DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Security preparation for receipt of SNF from the FRR to the INEEL
International Nuclear Information System (INIS)
Dahlquist, R.L.
1997-01-01
This paper reports the key security related activities associated with the FRR shipment. Starting with transportation of the SNF in the country of origin to the final destination at the INEEL. Methodology for compliance will be addressed. The graded approach and a three step system will be explained. This paper will be used as part of the planning to support the FRR Project for returning the Asia and European SNF back to the US
Security preparation for receipt of SNF from the FRR to the INEEL
International Nuclear Information System (INIS)
Dahlquist, Rhonda L.
1997-01-01
This paper reports the key security-related activities associated with the Foreign Research Reactors (FRR) shipment. Starting with Transportation of the SNF in the country of origin to the final destination at the INEEL. Methodology for compliance will be addressed. The graded approach and a three-step system will be explained. This paper will be used as part of the planning to support the FRR Project for returning the Asia and European SNF back to the United States. (author)
Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae
Directory of Open Access Journals (Sweden)
Mônica de Oliveira Santos
2007-01-01
Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
FRR: fair remote retrieval of outsourced private medical records in electronic health networks.
Wang, Huaqun; Wu, Qianhong; Qin, Bo; Domingo-Ferrer, Josep
2014-08-01
Cloud computing is emerging as the next-generation IT architecture. However, cloud computing also raises security and privacy concerns since the users have no physical control over the outsourced data. This paper focuses on fairly retrieving encrypted private medical records outsourced to remote untrusted cloud servers in the case of medical accidents and disputes. Our goal is to enable an independent committee to fairly recover the original private medical records so that medical investigation can be carried out in a convincing way. We achieve this goal with a fair remote retrieval (FRR) model in which either t investigation committee members cooperatively retrieve the original medical data or none of them can get any information on the medical records. We realize the first FRR scheme by exploiting fair multi-member key exchange and homomorphic privately verifiable tags. Based on the standard computational Diffie-Hellman (CDH) assumption, our scheme is provably secure in the random oracle model (ROM). A detailed performance analysis and experimental results show that our scheme is efficient in terms of communication and computation. Copyright © 2014 Elsevier Inc. All rights reserved.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk
2018-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase that metabolizes commonly used drugs. The CES1-related pseudogene, carboxylesterase 1 pseudogene 1 (CES1P1), has been implicated in gene exchange with CES1 and in the formation of hybrid genes including the carboxylesterase 1A2 gene (CES1A2...
Integrated Technology Rotor/Flight Research Rotor (ITR/FRR) concept definition
Howes, H. E.; Tomashofski, C. A.
1983-01-01
A program was performed to identify and evaluate a variety of candidate rotor hub configurations for the ITR/FRR. Design criteria were established for the development of the hub concepts. Five initial hub configurations were examined and two were selected for further refinement and evaluation. The selected configurations were bearingless designs. The Classic Elastic Pitch Beam (CEPB) and the Plain Elastic Pitch Beam (PEPB), both exhibit superior qualities for the criteria in the final evalution. The CEPB is favored over the PEPB primarily because it offers better capability for built in damping for stability and is judged to have a lower risk in development.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Directory of Open Access Journals (Sweden)
Hui-Liang Li
2014-09-01
Full Text Available The cDNA encoding the R1-MYB transcription factor, designated as JcR1MYB1, was isolated from Jatropha curcas using rapid amplification of cDNA ends. JcR1MYB1 contains a 951 bp open reading frame that encodes 316 amino acids. The deduced JcR1MYB1 protein was predicted to possess the conserved, 56-amino acid-long DNA-binding domain, which consists of a single helix-turn-helix module and usually occurs in R1-MYBs. JcR1MYB1 is a member of the R1-MYB transcription factor subfamily. A subcellular localization study confirmed the nuclear localization of JcR1MYB1. Expression analysis showed that JcR1MYB1 transcripts accumulated in various examined tissues, with high expression levels in the root and low levels in the stem. JcR1MYB1 transcription was up-regulated by polyethylene glycol, NaCl, and cold treatments, as well as by abscisic acid, jasmonic acid, and ethylene treatment. Analysis of transgenic tobacco plants over-expressing JcR1MYB1 indicates an inportant function for this gene in salt stress.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.
2012-01-01
Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417
Directory of Open Access Journals (Sweden)
Sebastiaan M Bol
Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Tian, Guilian; Zhou, Yun; Hajkova, Dagmar; Miyagi, Masaru; Dinculescu, Astra; Hauswirth, William W; Palczewski, Krzysztof; Geng, Ruishuang; Alagramam, Kumar N; Isosomppi, Juha; Sankila, Eeva-Marja; Flannery, John G; Imanishi, Yoshikazu
2009-07-10
Clarin-1 is the protein product encoded by the gene mutated in Usher syndrome III. Although the molecular function of clarin-1 is unknown, its primary structure predicts four transmembrane domains similar to a large family of membrane proteins that include tetraspanins. Here we investigated the role of clarin-1 by using heterologous expression and in vivo model systems. When expressed in HEK293 cells, clarin-1 localized to the plasma membrane and concentrated in low density compartments distinct from lipid rafts. Clarin-1 reorganized actin filament structures and induced lamellipodia. This actin-reorganizing function was absent in the modified protein encoded by the most prevalent North American Usher syndrome III mutation, the N48K form of clarin-1 deficient in N-linked glycosylation. Proteomics analyses revealed a number of clarin-1-interacting proteins involved in cell-cell adhesion, focal adhesions, cell migration, tight junctions, and regulation of the actin cytoskeleton. Consistent with the hypothesized role of clarin-1 in actin organization, F-actin-enriched stereocilia of auditory hair cells evidenced structural disorganization in Clrn1(-/-) mice. These observations suggest a possible role for clarin-1 in the regulation and homeostasis of actin filaments, and link clarin-1 to the interactive network of Usher syndrome gene products.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Forster, B; Ropohl, D; Raule, P
1977-07-05
The manual examination of rigor mortis as currently used and its often subjective evaluation frequently produced highly incorrect deductions. It is therefore desirable that such inaccuracies should be replaced by the objective measuring of rigor mortis at the extremities. To that purpose a method is described which can also be applied in on-the-spot investigations and a new formula for the determination of rigor mortis--indices (FRR) is introduced.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.
Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C
2001-01-01
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.
1998-01-01
Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Directory of Open Access Journals (Sweden)
Martin Hampel
Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
Li, Min-Hui; Xie, Xiao-Ling; Lin, Xian-Feng; Shi, Jin-Xiu; Ding, Zhao-Jian; Ling, Jin-Feng; Xi, Ping-Gen; Zhou, Jia-Nuan; Leng, Yueqiang; Zhong, Shaobin; Jiang, Zi-De
2014-04-01
Fusarium oxysporum f. sp. cubense (FOC) is the causal agent of banana Fusarium wilt and has become one of the most destructive pathogens threatening the banana production worldwide. However, few genes related to morphogenesis and pathogenicity of this fungal pathogen have been functionally characterized. In this study, we identified and characterized the disrupted gene in a T-DNA insertional mutant (L953) of FOC with significantly reduced virulence on banana plants. The gene disrupted by T-DNA insertion in L953 harbors an open reading frame, which encodes a protein with homology to α-1,6-mannosyltransferase (OCH1) in fungi. The deletion mutants (ΔFoOCH1) of the OCH1 orthologue (FoOCH1) in FOC were impaired in fungal growth, exhibited brighter staining with fluorescein isothiocyanate (FITC)-Concanavalin A, had less cell wall proteins and secreted more proteins into liquid media than the wild type. Furthermore, the mutation or deletion of FoOCH1 led to loss of ability to penetrate cellophane membrane and decline in hyphal attachment and colonization as well as virulence to the banana host. The mutant phenotypes were fully restored by complementation with the wild type FoOCH1 gene. Our data provide a first evidence for the critical role of FoOCH1 in maintenance of cell wall integrity and virulence of F. oxysporum f. sp. cubense. Copyright © 2014 Elsevier Inc. All rights reserved.
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Energy Technology Data Exchange (ETDEWEB)
Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others
1994-09-15
Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.
Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier
2006-01-01
NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein
International Nuclear Information System (INIS)
Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.
2006-01-01
The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions
DEFF Research Database (Denmark)
Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.
2002-01-01
of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan
2016-06-01
Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Nomenclature for alleles of the human carboxylesterase 1 gene
DEFF Research Database (Denmark)
Rasmussen, Henrik B.; Madsen, Majbritt B.; Bjerre, Ditte
2017-01-01
The carboxylesterase 1 gene (CES1) in humans encodes a hydrolase, which is implicated in the metabolism of several commonly used drugs 1. This gene is located on chromosome 16 with a highly homologous pseudogene, CES1P1, in its proximity. A duplicated segment of CES1 replaces most of CES1P1 in some...... appears to be low 8,13. The formation of hybrids consisting of a gene and a related pseudogene has been reported for other genes than CES1. This includes the hybrids of the gene encoding cytochrome P450 2D6 (CYP2D6) and pseudogene CYP2D7, that is, the so-called CYP2D7/D6 hybrids 14......,15. These are categorized as CYP2D6 variants and not as variants of pseudogene CYP2D716....
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint
2004-02-01
Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Diehl, David L; LaPara, Timothy M
2010-12-01
The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Directory of Open Access Journals (Sweden)
Francesco Pezzini
2017-08-01
Full Text Available CLN1 disease (OMIM #256730 is an early childhood ceroid-lipofuscinosis associated with mutated CLN1, whose product Palmitoyl-Protein Thioesterase 1 (PPT1 is a lysosomal enzyme involved in the removal of palmitate residues from S-acylated proteins. In neurons, PPT1 expression is also linked to synaptic compartments. The aim of this study was to unravel molecular signatures connected to CLN1. We utilized SH-SY5Y neuroblastoma cells overexpressing wild type CLN1 (SH-p.wtCLN1 and five selected CLN1 patients’ mutations. The cellular distribution of wtPPT1 was consistent with regular processing of endogenous protein, partially detected inside Lysosomal Associated Membrane Protein 2 (LAMP2 positive vesicles, while the mutants displayed more diffuse cytoplasmic pattern. Transcriptomic profiling revealed 802 differentially expressed genes (DEGs in SH-p.wtCLN1 (as compared to empty-vector transfected cells, whereas the number of DEGs detected in the two mutants (p.L222P and p.M57Nfs*45 was significantly lower. Bioinformatic scrutiny linked DEGs with neurite formation and neuronal transmission. Specifically, neuritogenesis and proliferation of neuronal processes were predicted to be hampered in the wtCLN1 overexpressing cell line, and these findings were corroborated by morphological investigations. Palmitoylation survey identified 113 palmitoylated protein-encoding genes in SH-p.wtCLN1, including 25 ones simultaneously assigned to axonal growth and synaptic compartments. A remarkable decrease in the expression of palmitoylated proteins, functionally related to axonal elongation (GAP43, CRMP1 and NEFM and of the synaptic marker SNAP25, specifically in SH-p.wtCLN1 cells was confirmed by immunoblotting. Subsequent, bioinformatic network survey of DEGs assigned to the synaptic annotations linked 81 DEGs, including 23 ones encoding for palmitoylated proteins. Results obtained in this experimental setting outlined two affected functional modules (connected to
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H
2014-10-01
Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Directory of Open Access Journals (Sweden)
Chen Yuan
2005-05-01
Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Directory of Open Access Journals (Sweden)
Hsin-Chou Yang
Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to
Rare Variants in Genes Encoding MuRF1 and MuRF2 Are Modifiers of Hypertrophic Cardiomyopathy
Directory of Open Access Journals (Sweden)
Ming Su
2014-05-01
Full Text Available Modifier genes contribute to the diverse clinical manifestations of hypertrophic cardiomyopathy (HCM, but are still largely unknown. Muscle ring finger (MuRF proteins are a class of muscle-specific ubiquitin E3-ligases that appear to modulate cardiac mass and function by regulating the ubiquitin-proteasome system. In this study we screened all the three members of the MuRF family, MuRF1, MuRF2 and MuRF3, in 594 unrelated HCM patients and 307 healthy controls by targeted resequencing. Identified rare variants were confirmed by capillary Sanger sequencing. The prevalence of rare variants in both MuRF1 and MuRF2 in HCM patients was higher than that in control subjects (MuRF1 13/594 (2.2% vs. 1/307 (0.3%, p = 0.04; MuRF2 22/594 (3.7% vs. 2/307 (0.7%; p = 0.007. Patients with rare variants in MuRF1 or MuRF2 were younger (p = 0.04 and had greater maximum left ventricular wall thickness (p = 0.006 than those without such variants. Mutations in genes encoding sarcomere proteins were present in 19 (55.9% of the 34 HCM patients with rare variants in MuRF1 and MuRF2. These data strongly supported that rare variants in MuRF1 and MuRF2 are associated with higher penetrance and more severe clinical manifestations of HCM. The findings suggest that dysregulation of the ubiquitin-proteasome system contributes to the pathogenesis of HCM.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah
2008-08-01
Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues.
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L
2015-04-15
Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita
2015-10-01
Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
International Nuclear Information System (INIS)
Deveaux, Yves
1999-01-01
DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii
Minchenko, D O; Riabovol, O O; Ratushna, O O; Minchenko, O H
2017-01-01
The aim of the present study was to examine the effect of inhibition of endoplasmic reticulum stress signaling, mediated by IRE1 (inositol requiring enzyme 1), which is a central mediator of the unfolded protein response on the expression of genes encoded estrogen related proteins (NRIP1/RIP140, TRIM16/EBBP, ESRRA/NR3B1, FAM162A/E2IG5, PGRMC2/PMBP, and SLC39A6/LIV-1) and their hypoxic regulation in U87 glioma cells for evaluation of their possible significance in the control of glioma cells proliferation. The expression of NRIP1, EBBP, ESRRA, E2IG5, PGRMC2, and SLC39A6 genes in U87 glioma cells, transfected by empty vector pcDNA3.1 (control) and cells without IRE1 signaling enzyme function (transfected by dnIRE1) upon hypoxia, was studied by a quantitative polymerase chain reaction. Inhibition of both enzymatic activities (kinase and endoribonuclease) of IRE1 signaling enzyme function up-regulates the expression of EBBP, E2IG5, PGRMC2, and SLC39A6 genes is in U87 glioma cells in comparison with the control glioma cells, with more significant changes for E2IG5 and PGRMC2 genes. At the same time, the expression of NRIP1 and ESRRA genes is strongly down-regulated in glioma cells upon inhibition of IRE1. We also showed that hypoxia increases the expression of E2IG5, PGRMC2, and EBBP genes and decreases NRIP1 and ESRRA genes expression in control glioma cells. Furthermore, the inhibition of IRE1 in U87 glioma cells decreases the eff ect of hypoxia on the expression of E2IG5 and PGRMC2 genes, eliminates hypoxic regulation of NRIP1 gene, and enhances the sensitivity of ESRRA gene to hypoxic condition. Furthermore, the expression of SLC39A6 gene is resistant to hypoxia in both the glioma cells with and without IRE1 signaling enzyme function. Results of this investigation demonstrate that inhibition of IRE1 signaling enzyme function affects the expression of NRIP1, EBBP, ESRRA, E2IG5, PGRMC2, and SLC39A6 genes in U87 glioma cells in gene specific manner and these changes
Assignment of the human UDP glucuronosyltransferase gene (UGT1A1) to chromosome region 2q37
van Es, H. H.; Bout, A.; Liu, J.; Anderson, L.; Duncan, A. M.; Bosma, P.; Oude Elferink, R.; Jansen, P. L.; Chowdhury, J. R.; Schurr, E.
1993-01-01
UDP glucuronosyltransferases (UGTs) comprise a multigene family of drug-metabolizing enzymes. The sub-family of UGTs that conjugate bilirubin and phenolic compounds with glucuronic acid has been termed UGT1A1. In man, UGT1A1 isoforms are encoded by a single gene, UGT1A1. Protein isoforms encoded by
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah
2008-01-01
Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues. PMID:18757553
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
DEFF Research Database (Denmark)
Gerdes, K; Helin, K; Christensen, O W
1988-01-01
The parB locus of plasmid R1, which mediates plasmid stability via postsegregational killing of plasmid-free cells, encodes two genes, hok and sok. The hok gene product is a potent cell-killing protein. The hok gene is regulated at the translational level by the sok gene-encoded repressor, a small...
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Maclaren, R.E.; Groppe, M.; Barnard, A.R.; Cottriall, C.L.; Tolmachova, T.; Seymour, L.; Clark, K.; During, M.J.; Cremers, F.P.M.; Black, G.C.M.; Lotery, A.J.; Downes, S.M.; Webster, A.R.; Seabra, M.C.
2014-01-01
BACKGROUND: Choroideremia is an X-linked recessive disease that leads to blindness due to mutations in the CHM gene, which encodes the Rab escort protein 1 (REP1). We assessed the effects of retinal gene therapy with an adeno-associated viral (AAV) vector encoding REP1 (AAV.REP1) in patients with
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhou Yong
2018-01-01
Full Text Available Stress associated proteins (SAPs play important roles in developmental processes, responses to various stresses and hormone stimulation in plants. However, little is known about the SAP gene family in Medicago truncatula. In this study, a total of 17 MtSAP genes encoding A20/AN1 zinc-finger proteins were characterized. Out of these 17 genes, 15 were distributed over all 8 chromosomes at different densities, and two segmental duplication events were detected. The phylogenetic analysis of these proteins and their orthologs from Arabidopsis and rice suggested that they could be classified into five out of the seven groups of SAP family genes, with genes in the same group showing similar structures and conserved domains. The cis-elements of the MtSAP promoters were studied, and many cis-elements related to stress and plant hormone responses were identified. We also investigated the stress-responsive expression patterns of the MtSAP genes under various stresses, including drought, exposure to NaCl and cold. The qRT-PCR results showed that numerous MtSAP genes exhibited transcriptional responses to multiple abiotic stresses. These results lay the foundation for further functional characterization of SAP genes. To the best of our knowledge, this is the first report of a genome-wide analysis of the SAP gene family in M. truncatula.
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
Rep, M; Nooy, J; Guélin, E; Grivell, L A
1996-08-01
The AFG3 gene of Saccharomyces cerevisiae encodes a mitochondrial inner membrane protein with ATP-dependent protease activity. To gain more insight into the function of this protein, multi-copy suppressors of an afg3-null mutation were isolated. Three genes were found that restored partial growth on non-fermentable carbon sources, all of which affect the biogenesis of respiratory competent mitochondria: PIM1(LON) encodes a matrix-localized ATP-dependent protease involved in the turnover of matrix proteins; OXA1(PET1402) encodes a putative mitochondrial inner membrane protein involved in the biogenesis of the respiratory chain; and MBA1 encodes a mitochondrial protein required for optimal respiratory growth. All three genes also suppressed a null mutation in a related gene, RCA1, as well as in the combination of afg3- and rca1-null.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Hirota, Ryuichi; Kato, Junichi; Morita, Hiromu; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao
2002-03-01
The cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) large and small subunits in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11 were cloned and sequenced. The deduced gene products, CbbL and CbbS, had 93 and 87% identity with Thiobacillus intermedius CbbL and Nitrobacter winogradskyi CbbS, respectively. Expression of cbbL and cbbS in Escherichia coli led to the detection of RubisCO activity in the presence of 0.1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG). To our knowledge, this is the first paper to report the genes involved in the carbon fixation reaction in chemolithotrophic ammonia-oxidizing bacteria.
Song, Sang-Kee
2016-12-01
In this study, a tissue-specific GAL4/UAS activation tagging system was used for the characterization of genes which could induce lethality when ubiquitously expressed. A dominant mutant exhibiting stunted growth was isolated and named defective root development 1-D (drd1-D). The T-DNA tag was located within the promoter region of AtTX12, which is predicted to encode a truncated nucleotide-binding leucinerich repeat (NLR) protein, containing a Toll/interleukin-1 receptor (TIR) domain. The transcript levels of AtTX12 and defense-related genes were elevated in drd1-D, and the misexpression of AtTX12 recapitulated the drd1-D phenotypes. In the presence of ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1), a key transducer of signals triggered by TIR-type NLRs, a low-level of AtTX12 misexpression induced strong defective phenotypes including seedling lethality whereas, in the absence of EDS1, a high-level of AtTX12 misexpression induced weak growth defects like dwarfism, suggesting that AtTX12 might function mainly in an EDS1-dependent and partially in an EDS1-independent manner. [BMB Reports 2016; 49(12): 693-698].
DEFF Research Database (Denmark)
Nielsen, O; Friis, T; Kjaerulff, S
1996-01-01
Cells of Schizosaccharomyces pombe undergo mating and meiosis when starved for a nitrogen source. In this process a P and and M cell first mate to generate a diploid zygote, which subsequently enters meiosis and sporulates. The P mating type is controlled by the mat1-Pc gene at the mating type lo...... cerevisiae MCM1. The Mat1-Pc protein contains a motif characteristic for proteins that interact with MADS-box factors, suggesting that Mat-Pc and Map1 may form a heterodimer that activates the P-specific map3 gene....
Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S
2010-06-01
Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
Sequence analysis and overexpression of a pectin lyase gene (pel1) from Aspergillus oryzae KBN616.
Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N
2001-01-01
A gene (pel1) encoding pectin lyase (Pel1) was isolated from a shoyu koji mold, Aspergillus oryzae KBN616, and characterized. The structural gene comprised 1,196 bp with a single intron. The ORF encoded 381 amino acids with a signal peptide of 20 amino acids. The deduced amino acid sequence showed high similarity to those of Aspergillus niger pectin lyases and Glomerella cingulata PnlA. The pel1 gene was successfully overexpressed under the promoter of the A. oryzae TEF1 gene. The molecular mass of the recombinant pectin lyase substantially coincided with that calculated based on nucleotide sequence.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
[Cloning and characterization of Caveolin-1 gene in pigeon, Columba livia domestica].
Zhang, Ying; Yu, Jian-Feng; Yang, Li; Wang, Xing-Guo; Gu, Zhi-Liang
2010-10-01
Caveolins, a class of principal proteins forming the structure of caveolae in plasmalemma, were encoded by caveolins gene family. Caveolin-1 gene is a member of caveolins gene family. In the present study, a full-length of 2605 bp caveolin-1 cDNA sequence in Columba livia domestica, which included a 537 bp complete ORF encoding a 178 amino acids long putative peptide, were obtained by using RT-PCR and RACE technique. The Columba livia domestica caveolin-1 CDS shared 80.1% - 93.4% homology with Bos taurus, Canis lupus familiaris, Gallus gallus and Rattus norvegicus. Meanwhile, the putative amino acid sequence of Columba livia domestica caveolin-1 shared 85.4% - 97.2% homology with the above species. The semi-quantity RT-PCR revealed that Caveolin-1 expressions were detectable in all the Columba livia domestica tissues and the expressional level of caveolin-1 gene was high in adipose, medium in various muscles, low in liver. These results demonstrated that Caveolin-1 gene was potentially involved in some metabolic pathways in adipose and muscle.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The bromodomain protein LEX-1 acts with TAM-1 to modulate gene expression in C. elegans.
Tseng, Rong-Jeng; Armstrong, Kristin R; Wang, Xiaodong; Chamberlin, Helen M
2007-11-01
In many organisms, repetitive DNA serves as a trigger for gene silencing. However, some gene expression is observed from repetitive genomic regions such as heterochromatin, suggesting mechanisms exist to modulate the silencing effects. From a genetic screen in C. elegans, we have identified mutations in two genes important for expression of repetitive sequences: lex-1 and tam-1. Here we show that lex-1 encodes a protein containing an ATPase domain and a bromodomain. LEX-1 is similar to the yeast Yta7 protein, which maintains boundaries between silenced and active chromatin. tam-1 has previously been shown to encode a RING finger/B-box protein that modulates gene expression from repetitive DNA. We find that lex-1, like tam-1, acts as a class B synthetic multivulva (synMuv) gene. However, since lex-1 and tam-1 mutants have normal P granule localization, it suggests they act through a mechanism distinct from other class B synMuvs. We observe intragenic (interallelic) complementation with lex-1 and a genetic interaction between lex-1 and tam-1, data consistent with the idea that the gene products function in the same biological process, perhaps as part of a protein complex. We propose that LEX-1 and TAM-1 function together to influence chromatin structure and to promote expression from repetitive sequences.
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.
2010-01-01
Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Keszthelyi, A.; Jeney, A.; Kerenyi, Z.; Mendes, O.; Waalwijk, C.; Hornok, L.
2007-01-01
Mating type in filamentous ascomycetes is controlled by idiomorphic alleles, named MAT1-1 and MAT1-2, which contain 1-3 genes. Of these genes MAT1-1-1 and MAT1-2-1 encode putative transcription factors and are thus considered to be the major regulators of sexual communication and mating. Fungi with
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Wilson, R B; Renault, G; Jacquet, M; Tatchell, K
1993-07-05
The high affinity cAMP phosphodiesterase, encoded by PDE2, is an important component of the cAMP-dependent protein kinase signaling system in Saccharomyces cerevisiae. An unexpected phenotype of pde2 mutants is sensitivity to external cAMP. This trait has been found independently for rca1 mutants and has been used to monitor the effects of cAMP on several biological processes. We demonstrate here that RCA1 is identical to PDE2. Further analysis of the phenotype of pde2 deletions reveal that exogenously added cAMP results in an increase in the internal level of cAMP. This increase slows down the rate of cell division by increasing the length of the G1 phase of the cell cycle and leads to increased cell volume. Also, cells with a disrupted PDE2 gene previously arrested by nutrient starvation rapidly lose thermotolerance when incubated with exogenous cAMP. From these observations we propose that a role of the PDE2-encoded phosphodiesterase may be to help insulate the internal cAMP pools from the external environment. This protective role might also be important in other eukaryotic organisms where cAMP is a key second messenger.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Directory of Open Access Journals (Sweden)
Marek K Krzyzanowski
Full Text Available The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus, but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol, inhibiting DNA replication (hydroxyurea, and destabilizing the plasma membrane (SDS; this hypersensitivity can be abolished by expression of S. pombe erh1(+ and, to a lesser extent, S. japonicus erh1(+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
DIA1R is an X-linked gene related to Deleted In Autism-1.
Directory of Open Access Journals (Sweden)
Azhari Aziz
Full Text Available BACKGROUND: Autism spectrum disorders (ASDS are frequently occurring disorders diagnosed by deficits in three core functional areas: social skills, communication, and behaviours and/or interests. Mental retardation frequently accompanies the most severe forms of ASDs, while overall ASDs are more commonly diagnosed in males. Most ASDs have a genetic origin and one gene recently implicated in the etiology of autism is the Deleted-In-Autism-1 (DIA1 gene. METHODOLOGY/PRINCIPAL FINDINGS: Using a bioinformatics-based approach, we have identified a human gene closely related to DIA1, we term DIA1R (DIA1-Related. While DIA1 is autosomal (chromosome 3, position 3q24, DIA1R localizes to the X chromosome at position Xp11.3 and is known to escape X-inactivation. The gene products are of similar size, with DIA1 encoding 430, and DIA1R 433, residues. At the amino acid level, DIA1 and DIA1R are 62% similar overall (28% identical, and both encode signal peptides for targeting to the secretory pathway. Both genes are ubiquitously expressed, including in fetal and adult brain tissue. CONCLUSIONS/SIGNIFICANCE: Examination of published literature revealed point mutations in DIA1R are associated with X-linked mental retardation (XLMR and DIA1R deletion is associated with syndromes with ASD-like traits and/or XLMR. Together, these results support a model where the DIA1 and DIA1R gene products regulate molecular traffic through the cellular secretory pathway or affect the function of secreted factors, and functional deficits cause disorders with ASD-like symptoms and/or mental retardation.
Cloning and expression analysis of FaPR-1 gene in strawberry
Mo, Fan; Luo, Ya; Ge, Cong; Mo, Qin; Ling, Yajie; Luo, Shu; Tang, Haoru
2018-04-01
The FaPR-1 gene was cloned by RT-PCR from `Benihoppe' strawberry and its bioinformatics analysis was conducted. The results showed that the open reading frame was 483 bp encoding encoding l60 amino acids which protein molecular weight and theoretical isoelectricity were 17854.17 and 8.72 respectively. Subcellular localization prediction shows that this gene is located extracellularly. By comparing strawberry FaPR-l and other plant Pathogenesis-related protein, homology and phylogenetic tree construction showed that the homology with grapes, peach is relatively close. In the treatments of ABA, sucrose and the mixture of the two, the expression of FaPR-1 in strawberry fruit were significantly increased.
Directory of Open Access Journals (Sweden)
Lisa Zecchi
Full Text Available Recombination-dependent DNA replication, which is a central component of viral replication restart, is poorly understood in Firmicutes bacteriophages. Phage SPP1 initiates unidirectional theta DNA replication from a discrete replication origin (oriL, and when replication progresses, the fork might stall by the binding of the origin binding protein G38P to the late replication origin (oriR. Replication restart is dependent on viral recombination proteins to synthesize a linear head-to-tail concatemer, which is the substrate for viral DNA packaging. To identify new functions involved in this process, uncharacterized genes from phage SPP1 were analyzed. Immediately after infection, SPP1 transcribes a number of genes involved in recombination and replication from P(E2 and P(E3 promoters. Resequencing the region corresponding to the last two hypothetical genes transcribed from the P(E2 operon (genes 44 and 45 showed that they are in fact a single gene, re-annotated here as gene 44, that encodes a single polypeptide, named gene 44 product (G44P, 27.5 kDa. G44P shares a low but significant degree of identity in its C-terminal region with virus-encoded RusA-like resolvases. The data presented here demonstrate that G44P, which is a dimer in solution, binds with high affinity but without sequence specificity to several double-stranded DNA recombination intermediates. G44P preferentially cleaves Holliday junctions, but also, with lower efficiency, replicated D-loops. It also partially complemented the loss of RecU resolvase activity in B. subtilis cells. These in vitro and in vivo data suggest a role for G44P in replication restart during the transition to concatemeric viral replication.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.
Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V
2015-12-01
The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos
1998-01-01
The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Minsky, Neri; Roeder, Robert G
2017-01-06
Secreted proteins serve pivotal roles in the development of multicellular organisms, acting as structural matrix, extracellular enzymes, and signal molecules. However, how the secretome is regulated remains incompletely understood. Here we demonstrate, unexpectedly, that peroxisome proliferator-activated receptor γ coactivator 1-α (PGC-1α), a critical transcriptional co-activator of metabolic gene expression, functions to down-regulate the expression of diverse genes encoding secreted molecules and extracellular matrix components to modulate the secretome. Using cell lines, primary cells, and mice, we show that both endogenous and exogenous PGC-1α down-regulate the expression of numerous genes encoding secreted molecules. Mechanistically, results obtained using mRNA stability measurements as well as intronic RNA expression analysis are consistent with a transcriptional effect of PGC-1α on the expression of genes encoding secreted proteins. Interestingly, PGC-1α requires the central heat shock response regulator heat shock factor protein 1 (HSF1) to affect some of its targets, and both factors co-reside on several target genes encoding secreted molecules in cells. Finally, using a mass spectrometric analysis of secreted proteins, we demonstrate that PGC-1α modulates the secretome of mouse embryonic fibroblasts. Our results define a link between a key pathway controlling metabolic regulation and the regulation of the mammalian secretome. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Izumi, Yuriko; Kamei, Eri; Miyamoto, Yoko; Ohtani, Kouhei; Masunaka, Akira; Fukumoto, Takeshi; Gomi, Kenji; Tada, Yasuomi; Ichimura, Kazuya; Peever, Tobin L; Akimitsu, Kazuya
2012-08-01
The rough lemon pathotype of Alternaria alternata produces host-selective ACR-toxin and causes Alternaria leaf spot disease of the rootstock species rough lemon (Citrus jambhiri) and Rangpur lime (C. limonia). Genes controlling toxin production were localized to a 1.5-Mb chromosome carrying the ACR-toxin biosynthesis gene cluster (ACRT) in the genome of the rough lemon pathotype. A genomic BAC clone containing a portion of the ACRT cluster was sequenced which allowed identification of three open reading frames present only in the genomes of ACR-toxin producing isolates. We studied the functional role of one of these open reading frames, ACRTS1 encoding a putative hydroxylase, in ACR-toxin production by homologous recombination-mediated gene disruption. There are at least three copies of ACRTS1 gene in the genome and disruption of two copies of this gene significantly reduced ACR-toxin production as well as pathogenicity; however, transcription of ACRTS1 and production of ACR-toxin were not completely eliminated due to remaining functional copies of the gene. RNA-silencing was used to knock down the remaining ACRTS1 transcripts to levels undetectable by reverse transcription-polymerase chain reaction. The silenced transformants did not produce detectable ACR-toxin and were not pathogenic. These results indicate that ACRTS1 is an essential gene in ACR-toxin biosynthesis in the rough lemon pathotype of A. alternata and is required for full virulence of this fungus.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Kane, Garvan C; Lam, Chen-Fuh; O'Cochlain, Fearghas; Hodgson, Denice M; Reyes, Santiago; Liu, Xiao-Ke; Miki, Takashi; Seino, Susumu; Katusic, Zvonimir S; Terzic, Andre
2006-11-01
Sepsis, the systemic inflammatory response to infection, imposes a high demand for bodily adaptation, with the cardiovascular response a key determinant of outcome. The homeostatic elements that secure cardiac tolerance in the setting of the sepsis syndrome are poorly understood. Here, in a model of acute septic shock induced by endotoxin challenge with Escherichia coli lipopolysaccharide (LPS), knockout of the KCNJ8 gene encoding the vascular Kir6.1 K(ATP) channel pore predisposed to an early and profound survival disadvantage. The exaggerated susceptibility provoked by disruption of this stress-responsive sensor of cellular metabolism was linked to progressive deterioration in cardiac activity, ischemic myocardial damage, and contractile dysfunction. Deletion of KCNJ8 blunted the responsiveness of coronary vessels to cytokine- or metabolic-mediated vasodilation necessary to support myocardial perfusion in the wild-type (WT), creating a deficit in adaptive response in the Kir6.1 knockout. Application of a K(ATP) channel opener drug improved survival in the endotoxic WT but had no effect in the Kir6.1 knockout. Restoration of the dilatory capacity of coronary vessels was required to rescue the Kir6.1 knockout phenotype and reverse survival disadvantage in lethal endotoxemia. Thus, the Kir6.1-containing K(ATP) channel, by coupling vasoreactivity with metabolic demand, provides a vital feedback element for cardiovascular tolerance in endotoxic shock.
Cloning of a novel gene, Cymg1, related to family 2 cystatins and ...
Indian Academy of Sciences (India)
We have cloned a novel gene, Cymg1 (GenBank accession number AY600990), from a mouse testis cDNA library. Cymg1 is located in 2G3 of mouse chromosome 2. The cDNA includes an open reading frame that encodes 141 amino acid residues. The encoded polypeptide has a cysteine protease inhibitor domain found ...
International Nuclear Information System (INIS)
Jang, Su Jin; Kang, Joo Hyun; Kim, Kwang Il; Lee, Tae Sup; Lee, Yong Jin; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo
2010-01-01
Suicidal gene therapy is based on the transduction of tumor cells with 'suicide' genes encoding for prodrugactivating enzymes that render target cells susceptible to prodrug treatment. Suicidal gene therapy results in the death of tumor with the expression of gene encoding enzyme that converts non-toxic prodrug into cytotoxic product. Cytochrome P450 4B1 (CYP4B1) activates 4- ipomeanol (4-ipo) and 2-aminoanthracene (2-AA) to cytotoxic furane epoxide and unsaturated dialdehyde intermediate. In this study, therapeutic effects of suicidal gene therapy with rabbit CYP4B1/4-ipo or CYP4B1/2-AA system
Endele, S; Fuhry, M; Pak, S J; Zabel, B U; Winterpacht, A
1999-09-01
Deletions within human chromosome 4p16.3 cause Wolf-Hirschhorn syndrome (WHS), which is characterized by severe mental and developmental defects. It is thought that haploinsufficiency of more than one gene contributes to the complex phenotype. We have cloned and characterized a novel gene (LETM1) that is deleted in nearly all WHS patients. LETM1 encodes a putative member of the EF-hand family of Ca(2+)-binding proteins. The protein contains two EF-hands, a transmembrane domain, a leucine zipper, and several coiled-coil domains. On the basis of its possible Ca(2+)-binding property and involvement in Ca(2+) signaling and/or homeostasis, we propose that haploinsufficiency of LETM1 may contribute to the neuromuscular features of WHS patients. Copyright 1999 Academic Press.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Gene number determination and genetic polymorphism of the gamma delta T cell co-receptor WC1 genes
Directory of Open Access Journals (Sweden)
Chen Chuang
2012-10-01
Full Text Available Abstract Background WC1 co-receptors belong to the scavenger receptor cysteine-rich (SRCR superfamily and are encoded by a multi-gene family. Expression of particular WC1 genes defines functional subpopulations of WC1+ γδ T cells. We have previously identified partial or complete genomic sequences for thirteen different WC1 genes through annotation of the bovine genome Btau_3.1 build. We also identified two WC1 cDNA sequences from other cattle that did not correspond to sequences in the Btau_3.1 build. Their absence in the Btau_3.1 build may have reflected gaps in the genome assembly or polymorphisms among animals. Since the response of γδ T cells to bacterial challenge is determined by WC1 gene expression, it was critical to understand whether individual cattle or breeds differ in the number of WC1 genes or display polymorphisms. Results Real-time quantitative PCR using DNA from the animal whose genome was sequenced (“Dominette” and sixteen other animals representing ten breeds of cattle, showed that the number of genes coding for WC1 co-receptors is thirteen. The complete coding sequences of those thirteen WC1 genes is presented, including the correction of an error in the WC1-2 gene due to mis-assembly in the Btau_3.1 build. All other cDNA sequences were found to agree with the previous annotation of complete or partial WC1 genes. PCR amplification and sequencing of the most variable N-terminal SRCR domain (domain 1 which has the SRCR “a” pattern of each of the thirteen WC1 genes showed that the sequences are highly conserved among individuals and breeds. Of 160 sequences of domain 1 from three breeds of cattle, no additional sequences beyond the thirteen described WC1 genes were found. Analysis of the complete WC1 cDNA sequences indicated that the thirteen WC1 genes code for three distinct WC1 molecular forms. Conclusion The bovine WC1 multi-gene family is composed of thirteen genes coding for three structural forms whose
DEFF Research Database (Denmark)
Knudsen, K; Madsen, AS; Mygind, P
1999-01-01
Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...
Molecular characterization of the porcine deleted in malignant brain tumors 1 gene (DMBT1)
DEFF Research Database (Denmark)
Haase, Bianca; Humphray, Sean J; Lyer, Stefan
2006-01-01
The human gene deleted in malignant brain tumors 1 (DMBT1) is considered to play a role in tumorigenesis and pathogen defense. It encodes a protein with multiple scavenger receptor cysteine-rich (SRCR) domains, which are involved in recognition and binding of a broad spectrum of bacterial pathogens...
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.
Zhao, D; Yu, Q; Chen, M; Ma, H
2001-07-01
The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.
Directory of Open Access Journals (Sweden)
Roberto eRiquelme-Neira
2016-01-01
Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
DEFF Research Database (Denmark)
Hanotel, Julie; Bessodes, Nathalie; Thélie, Aurore
2014-01-01
The basic helix-loop-helix (bHLH) transcriptional activator Ptf1a determines inhibitory GABAergic over excitatory glutamatergic neuronal cell fate in progenitors of the vertebrate dorsal spinal cord, cerebellum and retina. In an in situ hybridization expression survey of PR domain containing genes...... encoding putative chromatin-remodeling zinc finger transcription factors in Xenopus embryos, we identified Prdm13 as a histone methyltransferase belonging to the Ptf1a synexpression group. Gain and loss of Ptf1a function analyses in both frog and mice indicates that Prdm13 is positively regulated by Ptf1a...
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Energy Technology Data Exchange (ETDEWEB)
Jang, Su Jin; Kang, Joo Hyun; Kim, Kwang Il; Lee, Tae Sup; Lee, Yong Jin; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2010-10-15
Suicidal gene therapy is based on the transduction of tumor cells with 'suicide' genes encoding for prodrugactivating enzymes that render target cells susceptible to prodrug treatment. Suicidal gene therapy results in the death of tumor with the expression of gene encoding enzyme that converts non-toxic prodrug into cytotoxic product. Cytochrome P450 4B1 (CYP4B1) activates 4- ipomeanol (4-ipo) and 2-aminoanthracene (2-AA) to cytotoxic furane epoxide and unsaturated dialdehyde intermediate. In this study, therapeutic effects of suicidal gene therapy with rabbit CYP4B1/4-ipo or CYP4B1/2-AA system
Energy Technology Data Exchange (ETDEWEB)
Kamei, Yuka; Tamura, Takayuki [Department of Bioscience, Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, Shiga 526-0829 (Japan); Yoshida, Ryo [Department of Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ohta, Shinji [Department of Bioscience, Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, Shiga 526-0829 (Japan); Fukusaki, Eiichiro [Department of Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp [Department of Bioscience, Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, Shiga 526-0829 (Japan)
2011-04-01
Highlights: {yields}We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. {yields} Deletion of the UGA1 or GAD1 genes extends replicative lifespan. {yields} Addition of GABA to wild-type cultures has no effect on lifespan. {yields} Intracellular GABA levels do not differ in longevity mutants and wild-type cells. {yields} Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for {gamma}-aminobutyric acid (GABA)-dependent induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The {Delta}uga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for {Delta}uga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of {sup 1}H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan
International Nuclear Information System (INIS)
Kamei, Yuka; Tamura, Takayuki; Yoshida, Ryo; Ohta, Shinji; Fukusaki, Eiichiro; Mukai, Yukio
2011-01-01
Highlights: →We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. → Deletion of the UGA1 or GAD1 genes extends replicative lifespan. → Addition of GABA to wild-type cultures has no effect on lifespan. → Intracellular GABA levels do not differ in longevity mutants and wild-type cells. → Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for γ-aminobutyric acid (GABA)-dependent induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The Δuga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for Δuga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of 1 H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan extension. These results strongly suggest
DEFF Research Database (Denmark)
Wandall, Hans H; Pedersen, Johannes W; Park, Chaeho
2002-01-01
-N-acetylglucosamine:beta Man beta 1,3-N-acetylglucosaminyltransferase (beta 3GlcNAc-transferase) tentatively assigned a key role in biosynthesis of arthroseries glycosphingolipids and forming the trihexosylceramide, GlcNAc beta 1-3Man beta 1-4Glc beta 1-1Cer. In the present study we demonstrate that egghead encodes a Golgi......-located GDP-mannose:beta Glc beta 1,4-mannosyltransferase tentatively assigned a biosynthetic role to form the precursor arthroseries glycosphingolipid substrate for Brainiac, Man beta 1-4Glc beta 1-1Cer. Egghead is unique among eukaryotic glycosyltransferase genes in that homologous genes are limited...
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Masloff, S; Pöggeler, S; Kück, U
1999-05-01
During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes.
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Directory of Open Access Journals (Sweden)
Nick Warr
2011-05-01
Full Text Available In mammals, the Y chromosome is a dominant male determinant, causing the bipotential gonad to develop as a testis. Recently, cases of familial and spontaneous 46,XY disorders of sex development (DSD have been attributed to mutations in the human gene encoding mitogen-activated protein kinase kinase kinase 1, MAP3K1, a component of the mitogen-activated protein kinase (MAPK signal transduction pathway. In individuals harbouring heterozygous mutations in MAP3K1, dysregulation of MAPK signalling was observed in lymphoblastoid cell lines, suggesting a causal role for these mutations in disrupting XY sexual development. Mice lacking the cognate gene, Map3k1, are viable and exhibit the eyes open at birth (EOB phenotype on a mixed genetic background, but on the C57BL/6J genetic background most mice die at around 14.5 dpc due to a failure of erythropoiesis in the fetal liver. However, no systematic examination of sexual development in Map3k1-deficient mice has been described, an omission that is especially relevant in the case of C57BL/6J, a genetic background that is sensitized to disruptions to testis determination. Here, we report that on a mixed genetic background mice lacking Map3k1 are fertile and exhibit no overt abnormalities of testis development. On C57BL/6J, significant non-viability is observed with very few animals surviving to adulthood. However, an examination of development in Map3k1-deficient XY embryos on this genetic background revealed no significant defects in testis determination, although minor abnormalities were observed, including an increase in gonadal length. Based on these observations, we conclude that MAP3K1 is not required for mouse testis determination. We discuss the significance of these data for the functional interpretation of sex-reversing MAP3K1 mutations in humans.
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Kumar, Santosh; Jordan, Mark C; Datla, Raju; Cloutier, Sylvie
2013-01-01
As a crop, flax holds significant commercial value for its omega-3 rich oilseeds and stem fibres. Canada is the largest producer of linseed but there exists scope for significant yield improvements. Implementation of mechanisms such as male sterility can permit the development of hybrids to assist in achieving this goal. Temperature sensitive male sterility has been reported in flax but the leakiness of this system in field conditions limits the production of quality hybrid seeds. Here, we characterized a 2,588 bp transcript differentially expressed in male sterile lines of flax. The twelve intron gene predicted to encode a 368 amino acid protein has five WD40 repeats which, in silico, form a propeller structure with putative nucleic acid and histone binding capabilities. The LuWD40-1 protein localized to the nucleus and its expression increased during the transition and continued through the vegetative stages (seed, etiolated seedling, stem) while the transcript levels declined during reproductive development (ovary, anthers) and embryonic morphogenesis of male fertile plants. Knockout lines for LuWD40-1 in flax failed to develop shoots while overexpression lines showed delayed growth phenotype and were male sterile. The non-viable flowers failed to open and the pollen grains from these flowers were empty. Three independent transgenic lines overexpressing the LuWD40-1 gene had ∼80% non-viable pollen, reduced branching, delayed flowering and maturity compared to male fertile genotypes. The present study provides new insights into a male sterility mechanism present in flax.
Directory of Open Access Journals (Sweden)
Santosh Kumar
Full Text Available As a crop, flax holds significant commercial value for its omega-3 rich oilseeds and stem fibres. Canada is the largest producer of linseed but there exists scope for significant yield improvements. Implementation of mechanisms such as male sterility can permit the development of hybrids to assist in achieving this goal. Temperature sensitive male sterility has been reported in flax but the leakiness of this system in field conditions limits the production of quality hybrid seeds. Here, we characterized a 2,588 bp transcript differentially expressed in male sterile lines of flax. The twelve intron gene predicted to encode a 368 amino acid protein has five WD40 repeats which, in silico, form a propeller structure with putative nucleic acid and histone binding capabilities. The LuWD40-1 protein localized to the nucleus and its expression increased during the transition and continued through the vegetative stages (seed, etiolated seedling, stem while the transcript levels declined during reproductive development (ovary, anthers and embryonic morphogenesis of male fertile plants. Knockout lines for LuWD40-1 in flax failed to develop shoots while overexpression lines showed delayed growth phenotype and were male sterile. The non-viable flowers failed to open and the pollen grains from these flowers were empty. Three independent transgenic lines overexpressing the LuWD40-1 gene had ∼80% non-viable pollen, reduced branching, delayed flowering and maturity compared to male fertile genotypes. The present study provides new insights into a male sterility mechanism present in flax.
A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1
Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.
2000-01-01
Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Han, Gil-Soo; Carman, George M
2017-08-11
The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Cloning of the rat Waf1/Cip1 gene
International Nuclear Information System (INIS)
Belinsky, S.A.; Middleton, S.K.
1994-01-01
The progression of eukaryotic cells through the cell cycle involves the sequential expression of specific genes. This process is regulated by both external and internal stimuli that prevent the cell from prematurely entering the next phase before all macromolecular events have been completed. The activation and subsequent inactivation of cyclin dependent kinases (Cdks) represent one internal stimuli required to regulate the transit of cells from one stage of the cell cycle to the next. Another member of this regulatory cascade is the p53 tumor suppressor gene, which controls a G 1 checkpoint at which the cell cycle can be arrested prior to the initiation of DNA synthesis. Following DNA damage, p53 protein levels rise, and entry into S phase is delayed, presumably to allow time for repair of the lesions. When p53 function is lost, cells containing damaged DNA template enter S phase leading to fixation and propagation of genetic alterations. Recently, evidence linking the growth-suppressing activity of p53 and inactivation of Cdks has been provided by the cloning of the Waf1/Cip1 gene. Waf1/Cip1 encodes a protein of M r 21,000 (p21), which inhibits Cdks in vitro. The overexpression of Waf1/Cip1 in cells inhibits cell growth, suggesting that p21 is a downstream mediator of p53 function. Loss of Waf1/Cip1 gene function could lead to deregulation of the cell cycle and contribute to the development of the neoplastic phenotype in tumors that do not contain mutations in the p53 gene. The purpose of the present investigation was to clone the rat Waf1/Cip1 gene,then determine the frequency for alteration of this gene in lung tumors induced by X-rays
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1
DEFF Research Database (Denmark)
Brøndsted, Lone; Hammer, Karin
1999-01-01
Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)
Energy Technology Data Exchange (ETDEWEB)
Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)
1988-08-11
The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.
Varrault, Annie; Dantec, Christelle; Le Digarcher, Anne; Chotard, Laëtitia; Bilanges, Benoit; Parrinello, Hugues; Dubois, Emeric; Rialle, Stéphanie; Severac, Dany; Bouschet, Tristan; Journot, Laurent
2017-10-13
PLAGL1/ZAC1 undergoes parental genomic imprinting, is paternally expressed, and is a member of the imprinted gene network (IGN). It encodes a zinc finger transcription factor with anti-proliferative activity and is a candidate tumor suppressor gene on 6q24 whose expression is frequently lost in various neoplasms. Conversely, gain of PLAGL1 function is responsible for transient neonatal diabetes mellitus, a rare genetic disease that results from defective pancreas development. In the present work, we showed that Plagl1 up-regulation was not associated with DNA damage-induced cell cycle arrest. It was rather associated with physiological cell cycle exit that occurred with contact inhibition, growth factor withdrawal, or cell differentiation. To gain insights into Plagl1 mechanism of action, we identified Plagl1 target genes by combining chromatin immunoprecipitation and genome-wide transcriptomics in transfected cell lines. Plagl1-elicited gene regulation correlated with multiple binding to the proximal promoter region through a GC-rich motif. Plagl1 target genes included numerous genes involved in signaling, cell adhesion, and extracellular matrix composition, including collagens. Plagl1 targets also included 22% of the 409 genes that make up the IGN. Altogether, this work identified Plagl1 as a transcription factor that coordinated the regulation of a subset of IGN genes and controlled extracellular matrix composition. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.
Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L
2015-01-01
Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.
Directory of Open Access Journals (Sweden)
Min Duan
2014-01-01
Full Text Available Through analysis of cold-induced transcriptome, a novel gene encoding a putative MYB transcription factor was isolated and designated Cold induced MYB 1 (CMYB1. Tissue-specific gene expression analysis revealed that CMYB1 was highly expressed in rice stems and nodes. qRT-PCR assay indicated that CMYB1 was dramatically induced by cold stress (>100-folds and induced by exogenous ABA and osmotic stress. Interestingly, CMYB1 showed rhythmic expression profile in rice leaves at different developmental stages. Subcellular localization assay suggested that CMYB1-GFP (green fluorescent protein fusion protein was localized in the nuclei. Moreover, CMYB1 exhibited the transcriptional activation activity when transiently expressed in rice protoplast cells. Taken together, CMYB1 probably functions as a transcriptional activator in mediating stress and rhythm responsive gene expression in rice.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
Qin, Ran; Zeng, Dongdong; Liang, Rong; Yang, Chengcong; Akhter, Delara; Alamin, Md; Jin, Xiaoli; Shi, Chunhai
2017-09-05
A new mutant named sdl (stripe and drooping leaf) was characterized from indica cultivar Zhenong 34 by ethylmethane sulfonate (EMS) mutagenesis. The mutant sdl exhibited development defects including stripe and drooping leaf, dwarfism and deformed floral organs. The gene SDL was found allelic to RNRS1 by map-based cloning, which was homologous to Arabidopsis TSO2 encoding the small subunit of ribonucleotide reductase. The gDNA sequencing results of sdl in mutant showed that there was a repetitive sequence insertion of 138-bp at the 475 th bp in the exon. The redundant sequence was conserved in SDL homologous proteins, which contained the active site (tyrosine), as well as two amino acids glutamate and histidine involved in the binding of iron. There were fewer chloroplasts and grana lamellas in sdl leaf compared with those of wild-type. Additionally, the stripe leaves of sdl seedlings were highly sensitive to temperature, since the chlorophyll content was increased with the temperature rising. The drooping leaf of sdl might be resulted from the disappearance of vascular bundles and mesophyll cells in both leaf midrib and lateral veins. Fittingly to the phenotypes of mutant sdl, the expression levels of genes associated with photosynthesis and chlorophyll synthesis were found to be down- or up-regulated at different temperatures in mutant sdl. Also, the transcriptional levels of genes related to plant height and floral organ formation showed obvious differences between wild-type and sdl. The "SDL/RNRS1" was, hence, required for the chlorophyll biosynthesis and also played pleiotropic roles in the regulation of plant development. Copyright © 2017. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.
Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice
2007-04-01
A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Isolation and expression pattern of COR15b and KIN1 genes in ...
African Journals Online (AJOL)
STORAGESEVER
2009-11-02
Nov 2, 2009 ... COR15b and KIN1 (COR 6.5) genes encode polypeptides of 15 KDa and 6.5 KDa, respectively. They are involved in the dehydration tolerance mechanisms and play important role under cold stress. cDNA sequences of COR15b and KIN1 genes were firstly isolated from leaves of watermelon (Citrullus.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham
2015-01-01
TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.
Directory of Open Access Journals (Sweden)
GangQiang Li
Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Directory of Open Access Journals (Sweden)
Boutennoune H.
2012-05-01
Full Text Available A pre-designed plasmid containing the gene encoding the second subunit of Echinococcus granulosus AgB8 (EgAgB8/2 was used to study the effect of the immunization route on the immune response in BALB/c mice. Mice were immunized with pDRIVEEgAgB8/ 2 or pDRIVE empty cassette using the intramuscular (i.m., intranasal (i.n. or the epidermal gene gun (g.g. routes. Analysis of the antibody response and cytokine data revealed that gene immunization by the i.m. route induced a marked bias towards a T helper type 1 (Th1 immune response as characterized by high IFN-γ gene expression and a low IgG1/IgG2a reactivity index (R.I. ratio of 0.04. The i.n. route showed a moderate IFN-γ expression but a higher IgG1/IgG2a R.I. ratio of 0.25 indicating a moderate Th1 response. In contrast, epidermal g.g. immunization induced a Th2 response characterized by high IL-4 expression and the highest IgG1/IgG2a R.I. ratio of 0.58. In conclusion, this study showed the advantage of genetic immunization using the i.m. route and i.n. over the epidermal g.g. routes in the induction of Th1 immunity in response to E. granulosus AgB gene immunization.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Howe, J G; Shu, M D
1988-08-01
Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Sousa, C S; Barros, B A; Barh, D; Ghosh, P; Azevedo, V; Barros, E G; Moreira, M A
2016-08-26
The enzymes 1,2-diacylglycerol cholinephosphotrans-ferase (CPT) and lysophosphatidylcholine acyltransferase (LPCAT) are important in lipid metabolism in soybean seeds. Thus, understand-ing the genes that encode these enzymes may enable their modification and aid the improvement of soybean oil quality. In soybean, the genes encoding these enzymes have not been completely described; there-fore, this study aimed to identify, characterize, and analyze the in silico expression of these genes in soybean. We identified two gene models encoding CPT and two gene models encoding LPCAT, one of which presented an alternative transcript. The sequences were positioned on the physical map of soybean and the promoter regions were analyzed. Cis-elements responsible for seed-specific expression and responses to biotic and abiotic stresses were identified. Virtual expression analysis of the gene models for CPT and LPCAT indicated that these genes are expressed under different stress conditions, in somatic embryos during differentiation, in immature seeds, root tissues, and calli. Putative ami-no acid sequences revealed the presence of transmembrane domains, and analysis of the cellular localization of these enzymes revealed they are located in the endoplasmic reticulum.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Population genetics and comparative genetics of CLDN1, a gene involved in hepatitis C virus entry
Bekker, Vincent; O'Brien, Thomas R.; Chanock, Stephen
2009-01-01
The claudin-1 gene (CLDN1) is a member of a family of genes that encodes proteins found in tight junctions and it has recently been implicated as one of several receptors for late stage binding of hepatitis C virus (HCV). Exploration of the population genetics of this gene could be informative,
Ashikawa, Ikuo; Abe, Fumitaka; Nakamura, Shingo
2013-07-01
The Arabidopsis gene DOG1 (AtDOG1) functions in seed dormancy and in sugar signaling. Little is known about the structural and functional features of plant genes homologous to AtDOG1, except for one type (clade 1) of Triticeae AtDOG1-like genes, which was previously demonstrated to be functionally orthologous to AtDOG1. Here, through phylogenetic, structural, and functional analyses of cereal AtDOG1-like genes, we characterized their features: these genes exist as a gene family that can be classified into five distinct clades (1-5). Of these, AtDOG1-like genes in clades 1-4 have a similar architecture to AtDOG1: they encode proteins with three conserved regions. In contrast, the clade 5 genes are distinct; their encoded proteins lack these conserved regions, but harbor domains that interact with DNA. Ectopic expression of the cereal AtDOG1-like genes of clades 2-4 in Arabidopsis demonstrated that like the clade 1 genes, they performed the same function as AtDOG1. The correlation between the depth of seed dormancy and the efficiency of sugar signaling in transgenic Arabidopsis conferred by genes in clades 1-4 suggests a close link in the underlying mechanisms between the seed dormancy and sugar signaling functions of AtDOG1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
Analysis of gene expression of myo1c and inpp5k genes involved in endometrial adenocarcinoma
International Nuclear Information System (INIS)
Koul, A.M.; Nadeem, A.; Baryalai, P.
2012-01-01
Abstract: Inpp5k gene encodes a protein which plays a very vital role in a number of metabolic pathways. It is very significant in the glucose metabolism where it regulates the signalling of the insulin pathway. But the full molecular details of the pathways regulated by Inpp5k encoded protein are not known. It is speculated that Inpp5k gene expression is altered in case of endometrial adenocarcinoma. Myolc gene encodes for a protein called Myosin-lc which acts an actin-based molecular motor in the cells. II has been studied that this gene down-regulates during endometrial adenocarcinoma and colorectal cancers. In this study the expression analysis of these two was carried out using multiplex PCR. An endogenous control was used for this PCR. ACTS gene served as the endogenous control because of it being a house keeping gene. It thus shows a universal expression in all cells. Thus in this study the gene expression of Inpp5k and Myulc genes was comparatively analysed with ACTS gene. The results that came out of this study showed an over-expression of Inpp5k gene and down-regulation of myolc gene with respect to ACTS gene in cancer cell lines as was indicated by the previous studies with these genes. Expression of both genes i.e. Inpp5k and Myolc was statistically compared between normal and cancerous cell lines and was found statistically significant at a value of P< O.O I in most of the cases. (author)
DEFF Research Database (Denmark)
Tarnow, L; Grarup, N; Hansen, T
2001-01-01
BACKGROUND: An XbaI polymorphism in the gene encoding the glucose transporter, GLUT-1, is associated with development of diabetic nephropathy in Chinese type 2 diabetic patients. In addition, an amino acid variant (K121Q) in the gene encoding the glycoprotein plasma cell differentiating antigen (PC...... men/77 women, age 40.9+/-9.6 years, diabetes duration 27+/-8 years) and type 1 diabetic patients with persistent normoalbuminuria (118 men/74 women, age 42.7+/-10.2 years, diabetes duration 26+/-9 years). Proliferative retinopathy was present in 156 patients (40%), while 67 patients (17%) had....... CONCLUSIONS: Neither the PC-1 K121Q nor the GLUT-1 XbaI polymorphism contribute to the genetic susceptibility of diabetic microvascular complications in Danish type 1 diabetic patients....
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
Identification of mutations in Iranian patients' DAX-1 gene with X ...
African Journals Online (AJOL)
) DAX-1 gene from four Iranian patients with X-linked AHC was analyzed by means of polymerase chain reaction (PCR) and direct sequencing. Results: We identified a polymorphism (Rs6150) which encodes a cysteine (Cys) at position 38, ...
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Blenau, W; Balfanz, S; Baumann, A
2000-03-01
Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Flagellar-phase variation: isolation of the rh1 gene
International Nuclear Information System (INIS)
Silverman, M.; Zieg, J.; Simon, M.
1979-01-01
In Salmonella, expression of flagellar antigen alternates between two serotypes (phases) encoded by two genes, H1 and H2. The mechanism which controls the alternative expression of the H1 and H2 genes was examined by cloning these genes and the genetic elements which control their activity on hybrid vehicles in Escherichia coli. H2 gene activity was shown to be controlled by a recombinational switch located adjacent to the H2 gene. Activity of the H1 gene is thought to be repressed, when the H2 gene is expressed, by the product of another gene, rhl (repressor of H1), which is controlled coordinately with the H2 gene. In this report, we describe the construction of hybrid lambda vehicles which contain, in addition to the H2 gene, a genetic activity corresponding to rhl. Variation of flagellar antigens analogous to that observed in Salmonella was observed when E. coli strains were transduced with the hybrid lambda. By using the lambda H2rhl hybrid to program protein syntheis in uv-irradiated cells, the synthesis of a polypeptide was correlated with rhl gene product activity. We conclude that the H2 region consists of two cotranscribed genes, H2 and rhl. The expression of both gene products is regulated by the same recombinational event
Directory of Open Access Journals (Sweden)
Johanna Meier-Soelch
2018-04-01
Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.
The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.
Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval
2012-07-30
In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Distinct Calcium Signaling Pathways Regulate Calmodulin Gene Expression in Tobacco1
van der Luit, Arnold H.; Olivari, Claudio; Haley, Ann; Knight, Marc R.; Trewavas, Anthony J.
1999-01-01
Cold shock and wind stimuli initiate Ca2+ transients in transgenic tobacco (Nicotiana plumbaginifolia) seedlings (named MAQ 2.4) containing cytoplasmic aequorin. To investigate whether these stimuli initiate Ca2+ pathways that are spatially distinct, stress-induced nuclear and cytoplasmic Ca2+ transients and the expression of a stress-induced calmodulin gene were compared. Tobacco seedlings were transformed with a construct that encodes a fusion protein between nucleoplasmin (a major oocyte nuclear protein) and aequorin. Immunocytochemical evidence indicated targeting of the fusion protein to the nucleus in these plants, which were named MAQ 7.11. Comparison between MAQ 7.11 and MAQ 2.4 seedlings confirmed that wind stimuli and cold shock invoke separate Ca2+ signaling pathways. Partial cDNAs encoding two tobacco calmodulin genes, NpCaM-1 and NpCaM-2, were identified and shown to have distinct nucleotide sequences that encode identical polypeptides. Expression of NpCaM-1, but not NpCaM-2, responded to wind and cold shock stimulation. Comparison of the Ca2+ dynamics with NpCaM-1 expression after stimulation suggested that wind-induced NpCaM-1 expression is regulated by a Ca2+ signaling pathway operational predominantly in the nucleus. In contrast, expression of NpCaM-1 in response to cold shock is regulated by a pathway operational predominantly in the cytoplasm. PMID:10557218
Larval survival of Cry1F-susceptible (FL), -resistant (PR and Cry1F-RR), and -heterozygous (FL x PR and Cry1F-RS) populations of the fall armyworm, Spodoptera frugiperda (J.E. Smith) to purified Cry1F protein and corn leaf tissue of seven Bacillus thuringiensis (Bt) corn hybrids and five non-Bt corn...
Directory of Open Access Journals (Sweden)
Laura Coninx
2017-11-01
Full Text Available Zinc (Zn is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree’s Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus, a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus. Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.
Coninx, Laura; Thoonen, Anneleen; Slenders, Eli; Morin, Emmanuelle; Arnauts, Natascha; Op De Beeck, Michiel; Kohler, Annegret; Ruytinx, Joske; Colpaert, Jan V
2017-01-01
Zinc (Zn) is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree's Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus , a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein) family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus . Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.
Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.
Directory of Open Access Journals (Sweden)
Jian Wang
Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Induction of 1-acylglycerophosphocholine acyltransferase genes by fibrates in the liver of rats.
Yamazaki, Tohru; Wakabayashi, Michiko; Ikeda, Erika; Tanaka, Shizuyo; Sakamoto, Takeshi; Mitsumoto, Atsushi; Kudo, Naomi; Kawashima, Yoichi
2012-01-01
The effect of fibrates (clofibric acid, bezafibrate and fenofibrate) on the gene expression and activity of 1-acylglycerophosphocholine acyltransferase (LPCAT) was investigated. The administration of 0.1% (w/w) clofibric acid, bezafibrate or fenofibrate in diet for 14 d to rats induced LPCAT activity in hepatic microsomes in the following order: fenofibrate>bezafibrate>clofibric acid. The LPCAT induced by fenofibrate preferred to arachidonoyl-CoA and linoleoyl-CoA to a greater extent than did LPCAT in control microsomes. The treatment with the fibrates resulted in upregulation of the relative expression of mRNAs encoding LPCAT3 and LPCAT4 in the following order: fenofibrate>bezafibrate>clofibric acid. The administration of fibrates did not change the expression of genes encoding either LPCAT1 or LPCAT2. The treatment with fibrates elevated relative levels of both mRNAs encoding Δ6 desaturase (Fads2) and Δ5 desaturase (Fads1) in the order of fenofibrate>bezafibrate>clofibric acid, and the extent of the increase in the level of Δ6 desaturase mRNA was greater than that of Δ5 desaturase. Fatty acid profile in hepatic phosphatidylcholine (PC) was significantly changed by the treatments with fibrates. These results suggest (i) that fibrates induce LPCAT activity in hepatic microsomes by elevating the expression of genes encoding LPCAT3 and LPCAT4, (ii) that the changes in fatty acid profile of hepatic PC are, in part, due to the elevated expression of two isoforms, LPCAT3 and LPCAT4, and (iii) that the ability of fibrates to induce these changes are in the order of fenofibrate>bezafibrate>clofibric acid.
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D
1997-06-15
We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.
International Nuclear Information System (INIS)
Yoshisaki, Magno B.; Leopando, Leonardo S.
1999-03-01
Fifty one (51) fuel assemblies of mixed enrichment from the Philippine Research Reactor (PRR-1), consisting of 50 spent and 1 fresh, were shipped to the United States last 14 March 1999 under the U.S. Return of Foreign Research Reactor (FRR) fuel policy. The shipment was in line with the U.S. initiative to implement its Record of Decision (ROD) which took effect on 13 May 1996 to accept and manage all FRR uranium fuel of U.S. origin and enriched in the United States. The shipment program would last10 years, ending midnight of 13 May 2006. The ROD provided a 3 year extension period within which to accept FRR spent nuclear fuel (SNF) withdrawn from reactors after 2006. The U.S. policy gave priority to the NPT significance of high enriched U, as the prime target of the return of FRR policy. Classified as a developing country, the Philippines, through the PNRI, signed a contract with the U.S. Department of Energy for the cost-free shipment of PRR-1 spent fuel to the United States. Spent fuel loading and transport operations to the port area lasted seven (7) days, from 8 to 14 March 1999. (Author)
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong
2010-01-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and sev...
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming
2016-01-01
Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.
Neurospora crassa tox-1 Gene Encodes a pH- and Temperature-Tolerant Mini-Cellulase.
Xiao, Yue; Zhang, Qiongsi; Luo, Yiquan; Zhang, Ying; Luo, Xi; Wang, Yuchuan; Cao, Weiguo; Pinto, Vito De; Liu, Qiuyun; Li, Gang
2016-06-15
Cellulases that endure extreme conditions are essential in various industrial sectors. This study reports a mini-cellulase gene tox-1 from Neurospora crassa. The gene tox-1 was cloned in Escherichia coli after chimerization with the YebF gene and substitutions of certain isoleucine and valine with leucine residues. The yeast transformants could grow on rice straw-agar medium. The 44-amino acid peptide and its two mutant variants displayed potent cellulase activities in Congo Red assay and enzymatic assays. Conservative replacements with leucine have substantially increased the stabilities and half-lives of the peptides at alkaline pH and low and high temperatures and also the tolerance to organic solvents and surfactants, on the basis of activities toward cellose. The small size of the mini-cellulase would allow for commercially viable automatic chemical peptide synthesis. This work suggests that conservative leucine replacements may serve as a general strategy in the engineering of more robust enzymes with special features with little loss of activities.
Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.
Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D
2015-04-01
Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene
International Nuclear Information System (INIS)
Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.
1990-01-01
An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations
Banilas, Georgios; Karampelias, Michael; Makariti, Ifigenia; Kourti, Anna; Hatzopoulos, Polydefkis
2010-01-01
Diacylglycerol acyltransferases (DGATs) catalyse the final step of the triacylglycerol (TAG) biosynthesis of the Kennedy pathway. Two major gene families have been shown to encode DGATs, DGAT1 (type-1) and DGAT2 (type-2). Both genes encode membrane-bound proteins, with no sequence homology to each other. In this study, the molecular cloning and characterization of a type-2 DGAT cDNA from olive is presented. Southern blot analysis showed that OeDGAT2 is represented by a single copy in the oliv...
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
Trapalis, Menelaos; Li, Song Feng; Parish, Roger W
2017-07-01
The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.
Corbin, Cyrielle; Decourtil, Cédric; Marosevic, Djurdjica; Bailly, Marlène; Lopez, Tatiana; Renouard, Sullivan; Doussot, Joël; Dutilleul, Christelle; Auguin, Daniel; Giglioli-Guivarc'h, Nathalie; Lainé, Eric; Lamblin, Frédéric; Hano, Christophe
2013-11-01
A Linum usitatissimum LuERA1 gene encoding a putative ortholog of the ERA1 (Enhanced Response to ABA 1) gene of Arabidopsis thaliana (encoding the beta subunit of a farnesyltransferase) was analyzed in silico and for its expression in flax. The gene and the protein sequences are highly similar to other sequences already characterized in plants and all the features of a farnesyltransferase were detected. Molecular modeling of LuERA1 protein confirmed its farnesyltransferase nature. LuERA1 is expressed in the vegetative organs and also in the outer seedcoat of the flaxseed, where it could modulate the previously observed regulation operated by ABA on lignan synthesis. This effect could be mediated by the regulation of the transcription of a key gene for lignan synthesis in flax, the LuPLR1 gene, encoding a pinoresinol lariciresinol reductase. The positive effect of manumycin A, a specific inhibitor of farnesyltransferase, on lignan biosynthesis in flax cell suspension systems supports the hypothesis of the involvement of such an enzyme in the negative regulation of ABA action. In Arabidopsis, ERA1 is able to negatively regulate the ABA effects and the mutant era1 has an enhanced sensitivity to ABA. When expressed in an Arabidopsis cell suspension (heterologous system) LuERA1 is able to reverse the effect of the era1 mutation. RNAi experiments in flax targeting the farnesyltransferase β-subunit encoded by the LuERA1 gene led to an increase LuPLR1 expression level associated with an increased content of lignan in transgenic calli. Altogether these results strongly suggest a role of the product of this LuERA1 gene in the ABA-mediated upregulation of lignan biosynthesis in flax cells through the activation of LuPLR1 promoter. This ABA signaling pathway involving ERA1 probably acts through the ABRE box found in the promoter sequence of LuPLR1, a key gene for lignan synthesis in flax, as demonstrated by LuPLR1 gene promoter-reporter experiments in flax cells using wild
Directory of Open Access Journals (Sweden)
Long Yu
2007-05-01
Full Text Available The glycine-N-acyltransferase (GLYAT is well known to be involved in thedetoxification of endogenous and exogenous xenobiotic acyl-CoA's in mammals.Unfortunately, the knowledge about the gene encoding GLYAT is very limited. Here wereport a novel gene encoding a GLYAT member, designated as GLYATL1, which was1546 base pairs in length and contained an open reading frame (ORF encoding apolypeptide of 302 amino acids. GLYATL1 was a split gene that was consisted of 7 exonsand 6 introns and mapped to chromosome 11q12.1. The expression of GLYATL1 could befound in liver, kidney, pancreas, testis, ovary and stomach among 18 human tissues by RT-PCR analysis. Subcellular localization of myc-tagged GLYATL1 fusion protein revealedthat GLYATL1 was distributed primarily in the cytoplasm of COS-7 cells. Furthermore,through the pathway profiling assay, the GLYATL1 protein was found to activate HSEsignaling pathway in a dose-dependent manner when overexpressed in HEK293T cells.
Energy Technology Data Exchange (ETDEWEB)
Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others
1996-07-01
Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.
Argyris, Jason; Truco, María José; Ochoa, Oswaldo; McHale, Leah; Dahal, Peetambar; Van Deynze, Allen; Michelmore, Richard W; Bradford, Kent J
2011-01-01
Thermoinhibition, or failure of seeds to germinate when imbibed at warm temperatures, can be a significant problem in lettuce (Lactuca sativa L.) production. The reliability of stand establishment would be improved by increasing the ability of lettuce seeds to germinate at high temperatures. Genes encoding germination- or dormancy-related proteins were mapped in a recombinant inbred line population derived from a cross between L. sativa cv. Salinas and L. serriola accession UC96US23. This revealed several candidate genes that are located in the genomic regions containing quantitative trait loci (QTLs) associated with temperature and light requirements for germination. In particular, LsNCED4, a temperature-regulated gene in the biosynthetic pathway for abscisic acid (ABA), a germination inhibitor, mapped to the center of a previously detected QTL for high temperature germination (Htg6.1) from UC96US23. Three sets of sister BC(3)S(2) near-isogenic lines (NILs) that were homozygous for the UC96US23 allele of LsNCED4 at Htg6.1 were developed by backcrossing to cv. Salinas and marker-assisted selection followed by selfing. The maximum temperature for germination of NIL seed lots with the UC96US23 allele at LsNCED4 was increased by 2-3°C when compared with sister NIL seed lots lacking the introgression. In addition, the expression of LsNCED4 was two- to threefold lower in the former NIL lines as compared to expression in the latter. Together, these data strongly implicate LsNCED4 as the candidate gene responsible for the Htg6.1 phenotype and indicate that decreased ABA biosynthesis at high imbibition temperatures is a major factor responsible for the increased germination thermotolerance of UC96US23 seeds.
Basmanav, F. Buket; Oprisoreanu, Ana-Maria; Pasternack, Sandra M.; Thiele, Holger; Fritz, Günter; Wenzel, Jörg; Größer, Leopold; Wehner, Maria; Wolf, Sabrina; Fagerberg, Christina; Bygum, Anette; Altmüller, Janine; Rütten, Arno; Parmentier, Laurent; El Shabrawi-Caelen, Laila; Hafner, Christian; Nürnberg, Peter; Kruse, Roland; Schoch, Susanne; Hanneken, Sandra; Betz, Regina C.
2014-01-01
Dowling-Degos disease (DDD) is an autosomal-dominant genodermatosis characterized by progressive and disfiguring reticulate hyperpigmentation. We previously identified loss-of-function mutations in KRT5 but were only able to detect pathogenic mutations in fewer than half of our subjects. To identify additional causes of DDD, we performed exome sequencing in five unrelated affected individuals without mutations in KRT5. Data analysis identified three heterozygous mutations from these individuals, all within the same gene. These mutations, namely c.11G>A (p.Trp4∗), c.652C>T (p.Arg218∗), and c.798-2A>C, are within POGLUT1, which encodes protein O-glucosyltransferase 1. Further screening of unexplained cases for POGLUT1 identified six additional mutations, as well as two of the above described mutations. Immunohistochemistry of skin biopsies of affected individuals with POGLUT1 mutations showed significantly weaker POGLUT1 staining in comparison to healthy controls with strong localization of POGLUT1 in the upper parts of the epidermis. Immunoblot analysis revealed that translation of either wild-type (WT) POGLUT1 or of the protein carrying the p.Arg279Trp substitution led to the expected size of about 50 kDa, whereas the c.652C>T (p.Arg218∗) mutation led to translation of a truncated protein of about 30 kDa. Immunofluorescence analysis identified a colocalization of the WT protein with the endoplasmic reticulum and a notable aggregating pattern for the truncated protein. Recently, mutations in POFUT1, which encodes protein O-fucosyltransferase 1, were also reported to be responsible for DDD. Interestingly, both POGLUT1 and POFUT1 are essential regulators of Notch activity. Our results furthermore emphasize the important role of the Notch pathway in pigmentation and keratinocyte morphology. PMID:24387993
Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso
2017-12-18
Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.
DEFF Research Database (Denmark)
Andreou, Dimitrios; Saetre, Peter; Kähler, Anna K
2011-01-01
The dystrobrevin binding protein-1 (DTNBP1) gene encodes dysbindin-1, a protein involved in neurodevelopmental and neurochemical processes related mainly to the monoamine dopamine. We investigated possible associations between eleven DTNBP1 polymorphisms and cerebrospinal fluid (CSF) concentratio...
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Linkage of genes for laminin B1 and B2 subunits on chromosome 1 in mouse.
Elliott, R W; Barlow, D; Hogan, B L
1985-08-01
We have used cDNA clones for the B1 and B2 subunits of laminin to find restriction fragment length DNA polymorphisms for the genes encoding these polypeptides in the mouse. Three alleles were found for LamB2 and two for LamB1 among the inbred mouse strains. The segregation of these polymorphisms among recombinant inbred strains showed that these genes are tightly linked in the central region of mouse Chromosome 1 between Sas-1 and Ly-m22, 7.4 +/- 3.2 cM distal to the Pep-3 locus. There is no evidence in the mouse for pseudogenes for these proteins.
DEFF Research Database (Denmark)
Bross, Peter; Li, Zhijie; Hansen, Jakob
2007-01-01
for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...
Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D
1995-03-01
A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.
Directory of Open Access Journals (Sweden)
Dmitrii E. Polev
2014-01-01
Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Kofuji, Takefumi; Hayashi, Yuko; Fujiwara, Tomonori; Sanada, Masumi; Tamaru, Masao; Akagawa, Kimio
2017-03-22
Autism spectrum disorder (ASD) is highly heritable and encompasses a various set of neuropsychiatric disorders with a wide-ranging presentation. HPC-1/syntaxin1A (STX1A) encodes a neuronal plasma membrane protein that regulates the secretion of neurotransmitters and neuromodulators. STX1A gene ablated mice (null and heterozygote mutant) exhibit abnormal behavioral profiles similar to human autistic symptoms, accompanied by reduction of monoamine secretion. To determine whether copy number variation of STX1A gene and the change of its expression correlate with ASD as in STX1A gene ablated mice, we performed copy number assay and real-time quantitative RT-PCR using blood or saliva samples from ASD patients. We found that some ASD patients were haploid for the STX1A gene similar to STX1A heterozygote mutant mice. However, copy number of STX1A gene was normal in the parents and siblings of ASD patients with STX1A gene haploidy. In ASD patients with gene haploidy, STX1A mRNA expression was reduced to about half of their parents. Thus, a part of ASD patients had haploidy of STX1A gene and lower STX1A gene expression. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
DasSarma Shiladitya
2007-06-01
Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten
DEFF Research Database (Denmark)
Madsen, Jack Egelund; Petersen, Bent Larsen; Motawia, Mohammed Saddik
2006-01-01
in rhamnogalacturonan-II, a complex polysaccharide essential to vascular plants, and is conserved across higher plant families. Rhamnogalacturonan-II isolated from both RGXT1 and RGXT2 T-DNA insertional mutants functioned as specific acceptor molecules in the xylosyltransferase assay. Expression of RGXT1- and RGXT2......Two homologous plant-specific Arabidopsis thaliana genes, RGXT1 and RGXT2, belong to a new family of glycosyltransferases (CAZy GT-family-77) and encode cell wall (1,3)-alpha-d-xylosyltransferases. The deduced amino acid sequences contain single transmembrane domains near the N terminus, indicative...
Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing
2015-01-01
The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.
Luo, Anding; Qian, Qian; Yin, Hengfu; Liu, Xiaoqiang; Yin, Changxi; Lan, Ying; Tang, Jiuyou; Tang, Zuoshun; Cao, Shouyun; Wang, Xiujie; Xia, Kai; Fu, Xiangdong; Luo, Da; Chu, Chengcai
2006-02-01
Elongation of rice internodes is one of the most important agronomic traits, which determines the plant height and underlies the grain yield. It has been shown that the elongation of internodes is under genetic control, and various factors are implicated in the process. Here, we report a detailed characterization of an elongated uppermost internode1 (eui1) mutant, which has been used in hybrid rice breeding. In the eui1-2 mutant, the cell lengths in the uppermost internodes are significantly longer than that of wild type and thus give rise to the elongated uppermost internode. It was found that the level of active gibberellin was elevated in the mutant, whereas its growth in response to gibberellin is similar to that of the wild type, suggesting that the higher level accumulation of gibberellin in the eui1 mutant causes the abnormal elongation of the uppermost internode. Consistently, the expression levels of several genes which encode gibberellin biosynthesis enzymes were altered. We cloned the EUI1 gene, which encodes a putative cytochrome P450 monooxygenase, by map-based cloning and found that EUI1 was weakly expressed in most tissues, but preferentially in young panicles. To confirm its function, transgenic experiments with different constructs of EUI1 were conducted. Overexpression of EUI1 gave rise to the gibberellin-deficient-like phenotypes, which could be partially reversed by supplementation with gibberellin. Furthermore, apart from the alteration of expression levels of the gibberellin biosynthesis genes, accumulation of SLR1 protein was found in the overexpressing transgenic plants, indicating that the expression level of EUI1 is implicated in both gibberellin-mediated SLR1 destruction and a feedback regulation in gibberellin biosynthesis. Therefore, we proposed that EUI1 plays a negative role in gibberellin-mediated regulation of cell elongation in the uppermost internode of rice.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers
Directory of Open Access Journals (Sweden)
Pattana Srifah Huehne
2013-08-01
Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.
Wound healing genes and susceptibility to cutaneous leishmaniasis in Brazil: Role of COL1A1
Almeida, Lucas; Oliveira, Joyce; Guimarães, Luiz Henrique; Carvalho, Edgar M; Blackwell, Jenefer M
2015-01-01
Previous studies have demonstrated a role for wound healing genes in resolution of cutaneous lesions caused by Leishmania spp. in both mice and humans, including the gene FLI1 encoding Friend leukaemia virus integration 1. Reduction of Fli1 expression in mice has been shown to result in up-regulation of collagen type I alpha 1 (Col1a1) and alpha 2 (Col1a2) genes and, conversely, in down-regulation of the matrix metalloproteinase 1 (Mmp1) gene, suggesting that Fli1 suppression is involved in activation of the profibrotic gene program. Here we examined single nucleotide polymorphisms (SNPs) in these genes as risk factors for cutaneous (CL) and mucosal leishmaniasis (ML), and leishmaniasis per se, caused by L. braziliensis in humans. SNPs were genotyped in 168 nuclear families (250 CL; 87 ML cases) and replicated in 157 families (402 CL; 39 ML cases). Family-based association tests (FBAT) showed the strongest association between SNPs rs1061237 (combined P=0.002) and rs2586488 (combined P=0.027) at COL1A1 and CL disease. This contributes to our further understanding of the role of wound healing in the resolution of CL disease, providing potential for therapies modulating COL1A1 via drugs acting on FLI1. PMID:25562121
Qiu, Yixuan; Fakas, Stylianos; Han, Gil-Soo; Barbosa, Antonio Daniel; Siniossoglou, Symeon; Carman, George M
2013-10-04
In the yeast Saccharomyces cerevisiae, the DGK1-encoded diacylglycerol kinase catalyzes the CTP-dependent phosphorylation of diacylglycerol to form phosphatidate. This enzyme, in conjunction with PAH1-encoded phosphatidate phosphatase, controls the levels of phosphatidate and diacylglycerol for phospholipid synthesis, membrane growth, and lipid droplet formation. In this work, we showed that a functional level of diacylglycerol kinase is regulated by the Reb1p transcription factor. In the electrophoretic mobility shift assay, purified recombinant Reb1p was shown to specifically bind its consensus recognition sequence (CGGGTAA, -166 to -160) in the DGK1 promoter. Analysis of cells expressing the PDGK1-lacZ reporter gene showed that mutations (GT→TG) in the Reb1p-binding sequence caused an 8.6-fold reduction in β-galactosidase activity. The expression of DGK1(reb1), a DGK1 allele containing the Reb1p-binding site mutation, was greatly lower than that of the wild type allele, as indicated by analyses of DGK1 mRNA, Dgk1p, and diacylglycerol kinase activity. In the presence of cerulenin, an inhibitor of de novo fatty acid synthesis, the dgk1Δ mutant expressing DGK1(reb1) exhibited a significant defect in growth as well as in the synthesis of phospholipids from triacylglycerol mobilization. Unlike DGK1, the DGK1(reb1) expressed in the dgk1Δ pah1Δ mutant did not result in the nuclear/endoplasmic reticulum membrane expansion, which occurs in cells lacking phosphatidate phosphatase activity. Taken together, these results indicate that the Reb1p-mediated regulation of diacylglycerol kinase plays a major role in its in vivo functions in lipid metabolism.
Prokaryotic Expression of Rice Ospgip1 Gene and Bioinformatic Analysis of Encoded Product
Directory of Open Access Journals (Sweden)
Xi-jun CHEN
2011-12-01
Full Text Available Using the reference sequences of pgip genes in GenBank, a fragment of 930 bp covering the open reading frame (ORF of rice Ospgip1 (Oryza sativa polygalacturonase-inhibiting protein 1 was amplified. The prokaryotic expression product of the gene inhibited the growth of Rhizoctonia solani, the causal agent of rice sheath blight, and reduced its polygalacturonase activity. Bioinformatic analysis showed that OsPGIP1 is a hydrophobic protein with a molecular weight of 32.8 kDa and an isoelectric point (pI of 7.26. The protein is mainly located in the cell wall of rice, and its signal peptide cleavage site is located between the 17th and 18th amino acids. There are four cysteines in both the N- and C-termini of the deduced protein, which can form three disulfide bonds (between the 56th and 63rd, the 278th and 298th, and the 300th and 308th amino acids. The protein has a typical leucine-rich repeat (LRR domain, and its secondary structure comprises α-helices, β-sheets and irregular coils. Compared with polygalacturonase-inhibiting proteins (PGIPs from other plants, the 7th LRR is absent in OsPGIP1. The nine LRRs could form a cleft that might associate with proteins from pathogenic fungi, such as polygalacturonase.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Yun, Choong-Soo; Suzuki, Chiho; Naito, Kunihiko; Takeda, Toshiharu; Takahashi, Yurika; Sai, Fumiya; Terabayashi, Tsuguno; Miyakoshi, Masatoshi; Shintani, Masaki; Nishida, Hiromi; Yamane, Hisakazu; Nojiri, Hideaki
2010-09-01
Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS family proteins PP_1366 (TurA), PP_3765 (TurB), PP_0017 (TurC), PP_3693 (TurD), and PP_2947 (TurE). Quantitative reverse transcription-PCR (qRT-PCR) demonstrated that the presence of pCAR1 does not affect the transcription of these five genes and that only pmr, turA, and turB were primarily transcribed in KT2440(pCAR1). In vitro pull-down assays revealed that Pmr strongly interacted with itself and with TurA, TurB, and TurE. Transcriptome comparisons of the pmr disruptant, KT2440, and KT2440(pCAR1) strains indicated that pmr disruption had greater effects on the host transcriptome than did pCAR1 carriage. The transcriptional levels of some genes that increased with pCAR1 carriage, such as the mexEF-oprN efflux pump genes and parI, reverted with pmr disruption to levels in pCAR1-free KT2440. Transcriptional levels of putative horizontally acquired host genes were not altered by pCAR1 carriage but were altered by pmr disruption. Identification of genome-wide Pmr binding sites by ChAP-chip (chromatin affinity purification coupled with high-density tiling chip) analysis demonstrated that Pmr preferentially binds to horizontally acquired DNA regions. The Pmr binding sites overlapped well with the location of the genes differentially transcribed following pmr disruption on both the plasmid and the chromosome. Our findings indicate that Pmr is a key factor in optimizing gene transcription on pCAR1 and the host chromosome.
Kim, K S; Chilton, W S; Farrand, S K
1996-01-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
Directory of Open Access Journals (Sweden)
Alexander G Bulakhov
Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable
Polymorphism of Prophet of Pit-1 gene and its relationship with litter ...
Indian Academy of Sciences (India)
c Indian Academy of Sciences. ONLINE ... ovine PROP1 gene encoding protein products with different carboxyl-terminal domain ... prolificacy breeds (Small Tail Han and Hu sheep) and low prolificacy ... of health and nutrition. Genomic DNA .... an ethnically homogenous cohort of patients with multiple pitu- itary hormone ...
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Directory of Open Access Journals (Sweden)
Hyun Uk Kim
2014-01-01
Full Text Available The LEAFY COTYLEDON2 (LEC2 gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis, and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1, LEAFY COTYLEDON1-LIKE (L1L, FUSCA3 (FUS3, and ABSCISIC ACID INSENSITIVE 3 (ABI3 transcripts for seed maturation, and WRINKELED1 (WRI1 transcripts for fatty acid biosynthesis, as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1 and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11, in vegetative tissues.
Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum
2013-01-01
The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1(Δ11)), in vegetative tissues.
Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum
2013-01-01
The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11), in vegetative tissues. PMID:24363987
Mutation of the planar cell polarity gene VANGL1 in adolescent idiopathic scoliosis
DEFF Research Database (Denmark)
Andersen, Malene Rask; Farooq, Muhammad; Koefoed, Karen
2017-01-01
STUDY DESIGN: Mutation analysis of a candidate disease gene in a cohort of patients with moderate to severe Adolescent idiopathic scoliosis (AIS). OBJECTIVE: To investigate if damaging mutations in the planar cell polarity gene VANGL1 could be identified in AIS patients. SUMMARY OF BACKGROUND DATA......: AIS is a spinal deformity which occurs in 1-3% of the population. The cause of AIS is often unknown, but genetic factors are important in the etiology. Rare variants in genes encoding regulators of WNT/planar cell polarity (PCP) signaling were recently identified in AIS patients. METHODS: We analyzed...
Cloning, sequencing and expression of cDNA encoding growth ...
Indian Academy of Sciences (India)
Unknown
of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.
Bcmimp1, a Botrytis cinerea gene transiently expressed in planta, encodes a mitochondrial protein
Directory of Open Access Journals (Sweden)
David eBenito-Pescador
2016-02-01
Full Text Available Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of ROS, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor.
Properties of virion transactivator proteins encoded by primate cytomegaloviruses
Directory of Open Access Journals (Sweden)
Barry Peter A
2009-05-01
Full Text Available Abstract Background Human cytomegalovirus (HCMV is a betaherpesvirus that causes severe disease in situations where the immune system is immature or compromised. HCMV immediate early (IE gene expression is stimulated by the virion phosphoprotein pp71, encoded by open reading frame (ORF UL82, and this transactivation activity is important for the efficient initiation of viral replication. It is currently recognized that pp71 acts to overcome cellular intrinsic defences that otherwise block viral IE gene expression, and that interactions of pp71 with the cell proteins Daxx and ATRX are important for this function. A further property of pp71 is the ability to enable prolonged gene expression from quiescent herpes simplex virus type 1 (HSV-1 genomes. Non-human primate cytomegaloviruses encode homologs of pp71, but there is currently no published information that addresses their effects on gene expression and modes of action. Results The UL82 homolog encoded by simian cytomegalovirus (SCMV, strain Colburn, was identified and cloned. This ORF, named S82, was cloned into an HSV-1 vector, as were those from baboon, rhesus monkey and chimpanzee cytomegaloviruses. The use of an HSV-1 vector enabled expression of the UL82 homologs in a range of cell types, and permitted investigation of their abilities to direct prolonged gene expression from quiescent genomes. The results show that all UL82 homologs activate gene expression, and that neither host cell type nor promoter target sequence has major effects on these activities. Surprisingly, the UL82 proteins specified by non-human primate cytomegaloviruses, unlike pp71, did not direct long term expression from quiescent HSV-1 genomes. In addition, significant differences were observed in the intranuclear localization of the UL82 homologs, and in their effects on Daxx. Strikingly, S82 mediated the release of Daxx from nuclear domain 10 substructures much more rapidly than pp71 or the other proteins tested. All
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
DEFF Research Database (Denmark)
Bruun, A W; Svendsen, I; Sørensen, S O
1998-01-01
signals for transport into the endoplasmic reticulum. Surprisingly, Ic is encoded by TFS1, which has previously been isolated as a high-copy suppressor of cdc25-1. CDC25 encodes the putative GTP exchange factor for Ras1p/Ras2p in yeast. In an attempt to rationalize this finding, we looked...... degree of specificity, showing a 200-fold higher Ki toward a carboxypeptidase from Candida albicans which is highly homologous to carboxypeptidase Y. The TFS1 gene product shows extensive similarity to a class of proteins termed "21-23-kDa lipid binding proteins", members of which are found in several...
Alvarez, Rene; Seal, Bruce S
2005-01-01
Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the
Directory of Open Access Journals (Sweden)
Alvarez Rene
2005-04-01
Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex
Directory of Open Access Journals (Sweden)
Susanne Sattler
2012-01-01
Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Brad Gilbertson
2016-08-01
Full Text Available The influenza A virus genome comprises eight negative-sense viral RNAs (vRNAs that form individual ribonucleoprotein (RNP complexes. In order to incorporate a complete set of each of these vRNAs, the virus uses a selective packaging mechanism that facilitates co-packaging of specific gene segments but whose molecular basis is still not fully understood. Recently, we used a competitive transfection model where plasmids encoding the A/Puerto Rico/8/34 (PR8 and A/Udorn/307/72 (Udorn PB1 gene segments were competed to show that the Udorn PB1 gene segment is preferentially co-packaged into progeny virions with the Udorn NA gene segment. Here we created chimeric PB1 genes combining both Udorn and PR8 PB1 sequences to further define the location within the Udorn PB1 gene that drives co-segregation of these genes and show that nucleotides 1776–2070 of the PB1 gene are crucial for preferential selection. In vitro assays examining specific interactions between Udorn NA vRNA and purified vRNAs transcribed from chimeric PB1 genes also supported the importance of this region in the PB1-NA interaction. Hence, this work identifies an association between viral genes that are co-selected during packaging. It also reveals a region potentially important in the RNP-RNP interactions within the supramolecular complex that is predicted to form prior to budding to allow one of each segment to be packaged in the viral progeny. Our study lays the foundation to understand the co-selection of specific genes, which may be critical to the emergence of new viruses with pandemic potential.
Lara-Diaz, V J; Castilla-Cortazar, I; Martín-Estal, I; García-Magariño, M; Aguirre, G A; Puche, J E; de la Garza, R G; Morales, L A; Muñoz, U
2017-05-01
Even though the liver synthesizes most of circulating IGF-1, it lacks its receptor under physiological conditions. However, according to previous studies, a damaged liver expresses the receptor. For this reason, herein, we examine hepatic histology and expression of genes encoding proteins of the cytoskeleton, extracellular matrix, and cell-cell molecules and inflammation-related proteins. A partial IGF-1 deficiency murine model was used to investigate IGF-1's effects on liver by comparing wild-type controls, heterozygous igf1 +/- , and heterozygous mice treated with IGF-1 for 10 days. Histology, microarray for mRNA gene expression, RT-qPCR, and lipid peroxidation were assessed. Microarray analyses revealed significant underexpression of igf1 in heterozygous mice compared to control mice, restoring normal liver expression after treatment, which then normalized its circulating levels. IGF-1 receptor mRNA was overexpressed in Hz mice liver, while treated mice displayed a similar expression to that of the controls. Heterozygous mice showed overexpression of several genes encoding proteins related to inflammatory and acute-phase proteins and underexpression or overexpression of genes which coded for extracellular matrix, cytoskeleton, and cell junction components. Histology revealed an altered hepatic architecture. In addition, liver oxidative damage was found increased in the heterozygous group. The mere IGF-1 partial deficiency is associated with relevant alterations of the hepatic architecture and expression of genes involved in cytoskeleton, hepatocyte polarity, cell junctions, and extracellular matrix proteins. Moreover, it induces hepatic expression of the IGF-1 receptor and elevated acute-phase and inflammation mediators, which all resulted in liver oxidative damage.
DEFF Research Database (Denmark)
Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther
2009-01-01
). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B
1992-12-01
Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen
DEFF Research Database (Denmark)
Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup
2012-01-01
Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...
Human Transcriptome and Chromatin Modifications: An ENCODE Perspective
Directory of Open Access Journals (Sweden)
Li Shen
2013-06-01
Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng
2017-07-01
Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Thomas Lettner
Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it
Girlich, Delphine; Dortet, Laurent; Poirel, Laurent; Nordmann, Patrice
2015-01-01
To decipher the mechanisms and their associated genetic determinants responsible for β-lactam resistance in a Proteus mirabilis clinical isolate. The entire genetic structure surrounding the β-lactam resistance genes was characterized by PCR, gene walking and DNA sequencing. Genes encoding the carbapenemase NDM-1 and the ESBL VEB-6 were located in a 38.5 kb MDR structure, which itself was inserted into a new variant of the Proteus genomic island 1 (PGI1). This new PGI1-PmPEL variant of 64.4 kb was chromosomally located, as an external circular form in the P. mirabilis isolate, suggesting potential mobility. This is the first known description of the bla(NDM-1) gene in a genomic island structure, which might further enhance the spread of the bla(NDM-1) carbapenemase gene among enteric pathogens. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon
2010-01-01
Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Directory of Open Access Journals (Sweden)
Hongyu Chen
2018-02-01
Full Text Available In higher plants, embryo development originated from fertilized egg cell is the first step of the life cycle. The chloroplast participates in many essential metabolic pathways, and its function is highly associated with embryo development. However, the mechanisms and relevant genetic components by which the chloroplast functions in embryogenesis are largely uncharacterized. In this paper, we describe the Arabidopsis EMB1990 gene, encoding a plastid-targeted YlmG protein which is required for chloroplast biogenesis and embryo development. Loss of the EMB1990/YLMG1-1 resulted in albino seeds containing abortive embryos, and the morphological development of homozygous emb1990 embryos was disrupted after the globular stage. Our results showed that EMB1990/YLMG1-1 was expressed in the primordia and adaxial region of cotyledon during embryogenesis, and the encoded protein was targeted to the chloroplast. TEM observation of cellular ultrastructure showed that chloroplast biogenesis was impaired in emb1990 embryo cells. Expression of certain plastid genes was also affected in the loss-of-function mutants, including genes encoding core protein complex subunits located in the thylakoid membrane. Moreover, the tissue-specific genes of embryo development were misexpressed in emb1990 mutant, including genes known to delineate cell fate decisions in the SAM (shoot apical meristem, cotyledon and hypophysis. Taken together, we propose that the nuclear-encoded YLMG1-1 is targeted to the chloroplast and required for normal plastid gene expression. Hence, YLMG1-1 plays a critical role in Arabidopsis embryogenesis through participating in chloroplast biogenesis.
Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development.
Simeone, A; Mavilio, F; Acampora, D; Giampaolo, A; Faiella, A; Zappavigna, V; D'Esposito, M; Pannese, M; Russo, G; Boncinelli, E
1987-07-01
Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomain identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hydridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny.
Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development
International Nuclear Information System (INIS)
Simeone, A.; Mavilio, F.; Acampora, D.
1987-01-01
Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomains identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hybridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny
Qiu, Yixuan; Fakas, Stylianos; Han, Gil-Soo; Barbosa, Antonio Daniel; Siniossoglou, Symeon; Carman, George M.
2013-01-01
In the yeast Saccharomyces cerevisiae, the DGK1-encoded diacylglycerol kinase catalyzes the CTP-dependent phosphorylation of diacylglycerol to form phosphatidate. This enzyme, in conjunction with PAH1-encoded phosphatidate phosphatase, controls the levels of phosphatidate and diacylglycerol for phospholipid synthesis, membrane growth, and lipid droplet formation. In this work, we showed that a functional level of diacylglycerol kinase is regulated by the Reb1p transcription factor. In the electrophoretic mobility shift assay, purified recombinant Reb1p was shown to specifically bind its consensus recognition sequence (CGGGTAA, −166 to −160) in the DGK1 promoter. Analysis of cells expressing the PDGK1-lacZ reporter gene showed that mutations (GT→TG) in the Reb1p-binding sequence caused an 8.6-fold reduction in β-galactosidase activity. The expression of DGK1(reb1), a DGK1 allele containing the Reb1p-binding site mutation, was greatly lower than that of the wild type allele, as indicated by analyses of DGK1 mRNA, Dgk1p, and diacylglycerol kinase activity. In the presence of cerulenin, an inhibitor of de novo fatty acid synthesis, the dgk1Δ mutant expressing DGK1(reb1) exhibited a significant defect in growth as well as in the synthesis of phospholipids from triacylglycerol mobilization. Unlike DGK1, the DGK1(reb1) expressed in the dgk1Δ pah1Δ mutant did not result in the nuclear/endoplasmic reticulum membrane expansion, which occurs in cells lacking phosphatidate phosphatase activity. Taken together, these results indicate that the Reb1p-mediated regulation of diacylglycerol kinase plays a major role in its in vivo functions in lipid metabolism. PMID:23970552
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Directory of Open Access Journals (Sweden)
Juliette J Kahle
2013-03-01
Full Text Available Hematopoietic stem cells (HSCs are rare quiescent cells that continuously replenish the cellular components of the peripheral blood. Observing that the ataxia-associated gene Ataxin-1-like (Atxn1L was highly expressed in HSCs, we examined its role in HSC function through in vitro and in vivo assays. Mice lacking Atxn1L had greater numbers of HSCs that regenerated the blood more quickly than their wild-type counterparts. Molecular analyses indicated Atxn1L null HSCs had gene expression changes that regulate a program consistent with their higher level of proliferation, suggesting that Atxn1L is a novel regulator of HSC quiescence. To determine if additional brain-associated genes were candidates for hematologic regulation, we examined genes encoding proteins from autism- and ataxia-associated protein-protein interaction networks for their representation in hematopoietic cell populations. The interactomes were found to be highly enriched for proteins encoded by genes specifically expressed in HSCs relative to their differentiated progeny. Our data suggest a heretofore unappreciated similarity between regulatory modules in the brain and HSCs, offering a new strategy for novel gene discovery in both systems.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Identification of new alternative splice events in the TCIRG1 gene in different human tissues
International Nuclear Information System (INIS)
Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia; Silva, Ismael D.C.G.; Gerbase-DeLima, Maria
2005-01-01
Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice forms in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
International Nuclear Information System (INIS)
Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin
2008-01-01
Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy
Fairley, D J; Wang, G; Rensing, C; Pepper, I L; Larkin, M J
2006-12-01
Gentisate-1,2-dioxygenase genes (gdoA), with homology to a number of bacterial dioxygenases, and genes encoding a putative coenzyme A (CoA)-synthetase subunit (acdB) and a CoA-thioesterase (tieA) were identified in two haloarchaeal isolates. In Haloarcula sp. D1, gdoA was expressed during growth on 4-hydroxybenzoate but not benzoate, and acdB and tieA were not expressed during growth on any of the aromatic substrates tested. In contrast, gdoA was expressed in Haloferax sp. D1227 during growth on benzoate, 3-hydroxybenzoate, cinnamate and phenylpropionate, and both acdB and tieA were expressed during growth on benzoate, cinnamate and phenylpropionate, but not on 3-hydroxybenzoate. This pattern of induction is consistent with these genes encoding steps in a CoA-mediated benzoate pathway in this strain.
International Nuclear Information System (INIS)
Shirley, B.W.; Berry-Lowe, S.L.; Grandbastien, M.A.; Zurfluh, L.L.; Shah, D.M.; Meagher, R.B.
1987-01-01
The expression of two closely related soybean ribulose bisphosphate carboxylase small subunit (Rubisco ss) genes, SRS1 and SRS4, has been compared. These genes account for approximately 2-4% of the total transcription in light grown leaves, SRS4 being twice as transcriptionally active as SRS1. The transcription of these genes is reduced more than 30 fold after a pulse of far-red light or extended periods of darkness. When etiolated seedlings are shifted to the light the transcription of both genes increases 30-50 fold. Despite this 30-fold range in transcriptional expression the steady state mRNA levels in light and dark grown tissue differ by less than 8 fold. This suggests that the mRNAs are less stable in light grown tissue. 38 refs., 5 figs
Sequence of a cDNA encoding turtle high mobility group 1 protein.
Zheng, Jifang; Hu, Bi; Wu, Duansheng
2005-07-01
In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.
Encoding methods for B1+ mapping in parallel transmit systems at ultra high field
Tse, Desmond H. Y.; Poole, Michael S.; Magill, Arthur W.; Felder, Jörg; Brenner, Daniel; Jon Shah, N.
2014-08-01
Parallel radiofrequency (RF) transmission, either in the form of RF shimming or pulse design, has been proposed as a solution to the B1+ inhomogeneity problem in ultra high field magnetic resonance imaging. As a prerequisite, accurate B1+ maps from each of the available transmit channels are required. In this work, four different encoding methods for B1+ mapping, namely 1-channel-on, all-channels-on-except-1, all-channels-on-1-inverted and Fourier phase encoding, were evaluated using dual refocusing acquisition mode (DREAM) at 9.4 T. Fourier phase encoding was demonstrated in both phantom and in vivo to be the least susceptible to artefacts caused by destructive RF interference at 9.4 T. Unlike the other two interferometric encoding schemes, Fourier phase encoding showed negligible dependency on the initial RF phase setting and therefore no prior B1+ knowledge is required. Fourier phase encoding also provides a flexible way to increase the number of measurements to increase SNR, and to allow further reduction of artefacts by weighted decoding. These advantages of Fourier phase encoding suggest that it is a good choice for B1+ mapping in parallel transmit systems at ultra high field.
Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia
Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.; Papadopoulos, Nickolas; Malek, Sami N.
2011-01-01
To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell...
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei
2005-01-01
To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M
1990-01-01
The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158
A Large PROP1 Gene Deletion in a Turkish Pedigree
Directory of Open Access Journals (Sweden)
Suheyla Gorar
2018-01-01
Full Text Available Pituitary-specific paired-like homeodomain transcription factor, PROP1, is associated with multiple pituitary hormone deficiency. Alteration of the gene encoding the PROP1 may affect somatotropes, thyrotropes, and lactotropes, as well as gonadotropes and corticotropes. We performed genetic analysis of PROP1 gene in a Turkish pedigree with three siblings who presented with short stature. Parents were first degree cousins. Index case, a boy, had somatotrope, gonadotrope, thyrotrope, and corticotrope deficiency. However, two elder sisters had somatotroph, gonadotroph, and thyrotroph deficiency and no corticotroph deficiency. On pituitary magnetic resonance, partial empty sella was detected with normal bright spot in all siblings. In genetic analysis, we found a gross deletion involving PROP1 coding region. In conclusion, we report three Turkish siblings with a gross deletion in PROP1 gene. Interestingly, although little boy with combined pituitary hormone deficiency has adrenocorticotropic hormone (ACTH deficiency, his elder sisters with the same gross PROP1 deletion have no ACTH deficiency. This finding is in line with the fact that patients with PROP1 mutations may have different phenotype/genotype correlation.
Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata
2017-07-01
Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.
High Myopia Caused by a Mutation in LEPREL1, Encoding Prolyl 3-Hydroxylase 2
Mordechai, Shikma; Gradstein, Libe; Pasanen, Annika; Ofir, Rivka; El Amour, Khalil; Levy, Jaime; Belfair, Nadav; Lifshitz, Tova; Joshua, Sara; Narkis, Ginat; Elbedour, Khalil; Myllyharju, Johanna; Birk, Ohad S.
2011-01-01
Autosomal-recessive high-grade axial myopia was diagnosed in Bedouin Israeli consanguineous kindred. Some affected individuals also had variable expressivity of early-onset cataracts, peripheral vitreo-retinal degeneration, and secondary sight loss due to severe retinal detachments. Through genome-wide linkage analysis, the disease-associated gene was mapped to ∼1.7 Mb on chromosome 3q28 (the maximum LOD score was 11.5 at θ = 0 for marker D3S1314). Sequencing of the entire coding regions and intron-exon boundaries of the six genes within the defined locus identified a single mutation (c.1523G>T) in exon 10 of LEPREL1, encoding prolyl 3-hydroxylase 2 (P3H2), a 2-oxoglutarate-dependent dioxygenase that hydroxylates collagens. The mutation affects a glycine that is conserved within P3H isozymes. Analysis of wild-type and p.Gly508Val (c.1523G>T) mutant recombinant P3H2 polypeptides expressed in insect cells showed that the mutation led to complete inactivation of P3H2. PMID:21885030
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang
2011-01-01
The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138
Mutations in STX1B, encoding a presynaptic protein, cause fever-associated epilepsy syndromes
DEFF Research Database (Denmark)
Schubert, J.; Siekierska, A.; Langlois, M.
2014-01-01
Febrile seizures affect 2-4% of all children(1) and have a strong genetic component(2). Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2)(3-5) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encoding...... syntaxin-1B(6), that are associated with both febrile seizures and epilepsy. Whole-exome sequencing in independent large pedigrees(7,8) identified cosegregating STX1B mutations predicted to cause an early truncation or an in-frame insertion or deletion. Three additional nonsense or missense mutations...... and a de novo microdeletion encompassing STX1B were then identified in 449 familial or sporadic cases. Video and local field potential analyses of zebrafish larvae with antisense knockdown of stx1b showed seizure-like behavior and epileptiform discharges that were highly sensitive to increased temperature...
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
A de novo variant in the ASPRV1 gene in a dog with ichthyosis.
Bauer, Anina; Waluk, Dominik P; Galichet, Arnaud; Timm, Katrin; Jagannathan, Vidhya; Sayar, Beyza S; Wiener, Dominique J; Dietschi, Elisabeth; Müller, Eliane J; Roosje, Petra; Welle, Monika M; Leeb, Tosso
2017-03-01
Ichthyoses are a heterogeneous group of inherited cornification disorders characterized by generalized dry skin, scaling and/or hyperkeratosis. Ichthyosis vulgaris is the most common form of ichthyosis in humans and caused by genetic variants in the FLG gene encoding filaggrin. Filaggrin is a key player in the formation of the stratum corneum, the uppermost layer of the epidermis and therefore crucial for barrier function. During terminal differentiation of keratinocytes, the precursor profilaggrin is cleaved by several proteases into filaggrin monomers and eventually processed into free amino acids contributing to the hydration of the cornified layer. We studied a German Shepherd dog with a novel form of ichthyosis. Comparing the genome sequence of the affected dog with 288 genomes from genetically diverse non-affected dogs we identified a private heterozygous variant in the ASPRV1 gene encoding "aspartic peptidase, retroviral-like 1", which is also known as skin aspartic protease (SASPase). The variant was absent in both parents and therefore due to a de novo mutation event. It was a missense variant, c.1052T>C, affecting a conserved residue close to an autoprocessing cleavage site, p.(Leu351Pro). ASPRV1 encodes a retroviral-like protease involved in profilaggrin-to-filaggrin processing. By immunofluorescence staining we showed that the filaggrin expression pattern was altered in the affected dog. Thus, our findings provide strong evidence that the identified de novo variant is causative for the ichthyosis in the affected dog and that ASPRV1 plays an essential role in skin barrier formation. ASPRV1 is thus a novel candidate gene for unexplained human forms of ichthyoses.
A de novo variant in the ASPRV1 gene in a dog with ichthyosis.
Directory of Open Access Journals (Sweden)
Anina Bauer
2017-03-01
Full Text Available Ichthyoses are a heterogeneous group of inherited cornification disorders characterized by generalized dry skin, scaling and/or hyperkeratosis. Ichthyosis vulgaris is the most common form of ichthyosis in humans and caused by genetic variants in the FLG gene encoding filaggrin. Filaggrin is a key player in the formation of the stratum corneum, the uppermost layer of the epidermis and therefore crucial for barrier function. During terminal differentiation of keratinocytes, the precursor profilaggrin is cleaved by several proteases into filaggrin monomers and eventually processed into free amino acids contributing to the hydration of the cornified layer. We studied a German Shepherd dog with a novel form of ichthyosis. Comparing the genome sequence of the affected dog with 288 genomes from genetically diverse non-affected dogs we identified a private heterozygous variant in the ASPRV1 gene encoding "aspartic peptidase, retroviral-like 1", which is also known as skin aspartic protease (SASPase. The variant was absent in both parents and therefore due to a de novo mutation event. It was a missense variant, c.1052T>C, affecting a conserved residue close to an autoprocessing cleavage site, p.(Leu351Pro. ASPRV1 encodes a retroviral-like protease involved in profilaggrin-to-filaggrin processing. By immunofluorescence staining we showed that the filaggrin expression pattern was altered in the affected dog. Thus, our findings provide strong evidence that the identified de novo variant is causative for the ichthyosis in the affected dog and that ASPRV1 plays an essential role in skin barrier formation. ASPRV1 is thus a novel candidate gene for unexplained human forms of ichthyoses.
Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun
2018-02-01
The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the
A lepidopteran-specific gene family encoding valine-rich midgut proteins.
Directory of Open Access Journals (Sweden)
Jothini Odman-Naresh
Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran
Song, Xin-qiang; Luo, Yuan; Wang, Dan; Liu, Shu-guang; Liu, Jin-feng; Yuan, Fang; Xue, Hong; Liu, Nan; Liang, Fei; Sun, Yu-ying; Xi, Yong-zhi
2006-08-08
To investigate the therapeutic effect of gene vaccine encoding chicken collagen type II (CC II) on collagen-induced arthritis (CIA) comprehensively. Three groups (CIA) were given a single intravenous injection of plasmid pcDNA-CCOL2A1 (20 microg/kg, 200 microg/kg, 400 microg/kg) respectively and one group (CIA) was injected 200 microg/kg pcDNA3.1 as a control. The effect of gene vaccine (pcDNA-CCOL2A1) was evaluated according to the arthritis score, radiological and histological examinations. The severity of arthritis of CIA rats which were administered 200 microg/kg pcDNA-CCOL2A1 was significantly reduced from the fifth day. According to the radiological and histological examinations, the articular cartilage as well as subchondral bone trabeculae are similar to those of the normal groups, so the bone and articular cartilage structure were protected after treatment with 200 microg/kg pcDNA-CCOL2A1 with a little synovial hyperplasia. The therapeutic effect of 200 microg/kg pcDNA-CCOL2A1 group has significant difference in comparison with that of the pcDNA3.1 group (P 0.05). The new gene vaccine pcDNA-CCOL2A1 has significant therapeutic effect on CIA rats, and the treatment may therefore be an effective strategy for RA patient clinically.
Barchinger, Sarah E.; Pirbadian, Sahand; Baker, Carol S.; Leung, Kar Man; Burroughs, Nigel J.; El-Naggar, Mohamed Y.
2016-01-01
ABSTRACT In limiting oxygen as an electron acceptor, the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1 rapidly forms nanowires, extensions of its outer membrane containing the cytochromes MtrC and OmcA needed for extracellular electron transfer. RNA sequencing (RNA-Seq) analysis was employed to determine differential gene expression over time from triplicate chemostat cultures that were limited for oxygen. We identified 465 genes with decreased expression and 677 genes with increased expression. The coordinated increased expression of heme biosynthesis, cytochrome maturation, and transport pathways indicates that S. oneidensis MR-1 increases cytochrome production, including the transcription of genes encoding MtrA, MtrC, and OmcA, and transports these decaheme cytochromes across the cytoplasmic membrane during electron acceptor limitation and nanowire formation. In contrast, the expression of the mtrA and mtrC homologs mtrF and mtrD either remains unaffected or decreases under these conditions. The ompW gene, encoding a small outer membrane porin, has 40-fold higher expression during oxygen limitation, and it is proposed that OmpW plays a role in cation transport to maintain electrical neutrality during electron transfer. The genes encoding the anaerobic respiration regulator cyclic AMP receptor protein (CRP) and the extracytoplasmic function sigma factor RpoE are among the transcription factor genes with increased expression. RpoE might function by signaling the initial response to oxygen limitation. Our results show that RpoE activates transcription from promoters upstream of mtrC and omcA. The transcriptome and mutant analyses of S. oneidensis MR-1 nanowire production are consistent with independent regulatory mechanisms for extending the outer membrane into tubular structures and for ensuring the electron transfer function of the nanowires. IMPORTANCE Shewanella oneidensis MR-1 has the capacity to transfer electrons to its external surface
Daniel, Dianne C; Johnson, Edward M
2018-02-15
The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study
DEFF Research Database (Denmark)
Hedley, Paula L; Haundrup, Ole; Andersen, Paal S
2011-01-01
The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a genetic...
Pinheiro, Pedro F.; Leitão, Jorge H.
2013-01-01
This work reports the biochemical and functional analysis of the Burkholderia cenocepacia J2315 bceN gene, encoding a protein with GDP-D-mannose 4,6-dehydratase enzyme activity (E.C.4.2.1.47). Data presented indicate that the protein is active when in the tetrameric form, catalyzing the conversion of GDP-D-mannose into GDP-4-keto-6-deoxy-D-mannose. This sugar nucleotide is the intermediary necessary for the biosynthesis of GDP-D-rhamnose, one of the sugar residues of cepacian, the major exopolysaccharide produced by environmental and human, animal and plant pathogenic isolates of the Burkholderia cepacia complex species. Vmax and Km values of 1.5±0.2 µmol.min−1.mg−1 and 1024±123 µM, respectively, were obtained from the kinetic characterization of the B. cenocepacia J2315 BceN protein by NMR spectroscopy, at 25°C and in the presence of 1 mol MgCl2 per mol of protein. The enzyme activity was strongly inhibited by the substrate, with an estimated Ki of 2913±350 µM. The lack of a functional bceN gene in a mutant derived from B. cepacia IST408 slightly reduced cepacian production. However, in the B. multivorans ATCC17616 with bceN as the single gene in its genome with predicted GMD activity, a bceN mutant did not produce cepacian, indicating that this gene product is required for cepacian biosynthesis. PMID:23460819
Directory of Open Access Journals (Sweden)
Sílvia A Sousa
Full Text Available This work reports the biochemical and functional analysis of the Burkholderia cenocepacia J2315 bceN gene, encoding a protein with GDP-D-mannose 4,6-dehydratase enzyme activity (E.C.4.2.1.47. Data presented indicate that the protein is active when in the tetrameric form, catalyzing the conversion of GDP-D-mannose into GDP-4-keto-6-deoxy-D-mannose. This sugar nucleotide is the intermediary necessary for the biosynthesis of GDP-D-rhamnose, one of the sugar residues of cepacian, the major exopolysaccharide produced by environmental and human, animal and plant pathogenic isolates of the Burkholderia cepacia complex species. Vmax and Km values of 1.5±0.2 µmol.min(-1.mg(-1 and 1024±123 µM, respectively, were obtained from the kinetic characterization of the B. cenocepacia J2315 BceN protein by NMR spectroscopy, at 25°C and in the presence of 1 mol MgCl2 per mol of protein. The enzyme activity was strongly inhibited by the substrate, with an estimated Ki of 2913±350 µM. The lack of a functional bceN gene in a mutant derived from B. cepacia IST408 slightly reduced cepacian production. However, in the B. multivorans ATCC17616 with bceN as the single gene in its genome with predicted GMD activity, a bceN mutant did not produce cepacian, indicating that this gene product is required for cepacian biosynthesis.
Sawaswong, Vorthon; Simpalipan, Phumin; Siripoon, Napaporn; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn
2015-04-01
Merozoite surface proteins (MSPs) of malaria parasites play critical roles during the erythrocyte invasion and so are potential candidates for malaria vaccine development. However, because MSPs are often under strong immune selection, they can exhibit extensive genetic diversity. The gene encoding the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum displays 2 allelic types, K1 and 3D7. In Thailand, the allelic frequency of the P. falciparum msp-3 gene was evaluated in a single P. falciparum population in Tak at the Thailand and Myanmar border. However, no study has yet looked at the extent of genetic diversity of the msp-3 gene in P. falciparum populations in other localities. Here, we genotyped the msp-3 alleles of 63 P. falciparum samples collected from 5 geographical populations along the borders of Thailand with 3 neighboring countries (Myanmar, Laos, and Cambodia). Our study indicated that the K1 and 3D7 alleles coexisted, but at different proportions in different Thai P. falciparum populations. K1 was more prevalent in populations at the Thailand-Myanmar and Thailand-Cambodia borders, whilst 3D7 was more prevalent at the Thailand-Laos border. Global analysis of the msp-3 allele frequencies revealed that proportions of K1 and 3D7 alleles of msp-3 also varied in different continents, suggesting the divergence of malaria parasite populations. In conclusion, the variation in the msp-3 allelic patterns of P. falciparum in Thailand provides fundamental knowledge for inferring the P. falciparum population structure and for the best design of msp-3 based malaria vaccines.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Pandey, Dhananjay K; Chaudhary, Bhupendra
2016-05-13
Plant profilin genes encode core cell-wall structural proteins and are evidenced for their up-regulation under cotton domestication. Notwithstanding striking discoveries in the genetics of cell-wall organization in plants, little is explicit about the manner in which profilin-mediated molecular interplay and corresponding networks are altered, especially during cellular signalling of apical meristem determinacy and flower development. Here we show that the ectopic expression of GhPRF1 gene in tobacco resulted in the hyperactivation of apical meristem and early flowering phenotype with increased flower number in comparison to the control plants. Spatial expression alteration in CLV1, a key meristem-determinacy gene, is induced by the GhPRF1 overexpression in a WUS-dependent manner and mediates cell signalling to promote flowering. But no such expression alterations are recorded in the GhPRF1-RNAi lines. The GhPRF1 transduces key positive flowering regulator AP1 gene via coordinated expression of FT4, SOC1, FLC1 and FT1 genes involved in the apical-to-floral meristem signalling cascade which is consistent with our in silico profilin interaction data. Remarkably, these positive and negative flowering regulators are spatially controlled by the Actin-Related Protein (ARP) genes, specifically ARP4 and ARP6 in proximate association with profilins. This study provides a novel and systematic link between GhPRF1 gene expression and the flower primordium initiation via up-regulation of the ARP genes, and an insight into the functional characterization of GhPRF1 gene acting upstream to the flowering mechanism. Also, the transgenic plants expressing GhPRF1 gene show an increase in the plant height, internode length, leaf size and plant vigor. Overexpression of GhPRF1 gene induced early and increased flowering in tobacco with enhanced plant vigor. During apical meristem determinacy and flower development, the GhPRF1 gene directly influences key flowering regulators through ARP-genes
Directory of Open Access Journals (Sweden)
Julia Schumacher
Full Text Available Botrytis cinerea is an aggressive plant pathogen causing gray mold disease on various plant species. In this study, we identified the genetic origin for significantly differing phenotypes of the two sequenced B. cinerea isolates, B05.10 and T4, with regard to light-dependent differentiation, oxalic acid (OA formation and virulence. By conducting a map-based cloning approach we identified a single nucleotide polymorphism (SNP in an open reading frame encoding a VELVET gene (bcvel1. The SNP in isolate T4 results in a truncated protein that is predominantly found in the cytosol in contrast to the full-length protein of isolate B05.10 that accumulates in the nuclei. Deletion of the full-length gene in B05.10 resulted in the T4 phenotype, namely light-independent conidiation, loss of sclerotial development and oxalic acid production, and reduced virulence on several host plants. These findings indicate that the identified SNP represents a loss-of-function mutation of bcvel1. In accordance, the expression of the B05.10 copy in T4 rescued the wild-type/B05.10 phenotype. BcVEL1 is crucial for full virulence as deletion mutants are significantly hampered in killing and decomposing plant tissues. However, the production of the two best known secondary metabolites, the phytotoxins botcinic acid and botrydial, are not affected by the deletion of bcvel1 indicating that other factors are responsible for reduced virulence. Genome-wide expression analyses of B05.10- and Δbcvel1-infected plant material revealed a number of genes differentially expressed in the mutant: while several protease- encoding genes are under-expressed in Δbcvel1 compared to the wild type, the group of over-expressed genes is enriched for genes encoding sugar, amino acid and ammonium transporters and glycoside hydrolases reflecting the response of Δbcvel1 mutants to nutrient starvation conditions.
Schumacher, Julia; Pradier, Jean-Marc; Simon, Adeline; Traeger, Stefanie; Moraga, Javier; Collado, Isidro González; Viaud, Muriel; Tudzynski, Bettina
2012-01-01
Botrytis cinerea is an aggressive plant pathogen causing gray mold disease on various plant species. In this study, we identified the genetic origin for significantly differing phenotypes of the two sequenced B. cinerea isolates, B05.10 and T4, with regard to light-dependent differentiation, oxalic acid (OA) formation and virulence. By conducting a map-based cloning approach we identified a single nucleotide polymorphism (SNP) in an open reading frame encoding a VELVET gene (bcvel1). The SNP in isolate T4 results in a truncated protein that is predominantly found in the cytosol in contrast to the full-length protein of isolate B05.10 that accumulates in the nuclei. Deletion of the full-length gene in B05.10 resulted in the T4 phenotype, namely light-independent conidiation, loss of sclerotial development and oxalic acid production, and reduced virulence on several host plants. These findings indicate that the identified SNP represents a loss-of-function mutation of bcvel1. In accordance, the expression of the B05.10 copy in T4 rescued the wild-type/B05.10 phenotype. BcVEL1 is crucial for full virulence as deletion mutants are significantly hampered in killing and decomposing plant tissues. However, the production of the two best known secondary metabolites, the phytotoxins botcinic acid and botrydial, are not affected by the deletion of bcvel1 indicating that other factors are responsible for reduced virulence. Genome-wide expression analyses of B05.10- and Δbcvel1-infected plant material revealed a number of genes differentially expressed in the mutant: while several protease- encoding genes are under-expressed in Δbcvel1 compared to the wild type, the group of over-expressed genes is enriched for genes encoding sugar, amino acid and ammonium transporters and glycoside hydrolases reflecting the response of Δbcvel1 mutants to nutrient starvation conditions.
Liao, Zhihua; Chen, Rong; Chen, Min; Yang, Chunxian; Wang, Qiang; Gong, Yifu
2007-01-01
1-Deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase (DXR; EC 1.1.1.267) catalyzes a committed step of the methylerythritol phosphate (MEP) pathway for the biosynthesis of pharmaceutical terpenoid indole alkaloid (TIA) precursors. The full-length cDNA sequence was cloned and characterized from a TIA-producing species, Rauvolfia verticillata, using rapid amplification of cDNA ends (RACE) technique. The new cDNA was named as RvDXR and submitted to GenBank to be assigned with an accession number (DQ779286). The full-length cDNA of RvDXR was 1804 bp containing a 1425 bp open reading frame (ORF) encoding a polypeptide of 474 amino acids with a calculated molecular mass of 51.3 kDa and an isoelectric point of 5.88. Comparative and bioinformatic analyses revealed that RvDXR showed extensive homology with DXRs from other plant species and contained a conserved transit peptide for plastids, an extended Pro-rich region and a highly conserved NADPH-binding motif in its N-terminal region owned by all plant DXRs. The phylogenetic analysis revealed that DXRs had two groups including a plant and bacterial group; RvDXR belonged to angiosperm DXRs that were obtained from Synechocystis through gene transfer according to the phylogenetic analysis. The structural modeling of RvDXR showed that RvDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that RvDXR expressed in all tissues including roots, stems, leaves, fruits and followers but at different levels. The lowest transcription level was observed in followers and the highest transcription was found in fruits of R. verticillata; the transcription level of RvDXR was a little higher in roots and stems than in leaves. The cloning and characterization of RvDXR will be helpful to understand more about the role of DXR involved in R. verticillata TIA biosynthesis at the molecular level and provides a candidate gene for metabolic engineering of the TIAs pathway in R. verticillata.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
A defect in the CLIP1 gene (CLIP-170) can cause autosomal recessive intellectual disability
Larti, Farzaneh; Kahrizi, Kimia; Musante, Luciana; Hu, Hao; Papari, Elahe; Fattahi, Zohreh; Bazazzadegan, Niloofar; Liu, Zhe; Banan, Mehdi; Garshasbi, Masoud; Wienker, Thomas F; Hilger Ropers, H; Galjart, Niels; Najmabadi, Hossein
2015-01-01
In the context of a comprehensive research project, investigating novel autosomal recessive intellectual disability (ARID) genes, linkage analysis based on autozygosity mapping helped identify an intellectual disability locus on Chr.12q24, in an Iranian family (LOD score=3.7). Next-generation sequencing (NGS) following exon enrichment in this novel interval, detected a nonsense mutation (p.Q1010*) in the CLIP1 gene. CLIP1 encodes a member of microtubule (MT) plus-end tracking proteins, which ...
Directory of Open Access Journals (Sweden)
Daniel Wibberg
Full Text Available Rhizoctonia solani, a soil-born plant pathogenic basidiomycetous fungus, affects various economically important agricultural and horticultural crops. The draft genome sequence for the R. solani AG1-IB isolate 7/3/14 as well as a corresponding transcriptome dataset (Expressed Sequence Tags--ESTs were established previously. Development of a specific R. solani AG1-IB gene model based on GMAP transcript mapping within the eukaryotic gene prediction platform AUGUSTUS allowed detection of new genes and provided insights into the gene structure of this fungus. In total, 12,616 genes were recognized in the genome of the AG1-IB isolate. Analysis of predicted genes by means of different bioinformatics tools revealed new genes whose products potentially are involved in degradation of plant cell wall components, melanin formation and synthesis of secondary metabolites. Comparative genome analyses between members of different R. solani anastomosis groups, namely AG1-IA, AG3 and AG8 and the newly annotated R. solani AG1-IB genome were performed within the comparative genomics platform EDGAR. It appeared that only 21 to 28% of all genes encoded in the draft genomes of the different strains were identified as core genes. Based on Average Nucleotide Identity (ANI and Average Amino-acid Identity (AAI analyses, considerable sequence differences between isolates representing different anastomosis groups were identified. However, R. solani isolates form a distinct cluster in relation to other fungi of the phylum Basidiomycota. The isolate representing AG1-IB encodes significant more genes featuring predictable functions in secondary metabolite production compared to other completely sequenced R. solani strains. The newly established R. solani AG1-IB 7/3/14 gene layout now provides a reliable basis for post-genomics studies.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-08-01
Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. Copyright © 2015 Elsevier Ltd. All rights reserved.
Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio
2004-06-23
Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.
Directory of Open Access Journals (Sweden)
Bryan Holland
Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the
Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N
2011-11-24
To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.
Colau, D; Negrutiu, I; Van Montagu, M; Hernalsteens, J P
1987-01-01
The Saccharomyces cerevisiae ILV1 gene, encoding threonine dehydratase (EC 4.2.1.16) was fused to the transferred DNA nopaline synthase promoter and the 3' noncoding region of the octopine synthase gene. It was introduced, by Agrobacterium tumefaciens-mediated gene transfer, into an isoleucine-requiring Nicotiana plumbaginifolia auxotroph deficient in threonine dehydratase. Functional complementation by the ILV1 gene product was demonstrated by the selection of several transformed lines on a ...
Ayo, Christiane Maria; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Brandão de Mattos, Cinara de Cássia; Previato, Mariana; Barbosa, Amanda Pires; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos
2016-01-01
The objective of this study was to investigate the influence of the genes encoding the KIR receptors and their HLA ligands in the susceptibility of ocular toxoplasmosis. A total of 297 patients serologically-diagnosed with toxoplasmosis were selected and stratified according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping was performed by PCR-SSOP. Statistical analyses were conducted using the Chi-square test, and odds ratio with a 95% confidence interval was also calculated to evaluate the risk association. The activating KIR3DS1 gene was associated with increased susceptibility for ocular toxoplasmosis. The activating KIR together with their HLA ligands (KIR3DS1-Bw4-80Ile and KIR2DS1+/C2++ KIR3DS1+/Bw4-80Ile+) were associated with increased susceptibility for ocular toxoplasmosis and its clinical manifestations. KIR-HLA inhibitory pairs -KIR2DL3/2DL3-C1/C1 and KIR2DL3/2DL3-C1- were associated with decreased susceptibility for ocular toxoplasmosis and its clinical forms, while the KIR3DS1−/KIR3DL1+/Bw4-80Ile+ combination was associated as a protective factor against the development of ocular toxoplasmosis and, in particular, against recurrent manifestations. Our data demonstrate that activating and inhibitory KIR genes may influence the development of ocular toxoplasmosis. PMID:27827450
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Hydrocephalus and intestinal aganglionosis : Is L1CAM a modifier gene in Hirschsprung disease?
Parisi, MA; Kapur, RP; Neilson, [No Value; Hofstra, RMW; Holloway, LW; Michaelis, RC; Leppig, KA
2002-01-01
Congenital hydrocephalus associated with aqueductal stenosis and/or agenesis of the corpus callosum has been described in newborn males with mutations in L1CAM, a gene that encodes a neural cell adhesion molecule. These males usually have severe mental retardation and may have spastic paraplegia and
Identification of functional elements and regulatory circuits by Drosophila modENCODE
Energy Technology Data Exchange (ETDEWEB)
Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis
2010-12-22
To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions
International Nuclear Information System (INIS)
Cirullo, R.E.; Dana, S.; Wasmuth, J.J.
1983-01-01
A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure
Joshi, Geetika; Schmidt, Radomir; Scow, Kate M; Denison, Michael S; Hristova, Krassimira R
2015-04-01
Among the few bacteria known to utilize methyl tert-butyl ether (MTBE) as a sole carbon source, Methylibium petroleiphilum PM1 is a well-characterized organism with a sequenced genome; however, knowledge of the genetic regulation of its MTBE degradation pathway is limited. We investigated the role of a putative transcriptional activator gene, mdpC, in the induction of MTBE-degradation genes mdpA (encoding MTBE monooxygenase) and mdpJ (encoding tert-butyl alcohol hydroxylase) of strain PM1 in a gene-knockout mutant mdpC(-). We also utilized quantitative reverse transcriptase PCR assays targeting genes mdpA, mdpJ and mdpC to determine the effects of the mutation on transcription of these genes. Our results indicate that gene mdpC is involved in the induction of both mdpA and mdpJ in response to MTBE and tert-butyl alcohol (TBA) exposure in PM1. An additional independent mechanism may be involved in the induction of mdpJ in the presence of TBA. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Yasui, Fumihiko; Itoh, Yasushi; Ikejiri, Ai; Kitabatake, Masahiro; Sakaguchi, Nobuo; Munekata, Keisuke; Shichinohe, Shintaro; Hayashi, Yukiko; Ishigaki, Hirohito; Nakayama, Misako; Sakoda, Yoshihiro; Kida, Hiroshi; Ogasawara, Kazumasa; Kohara, Michinori
2016-11-28
H5N1 highly pathogenic avian influenza (H5N1 HPAI) virus causes elevated mortality compared with seasonal influenza viruses like H1N1 pandemic influenza (H1N1 pdm) virus. We identified a mechanism associated with the severe symptoms seen with H5N1 HPAI virus infection. H5N1 HPAI virus infection induced a decrease of dendritic cell number in the splenic extrafollicular T-cell zone and impaired formation of the outer layers of B-cell follicles, resulting in insufficient levels of antibody production after infection. However, in animals vaccinated with a live recombinant vaccinia virus expressing the H5 hemagglutinin, infection with H5N1 HPAI virus induced parafollicular dendritic cell accumulation and efficient antibody production. These results indicate that a recombinant vaccinia encoding H5 hemagglutinin gene does not impair dendritic cell recruitment and can be a useful vaccine candidate.
Molecular analysis of an actin gene, CarACT1, from chickpea (Cicer arietinum L.).
Peng, Hui; Cheng, Huiying; Yu, Xingwang; Shi, Qinghua; Zhang, Hua; Li, Jiangui; Ma, Hao
2010-02-01
Actins are ubiquitous and highly conserved proteins that play key roles in cell formation and cellular activities. In this study, an actin gene was isolated from chickpea for the first time and designated as CarACT1 (for Cicer arietinum L. actin gene 1; Genbank accession no. EU529707). It encoded a putative protein with 377 amino acids and contained five exons and four introns within genomic DNA sequence. CarACT1 was localized in cytoplasm and showed high similarity to other well known actins from various species. Reverse transcription-polymerase chain reaction (RT-PCR) assay proved that CarACT1 transcripts were ubiquitously accumulated in all major organs, such as seedling roots, stems, leaves, flowers, young pods, and seeds, as well as in diverse developmental stages, such as leaf senescence, seed development and germination. Our results suggested that CarACT1 is an actin gene with physiological functions and may be served as a potential reference gene for transcription level of interesting genes in chickpea.
Bowman, Barry J; Abreu, Stephen; Johl, Jessica K; Bowman, Emma Jean
2012-11-01
The pmr gene is predicted to encode a Ca(2+)-ATPase in the secretory pathway. We examined two strains of Neurospora crassa that lacked PMR: the Δpmr strain, in which pmr was completely deleted, and pmr(RIP), in which the gene was extensively mutated. Both strains had identical, complex phenotypes. Compared to the wild type, these strains required high concentrations of calcium or manganese for optimal growth and had highly branched, slow-growing hyphae. They conidiated poorly, and the shape and size of the conidia were abnormal. Calcium accumulated in the Δpmr strains to only 20% of the wild-type level. High concentrations of MnCl(2) (1 to 5 mM) in growth medium partially suppressed the morphological defects but did not alter the defect in calcium accumulation. The Δpmr Δnca-2 double mutant (nca-2 encodes a Ca(2+)-ATPase in the plasma membrane) accumulated 8-fold more calcium than the wild type, and the morphology of the hyphae was more similar to that of wild-type hyphae. Previous experiments failed to show a function for nca-1, which encodes a SERCA-type Ca(2+)-ATPase in the endoplasmic reticulum (B. J. Bowman, S. Abreu, E. Margolles-Clark, M. Draskovic, and E. J. Bowman, Eukaryot. Cell 10:654-661, 2011). The pmr(RIP) Δnca-1 double mutant accumulated small amounts of calcium, like the Δpmr strain, but exhibited even more extreme morphological defects. Thus, PMR can apparently replace NCA-1 in the endoplasmic reticulum, but NCA-1 cannot replace PMR. The morphological defects in the Δpmr strain are likely caused, in part, by insufficient concentrations of calcium and manganese in the Golgi compartment; however, PMR is also needed to accumulate normal levels of calcium in the whole cell.
ClRTL1 Encodes a Chinese Fir RNase III–Like Protein Involved in Regulating Shoot Branching
Directory of Open Access Journals (Sweden)
Xia Li
2015-10-01
Full Text Available Identification of genes controlling shoot branching is crucial for improving plant architecture and increasing crop yield or biomass. A branching mutant of Chinese fir named “Dugansha” (Cunninghamia lanceolata var. dugan. has been isolated in our laboratory. We chose the cDNA-AFLP technique and an effective strategy to screen genes that potentially regulate shoot branching in Chinese fir using this mutant. An RNase III-like1 cDNA fragment named ClRTL1 was identified as a potential positive regulator. To investigate the function of ClRTL1 in regulating shoot branching, we cloned the full-length cDNA sequence from C. lanceolata (Lamb. Hook, deduced its secondary structure and function, and overexpressed the coding sequence in Arabidopsis. The ClRTL1 cDNA is 1045 bp and comprises an open reading frame of 705 bp. It encodes a protein of 235 amino acids. The deduced secondary structure of the ClRTL1 indicates that it is a mini-RNase III-like protein. The expression analysis and phenotypes of 35S: ClRTL1 in A. thaliana implies that ClRTL1 plays a role in promoting shoot branching in Chinese fir.
Rai, Avinash Chandra; Singh, Major; Shah, Kavita
2013-01-01
Efficient genetic transformation of cotyledonary explants of tomato (Solanum lycopersicum, cv. H-86, Kashi vishesh) was obtained. Disarmed Agrobacterium tumifaciens strain GV 3101 was used in conjugation with binary vector pBinAR containing a construct consisting of the coding sequence of the BcZAT12 gene under the regulatory control of the stress inducible Bclea1a promoter. ZAT12 encodes a C₂H₂ zinc finger protein which confers multiple abiotic stress tolerance to plants. Integration of ZAT12 gene into nuclear genome of individual kanamycin resistant transformed T₀ tomato lines was confirmed by Southern blot hybridization with segregation analysis of T(1) plants showing Mendelian inheritance of the transgene. Expression of ZAT12 in drought-stressed transformed tomato lines was verified in T₂ generation plants using RT-PCR. Of the six transformed tomato lines (ZT1-ZT6) the transformants ZT1 and ZT5 showed maximum expression of BcZAT12 gene transcripts when exposed to 7 days drought stress. Analysis of relative water content (RWC), electrolyte leakage (EL), chlorophyll colour index (CCI), H₂O₂ level and catalase activity suggested that tomato BcZAT12 transformants ZT1 and ZT5 have significantly increased levels of drought tolerance. These results suggest that BcZAT12 transformed tomato cv. H-86 has real potential for molecular breeding programs aimed at augmenting yield of tomato in regions affected with drought stress. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yang Deming
2016-01-01
Full Text Available Domestic guinea pig is a model animal for human disease research. Uridine diphosphate glucuronosyltransferase 1 family, polypeptide A1 (UGT1A1 is an important human disease-related gene. In this study, the complete coding sequence of domestic guinea pig gene UGT1A1 was amplified by reverse transcription-polymerase chain reaction. The open reading frame of the domestic guinea pig UGT1A1 gene is 1602 bp in length and was found to encode a protein of 533 amino acids. Sequence analysis revealed that the UGT1A1 protein of domestic guinea pig shared high homology with the UGT1A1 proteins of degu (84%, damara mole-rat (84%, human (80%, northern white-cheeked gibbon (80%, Colobus angolensis palliatus (80% and golden snub-nosed monkey (79%. This gene contains five exons and four introns, as revealed by the computer-assisted analysis. The results also showed that the domestic guinea pig UGT1A1 gene had a close genetic relationship with the UGT1A1 gene of degu. The prediction of transmembrane helices showed that domestic guinea pig UGT1A1 might be a transmembrane protein. Expression profile analysis indicated that the domestic guinea pig UGT1A1 gene was differentially expressed in detected domestic guinea pig tissues. Our experiment laid a primary foundation for using the domestic guinea pig as a model animal to study the UGT1A1-related human diseases.
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
International Nuclear Information System (INIS)
Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard
2008-01-01
Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
Zhang, HuiFang; Xu, WeiGang; Wang, HuiWei; Hu, Lin; Li, Yan; Qi, XueLi; Zhang, Lei; Li, ChunXin; Hua, Xia
2014-09-01
Using particle bombardment transformation, we introduced maize pepc cDNA encoding phosphoenolpyruvate carboxylase (PEPC) and ppdk cDNA encoding pyruvate orthophosphate dikinase (PPDK) into the C3 crop wheat to generate transgenic wheat lines carrying cDNA of pepc (PC lines), ppdk (PK lines) or both (PKC lines). The integration, transcription, and expression of the foreign genes were confirmed by Southern blot, Real-time quantitative reverse transcription PCR (Q-RT-PCR), and Western blot analysis. Q-RT-PCR results indicated that the average relative expression levels of pepc and ppdk in the PKC lines reached 10 and 4.6, respectively, compared to their expressions in untransformed plants (set to 1). The enzyme activities of PEPC and PPDK in the PKC lines were 4.3- and 2.1-fold higher, respectively, than in the untransformed control. The maximum daily net photosynthetic rates of the PKC, PC, and PK lines were enhanced by 26.4, 13.3, and 4.5%, respectively, whereas the diurnal accumulations of photosynthesis were 21.3, 13.9, and 6.9%, respectively, higher than in the control. The Fv/Fm of the transgenic plants decreased less than in the control under high temperature and high light conditions (2 weeks after anthesis), suggesting that the transgenic wheat transports more absorbed light energy into a photochemical reaction. The exogenous maize C4-specific pepc gene was more effective than ppdk at improving the photosynthetic performance and yield characteristics of transgenic wheat, while the two genes showed a synergistic effect when they were transformed into the same genetic background, because the PKC lines exhibited improved photosynthetic and physiological traits.
International Nuclear Information System (INIS)
Pettenati, M.J.; Le Beau, M.M.; Lemons, R.S.; Shima, E.A.; Kawasaki, E.S.; Larson, R.A.; Sherr, C.J.; Diaz, M.O.; Rowley, J.D.
1987-01-01
The CSF-1 gene encodes a hematopoietic colony-stimulating factor (CSF) that promotes growth, differentiation, and survival of mononuclear phagocytes. By using somatic cell hybrids and in situ hybridization, the authors localized this gene to human chromosome 5 at bands q31 to q35, a chromosomal region that is frequently deleted [del(5q)] in patients with myeloid disorders. By in situ hybridization, the CSF-1 gene was found to be deleted in the 5q- chromosome of a patient with refractory anemia who had a del(5) (q15q33.3) and in that of a second patient with acute nonlymphocytic leukemia de novo who had a similar distal breakpoint [del(5)(q13q33.3)]. The gene was present in the deleted chromosome of a third patient, with therapy-related acute nonlymphocytic leukemia, who had a more proximal breakpoint in band q33 [del(5)(q22q33.1)]. Hybridization of the CSF-1 probe to metaphase cells of a fourth patient, with acute nonlymphocytic leukemia de novo, who had a rearrangement of chromosomes 5 and 21 resulted in labeling of the breakpoint junctions of both rearranged chromosomes; this suggested that CSF-1 is located at 5q33.1. Thus, a small segment of chromosome 5 contains GM-CSF (the gene encoding the granulocyte-macrophage CSF), CSF-1, and FMS, which encodes the CSF-1 receptor, in that order from the centromere; this cluster of genes may be involved in the altered hematopoiesis associated with a deletion of 5q
Directory of Open Access Journals (Sweden)
Nan-Yang Li
2018-02-01
Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario
2017-04-01
Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Identification of genes involved in DNA replication of the Autographa californica baculovirus
Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.
1994-01-01
By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,