription factors reversed their expression as NK cells proceeded through development. Foxo1 promoted NK cell homing to lymph nodes through upregulating CD62L expression, and impaired late-stage maturation and effector functions by repressing Tbx21 expression. Loss of Foxo1 rescued the defect in late-stage NK cell maturation in heterozygous Tbx21+/− mice. Collectively, our data reveal a regulatory pathway by which the negative regulator Foxo1 and the positive regulator Tbx21 play opposing roles in controlling NK cell development and effector functions. PMID:25769609
Glucose regulation and cognitive function after bariatric surgery.
Galioto, Rachel; Alosco, Michael L; Spitznagel, Mary Beth; Strain, Gladys; Devlin, Michael; Cohen, Ronald; Crosby, Ross D; Mitchell, James E; Gunstad, John
2015-01-01
Obesity is associated with cognitive impairment, and bariatric surgery has been shown to improve cognitive functioning. Rapid improvements in glycemic control are common after bariatric surgery and likely contribute to these cognitive gains. We examined whether improvements in glucose regulation are associated with better cognitive function following bariatric surgery. A total of 85 adult bariatric surgery patients underwent computerized cognitive testing and fasting blood draw for glucose, insulin, and glycated hemoglobin (HbA1c) at baseline and 12 months postoperatively. Significant improvements in both cognitive function and glycemic control were observed among patients. After controlling for baseline factors, 12-month homeostatic model assessment of insulin resistance HOMA-IR predicted 12-month digits backward (β = -.253, p cognitive flexibility improved. Decreases in HbA1c were not associated with postoperative cognitive improvements. After controlling for baseline cognitive test performance, changes in body mass index (BMI) were also not associated with 12-month cognitive function. Small effects of improved glycemic control on improved aspects of attention and executive function were observed following bariatric surgery among severely obese individuals. Future research is needed to identify the underlying mechanisms for the neurocognitive benefits of these procedures.
Rac1 Regulates Endometrial Secretory Function to Control Placental Development
Davila, Juanmahel; Laws, Mary J.; Kannan, Athilakshmi; Li, Quanxi; Taylor, Robert N.; Bagchi, Milan K.; Bagchi, Indrani C.
2015-01-01
During placenta development, a succession of complex molecular and cellular interactions between the maternal endometrium and the developing embryo ensures reproductive success. The precise mechanisms regulating this maternal-fetal crosstalk remain unknown. Our study revealed that the expression of Rac1, a member of the Rho family of GTPases, is markedly elevated in mouse decidua on days 7 and 8 of gestation. To investigate its function in the uterus, we created mice bearing a conditional deletion of the Rac1 gene in uterine stromal cells. Ablation of Rac1 did not affect the formation of the decidua but led to fetal loss in mid gestation accompanied by extensive hemorrhage. To gain insights into the molecular pathways affected by the loss of Rac1, we performed gene expression profiling which revealed that Rac1 signaling regulates the expression of Rab27b, another GTPase that plays a key role in targeting vesicular trafficking. Consequently, the Rac1-null decidual cells failed to secrete vascular endothelial growth factor A, which is a critical regulator of decidual angiogenesis, and insulin-like growth factor binding protein 4, which regulates the bioavailability of insulin-like growth factors that promote proliferation and differentiation of trophoblast cell lineages in the ectoplacental cone. The lack of secretion of these key factors by Rac1-null decidua gave rise to impaired angiogenesis and dysregulated proliferation of trophoblast cells, which in turn results in overexpansion of the trophoblast giant cell lineage and disorganized placenta development. Further experiments revealed that RAC1, the human ortholog of Rac1, regulates the secretory activity of human endometrial stromal cells during decidualization, supporting the concept that this signaling G protein plays a central and conserved role in controlling endometrial secretory function. This study provides unique insights into the molecular mechanisms regulating endometrial secretions that mediate stromal
Rac1 Regulates Endometrial Secretory Function to Control Placental Development.
Directory of Open Access Journals (Sweden)
Juanmahel Davila
2015-08-01
Full Text Available During placenta development, a succession of complex molecular and cellular interactions between the maternal endometrium and the developing embryo ensures reproductive success. The precise mechanisms regulating this maternal-fetal crosstalk remain unknown. Our study revealed that the expression of Rac1, a member of the Rho family of GTPases, is markedly elevated in mouse decidua on days 7 and 8 of gestation. To investigate its function in the uterus, we created mice bearing a conditional deletion of the Rac1 gene in uterine stromal cells. Ablation of Rac1 did not affect the formation of the decidua but led to fetal loss in mid gestation accompanied by extensive hemorrhage. To gain insights into the molecular pathways affected by the loss of Rac1, we performed gene expression profiling which revealed that Rac1 signaling regulates the expression of Rab27b, another GTPase that plays a key role in targeting vesicular trafficking. Consequently, the Rac1-null decidual cells failed to secrete vascular endothelial growth factor A, which is a critical regulator of decidual angiogenesis, and insulin-like growth factor binding protein 4, which regulates the bioavailability of insulin-like growth factors that promote proliferation and differentiation of trophoblast cell lineages in the ectoplacental cone. The lack of secretion of these key factors by Rac1-null decidua gave rise to impaired angiogenesis and dysregulated proliferation of trophoblast cells, which in turn results in overexpansion of the trophoblast giant cell lineage and disorganized placenta development. Further experiments revealed that RAC1, the human ortholog of Rac1, regulates the secretory activity of human endometrial stromal cells during decidualization, supporting the concept that this signaling G protein plays a central and conserved role in controlling endometrial secretory function. This study provides unique insights into the molecular mechanisms regulating endometrial secretions
RNA-Mediated Regulation of HMGA1 Function
Directory of Open Access Journals (Sweden)
Arndt G. Benecke
2015-05-01
Full Text Available The high mobility group protein A1 (HMGA1 is a master regulator of chromatin structure mediating its major gene regulatory activity by direct interactions with A/T-rich DNA sequences located in the promoter and enhancer regions of a large variety of genes. HMGA1 DNA-binding through three AT-hook motifs results in an open chromatin structure and subsequently leads to changes in gene expression. Apart from its significant expression during development, HMGA1 is over-expressed in virtually every cancer, where HMGA1 expression levels correlate with tumor malignancy. The exogenous overexpression of HMGA1 can lead to malignant cell transformation, assigning the protein a key role during cancerogenesis. Recent studies have unveiled highly specific competitive interactions of HMGA1 with cellular and viral RNAs also through an AT-hook domain of the protein, significantly impacting the HMGA1-dependent gene expression. In this review, we discuss the structure and function of HMGA1-RNA complexes during transcription and epigenomic regulation and their implications in HMGA1-related diseases.
Ghassemi, Pejhman; Wang, Quanzeng; Pfefer, T. Joshua
2016-03-01
Photoacoustic Tomography (PAT) employs high-power near-infrared (near-IR) laser pulses to generate structural and functional information on tissue chromophores up to several centimeters below the surface. Such insights may facilitate detection of breast cancer - the most common cancer in women. PAT mammography has been the subject of extensive research, including techniques based on exogenous agents for PAT contrast enhancement and molecular specificity. However, photothermal safety risks of PAT due to strong chromophores such as epidermal melanin and plasmonic nanoparticles have not been rigorously studied. We have used computational and experimental approaches to elucidate highly dynamic optical-thermal processes during PAT. A Monte Carlo model was used to simulate light propagation at 800 and 1064 nm in a multi-layer breast tissue geometry with different epidermal pigmentation levels and a tumorsimulating inclusion incorporating nanoparticles. Energy deposition results were then used in a bioheat transfer model to simulate temperature transients. Experimental measurements involved multi-layer hydrogel phantoms with inclusions incorporating gold nanoparticles. Phantom optical properties were measured using the inverse adding-doubling technique. Thermal imaging was performed as phantoms were irradiated with 5 ns near-IR pulses. Scenarios using 10 Hz laser irradiation of breast tissue containing various nanoparticle concentrations were implemented experimentally and computationally. Laser exposure levels were based on ANSI/IEC limits. Surface temperature measurements were compared to corresponding simulation data. In general, the effect of highly pigmented skin on temperature rise was significant, whereas unexpectedly small levels of temperature rise during nanoparticle irradiation were attributed to rapid photodegradation. Results provide key initial insights into light-tissue interactions impacting the safety and effectiveness of PAT.
Regulation of Central Nervous System Myelination in Higher Brain Functions
Directory of Open Access Journals (Sweden)
Mara Nickel
2018-01-01
Full Text Available The hippocampus and the prefrontal cortex are interconnected brain regions, playing central roles in higher brain functions, including learning and memory, planning complex cognitive behavior, and moderating social behavior. The axons in these regions continue to be myelinated into adulthood in humans, which coincides with maturation of personality and decision-making. Myelin consists of dense layers of lipid membranes wrapping around the axons to provide electrical insulation and trophic support and can profoundly affect neural circuit computation. Recent studies have revealed that long-lasting changes of myelination can be induced in these brain regions by experience, such as social isolation, stress, and alcohol abuse, as well as by neurological and psychiatric abnormalities. However, the mechanism and function of these changes remain poorly understood. Myelin regulation represents a new form of neural plasticity. Some progress has been made to provide new mechanistic insights into activity-independent and activity-dependent regulations of myelination in different experimental systems. More extensive investigations are needed in this important but underexplored research field, in order to shed light on how higher brain functions and myelination interplay in the hippocampus and prefrontal cortex.
Barkla, Bronwyn J; Vera-Estrella, Rosario
2015-01-01
One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na(+) and Cl(-) ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells.
Barkla, Bronwyn J.; Vera-Estrella, Rosario
2015-01-01
One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na+ and Cl− ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells. PMID:26113856
Negative Regulation of Receptor Tyrosine Kinase (RTK Signaling: A Developing Field
Directory of Open Access Journals (Sweden)
Fernanda Ledda
2007-01-01
Full Text Available ophic factors control cellular physiology by activating specific receptor tyrosine kinases (RTKs. While the over activation of RTK signaling pathways is associated with cell growth and cancer, recent findings support the concept that impaired down-regulation or deactivation of RTKs may also be a mechanism involved in tumor formation. Under this perspective, the molecular determinants of RTK signaling inhibition may act as tumor-suppressor genes and have a potential role as tumor markers to monitor and predict disease progression. Here, we review the current understanding of the physiological mechanisms that attenuate RTK signaling and discuss evidence that implicates deregulation of these events in cancer.Abbreviations: BDP1: Brain-derived phosphatase 1; Cbl: Casitas B-lineage lymphoma; CIN-85: Cbl-interacting protein of 85 kDa; DER: Drosophila EGFR; EGFR: Epidermal growth factor receptor; ERK 1/2: Extracellular signal-regulated kinase 1/2; Grb2: Growth factor receptor-bound protein 2; HER2: Human epidermal growth factor receptor 2; LRIG: Leucine-rich repeats and immunoglobulin-like domain 1; MAPK: Mitogen-activated protein kinase; Mig 6: Mitogen-inducible gene 6; PTEN: Phosphatase and tensin homologue; RET: Rearranged in transformation; RTK: Receptor tyrosine kinase. SH2 domain: Src-homology 2 domain; SH3 domain: Src-homology 3 domain; Spry: Sprouty.
Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.
Insausti, T C; Casas, J
2009-12-01
Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.
Wu, Jia; Zhang, Wei; Xu, Aiqiang; Zhang, Li; Yan, Tao; Li, Zhuo; Wu, Xiaopan; Zhu, Xilin; Ma, Juan; Li, Ke; Li, Hui; Liu, Ying
2013-08-01
Hepatocellular carcinoma (HCC) is a common solid malignant tumor occurring worldwide that leads to the third largest cause of death compared to other cancers. Genetic and environmental factors are involved in the pathogenesis of HCC. Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) can stimulate the proliferation of epidermal and epithelial cells. The EGF signal pathway has a relationship with the growth of the embryo, tissue repairing, and tumorigenesis. In this study, 416 patients with hepatitis B virus infection (HBV)-related HCC and 645 individuals who had never been infected with HBV of the Chinese Han population were enrolled. Eight single-nucleotide polymorphisms (SNPs), whose minor allele frequency >20% in the EGF and EGFR genes, were genotyped to examine their associations with hepatocarcinogenesis. Genotyping experiments were carried out using TaqMan. There were significant differences in genotype distributions (p=0.005) and allele frequencies (p=0.001, odds ratio [OR]=1.43, 95% confidence interval [CI]=1.15-1.79) of rs11569017 in the EGF gene between the HCC and control groups. After binary logistic regression to determine independent factors for susceptibility to HCC under an additive model, rs11569017 was still independently associated with the susceptibility to HCC (p=0.021, OR=1.48, 95% CI=1.06-2.07), but no significant differences in other SNPs were found. Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). The rs11569017 T allele was associated with susceptibility to HBV-related HCC.
Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M
2007-02-01
Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.
Directory of Open Access Journals (Sweden)
V. D. El'kin
2017-01-01
Full Text Available We present a clinical case of ichthyosis hystrix, a rare genetic ichthyosiform dermatosis. Specifics of the disease are related to the complexity of differential diagnosis and verification of the diagnosis, because clinical manifestation of ichthyosis hystrix is similar with that of verrucous epidermal nevus. Clinical particulars of both nosologies are characterized by bizarre and widespread skin lesions of spicular hyperkeratotic growth, located along Blaschko lines. The exclusive feature of the clinical case described is a long-term (20 years clinical and laboratory monitoring of the patient. The literature review provides brief information on etiology, pathogenesis, clinical features, differential diagnosis, and pathomorphology of ichthyosis hystrix and verrucous epidermal nevus.
Regulation of T cell differentiation and function by EZH2
Directory of Open Access Journals (Sweden)
THEODOROS KARANTANOS
2016-05-01
Full Text Available The enhancer of zeste homologue 2 (EZH2, one of the polycomb group (PcG proteins, is the catalytic subunit of Polycomb-repressive complex 2 (PRC2 and induces the trimethylation of the histone H3 lysine 27 (H3K27me3 promoting epigenetic gene silencing. EZH2 contains a SET domain promoting the methyltransferase activity while the three other protein components of PRC2, namely EED, SUZ12 and RpAp46/48 induce compaction of the chromatin permitting EZH2 enzymatic activity. Numerous studies highlight the role of this evolutionary conserved protein as a master regulator of differentiation in humans involved in the repression of the homeotic (Hox gene and the inactivation of X-chromosome. Through its effects in the epigenetic regulation of critical genes, EZH2 has been strongly linked to cell cycle progression, stem cell pluripotency and cancer biology. Most recently, EZH2 has been associated with hematopoietic stem cell proliferation and differentiation, thymopoiesis and lymphopoiesis. Several studies have evaluated the role of EZH2 in the regulation of T cell differentiation and plasticity as well as its implications in the development of autoimmune diseases and graft versus host disease (GvHD. In this review we will briefly summarize the current knowledge regarding the role of EZH2 in the regulation of T cell differentiation, effector function and homing in the tumor microenvironment and we will discuss possible therapeutic targeting of EZH2 in order to alter T cell immune functions.
Functioning of spontaneous and induced Con A regulators of T-cell proliferation. Modifying factors
International Nuclear Information System (INIS)
Kuz'mina, E.G.
1989-01-01
It is shown that active spontaneous non-specific regulators of T-cell proliferation are activated in peripheral blood ''in vivo'' by endogenous metabolites; non-specific regulator action can be induced ''in vitro'' by Con A, FGA. Non-specific regulators suppress and increase lymphocyte proliferation. Cyclic character of their functioning is revealed. 4 refs.; 1 tab
International Nuclear Information System (INIS)
Yarden, Y.; Schlessinger, J.
1987-01-01
The membrane receptor for epidermal growth factor (EGF) is a 170,000 dalton glycoprotein composed of an extracellular EGF-binding domain and a cytoplasmic kinase domain connected by a stretch of 23 amino acids traversing the plasma membrane. The binding of EGF to the extracellular domain activates the cytoplasmic kinase function even in highly purified preparations of EGF receptor, suggesting that the activation occurs exclusively within the EGF receptor moiety. Conceivably, kinase activation may require the transfer of a conformational change through the single transmembrane region from the ligand binding domain to the cytoplasmic kinase region. Alternatively, ligand-induced receptor-receptor interactions may activate the kinase and thus bypass this requirement. Both mechanisms were contrasted by employing independent experimental approaches. On the basis of these results, an allosteric aggregation model is formulated for the activation of the cytoplasmic kinase function of the receptor by EGF. This model may be relevant to the mechanism by which the mitogenic signal of EGF is transferred across the membrane
Directory of Open Access Journals (Sweden)
Delfina Costa
2018-05-01
Full Text Available Mesenchymal stromal cells (MSC present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF] can exert immunosuppressive effects on T and natural killer (NK lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16. In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR; thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy.
Costa, Delfina; Venè, Roberta; Benelli, Roberto; Romairone, Emanuele; Scabini, Stefano; Catellani, Silvia; Rebesco, Barbara; Mastracci, Luca; Grillo, Federica; Minghelli, Simona; Loiacono, Fabrizio; Zocchi, Maria Raffaella; Poggi, Alessandro
2018-01-01
Mesenchymal stromal cells (MSC) present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF)] can exert immunosuppressive effects on T and natural killer (NK) lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC) and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16). In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR); thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF) of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy. PMID:29910806
Directory of Open Access Journals (Sweden)
Victor Paromov
2011-01-01
Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.
Influence of epidermal hydration on the friction of human skin against textiles
Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.
Phosphorylation regulates SIRT1 function.
Directory of Open Access Journals (Sweden)
Tsutomu Sasaki
Full Text Available BACKGROUND: SIR2 is an NAD(+-dependent deacetylase [1]-[3] implicated in the regulation of lifespan in species as diverse as yeast [4], worms [5], and flies [6]. We previously reported that the level of SIRT1, the mammalian homologue of SIR2 [7], [8], is coupled to the level of mitotic activity in cells both in vitro and in vivo[9]. Cells from long-lived mice maintained SIRT1 levels of young mice in tissues that undergo continuous cell replacement by proliferating stem cells. Changes in SIRT1 protein level were not associated with changes in mRNA level, suggesting that SIRT1 could be regulated post-transcriptionally. However, other than a recent report on sumoylation [10] and identification of SIRT1 as a nuclear phospho-protein by mass spectrometry [11], post-translational modifications of this important protein have not been reported. METHODOLOGY/PRINCIPAL FINDINGS: We identified 13 residues in SIRT1 that are phosphorylated in vivo using mass spectrometry. Dephosphorylation by phosphatases in vitro resulted in decreased NAD(+-dependent deacetylase activity. We identified cyclinB/Cdk1 as a cell cycle-dependent kinase that forms a complex with and phosphorylates SIRT1. Mutation of two residues phosphorylated by Cyclin B/Cdk1 (threonine 530 and serine 540 disturbs normal cell cycle progression and fails to rescue proliferation defects in SIRT1-deficient cells [12], [13]. CONCLUSIONS/SIGNIFICANCE: Pharmacological manipulation of SIRT1 activity is currently being tested as a means of extending lifespan in mammals. Treatment of obese mice with resveratrol, a pharmacological activator of SIRT1, modestly but significantly improved longevity and, perhaps more importantly, offered some protection against the development of type 2 diabetes mellitus and metabolic syndrome [14]-[16]. Understanding the endogenous mechanisms that regulate the level and activity of SIRT1, therefore, has obvious relevance to human health and disease. Our results identify
Epidermal stem cells response to radiative genotoxic stress
International Nuclear Information System (INIS)
Marie, Melanie
2013-01-01
Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global
Functions and regulation of the multitasking FANCM family of DNA motor proteins.
Xue, Xiaoyu; Sung, Patrick; Zhao, Xiaolan
2015-09-01
Members of the conserved FANCM family of DNA motor proteins play key roles in genome maintenance processes. FANCM supports genome duplication and repair under different circumstances and also functions in the ATR-mediated DNA damage checkpoint. Some of these roles are shared among lower eukaryotic family members. Human FANCM has been linked to Fanconi anemia, a syndrome characterized by cancer predisposition, developmental disorder, and bone marrow failure. Recent studies on human FANCM and its orthologs from other organisms have provided insights into their biological functions, regulation, and collaboration with other genome maintenance factors. This review summarizes the progress made, with the goal of providing an integrated view of the functions and regulation of these enzymes in humans and model organisms and how they advance our understanding of genome maintenance processes. © 2015 Xue et al.; Published by Cold Spring Harbor Laboratory Press.
Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases
International Nuclear Information System (INIS)
Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.
2000-01-01
Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs
Talaei-Khoei, Mojtaba; Nemati-Rezvani, Hora; Fischerauer, Stefan F; Ring, David; Chen, Neal; Vranceanu, Ana-Maria
2017-05-01
The Gross process model of emotion regulation holds that emotion-eliciting situations (e.g. musculoskeletal illness) can be strategically regulated to determine the final emotional and behavioral response. Also, there is some evidence that innate emotional traits may predispose an individual to a particular regulating coping style. We enrolled 107 patients with upper extremity musculoskeletal illness in this cross-sectional study. They completed self-report measures of positive and negative affect, emotion regulation strategies (cognitive reappraisal and expressive suppression), upper extremity physical function, pain intensity, and demographics. We used Preacher and Hayes' bootstrapping approach to process analysis to infer the direct effect of positive and negative affect on physical function as well as their indirect effects through activation of emotion regulation strategies. Negative affect was associated with decreased physical function. The association was partly mediated by expressive suppression (b (SE)=-.10 (.05), 95% BCa CI [-.21, -.02]). Positive affect was associated with increased physical function. Cognitive reappraisal partially mediated this association (b (SE)=.11 (.05), 95% BCa CI [.03, .24]). After controlling for pain intensity, the ratio of the mediated effect to total effect grew even larger in controlled model comparing to uncontrolled model (33% vs. 26% for expressive suppression and 32% vs. 30% for cognitive reappraisal). The relationships between affect, emotion regulation strategies and physical function appear to be more dependent on the emotional response to an orthopedic condition rather than the intensity of the nociceptive stimulation of the pain. Findings support integration of emotion regulation training in skill-based psychotherapy in this population to mitigate the effect of negative affect and enhance the influence of positive affect on physical function. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming
2014-03-01
To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.
Antimicrobial susceptibility of Staphylococcus hyicus Isolated from exudative epidermitis in pigs
DEFF Research Database (Denmark)
Wegener, Henrik Caspar; Watts, J.L.; Salmon, S.A.
1994-01-01
for their activities against 100 S. hyicus strains isolated from pigs with exudative epidermitis. Novobiocin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of less than or equal to 0.06 mu g/ml. Enrofloxacin, ampicillin, and ceftiofur were the next most active compounds...
International Nuclear Information System (INIS)
Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.
1991-01-01
Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent
International Nuclear Information System (INIS)
Archambeau, J.O.
1987-01-01
This presentation lists gross and histologic changes produced by irradiation of the skin that have been quantified. It examines available cell kinetic radiobiological and morphological variables to identify interactions that occur between component populations. The dose response data of the hair and epidermal, fibrocytic, and endothelial cell populations are examined and a rank ordering is attempted. The contribution of the radiosensitivity of these populations to defining the dose tolerance of the skin is discussed. Future clinical needs are considered. The intent is to quantify or define tissue population changes in the irradiated skin so that the data may serve as guidelines to aid the radiation therapist to select therapy schedules that preserve skin function while improving cancer control
L-tyrosine and L-DOPA as hormone-like regulators of melanocytes functions
Slominski, Andrzej; Zmijewski, Michal; Pawelek, John
2011-01-01
Summary Evidence reveals that L-tyrosine and L-DOPA, besides serving as substrates and intermediates of melanogenesis, are also bioregulatory agents acting not only as inducers and positive regulators of melanogenesis but also as regulators of other cellular functions. These can be mediated through action on specific receptors or through non-receptor mediated mechanisms. The substrate induced (L-tyrosine and/or L-DOPA) melanogenic pathway would autoregulate itself as well as it would regulate the melanocyte functions through activity of its structural or regulatory proteins and through intermediates of melanogenesis and melanin itself. Dissection of regulatory and autoregulatory elements of this process may elucidate how substrate induced autoregulatory pathways have evolved from prokaryotic or simple eukaryotic organisms to complex systems in vertebrates. This could substantiate older theory proposing that receptors for amino-acid derived hormones arose from the receptors for those amino acids, and that nuclear receptors evolved from primitive intracellular receptors binding nutritional factors or metabolic intermediates. PMID:21834848
Cellular regulation of the structure and function of aortic valves
Directory of Open Access Journals (Sweden)
Ismail El-Hamamsy
2010-01-01
Full Text Available The aortic valve was long considered a passive structure that opens and closes in response to changes in transvalvular pressure. Recent evidence suggests that the aortic valve performs highly sophisticated functions as a result of its unique microscopic structure. These functions allow it to adapt to its hemodynamic and mechanical environment. Understanding the cellular and molecular mechanisms involved in normal valve physiology is essential to elucidate the mechanisms behind valve disease. We here review the structure and developmental biology of aortic valves; we examine the role of its cellular parts in regulating its function and describe potential pathophysiological and clinical implications.
Renal origin of rat urinary epidermal growth factor
DEFF Research Database (Denmark)
Nexø, Ebba; Poulsen, Steen Seier
1984-01-01
The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...
Suzuki, Shinsuke; Ishikawa, Kazuo
2014-03-01
It has been reported that the epidermal growth factor receptor (EGFR) expression is associated with the extracellular matrix metalloproteinase inducer (EMMPRIN) in some solid tumors; however, the relationship of EMMPRIN with EGFR in head and neck cancers is not fully understood. To determine the relationship between EMMPRIN and EGFR in head and neck squamous cell carcinoma (HNSCC), HNSCC cells were stimulated with epidermal growth factor (EGF), a ligand of EGFR. EMMPRIN expression in HNSCC cells was upregulated by EGF. In addition, EGF stimulation induced HNSCC cell invasion and MMP-9 expression. This increase in invasion and MMP-9 expression was abrogated by downmodulation of EMMPRIN. Furthermore, to determine the effects of combined EMMPRIN and EGFR targeting in HNSCC, HNSCC cells were treated with an EMMPRIN function-blocking antibody and the EGFR inhibitor AG1478. This combined treatment resulted in greater inhibition of HNSCC cell proliferation and migration compared with the individual agents alone. These results suggest that EMMPRIN mediates EGFR-induced tumorigenicity and that combined targeting of EMMPRIN and EGFR may be an efficacious treatment approach.
Gu, Yang; Zhang, Gang; Lin, Mei
2008-02-01
To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to
TAK1 regulates skeletal muscle mass and mitochondrial function
Hindi, Sajedah M.; Sato, Shuichi; Xiong, Guangyan; Bohnert, Kyle R.; Gibb, Andrew A.; Gallot, Yann S.; McMillan, Joseph D.; Hill, Bradford G.
2018-01-01
Skeletal muscle mass is regulated by a complex array of signaling pathways. TGF-β–activated kinase 1 (TAK1) is an important signaling protein, which regulates context-dependent activation of multiple intracellular pathways. However, the role of TAK1 in the regulation of skeletal muscle mass remains unknown. Here, we report that inducible inactivation of TAK1 causes severe muscle wasting, leading to kyphosis, in both young and adult mice.. Inactivation of TAK1 inhibits protein synthesis and induces proteolysis, potentially through upregulating the activity of the ubiquitin-proteasome system and autophagy. Phosphorylation and enzymatic activity of AMPK are increased, whereas levels of phosphorylated mTOR and p38 MAPK are diminished upon inducible inactivation of TAK1 in skeletal muscle. In addition, targeted inactivation of TAK1 leads to the accumulation of dysfunctional mitochondria and oxidative stress in skeletal muscle of adult mice. Inhibition of TAK1 does not attenuate denervation-induced muscle wasting in adult mice. Finally, TAK1 activity is highly upregulated during overload-induced skeletal muscle growth, and inactivation of TAK1 prevents myofiber hypertrophy in response to functional overload. Overall, our study demonstrates that TAK1 is a key regulator of skeletal muscle mass and oxidative metabolism. PMID:29415881
Influence of epidermal hydration on the friction of human skin against textile
Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between
Retinoic Acid-Induced Epidermal Transdifferentiation in Skin
Directory of Open Access Journals (Sweden)
Yoshihiro Akimoto
2014-06-01
Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.
Pediatric Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Halted by Etanercept.
Gavigan, Geneviève M; Kanigsberg, Nordau D; Ramien, Michele L
2018-02-01
We report a case of an 11-year-old female with Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) overlap, most likely triggered by sulfamethoxazole-trimethoprim, who was treated with the combination of methylprednisolone, cyclosporine, and etanercept. Her condition stabilized and her skin involvement did not progress after the addition of etanercept. To our knowledge, this is the first report of etanercept for pediatric SJS/TEN.
Fries, Gabriel R; Gassen, Nils C; Rein, Theo
2017-12-05
Among the chaperones and co-chaperones regulating the glucocorticoid receptor (GR), FK506 binding protein (FKBP) 51 is the most intensely investigated across different disciplines. This review provides an update on the role of the different co-chaperones of Hsp70 and Hsp90 in the regulation of GR function. The development leading to the focus on FKBP51 is outlined. Further, a survey of the vast literature on the mechanism and function of FKBP51 is provided. This includes its structure and biochemical function, its regulation on different levels-transcription, post-transcription, and post-translation-and its function in signaling pathways. The evidence portraying FKBP51 as a scaffolding protein organizing protein complexes rather than a chaperone contributing to the folding of individual proteins is collated. Finally, FKBP51's involvement in physiology and disease is outlined, and the promising efforts in developing drugs targeting FKBP51 are discussed.
Vernon-Feagans, Lynne; Garrett-Peters, Patricia; Willoughby, Michael
2016-01-01
Behavioral regulation is an important school readiness skill that has been linked to early executive function (EF) and later success in learning and school achievement. Although poverty and related risks, as well as negative parenting, have been associated with poorer EF and behavioral regulation, chaotic home environments may also play a role in…
DEFF Research Database (Denmark)
Helin, K; Beguinot, L
1991-01-01
with receptors in which 1, 2, or all 3 tyrosines were changed to phenylalanines. The triple point mutant EGF-R, expressed in NIH-3T3, exhibited low autophosphorylation in vivo, low biological and reduced kinase activities. Single and double point mutants were down-regulated, as well as wild type EGF......-R in response to EGF showing a half-life of about 1 h. Degradation of the triple point mutant, however, was impaired and resulted in a half-life of 4 h in the presence of EGF. EGF-dependent down-regulation of surface receptors was decreased in the triple point mutant EGF-R as was internalization and degradation...... of EGF. The specific rate of internalization of the triple point mutant was reduced. By contrast, intracellular processing of ligand previously internalized at 20 degrees C was similar between wild type and mutant receptors. Taken together the data indicate that the delay in degradation observed in cells...
The Prohormone VGF Regulates β Cell Function via Insulin Secretory Granule Biogenesis
Directory of Open Access Journals (Sweden)
Samuel B. Stephens
2017-09-01
Full Text Available The prohormone VGF is expressed in neuroendocrine and endocrine tissues and regulates nutrient and energy status both centrally and peripherally. We and others have shown that VGF-derived peptides have direct action on the islet β cell as secretagogues and cytoprotective agents; however, the endogenous function of VGF in the β cell has not been described. Here, we demonstrate that VGF regulates secretory granule formation. VGF loss-of-function studies in both isolated islets and conditional knockout mice reveal a profound decrease in stimulus-coupled insulin secretion. Moreover, VGF is necessary to facilitate efficient exit of granule cargo from the trans-Golgi network and proinsulin processing. It also functions to replenish insulin granule stores following nutrient stimulation. Our data support a model in which VGF operates at a critical node of granule biogenesis in the islet β cell to coordinate insulin biosynthesis with β cell secretory capacity.
Effect of photo-immobilization of epidermal growth factor on the cellular behaviors
International Nuclear Information System (INIS)
Ogiwara, Kazutaka; Nagaoka, Masato; Cho, Chong-Su; Akaike, Toshihiro
2006-01-01
We constructed photo-reactive epidermal growth factor (EGF) bearing p-azido phenylalanine at the C-terminal (HEGFP) by genetic engineering to investigate the possibility of immobilized EGF as a novel artificial extracellular matrix (ECM). The constructed recombinant protein was immobilized to glass surface by ultraviolet irradiation. A431 cells adhered both to HEGFP-immobilized and collagen-coated surfaces. Interaction between immobilized HEGFP and EGF receptors in the A431 cells was independent of Mg 2+ although integrin-mediated cell adhesion to natural ECMs is dependent on Mg 2+ . Phosphorylation of EGF receptors in A431 cells was induced by immobilized HEGFP as same as soluble EGF. DNA uptake of hepatocytes decreased by immobilized HEGFP whereas it increased by soluble EGF. Liver-specific functions of hepatocytes were maintained for 3 days by immobilized HEGFP whereas they were not maintained by soluble EGF, indicating that immobilized HEGFP follows different signal transduction pathway from soluble EGF
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Gibbs, S.; Corsini, E.; Spiekstra, S.W.; Galbiati, V.; Fuchs, H.W.; Degeorge, G.; Troese, M.; Hayden, P.; Deng, W.; Roggen, E.
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low
Immunohistochemical localisation and developmental aspects of epidermal growth factor in the rat
DEFF Research Database (Denmark)
Raaberg, L; Nexø, E; Damsgaard Mikkelsen, J
1988-01-01
The tissue localisation and time of first appearance of Epidermal Growth Factor (EGF) in the developing rat were investigated by means of immunohistochemistry, radioimmunoassay and radioreceptor assay. In this study we were able to show, that EGF appears prenatally in the lung and the kidney from...
Does epidermal growth factor play a role in the action of sucralfate?
DEFF Research Database (Denmark)
Nexø, Ebba; Poulsen, Steen Seier
1987-01-01
Epidermal growth factor (EGF) is a mitogenic peptide synthesized in the submandibular glands and released in saliva. EGF is able to prevent the development of gastrointestinal ulcers in the rat and to accelerate their healing. The present work was undertaken to examine whether Sucralfate acts via...
Tyrosine Residues Regulate Multiple Nuclear Functions of P54nrb.
Lee, Ahn R; Hung, Wayne; Xie, Ning; Liu, Liangliang; He, Leye; Dong, Xuesen
2017-04-01
The non-POU-domain-containing octamer binding protein (NONO; also known as p54nrb) has various nuclear functions ranging from transcription, RNA splicing, DNA synthesis and repair. Although tyrosine phosphorylation has been proposed to account for the multi-functional properties of p54nrb, direct evidence on p54nrb as a phosphotyrosine protein remains unclear. To investigate the tyrosine phosphorylation status of p54nrb, we performed site-directed mutagenesis on the five tyrosine residues of p54nrb, replacing the tyrosine residues with phenylalanine or alanine, and immunoblotted for tyrosine phosphorylation. We then preceded with luciferase reporter assays, RNA splicing minigene assays, co-immunoprecipitation, and confocal microscopy to study the function of p54nrb tyrosine residues on transcription, RNA splicing, protein-protein interaction, and cellular localization. We found that p54nrb was not phosphorylated at tyrosine residues. Rather, it has non-specific binding affinity to anti-phosphotyrosine antibodies. However, replacement of tyrosine with phenylalanine altered p54nrb activities in transcription co-repression and RNA splicing in gene context-dependent fashions by means of differential regulation of p54nrb protein association with its interacting partners and co-regulators of transcription and splicing. These results demonstrate that tyrosine residues, regardless of phosphorylation status, are important for p54nrb function. J. Cell. Physiol. 232: 852-861, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.
Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo
2016-02-01
Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.
Yao, Bao-Guo; Zhang, Shan; Zhang, De-Pin
2017-05-01
In order to evaluate the temperature regulating properties of thermal functional porous polymeric materials such as fabrics treated with phase change material microcapsules, a new apparatus was developed. The apparatus and the test method can measure the heat flux, temperature, and displacement signals during the dynamic contact and then quickly give an evaluation for the temperature regulating properties by simulating the dynamic heat transfer and temperature regulating process when the materials contact the body skin. A series of indices including the psychosensory intensity, regulating capability index, and relative regulating index were defined to characterize the temperature regulating properties. The measurement principle, the evaluation criteria and grading method, the experimental setup and the test results discussion, and the gage capability analysis of the apparatus are presented. The new apparatus provides a method for the objective measurement and evaluation of the temperature regulating properties of thermal functional porous polymeric materials.
Directory of Open Access Journals (Sweden)
Nerea Sanvisens
2013-04-01
Full Text Available Ribonucleotide reductases (RNRs are essential enzymes that catalyze the reduction of ribonucleotides to desoxyribonucleotides, thereby providing the building blocks required for de novo DNA biosynthesis. The RNR function is tightly regulated because an unbalanced or excessive supply of deoxyribonucleoside triphosphates (dNTPs dramatically increases the mutation rates during DNA replication and repair that can lead to cell death or genetic anomalies. In this review, we focus on Saccharomyces cerevisiae class Ia RNR as a model to understand the different mechanisms controlling RNR function and regulation in eukaryotes. Many studies have contributed to our current understanding of RNR allosteric regulation and, more recently, to its link to RNR oligomerization. Cells have developed additional mechanisms that restrict RNR activity to particular periods when dNTPs are necessary, such as the S phase or upon genotoxic stress. These regulatory strategies include the transcriptional control of the RNR gene expression, inhibition of RNR catalytic activity, and the subcellular redistribution of RNR subunits. Despite class Ia RNRs requiring iron as an essential cofactor for catalysis, little is known about RNR function regulation depending on iron bioavailability. Recent studies into yeast have deciphered novel strategies for the delivery of iron to RNR and for its regulation in response to iron deficiency. Taken together, these studies open up new possibilities to explore in order to limit uncontrolled tumor cell proliferation via RNR.
Dellett, Margaret; Hu, Wanzhou; Papadaki, Vasiliki; Ohnuma, Shin-ichi
2012-04-01
The small leucine-rich repeat proteoglycan (SLRPs) family of proteins currently consists of five classes, based on their structural composition and chromosomal location. As biologically active components of the extracellular matrix (ECM), SLRPs were known to bind to various collagens, having a role in regulating fibril assembly, organization and degradation. More recently, as a function of their diverse proteins cores and glycosaminoglycan side chains, SLRPs have been shown to be able to bind various cell surface receptors, growth factors, cytokines and other ECM components resulting in the ability to influence various cellular functions. Their involvement in several signaling pathways such as Wnt, transforming growth factor-β and epidermal growth factor receptor also highlights their role as matricellular proteins. SLRP family members are expressed during neural development and in adult neural tissues, including ocular tissues. This review focuses on describing SLRP family members involvement in neural development with a brief summary of their role in non-neural ocular tissues and in response to neural injury. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.
International Nuclear Information System (INIS)
Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.
2011-01-01
Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.
Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna
2017-09-01
Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in
Ruiz, Montse C; Haapanen, Saara; Tolvanen, Asko; Robazza, Claudio; Duda, Joan L
2017-08-01
This study examined the relationships between perceptions of the motivational climate, motivation regulations, and the intensity and functionality levels of athletes' pleasant and unpleasant emotional states. Specifically, we examined the hypothesised mediational role of motivation regulations in the climate-emotion relationship. We also tested a sequence in which emotions were assumed to be predicted by the motivational climate dimensions and then served as antecedents to variability in motivation regulations. Participants (N = 494) completed a multi-section questionnaire assessing targeted variables. Structural equation modelling (SEM) revealed that a perceived task-involving climate was a positive predictor of autonomous motivation and of the impact of functional anger, and a negative predictor of the intensity of anxiety and dysfunctional anger. Autonomous motivation was a partial mediator of perceptions of a task-involving climate and the impact of functional anger. An ego-involving climate was a positive predictor of controlled motivation, and of the intensity and impact of functional anger and the intensity of dysfunctional anger. Controlled motivation partially mediated the relationship between an ego-involving climate and the intensity of dysfunctional anger. Good fit to the data also emerged for the motivational climate, emotional states, and motivation regulations sequence. Findings provide support for the consideration of hedonic tone and functionality distinctions in the assessment of athletes' emotional states.
Integrin Beta 1 Suppresses Multilayering of a Simple Epithelium
Chen, Jichao; Krasnow, Mark A.
2012-01-01
Epithelia are classified as either simple, a single cell layer thick, or stratified (multilayered). Stratified epithelia arise from simple epithelia during development, and transcription factor p63 functions as a key positive regulator of epidermal stratification. Here we show that deletion of integrin beta 1 (Itgb1) in the developing mouse airway epithelium abrogates airway branching and converts this monolayer epithelium into a multilayer epithelium with more than 10 extra layers. Mutant lung epithelial cells change mitotic spindle orientation to seed outer layers, and cells in different layers become molecularly and functionally distinct, hallmarks of normal stratification. However, mutant lung epithelial cells do not activate p63 and do not switch to the stratified keratin profile of epidermal cells. These data, together with previous data implicating Itgb1 in regulation of epidermal stratification, suggest that the simple-versus-stratified developmental decision may involve not only stratification inducers like p63 but suppressors like Itgb1 that prevent simple epithelia from inappropriately activating key steps in the stratification program. PMID:23285215
Directory of Open Access Journals (Sweden)
Bronwyn Jane Barkla
2015-06-01
Full Text Available One of the remarkable adaptive features of the halophyte and facultative CAM plant Mesembryathemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples was used to identify 352 significantly differing metabolites (268 after correction for FDR. Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na and Cl ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggest large alterations in Mesembryanthemum crystallinum epidermal bladder cells.
Cdkal1, a type 2 diabetes susceptibility gene, regulates mitochondrial function in adipose tissue
Directory of Open Access Journals (Sweden)
Colin J. Palmer
2017-10-01
Conclusions: Cdkal1 is necessary for normal mitochondrial morphology and function in adipose tissue. These results suggest that the type 2 diabetes susceptibility gene CDKAL1 has novel functions in regulating mitochondrial activity.
Alibardi, Lorenzo; Holthaus, Karin Brigit; Sukseree, Supawadee; Hermann, Marcela; Tschachler, Erwin; Eckhart, Leopold
2016-01-01
The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC) encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine), which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14-18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs). Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP) and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm.
Directory of Open Access Journals (Sweden)
Lorenzo Alibardi
Full Text Available The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine, which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14-18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs. Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm.
L. Cao (Lu); M. Graauw (Marjo de); K. Yan (Kuan); L.C.J. Winkel (Leah C.J.); F.J. Verbeek (Fons)
2016-01-01
textabstractBackground: Endocytosis is regarded as a mechanism of attenuating the epidermal growth factor receptor (EGFR) signaling and of receptor degradation. There is increasing evidence becoming available showing that breast cancer progression is associated with a defect in EGFR endocytosis. In
DEFF Research Database (Denmark)
Povlsen, Gro Klitgaard; Berezin, Vladimir; Bock, Elisabeth
2008-01-01
The neural cell adhesion molecule (NCAM) plays important roles in neuronal development, regeneration, and synaptic plasticity. NCAM homophilic binding mediates cell adhesion and induces intracellular signals, in which the fibroblast growth factor receptor plays a prominent role. Recent studies...... this NCAM-180-induced EGFR down-regulation involves increased EGFR ubiquitination and lysosomal EGFR degradation. Furthermore, NCAM-180-mediated EGFR down-regulation requires NCAM homophilic binding and interactions of the cytoplasmic domain of NCAM-180 with intracellular interaction partners, but does...
Directory of Open Access Journals (Sweden)
Raúl E. Cian
2015-08-01
Full Text Available Based on their composition, marine algae, and namely red seaweeds, are good potential functional foods. Intestinal mucosal barrier function refers to the capacity of the intestine to provide adequate containment of luminal microorganisms and molecules. Here, we will first outline the component of seaweeds and will summarize the effects of these on the regulation of mucosal barrier function. Special attention will be paid to unique components of red seaweeds: proteins and derived peptides (e.g., phycobiliproteins, glycoproteins that contain “cellulose binding domains”, phycolectins and the related mycosporine-like amino acids together with polysaccharides (e.g., floridean starch and sulfated galactans, such as carrageenans, agarans and “dl-hybrid” and minerals. These compounds have been shown to exert prebiotic effects, to regulate intestinal epithelial cell, macrophage and lymphocyte proliferation and differentiation and to modulate the immune response. Molecular mechanisms of action of peptides and polysaccharides are starting to be elucidated, and evidence indicating the involvement of epidermal growth factor receptor (EGFR, insulin-like growth factor receptor (IGFR, Toll-like receptors (TLR and signal transduction pathways mediated by protein kinase B (PKB or AKT, nuclear factor-κB (NF-κB and mitogen activated protein kinases (MAPK will also be summarized. The need for further research is clear, but in vivo experiments point to an overall antiinflammatory effect of these algae, indicating that they can reinforce membrane barrier function.
Bragulla, Hermann; Hirschberg, Ruth M
2003-08-15
Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.
Functional properties of Virus-Encoded and Virus-Regulated 7TM Receptors
DEFF Research Database (Denmark)
Spiess, Katja; Rosenkilde, Mette Marie
2014-01-01
During co-evolution with their hosts, viruses have developed several survival strategies that involve exploitation of 7TM receptors. These include virus-encoded 7TM receptors and ligands and viral regulation of endogenous receptors. Many functional properties have been ascribed to virus-exploited...
Executive function and self-regulated exergaming adherence
Directory of Open Access Journals (Sweden)
Cay eAnderson-Hanley
2014-12-01
Full Text Available The rise in dementia and the evidence of cognitive benefits of exercise for the older adult population together make salient the research into variables affecting cognitive benefit and exercise behavior. One promising avenue for increasing exercise participation has been the introduction of exergaming, a type of exercise that works in combination with virtual reality to enhance both the exercise experience and health outcomes. Past research has revealed that executive function (EF was related to greater use of self-regulatory strategies, which in turn was related to greater adherence to exercise following an intervention (McAuley et al., 2011. Best et al. (2014 found improvement in EF related to adherence to exercise post- intervention. Anderson-Hanley et al. (2012 found that for older adults aerobic exergaming yielded greater cognitive benefit than traditional exercise alone; however, questions remain as to the possible impact of greater cognitive benefit and other factors on participants’ involvement in exercise following the end of an intervention. The current study presents follow-up data exploring the relationship between change in EF, self-regulation, and exercise adherence in the post-intervention (naturalistic period. Herein, it was predicted that improvement in EF during an exercise intervention, would predict subsequent exercise with an exergame during the naturalistic window. Contrary to expectations, results suggest that those with EF decline during the intervention used the exergame more frequently. The results of this study contradict previous literature, but suggest an interesting relationship between change in executive function, self-regulation, and exercise behaviors when exergaming is employed, particularly with older adults with some cognitive decline. We hypothesize that other factors may be at work; perhaps expectation of cognitive benefit might act as a unique motivator or caregivers may be instrumental in adherence.
Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells
International Nuclear Information System (INIS)
Ronald Sluyter; Kylie S Yuen; Gary M Halliday
2001-01-01
There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc
Radiosensitivity of normal human epidermal cells in culture
International Nuclear Information System (INIS)
Dover, R.; Potten, C.S.
1983-01-01
Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)
Kim, Jungmin; Cho, Yunhi
2013-01-01
We have previously reported that dietary gromwell (Lithospermum erythrorhizon; LE) prevents the development of atopic dermatitis (AD) with increased epidermal levels of total ceramide (Cer), the major lipid maintaining epidermal barrier. In this study, we investigated whether the increased level of total Cer induced by dietary LE would be related to the altered metabolism of glucosylceramide (GlcCer) and sphingomyelin (SM), two major precursor lipids in Cer generation. NC/Nga mice, an animal ...
Hinnant, J Benjamin; Nelson, Jackie A; O'Brien, Marion; Keane, Susan P; Calkins, Susan D
2013-01-01
We examined mother-child co-operative behaviour, children's emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic co-operation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more co-operative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood.
Hinnant, J. Benjamin; Nelson, Jackie A.; O’Brien, Marion; Keane, Susan P.; Calkins, Susan D.
2013-01-01
We examined mother-child cooperative behavior, children’s emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic cooperation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more cooperative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood. PMID:23650955
DEFF Research Database (Denmark)
Christensen, M E; Therkildsen, M H; Poulsen, Steen Seier
1993-01-01
the basal cell layer. The present investigation and our previous results confirm the existence of EGF receptors, TGF-alpha and EGF in laryngeal carcinomas. In addition, we conclude that the conditions do exist for growth factors to act through an autocrine system in poorly differentiated tumours and through......Fifteen laryngeal squamous cell carcinomas were investigated for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF) using immunohistochemical methods. In a recent study the same material was characterized for epidermal growth factor receptors (EGF...... receptors) which were confined predominantly to the undifferentiated cells. The expression of this growth factor system in malignant cells may play a role in carcinogenesis and/or tumour growth. All carcinomas were positive for TGF-alpha and 12 were positive for EGF. In moderately-to-well differentiated...
Directory of Open Access Journals (Sweden)
Yu-Chin Lin
2012-06-01
Full Text Available Epidermal growth factor receptor (EGFR is an important oncoprotein that promotes cell growth and proliferation. Dasatinib, a bcr-abl inhibitor, has been approved clinically for the treatment of chronic myeloid leukemia and demonstrated to be effective against solid tumors in vitro through Src inhibition. Here, we disclose that EGFR degradation mediated dasatinib-induced apoptosis in head and neck squamous cell carcinoma (HNSCC cells. HNSCC cells, including Ca9-22, FaDu, HSC3, SAS, SCC-25, and UMSCC1, were treated with dasatinib, and cell viability, apoptosis, and underlying signal transduction were evaluated. Dasatinib exhibited differential sensitivities against HNSCC cells. Growth inhibition and apoptosis were correlated with its inhibition on Akt, Erk, and Bcl-2, irrespective of Src inhibition. Accordingly, we found that down-regulation of EGFR was a determinant of dasatinib sensitivity. Lysosome inhibitor reversed dasatinib-induced EGFR down-regulation, and c-cbl activity was increased by dasatinib, indicating that dasatinib-induced EGFR down-regulation might be through c-cbl-mediated lysosome degradation. Increased EGFR activation by ligand administration rescued cells from dasatinib-induced apoptosis, whereas inhibition of EGFR enhanced its apoptotic effect. Estrogen receptor α (ERα was demonstrated to play a role in Bcl-2 expression, and dasatinib inhibited ERα at the pretranslational level. ERα was associated with EGFR in dasatinib-treated HNSCC cells. Furthermore, the xenograft model showed that dasatinib inhibited HSC3 tumor growth through in vivo down-regulation of EGFR and ERα. In conclusion, degradation of EGFR is a novel mechanism responsible for dasatinib-induced apoptosis in HNSCC cells.
2000-08-01
stromal steroid hormone receptors in mammary gland growth and development using tissue recombinants. J. Mammary Gland Biol. Neoplasia 2, 393-402. Debatin...Birkedal-Hansen (1999) MT1-MMP- deficient mice develop dwarfism , osteopenia, arthritis, and connective tissue disease due to inadequate collagen...al., 1988). Ligands of the epidermal growth hormonally regulated ductal development during puberty and factor receptor (EGFR) are believed to be
Toward a functional analysis of private verbal self-regulation.
Taylor, I; O'Reilly, M F
1997-01-01
We developed a methodology, derived from the theoretical literatures on rule-governed behavior and private events, to experimentally investigate the relationship between covert verbal self-regulation and nonverbal behavior. The methodology was designed to assess whether (a) nonverbal behavior was under the control of covert rules and (b) verbal reports of these rules were functionally equivalent to the covert rules that control non-verbal behavior. The research was conducted in the context of...
Oh, Dong-Ha; Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar; Lee, Sang-Yeol; Bohnert, Hans J; Dassanayake, Maheshi
2015-08-01
Mesembryanthemum crystallinum (ice plant) exhibits extreme tolerance to salt. Epidermal bladder cells (EBCs), developing on the surface of aerial tissues and specialized in sodium sequestration and other protective functions, are critical for the plant's stress adaptation. We present the first transcriptome analysis of EBCs isolated from intact plants, to investigate cell type-specific responses during plant salt adaptation. We developed a de novo assembled, nonredundant EBC reference transcriptome. Using RNAseq, we compared the expression patterns of the EBC-specific transcriptome between control and salt-treated plants. The EBC reference transcriptome consists of 37 341 transcript-contigs, of which 7% showed significantly different expression between salt-treated and control samples. We identified significant changes in ion transport, metabolism related to energy generation and osmolyte accumulation, stress signalling, and organelle functions, as well as a number of lineage-specific genes of unknown function, in response to salt treatment. The salinity-induced EBC transcriptome includes active transcript clusters, refuting the view of EBCs as passive storage compartments in the whole-plant stress response. EBC transcriptomes, differing from those of whole plants or leaf tissue, exemplify the importance of cell type-specific resolution in understanding stress adaptive mechanisms. No claim to original US government works. New Phytologist © 2015 New Phytologist Trust.
Cysteine regulation of protein function--as exemplified by NMDA-receptor modulation.
Lipton, Stuart A; Choi, Yun-Beom; Takahashi, Hiroto; Zhang, Dongxian; Li, Weizhong; Godzik, Adam; Bankston, Laurie A
2002-09-01
Until recently cysteine residues, especially those located extracellularly, were thought to be important for metal coordination, catalysis and protein structure by forming disulfide bonds - but they were not thought to regulate protein function. However, this is not the case. Crucial cysteine residues can be involved in modulation of protein activity and signaling events via other reactions of their thiol (sulfhydryl; -SH) groups. These reactions can take several forms, such as redox events (chemical reduction or oxidation), chelation of transition metals (chiefly Zn(2+), Mn(2+) and Cu(2+)) or S-nitrosylation [the catalyzed transfer of a nitric oxide (NO) group to a thiol group]. In several cases, these disparate reactions can compete with one another for the same thiol group on a single cysteine residue, forming a molecular switch composed of a latticework of possible redox, NO or Zn(2+) modifications to control protein function. Thiol-mediated regulation of protein function can also involve reactions of cysteine residues that affect ligand binding allosterically. This article reviews the basis for these molecular cysteine switches, drawing on the NMDA receptor as an exemplary protein, and proposes a molecular model for the action of S-nitrosylation based on recently derived crystal structures.
International Nuclear Information System (INIS)
Hirata, Y.; Orth, D.N.
1981-01-01
Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)
Directory of Open Access Journals (Sweden)
Lakshmana K Yerneni
2007-01-01
Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed
Isolation and In Vitro Characterization of Epidermal Stem Cells
DEFF Research Database (Denmark)
Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak
2017-01-01
flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...
Insulin action in brain regulates systemic metabolism and brain function.
Kleinridders, André; Ferris, Heather A; Cai, Weikang; Kahn, C Ronald
2014-07-01
Insulin receptors, as well as IGF-1 receptors and their postreceptor signaling partners, are distributed throughout the brain. Insulin acts on these receptors to modulate peripheral metabolism, including regulation of appetite, reproductive function, body temperature, white fat mass, hepatic glucose output, and response to hypoglycemia. Insulin signaling also modulates neurotransmitter channel activity, brain cholesterol synthesis, and mitochondrial function. Disruption of insulin action in the brain leads to impairment of neuronal function and synaptogenesis. In addition, insulin signaling modulates phosphorylation of tau protein, an early component in the development of Alzheimer disease. Thus, alterations in insulin action in the brain can contribute to metabolic syndrome, and the development of mood disorders and neurodegenerative diseases. © 2014 by the American Diabetes Association.
Vaccine-induced toxic epidermal necrolysis: A case and systematic review
Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott
2018-01-01
Background: Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Objective: Herein, we discuss a case of suspected TEN in a 19-yea...