WorldWideScience

Sample records for frijol mungo vigna

  1. Nodulation studies with induced mutants of black gram (Vigna mungo L.)

    International Nuclear Information System (INIS)

    Mahna, S.K.; Garg, Rekha; Parvateesam, M.

    1990-01-01

    Mutation breeding has been widely used to generate genetic variability in plants, but reports of mutations affecting the root system are less common. In the present work, black gram (Vigna mungo L. var T9), has been used for studies on the effect of induced mutations on nodulation patterns

  2. DEVELOPMENTAL CHANGES IN THE GERMINATION, GROWTH AND CHLOROPHYLLASE ACTIVITY OF VIGNA MUNGO L. USING SEAWEED EXTRACT OF ULVA RETICULATA FORSSKAL.

    OpenAIRE

    Ganapathy Selvam G.; Balamurugan M.; Thinakaran T.; Sivakumar K

    2013-01-01

    The effect of seaweed extract prepared from Ulva reticulata on seed germination, seedling growth and chlorophyllase activity of Vigna mungo L. was studied. 100% germination was recorded in the seeds treated with lower concentration of seaweed extract. The V. mungo seeds soaked with lower concentrations of the seaweed extracts showed higher rates of germination, while the higher concentrations of the extracts inhibited the germination.

  3. Biofertilizing efficiency of Sargassum polycystum extract on growth and biochemical composition of Vigna radiata and Vigna mungo

    Directory of Open Access Journals (Sweden)

    B Bharath

    2018-01-01

    Full Text Available Objective: To evaluate the effect of marine brown alga Sargassum polycystum extract on growth and biochemical parameters of Vigna radiata and Vigna mungo.Methods: Different concentrations of algal extracts (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0% were prepared and applied to the crops at every 10-day intervals under natural conditions. After 30 d, the plants were harvested to evaluate the growth and biochemical parameters.Results: Seaweed liquid fertilizers treated seedlings showed maximum growth in 3.0% concentration when compared to the untreated seedlings. Similarly, biochemical parameters such as photosynthetic pigments, protein, reducing sugar, total sugar and amino acids exhibited increases in 3.0% concentration seaweed extract. Decreases in growth and biochemical parameters were noticed in concentrations higher than 3.0%.Conclusions: Presence of micronutrients and growth regulating substances in the liquid extract help healthier and faster productivity of the crop.

  4. Identification of Mungbean yellow mosaic India virus infecting Vigna mungo var. silvestris L.

    Directory of Open Access Journals (Sweden)

    Kamaal NAIMUDDIN

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yellow mosaic of Vigna mungo var.  silvestris, a wild relative of blackgram (Vigna mungo [L.] Hepper, was noticed at the Indian Institute of Pulses Research, Kanpur, India during 2008–2010, with an incidence of 100 per cent. The observed symptoms, consisting of veinal yellowing and scattered bright yellow spots, were suggestive of infection with a begomovirus. To characterize the virus, several sets of primer pairs were designed to amplify the targeted DNA fragments of the causal virus. The sequence data revealed that the coat protein (AV1 gene of the begomovirus under study contained a single open reading frame with 774 nucleotides, coding for 257 amino acids. Comparative analysis of the coat protein (AV1 gene of the virus under study (FJ821189 showed a 97 and 99% similarity with Mungbean yellow mosaic India virus (MYMIV-Mungbean strain at the nucleotide and the amino acid levels respectively. Sequence homology of different genes (AC1, AC2, AC3 and AC4 of the isolate under study (FJ663015 with MYMIV-Mungbean (EU523045 was 94–97% for the nucleotides and 91–99% for the amino acids sequence. Therefore, the begomovirus infecting V. mungo var. silvestris at Kanpur is to be considered a strain of MYMIV and is

  5. The effect of sodium chloride salinity on germination and productivity of mung bean (Vigna Mungo Linn.)

    International Nuclear Information System (INIS)

    Jabeen, M.; Azim, F.; Ibrar, M.; Hussain, F.; Ilahi, I.

    2003-01-01

    The germination was significantly declined at salinity levels of 5.0 dSm/sup -1/ and above in the laboratory experiment while in the pot experiment germination significantly reduced at salinity levels of 7.5 dSm/sup -1/ and above. Radicle and plumule lengths were also significantly reduced at 5.0 dSm/sup -1/ and higher levels of NaCl. Plant height, number of branches and number of leaves significantly decreased at 10.0 dSm/sup -1/ and higher levels of salinity. The number of seeds was significantly dwindled at 7.5 dSm/sup -1/ and above. Similarly, chlorophyll contents were also significantly low at 7.5 dSm/sup -1/ and higher concentrations. It was concluded that Vigna mungo might not show promising growth and productivity in saline habitats. However, under mild saline conditions it might be grown not only to supplement the crop yield, but also as a source of fodder and soil reclamation measure. (author)

  6. Effect of simulated acid rain (sar) on some morphochemical aspects of mash (vigna mungo l.)

    International Nuclear Information System (INIS)

    Imran, H.A.; Hussain, M.; Hussain, S.

    2014-01-01

    The studies were conducted to evaluate the effect of simulated acid rain (SAR) at early plant growth on some morphochemical characters of two varieties of Mash (Vigna mungo L.) namely Mash 97 and Var. 95009. Different pH values were made by using H/sub 2/SO/sub 4/, HNO/sub 3/, and combination of both. The data revealed that low pH (3.5) of either sulphuric acid or the combination of H/sub 2/SO/sub 4/ and HNO/sub 3/ affected more severely at all parameters including number of leaves, shoot: root ratio, water contents of shoot and Potassium ion concentration. Whereas for a few parameters like plant height and number of branches the simulated acid rain of solution of pH 4.5 and 3.5 by using HNO/sub 3/ proved a bit better for plant growth, the root length was increased in case of SAR of solution of pH 3.5 by using H/sub 2/SO/sub 4/+HNO/sub 3/. Foliar application of SAR of solution of pH greater than 4.5 showed some improvement in crop growth due to fertilizer effect of solution's components. (author)

  7. Bruchid egg induced transcript dynamics in developing seeds of black gram (Vigna mungo.

    Directory of Open Access Journals (Sweden)

    Indrani K Baruah

    Full Text Available Black gram (Vigna mungo seeds are a rich source of digestible proteins, however, during storage these seeds are severely damaged by bruchids (Callosobruchus spp., reducing seed quality and yield losses. Most of the cultivated genotypes of black gram are susceptible to bruchids, however, few tolerant genotypes have also been identified but the mechanism of tolerance is poorly understood. We employed Suppression Subtractive Hybridization (SSH to identify specifically, but rarely expressed bruchid egg induced genes in black gram. In this study, Suppression Subtractive Hybridization (SSH library was constructed to study the genes involved in defense response in black gram against bruchid infestation. An EST library of 277 clones was obtained for further analyses. Based on CAP3 assembly, 134 unigenes were computationally annotated using Blast2GOPRO software. In all, 20 defense related genes were subject to quantitative PCR analysis (qPCR out of which 12 genes showed up-regulation in developing seeds of the pods oviposited by bruchids. Few major defense genes like defensin, pathogenesis related protein (PR, lipoxygenase (LOX showed high expression levels in the oviposited population when compared with the non-oviposited plants. This is the first report on defense related gene transcript dynamics during the bruchid-black gram interaction using SSH library. This library would be useful to clone defense related gene(s such as defensin as represented in our library for crop improvement.

  8. First report of natural infection of Vigna mungo var. silvestris L. by Groundnut bud necrosis virus, a tospovirus

    Directory of Open Access Journals (Sweden)

    Mohammad AKRAM

    2010-09-01

    Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.

  9. Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

  10. Spectrum and frequency of chlorophyll mutations in urdbean (Vigna mungo L. Hepper) induced by EMS and gamma rays

    International Nuclear Information System (INIS)

    Sharma, A.K.; Singh, V.P.; Sarma, M.K.

    2006-01-01

    In mutation breeding experiment, plants with altered characteristics such as chlorophyll changes, sterility, plant lethality etc. could be the marker of the mutability of a variety. In fact, spectrum and frequency of chlorophyll mutations have been studied in the great detail. The chlorophyll mutation is the clear-cut indication of non-directional nature of mutation and possibility of induction of useful mutations. The spectrum and frequency of chlorophyll mutation was estimated by using gamma rays (100, 200, 300 and 400 Gy doses), EMS (0.2, 0.4, 0.6 and 0.8%) and combination of gamma rays (100, 200, 300 400 Gy) with 0.2 % concentration EMS on two cultivars, namely, Pant Urd-19 and Pant Urd-30 of urdbean ( Vigna mungo L. Hepper). Five different types of chlorophyll mutations viz., albina, xantha, viridis, chlorina and maculata were identified in both the cultivars. Almost all the combination treatments produced maximum frequency and wider spectrum of chlorophyll mutations followed by single treatment of gamma rays or EMS. The frequency of chlorophyll mutation increased with higher doses of mutagens but decreased at highest dose. Proc. Nat. Acad. Sci. India. 76(8), I, 2006. 64-68. (author)

  11. Leaf crinkle disease in urdbean (Vigna mungo L. Hepper): An overview on causal agent, vector and host.

    Science.gov (United States)

    Gautam, Narinder Kumar; Kumar, Krishna; Prasad, Manoj

    2016-05-01

    Urdbean leaf crinkle disease (ULCD) is an economically significant widespread and devastating disease resulting in extreme crinkling, puckering and rugosity of leaves inflicting heavy yield losses annually in major urdbean-producing countries of the world. This disease is caused by urdbean leaf crinkle virus (ULCV). Urdbean (Vigna mungo L. Hepper) is relatively more susceptible than other pulses to leaf crinkle disease. Urdbean is an important and useful crop cultivated in various parts of South-East Asia and well adapted for cultivation under semi-arid and subtropical conditions. Aphids, insects and whiteflies have been reported as vectors of the disease. The virus is also transmitted through sap inoculation, grafting and seed. The loss in seed yield in ULCD-affected urdbean crop ranges from 35 to 81%, which is dependent upon type of genotype location and infection time. The diseased material and favourable climatic conditions contribute for the widespread viral disease. Anatomical and biochemical changes take place in the affected diseased plants. Genetic variations have been reported in the germplasm screening which suggest continuous screening of available varieties and new germplasm to search for new traits (new genes) and identify new sources of disease resistance. There are very few reports on breeding programmes for the development and release of varieties tolerant to ULCD. Mostly random amplified polymorphic DNA (RAPD) as well as inter-simple sequence repeat (ISSR) molecular markers have been utilized for fingerprinting of blackgram, and a few reports are there on sequence-tagged micro-satellite site (STMS) markers. There are so many RNA viruses which have also developed strategies to counteract silencing process by encoding suppressor proteins that create hindrances in the process. But, in the case of ULCV, there is no report available indicating which defence pathway is operating for its resistance in the plants and whether same silencing suppression

  12. Vigna mungo L. Hepper

    African Journals Online (AJOL)

    satyam

    2013-03-13

    Mar 13, 2013 ... Genetic engineering allows these genes to be transferred to cultivated varieties in order to enhance the tolerance to various stresses and hence stabilize .... primer: 5'. AATATCACGGGTAGCCAACG 3' and reverse primer 5'.

  13. Vigna mungo (L.) Hepper

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Available online at http://www.academicjournals.org/AJB .... g/100 g, Trifolium alexandrianum green manure (GM) @ 4 g/100 g. (on dry weight ... MN-S with concentrated sugar solution as an ad- ..... as an alternative fertilizer.

  14. Comparative nutritional analysis between Vigna radiata and Vigna ...

    African Journals Online (AJOL)

    Vigna radiata (mung bean) and Vigna mungo (mash bean) of the family Fabaceae are among staple food in Pakistan. The experiments were conducted on these beans to determine the proximate composition such as moisture, ash, fibre, fat and protein content. The protein isolates from V. radiata and V. mungo was ...

  15. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. �UG157� and �DPU915� were good general combiners. Two crosses namely �PDB 88-31�/�DPU 915� and �PLU 277�/�KAU7� had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  16. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. UG157 and DPU915 were good general combiners. Two crosses namely PDB 88-31/DPU 915 and PLU 277/KAU7 had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  17. Structural characterization of silver nanoparticles phyto-mediated by a plant waste, seed hull of Vigna mungo and their biological applications

    Science.gov (United States)

    Varadavenkatesan, Thivaharan; Vinayagam, Ramesh; Selvaraj, Raja

    2017-11-01

    Nanobiotechnology has rapidly become a critical facet of nanotechnology. The green synthesis of silver nanoparticles, making use of the hull of black gram (Vigna mungo), paves the way for a simple and eco-friendly utilization of a domestic waste to a product with antioxidant and anticoagulant activities. The emergence of silver nanoparticles was characterized by a variety of methods UV-visible spectrophotometry, scanning electron microscopy added to energy dispersive spectroscopy, X-ray diffractometry, particle size distribution and FT-IR spectroscopy analyses. A discrete band at 421 nm was obtained from UV-visible spectroscopy of the silver nanoparticle suspension. The extract sourced from the hull of black gram showed evidence of the presence of a variety of functional moieties of phytochemicals using FTIR spectroscopy. These were also deemed responsible for maintaining the stability of silver nanoparticles. SEM and EDAX techniques combined, proved that the zero-valent silver nanoparticles were lesser than 100 nm in size. The crystallinity of the nanoparticles was confirmed, as deduced by the (1 1 1) plane, from XRD analysis. The potential of the phytochemicals in maintaining the steadiness of nanoparticles was implied by the zeta potential value that stood at -30.3 mV. In the current study, we have endeavored to comprehend the antioxidant and anticoagulant nature of the green-synthesized benign silver nanoparticles.

  18. Comportamento de linhagens de feijão-mungo(Vigna radiata L. em Santa Catarina Behaviour of mungbean (Vigna radiata L. in Santa Catarina

    Directory of Open Access Journals (Sweden)

    Shong Lin Shiow

    2002-08-01

    Full Text Available Foram conduzidos três experimentos na fazenda experimental do Centro de Ciências Agrárias da Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil. A finalidade do trabalho foi avaliar o comportamento de 29 linhagens de feijão mungo provenientes do "Asian Vegetable Research and Development Center" (AVRDC. Avaliaram-se as características agronômicas (formacão da primeira flor, primeiro legume maduro, estatura da planta, o peso de mil sementes e o rendimento. As linhagens foram testadas em blocos ao acaso, com quatro repetições. Cada parcela foi constituída por 4 linhas de 6m de comprimento, espaçadas de 50cm, com vinte sementes por metro de sulco. A floração inicial das linhagens ocorreu entre os 33 e 49 dias após o plantio, enquanto a maturação do primeiro legume se deu entre os 70 e 78 dias após a semeadura. A estatura das plantas e o peso de mil sementes variaram entre 22,5 e 63,8cm e 33,0 e 76,4g respectivamente. As linhagens mais produtivas foram: VC 3890B, VC 1973C e VC 2764B com rendimento acima de 1140kg.ha-1. Estas linhagens apresentaram peso de mil sementes e estatura de planta boas para cultivo e um ciclo biológico médio. A colheita foi feita em uma única operação, entre 80 e 85 dias após a semeadura no primeiro e segundo experimentos. No terceiro experimento, a colheita foi feita em duas vezes, aos 80 e 85 dias e aos 95 e 100 dias, sendo que na primeira colheita foram colhidos 78% dos legumes; os restantes 22% foram colhidos 15 dias após a primeira.Three experiments were conducted at the experimental farm of the Agricultural Science Center, Federal University of Santa Catarina, Ressacada, Florianópolis, SC. Brazil. Twenty nine lines of mungbean from the Asian Vegetable Research and Development Center (AVRDC, Taiwan, Republic of China were evaluated about their agronomic characters (first flower formation, first legume mature, plant height, thousand seeds weight and yield. The experimental design

  19. Improvement of the Chinese bean [Vigna Unguiculata (L.) Walp.], through radioinduced mutagenesis; Mejoramiento de Frijol Chino [Vigna Unguiculata (L.) Walp.], Mediante Mutagenesis Radioinducida

    Energy Technology Data Exchange (ETDEWEB)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Solis M, M. [Colegio Superior Agropecuario del Estado de Guerrero, Iguala (Mexico); Cervantes S, T. [Instituto de Recursos Geneticos y Productividad (Mexico); Cruz T, E. de la [ININ, Carretera Mexico-La Marquesa S/N, La Marquesa Ocoyoacac, Mexico. C.P. 52750 (Mexico)]. e-mail: csaegro@prodigy.net.mx

    2006-07-01

    The advances in the process of genetic improvement of the Chinese bean (Vigna Unguiculata (L.) are presented, high nutritious value that it is evaluating as alternative for marginal areas producers of the State of Guerrero. The method of improvement applied it is recurrent radiation, continued by selection cycles applying the method of progeny by plant. The applied radiation doses were 200 and 250 Gray. The established selection approaches are: resistant plants or tolerant to the plagues attack and illnesses, vigorous, with more height to the first sheath, of compact and certain growth, with short internodes, bigger number of sheaths by plant and of grains by sheath, bigger number of grain size, among others. The obtained results show that the dose that induces bigger variability and that it has propitiated the biggest quantity in possible mutants it is 200Gy. Precocious plants with more height to the first sheath, with certain growth as well as with bigger number and sheaths size have been detected. The selected plants have incorporated to an increment process by means of the progeny method by plant. (Author)

  20. De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L. Hepper].

    Directory of Open Access Journals (Sweden)

    J Souframanien

    Full Text Available Black gram [V. mungo (L. Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes pathways were identified, of which majority of TCS are grouped into purine metabolism (678 followed by pyrimidine metabolism (263. A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35% followed by di-nucleotide repeats (32%. PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS and untranslated regions (UTRs respectively. Tri-nucleotide repeats (57.3% were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram.

  1. De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L.) Hepper

    Science.gov (United States)

    Souframanien, J.; Reddy, Kandali Sreenivasulu

    2015-01-01

    Black gram [V. mungo (L.) Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS) were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO) functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways were identified, of which majority of TCS are grouped into purine metabolism (678) followed by pyrimidine metabolism (263). A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35%) followed by di-nucleotide repeats (32%). PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS) and untranslated regions (UTRs) respectively. Tri-nucleotide repeats (57.3%) were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram. PMID

  2. Fenólicos totais e atividade antioxidante do extrato aquoso de broto de feijão-mungo (Vigna radiata L. Total phenolics and antioxidant activity of the aqueous extract of mung bean sprout (Vigna radiata L.

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Arroxelas Galvão de Lima

    2004-03-01

    Full Text Available OBJETIVO: Considerando a importância dos compostos fenólicos em alimentos e que o broto de feijão-mungo vem sendo incluído na culinária brasileira, este estudo teve como objetivo quantificar o teor de fenólicos totais deste vegetal e avaliar a ação antioxidante do seu extrato aquoso. MÉTODOS: Os compostos fenólicos foram extraídos por quatro sistemas de solventes e dois métodos de extração, os quais foram diferenciados no tempo (2 e 1h e número de extrações (2 e 3 extrações. Os fenólicos totais dos extratos foram quantificados por método espectrofotométrico. RESULTADOS: Os extratos obtidos com água à temperatura ambiente (28ºC, nos dois métodos de extração, foram os que apresentaram maior quantidade de fenólicos totais, sem contudo apresentar diferença significativa entre eles. O método II, que consistiu de três extrações em 1h, pode ser considerado o melhor por ter utilizado menor tempo de extração. O extrato aquoso em sistema modelo b-caroteno/ácido linoléico exibiu ação antioxidante (48,07% de inibição da oxidação, entretanto foi inferior ao padrão BHT. CONCLUSÃO: O broto de feijão-mungo possui considerável quantidade de fenólicos totais, compostos responsáveis por sua ação antioxidante, cujo consumo pode proporcionar efeitos benéficos à saúde.OBJECTIVE: Considering the importance of phenolic compounds in foods and the increasing consumption of mung bean sprouts in Brazil, this study had the objective of quantifying the total phenolic content in this vegetable and to assess the antioxidant activity of its aqueous extract. METHODS: The phenolic compounds were extracted by four solvent systems and two extraction methods, which were different in time (2 and 1h and in number of extractions (2 and 3 extractions. The total phenolic content of the extracts were quantified by the spectrophotometric method. RESULTS: The extracts obtained with water at room temperature (28ºC in both extraction

  3. Pathology of the emerging Mycobacterium tuberculosis complex pathogen, M. mungi in the banded mongoose (Mungos mungo)

    Science.gov (United States)

    Wild banded mongooses (Mungos mungo) in northeastern Botswana and Northwest Zimbabwe are infected with a novel Mycobacterium tuberculosis complex pathogen (MTC), M. mungi. This pathogen is transmitted environmentally between mongoose hosts through exposure to infected scent marks used in olfactory c...

  4. Emerging tuberculosis pathogen hijacks social communication behavior in the group-living banded mongoose (Mungos mungo)

    Science.gov (United States)

    Mycobacterium mungi, a novel M. tuberculosis complex pathogen (MtbC), has emerged in wild banded mongoose (Mungos mungo) in Northern Botswana, causing significant mortality. Unlike other members of the MtbC, M. mungi is not transmitted through a primary aerosol route. Rather, pathogen invasion occur...

  5. Vigna unguiculasta

    African Journals Online (AJOL)

    Vigna ... content, level of starch damage and foaming capacity; Iron was least affected in TDF and SI while. Ife brown was the least ... cowpea in storage is reported to reach 100% sometimes, if left ..... potato flake quality as influenced by free starch.

  6. [Use of Phaseolus vulgaris and Vigna sinensis in a fermented dairy drink].

    Science.gov (United States)

    Granito, Marisela; Trujillo, Lesma; Guerra, Marisa

    2004-06-01

    The objective of this work was to develop a new kind fermented dairy drink, partially substituted with clear varieties of Phaseolus vulgaris (caraota) and Vigna sinensis (frijol). The formulation of fermented dairy drinks included sterile extracts of caraota and frijol, as partial substitutes which replaced milk: 10, 20 and 30%. The mixtures were inoculated with 2% of a mixture of Lactobacillus acidophillus, Streptococcus thermophilus and Bifidobacterium sp. and were incubated at 42 degrees C for 7 hours. Mango and guava jams were used as flavorings at 20%. On the basis of the sensorial evaluation the mixtures 10% frijol-mango, 10% frijol-guava, 30% caraota-mango and 20% caraota-guava were selected. In the selected fermented dairy drinks, the levels of protein, soluble and insoluble fiber, available and resistant starches were increased and the protein digestibility was 81%. The technical feasibility of partial substitution of milk with extracts of Phaseolus vulgaris or Vigna sinensis. For the elaboration of a fermented dairy drink similar to the liquid yogurt kind was demonstrated.

  7. Microflora en semillas de frijol

    Directory of Open Access Journals (Sweden)

    Jos\\u00E9 B. Membre\\u00F1o

    2001-01-01

    Full Text Available Microflora en semillas de frijol (Phaseolus vulgaris L.. Se estudió la microflora bacteriana presente en semillas de frijol y su relación con Xanthomonas campestris pv. phaseoli (Xcp, en 118 genotipos procedentes de VIDAC-98, INTA- Nicaragua, TARS-USDA e Isabela-P.R. Se utilizaron cinco métodos de aislamiento: semilla desinfectada con hipoclorito de sodio, semilla en caldo nutritivo refrigerada por una hora, dispersión de 0,1 ml de suspensión de semillas en medio sólido, siembra líquida de 1 ml de suspensión y semilla en caldo nutritivo, agitado y refrigerado por 24 horas. Se aislaron 104 colonias amarillas de 41 genotipos. Treinta y seis colonias fueron KOH positivo (Gram negativo, 68 negativo (Gram positivo y 34 hidrolizaron almidón. Las colonias de pigmentación amarilla resultaron no patogénicas bajo condiciones de invernadero. Estas se identificaron con el sistema BIOLOG como: Pantoea agglomerans (25, Xanthomonas campestris (2, Enterobacter agglomerans (2, Sphingomonas paucimobilis (2, Pseudomonas fluorescens y Flavimonas oryzihabitans. En adición, los genotipos portaron colonias con pigmentación distinta a la amarilla. En las pruebas de antagonismo se identificaron colonias con actividad de deoxyribonucleasa y de antibiosis a Xcp. De éstas, 15 colonias inhibieron a Xcp significativamente. Se identificaron los hongos Rhizoctonia solani, Penicillium spp., Fusarium spp., Aspergillus flavus, Rhizopus nigricans y Macrophomina phaseolina en un 52,9 % del total de genotipos evaluados

  8. Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers.

    Science.gov (United States)

    Abbas, Ghulam; Hameed, Amjad; Rizwan, Muhammad; Ahsan, Muhammad; Asghar, Muhammad J; Iqbal, Nayyer

    2015-01-01

    Molecular confirmation of interspecific recombinants is essential to overcome the issues like self-pollination, environmental influence, and inadequacy of morphological characteristics during interspecific hybridization. The present study was conducted for genetic confirmation of mungbean (female) and mashbean (male) interspecific crosses using molecular markers. Initially, polymorphic random amplified polymorphic DNA (RAPD), universal rice primers (URP), and simple sequence repeats (SSR) markers differentiating parent genotypes were identified. Recombination in hybrids was confirmed using these polymorphic DNA markers. The NM 2006 × Mash 88 was most successful interspecific cross. Most of true recombinants confirmed by molecular markers were from this cross combination. SSR markers were efficient in detecting genetic variability and recombination with reference to specific chromosomes and particular loci. SSR (RIS) and RAPD identified variability dispersed throughout the genome. In conclusion, DNA based marker assisted selection (MAS) efficiently confirmed the interspecific recombinants. The results provided evidence that MAS can enhance the authenticity of selection in mungbean improvement program.

  9. Estrategias de mercado para el frijol centroamericano

    Directory of Open Access Journals (Sweden)

    Lourdes Mart\\u00EDnez

    2004-01-01

    Full Text Available Estrategias de mercado para el frijol centroamericano. En los últimos años, el sub-sector de frijol en Centro América ha sido testigo de varios cambios dinámicos. Si no se encuentran medidas para incrementar la competitividad regional de este sub-sector, los países centroamericanos experimentarán impactos negativos en las áreas sociales y económicas de considerable magnitud, especialmente ahora que Centro América necesita ajustar su economía a los nuevos requerimientos de mercados mas abiertos, como el Tratado Centroamericano de Libre Comercio con USA (TLC. Vendedores de frijoles a nivel intermediario y de consumo final, así como técnicos de oficinas gubernamentales dedicadas al mercadeo de frijoles en Centro América fueron entrevistados para documentar los cambios experimentados, identificar los obstáculos que frenan la viabilidad del sub-sector e identificar las oportunidades de incremento de mercados en el futuro para los productores y vendedores de frijol. Los resultados muestran que para que continúen siendo competitivos, los países centroamericanos deben incrementar la productividad a través del apoyo a las investigaciones para el mejoramiento de variedades de frijol, especialmente aquellas que los consumidores prefieren por características específicas (e.g. color. También es imprescindible el fortalecimiento de los programas de distribución de variedades mejoradas a los productores; las mejoras en la transmisión de información de mercado a los productores; el fortalecimiento de los contactos entre productores, comercializadores a nivel mayorista y supermercados; y una política más específica de apertura de mercados de exportación, especialmente con los Estados Unidos.

  10. Vigna unguiculata L.

    African Journals Online (AJOL)

    user

    2012-02-16

    Feb 16, 2012 ... via organogenesis from cotyledonary node of cowpea. (Vigna unguiculata L. ... cowpea (Vigna unguiculata L. Walp) has been established. The cotyledonary node ..... Genomic/Proteomic Technol. 3: 45-47. Pellegrineschi A ...

  11. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  12. Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo).

    Science.gov (United States)

    Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko

    2017-03-01

    Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism ( mog ) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf ( rl ) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD ( PPD ) that regulates arrest of cell divisions in meristematic cells . We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes.

  13. Vivipary in Ophiorrhiza mungos L. - a rare phenomenon in angiosperms.

    Science.gov (United States)

    Dintu, K P; Sibi, C V; Ravichandran, P; Satheeshkumar, K

    2015-01-01

    Vivipary, the precocious germination of seeds within the parent plant, is a specialised feature of evolutionary and biological importance that ensures survival of a plant. Reports on vivipary in angiosperms are rare, accounting for <0.1% of flowering plants. Here, we report a remarkable case of occurrence of vivipary in Ophiorrhiza mungos. A study was conducted to collect information on the morphology of the capsules that support vivipary, environmental factors that induce vivipary, survival mode and the survival of viviparous seedlings. The hydroscopic movement of the cup-shaped capsules of O. mungos was found to help in viviparous germination during the rainy season. Of the total seeds in a capsule, 70% showed viviparous germination. The seedlings remaining inside the capsule attain a height of 0.98 ± 0.4 cm and reach the ground when the capsule falls. On the ground, seedlings obtain easy anchorage to the substratum since they have already germinated. Vivipary appears to be an adaptation of O. mungos to the rainy season for ensuring viable offspring. This suggests that vivipary in this species might be artificially induced by continuous spraying with water to rescue seeds in all seasons for use in large-scale propagation to meet increasing market demand and conservation of this valuable anticancer medicinal herb. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  14. El proyecto "campana educativa para incrementar el consumo de frijoles"

    Directory of Open Access Journals (Sweden)

    Ligia Rodr\\u00EDguez

    2004-01-01

    Full Text Available El proyecto “Campaña educativa para incrementar el consumo de frijoles”. Se describen las diferentes etapas que se siguen en el desarrollo de un proyecto denominado “Campaña educativa para incrementar el consumo de frijoles”. La Campaña tuvo como objetivo “incrementar el consumo de frijoles en la población urbana de clase media de Costa Rica” y contribuir a contrarrestar la disminución en el consumo de este alimento, que se ha presentado en forma muy marcada en el área urbana. El artículo pretende ofrecer una visión global del mencionado proyecto, de manera que le permita al lector la ubicación dentro del proceso, al mismo tiempo que lo refiere a los artículos específicos que ofrecen el detalle de las diferentes etapas y resultados. La metodología describe las características generales del abordaje que se utiliza y la forma en que se desarrolla cada una de las etapas. Los resultados sumarizan los hallazgos de la evaluación y otros aspectos globales del proyecto. Además, ofrece pautas para un abordaje de la educación nutricional focalizada alrededor de un alimento y sustentada en la realidad social y cultural de la población.

  15. Vigna unguiculata [Linn] Walp varieties

    African Journals Online (AJOL)

    Walp) have differential effects on blood glucose when equal amounts are consumed. Objective: To ... Previous studies have described the benefit of consumption of ... Beans (Vigna unguiculata) are one of the staple local foods consumed by ...

  16. Infectividad y efectividad de rizobios aislados de Suelos de la Costa Caribe Colombiana en Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Jonathan Alberto Mendoza Labrador

    2014-07-01

    Full Text Available Título en español: Infectividad y efectividad de rizobios aislados de Suelos de la Costa Caribe Colombiana  en Vigna unguiculata Título en ingles: Infectivity and effectiveness of isolated rhizobia from colombian caribbean soils in Vigna unguiculata Título corto: Infectividad y efectividad de rizobios aislados de Suelos Resumen:  Es el primer estudio en Colombia que abarca una evaluación de rizobios nativos asociados a frijol Caupí (Vigna unguiculata L. Walp. en los departamentos del Cesar y la Guajira. En esta investigación, se demostró que la utilización de  aislamientos de rizobios nativos aislados a partir de  nódulos,  mejoraron el desarrollo del frijol Caupí  (Vigna unguiculata L. Walp., siendo estas bacterias más eficientes que los tratamientos químicos y absolutos (sin inóculo ni fertilización y que las cepas inducidas mejorando además, la fijación biológica de nitrógeno y la tasa fotosintética. Como aportes del estudio, se determinó que en condiciones de invernadero la fertilización biológica fue más eficiente que la química y que, de acuerdo a los resultados obtenidos de las diferentes variables agronómicas evaluadas, esto podría influir positivamente en los rendimientos nutricionales del cultivo, base alimentaria de los sistemas ganaderos de estas regiones del país y  fuente alimenticia  de la comunidad indígena y de bajos recursos económicos.  Palabras clave Nodulación, fijación Biológica de Nitrógeno, Fertilización, Tasa Fotosintética Abstract:  This is the first study in Colombia which covers an evaluation of native rhizobium associated to the Caupí bean   (Vigna unguiculata L. Walp. in the departaments of Cesar and Guajira. In this research it was demonstrated that the use of native rhizobium isolated from nodes, improved the development of the Caupí bean (Vigna unguiculata L. Walp., being this bacteria more efficient than the chemical and absolute treatments (without inoculum and

  17. ENCUESTA A PRODUCTORES PARA ORIENTAR EL FITOMEJORAMIENTO DE FRIJOL EN ECUADOR

    Directory of Open Access Journals (Sweden)

    Emmalea Garver Ernest

    2008-01-01

    Full Text Available Se realizó una encuesta a más de cincuenta productores de frijol de los valles de Chota y Mira, ubicados al norte de Ecuador, en el año 2003, con la finalidad de recabar información y plantear objetivos para la implementación de un programa de mejoramiento participativo de frijol en Ecuador. Los productores fueron consultados acerca de las variedades de frijol que están cultivando actualmente, los métodos de producción empleados, los problemas de producción del cultivo y las características que deberían mejorarse en las nuevas variedades. Los principales problemas de producción reportados fueron los daños causados por mosca blanca (Trialeurodes vaporariorum, roya (Uromyces appendiculatus y brúquidos (Acanthoscelides obtectus. Los agricultores han cambiado recientemente las clases comerciales de frijol que tradicionalmente cultivaban en respuesta a la demanda del mercado. En cuanto a las características que deberían poseer las nuevas variedades de frijol, indicaron alto rendimiento y semilla de tamaño grande con color y forma comercial. La costumbre de los agricultores de comprar semilla para cada siembra, y no de producir su propia semilla, fue identifi cada como un obstáculo potencial para el uso y mantenimiento de las nuevas variedades mejoradas de frijol en el área estudiada.

  18. EFECTO DE LA ROTACIÓN DE CULTIVOS EN LA INCIDENCIA DEL AMACHAMIENTO (Aphelenchoides besseyi Christie EN FRIJOL

    Directory of Open Access Journals (Sweden)

    Néstor Felipe Chaves

    2012-01-01

    Full Text Available El efecto de la rotación de cultivos en la incidencia del amachamiento en frijol se evaluó en la región Brunca de Costa Rica durante 2009 y se complementó con una observación de campo en el 2010. La incidencia en 2009 se cuantificó en las etapas de desarrollo vegetativo (V3 o V4, floración (R6 y llenado de vainas (R8 en planta - ciones comerciales de frijol provenientes de rota - ción con arroz, maíz, chile picante, ayote o frijol. En cada plantación se establecieron al azar 4 microparcelas de 10 m 2 , excepto en la secuencia frijol-frijol, donde fueron solo 2; los datos obte - nidos se transformaron angularmente y con un ANDEVA se separaron las medias entre rotacio - nes. La observación de campo del 2010 se llevó a cabo en una finca con 3 parcelas comerciales de frijol en etapa de floración y en suelos previa - mente sembrados con jengibre, tiquizque y maíz, respectivamente; en cada parcela, se establecie - ron sistemáticamente 10 puntos de muestreo para cuantificar la incidencia de amachamiento y se utilizó la prueba de Chi-cuadrado para deter - minar diferencias entre rotaciones. En el 2009, durante la etapa R8 se presentó una incidencia mínima de amachamiento en la rotación chile picante-frijol (4%, niveles intermedios en las rotaciones ayote-frijol (15% y arroz-frijol (29% y altas incidencias en las rotaciones frijol-frijol (62% y maíz-frijol (64%. En la observación de campo del 2010, durante la etapa de floración se presentaron incidencias de 4% en la rotación jengibre-frijol y de 5% en la rotación tiquizque- frijol, que fueron entre 5 y 6 veces menores que la cuantificada en la rotación maíz-frijol (25%. Con base en los resultados obtenidos, el uso de cultivos como chile picante, jengibre, tiquizque y ayote en el ciclo previo a la siembra de frijol, podría contribuir a bajar la incidencia de amacha - miento y las pérdidas que ocasiona en ese cultivo.

  19. Evaluation of the Antioxidant and Melanogenesis Inhibitory Properties of Pracparatum Mungo (Lu-Do Huang

    Directory of Open Access Journals (Sweden)

    Yu-Yu Kao

    2013-07-01

    Full Text Available Pracparatum mungo (Lu-Do Huang is a traditional Chinese functional medicine made from the natural fermentation of mung bean (綠豆 Lǜ Dòu mixed with other Chinese medicines. It has been recognized as having liver protecting and detoxifying effects. As mung beans have been verified to possess anti-inflammatory, antioxidant, antipyretic, and whitening actions, the present research utilized the in vitro, ex vivo, and in vivo experimental models to investigate the antioxidant and melanin inhibiting effects of P. mungo on the skin. The in vitro experiment revealed that P. mungo methanol extract (PMME and P. mungo ethanol extract (PMEE possess the capacity to clear α,α-diphenyl-2-picrylhydrazyl (DPPH radicals and inhibit tyrosinase activity. The ex vivo experiment indicated that PMEE can promote the growth of MDCK cells and increase the enzymatic activities of superoxide dismutase (SOD and catalase in MDCK cells. On the other hand, PMME and PMEE can suppress the proliferation of A375 cells, and PMEE can reduce the enzymatic activities of SOD and catalase in A375 cells. The in vivo results showed that P. mungo can enhance the enzymatic performance of SOD, Catalase, and glutathione peroxidase (GPx in the liver. The results also showed that P. mungo has antioxidant characteristics and can inhibit tyrosinase activity, thereby promoting the growth of skin tissues and suppressing the proliferation of A375 cells, and thus enhancing the effects that the antioxidant enzymatic performance has on the liver. These results can be applied in the development of tyrosinase inhibitors or antioxidants used for the inhibition of melanin biosynthesis or for auto-oxidation in further industrial applications, particularly those relating to functional food or cosmetic compositions.

  20. FLUJO DE GENES ENTRE FRIJOL COMÚN Y SILVESTRE EN COSTA RICA

    Directory of Open Access Journals (Sweden)

    N\\u00E9stor Chaves-Barrantes

    2009-01-01

    Full Text Available Con el objetivo de analizar el flujo de genes entre frijol común silvestre y cultivado, se determinó el porcentaje de alogamia en condiciones naturales de crecimie nto del frijol silvestre y en estación experimental. En el 2004 se evaluó el cruzamie nto natural entre frijol silvestre mexicano G23511A (Phaseolus vulgaris L. y la línea blanca PAN 68, en la Estación Experimental Fabio Baudrit de la Universidad de Costa Ri ca en Alajuela. Para ello se sembraron dos parcelas experimentales; cada una constó de dos bloques de PAN 68 de 10 surcos (15 m de largo y espacia dos 0,6 m. Entre los bloques y en el borde superior de los mismos, se sembraron tres surcos de frijol silvestre como donantes de polen. Se numeraron las hileras y las plantas de cada una en los bloques de frijol blanco. En Quircot de Ca rtago (área donde crece en forma natural P. vulgaris silvestre, en el 2005 y 2006, se sembraron plantas de frijol comercia l (Vainica de Palo a lo largo de seis sitios junto a las poblaciones de frijol silvestre. En ambas localidades la floración de silvestres y comerciales fue coincidente. Se cosechó toda la semilla de los ensayos y se germinó en bandejas, determinando el porcentaje de alogamia por medio del color morado del hip ocotilo, indicativo de aquellas plántulas cruzadas. En Alajuela el porcentaje de cruza varió entre 0,007 y 0,028 %; mie ntras que en Quircot, entre 0 y 0,199 %.

  1. Mutagenic effects of gamma rays and EMS on frequency and spectrum of chlorophyll mutations in urdbean (Vigna mungo (L.) Hepper)

    International Nuclear Information System (INIS)

    Usharani, K.S.; Ananda Kumar, C.R.

    2015-01-01

    Chlorophyll mutations act as a significant index in the judgment of induced genetic variations in mutagen treated populations. Different types of chlorophyll mutation have been observed in various crop plants. In the current study, the effect of different concentrations (40 kR, 50 kR and 60 kR) of gamma rays, Ethyl Methane Sulphonate (50 mM, 60 mM and 70 mM) in single and combination dose/concentration on the frequency and spectrum of chlorophyll mutation and the effect of VBN 4 urdbean variety to such irradiation dose was observed. Results showed induction of broad spectrum of chlorophyll mutations which included albina, xantha, chlorina and viridis. Among these chlorina type was predominant in all the mutagenic treatments. The albina type of chlorophyll mutants occurred very rarely and was found only at 60 mM of EMS treatment and at 40 kR + 50 mM, 60 kR + 70 mM of combination treatments. Based on the chlorophyll mutation frequency, gamma rays were most effective followed by EMS and combination of treatments. (author)

  2. Aluminium-induced excessive ROS causes cellular damage and metabolic shifts in black gram Vigna mungo (L.) Hepper.

    Science.gov (United States)

    Chowra, Umakanta; Yanase, Emiko; Koyama, Hiroyuki; Panda, Sanjib Kumar

    2017-01-01

    Aluminium-induced oxidative damage caused by excessive ROS production was evaluated in black gram pulse crop. Black gram plants were treated with different aluminium (Al 3+ ) concentrations (10, 50 and 100 μM with pH 4.7) and further the effects of Al 3+ were characterised by means of root growth inhibition, histochemical assay, ROS content analysis, protein carbonylation quantification and 1 H-NMR analysis. The results showed that aluminium induces excessive ROS production which leads to cellular damage, root injury, stunt root growth and other metabolic shifts. In black gram, Al 3+ induces cellular damage at the earliest stage of stress which was characterised from histochemical analysis. From this study, it was observed that prolonged stress can activate certain aluminium detoxification defence mechanism. Probably excessive ROS triggers such defence mechanism in black gram. Al 3+ can induce excessive ROS initially in the root region then transported to other parts of the plant. As much as the Al 3+ concentration increases, the rate of cellular injury and ROS production also increases. But after 72 h of stress, plants showed a lowered ROS level and cellular damage which indicates the upregulation of defensive mechanisms. Metabolic shift analysis also showed that the black gram plant under stress has less metabolic content after 24 h of treatment, but gradually, it was increased after 72 h of treatment. It was assumed that ROS played the most important role as a signalling molecule for aluminium stress in black gram.

  3. COMPOSICIÓN NUTRICIONAL Y FACTORES ANTINUTRICIONAL DE ESPECIES POCO CONOCIDAS DE VIGNA

    Directory of Open Access Journals (Sweden)

    Chinnamadasamy Kalidass

    2012-11-01

    Full Text Available Las semillas de Vigna trilobata, V. radiata var. sublobata, V. umbellata, V. unguiculata subsp. cylindrica, V. aconitifolia, V. vexillata and V. bourneae se colectaron de diferentes regiones geográficas en el oeste de Ghats Tamil Nadu. Se analizó su composición proximal y mineral, vitaminas (niacina y ácido ascórbico, perfiles de ácidos grasos, perfiles de aminoácidos de la proteína total de la semillas, digestibilidad de la proteína in vitro (IVPD y algunos factores antinutricionales. La proteína cruda tuvo un rango entre 18.24 a 26.12%, lípidos totales de 3.8 a 6.48%, fibra dietética total de 3.42 a 7.48%, cenizas de 3.10 a 4.12% y carbohidratos de 59.44 a 72.06%. Los valores de energía de la semilla estuvieron entre 1584.87 a 1644.34 kJ100g-1MS, los cuales fueron comparables con otras leguminosas. Los perfiles de ácidos grasos de todas las especies de Vigna revelaron altas concentraciones de ácido oleico, linoleico y linolenico. Los perfiles de aminoácidos esenciales del total de proteína de la semilla se compararon favorablemente con los requerimientos de la FAO/WHO (1991, con excepción de ciertas deficiencias de aminoácidos azufrados en todas las especies de Vigna El IVPD de las diferentes especies de Vigna tuvo un rango de 70.38 a 79.12%. Sustancias antinutricionales como el total de fenoles libres, taninos, L-DOPA (3-4 dihidroxifenilalanina, ácido fitico, cinacina hidrogenada, actividad inhibidora de la tripsina, oligosacáridos y actividad fitohematoaglutinadora también se determinaron. Los factores antinutricionales que fueron detectados, se presume que presentan una pequeña significancia si los frijoles son procesados correctamente.

  4. Growth Response of Two Phaseolus mungo L. Cultivars Induced by Arbuscular Mycorrhizal Fungi and Trichoderma viride

    Directory of Open Access Journals (Sweden)

    Navnita Sharma

    2016-01-01

    Full Text Available The present investigation aimed to quantify the difference in response of two Phaseolus mungo L. cultivars (i.e., UH-1 and IPU-94-1 to Glomus mosseae (G, that is, Funneliformis mosseae, Acaulospora laevis (A, and Trichoderma viride (T, in different combinations or alone. All the treatments were inoculated with Bradyrhizobium japonicum to ensure nodulation as soil used in the experiment was sterilized. After 120 days of inoculation, plants were analyzed for chlorophyll content, nodulation, mycorrhization, leaf area, and protein content. Results indicate variation in growth response of two cultivars with different treatments. Triple inoculation of plants with G + A + T proved to be the best treatment for growth followed by G + T in both cultivars. Our work allowed the selection of P. mungo L. cultivar UH-1 as highly mycorrhizal responsive as compared to IPU-94-1 and G. mosseae to be an efficient bioinoculant as compared to A. laevis for growth enhancement of P. mungo. Further characterization of P. mungo genotypes will enhance our knowledge of physiological and genetic mechanism behind increase in plant growth and yield due to AM symbiosis.

  5. Esfuerzo iberoamericano aporta la secuencia del genoma del frijol al conocimiento mundial.

    OpenAIRE

    Consejo Nacional de Ciencia y Tecnología (CONACYT)

    2012-01-01

    El Proyecto Genoma del-CYTED se plantea como una actividad de cooperación multinacional donde la meta principal del mismo incrementar el conocimiento básico y las herramientas genéticas en este caso apoyar a la plantación de frijol, seleccionando y diseñando nuevas variedades de este grano.

  6. Eficiencia y productividad del cultivo de frijol en un sistema de riego por bombeo en Zacatecas, México

    Directory of Open Access Journals (Sweden)

    José Luis Ríos Flores

    2017-01-01

    Full Text Available La escasez de agua es un factor limitante para la agricultura. Conforme la competencia por este recurso se intensifica, el sector agrícola debe hacer un uso más eficiente. Se estima la productividad del agua en frijol (Phaseolus vulgaris L. producido en Calera y Villa de Cos, Zacatecas, con base en la metodología establecida por Ríos et al. (2015. La productividad física fue 0.118 kg m-3, es decir, 8 442 L kg-1 de frijol para el Distrito de Desarrollo Rural 189 Zacatecas. El precio del metro cúbico para riego fue $0.48 m-3 y utilidad bruta MN$1.88m-3. Se concluye que la productividad agrícola del agua en frijol fue baja, por lo que la producción de frijol en bombeo es insostenible.

  7. Failure of survival strategies in adaption of heavy metal environment in lens culinaris and phaseolus mungo

    International Nuclear Information System (INIS)

    Haider, S.; Azmat, R.

    2012-01-01

    Lead (Pb)-treated Lens culinaris and Phaseolus mungo seedlings leaves showed considerable reduction in the size with enhance proline and phenol contents while peroxidase and lignin activity was Pb/sup 2+/ dose dependent. The reduced leaves sizes of both seedlings were correlated with an increase in Pb/sup 2+/levels, and activities of peroxidase and lignin deposition in it. The intensification of activities of peroxidase and phenol in the Pb/sup 2+/ treated plants were accompanied by an increase in the biosynthesis of the lignin contents as their function is of scavenging ROS radical. A strong correlation (r/sup 2/=0.8570) was observed between Pb/sup 2+/ and lignin deposition in the Lens culinaris whereas it was non-significant in Phaseolus mungo (r/sup 2/=0.466). Increased in the lignin contents in the Lens culinaris as a chemical adaptation of the cell walls of various leaves tissues for endurance while decrease in the lignin contents in Phaseolus mungo at high dose of Pb/sup 2+/ may be attributed with the decline in the peroxidase activity. Investigations revealed that although plants adopt several biochemical strategies for their survival but toxicity of Pb/sup 2+/was significant due to which plant fails to continue in stay alive. (author)

  8. Seed yield and agronomic parameters of cowpea (Vigna ...

    African Journals Online (AJOL)

    Jane

    2011-10-12

    Oct 12, 2011 ... 1Department of Field Crops, Faculty of Agriculture, Bozok University, Sivas ... Key words: Vigna unguiculata, seed yield, thousand seed weight, Black Sea. INTRODUCTION. The cowpea (Vigna unguiculata L.) is an important.

  9. Genotipos de frijol (Phaseolus Vulgaris l. resistentes a Xanthomonas campestris pv. phaseoli de Mexico

    Directory of Open Access Journals (Sweden)

    Rosa Navarrete

    2000-01-01

    Full Text Available Genotipos de frijol (Phaseolus vulgaris L. resistentes a Xanthomonas campestris pv. phaseoli de México. Durante 1995 se evaluó la reacción de genotipos de frijol de diversos origenes a Xcp, bajo condiciones de invernadero en el Campo Experimental del Valle de México, del INIFAP. Se realizaron tres experimentos con a120, b44 y csiete genotipos de frijol. Las plantas se inocularon por corte con navajas en la etapa V3, a y b con una mezcla de nueve cepas de Xcp y el c, con cada una de siete cepas con diferente grado de patogenicidad. La severidad se evaluó 20 días después de la inoculación, por comparación con una escala visual de nueve grados. Los datos se analizaron bajo un diseño completamente al azar. En a, los genotipos que mostraron reacción de resistencia a Xcp fueron: A 36, A 475, G 5686, G 11867, Harowood, SEA 14, XAN 266, MCD 4012 y REN 27. En b los genotipos resistentes fueron: Sequía Durango, Taylor y XAN 30. En los experimentos anteriores la severidad de la enfermedad mostró una distribución normal, con el máximo número de genotipos en el grado de severidad cinco en a y seis en b. Los resultados obtenidos indican que el uso de mezclas de cepas de bacterias con diferente patogenicidad es eficiente para identificar genotipos de frijol resistentes a Xcp. Los genotipos resistentes identificados en el último experimento, mostraron respuesta diferencial e interacciones genotipo por cepa. REN 27 y SEA 14 mostraron resistencia a las cepas utilizadas

  10. OLEORRESINA DE JÍCAMA Y CALIDAD DE SEMILLA DE FRIJOL INFESTADA CON Acanthoscelides obtectus Say

    Directory of Open Access Journals (Sweden)

    Jos\\u00E9 Antonio Rangel-Lucio

    2011-01-01

    Full Text Available El objetivo de este trabajo fue determinar el efecto de la oleorresina de jícama en la calidad de la semilla de frijol. En laboratorio se obtuvo el extracto de oleorresina media nte HPLC y se detectó la presencia de rotenona (15 mg/l. Se ensayaron tres concentraciones (Ci, g/ml del extracto: C1 (5x10-7, 5x10-6, ¿5x10-2; C2 (1x10-2, 2x10-2,¿6x10-2; C3 (5x10-1, 6x10-1,¿9x10-1 y testigo por concentración, en frascos de 300 ml con 50 g de semilla de frijol (varie dades Flor de Ma yo, Flor de Junio, Ma - yocoba y veinte gorgojos adultos. El ensayo sólo comprendió semillas de frijol tratadas con C2 por 48 horas para evaluar vigor y germinación estándar a los tres y sie te días después de la siembra, bajo normas de IS TA. El aumento de C2 fue gradual en el número de plántulas normales y germinación estándar en el primer recuento, en particular con las diluciones 3 x 10-2 a 6 x 10-2; en el segundo recuento se confirmó la germinación estándar total con estas mismas diluciones. El frijol Ma yocoba en presencia del extracto de semilla de jícama, mantuvo el vigor y valores porcentuales aceptables de germinación estándar de la semilla.

  11. Species differences in ligand specificity of auxin-controlled elongation and auxin transport: comparing Zea and Vigna

    Science.gov (United States)

    Zhao, Hu; Hertel, Rainer; Ishikawa, Hideo; Evans, Michael L.

    2002-01-01

    The plant hormone auxin affects cell elongation in both roots and shoots. In roots, the predominant action of auxin is to inhibit cell elongation while in shoots auxin, at normal physiological levels, stimulates elongation. The question of whether the primary receptor for auxin is the same in roots and shoots has not been resolved. In addition to its action on cell elongation in roots and shoots, auxin is transported in a polar fashion in both organs. Although auxin transport is well characterized in both roots and shoots, there is relatively little information on the connection, if any, between auxin transport and its action on elongation. In particular, it is not clear whether the protein mediating polar auxin movement is separate from the protein mediating auxin action on cell elongation or whether these two processes might be mediated by one and the same receptor. We examined the identity of the auxin growth receptor in roots and shoots by comparing the response of roots and shoots of the grass Zea mays L. and the legume Vigna mungo L. to indole-3-acetic acid, 2-naphthoxyacetic acid, 4,6-dichloroindoleacetic acid, and 4,7-dichloroindoleacetic acid. We also studied whether or not a single protein might mediate both auxin transport and auxin action by comparing the polar transport of indole-3-acetic acid and 2-naphthoxyacetic acid through segments from Vigna hypocotyls and maize coleoptiles. For all of the assays performed (root elongation, shoot elongation, and polar transport) the action and transport of the auxin derivatives was much greater in the dicots than in the grass species. The preservation of ligand specificity between roots and shoots and the parallels in ligand specificity between auxin transport and auxin action on growth are consistent with the hypothesis that the auxin receptor is the same in roots and shoots and that this protein may mediate auxin efflux as well as auxin action in both organ types.

  12. Fish otolith geochemistry, environmental conditions and human occupation at Lake Mungo, Australia

    Science.gov (United States)

    Long, Kelsie; Stern, Nicola; Williams, Ian S.; Kinsley, Les; Wood, Rachel; Sporcic, Katarina; Smith, Tegan; Fallon, Stewart; Kokkonen, Harri; Moffat, Ian; Grün, Rainer

    2014-03-01

    Fish otoliths from the Willandra Lakes Region World Heritage Area (south-western New South Wales, Australia) have been analysed for oxygen isotopes and trace elements using in situ techniques, and dated by radiocarbon. The study focused on the lunettes of Lake Mungo, an overflow lake that only filled during flooding events and emptied by evaporation, and Lake Mulurulu, which was part of the running Willandra Creek system. Samples were collected from two different contexts: from hearths directly associated with human activity, and isolated surface finds. AMS radiocarbon dating constrains the human activity documented by five different hearths to a time span of less than 240 years around 19,350 cal. BP. These hearths were constructed in aeolian sediments with alternating clay and sand layers, indicative of fluctuating lake levels and occasional drying out. The geochemistry of the otoliths confirms this scenario, with shifts in Sr/Ca and Ba/Ca marking the entry of the fish into Lake Mungo several years before their death, and a subsequent increase in the δ18O by ˜4‰ indicating increasing evaporation of the lake. During sustained lake-full conditions there are considerably fewer traces of human presence. It seems that the evaporating Lake Mungo attracted people to harvest fish that might have become sluggish through oxygen starvation in an increasingly saline water body (easy prey hypothesis). In contrast, surface finds have a much wider range in radiocarbon age as a result of reworking, and do not necessarily indicate evaporative conditions, as shown by comparison with otoliths from upstream Lake Mulurulu.

  13. Efecto de la rotación de cultivos en la incidencia del Amachamiento (Aphelenchoides besseyi Christie ) en frijol

    OpenAIRE

    Chaves, Néstor Felipe; Araya, Carlos Manuel

    2012-01-01

    El efecto de la rotación de cultivos en la incidencia del amachamiento en frijol se evaluó en la región Brunca de Costa Rica durante 2009 y se complementó con una observación de campo en el 2010. La incidencia en 2009 se cuantificó en las etapas de desarrollo vegetativo (V3 o V4), floración (R6) y llenado de vainas (R8) en plantaciones comerciales de frijol provenientes de rotación con arroz, maíz, chile picante, ayote o frijol. En cada plantación se establecieron al azar 4 microparcelas de 1...

  14. EFECTO DE LA ROTACIÓN DE CULTIVOS EN LA INCIDENCIA DEL AMACHAMIENTO (Aphelenchoides besseyi Christie ) EN FRIJOL

    OpenAIRE

    Néstor Felipe Chaves; Carlos Manuel Araya

    2012-01-01

    El efecto de la rotación de cultivos en la incidencia del amachamiento en frijol se evaluó en la región Brunca de Costa Rica durante 2009 y se complementó con una observación de campo en el 2010. La incidencia en 2009 se cuantificó en las etapas de desarrollo vegetativo (V3 o V4), floración (R6) y llenado de vainas (R8) en planta - ciones comerciales de frijol provenientes de rota - ción con arroz, maíz, chile picante, ayote o frijol. En cada plantación se establecieron al azar 4 microparcela...

  15. Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

    International Nuclear Information System (INIS)

    Bell, W.T.

    1991-01-01

    During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400 o C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author)

  16. Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

    Energy Technology Data Exchange (ETDEWEB)

    Bell, W T [Australian National Univ., Canberra (Australia)

    1991-02-01

    During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400{sup o}C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author).

  17. Respuesta de frijol al Endospor 33® a dosis 50% de fertilizante nitrogenado/fosfatado en agricultura protegida

    Directory of Open Access Journals (Sweden)

    Juan Manuel Sanchez-Yañez

    2014-01-01

    Full Text Available El frijol requiere fertilización nitrogenada y fosfatada (FNP, cuya indiscriminada aplicación causa pérdida de productividad del suelo, una alternativa de solución para este problema es reducir y optimizar la dosis de FNP con un inoculante mixto con bacterias promotoras de crecimiento vegetal (BPCV y hongos micorricicos vesículo arbusculares (HMA. El objetivo de esta investigación fue analizar la respuesta del frijol al inoculante mixto Endospor 33® a dosis reducida al 50% del FNP. En un suelo ferralítico rojo pobre de Nitrógeno (N y materia orgánica. Con un diseño experimental de bloques al azar con 5 tratamientos y 6 repeticiones. Los resultados indican que el porcentaje de germinación del frijol con Endospor 33® a la dosis 20 mg/semilla fue de 100%. A plántula con 10 mg/planta, tuvo 6,13g de peso fresco total (PFT y de 0,66g de peso seco total (PST comparado con el frijol control relativo (CR con 0,28g de PST con el 100% del FNP. A floración con 30 mg/planta Endospore 33® tuvo 1,5g de PST comparado con 1,07g de PST del frijol CR. A madurez fisiológica con 30mg/planta registro 34,83g/100 semillas, en contraste a su homologo CR con 20,39g/100 semillas. Lo anterior indica que este inoculante mixto es una opción en la producción del frijol a dosis reducida del FNP, sin afectar negativamente su crecimiento y/o rendimiento.

  18. Physiological and molecular characterization of cowpea [Vigna ...

    African Journals Online (AJOL)

    Diaga Diouf

    Cowpea, Vigna unguiculata (L.) Walp. presents phenotypical variabilities and in order to study the genetic diversity of cultivated Senegalese varieties, two experimental approaches were used. First, a physiological characterization based on nitrogen fixation was used to assess cowpea breeding lines. Inoculation with two ...

  19. Male sterile mutant in Vigna radiata

    International Nuclear Information System (INIS)

    Pande, Kalpana; Raghuvanshi, S.S.

    1987-01-01

    Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)

  20. DISTRIBUCIÓN ESPACIAL DEL AMACHAMIENTO DEL FRIJOL (Aphelenchoides besseyi CHRISTIE EN CAMPO

    Directory of Open Access Journals (Sweden)

    N\\u00E9stor Felipe Chaves-Barrantes

    2014-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la distribución espacial del amachamiento en campo. La investigación se realizó entre mayo y julio del 2009 en las comunidades de Veracruz de Pérez Zeledón, San José y Concepción de Buenos Aires, Puntarenas, Costa Rica. Para ello se evaluó la incidencia de la enfermedad por punto de siembra en dos parcelas de frijol provenientes de distintas rotaciones (arroz/frijol y maíz/fri - jol, con lo cual, posteriormente se determinó la distribución espacial de la enfermedad en campo por medio de un análisis de corridas y los índices de varianza/media (V/M, Lloyd y Morisita. En el análisis de corridas se obtuvo un valor pro - medio de Z de -1,06 para la parcela sembrada previamente con arroz, y de -0,98 para la parcela sembrada previamente con maíz, lo que indica una tendencia a la agregación. Los índices de V/M, Lloyd y Morisita fueron mayores que 1 en ambas parcelas, por lo que se determinó que el amacha - miento presentó un patrón espacial agregado (en parches en condiciones de campo. El patrón espacial del amachamiento en campo tiende a enmascararse debido a la rotación con cultivos hospederos de Aphelenchoides besseyi , – su agente causal –, en especial la rotación maíz/frijol donde el produc - tor redistribuye el inóculo de la enfermedad cuando esparce las cañas de maíz sobre el terreno de cultivo

  1. Variabilidad genética en razas locales de frijol común de Honduras

    OpenAIRE

    Meza Linarez, Narcizo; Rosas Sotomayor, Juan Carlos; Ortiz Marcide, Jesus Maria; Martin Clemente, Juan Pedro

    2010-01-01

    Las regiones agroecológicas Centro-Oriental (Francisco Morazón y El Paraíso) y Nor-Oriental (Olancho) aportan el 52% de la producción de frijol común (Phaseolus vulgaris) en Honduras. En el presente estudio se ha analizado la variabilidad genética en 59 razas locales colectadas en los tres departamentos de las dos regiones agroecológicas mencionadas, mediante cuatro loci microsatélites previamente descritos en P. vulgaris. Los resultados obtenidos muestran la existencia de una gran variabilid...

  2. Bayo Azteca, primera variedad mejorada de frijol con resistencia a Apion godmani Wagner Bayo Azteca, first improved bean variety with resistance to Apion godmani Wagner

    OpenAIRE

    Ramón Garza-García; Carmen Jacinto-Hernández; Dagoberto Garza-García

    2010-01-01

    Bayo Azteca, la primera variedad mejorada de frijol (Phaseolus vulgaris L.), con resistencia a una plaga insectil, ha sido obtenida por el programa de frijol del Campo Experimental Valle de México, del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias por cruzas múltiples, esto involucró un largo proceso de mejora genética. Bayo Azteca es la primera variedad mejorada resistente al picudo del ejote (Apion godmani Wagner), un curculiónido que ataca al frijol en las zonas t...

  3. Estudio de las propiedades fisico químicas y calidad nutricional en distintas variedades de frijol consumidas en México

    Directory of Open Access Journals (Sweden)

    América Fernanda Fernández Valenciano

    2017-01-01

    Full Text Available Introducción : El frijol común ( Phaseolus vulgaris L. es la leguminosa más importante para consumo humano en el mundo , es una fuente importante de proteína, calorías, vitamin as del complejo B y minerales . P o r lo que el objetivo del trabajo de investigación fue estudiar las propiedades f isico químicas y la calidad nutricional en las principales variedades de frijol consumidas y producidas en México, con el propósito de conocer sus beneficios nutricionales para el consumidor. Método : En este estudio se seleccionaron seis variedades de frijol más representativas y consumidas en México : Bayo, Negro, Peruano, Flor de Mayo, Alubia y Pinto, así como, una varieda d de frijol ejotero. A estas variedades se les determin aron las propiedades fisicoquímicas, C, H y N por medio del Analizador Orgánico Elemental Flash 2000. La determinación de Cu, Fe, Zn, Ni, Na, K, Ca y Mg se de terminó por espectrofotometría de absorción atómica y el P se terminó por espectrofotometría y metavandato - molibdato de amonio . Resultados : Se encontraron diferencias significativas en las propiedades f isico químicas, así como, en el contenido de macro y micronutrientes en las diferentes variedades de frijol estudiadas. En general, sobresali ó el frijol ejotero en las propiedades f isico químicas, contenido de micronutrientes y macronutrientes en relación a las variedades de frijol en grano. Discusión o Conclusión : La semilla del ejote presentó las máx imas concentraciones en proteína, N, P, K, Mg, Fe y Zn, mientras que las variedades de frijol de grano estudiadas sobresalieron en fibra (Alubia, proteínas (Pinto y Bayo, en Fe (Flor de Mayo. Por ú ltimo , resaltar que la variedad de frijol de grano estud iada que p resent ó un aporte bajo en proteína, contenido de N, Mg y Ca fue la variedad Frijol Peruano. Finalmente, se concluye que el frijol ejotero representa un gran beneficio para el consumidor por el aporte de prote

  4. The tropics and the rise of the British Empire: Mungo Park's perspective on Africa in the late eighteenth century.

    Science.gov (United States)

    Viana, Larissa

    2011-03-01

    The young Scottish physician Mungo Park, aged 23, arrived in Africa in 1795 with a mission as specific as it was complex in those bygone days, namely to travel the entire length of the River Niger. In 1799, the story of this journey was published in a book that sold 1500 copies in the first month alone, with two further editions published that same year, as well as the translation of the work into French and German the following year. In this article, the narrative of Mungo Park is examined by taking due consideration of the relationship between the tropics, science and travel in the early days of British expansionism into the heart of Africa.

  5. Available and unavailable carbohydrate content of black gram(Vigna Mungo) and chick-pea (Cicer Arietinum) as affected by soaking and cooking processes

    International Nuclear Information System (INIS)

    Zia-ur-Rehman; Rashid, M.; Salariya, A.M.

    2003-01-01

    The effects of soaking (Tap water, sodium bicarbonate solution) and cooking in tap water were investigated on available and unavailable carbohydrate contents and starch digestibility of black grams and chick-peas. Available carbohydrates including total soluble sugars, reducing sugars, non-reducing sugars and starch contents of these two legumes decreased to various extents as a result of soaking and cooking. From 3.43 - 25.63% total soluble sugars and 4.26 - 22.70% starch contents were lost on soaking black grams and chick-peas in tap water and sodium bicarbonate solution. Maximum amounts of total soluble sugars (28.43 - 59.64%) and starch contents (29.93 - 67.40%) were lost on cooking the water and alkali soaked legumes. However, these losses were comparatively less in case of water soaking process. Soaking and cooking processes also brought about some changes in the profile of unavailable carbohydrates of black grams and chick-peas. Soaking in sodium bicarbonate solution led to an appreciable increase of hemicellulose (42.50 - 54.31%) and NDF (28.69 - 30.68%) but not in legumes soaked in tap water. However, cooking process caused reduction in NDF (19.25 - 41.04%), ADF (5.48 - 25.31%), cellulose (12.88 - 28.42%) and hemicellulose (31.86 - 59.37%). Lignin contents of these legumes increased to some extents on cooking whereas it remained unchanged as a result of soaking. Starch digestibility of black grams and chick peas was markedly improved after cooking. However, no appreciable improvement in starch digestibility was observed after soaking these legumes in tap water or alkaline solution.(author)

  6. Productividad y adaptación del frijol ejotero en el Valle de México

    Directory of Open Access Journals (Sweden)

    G. Esquivel-Esquivel

    2006-01-01

    Full Text Available Los ejotes son hortalizas de alta calidad nutritiva y en México existe tendencia a incrementar el consumo de esta leguminosa, por lo cual, el objetivo de este trabajo fue identificar variedades de frijol ejotero de diferente hábito de crecimiento, adaptadas al Valle de México con base en la productividad y calidad del ejote en dos fechas de siembra. Se estableció un experimento con 36 variedades de frijol (31 fueron de hábito de crecimiento determinado y 5 de hábito indeterminado, el 21 de mayo y 15 de junio de 2001, en Texcoco, Estado de México. Se registraron los días a floración, días a inicio de corte, días a madurez fisiológica, peso fresco, producción total y longitud de los ejotes, así como el rendimiento de semilla. En la primera fecha de siembra (PFS se evaluó el contenido de proteína y de fibra cruda en los ejotes. Se encontraron diferencias significativas (P≤0.01 para todas las variables cuantificadas. El descenso de la temperatura, el fotoperiodo y la disponibilidad hídrica redujo el número de cortes de ejote, de ocho en la PFS a cinco en la segunda. Las variedades de hábito indeterminado registraron, en promedio, mayor rendimiento total de ejotes y semilla. Ejotero 50, OR 900 y US No. 3 mostraron el mayor rendimiento de ejotes en la PFS y pueden usarse en siembras tempranas. US No. 3, E10-1, F2 y E10-2 sobresalieron en la segunda fecha y pueden utilizarse en siembras tardías. En las dos fechas de siembra, Bayo Alteño mostró resistencia a enfermedades y rendimiento de ejotes y de semilla alto, por lo que puede sembrarse para doble propósito (ejote y grano y como progenitor en el mejoramiento genético del frijol ejotero. El rendimiento y calidad obtenidos mostraron que es factible producir ejotes en el Valle de México

  7. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  8. Mejoramiento genético del frijol rojo y negro mesoamericano para Centroamérica y El Caribe

    Directory of Open Access Journals (Sweden)

    Juan C. Rosas

    2000-01-01

    Full Text Available La producción de frijol en Centroamérica es llevada a cabo mayormente en laderas de suelos marginales, limitada por diversos factores bióticos y abióticos. Más de 350,000 t de este grano se producen en cerca de 0,5 millones de hectáreas, con rendimientos promedios de 678 kg/ha. La mayoría de los productores de frijol utilizan bajos insumos y muy pocas fincas están mecanizadas. El autoconsumo es alto; sin embargo, una alta proporción de este grano es comprado por intermediarios. En Honduras, el frijol es el sétimo cultivo en valor económico y es el de mayor rentabilidad entre el maíz, arroz y sorgo. Las dos clases comerciales más importantes en Centroamérica son el frijol rojo y negro pequeños (raza Mesoamérica. El mejoramiento de estos tipos de frijol se ha enfocado en el desarrollo de resistencia a enfermedades (mosaico común, mosaico dorado, antracnosis, mancha angular, roya, mustia hilachosa y bacteriosis común e insectos (principalmente picudo de la vaina; y tolerancia a baja fertilidad, sequía y calor. Programas adecuados de hibridación, evaluación y selección son usados para el desarrollo de cultivares con resistencia múltiple, alto rendimiento, buena adaptación y aceptación comercial. La ampliación de la base genética se obtiene usando fuentes de germoplasma Andino y Mesoamericano en la etapa de hibridación. La selección simultánea por varios caracteres y pruebas multilocalidades son utilizadas. Los viveros y ensayos de adaptación y rendimiento de líneas avanzadas son distribuídos a países de Centroamérica, México, y El Caribe. Las pruebas y validaciones en fincas y la liberación de variedades, son efectuadas por los programas nacionales de frijol de los países miembros de PROFRIJOL, en colaboración con el Zamorano, CIAT y el Bean/Cowpea CRSP

  9. Controles alternativos para el gorgojo del frijol (Acanthoscelides obtectus Say en granos almacenados a partir de materiales naturales y minerales

    Directory of Open Access Journals (Sweden)

    Carlos Ernesto Lopez-Monzon

    2017-03-01

    Full Text Available Con el fin de controlar el daño del gorgojo del frijol [Acanthoscelides obtectus (Say], se evaluó la efectividad en polvo de raíces deshidratadas de chilca (Senecio salignus DC., frutos deshidratados de pimienta negra (Piper nigrum L., fragmentos de madera de pino (Pinus oocarpa Schiede, maíz pulverizado (Zea mays L., cascabillo de frijol (Phaseolus vulgaris L., cal mezclada con ceniza, y arena de río. Se evaluaron ocho tratamientos, con cuatro repeticiones cada uno, en arreglo totalmente al azar. Los materiales naturales y minerales fueron colectados en el municipio de Malacatancito, Huehuetenango y el ensayo se montó en el laboratorio del Centro Universitario de Nor Occidente (Cunoroc, empleando por réplica un frasco de vidrio con capacidad de 1 L y aplicando a cada uno 100 g de semilla de frijol, 10 parejas de gorgojos adultos y 1 g de polvo de los materiales evaluados, según su tratamiento. El análisis se realizó 60 días después de la infestación, donde se evaluó: el porcentaje de daño del gorgojo del frijol, número de gorgojos vivos, correlación del porcentaje de daño versus número de gorgojos vivos y porcentaje de germinación del frijol. El polvo de pimienta negra y la mezcla de cal con ceniza evidenciaron los mejores resultados con el menor porcentaje de daño (1.64% y 3.55%, respectivamente. Las variables porcentaje de daño y número de gorgojos vivos marcaron una fuerte correlación con valor de r = .892. Se estableció que ninguno de los materiales utilizados influyó en la viabilidad de la semilla, registrándose porcentajes de germinación por arriba del 97% en todos los tratamientos. Se recomienda implementar estos productos en el almacenamiento del frijol, para contrarrestar los daños ocasionados por la plaga, obteniendo así beneficios económicos, sociales y ambientales.

  10. Geohydrology of White Rock Canyon of the Rio Grande from Otowi to Frijoles Canyon

    International Nuclear Information System (INIS)

    Purtymun, W.D.; Peters, R.J.; Owens, J.W.

    1980-12-01

    Twenty-seven springs discharge from the Totavi Lentil and Tesuque Formation in White Rock Canyon. Water generally acquires its chemical characteristics from rock units that comprise the spring aquifer. Twenty-two of the springs are separated into three groups of similar aquifer-related chemical quality. The five remaining springs make up a fourth group with a chemical quality that differs due to localized conditions in the aquifer. Localized conditions may be related to recharge or discharge in or near basalt intrusion or through faults. Streams from Pajarito, Ancho, and Frijoles Canyons discharge into the Rio Grande in White Rock Canyon. The base flow in the streams is from springs. Sanitary effluent in Mortandad Canyon from the treatment plant at White Rock also reaches the Rio Grande

  11. Phytotoxicity attenuation in Vigna radiata under heavy metal stress at the presence of biochar and N fixing bacteria.

    Science.gov (United States)

    Seneviratne, Mihiri; Weerasundara, Lakshika; Ok, Yong Sik; Rinklebe, Jörg; Vithanage, Meththika

    2017-01-15

    This study assesses the effect of N-fixing bacteria and biochar synergism on plant growth and development of Vigna mungo under heavy metal stress (HM). Heavy metal stress is a worldwide problem, which causes critical effects on plant life due to oxidative stress. Application of biochar is a recent biological remediation technique, which often leads to an immobilization of heavy metals in soil. . Synergism of bacteria and biochar is a novel aspect to enhance plant growth under heavy metal stress. Woody biochar a byproduct of a dendro power industry was added as 1, 2.5 and 5% amounts combination with Bradyrhizobium japonicum, where mung seedlings were planted in serpentine soil rich in Ni, Mn, Cr and Co. Pot experiments were conducted for 12 weeks. The plant height, heavy metal uptake by plants, soil bioavailable heavy metal contents, soil N and P and microbial biomass carbon (MBC) were measured. The plant growth was enhanced with biochar amendment but a retardation was observed with high biochar application (5%). The soil N and P increased with the increase of biochar addition percentage while soil MBC showed reductions at 5% biochar amendment. Both soil bioavailable fractions of HM and up take of HMs by plants were gradually reduced with increase in biochar content. Based on the results, 2.5% biochar synergism with bacteria was the best for plant growth and soil nutrition status. Despite the synergism, available N was negatively correlated with the decrease of bioavailable metal percentage in soil whereas it was conversely for P. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Detección por PCR de Colletotrichum lindemuthianum en cultivos y semillas de frijol en Antioquia, Colombia

    Directory of Open Access Journals (Sweden)

    Leonardo Martínez Pacheco

    2014-12-01

    Full Text Available Colletotrichum lindemuthianum, agente causal de la antracnosis del frijol, es uno de los patógenos más limitantes en la producción de este cultivo. La detección y correcta identificación de este hongo resulta fundamental para el manejo de la enfermedad, siendo las pruebas moleculares alternativas rápidas y sensibles para este fin. Mediante la técnica de PCR se evaluaron cuatro juegos de cebadores (CY1/CY2, CD1/CD2, ClF4/ITS4 y ClF432/ClR533 para la detección de C. lindemuthianum a partir de tejidos foliares, de vainas y de semillas procedentes de cultivos de frijol de Antioquia, Colombia. Los resultados indicaron que el par CD1/CD2, dirigido al pseudogen de permeasa de hierro Ftr1, fue el más efectivo para detectar el hongo en tejidos y semillas de frijol, así como para identificar aislamientos en cultivos microbiológicos. Para los cebadores CY1/CY2, dirigidos a los ITS del rDNA, se recomienda un esquema de PCR-RFLPs con MseI (=Tru1I para la diferenciación con las especies C. orbiculare y C. trifolii. Estos cebadores generaron resultados consistentes cuando se utilizaron en combinación con ITS1 (ITS1/CY2 e ITS4 (CY1/ITS4. Finalmente, los cebadores ClF4/ITS4 resultaron en amplificaciones inespecíficas y ClF432/ClR533 en fragmentos de difícil resolución en electroforesis de agarosa. Este estudio servirá de apoyo para los programas de certificación de semilla y mejoramiento genético de frijol.

  13. Transgene expression in cowpea ( Vigna unguiculata (L.) Walp ...

    African Journals Online (AJOL)

    Transgene expression in cowpea ( Vigna unguiculata (L.) Walp.) ... and Bar genes for β-glucuronidase expression and bialaphos resistance respectively. ... expression also showed positive signals under PCR and Southern analysis giving ...

  14. Pollination and yield responses of cowpea (Vigna unguiculata L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... Key words: Apis mellifera adansonii, Vigna unguiculata, bee plant, foraging, pollination, increased yield. INTRODUCTION. There are ... several techniques such as fire-prone, crop rotations, ..... Inventory of melliferous plants.

  15. Genetic analysis of Myanmar Vigna species in responses to salt ...

    African Journals Online (AJOL)

    Genetic analysis of Myanmar Vigna species in responses to salt stress at the ... of reduction was highly dependent on different genotypes and salinity levels. ... the mechanism of salt tolerance and for the provision of genetic resources for ...

  16. survey of the symptoms and viruses associated with cowpea (vigna

    African Journals Online (AJOL)

    Osondu

    2012-10-29

    Oct 29, 2012 ... of the prevalence of virus disease symptoms and to specifically identify the viruses infecting cowpea. (Vigna unguiculata . ... 1Department of Crop Protection, Faculty of Agriculture,. University of ..... emerging viruses. This will ...

  17. Mejora genética participativa de la variedad criolla de frijol "Sacapobres"

    Directory of Open Access Journals (Sweden)

    Rodolfo Araya-Villalobos

    2006-01-01

    Full Text Available Agricultores experimentadores de la Región Brunca de Costa Rica solicitaron en el año 1999, al Programa de Investigación y Transferencia de Tecnología Agropecuaria en frijol (PITTA Frijol, la mejora genética de la variedad criolla Sacapobres, una de las principales variedades criollas de la Región Brunca, que posee precocidad (60 días a cosecha, superando en más de diez días a la variedad mejorada más precoz y alto potencial de rendimiento en grano (no había podido ser sustituida por las variedades mejoradas en sus campos de producción, pero de alta emisión de guías y acame. En el Centro Internacional de Agricultura Tropical (CIAT y la Escuela Agrícola Panamericana Zamorano, se efectuaron hibridaciones con esta variedad criolla. La selección de los materiales segregantes se inició en los años 2000 y 2001, en Costa Rica y se basó en la metodología de fitomejoramiento participativo (FP. Los sitios de selección fueron fincas de agricultores y una estación experimental. El principal criterio empleado por los agricultores fue la arquitectura erecta (ausencia o poca emisión de guías y sin acame para facilitar el tránsito por el terreno en las labores de deshierba y fumigación, seguido del tipo, tamaño y color de grano e incidencia de patógenos. Se seleccionaron, en el año 2005, dos líneas promisorias, que pasarán a la etapa de validación. Se describe la estrategia de selección en FP, la genealogía de los progenitores empleados y se concluye sobre el futuro mejoramiento de Sacapobres

  18. Estrategia para el manejo de suelos ácidos en frijol (phaseolus vulgaris l. en el estado de Chiapas, Mexico

    Directory of Open Access Journals (Sweden)

    Bernardo Villar S\\u00E1nchez

    2000-01-01

    Full Text Available Estrategia para el manejo de suelos ácidos en frijol (Phaseolus vulgaris L. en el estado de Chiapas, México. Por su contribución en la dieta alimenticia y la generación de empleos, y por existir una ancestral cultura productiva y una superficie de siembra de más de 100 mil hectáreas, el cultivo de frijol es de fundamental importancia en el estado de Chiapas. Sin embargo, se ha determinado una brecha tecnológica de más de 700 kg/ha entre el potencial del cultivo y los rendimientos actuales. Esta es ocasionada por numerosos factores limitantes entre los que destaca la presencia de suelos de baja fertilidad y ácidos. La estrategia adoptada para el manejo de este problema incluye: 1.Aplicación de cal y fósforo; 2. Mejoramiento genético para resistencia; 3.Manejo de los ciclos de materia orgánica y nutrientes del suelo; y 4.Combinación de las tres alternativas. En este reporte se dan los avances obtenidos con relación a la primera alternativa considerada como el paso inicial para el logro de un manejo integral de suelos en Chiapas. Durante 1997 se estudiaron cinco dosis de cal y tres de fósforo en condiciones de invernadero y campo para suelos de diferentes localidades. Se utilizó un experimento factorial completo con cuatro repeticiones, los experimentos fueron evaluados en términos de la producción de grano y al efecto de la cal sobre las propiedades químicas del suelo. Hubo respuesta del frijol en rendimiento a la aplicación de cal y fósforo

  19. Papel del frijol negro Phaseolus vulgaris en el estado nutricional de la población guatemalteca

    OpenAIRE

    Serrano, José; Goñi, Isabel

    2004-01-01

    RESUMEN. En Guatemala existe un fenómeno de superposición epidemiológica, en el que coexisten problemas de salud propios de países desarrollados con otros característicos de poblaciones en vías de desarrollo. Se observan deficiencias marcadas en algunos macronutrientes tales como hierro y vitamina A. en simultaneidad con enfermedades crónicas como diabetes tipo II o enfermedades cardiovasculares. Se conoce muy bien la importancia del frijol negro (Phaseolus vulgaris) en la dieta habitual de G...

  20. EFECTO DEL ABONO DE SUSTRATO GASTADO DE CHAMPIÑÓN EN EL RENDIMIENTO DE FRIJOL Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Helio Adán García Mendívil

    2014-01-01

    Full Text Available La manipulación de los desechos orgánicos y sus compostas representan una fuente de nutrientes imprescindible para la agricultura sostenible, ya que provee de fertilizantes naturales y reduce la contaminación ambiental, bajando con ello el costo de producción. El objetivo de este estudio fue evaluar el efecto de la aplicación de composta a base de sustrato gastado de champiñón, enriquecida con silicio, al suelo, en cultivo de frijol, a través de mediciones fisiológicas y rendimiento en frijol. El experimento se estableció en campo, sembrándose frijol var. Pinto Saltillo en Huatabampo, Sonora, en un suelo de tipo aluvión ligero. El diseño experimental utilizado fue de bloques completos al azar, compuesto de 4 tratamientos con cuatro repeticiones: 1.- testigo (sin aplicación, 2-2.5, 3 5 y 4-7.5 Mg ha 1 de composta. Las variables evaluadas fueron: clorofila total, tasa fotosintética (µg CO2 S-1 cm-2, número de vainas por planta y rendimiento. Con los datos se realizó un análisis de varianza y las medias se compararon con la prueba de Tukey (P ≤ 0.05. Se observaron respuestas significativas en la mayoría las variables evaluadas, en clorofila total hubo aumentos de hasta 26.2% en el tratamiento dos, para fotosíntesis de 26.1% en el tratamiento cuatro, en el número de vainas 8.7% en el tratamiento tres, siendo este el de mayor rendimiento (P ≤ 0.05 con 2.91 Mg ha-1, seguido del tratamiento dos con 2.89 Mg ha-1, el tratamiento cuatro con 2.85 Mg ha-1, y por último el testigo con 1.4 Mg ha 1. Los resultados sugieren que el empleo de composta es una alternativa de fertilización viable para la producción de frijol.

  1. The effects of wildfire on the peak streamflow magnitude and frequency, Frijoles and Capulin Canyons, Bandelier National Monument, New Mexico

    Science.gov (United States)

    Veenhuis, J.E.

    2004-01-01

    In June of 1977, the La Mesa fire burned 15,270 acres in and around Frijoles Canyon, Bandelier National Monument and the adjacent Santa Fe National Forest, New Mexico. The Dome fire occurred in April of 1996 in Bandelier National Monument, burned 16,516 acres in Capulin Canyon and the surrounding Dome Wilderness area. Both canyons are characterized by extensive archeological artifacts, which could be threatened by increased runoff and accelerated rates of erosion after a wildfire. The U.S. Geological Survey (USGS) in cooperation with the National Park Service monitored the fires' effects on streamflow in both canyons. Copyright 2004 ASCE.

  2. PRODUCTIVIDAD Y RENTABILIDAD DEL CULTIVO DE FRIJOL CON FERTIRRIEGO EN VERACRUZ, MÉXICO

    Directory of Open Access Journals (Sweden)

    Francisco Javier Ugalde-Acosta

    2011-01-01

    Full Text Available El objetivo de este trabajo fue determinar el efecto del fertirriego en el cultivo de frijol en las zonas centro y sur del estado de Veracruz, México. Durante los ciclos invierno-primavera 2000 y 2001 se evaluaron tres tratamientos: 1 Riego rodado (por gravedad y fertilización sólida manual (testigo regional, con la dosis 40N-40P-0K (RR-40, 2 Riego por goteo y fertilización sólida manual, con la dosis 4N-40P-0K (RG-40; en ambos tratamientos se aplicó el fertilizante a los quince días de nacido el cultivo, y 3 riego por goteo y fertilización soluble, con la dosis 60N-60P-60K, aplicada en forma fraccionada durante el ciclo del cultivo (RG-60. De 2002 a 2005 se validó el mejor tratamiento y se realizó análisis económico para determinar su rentabilidad en comparación con el testigo regional. En la etapa de evaluación, con el tratamiento RG- 60 se redujo en 85% el gasto de agua y se obtuvo el mayor rendimiento promedio (2256 kg/ha, que superó en 145% al obtenido con RG-40 y en 186% al RR-40 (testigo regional. En la etapa de validación con riego por goteo y fertilización soluble fraccionada 60N-60-P-60K se obtuvo 110% más rendimiento que el testigo regional y mejor relación beneficio/ costo (1:1,80.

  3. BIOMASA Y RENDIMIENTO DE FRIJOL CON POTENCIAL EJOTERO EN UNICULTIVO Y ASOCIADO CON GIRASOL

    Directory of Open Access Journals (Sweden)

    J. Garduño-González

    2009-01-01

    Full Text Available El objetivo del presente estudio fue estimar la producción de biomasa, rendimiento y algunos de sus componentes de dos cultivares de frijol (Phaseolus vulgaris L. con potencial ejotero ('Acerado' y 'Criollo', en unicultivo y asociado con dos cultivares de girasol (Helianthus annuus L. ('Sunbright' y 'Victoria'. El estudio se realizó durante el ciclo primavera verano 2006 bajo condiciones de temporal en Tenancingo, Méx. Las variables evaluadas fueron: índice de área foliar (IAF, tasa de asimilación neta (TAN, biomasa total (BT, diámetro de vaina (DV, longitud de vaina (LV, número de vainas·m-2 (NV y rendimiento de vaina·m-2 (RV; las cuales fueron analizadas en arreglo factorial, bajo un diseño de bloques completos al azar con cuatro repeticiones. Para estimar el grado de asociación, entre las variables estudiadas y el rendimiento de vainas, se realizó un análisis de correlación lineal simple. En el factor cultivares se detectaron diferencias estadísticas significativas para la TAN y DV; para el factor sistemas de siembra hubo diferencias significativas para BT, DV, NV y RV. La interacción cultivares * sistema de siembra fue significativa en todas las variables, excepto en la TAN. En ese sentido, las asociaciones 'Criollo' + 'Sunbright', 'Acerado' + 'Victoria' y 'Acerado' en unicultivo, presentaron el mayor RV. Las variables IAF, BT y NV se correlacionaron positiva y significativamente con el rendimiento de vaina. Los resultados indican que 'Criollo' y 'Acerado', asociados con 'Sunbright' y 'Victoria', respectivamente, responden positivamente a la asociación, constituyendo una buena opción para los productores de la región de Tenancingo, México.

  4. CARACTERIZACIÓN PRELIMINAR CON MICROSATÉLITES DE LA COLECCIÓN GUATEMALTECA DE FRIJOL COMÚN TREPADOR

    Directory of Open Access Journals (Sweden)

    Karla Melina Ponciano-Samayoa

    2009-01-01

    Full Text Available El objetivo de este estudio fue caracterizar con microsatélites una colección de 558 accesiones de frijol voluble guatemalteco. En el Instituto de Ciencia y Tecnología Agrícolas (ICTA, en el periodo enero 2008 a junio 2009, con base en seis marcadores microsatélites, se analizaron agrupamientos y diversidad genética dentro de los grupos de frijol. Todos los loci analizados fueron polimórficos, se detectaron 25 alelos con un promedio de 4,12 alelos por marcador. El análisis de similaridad detectó genotipos duplicados que al ser eliminados dio lugar a una colección reducida de 261 muestras diferentes (46,8 % de la original. Los análisis de similaridad y correspondencia identificaron 12 grupos, incluyendo un control andino. La diversidad genética de Nei para la colección reducida fue 0,4310, y la diferenciación genética (Gst de 0,5747. La diversidad genética entre los grupos (57,5 % fue mayor que la detectada dentro de los grupos (42,5 %. Las distancias genéticas entre grupos se calcularon en un rango de 0.1566 a 1,6205. Un alto nivel de heterocigosidad fue observado.

  5. Fraccionamiento de nitrógeno en frijol ( phaseolus vulgaris l. en el valle de san juan

    Directory of Open Access Journals (Sweden)

    Juan Cedano

    2000-01-01

    Full Text Available Fraccionamiento de nitrógeno en frijol (Phaseolus vulgaris L. en el valle de San Juan. Se realizó un estudio para determinar el efecto del fraccionamiento de la fertilización nitrogenada y el momento adecuado para la aplicación de nitrógeno en el cultivo de frijol (Phaseolus vulgaris L. en cinco localidades del Valle de San Juan, R. D. Los experimentos fueron establecidos del 5 al 14 de noviembre (1997 , se utilizó un diseño de bloques completamente al azar y nueve tratamientos en cada localidad, encontrándose que en los terrenos con altos niveles de nitrógeno no hubo respuesta a la aplicación de nitrógeno ni al fraccionamiento de este nutrimento; mientras que en los suelos con deficiencia en nitrógeno si hubo respuesta a la fertilización nitrogenada encontrándose diferencia estadística significativa a la aplicación y al momento de aplicación del fertilizante. Entre las localidades hubo diferencia estadística significativa (P>0.05, mientras que no se encontró interacción entre los tratamientos y las localidades

  6. Evaluación de líneas de frijol negro, en Veracruz y Chiapas, México

    Directory of Open Access Journals (Sweden)

    Ernesto Lopez

    2001-01-01

    Full Text Available Evaluación de líneas de frijol negro, en Veracruz y Chiapas, México. El presente estudio se llevó a cabo durante los ciclos agrícolas de 1999-2000 y 2000-2001; se evaluó la adaptación y rendimiento de 15 líneas avanzadas de frijol negro, así como un testigo local. Dichos genotipos forman parte al Ensayo Centroamericano de Adaptación y Rendimiento (ECAR. La evaluación se realizó en 11 localidades, cinco en el estado de Chiapas y seis en Veracruz, los experimentos se establecieron bajo condiciones de riego, temporal y humedad residual. Las líneas ICTA-Ju 97-1, ICTA-Ju II- 307, DOR-678 y Cut-45, resultaron sobresalientes por su rendimiento, amplia adaptación y estabilidad. En el ciclo agrícola de otoño-invierno 1999-2000, se evaluó la respuesta de las líneas a las siguientes enfermedades: mosaico dorado (BGMV, mancha angular (Phaseoisariopsis griseola, roya (Uromyces appendiculatus y la antracnosis (Colletotrichum lindemuthianum. Las líneas que resultaron tolerantes fueron ICTA Ju 97-1 y Cut-45. Ambas serán validadas en campos de agricultores para su posible liberación como nuevas variedades para algunas regiones productoras de Veracruz y Chiapas, México

  7. Efectos de la suplementación alimenticia sobre la producción de gallinas de patio

    Directory of Open Access Journals (Sweden)

    Eduberto Sánchez Sevilla

    2000-06-01

    Full Text Available El presente artículo expone los resultados de una investigación experimental realizada en las comunidades de San Andrés de la Palanca y La Ceiba, del municipio de Mateare, departamento de Managua. El estudio es parte de las actividades desarrolladas en el marco del Proyecto de Desarrollo Rural, ejecutado por el Programa de Desarrollo Agrario y Agronomía (ADAA-UCA. Se analizaron los efectos de la implementación de dos dietas compuestas de Maíz y Frijol Mungo (Maíz Zea mays L + Mungo Vigna radi@ta y de Maíz y Frijol Gandul (Maíz + Gandul Çqjanusaian, como suplementos proteicos para "gallinas de patio". El objetivo de este experimento fue mejorar la condición física de las gallinas de patio, principal fuente de alimentos (huevo y carne de que disponen las familias rurales de las mencionadas comunidades.

  8. Effectiveness and efficiency of chemical mutagens in cowpea (Vigna ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-11-19

    Nov 19, 2008 ... A study was undertaken in a cowpea (Vigna unguiculata (L.) Walp.) variety CO 6 to assess the efficiency and effectiveness of chemical mutagens; ethyl methane sulphonate (EMS), diethyl sulphate (DES) and sodium azide (SA). EMS treatments were found highly effective than the other chemicals.

  9. Pollination and yield responses of cowpea ( Vigna unguiculata L ...

    African Journals Online (AJOL)

    To determine the apicultural value of Vigna unguiculata (L.) Walp. (Fabaceae) and evaluate the Apis mellifera adansonii Latreille (Hymenoptera: Apidae) activity on its pod and seed yields, the bee foraging and pollinating activities were studied in Ngaoundéré. The experiment was carried out within the University of ...

  10. Recovery of herbicide-resistant Azuki bean [ Vigna angularis (Wild ...

    African Journals Online (AJOL)

    ... of the bar gene as determined by assaying for resistance to bialaphos applied directly to leaves. This result demonstrates the feasibility of introducing potentially useful agronomic traits into azuki bean through genetic engineering. Key Words: Agrobacterium tumefaciens, bar gene, bialaphos, transgenic, Vigna angulazris.

  11. Susceptibility Of Five Cowpea ( Vigna unguiculata ) Varieties To ...

    African Journals Online (AJOL)

    Susceptibility Of Five Cowpea ( Vigna unguiculata ) Varieties To Attack By Callosobruchus maculatus (Fab.) ... in Ghana were screened for susceptibility to the cowpea beetle, C. maculatus, in storage for a period of 30 days in the laboratory at an ambient temperature of 27.5 ± 0.9oC and relative humidity of 64.6 ± 2%.

  12. Weed control in cowpea ( Vigna unguiculata (L) Walp) with ...

    African Journals Online (AJOL)

    Field experiments were conducted between 1994 and 1997 at the University of Ilorin Teaching and Research Farm, Ilorin (8o29`N; 4o35`E), in the southern Guinea savanna agro-ecological zone, to evaluate the efficacy of pre-emergence applications of two imidazolinone-based herbicide mixtures in cowpea (Vigna ...

  13. Generation mean analysis of dual purpose traits in cowpea (Vigna ...

    African Journals Online (AJOL)

    Fadiji

    2012-06-07

    Jun 7, 2012 ... Frequency analysis showed that all the F2 populations for fodder yield exhibited a continuous distribution, suggesting that inheritance of fodder yield is ... Key words: Gene effects, fodder, Vigna unguiculata, generation mean analysis. .... using the ABC scaling test (Mather, 1949), incorporating the weighted ...

  14. Plants regeneration from African cowpea variety (Vigna unguiculata ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-18

    Aug 18, 2008 ... Vigna unguiculata (L.) Walp. plant was efficiently regenerated from cotyledonary node explants. The shoots multiplication rate was ... Africa, insect pests are often responsible for 100% losses of cowpea yields (Singh and .... 26 days after acclimatization first flower buds were observed; thus plants were ...

  15. Genetic diversity of Bambara groundnut ( Vigna subterranea (L ...

    African Journals Online (AJOL)

    The existence of genetic diversity in germplasm collections is crucial for cultivar development. Genetic relationships among 105 Bambara groundnuts (Vigna subterranea (L) Verdc.) accessions from Kenya were evaluated using 12 microsatellite markers. The Bambara landraces were collected from farmers in the western ...

  16. Heat stable peroxidases from Vigna species (V) | Mbassi | African ...

    African Journals Online (AJOL)

    Shoots of three landraces of a Vigna species from two climatic areas of Cameroon were evaluated for their content of heat-resistant peroxidases. The peroxidase activity in the three landraces was detected with a greater catalytic efficiency for oxidation of O-dianisidine relative to ABTS (2, 2'-azino-bis-(3- ...

  17. Selection and evaluation of Rhizobial strains of Vigna radiata L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Selection and evaluation of Rhizobial strains of Vigna radiata L. beneficial to ... This study aimed to select suitable strains that can be used as inoculants to enhance legume production and simultaneously reduce the use of ... contributor to natural or biological N2 fixation and allows legumes to grow in the ...

  18. Effect Of Sprouting On Available Lysine Content Of Cowpea ( Vigna ...

    African Journals Online (AJOL)

    This study was conducted to determine the effect of sprouting on available Lysine content of cowpea (Vigna unguiculata) flour and the performance of the flour used for producing “moi – moi” (steamed bean cake). Cowpea seed was subjected to sprouting for different periods of 1 day, 2 days and 3 days for samples B, C and ...

  19. RELACIONES HÍDRICAS Y TEMPERATURAS ALTAS EN FRIJOL DEL TIPO "FLOR DE MAYO"

    Directory of Open Access Journals (Sweden)

    Edwin Javier Barrios-Gómez

    2011-01-01

    Full Text Available Se estudió el efecto del déficit hídrico del suelo y temperatura alta del aire en las relaciones hídricas y temperatura del dosel del cultivo (Tc, rendimiento de semilla (RS y sus componentes en 8 variedades de frijol del tipo "Flor de Mayo" (FM y una variedad criolla. Se realizaron 3 experimentos de campo; Montecillo en riego (MR con la aplicación de agua de la siembra a la madurez, Montecillo en secano (MS con la lluvia como fuente única de humedad y Celaya en secano (CS con lluvia y 2 riegos suplementarios en floración. Se utilizó una dosis de fertilización de 80 kg.ha-1 de nitrógeno y 40 kg.ha-1 de fósforo. En MR el potencial hídrico foliar ( =-0,33 Mpa, osmótico ( =-1,26 Mpa y de turgencia y (P=0,93 Mpa fue más alto que en CS ( =-0,77, =-1,36 y P=0,59 Mpa y MS ( =-1,22, =-1,57 y P=0,35 Mpa; MS, con mayor deficiencia hídrica del suelo, tuvo mayor reducción en y , y mayor grado de ajuste osmótico (AO=0,70 Mpa. El AO estuvo positiva y significativamente asociado con RS y biomasa aérea final (BMAF en los 2 ambientes de secano. La Tc en MR (26,7°C fue más baja que en CS (30,8°C y MS (36,6°C; el estrés por calor se agudizó con el descenso en el contenido hídrico de las plantas en el ambiente más seco (MS; Tc se relacionó negativa y significativamente con y en MS. La alta Tc también tuvo efecto significativo en la producción de BMAF y RS y sus componentes; la alta Tc redujo el RS, BMAF, número de vainas normales.m-2 (VN.m-2 y peso de 100 semillas (P100S en 12,5, 10,7, 10,2 y 3,4% por cada ºC (-1 ºC de aumento en la Tc, respectivamente.

  20. RESISTENCIA A SEQUÍA DE LINEAS Y VARIEDADES DE FRIJOL NEGRO TROPICAL

    Directory of Open Access Journals (Sweden)

    Ernesto Lopez Salinas

    2011-06-01

    Full Text Available Los objetivos de esta investigación fueron: clasificar genotipos de frijol negro por su tolerancia a sequía e identificar los de mayor eficiencia en el rendimiento en condiciones de riego y sequía. Para ello, en invierno-primavera 2008 se condujeron dos experimentos en Medellín de Bravo, Veracruz; uno con riego todo el ciclo y el otro sin riego, a partir del inicio de floración. Se evaluaron nueve líneas, seis variedades y Criollo Arbolito (testigo local en diseño bloques completos al azar con tres repeticiones. Se cuantificó días a madurez fisiológica, producción de materia seca sin grano, vainas por planta, peso de 100 semillas y rendimiento de grano. Se hicieron análisis de varianza por condición de humedad y uno combinado. Como estimadores de eficiencia se utilizaron el índice de susceptibilidad a sequía (ISS y el índice de eficiencia relativa del rendimiento (IER. Con riego, Negro INIFAP, 82L-17-80, Negro Tacaná y Negro Veracruz, fueron los genotipos más productivos con más de 1,0 t ha-1. Con sequía sobresalieron los dos últimos genotipos, más la línea DOR 448, con rendimientos superiores a 400 kg ha-1. El rendimiento bajo sequía en promedio representó el 37,7% con respecto al de riego. Con ISS de 0,71, 0,85 y 0,87, las líneas DOR-448, NGO 17-99 e Icta Ju-97-1, respectivamente, fueron clasificadas como resistentes a sequía. Las variedades Negro Tacaná y Negro Veracruz con valores de IER de 1,67 y 1,47, mostraron la mayor eficiencia en el rendimiento en ambas condiciones de humedad.

  1. Interacción de Tsukamurella paurometabola C-924 con Rhizobium leguminosarum biovar phaseoli CFH en el cultivo de frijol

    Directory of Open Access Journals (Sweden)

    Marieta Marín Bruzos

    2013-01-01

    Full Text Available En el estudio se evaluaron, mediante análisis de los parámetros fenológicos de las plantas, la interacción de Tsukamurella paurometabola C-924 con Rhizobium leguminosarum biovar phaseoli CFH en el cultivo de frijol. Se emplearon cuatro tratamientos: plantas sin inocular (control, inoculadas con T. paurometabola C-924, inoculadas con R. leguminosarum biovar phaseoli CFH e inoculadas con ambas cepas. Se observaron diferencias significativas (P < 0.01 en los porcentajes de germinación de las plantas tratadas con microorganismos de forma independiente o conjunta con respecto al control sin inocular. Se determinó que la inoculación de T. paurometabola C-924 afectó el proceso de nodulación de R. leguminosarum biovar phaseoli CFH. Sin embargo, esto no incidió de manera significativa en la altura de las plantas ni en el diámetro del tallo, ya que no se encontraron diferencias entre los tratamientos para estos parámetros. Para el número de hojas, los mejores resultados se obtuvieron con la aplicación de T. paurometabola C-924. Se concluyó que la interacción de T. paurometabola C-924 con R. leguminosarum biovar phaseoli CFH en el frijol estimuló significativamente la germinación de las semillas y el número de hojas de las plantas con respecto al control sin inocular. Aunque la aplicación de T. paurometabola C-924 no favoreció la nodulación de R. leguminosarum biovar phaseoli CFH, esto no afectó las características fenológicas del cultivo.

  2. Validación de genotipos de frijol negro en la zona central del Estado de Veracruz, México

    Directory of Open Access Journals (Sweden)

    Francisco Javier Ugalde Acosta

    2005-01-01

    Full Text Available Validación de genotipos de frijol negro en la zona central del estado de Veracruz, México. El objetivo del presentetrabajo, fue validar genotipos de frijol con el paquete tecnológico del INIFAP, en parcelas de productores. Durante los ciclosde humedad residual de 1998 a 2001 se establecieron nueveparcelas de validación. Los genotipos utilizados fueron: las lí-neas II-307 y DOR-500 y las variedades Negro Huasteco 81,Negro Cotaxtla 91 y Negro INIFAPy como testigo del productor la variedad Jamapa. En las parcelas se realizaron las laboresde manejo agronómico recomendadas por el INIFAPpara esazona de producción. Cada parcela ocupó una superficie total de3000 m2. Se realizaron análisis de varianza individuales por localidad, considerando como repetición los rendimientos obtenidos por cada genotipo (500 m2 por ciclo de evaluación; también se efectuaron análisis combinado con prueba deseparación de medias (DMS 5% y un análisis económico mediante la Tasa de Retorno Marginal. Los resultados indicaronque las variedades y líneas mejoradas fueron superiores en másdel 100% en rendimiento al testigo. El análisis económicomostró que el mayor beneficio económico se obtuvo al sembrarlas variedades Negro INIFAPy Negro Cotaxtla 91, con utilidades superiores a los US $ 286/ha y una relación beneficio/costo de 1,52 y 1,51, respectivamente.

  3. Efectividad de cepas rizobianas nativas de sabana en Vigna unguiculata (L. Walp. cv. C4A-3

    Directory of Open Access Journals (Sweden)

    Juliana Mayz

    2010-07-01

    Full Text Available Título en inglés: Effectiveness of savannah native rhizobial strains in Vigna unguiculata (L. Walp. cv. C4A-3 Resumen Se estima que la población mundial se incrementará y demandará mayor cantidad de alimentos y uso de fertilizantes nitrogenados. En Venezuela, el frijol es altamente consumido y se cultiva en las sabanas orientales, cuyas características edáficas pueden afectar negativamente la población rizobiana. Estos planteamientos refuerzan la importancia de la evaluación de la flora rizobiana nativa, y enfatizan la necesidad de aumentar la explotación de la fijación biológica de nitrógeno. En este contexto, se evaluaron 6 cepas rizobianas en el cultivar C4A-3, aisladas, de frijol cv. Tejero Criollo y previamente catalogadas como efectivas (JV91, JV94 y JV101 e inefectivas (JV99, JV103, y JV104 en el cultivar TC9-6. El experimento se llevó a cabo en umbráculo por 45 días, donde además se incluyeron dos tratamientos control no inoculados. La suspensión de las cepas individualmente cultivadas se usó para inoculación. De acuerdo con la tipología de la nodulación (número de nódulos, peso total y por nódulo, tamaño y color, los valores de los parámetros de crecimiento (peso seco, altura y número de hojas del vástago y los estimados de la concentración de nitrógeno y nitrógeno total, las cepas JV91, JV99 y JV101, fueron las más efectivas en la fijación de nitrógeno. El nitrógeno total y la concentración de nitrógeno tuvieron una correlación significativa con peso seco, altura y número de hojas del vástago. Los resultados muestran la existencia de cepas efectivas en los suelos de sabana para este cultivar, y enfatizan la importancia de evaluar las cepas indígenas, antes de proceder a la inoculación con foráneas. Palabras clave: Rhizobium; frijol; fijación de nitrógeno; Venezuela. Abstract It is estimated that world-wide population will increase and demand higher amount of food and use of nitrogen

  4. Uso de un vivero móvil para obtener patrones de virulencia de la roya del frijol común

    Directory of Open Access Journals (Sweden)

    James Steadman

    2002-01-01

    Full Text Available Después de identificar nuevas fuentes de resistencia a la roya, causada por Uromyces appendiculatus, es necesario saber si las variedades con nuevos genes conservarán su resistencia cuando sean sembradas en diferentes regiones de producción. Para ello, se pueden utilizar viveros móviles con líneas/variedades de frijol con diferentes genes de resistencia para obtener los patrones de virulencia del patógeno de la roya. El vivero contiene plantas de frijol con seis días después de la germinación. El vivero se coloca por dos a tres horas en un campo de frijol infectado con la roya, y luego se exponen a las plantas bajo neblina por un periodo de 15 horas dentro de un ambiente controlado, para un un período de incubación de ocho a diez días en una casa de malla. En las hojas primarias, se efectúan las lecturas del tamaño de la uredinia (pústulas. Se utilizan las reacciones para evaluar los patrones de virulencia y para predecir estrategias de uso de genes de resistencia. El vivero móvil economiza tiempo y dinero (10-12 días comparado con dos a cuatro meses para identificar patotipos de roya con inoculaciones en el invernadero y permite el conocimiento de los resultados durante el ciclo del cultivo del frijol. El concepto del vivero móvil podría ser especialmente útili en paí- ses donde hay una escasez de invernaderos y puede ser utilizado con otros sistemas de cultivos-patógenos.

  5. Avances en la selección de fuentes de resistencia a las principales enfermedades del frijol común (Phaseolus vulgaris L.) en Costa Rica

    OpenAIRE

    Carlos M. Araya; Rodolfo Araya

    2000-01-01

    En esta investigación se evaluaron diversos genotipos de frijol en la búsqueda de fuentes de resistencia a la antracnosis (Colletotrichum lindemuthianum) y a la mancha angular (Phaeoisariopsis griseola). Se evaluó germoplasma del programa nacional de hibridaciones y de tres viveros internacionales distribuidos por el CIAT: VIFURE, VIPADOGEN y CORE COLLECTION. Los ensayos se establecieron en Puriscal (1017 msnm), Alajuela (814 msnm) y Fraijanes (1650 msnm), durante los ...

  6. Gestión de nuevos cultivares de frijol común en las condiciones de la UBPC “Santa Maria 4”

    Directory of Open Access Journals (Sweden)

    Juan Miguel Avila Concepción

    2013-11-01

    Full Text Available Esta investigación se real izó en la UBPC Santa Maria 4 perteneciente a la UEB Antonio Guiteras del municipio Puerto padre, provincia Las Tunas, en el período comprendido entre el 28 de noviembre de 2012 hasta el 16 de febrero de 2013, con el objetivo de evaluar el comportamiento agroproductivo de siete cultivares de frijol común (Phaseolus vulgaris, L. , en un suelo Pardo sialítico mullido carbonatado con vista a incrementar la biodiversidad y elevar el rendimiento agrícola de este cultivo. Los cultivares evaluados fueron (Velazco Largo, Colorado E-120, frijol Rayado, Rojo E-114, Frijol Crema Japones, Rojo E-130, frijol Blanco Español, se utilizó un diseño de bloques al azar con cuatro réplicas, la fitotecnia aplicada fue la tradicional establecida para este cultivo, los aspectos evaluados fueron los siguientes, altura de las plantas, número de hojas, grosor del tallo, altura de la primera vaina, granos por vainas, peso de 100 granos, rendimiento agrícola, incidencia de las principales plagas y valoración económica de la producción. El cultivar que obtuvo mayor rendimiento fue el Velazco Largo y los de menor el Rojo E-114 y el Rayado, los valores obtenidos permiten asegurar que desde el punto de vista económico es factible la realización de estas siembras, pues se pueden obtener incrementos en el ingreso por ventas de $ 6242.90 – 20108.85 pesos por hectárea. En el experimento las condiciones edafoclimáticas fueron favorables en todo el ciclo del cultivo, no se registraron altos niveles de infestación de plagas y enfermedades.

  7. Efecto de diferentes distancias de siembra sobre la producción de biomasa del frijol terciopelo (Stizolobium deeringianum en el departamento de Masaya

    Directory of Open Access Journals (Sweden)

    Roberto Tapia Morales

    2002-06-01

    Full Text Available El presente trabajo tuvo como objetivo, evaluar en términos biológicos el efecto de diferentes distancias de siembra entre plantas sobre la producción de biomasa en base verde y seca del frijol terciopelo (Stizolobium deeringianum. Los resultados evidencian que las diferentes distancias de siembra, tuvieron efecto estadísticamente significativo en la producción de biomasa de frijol terciopelo en base verde y seca. Los valores de producción de biomasa más altos en cuanto a producción de biomasa corresponden a aquellos tratamientos Cuya distancias entre planta son iguales a 0.25 m y 0.50 m, obteniéndose 15.3 ton/ha y 12.3 ton/ha en base verde respectivamente y 2.43 ton/ha y 2.025 ton/ha en base seca respectivamente. En lo que respecta a la capacidad de rebrote se demostró que a una altura de corte inferior a 10 cm el frijol terciopelo no es eficiente, ya que en ninguno de los diferentes tratamientos una vez realizado el primer corte se encontraron plantas en estado de rebrote.

  8. MGS Esmeralda: new large seed mungbean cultivar MGS Esmeralda: nova cultivar de mungo-verde de sementes grandes

    Directory of Open Access Journals (Sweden)

    Rogério Faria Vieira

    2008-06-01

    Full Text Available Mungbean cultivar MGS Esmeralda was developed by Asian Vegetable Research and Development Center (Shanhua, Taiwan, as a result of crossing between the lines VC 1973A and VC 2768A. In ten trials conducted in the State of Minas Gerais, Brazil, it produced 13.5% more grains than 'Ouro Verde MG-2' (control cultivar, and its highest yield was 2,550 kg ha-1. The cultivar MGS Esmeralda is more susceptible to lodging, and its pods mature more uniformly than Ouro Verde MG-2 pods. One hundred-seed mass of 'MGS Esmeralda' ranged between 5.5 and 6.8 g. Both cultivars are susceptible to powdery mildew and cercospora leaf spot.A cultivar de mungo-verde MGS Esmeralda foi criada pelo Asian Vegetable Research and Development Center, localizado em Shanhua, Formosa. Ela é resultado do cruzamento entre as linhagens VC 1973A e VC 2768A. Em dez ensaios conduzidos em Minas Gerais, ela produziu 13,5% mais grãos do que a cultivar Ouro Verde MG-2 (testemunha, e sua produtividade mais alta foi 2.550 kg ha-1. A cultivar MGS Esmeralda é mais suscetível ao acamamento do que a Ouro Verde MG-2, mas suas vagens amadurecem mais uniformemente. A massa de 100 grãos da 'MGS Esmeralda' varia de 5,5 a 6,8 g. Ambas as cultivares são suscetíveis ao oídio e à cercosporiose.

  9. Development of unigene-derived SSR markers in cowpea (Vigna unguiculata) and their transferability to other Vigna species.

    Science.gov (United States)

    Gupta, S K; Gopalakrishna, T

    2010-07-01

    Unigene sequences available in public databases provide a cost-effective and valuable source for the development of molecular markers. In this study, the identification and development of unigene-based SSR markers in cowpea (Vigna unguiculata (L.) Walp.) is presented. A total of 1071 SSRs were identified in 15 740 cowpea unigene sequences downloaded from the National Center for Biotechnology Information. The most frequent SSR motifs present in the unigenes were trinucleotides (59.7%), followed by dinucleotides (34.8%), pentanucleotides (4%), and tetranucleotides (1.5%). The copy number varied from 6 to 33 for dinucleotide, 5 to 29 for trinucleotide, 5 to 7 for tetranucleotide, and 4 to 6 for pentanucleotide repeats. Primer pairs were successfully designed for 803 SSR motifs and 102 SSR markers were finally characterized and validated. Putative function was assigned to 64.7% of the unigene SSR markers based on significant homology to reported proteins. About 31.7% of the SSRs were present in coding sequences and 68.3% in untranslated regions of the genes. About 87% of the SSRs located in the coding sequences were trinucleotide repeats. Allelic variation at 32 SSR loci produced 98 alleles in 20 cowpea genotypes. The polymorphic information content for the SSR markers varied from 0.10 to 0.83 with an average of 0.53. These unigene SSR markers showed a high rate of transferability (88%) across other Vigna species, thereby expanding their utility. Alignment of unigene sequences with soybean genomic sequences revealed the presence of introns in amplified products of some of the SSR markers. This study presents the distribution of SSRs in the expressed portion of the cowpea genome and is the first report of the development of functional unigene-based SSR markers in cowpea. These SSR markers would play an important role in molecular mapping, comparative genomics, and marker-assisted selection strategies in cowpea and other Vigna species.

  10. Mejoramiento de la producción del frijol (Phaseolus vulgaris, L con el uso de alternativas de fertilización

    Directory of Open Access Journals (Sweden)

    Rolando Ramírez Olivera

    2010-01-01

    Full Text Available Argumenta la evaluación de algunas alternativas de nutrición en el frijol común (Phaseolus vulgaris, L., variedad Velasco Largo, que se desarrolló en áreas de la subestación de Granos de la Unidad de Extensión, Investigación y Capacitación Agropecuaria de Holguín (UEICA-H, ubicada en Velasco, municipio de Gibara, provincia de Holguín, en el periodo comprendido entre diciembre de 2007 y marzo de 2008. Se aplicaron seis (6 variantes de fertilización, que comprendió el uso de fertilizantes químicos a dosis menores que las recomendadas, la utilización de abonos orgánicos: humus de lombriz tanto sólido como líquido y el biofertilizante Ecomic. Se tomaron mediciones de altura de las plantas, nodulación y rendimiento y sus componentes, así como, se realizó un análisis económico en base a los rendimientos obtenidos. Los resultados mostraron que la utilización de diferentes alternativas de fertilización provocó un efecto directo sobre el crecimiento de las plantas de frijol, sobre la nodulación natural y el rendimiento y sus componentes, los mismos sugieren la utilización de combinaciones de fertilizantes químicos, orgánicos y biofertilizantes para la obtención de altos rendimientos de forma sostenible en el cultivo del frijol.

  11. Rendimiento de semilla y sus componentes en frijol bajo condiciones de acidez y sequía terminal en el sur de Veracruz.

    OpenAIRE

    Morales Rivera, Aurelio

    2014-01-01

    Se estudió la variabilidad en rendimiento de semilla y sus componentes, y producción de biomasa aérea en un grupo de variedades de frijol de color negro, nativas del sur de Veracruz y un grupo del tipo “Flor de Mayo”, introducidas del Altiplano, y la región central de México, en condiciones de acidez edáfica y sequía terminal en el Municipio de Juan Rodríguez Clara, Veracruz, en el ciclo otoño-invierno 2012-13. Se incluyeron ocho variedades comerciales liberadas por el INIFAP, un criollo de M...

  12. Efecto inhibitorio de los taninos del frijol carioca (Phaseolus vulgaris L.) sobre la digestibilidad de la faseolina por dos sistemas multienzimáticos

    OpenAIRE

    Del Pino,Victoria H.; Lajolo,Franco M.

    2003-01-01

    Cantidades variables de dos sistemas multienzimáticos de tripsina-quimotripsina-peptidasa y pepsina-pancreatina, fueron utilizados para evaluar el efecto de los taninos provenientes de frijol Carioca (Phaseolus vulgaris L.) sobre la digestibilidad de la faseolina, en las formas nativa y denaturalizada. Esta evaluación hecha por los métodos de caida de pH, de hidrólisis en medio tamponado con posterior medición del grado de hidrólisis con ninhidrina y por la técnica electroforética, demostró e...

  13. Respuesta fotosintética de algunas variedades de maíz, frijol y café

    Directory of Open Access Journals (Sweden)

    Anundo Polanía

    2009-06-01

    Full Text Available Con el objeto de caracterizar fotosintéticamente algunas variedades de maíz, frijol y café, se estudió el comportamiento de la rata de fotosíntesis neta, de la transpiración y de los diferentes tipos de resistencia foliar a ia difusión y fijación de CO2 en la hoja, frente a las variables temperatura, intensidad de luz y concentración de CO2 en el aire. La variedad de maíz ICA H 507 presentó un comportamiento típico de plantas C 4 con altas ratas de fotosíntesis neta, insaturación de luz y baja fotorespiración. El fríjol Dlacol Andino presentó bajas ratas de fotosíntesis, alta fotorespiración y saturación de luz a bajas Intensidades, características propias de plantas C3. Las dos varíedades de café, Típica y Caturra, presentaron bajas ratas de fotosíntesis, valores de fotorespiración cercanos a los del fríjol, comportamiento típico de plantas C3; no lo es su respuesta a la intensidad de luz, ya que se saturaron a intensidades más altas que las presentadas por plantas C3 reconocidas. Estas varíedades presentaron ratas de fotosíntesis mayores que las observadas por otros autores en plantas de café de más edad. Los resultados obtenidos brindan información útil acerca del comportamiento ecoflslológico de

  14. Estudio de la fitohemaglutinina proveniente del frijol colorado (Phaseolus Vulgaris Study of phytohemagglutinin from red bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Patricia Hernández Díaz

    1999-12-01

    Full Text Available Se obtuvieron preparaciones crudas de fitohemaglutinina (PHA a partir de frijol colorado (Phaseolus vulgaris por 2 métodos: extracción acuosa y extracción ácida. Por el método ácido se obtuvieron mejores resultados en cuanto a concentración de proteínas y pureza de la misma. Se empleó la cromatografía en hidroxiapatita para separar las isoformas que forman la PHA y se obtuvieron 5 fraccciones proteicas que se evaluaron funcionalmente junto con las preparaciones crudas, a través de sus propiedades eritroaglutinantes y leucoaglutinantes. A medida que se aumentó la fuerza iónica del medio se observó que las fracciones obtenidas presentaban una disminución relativa de la actividad leucoaglutinante, así como un incremento relativo de la actividad eritroaglutinante. Las preparaciones crudas y las fracciones se evaluaron electroforéticamente y se obtuvieron bandas muy similares a la de la PHA patrón utilizadaRaw preparations of phytohemagglutinin (PHA were obtained from red bean (Phaseolus vulgaris by 2 methods: aqueous extraction and acid extraction. Better results were obtained with the acid methods as regards the protein concentration and its purity. Hydroxyapatite chromatography was used to separate the isoforms forming the phytohemagglutinin. 5 protein fractions were obtained and functionally evaluated together with the raw preparations through their erythroagglutinating and leukoagglutinating properties. As the ionic force of the medium increased it was observed that the fractions obtained presented a relative decrease of the leukoagglutinating activity as well as a relative rise of the crythroagglutinating activity. The raw preparations and the fractions were electrophoretically evaluated and bands very similar to that of the PHA used as a pattern were obtained

  15. RENDIMIENTO, CALIDAD NUTRIMENTAL Y RENTABILIDAD DEL FRIJOL EJOTERO DE TEMPORAL EN SAN PABLO IXAYOC, MÉXICO

    Directory of Open Access Journals (Sweden)

    Nicolás Salinas-Ramírez

    2013-01-01

    Full Text Available Una de las estrategias para elevar el rendimiento y la calidad nutricional en las regiones agrícolas es la búsqueda de cultivares con mayor adaptación a diferentes condiciones ambientales. El objetivo de este estudio fue caracterizar cultivares de frijol ejotero con base en su fenología, crecimiento, rendimiento, calidad nutricional y rentabilidad, en clima templado y condiciones de secano. Tres variedades de hábito de crecimiento determinado, ‘Opus’, ‘Strike’ y ‘Black Valentine’, y una de crecimiento indeterminado, ‘Hav-14’, fueron sembradas el 7 de mayo de 2008 en San Pablo Ixayoc, Estado de México, con densidad de 6.25 plantas·m -2 . Se encontraron diferencias en el ciclo biológico desde 90 a 199 días al último corte, así como en rendimiento y número de ejotes. Estas diferencias se relacionaron en mayor grado con la precipitación acumulada (PP, r = 0.83**, la evapotranspiración total del cultivo (ETc, r = 0.71* y unidades térmicas acumu - ladas (UC, r = 0.65*. La variedad Opus mostró el mayor porcentaje de minerales, fósforo, FDA, lignina, FDN y proteína. El ingreso neto más alto se obtuvo con ‘Opus’ y ‘Black Valentine’. No obstante, en un periodo de cinco años (vida media de la espaldera ‘Hav-14’ ofrece mayor ventaja desde el punto de vista económico. Estos resultados sugieren que ‘Hav-14’, ‘Opus’ y ‘Black Valentine’ serían los cultivares más apropiados para lograr mayor producción bajo condiciones de lluvia estacional en el clima templado de San Pablo Ixayoc.

  16. Rendimiento de dos variedades mejoradas de frijol, sembrados al voleo y al espeque, en Moss Pam, Waspam, rio Coco

    Directory of Open Access Journals (Sweden)

    Sankara Narvaez Ismael

    2012-10-01

    Full Text Available           Este articulo presenta el comportamiento agronómico del frijol (Phaseolus vulgaris L. en dos variedades:(DOR-364 y H-46, establecidos a través del análisis de dos métodos de siembra (al voleo y al espeque,  para medir la variable rendimiento. El experimento se realizó en la finca académica SNAKY/URACCAN, ubicada en la comunidad Moss Pam, en el municipio de Waspam río Coco, Región Autónoma Atlántico Norte (RAAN. El cultivo de frijol es de gran relevancia en la vida de las comunidades indígenas, ya que constituye al igual que el arroz, el grano de mayor importancia en la dieta familiar. Es de mencionar que las comunidades indígenas de la RAAN utilizan básicamente dos métodos de siembra (al voleo y al espeque; no obstante, siempre los rendimientos son bajos, por lo que se hace necesario el estudio con las condiciones descritas.    Se utilizó un diseño bifactorial en bloques completos al azar, en donde el factor A: equivale a las dos variedades de frijol (DOR-364 y H-46, y el factor B: dos métodos de siembra (al voleo y al espeque. La evaluación se hizo sobre las características morfométricas presentadas en la fase vegetativa y reproductiva del cultivo. El procesamiento de la información se hizo con el programa estadístico InfoStat, indagando desde el análisis del ANAVA y la prueba Kruskal-Wallis. Los resultados mostraron una alta viabilidad germinativa (95%, con diferencias estadísticas entre tratamientos en las variables altura y diámetro en la etapa vegetativa. En la etapa reproductiva las variables: número de vainas/plantas y granos/vainas/plantas, fueron las que presentaron diferencias estadísticas entre tratamientos, contrario a las variables número de flores/plantas y longitud de vainas/plantas que no mostraron diferencias. Finalmente el ANAVA con un 95 por ciento de confiabilidad encontró diferencias de medias en la variable rendimiento.Se recomienda el establecimiento de la variedad H-46

  17. Efecto de un promotor del crecimiento activado molecularmente sobre la germinación y la producción de frijol (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Kolima Peña Calzada

    2015-09-01

    Full Text Available El objetivo de la investigación fue evaluar el efecto de un promotor del crecimiento activado molecularmente sobre la germinación y producción del cultivo de frijol (Phaseolus vulgaris L.. Se hicieron dos experimentos, uno in vitro con un diseño completamente aleatorizado y otro en campo con dos variantes y 8 réplicas (diseño de bloques al azar. El tratamiento en ambos ensayos fue inmersión de las semillas en una solución del promotor al 0,02% por 3 horas y otro grupo testigo con inmersión por igual tiempo en agua natural. Los resultados mostraron que la germinación y la altura de las plantas fueron mejores con la inmersión en el producto en ambos experimentos. En el ensayo de campo los vainas por planta no hubo diferencia entre los tratamientos. En los granos por vaina y granos por planta el grupo tratado fue superior al control en 16,70 y 15,22% respectivamente. La masa de 100 granos no mostró diferencia entre ambos tratamientos. El rendimiento agrícola fue superior en los tratados(1,22t.ha-1 vs. 1,02. Con ambos experimentos se determinó que el promotor del crecimiento influyó positivamente en la germinación, desarrollo y producción del cultivo del frijol.

  18. Estudio etnobotánico del frijol yepatlaxtle (Phaseolus coccineus L., en el área natural protegida Corredor Biológico Chichinautzin, Morelos, México

    Directory of Open Access Journals (Sweden)

    R. Monroy

    2010-01-01

    alimentación y la comercialización de excedentes y aporta ingresos económicos. En otras localidades de la entidad, aún se cultiva en parcelas pequeñas o en el traspatio. El conocimiento tradicional del manejo y uso del frijol es fundamental como alternativa para su conservación; por tanto, se planteó describir el proceso productivo hasta su comercialización y las formas tradicionales de consumo. El proceso productivo del yepataxtle, desde la siembra hasta la cosecha, se registró durante un ciclo agrícola en una parcela cuyo dueño lo explicó. La comercialización se documentó a través de entrevistas a comerciantes y compradores en el mercado municipal durante los días de selecplaza. Las formas de consumo se obtuvieron a través de entrevistas abiertas a las amas de casa que preparan platillos con el yepataxtle. El sistema milpa, cuando incluye yepataxtle, dura 240 días; cuando es solo, 120. Se explican las técnicas campesinas desde la cosmovisión de los informantes. El yepataxtle se comercializa directamente en el mercado, de febrero a mayo como ejote fresco, y en abril, como frijol seco. La información culinaria tradicional del yepataxtle se organizó en un recetario mediante un uso ceremonial para las fiestas patronales del pueblo.

  19. Channel and hillslope processes revisited in the Arroyo de los Frijoles watershed near Santa Fe, New Mexico

    Science.gov (United States)

    Gellis, Allen C.; Emmett, William W.; Leopold, Luna Bergere

    2005-01-01

    Detailed documentation of geomorphic changes in the landscape of more than a few years is rarely possible. Channel cross sections, channel profiles, sediment deposition behind dams, and hillslope-erosion plots, originally benchmarked within several watersheds outside Santa Fe, New Mexico, in the 1950’s and 1960’s, for a 1966 report that documented processes and rates of arid-region sediment production and deposition, were resurveyed in the mid-1990’s. Many of the original study sites were relocated and surveyed in the mid-1990’s to determine subsequent channel and hillslope changes and to determine whether trends of channel and hillslope aggradation and degradation that were evident in the 1950’s and 1960’s have continued. In general, the net change in channel geometry has been small over the last 30–40 years. The average change in cross-sectional area of 32 resurveyed cross sections was erosion of 0.27 square meter, which equates to a 4-percent increase in cross-sectional area. The average net change in thalweg elevation for 51 resurveyed cross sections was degradation of 0.04 meter. Unpublished data (1964–68) from the scour chains showed that 371 chains had an average scour of 0.14 ± 0.14 meter and that 372 chains showed an average fill of 0.13 + 0.11 meter. Scour, found in the original study (1958–64) to be proportional to the square root of discharge, was confirmed with the addition of unpublished data (1964–68). The observed channel changes have no consistent trend, compared either to results observed in the original 1966 study or to distance from the watershed divide. The conclusion drawn in the original study was that most channels were aggrading; the resurvey showed that aggradation did not continue.An increase in housing and population in the Arroyo de los Frijoles watershed since the 1950’s has led to more roads. Channel degradation is most noticeable at road crossings. The greatest degradation of the main channel Arroyo de los

  20. EFECTIVIDAD DE UN BIOFERTILIZANTE FOLIAR SOBRE EL CULTIVO DE FRIJOL COMÚN (PHASEOLUS VULGARIS, BLUEFIELDS, R.A.A.S.

    Directory of Open Access Journals (Sweden)

    Yader Mejía Bermúdez

    2012-01-01

    Full Text Available Este trabajo tuvo como propósito evaluar la efectividad de las diferentes dosis de un biofertilizante foliar sobre el rendimiento del cultivo de frijol común (Phaseolus vulgaris en época de postrera, en la comunidad El Cañal, Kukra River, Bluefields, en el ciclo productivo 2008-2009. Se utilizó un diseño completo al azar, cuatro tratamientos con dos repeticiones, cada repetición constó de 63 plantas de frijol (n=126. Los tratamientos fueron: T1 (testigo; T2: 0.25 litros de biofertilizante; T3: 0.37 lt. y T4: 0.5 lt. En todos los tratamientos, incluyendo al testigo, se hizo deshierbe y en todos, excepto el testigo, se aplicó el biofertilizante disuelto en 10 litros de agua. Se realizaron tres mediciones (21, 36 y 51 días después de la siembra.Los resultados indican que no existen diferencias significativas entre los tratamientos en la altura de las plantas, pero si en el porcentaje de afectación por herbívoros, así como en el número de vainas por planta y de granos por vaina. El tratamiento T4 registró el menor ataque por herbívoros, la mayor producción en función del número de vainas por planta, de granos por vaina y peso total de los granos de frijol, en cambio el testigo fue el que registró el menor rendimiento con respecto a todas estas variables. El uso del biofertilizante foliar aumentó el rendimiento del cultivo de frijol en todas las dosis.SummaryThe aim of this work was to evaluate the effectiveness of different doses of a foliar biofertilizer on crop production of common bean (Phaseolus vulgaris throughout season time in the community of El Cañal, Kukra River, Bluefields, during the production cycle 2008-2009. A random design was used, four treatments with two replications, each replication consisted of 63 bean plants (n=126. The treatments were: T1 (baton, T2: 0.25 liters of biofertilizer, T3: 0.37 lt. and T4: 0.5 lt.  In all the treatments, including the baton, weeding was done, and in all except the baton

  1. Efectos de la aplicación simultanea de Fitomas E y Biobras 16 en el cultivo del frijol (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Kolima Peña Calzada

    2015-09-01

    Full Text Available El objetivo fue evaluar el efecto de la aplicación simultánea de Fitomas E y Biobras 16 en el cultivo del frijol (Phaseolus vulgaris L.. Se utilizó un diseño de bloques al azar con dos tratamientos y ocho réplicas. Los tratamientos consistieron en la aplicación combinada de Fitomas E (2,0 l.ha-1 y Biobras 16 (0,12 l.ha-1 y una variante control. Las variables evaluadas fueron: altura de las plantas a los 25 y 40 días post siembra, vaina por planta, granos por vainas, granos por plantas, masa de 100 granos y rendimiento agrícola. Se observó en la altura de las plantas diferencias estadísticas significativas entre ambos tratamientos, superando la combinación de Fitomas E y Biobras 16 al tratamiento control, en un 19,43 % y un 17,73 % respectivamente. La variable vainas por planta también mostró diferencias significativas favorables al tratamiento con los bioestimulantes, no así el número de granos por vainas y la masa de 100 granos. El mayor rendimiento agrícola se obtuvo con la variante donde se aplicó Fitomas E y Biobras 16, el cual difirió significativamente del control. Se concluye que el comportamiento agroproductivo del cultivo del frijol (Phaseolus vulgaris L. se favoreció con el tratamiento evaluado.

  2. Efecto del encalado en la respuesta vegetal y fijación simbiótica del nitrógeno en frijol común

    Directory of Open Access Journals (Sweden)

    Aurelio Garc\\u00EDa

    2003-01-01

    Full Text Available En casa de cristales se evaluó mediante el método de valor A, utilizando el isótopo estable 15N, el efecto del encalado de un suelo Rhodic ferralsol sobre la fijación simbiótica de nitrógeno (FSN de los genotipos de frijol común (Phaseolus vulgaris L. BAT 58, BAT 477, DOR 364, CC 25-9 (N. La isolínea NN 125, genotipo de frijol no nodulante, fue utilizado como cultivo de referencia. El efecto del encalado incrementó la fracción de nitrógeno en planta derivado del aire, principalmente en CC 25-9 (N que posee muy poca capacidad de fijación de N atmosf érico cuando no se encala el suelo. Además, se encontró un efecto beneficioso del encalado sobre las reservas de N del suelo, visto que los incrementos de las extracciones totales de N por las plantas provienen del N del aire, e incluso, la cantidad de N en planta derivado del suelo disminuyó para todos los genotipos, principalmente en DOR 364 y CC 25-9(N. Por otra parte, la relación %Nddf/%Ndds, por ciento de N en planta derivado del fertilizante y por ciento de N en planta derivado del suelo respectivamente, varió debido a la aplicación de cal. Por consiguiente, es necesario utilizar dos tratamientos con el cultivo de referencia para evaluar acertadamente la FSN: cultivo de referencia con y sin suelo encalado. Se discute la interpretación del parámetro Eficiencia de Uso del N.

  3. Fuentes fosfóricas de diferente solubilidad para frijol común evaluadas por método isotópico

    Directory of Open Access Journals (Sweden)

    Aurelio Garc\\u00EDa Altunaga

    2005-01-01

    Full Text Available Se condujeronexperimentos en casa de cristales de la Estación ExperimentalLa Renée ubicada en la provincia Habana en el año 2003. Elobjetivo fue evaluar fuentes fosfóricas de diferente solubilidadpara frijol común (Phaseolus vulgarisL. utilizando dos sue-los, Acrisol y Ferralsol ródico, y la técnica de dilución isotópica con 32P. Las fuentes fosfóricas evaluadas fueron roca fosfórica (RF Trinidad de Guedes, RF parcialmente solubilizadaal 50 % con H2SO4(producto denominado comercialmenteFPA50 y superfosfato simple (SS en el Acrisol y superfosfato triple (SFT en el Ferralsol ródico. Los genotipos de frijol empleados en el Acrisol fueron BAT477, DOR 364, DOR390 y Censa, mientras que en el Ferralsol fueron BAT58, BAT477, DOR 364 y CC-25-9(N. Se evaluó producción de mate-ria seca y extracción de Py se determinó la fracción (% y cantidad de Pen planta derivado de los portadores y % de eficiencia de uso del fertilizante. La RF en aplicación directa fuepoco efectiva mientras que los superfosfatos y el FPA50 resultaron efectivos en ambos suelos. Hubo diferencia varietalen la respuesta vegetal y en la utilización del Pde las fuentes,que también dependió de las características del suelo.

  4. REACCIÓN DE VARIEDADES DE FRIJOL A LA INOCULACIÓN ARTIFICIAL DE Aphelenchoides besseyi, AGENTE CAUSAL DE LA FALSA MANCHA ANGULAR

    Directory of Open Access Journals (Sweden)

    Walter Barrantes-Santamar\\u00EDa

    2008-01-01

    Full Text Available Especímenes adultos y juveniles de A. besseyi provenientes de cultivo in vitro se inocularon sobre el follaje de plantas de frijol de las variedades Bribri, Huetar, Telire y Chirripó Rojo. Las edades de las plantas inoculadas en el invernadero fueron de diez, 20 y 30 días después de siembra (dds. Los bioensayos se realizaron en los invernaderos de la Escuela de Ciencias Agrarias de la Universidad Nacional, Heredia-Costa Rica en el 2006. El objetivo de esta investigación fue evaluar la reacción de variedades de frijol al nematodo A. besseyi. Las variedades estudiadas mostraron similar nivel de resistencia al ataque del nematodo, de acuerdo a la escala de severidad utilizada; sin embargo, las variedades Huetar y Bribri mostraron menor severidad de infección y población de nematodos que las otras dos variedades. Los primeros síntomas de la enfermedad se desarrollaron en las hojas primarias. El período de incubación fue más corto a medida que las inoculaciones se realizaron en plantas de mayor edad. Igualmente, las hojas maduras fueron más susceptibles que las jóvenes a la infección del nematodo. El desarrollo de la enfermedad difi rió entre hojas primarias y trifoliadas y dependió de la disponibilidad de tejido foliar, la madurez del follaje y la producción de inóculo secundario.

  5. The Vigna Genome Server, 'VigGS': A Genomic Knowledge Base of the Genus Vigna Based on High-Quality, Annotated Genome Sequence of the Azuki Bean, Vigna angularis (Willd.) Ohwi & Ohashi.

    Science.gov (United States)

    Sakai, Hiroaki; Naito, Ken; Takahashi, Yu; Sato, Toshiyuki; Yamamoto, Toshiya; Muto, Isamu; Itoh, Takeshi; Tomooka, Norihiko

    2016-01-01

    The genus Vigna includes legume crops such as cowpea, mungbean and azuki bean, as well as >100 wild species. A number of the wild species are highly tolerant to severe environmental conditions including high-salinity, acid or alkaline soil; drought; flooding; and pests and diseases. These features of the genus Vigna make it a good target for investigation of genetic diversity in adaptation to stressful environments; however, a lack of genomic information has hindered such research in this genus. Here, we present a genome database of the genus Vigna, Vigna Genome Server ('VigGS', http://viggs.dna.affrc.go.jp), based on the recently sequenced azuki bean genome, which incorporates annotated exon-intron structures, along with evidence for transcripts and proteins, visualized in GBrowse. VigGS also facilitates user construction of multiple alignments between azuki bean genes and those of six related dicot species. In addition, the database displays sequence polymorphisms between azuki bean and its wild relatives and enables users to design primer sequences targeting any variant site. VigGS offers a simple keyword search in addition to sequence similarity searches using BLAST and BLAT. To incorporate up to date genomic information, VigGS automatically receives newly deposited mRNA sequences of pre-set species from the public database once a week. Users can refer to not only gene structures mapped on the azuki bean genome on GBrowse but also relevant literature of the genes. VigGS will contribute to genomic research into plant biotic and abiotic stresses and to the future development of new stress-tolerant crops. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  6. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  7. Regeneration and genetic transformation of cowpea (Vigna unguiculata Walp.)

    International Nuclear Information System (INIS)

    Filippone, E.; Colucci, G.; Ciardi, F.; Monti, L.

    1997-01-01

    Regeneration of cowpea (Vigna unguiculata Walp.) was achieved through massive bud formation induced in apical and lateral meristems by the herbicide Thidiazuron (TDZ). The effect of TDZ (5, 10, or 20 μM) was tested in vitro on four different cowpea genotypes. Thidiazuron, even at the highest concentration, had no effect on seed germination. After one month of culture, multiple bud cluster formation was observed in all genotypes tested; about 80% of shoot apices regenerated multiple buds, whilst only 34% of cotyledonary nodes behaved in the same way. Histology of regenerating multiple bud clusters revealed that regeneration initiated from pre-existing meristems in the apex and cotyledonary node. Thidiazuron at 10 μM appeared to be the best concentration to produce clusters with high number of buds, ranging from 5 to 10. Shoot elongation occurred only on MS medium without TDZ. On the same medium, 75% of elongated shoots rooted. For genetic transformation of cowpea, a direct DNA transfer methods in plants under in vivo conditions was tested by electroporation of plasmid DNA into the nodal meristematic cells. Some transformed plants were obtained, and produced T 1 transformed progenies; their transgenic nature was confirmed by Southern analysis. (author). 21 refs, 2 figs, 3 tabs

  8. Regeneration and genetic transformation of cowpea (Vigna unguiculata Walp.)

    Energy Technology Data Exchange (ETDEWEB)

    Filippone, E; Colucci, G; Ciardi, F; Monti, L [Department of Agronomy and Plant Genetics, Univ. of Naples Federico 11, Portici (Italy)

    1997-07-01

    Regeneration of cowpea (Vigna unguiculata Walp.) was achieved through massive bud formation induced in apical and lateral meristems by the herbicide Thidiazuron (TDZ). The effect of TDZ (5, 10, or 20 {mu}M) was tested in vitro on four different cowpea genotypes. Thidiazuron, even at the highest concentration, had no effect on seed germination. After one month of culture, multiple bud cluster formation was observed in all genotypes tested; about 80% of shoot apices regenerated multiple buds, whilst only 34% of cotyledonary nodes behaved in the same way. Histology of regenerating multiple bud clusters revealed that regeneration initiated from pre-existing meristems in the apex and cotyledonary node. Thidiazuron at 10 {mu}M appeared to be the best concentration to produce clusters with high number of buds, ranging from 5 to 10. Shoot elongation occurred only on MS medium without TDZ. On the same medium, 75% of elongated shoots rooted. For genetic transformation of cowpea, a direct DNA transfer methods in plants under in vivo conditions was tested by electroporation of plasmid DNA into the nodal meristematic cells. Some transformed plants were obtained, and produced T{sub 1} transformed progenies; their transgenic nature was confirmed by Southern analysis. (author). 21 refs, 2 figs, 3 tabs.

  9. Adzuki beans (Vigna angularis seed quality under several drying conditions

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.

  10. Photoperiod regulation of development and growth in bambara groundnut (Vigna subterranea).

    NARCIS (Netherlands)

    Linnemann, A.R.; Westphal, E.; Wessel, M.

    1995-01-01

    The influence of constant photoperiods of 10, 12, 14 and 16 h on development and growth in two bambara groundnut genotypes (Vigna subterranea (L.) Verdc., syn. Voandzeia subterranea (L.) Thouars) was studied in a greenhouse experiment in the Netherlands. Data on dry matter accumulation were

  11. Aperçu de la culture du voandzou ( Vigna subterranea (L.) Verdcourt ...

    African Journals Online (AJOL)

    Aperçu de la culture du voandzou ( Vigna subterranea (L.) Verdcourt) au Burkina Faso: enjeux et perspectives d'amélioration de sa productivité. ... 2016 International Formulae Group. All rights reserved. ... The favorite variety is the cream-colored white hilum for its organoleptic, agronomic and aesthetic qualities. Lack of ...

  12. Recent advances in cowpea [ Vigna unguiculata (L.) Walp.] “omics ...

    African Journals Online (AJOL)

    After decades of research on cowpea, significant amount of omics datasets are available and useful in understanding the genetic relationship between Vigna unguiculata ssp. unguiculata and other species belonging to the same genus as well as its genetic variation. Besides, the development of genetic map allowed the ...

  13. Potential biochemical markers for selection of disease resistance in Vigna radiata

    International Nuclear Information System (INIS)

    Badere, R.S.; Koche, D.K.; Choudhary, A.D.; Pawar, S.E.

    2001-01-01

    The Vigna radiata (L.) Wilczek (Green gram), a major pulse crop is prone to damaging diseases caused by Erysiphe polygoni, Cercospora canescens and Rhizoctonia sp. Therefore, the development of multiple resistance is a major breeding objective in green gram. Resistance to powdery mildew has already been developed, however, there are no reports on the development of resistance to Cercospora in green gram. Owing to limitation of conventional screening methods, the improvement for multiple disease resistance is inadequate, in this crop. It needs an efficient and quick selection method, for screening the plant population at an early stage. It is well established that the resistant interaction, in plants, involves accumulation of antibiotic compound phytoalexin (Genestein in Vigna radiata) and induction of enzymes such as β-1,3 gulcanase and Chitinases. These compounds are not only induced by pathogens but also pathogen-derived elicitors. These biochemical compounds can be used as resistance indicative biochemical markers for screening the natural or mutagen induced genetic diversity in populations of Vigna radiata in non-destructive manner. It, however, needs a systematic study of plant defense response. This paper deals with the response of resistant and susceptible cultivars of vigna radiata to Cercospora elicitor and development of non-destructive selection method for disease resistance. (author)

  14. Analysis of radiation-induced genome alterations in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    van der Vyver C

    2011-09-01

    Full Text Available Christell van der Vyver1, B Juan Vorster2, Karl J Kunert3, Christopher A Cullis41Institute for Plant Biotechnology, Department of Genetics, University of Stellenbosch, Stellenbosch, South Africa; 2Department of Plant Production and Soil Science, and 3Department of Plant Science, Forestry and Agricultural Biotechnology Institute, University of Pretoria, Pretoria, South Africa; 4Case Western Reserve University, Department of Biology, Cleveland, OH, USAAbstract: Seeds from an inbred Vigna unguiculata (cowpea cultivar were gamma-irradiated with a dose of 180 Gy in order to identify and characterize possible mutations. Three techniques, ie, random amplified polymorphic DNA, microsatellites, and representational difference analysis, were used to characterize possible DNA variation among the mutants and nonirradiated control plants both immediately after irradiation and in subsequent generations. A large portion of putative radiation-induced genome changes had significant similarities to chloroplast sequences. The frequency of mutation at three of these isolated polymorphic regions with chloroplast similarity was further determined by polymerase chain reaction screening using a large number of individual parental, M1, and M2 plants. Analysis of these sequences indicated that the rate at which various regions of the genome is mutated in irradiation experiments differs significantly and also that mutations have variable “repair” rates. Furthermore, regions of the nuclear DNA derived from the chloroplast genome are highly susceptible to modification by radiation treatment. Overall, data have provided detailed information on the effects of gamma irradiation on the cowpea genome and about the ability of the plant to repair these genome changes in subsequent plant generations.Keywords: mutation breeding, gamma radiation, genetic mutations, cowpea, representational difference analysis

  15. Compuestos nitrogenados indicadores de estrés en respuesta a las dosis tóxicas y deficientes de Nitrógeno en frijol ejotero

    Directory of Open Access Journals (Sweden)

    Esteban Sánchez

    2016-01-01

    Full Text Available Introducción: Un amplio rango de estreses ambientales, tales como baja temperatura, sequía, alcalinidad, salinidad, deficiencia y toxicidad de nutrientes son potencialmente dañinos para las plantas. El papel del nitrógeno como nutriente esencial y componente estructural de aminoácidos, proteínas, ácidos nucleicos y otros constituyentes esenciales para el desarrollo ha sido ampliamente documentado en varias especies debido a la importancia en los procesos de crecimiento y producción agrícola. Sin embargo, en la actualidad, existe escasa literatura del efecto de la deficiencia y toxicidad de nitrógeno sobre los compuestos osmoreguladores como indicadores de estrés en plantas. Por lo que el objetivo del presente trabajo fue estudiar los compuestos nitrogenados indicadores de estrés (prolina, glicinabetaina y colina en respuesta a las dosis tóxicas y deficientes de N en frijol ejotero desarrollado en cámara de cultivo bajo condiciones controladas y sistema hidropónico. Método: El nitrógeno fue aplicado a la solución nutritiva en la forma de NH4NO3 y en dosis crecientes: N1 = 1.5 mM, N2 = 3.0 mM, N3 = 6.0 mM, N4 = 12.0 mM, N5 = 18.0 mM y N6 = 24.0 mM de N. Los parámetros analizados fueron la acumulación de biomasa, la concentración de prolina, glicinabetaina y colina en hojas, raíces, semillas y vainas de frijol ejotero cv. Strike. Resultados: La aplicación de dosis deficientes y tóxicas de N afectó la producción de biomasa en frijol, siendo las dosis tóxicas las que afectaron más este parámetro. Por otro lado, resaltar que los osmoreguladores prolina, glicinabetaina y colina solamente se acumularon bajo condiciones de toxicidad de N (N6, sin embargo, en condiciones de estrés provocado por la deficiencia de N (N1 no se produce la acumulación de estos compuestos. Discusión o Conclusión: Los compuestos nitrogenados indicadores de estrés solamente se acumulan bajo condiciones de toxicidad de N (N6, sin embargo en

  16. Infectivity analysis of two variable DNA B components of Mungbean ...

    Indian Academy of Sciences (India)

    Unknown

    of Mungbean yellow mosaic virus-Vigna in Vigna mungo and Vigna radiata; J. Biosci. 29 297–308]. 1. Introduction. Yellow mosaic disease (YMD), which affects five impor- tant pulse crops, blackgram, mungbean, French bean, pigeon pea and soybean, causes an annual yield loss of about. $ 300 million (Varma et al 1992).

  17. Effect of gamma radiation of {sup 60}Co in the variability of chinese bean [Vigna unguiculata (l.) Walpers] en R{sub 4}M{sub 4}; Efecto de la radiacion gamma de {sup 60}Co en la variabilidad de frijol chino [Vigna unguiculata (l.) Walpers] en R{sub 4}M{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F. [CSAEGro, Iguala, Guerrero, Tel and Fax 01 733 (33) 24328 (Mexico); Cervantes S, T. [IREGEP (Mexico); Cruz T, E. De la [ININ, Departamento de Biologia, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail: csaegro@prodigy.net.mx

    2007-07-01

    Selection of plants of Chinese bean coming from seed irradiated with gammas of {sup 60}Co in the generation R{sub 4}M{sub 4} (fourth recurrent irradiation, fourth segregate generation) were carried out, taking as selection approaches the plant architecture, the numbers of sheaths for plant, sheath longitude, position of the sheaths, grain size and resistance to plagues and illnesses. 17 lines were selected for grain and 3 lines with fodder characteristics of black grain color were also obtained. (Author)

  18. COMPARACIÓN DE LOS COMPONENTES DEL RENDIMIENTO EN VARIEDADES DE FRIJOL EN CONDICIONES DE ACIDEZ Y HUMEDAD RESIDUAL DEL SUELO EN EL SUR DE VERACRUZ

    Directory of Open Access Journals (Sweden)

    Aurelio Morales Rivera

    2015-10-01

    Full Text Available El frijol negro (Phaseolus vulgaris L. se cultiva en suelos ácidos (pH<5 con humedad residual en el sur del estado de Veracruz, México. El cultivo se realiza en unas 6600 ha al final de la temporada de lluvias a mediados de septiembre o principios de octubre. La humedad residual, aunado a la acidez del suelo frecuentemente afectan el periodo de formación de la semilla, reduciendo el rendimiento. El presente trabajo tuvo como objetivo caracterizar variedades de frijol de tipo III en cuanto a su rendimiento de semilla y sus componentes, cultivadas bajo restricciones de humedad residual y acidez del suelo, y altas temperaturas en el ciclo otoño-invierno 2012-2013, en el Municipio de Juan Rodríguez Clara, Veracruz. Se emplearon seis variedades de testa de color negro, seis del tipo ‘Flor de Mayo’ y una del tipo ‘Flor de Junio’. El diseño experimental fue de bloques completos al azar con cuatro repeticiones. La unidad experimental se constituyó de cinco surcos de 5 m de longitud y 0.8 m de separación. Se fertilizó con una dosis de 40-40-00. Las variedades “Negro Veracruz”, “San Andrés”, “Negro Cotaxtla” y “Flor de Junio Marcela”, exhibieron mayor rendimiento de semilla, vainas por m2 y peso de 200 semillas, altura de planta y menor biomasa aérea final que las demás. El mayor rango de variabilidad genética entre las variedades se observó para la biomasa aérea final y altura de planta. La respuesta en rendimiento y sus componentes sugiere que algunas variedades de testa negra han desarrollado mecanismos de tolerancia a la acidez, restricción de humedad residual del suelo y altas temperaturas durante la floración y formación de la semilla, que les permiten producir altos rendimientos a pesar de estar sometidas a estrés ambiental. La variedad de Valles Altos (“Flor de Junio Marcela”, también mostró que podría tener buena adaptación a estas condiciones.

  19. Diversidad de razas de colletotrichum lindemuthianum en Antioquía y evaluación de germoplasma de frijol crema-rojo por resistencia a antracnosis

    Directory of Open Access Journals (Sweden)

    Gloria E. Santana

    2002-01-01

    Full Text Available Para verificar si la composición de razas en el Oriente de Antioquía se caracterizaron 15 aislamientos de C. lindemuthianum, usando 12 variedades diferenciales de frijol aceptadas internacionalmente. Se identificaron 11 razas, seis de las cuales (9, 131, 135, 139, 643, y 645 fueron caracterizadas por primera vez. Además, se evaluaron 49 genotipos procedentes de los bancos de germoplasma del CIAT y CORPOICA y cultivares de agricultor de municipios productores. Los genotipos fueron evaluados en campo y en invernadero con las razas más virulentas del patógeno (651 y 653 encontradas en Antioquía. Sólo cuatro genotipos (AND1084, SUG130, LAS106 y DiacolCatio mostraron resistencia a ambas razas. Estos genotipos podrían usarse como parentales para un plan de cruzas, con el fin de introducir genes de resistencia a variedades de importancia comercial que presenten susceptibilidad a la antracnosis.

  20. Efecto de la labranza mínima y la convencional en frijol (phaseolus vulgaris l. En la región Huetar norte de Costa Rica

    Directory of Open Access Journals (Sweden)

    Luis Antonio Rojas

    2002-01-01

    Full Text Available Se realizó un trabajo en la Región Huetar Norte de Costa Rica en donde se establecieron dos lotes: uno de labranza mínima (1,85 ha y otro de labranza convencional (2 ha. La siembra en ambos sistemas de labranza se realizó con una sembradora abonadora hidraúlica. La variedad sembrada fue la Brunca. La población de plantas de frijol evaluada durante la etapa vegetativa fue de 9,37 plantas/m lineal en labranza mínima, y de 9,55 plantas/m lineal en labranza convencional. La densidad de malezas fue mayor en labranza convencional y las malezas de mayor dominancia fueron Ri- chardia scabra, Rottboellia cochinchinensis y Spermacoce sp. El peso seco de malezas fue de 37,6 g de malezas/ cuadrí- cula de 0,25 m2 en labranza mínima, mientras que en el sistema de labranza convencional fue de 46,4 g de malezas/ cuadr ícula. La incidencia y severidad de mustia hilachosa (Tanatheporus cucumeris en el sistema de labranza mínima fue de un 42,8% y de 0,83, respectivamente, mientras que en labranza convencional fue de un 52,2% y 1,22, respectivamente. En el sistema de labranza mínima el rendimiento fue de 930 kg/ha, y en labranza convencional de 676 kg/ha.

  1. (Helianthus annuus L.-frijol (Phaseolus vulgaris L. en función del nitrógeno y fósforo

    Directory of Open Access Journals (Sweden)

    Edgar J. Morales Rosales

    2007-01-01

    Full Text Available En 2003 se realizó un estudio en Montecillo, Estado de México, para determinar el efecto de la aplicación de nitrógeno (0, 40 y 80 kg ha–1 y fósforo (0, 30 y 60 kg P2O5 ha–1 en la siembra combinada de girasol (cv. Victoria y frijol (cv. Michoacán. Con el suministro de 80 kg N ha–1 (80 – 00 – 00 se incrementó la producción de biomasa y rendimiento de semilla superando al testigo sin fertilizante en 32% y 35%. Cuando se adicionaron 60 kg P2O5 ha–1 (00 – 60 – 00 se obtuvo una producción de materia seca y rendimiento de semilla superior al testigo en 24 y 27%, respectivamente. Aunque la interacción nitrógeno x fósforo no fue significativa, existió una tendencia positiva a medida de que se incrementaron los niveles de nitrógeno y fósforo (80 – 60 – 00, alcanzando los máximos valores en la producción de biomasa (2667.9 g m–2 y rendimiento de semilla (644.6 g m–2, los cuales superaron en 49 y 50% al testigo sin fertilizante.

  2. Effect of gamma radiation on seed germination and seedling vigour in cowpea [Vigna unguiculata (L.) Walp.

    International Nuclear Information System (INIS)

    Thimmaiah, S.K.; Mahadevu, P; Srinivasappa, K.N.; Shankara, A.N.

    1998-01-01

    Cowpea [Vigna unguiculata (L.) Walp.) is regarded as hardy and one of the important tropical legumes. The plants respond differently to mutagenic treatments. Ionizing radiations affect a wide range of physiological and biochemical activities of plants. The purpose of this paper is to report the effect of gamma radiation on seed germination and seedling vigour of two important cowpea varieties viz., KBC-1 and TVX-994-02E in M 1 generation under laboratory conditions. (author)

  3. PENGARUH JENIS DAN DOSIS PUPUK BOKASHI TERHADAP PERTUMBUHAN DAN HASIL KACANG PANJANG (Vigna sinensis L.

    Directory of Open Access Journals (Sweden)

    Achmad Djunaedy

    2009-03-01

    Full Text Available The purpose of this Research to determine the effect of fertilizer type and dose of bokashi of growth and yield bean (Vigna sinensis L.. Results of research: 1 bokashi fertilizer and chicken manure effect on plant length and number of leaves at the age of 24 days after the plant, 2 dose of fertilizer bokashi or chicken manure is best for the total fruit weight per plant is 20 tons / ha.

  4. Genotypic Variation in Phosphorus Use Efficiency for Symbiotic Nitrogen Fixation in Voandzou (Vigna Subterranea)

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A.; Rabeharisoa, L. [Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Abdou, M. Malam [Laboratoire Banques de genes CERRA / KOLLO, Institut National de Recherche Agronomique du Niger (INRAN), Niamey (Niger); Masse, D. [Institut de Recherche pour le Developpement, UMR Eco and Sols, Montpellier, (France); Amenc, L.; Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier (France)

    2013-11-15

    Vigna subterranea, known as voandzou or Bambara groundnut as an African indigenous crop which is often neglected or under-used in African subsistence agriculture. Preliminary research and country perceptions have shown its agronomic and nutritional properties, in particular under atypical climates of arid and tropical areas, and in saline soils. There is a high potential to increase the production by optimizing symbiotic nitrogen fixation (SNF) through effective inoculation even in nitrate-rich environments. In this study, Vigna subterranea inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 was studied in order to assess the symbiotic fixation potential of different cultivars and landraces of Madagascar, Niger and Mali under low-P and sufficient-P conditions. Six voandzou cultivars inoculated with Bradyrhizobium sp. Vigna CB756, were grown under hydroaeroponic culture for 6 weeks supplied with four phosphorus levels of 15, 30, 75 and 250 {mu}mol plant{sup -1} week{sup -1} in order to establish the response curve of voandzou to P supply, and to induce P deficient and sufficient levels. In another experiment five tolerant cultivars with high SNF and five sensitive cultivars with low SNF were chosen after a preliminary screening of 54 voandzou genotypes, including 50 landraces from Madagascar, Niger and Mali supplied with 2 P levels as P deficient and P sufficient (30 and 75 {mu}mol plant{sup -1} week{sup -1} ) under hydroaeroponic conditions. Genotypic variation in SFN for the high phosphorus use efficiency (PUE) was observed among the 54 cultivars and landraces. Variability was especially related to the nodule and shoot biomass, nodule permeability, nodule respiration and gene phytase expression. Contrasting cultivars and landraces in terms of PUE for SNF were selected for further evaluation under field conditions. (author)

  5. De novo transcriptomic analysis of cowpea (Vigna unguiculata L. Walp.) for genic SSR marker development.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Liu, Xiaoyan; Hu, Liangliang; Wang, Suhua; Cheng, Xuzhen

    2017-07-11

    Cowpea [Vigna unguiculata (L.) Walp.] is one of the most important legumes in tropical and semi-arid regions. However, there is relatively little genomic information available for genetic research on and breeding of cowpea. The objectives of this study were to analyse the cowpea transcriptome and develop genic molecular markers for future genetic studies of this genus. Approximately 54 million high-quality cDNA sequence reads were obtained from cowpea based on Illumina paired-end sequencing technology and were de novo assembled to generate 47,899 unigenes with an N50 length of 1534 bp. Sequence similarity analysis revealed 36,289 unigenes (75.8%) with significant similarity to known proteins in the non-redundant (Nr) protein database, 23,471 unigenes (49.0%) with BLAST hits in the Swiss-Prot database, and 20,654 unigenes (43.1%) with high similarity in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Further analysis identified 5560 simple sequence repeats (SSRs) as potential genic molecular markers. Validating a random set of 500 SSR markers yielded 54 polymorphic markers among 32 cowpea accessions. This transcriptomic analysis of cowpea provided a valuable set of genomic data for characterizing genes with important agronomic traits in Vigna unguiculata and a new set of genic SSR markers for further genetic studies and breeding in cowpea and related Vigna species.

  6. Enhancing Growth of Vigna radiata in the Presence of Pseudomonas aeruginosa Biopolymer and Metarhizium anisopliae Spores

    Directory of Open Access Journals (Sweden)

    Bhagwan N. Rekadwad

    2016-01-01

    Full Text Available Exopolysaccharide producing Pseudomonas aeruginosa NCIM 2945 (PANCL belonging to gamma-proteobacterium and entomopathogenic fungus Metarhizium anisopliae MCC 1129 (MAMCC belonging to Ascomycota were studied for their morphological features biochemical characteristics and plant growth promotion ability. Optimum growth of PANCL was recorded after 24 h at temperature 30°C and pH 7.0. Gram-negative PANCL appeared as white in color, one mm size, circular, opaque, and nonconsistent elevated colonies with entire margin. It has utilized dextrose, fructose, maltose, and sorbitol as carbon source and produced acid in the medium. PANCL was sensitive to Polymyxin B (300 µgm/disc followed by Neomycin (30 µgm/disc, Gentamycin (10 µgm/disc, and Chloramphenicol (30 µgm/disc. PANCL has secreted extracellular lipase, amylase, protease, and exopolysaccharides (EPS. Another fungal strain MAMCC sporulated after 168 h at temperature 30°C and pH 7.0. MAMCC has septate-white mycelium and bears dirty green colored spores. Growth of MAMCC was enhanced in the presence of Neem and Karela-Amla oil (0.1 mL each. Extracellular polysaccharide produced by PANCL and spores of MAMCC promoted growth of dicotyledon Vigna radiata (Mung individually as well as in consortium. Considerable increase in dry weight of Vigna radiata was recorded. Thus, reported PANCL and MAMCC strains have promoted growth Vigna radiata and may be a solution for sustainable agriculture.

  7. Efecto inhibitorio de los taninos del frijol carioca (Phaseolus vulgaris L.) sobre la digestibilidad de la faseolina por dos sistemas multienzimáticos Inhibitory effect of carioca bean tannins on phaseolin digestibility assessed by two multi-enzymatic systems

    OpenAIRE

    Victoria H. Del Pino; Franco M. Lajolo

    2003-01-01

    Cantidades variables de dos sistemas multienzimáticos de tripsina-quimotripsina-peptidasa y pepsina-pancreatina, fueron utilizados para evaluar el efecto de los taninos provenientes de frijol Carioca (Phaseolus vulgaris L.) sobre la digestibilidad de la faseolina, en las formas nativa y denaturalizada. Esta evaluación hecha por los métodos de caida de pH, de hidrólisis en medio tamponado con posterior medición del grado de hidrólisis con ninhidrina y por la técnica electroforética, demostró e...

  8. A stakeless yard long bean cultivar derived from an interspecific cross between cowpea Vigna unguiculata L. (Walp) and yard long bean Vigna sesquipedalis L. (Verdc.)

    International Nuclear Information System (INIS)

    Luadthong, Sanit

    1990-01-01

    Full text: 'Yard long bean' is an important vegetable in the Thai diet, particularly in Northeast Thailand. However, growing 'yard long beans' requires stakes for supporting the twining stems and keeping the pod from touching the ground. Staking costs money, takes time and needs labour. An ideal cultivar would be a 'yard long bean' with erect plant type and under 80 cm in height that produces typical long bean pods and allows convenient picking during the harvest time. An attempt to breed such a cultivar was made by crossing cowpea Vigna unguiculata L. (Walp.) with' yard long bean' Vigna sesquipedalis L. (Verdc.) in 1984. This resulted in a new cultivar 'KKU 25'. This cultivar, having erect plant type, requires no staking for supporting the stem and produces long fresh pods with acceptable taste which can be harvested within 43 days. The average pod length is 48 cm, and pod diameter 1.43 cm. In a preliminary yield trial, an average fresh pod yield of 16 t/ha was obtained. (author)

  9. Ouro Verde MG 2: nova cultivar de mungo-verde para Minas Gerais Ouro Verde MG 2: new mungbean cultivar for Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Rogério F. Vieira

    2002-03-01

    Full Text Available Dentre várias linhagens introduzidas do "Asian Vegetable Research and Development Center" (AVRDC, sobressaiu a linhagem VC 3984-B-2-B-4-1-B, que recebeu o nome de Ouro Verde MG 2. Suas sementes são verde-brilhantes e o peso de 1000 unidades varia de 43 a 51 g. O início da floração ocorre em torno de 33 dias após a emergência e a primeira vagem madura surge entre 23 e 33 dias. Por se tratar de espécie de maturação desuniforme, podem ser necessárias duas a quatro colheitas. As plantas podem atingir 95 cm de altura. As vagens são marrom-escuras e concentram-se na parte superior da planta. É suscetível a duas doenças que geralmente aparecem no final do ciclo de vida do mungo-verde: míldio-pulverulento (Erysiphe polygoni e mancha-foliar-de-cercospora (Cercospora canescens. A 'Ouro Verde MG 2' é resistente ao acamamento, e o seu rendimento, em três ensaios instalados em dezembro, janeiro e fevereiro, variou de 1,5 a 2,0 t/ha. Esses rendimentos foram, em média, 12% superior ao da cultivar Ouro Verde.Among many accessions introduced from Asian Vegetable Research and Development Center (AVRDC, the VC 3984-B-2-B-4-1-B stood out and was named 'Ouro Verde MG 2'. The seeds are bright green and 1000-seed weight ranges from 43 to 51 g. Flowering starts approximately 33 days after emergence and the first pod ripens between 23 and 33 days later. As mungbean is a non-uniform maturation species, two to four harvests could be necessary. The plant can reach 95 cm high. The pods are dark brown and concentrated in the upper canopy. This cv. is susceptible to two diseases which generally appear late in the crop: powdery mildew (Erysiphe polygoni and cercospora leaf spot (Cercospora canescens. 'Ouro Verde MG 2' is resistant to lodging. The yield measured in three experiments carried out in December, January, and February, ranged from 1.5 to 2.0 t/ha. In average, these yields were 12% superior than the achieved by the cultivar 'Ouro Verde'.

  10. Prácticas de conservación de suelos en sistemas de cultivo maíz-frijol en Cuba

    Directory of Open Access Journals (Sweden)

    Alfonso Claro A.

    2000-01-01

    Full Text Available Se realizaron dos ensayos en segmentos de microcuencas en condiciones de producción de la Provincia de Pinar del Río: uno en Campo Hermoso y el otro en La Comunidad La Leña, Cuba. En ambas localidades se rotó el frijol variedad Bat 304 y Tomeguin 93, seguidos de maíz asociado con Mucuna deeringianum y se establecieron bordes de desagüe protegidos con barreras vivas de Leucaena leucocephala y Gliricidia sepium. Las pérdidas de suelos se estimaron en piscinas de sedimentación y limnígrafos Valday en Campo Hermoso y en el caso de La Leña sólo se determinaron las variaciones de la pendiente y el espesor máximo de sedimentos (EMS al final de cada ciclo. El suelo fue un Ferralítico Cuarcítico (Ultisol, la fertilización se realizó de acuerdo a sus reservas, la preparación y labores culturales con tracción animal. Los resultados al cabo de cinco años mostraron una reducción en las pérdidas de suelos por debajo del umbral permisible (5 t/ha, aumento de la altura de las terrazas debido a los sedimentos acumulados, mayor disponibilidad de agua en la sección receptora, mayor cobertura en el período lluvioso, disminución del efecto erosivo de la lluvia, reciclaje de nutrimentos a través de los abonos verdes e incremento de los rendimientos respecto a las áreas donde no se realizaron prácticas de manejo. Se concluyó que el manejo integrado de los diferentes factores en laderas con pendientes mayores de 5%, es necesario para la conservación de suelos y agua

  11. Adaptación del frijol a suelos de baja fertilidad bajo presión de enfermedades foliares en Costa Rica

    Directory of Open Access Journals (Sweden)

    Rodolfo Araya

    2000-01-01

    Full Text Available El objetivo de este estudio fue identificar germoplasma y líneas mejoradas de alta productividad, en suelos de baja fertilidad y bajo presión de antracnosis y mancha angular. Durante 1996 y 1997 se evaluaron fuentes de tolerancia a la baja fertilidad de diversa procedencia geográfica y con resistencia para otros factores bióticos y abióticos. Se caracterizaron 562 genotipos, 251 mejorados y 311 criollos, en dos localidades de Costa Rica: Fraijanes (1750 msnm; 15,3 °C; 3025 mm; 10º09’ Latitud norte y 84°12’ Longitud oeste y Alajuela (840 msnm, 23,1 °C; 1966 mm; 10°01’ Latitud norte y 84° 16’ Longitud oeste. La densidad de siembra fue de 15 semillas por metro lineal y el tamaño de parcela varió con base en la disponibilidad de semilla; a la siembra sólo se adicionó inoculante de Rhizobium tropici al surco de siembra (4 kg/ha. La línea A321, el testigo local UCR 55, A483, G11640; G19696, G10843 y BAC50 mostraron alto rendimiento en las dos localidades. Los genotipos de alto rendimiento en una localidad fueron: en Alajuela: Guanajuato 132, Negro INIFAP, VAX 2, MAR 3 y en Fraijanes G13860, G92, MOC112, Bayo Alteño, J 117; Negro 8025 y A 247. Se identificó germoplasma no mejorado de diferente acervo genético, procedente de México, Perú y Guatemala, con tolerancia a suelos de baja fertilidad. Esto indica la importancia de evaluar material criollo y del intercambio de germoplasma entre países. Los genotipos superiores serán utilizados en el mejoramiento del frijol común para agricultura de bajo uso de insumos

  12. Avances en la selección de fuentes de resistencia a las principales enfermedades del frijol común (Phaseolus vulgaris L. en Costa Rica

    Directory of Open Access Journals (Sweden)

    Carlos M. Araya

    2000-01-01

    Full Text Available En esta investigación se evaluaron diversos genotipos de frijol en la búsqueda de fuentes de resistencia a la antracnosis (Colletotrichum lindemuthianum y a la mancha angular (Phaeoisariopsis griseola. Se evaluó germoplasma del programa nacional de hibridaciones y de tres viveros internacionales distribuidos por el CIAT: VIFURE, VIPADOGEN y CORE COLLECTION. Los ensayos se establecieron en Puriscal (1017 msnm, Alajuela (814 msnm y Fraijanes (1650 msnm, durante los ciclos agrícolas 97-98 y 98-99. Los materiales se sembraron en parcelas de un surco de dos a seis metros de largo con una o dos repeticiones y manejo con mínimos insumos. Se evaluó la reacción a la infección natural por antracnosis y mancha angular a las seis y ocho semanas después de la siembra, con base en la escala de severidad de uno a nueve. Se seleccionaron materiales con reacción de uno hasta grado tres para antracnosis y de uno hasta grado cuatro para mancha angular. Del grupo de materiales provenientes del programa de hibridaciones se seleccionaron nueve líneas por su resistencia a ambos patógenos. Posteriormente, sólo cinco mostraron resistencia específica a antracnosis y dos a mancha angular. De los viveros distribuidos por el CIAT, el VIPADOGEN aportó dos líneas que mostraron resistencia combinada a las dos enfermedades, mientras que 25 fueron resistentes exclusivamente a antracnosis, además de mostrar tolerancia a baja fertilidad o a sequía. Del vivero CORE COLLECTION, sólo 26 líneas mostraron resistencia combinada; 82 líneas fueron resistentes a antracnosis y 12 a mancha angular. Las mejores fuentes de resistencia a antracnosis y mancha angular estarán disponibles en un vivero internacional

  13. Efecto inhibitorio de los taninos del frijol carioca (Phaseolus vulgaris L. sobre la digestibilidad de la faseolina por dos sistemas multienzimáticos

    Directory of Open Access Journals (Sweden)

    Del Pino Victoria H.

    2003-01-01

    Full Text Available Cantidades variables de dos sistemas multienzimáticos de tripsina-quimotripsina-peptidasa y pepsina-pancreatina, fueron utilizados para evaluar el efecto de los taninos provenientes de frijol Carioca (Phaseolus vulgaris L. sobre la digestibilidad de la faseolina, en las formas nativa y denaturalizada. Esta evaluación hecha por los métodos de caida de pH, de hidrólisis en medio tamponado con posterior medición del grado de hidrólisis con ninhidrina y por la técnica electroforética, demostró el efecto adverso de los taninos condensados sobre la digestibilidad de la faseolina, después de producirse una significativa inhibición en el grado de hidrólisis de esa proteína por los dos sistemas multienzimáticos. Se comprobó la dificultad de hidrólisis de la faseolina cuando esta unida al tanino en el punto de saturación (proporción 5/20 tanino/proteína p/p y mayores, después de detectarse en los perfiles electroforéticos, péptidos de 45.7 y 24KDa, resistentes a la hidrólisis hasta por prolongados períodos de incubación. Esto se debió a la existencia de un complejo de naturaleza refractária no digeríble, incluso en condiciones excesivas de enzima. Los resultados sugieren la unión simultánea del tanino con mas de un ligante a través de sus múltiples grupos hidróxilos libres, formando un complejo proteína-tanino-enzima (PTE* que correspondería a la fracción no digeríble de la faseolina.

  14. Métodos para avaliação da qualidade fisiológica de sementes de feijão vigna Methods for evaluation of physiological quality of vigna bean seeds

    Directory of Open Access Journals (Sweden)

    Antonieta Laurinda Francisco Bias

    1999-07-01

    Full Text Available Visando comparar diferentes testes de vigor quanto à avaliação da qualidade fisiológica, quatro lotes de sementes de feijão vigna (Vigna unguiculata W. de duas cultivares ('EPACE-10' e 'IPA-206' foram armazenados por 180 dias (novembro/94 a maio/95, em condições normais de ambiente em Pelotas, RS. Bimestralmente, foram conduzidos testes de germinação, envelhecimento acelerado, condutividade elétrica, frio sem solo, emergência de plântulas em campo e peso de matéria seca da parte aérea das plântulas. A análise e a interpretação dos resultados indicaram que a avaliação da qualidade fisiológica de sementes de feijão vigna deve ser fundamentada no conjunto das informações fornecidas por diferentes testes de vigor. O teste de frio sem solo, dentre os testes estudados, é o que apresenta melhor relação com a emergência das plântulas em campo. O peso de matéria seca da parte aérea das plântulas não é eficiente na separação de lotes de sementes de feijão vigna em diferentes níveis de vigor.The aim of this research was to compare vigor tests for seed quality evaluation. Four seed lots of vigna bean (Vigna unguiculata W. of two cultivares (EPACE-10 and IPA-206, were stored for six months (november/94 to may/95 at natural environmen conditions of Pelotas, RS, Brazil and evaluated at two month intervals, throught the following tests: germination, accelerated aging, cold test without soil, electrical condutivity, seedling dry weight and field emergence tests. The analysis and interpretation of the results showed that the evaluation of the physiological quality of vigna bean seeds needs to be based on different vigor tests. Among the tests, the cold test without soil was the best related with seedling field emergence. The seedling dry weight was not effective to separate vigna bean seed lots in different vigor levels.

  15. Características morfo-fisiológicas de frijol común (Phaseolus vulgaris L. relacionadas con la adaptación a sequía

    Directory of Open Access Journals (Sweden)

    José A Polanía

    2012-07-01

    Full Text Available El desarrollo de variedades adaptadas es una de las estrategias que contribuye a garantizar la seguridad alimentaria en zonas productoras de frijol con estrés por sequía. En los invernaderos de cristal del Centro Internacional de Agricultura Tropical (CIAT, Palmira, Colombia, se evaluaron las características morfológicas y fisiológicas de raíces de 21 líneas de frijol (Phaseolus vulgaris L. en condiciones de estrés por sequía e irrigación, utilizando un sistema de tubos plásticos desarrollado por el CIAT. Las características evaluadas fueron profundización visual, longitud total de raíces y distribución de raíces a través del perfil del suelo. En campo, utilizando los mismos genotipos de frijol, se evaluaron características relacionadas con la eficiencia de uso de agua mediante la técnica de discriminación de isótopo de carbono y producción de grano. Los resultados en invernadero mostraron que la profundización visual y longitud de raíces entre 60 y 75 cm tienen una correlación significativa (r = 0.56 y 0.50 respectivamente, P < 0.001 con la biomasa aérea de la planta en condiciones de estrés por sequía. En campo, la discriminación del isótopo de carbono en grano se correlacionó (r = 0.32, P < 0.01 con la producción de grano en condiciones igualmente de estrés por sequía. Las líneas de frijol NCB 226, SER 16, SEN 56 y SEA 15 presentaron una mayor longitud de raíces bajo estrés por sequía (28, 24, 29 y 27 m/planta respectivamente en comparación con las demás líneas evaluadas, lo que les permite mayor transpiración y movilización de fotoasimilados, que favorecen una alta producción de granos. Se estima que la profundización visual, la longitud de raíces entre 60 y 75 cm y la discriminación de isótopo de carbono en grano, son características valiosas como criterios de selección en mejoramiento por tolerancia a estrés por sequía en frijol común.

  16. THE ALLELOPATHIC EFFECT OF SHREDDED LEAVES OF ARTOCARPUS HETEROPHYLLUS AND A. ALTILIS ON VIGNA RADIATA L

    OpenAIRE

    Romilly Margaret Mendez* & Glaxy Ezekel.V

    2017-01-01

    In the present study, an attempt has been made to study the effect of Artocarpus heterophyllus Lam. and Artocarpus altilis (Parkinson) Fosberg on seed germination, seedling growth and total phenolic content of Vigna radiata L. The objective of this study is to assess the rate of germination, growth of the seedlings and the chlorophyll content of the cultivar seeds exposed to four concentrations (10 ppm, 1 ppm, 0.1 ppm and 0.01 ppm) of the leaf extracts of A. heterophyllus and A. altilis. I...

  17. Induction of chlorophyll chimeras and chlorophyll mutations in mungbean (Vigna radiata) cv. T44

    International Nuclear Information System (INIS)

    Singh, V.P.; Yadav, R.D.S.

    1993-01-01

    Uniform and healthy seeds of mungbean (Vigna radiata) cv. T44 were exposed to varying doses of gamma rays, ethyl methane sulphonate (EMS) and combination treatment of gamma rays with EMS. The data were recorded for seed germination, plant survival, frequency and spectrum of chlorophyll chimeras in M 1 and chlorophyll mutations in M 2 generation. Among all, the combination treatments were found most effective for inducing chlorophyll chimeras and chlorophyll mutations than the gamma rays or EMS alone. Of the mutants under reference, the albino, xantha and chlorina showed monogenic recessive while viridis exhibited digenic recessive inheritance. (author). 8 refs., 2 tabs

  18. biostudy on vigna sinensis beetle, callosobruchus chinensis l.and its control by gamma radiation

    International Nuclear Information System (INIS)

    Hasan, A.I.A.

    2005-01-01

    the present study carried out to determine: 1.the effects of the separate and combined effect of bacillus thuringiensis and gamma radiation on some biological aspects of callosobruchus chinensis. 2. the weight loss in infected seeds and total population of the pest after store it for different on adult beetles to determine the proteins, lipids and carbohydrates contents. 4. some analysis in the cowpea vigna anguiculata seeds to investigate the nutritive value after different treatments with bacillus thuringiensis (b.t) and gamma radiation

  19. First Report of Cowpea Mild Mottle Carlavirus on Yardlong Bean (Vigna unguiculata subsp. sesquipedalis in Venezuela

    Directory of Open Access Journals (Sweden)

    Edgloris Marys

    2012-12-01

    Full Text Available Yardlong bean (Vigna unguiculata subsp. sesquipedalis plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%–74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  20. Genetic diversity and population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L.) Walp.] germplasm collection

    Science.gov (United States)

    Cowpea (Vigna unguiculata) is an important legume crop with diverse uses. The species is presently a minor crop, and evaluation of its genetic diversity has been very limited. In this study, a total of 200 genic and 100 genomic simple sequence repeat (SSR) markers were developed from cowpea unigene ...

  1. Transformation of Cowpea Vigna unguiculata Cells with an Antibiotic Resistance Gene Using a Ti-Plasmid-Derived Vector

    NARCIS (Netherlands)

    Hille, Jacques; Goldbach, Rob

    1986-01-01

    A chimaeric antibiotic resistance gene was transferred to cowpea (Vigna unguiculata), a member of the legume family. This transfer was established by inoculating cowpea leaf discs with an Agrobacterium tumefaciens strain harboring a Ti-plasmid-derived vector that contained two copies of a chimaeric

  2. The phosphorus and nitrogen nutrition of bambara groundnut (Vigna subterranea (L.) Verdc.) in Botswana soils : an exploratory study

    NARCIS (Netherlands)

    Ramolemana, G.M.

    1999-01-01

    Bambara groundnut ( Vigna subterranea (L.) Verdec.) is a legume crop grown especially by small farmers mainly in semi-arid parts of Africa both in mixed cultivation and pure stands. It is considered as a hardy crop because of its drought tolerance, resistance to pests

  3. Adaptación y rendimiento de la variedad de frijol “Negro Medellín” en el sureste de México

    Directory of Open Access Journals (Sweden)

    Ernesto L\\u00F3pez

    2000-01-01

    Full Text Available El presente estudio se llevó a cabo de 1994 a 1997 con el objetivo de evaluar la adaptación y rendimiento de la nueva variedad de frijol “Negro Medellín” en la región del Trópico Húmedo del sureste de México. Se condujeron diez ensayos de rendimiento, cinco en el estado de Veracruz, cuatro en Chiapas y uno en Guerrero. Los ensayos incluyeron 16 genotipos y se realizaron, de acuerdo a las facilidades disponibles en los sitios de prueba, bajo condiciones de humedad residual o de temporal. En las evaluaciones se utilizó un diseño de Bloques Completos al Azar con tres repeticiones. La variedad Negro Medellín resultó sobresaliente por su rendimiento, amplia adaptación, con respuesta superior en ambientes favorables y consistente (1226 kg/ha, bi >1,0, S2di = 0. Durante las evaluaciones, la variedad Negro Medellín resultó tolerante a las enfermedades: virus del mosaico dorado (BGMV, mancha angular (Phaoisariopsis griseola y roya (Uromyces appendiculatus var. appendiculatus, enfermedades de amplia distribución en la región tropical. Sin embargo, en una localidad de Veracruz Negro Medellín resultó susceptible a la antracnosis (Colletotrichum lindemuthianum. Además, la variedad Negro Medellín se validó en parcelas comerciales en campos de agricultores en diez localidades del sureste de México, localidades con clima tropical. En éstas parcelas comerciales, Negro Medellín resultó superior en rendimiento a diversos testigos, variedades criollas y mejoradas, de un 10 a 25%, obteniendo un rendimiento promedio de 1300 kg/ha. La variedad Negro Medellín está en trámite para su registro como nueva variedad para las regiones productoras del sureste de México

  4. Morphology of seeds and seedlings of four species of Vigna Savi (Leguminosae, Phaseolinae

    Directory of Open Access Journals (Sweden)

    Fabiana Soledad Ojeda

    2013-09-01

    Full Text Available Four neotropical species of Vigna Savi (Leguminosae, Phaseolinae have potential value as forage crops or ornamentals and could be cultivated in tropical or subtropical areas, even on floodplains. In order to obtain useful data for their culture and taxonomy, the seed morphology, germination pattern (hypogeal or epigeal and seedling development were studied. The studied species belong to different sections of the genus: V. adenantha (G.F.W. Meyer Maréchal, Mascherpa & Stainier (Sect. Leptospron; V. candida (Vell. Maréchal, Mascherpa & Stainier (Sect. Sigmoidotropis; V. caracalla (L. Verdc. (Sect. Caracallae and V. luteola (Jacq. Benth. (Sect. Vigna. The seeds were collected during fieldwork conducted in northwestern and northeastern Argentina. The qualitative and quantitative characters of the seeds were registered, after which they were sown. The development of the emerged seedlings was followed, first in a greenhouse and thereafter in open field. We recorded the type of germination, the thigmotropic movements of the hypocotyl and of the stem, seedling architecture and plant longevity. These traits allowed us to differentiate the species and construct an identification key that could be useful for agronomic or floricultural purposes. The data obtained partially support the current taxonomic treatment of the genus.

  5. First Report of Cucumber mosaic virus Isolated from Wild Vigna angularis var. nipponensis in Korea

    Directory of Open Access Journals (Sweden)

    Mi-Kyeong Kim

    2014-06-01

    Full Text Available A viral disease causing severe mosaic, necrotic, and yellow symptoms on Vigna angularis var. nipponensis was prevalent around Suwon area in Korea. The causal virus was characterized as Cucumber mosaic virus (CMV on the basis of biological and nucleotide sequence properties of RNAs 1, 2 and 3 and named as CMV-wVa. CMV-wVa isolate caused mosaic symptoms on indicator plants, Nicotiana tabacum cv. Xanthi-nc, Petunia hybrida, and Cucumis sativus. Strikingly, CMV-wVa induced severe mosaic and malformation on Cucurbita pepo, and Solanum lycopersicum. Moreover, it caused necrotic or mosaic symptoms on V. angularis and V. radiate of Fabaceae. Symptoms of necrotic local or pin point were observed on inoculated leaves of V. unguiculata, Vicia fava, Pisum sativum and Phaseolus vulgaris. However, CMV-wVa isolate failed to infect in Glycine max cvs. ‘Sorok’, ‘Sodam’ and ‘Somyeong’. To assess genetic variation between CMV-wVa and the other known CMV isolates, phylogenetic analysis using 16 complete nucleotide sequences of CMV RNA1, RNA2, and RNA3 including CMV-wVa was performed. CMV-wVa was more closely related to CMV isolates belonging to CMV subgroup I showing about 85.1–100% nucleotide sequences identity to those of subgroup I isolates. This is the first report of CMV as the causal virus infecting wild Vigna angularis var. nipponensis in Korea.

  6. Detection of Aflatoxin Producing Aspergillus flavus in Post-harvest Contaminated Vigna ungulculata Seeds

    Directory of Open Access Journals (Sweden)

    Ajay Kumar Gautam

    2014-07-01

    Full Text Available The present study was carried out with a specific objective to study postharvest spoilage of Lobhiya (Vigna unguiculata seeds contaminated with Aspergillus flavus. Infected seeds were collected and cultured on potato dextrose agar (PDA media, at 25±2 °C. Aspergillus flavus isolates were primarily characterized by its morphological and microscopic characteristics. Collected fungal isolates were also screened for their afaltoxigenic nature on preliminary basis and at molecular level. For preliminary screening, 5 mm disc of fungal culture was soaked with few drops of liquid ammonia. Color change from yellow pigment to plum-red with different intensities showed the mycotoxic nature of the fungus. DNA from fungal isolates was isolated and amplified using PCR with aflatoxin specific primers, apa-2, ver-1 and omt-1. Amplicons of 1032 bp, 895 bp and 596 bp were obtained in most of the isolates regardless of primer set used which was useful to differentiate between mycotoxic and nontoxic isolates of A. flavus. The isolation of aflatoxigenic strains of A. flavus during post-harvest period of lobhiya seeds raise a serious concern over the quality of seeds and a threat to heath of consumers. It was concluded that Aspergillus flavus is responsible for postharvest spolilage of Lobhiya (Vigna unguiculata.

  7. Development and Validation of EST-SSR Markers from the Transcriptome of Adzuki Bean (Vigna angularis).

    Science.gov (United States)

    Chen, Honglin; Liu, Liping; Wang, Lixia; Wang, Suhua; Somta, Prakit; Cheng, Xuzhen

    2015-01-01

    The adzuki bean (Vigna angularis (Ohwi) Ohwi and Ohashi) is an important grain legume of Asia. It is cultivated mainly in China, Japan and Korea. Despite its importance, few genomic resources are available for molecular genetic research of adzuki bean. In this study, we developed EST-SSR markers for the adzuki bean through next-generation sequencing. More than 112 million high-quality cDNA sequence reads were obtained from adzuki bean using Illumina paired-end sequencing technology, and the sequences were de novo assembled into 65,950 unigenes. The average length of the unigenes was 1,213 bp. Among the unigenes, 14,547 sequences contained a unique simple sequence repeat (SSR) and 3,350 sequences contained more than one SSR. A total of 7,947 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats (99.0%) as the most abundant motif class, followed by AG/CT (68.4%), AAG/CTT (30.0%), AAAG/CTTT (26.2%), AAAAG/CTTTT (16.1%), and AACGGG/CCCGTT (6.0%). A total of 500 SSR markers were randomly selected for validation, of which 296 markers produced reproducible amplicons with 38 polymorphic markers among the 32 adzuki bean genotypes selected from diverse geographical locations across China. The large number of SSR-containing sequences and EST-SSR markers will be valuable for genetic analysis of the adzuki bean and related Vigna species.

  8. Variety identification and genetic relationships of mungbean and ...

    African Journals Online (AJOL)

    Genetic diversity and relatedness were measured in 17 mungbean (Vigna radiata (L.) Wilczek) and 5 blackgram (Vigna mungo (L.) Hepper) genotypes by means of inter-simple sequence repeat (ISSR) analysis and morphological characters. Unweighted pair-group method arithmetic average (UPGMA) analysis of 19 ...

  9. EFECTO DEL MOMENTO DE LA SIEMBRA DEL FRIJOL TERCIOPELO (MUCUNA SP. COMO CULTIVO DE COBERTERA EN EL RENDIMIENTO DE MAÃ?Z

    Directory of Open Access Journals (Sweden)

    José Bernardino Castillo-Caamal

    2010-09-01

    Full Text Available La agricultura milpera se practica desde hace casi tres milenios en el área maya mesoamericana. Se basa en el manejo de la vegetación con barbecho prolongado; y, el cultivo breve del maíz y sus acompañantes. Actualmente, debido a una mayor presión sobre los recursos, el barbecho se ha reducido, en consecuencia también el rendimiento de grano de maíz, atribuido a la disminución de la fertilidad y aumento de las arvenses. Los cultivos de cobertera contribuyen a resolver algunos de los problemas asociados a la milpa. Sin embargo, se conoce poco del funcionamiento de estas, en condiciones de baja precipitación y suelos permeables. Así, la fecha de siembra del frijol terciopelo (FT estas plantas juega un papel fundamental en el manejo de la biomasa y en el cultivo principal. Por lo tanto, el objetivo de este trabajo fue evaluar los tratamientos siguientes: 1 control, maíz sin FT, 2 siembra simultánea de FT con el maíz (0 DDSM, 3 siembra del FT 20 días después del maíz (20 DDSM, 4 siembra del FT 40 días después del maíz (40 DDSM y 5 siembra del FT 60 días después del maíz (60 DDSM. Se utilizó un diseño experimental de cuadrado latino 5 x 5 x 5, se registraron las variables siguientes: rendimiento de grano de maíz y sus componentes de rendimiento, contenidos de nitrógeno, fósforo y potasio del suelo en la fase masosa del grano de maíz; y, contenidos de nitrógeno, fósforo y potasio en el grano de maíz, vaina y grano del FT. La siembra simultánea y 20 DDSM del FT redujeron el rendimiento de grano del maíz en 59 y 25 %, respectivamente. El rendimiento de grano de maíz se ajustó a la ecuación y=-0.5525X2+48.54X+606.3 (R2=0.96, mientras que el rastrojo a y=-0.648X2+65.632X+3989.7 (R2=0.99. El nitrógeno del suelo se redujo en la siembra simultánea (P

  10. Utilization of Diamine Oxidase Enzyme from Mung Bean Sprouts (Vigna radiata L) for Histamine biosensors

    Science.gov (United States)

    Karim, Abdul; Wahab, A. W.; Raya, I.; Natsir, H.; Arif, A. R.

    2018-03-01

    This research is aimed to utilize the diamine oxidase enzyme (DAO) which isolated from mung bean sprouts (Vigna radiata L) to develop histamine biosensors based on electode enzyme with the amperometric method (cyclic voltammetry).The DAO enzyme is trapped inside the membrane of chitin-cellulose acetate 2:1 and glutaraldehyde which super imposed on a Pt electrode. Histamine will be oxidized by DAO enzyme to produce aldehydes and H2O2 that acting as electron transfer mediators.The performance of biosensors will be measured at various concentrations of glutaraldehyde, temperature changes and different range of pH. Recently, it has been found that the optimal conditions obtained from the paramaters as follows; at 25% of glutaraldehyde, temperature of 37°C and pH of 7.4. Eventually, the results provided an expectation for applying histamine biosensors in determining the freshness and safety of fish specifically skombroidae families.

  11. Development of 12 Chloroplast Microsatellite Markers in Vigna unguiculata (Fabaceae and Amplification in Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2014-03-01

    Full Text Available Premise of the study: Vigna unguiculata is an economically important legume, and the complexity of its variability and evolution needs to be further understood. Based on publicly available databases, we developed chloroplast microsatellite primers to investigate genetic diversity within V. unguiculata and its related species Phaseolus vulgaris. Methods and Results: Twelve polymorphic chloroplast microsatellite markers were developed and characterized in 62 V. unguiculata individuals. The number of alleles per locus varied between two and four, the unbiased haploid diversity per locus ranged from 0.123 to 0.497, and the polymorphism information content varied from 0.114 to 0.369. In cross-species amplifications, nine of these markers showed polymorphism in 29 P. vulgaris individuals. Conclusions: The newly developed chloroplast microsatellite markers exhibit variation in V. unguiculata as well as their transferability in P. vulgaris. These markers can be used to investigate genetic diversity and evolution in V. unguiculata and P. vulgaris.

  12. GENETIC OF DIVERSITY AND RELATIONSHIP BAMBARA GROUNDNUT (Vigna Subteranea L. GENOTYPE LANDRACES OF WEST JAVA

    Directory of Open Access Journals (Sweden)

    Enceng Sobari

    2017-12-01

    Full Text Available Bambara groundnut (Vigna subteranea L. is one of underutliized crops in Indonesia. Bambara groundnut is potential to be developed and can be utilized as an alternative food source in Indonesia. Bambara groundnut greatly varies and has a very wide area of adaptation. The experiment was conducted at the experimental field station at Ciparanje in Padjadjaran University. Starting on September 2014 until March 2015 with Randomized Block Design (RBD and repeated two times. The research used 30 accessions originally from various locations in West Java (Bandung, Tasikmalaya, Garut, Sumedang, Bogor, Majalengka and East Java (Lamongan, Madura. Genetic variability of Bambara groundnut landrace  in some West Java showed broad criteria on the characters fresh pod weight, dry pod weight, weight of 100 seeds, and weight per plot. Genotypes which had many similarities in some characters based on euclidian distance coefficient had close relationship.

  13. Measurements of experimental precision for trials with cowpea (Vigna unguiculata L. Walp.) genotypes.

    Science.gov (United States)

    Teodoro, P E; Torres, F E; Santos, A D; Corrêa, A M; Nascimento, M; Barroso, L M A; Ceccon, G

    2016-05-09

    The aim of this study was to evaluate the suitability of statistics as experimental precision degree measures for trials with cowpea (Vigna unguiculata L. Walp.) genotypes. Cowpea genotype yields were evaluated in 29 trials conducted in Brazil between 2005 and 2012. The genotypes were evaluated with a randomized block design with four replications. Ten statistics that were estimated for each trial were compared using descriptive statistics, Pearson correlations, and path analysis. According to the class limits established, selective accuracy and F-test values for genotype, heritability, and the coefficient of determination adequately estimated the degree of experimental precision. Using these statistics, 86.21% of the trials had adequate experimental precision. Selective accuracy and the F-test values for genotype, heritability, and the coefficient of determination were directly related to each other, and were more suitable than the coefficient of variation and the least significant difference (by the Tukey test) to evaluate experimental precision in trials with cowpea genotypes.

  14. Programmed cell death during development of cowpea (Vigna unguiculata (L.) Walp.) seed coat.

    Science.gov (United States)

    Lima, Nathália Bastos; Trindade, Fernanda Gomes; da Cunha, Maura; Oliveira, Antônia Elenir Amâncio; Topping, Jennifer; Lindsey, Keith; Fernandes, Kátia Valevski Sales

    2015-04-01

    The seed coat develops primarily from maternal tissues and comprises multiple cell layers at maturity, providing a metabolically dynamic interface between the developing embryo and the environment during embryogenesis, dormancy and germination of seeds. Seed coat development involves dramatic cellular changes, and the aim of this research was to investigate the role of programmed cell death (PCD) events during the development of seed coats of cowpea [Vigna unguiculata (L.) Walp.]. We demonstrate that cells of the developing cowpea seed coats undergo a programme of autolytic cell death, detected as cellular morphological changes in nuclei, mitochondria, chloroplasts and vacuoles, DNA fragmentation and oligonucleosome accumulation in the cytoplasm, and loss of membrane viability. We show for the first time that classes 6 and 8 caspase-like enzymes are active during seed coat development, and that these activities may be compartmentalized by translocation between vacuoles and cytoplasm during PCD events. © 2014 John Wiley & Sons Ltd.

  15. The inhibitory effect of metals and other ions on acid phosphatase activity from Vigna aconitifolia seeds.

    Science.gov (United States)

    Srivastava, Pramod Kumar; Anand, Asha

    2015-01-01

    Sensitivity of acid phosphatase from Vigna aconitifolia seeds to metal ions, fluoride, and phosphate was examined. All the effectors had different degree of inhibitory effect on the enzyme. Among metal ions, molybdate and ferric ion were observed to be most potent inhibitors and both exhibited mixed type of inhibition. Acid phosphatase activity was inhibited by Cu2+ in a noncompetitive manner. Zn and Mn showed mild inhibition on the enzyme activity. Inhibition kinetics analysis explored molybdate as a potent inhibitor for acid phosphatase in comparison with other effectors used in this study. Fluoride was the next most strong inhibitor for the enzyme activity, and caused a mixed type of inhibition. Phosphate inhibited the enzyme competitively, which demonstrates that inhibition due to phosphate is one of the regulatory factors for enzyme activity.

  16. Solid state characterization and rheological properties of native and modified Bambara groundnut (Vigna subterranean starches

    Directory of Open Access Journals (Sweden)

    Michael Odeniyi

    2017-09-01

    Full Text Available This study was designed to determine the suitability of native, pregelatinized and carboxymethylated Vigna subterranean (Bambara nut starches for pharmaceutical applications, through their characterization by means of physicochemical, rheological, thermal, morphological and instrumental spectroscopic methods. The native starch was extracted from Bambara nut, after which it was used to prepare both pregelatinized and carboxymethylated forms. Microscopy revealed increased in granular size on modification. Both pregelatinized and carboxymethylated Bambara starches had better flow properties and swellability compared to the native starch. Native Bambara starch had greater tendency to retrogradation, was more sensitive to heat and heat change, these were alleviated by both pregelatinization and carboxymethylation. DSC confirmed that carboxymethylated Bambara starch was the most thermally stable starch. Presence of functional groups and crystallinity were established by FTIR and XRD, respectively. Native and modified Bambara starches can be used as locally and readily available alternative excipients in pharmaceutical formulations.

  17. Yield and Quality of Mung Bean (Vigna radiata (l. R. Wilczek Seeds Produced in Poland

    Directory of Open Access Journals (Sweden)

    Kamil MISIAK

    2017-11-01

    Full Text Available The aim of the experiment was to do field and laboratory assessments of yield and quality of mung bean (Vigna radiata (L. R. Wilczek seeds cultivated in Western Poland. Mean yield of seeds per plant was higher for common bean (Phaseolus vulgaris L. than for mung one: 13.1 g and 2.58 g, respectively. The mean 1000 mung seeds weight was 50.9 g and their germination – 78 %. Germination capacities of seeds of both beans in the field were similar. Mung beans, compared to common bean, had much smaller seeds, started to bloom later and produced mature seeds later than the latter. Mung bean seeds had more total proteins and Magnesium and Copper than common bean seeds. In Western Poland, production of high quality mung bean seeds was possible.

  18. Vigna radiata as a New Source for Biotransformation of Hydroquinone to Arbutin

    Directory of Open Access Journals (Sweden)

    Zahra Tofighi, Mohsen Amini, Mahzad Shirzadi, Hamideh Mirhabibi, Negar Ghazi Saeedi, Narguess Yassa

    2016-06-01

    Full Text Available Background: The suspension culture of Vigna radiata was selected for biotransformation of hydroquinone to its β-D-glucoside form (arbutin as an important therapeutic and cosmetic compound. Methods: The biotransformation efficiency of a Vigna radiata cell culture in addition to different concentrations of hydroquinone (6-20 mg/100 ml was investigated after 24 hours in comparison to an Echinacea purpurea cell culture and attempts were made to increase the efficacy of the process by adding elicitors. Results: Arbutin was accumulated in cells and found in the media only in insignificant amounts. The arbutin content of the biomass extracts of V. radiata and E. purpurea was different, ranging from 0.78 to 1.89% and 2.00 to 3.55% of dry weight, respectively. V. radiata demonstrated a bioconversion efficiency of 55.82% after adding 8 mg/100 ml precursor, which was comparable with result of 69.53% for E. purpurea cells after adding 10 mg/100 ml hydroquinone (P>0.05. In both cultures, adding hydroquinone in two portions with a 24-hour interval increased the biotransformation efficiency. Different concentrations of methyl jasmonate (25, 50, and 100 µM and chitosan (50 and 100 µg/ml as elicitors increased the bio-efficiency percentage of the V. radiata culture in comparison with the flask containing only hydroquinone. Conclusion: This is the first report of the biotransformation possibility of V. radiata cultures. It was observed the bioconversion capacity increased by adding hydroquinone in two portions, which was comparable to adding an elicitor.

  19. Physiological Responses of Bambara Groundnut (Vigna subterranea L. Verdc) to Short Periods of Water Stress During Different Developmental Stages

    OpenAIRE

    R. Vurayai; V. Emongor and B. Moseki

    2011-01-01

    The study was conducted to evaluate the responses of bambara groundnut (Vigna subterranea L. Verdc) to short periods of water stress imposed at different growth stages, and the recuperative ability of the species from drought stress. A major problem associated with Bambara groundnut production is its very low yields due to intra-seasonal and inter-seasonal variability in rainfall in semi-arid regions. The response pattern of physiological processes to water stress imposed at different growth ...

  20. The mitochondrial genome of the legume Vigna radiata and the analysis of recombination across short mitochondrial repeats.

    Directory of Open Access Journals (Sweden)

    Andrew J Alverson

    2011-01-01

    Full Text Available The mitochondrial genomes of seed plants are exceptionally fluid in size, structure, and sequence content, with the accumulation and activity of repetitive sequences underlying much of this variation. We report the first fully sequenced mitochondrial genome of a legume, Vigna radiata (mung bean, and show that despite its unexceptional size (401,262 nt, the genome is unusually depauperate in repetitive DNA and "promiscuous" sequences from the chloroplast and nuclear genomes. Although Vigna lacks the large, recombinationally active repeats typical of most other seed plants, a PCR survey of its modest repertoire of short (38-297 nt repeats nevertheless revealed evidence for recombination across all of them. A set of novel control assays showed, however, that these results could instead reflect, in part or entirely, artifacts of PCR-mediated recombination. Consequently, we recommend that other methods, especially high-depth genome sequencing, be used instead of PCR to infer patterns of plant mitochondrial recombination. The average-sized but repeat- and feature-poor mitochondrial genome of Vigna makes it ever more difficult to generalize about the factors shaping the size and sequence content of plant mitochondrial genomes.

  1. Influence of double cropping on growth and yield of dry beans with colored plastic mulches Influencia del doble cultivo en el crecimiento y rendimiento de frijol con cubierta plástica de colores

    Directory of Open Access Journals (Sweden)

    Luis Ibarra-Jiménez

    2012-12-01

    Full Text Available There are numerous studies of the use of plastic mulches in vegetable production, but there is little documentation of their use with dry beans (Phaseolus vulgaris L. in single and double cropping. The objective of this study was to grow dry beans over two consecutive growing seasons using the same plastic mulch of different colors and examine the influence of soil temperature on growth and yield. The experiment was conducted in Saltillo, Coahuila, Mexico, in the spring and summer of 2008. The treatments included four colored plastic mulches: white-on-black, black, silver-on-black, aluminum-on-black, and bare soil as a control. The experimental design was a randomized complete block with four replicates. The percentage of photosynthetically active radiation (PAR reflected from the plastic tended to be highest with the white-on-black mulch and lowest with the black mulch. Mean soil temperature under the plastic mulch decreased with the increasing percentage of reflected PAR. Mean soil temperature exhibited a relationship of 98% and 99% to yield in the first and second growing season, respectively. Photosynthetically active radiation had a relationship of 98% and 86% to yield in the first and second growing season, respectively. The effect of the colored plastic mulch on yield was significant (p Existen numerosos estudios sobre el uso de cubierta plástica en la producción de hortalizas, sin embargo está muy poco documentado el cultivo simple o doble de frijol (Phaseolus vulgaris L.. El objetivo de este estudio fue cultivar frijol en dos estaciones de crecimiento consecutivas usando la misma cubierta plástica de diferentes colores y examinar la influencia de la temperatura del suelo en el crecimiento y rendimiento de frijol. El estudio fue conducido en Saltillo, Coahuila, México, en la primavera y verano de 2008. Se usaron cuatro colores de acolchado plástico: blanco-sobre-negro, negro, plata-sobre-negro, aluminio-sobre-negro, y control de

  2. Vigna unguiculata

    African Journals Online (AJOL)

    VIC

    2012-12-07

    Dec 7, 2012 ... Processing of raw meat into products does not only add value and extend the shelf life of meat ... The research was conducted at the Meat Processing Unit and Laboratories of the. University for ... oven (Turbofan, Blue seal, UK). .... therefore likely to reduce the sensory characteristics of food products [23].

  3. Vigna radiata

    Indian Academy of Sciences (India)

    Table 2. Cluster mean for different traits. Characters/ Days to 50% Days to Plant height Plant yield. 100-seed. Pods per Pods per Pod length Seeds per clusters flowering maturity. (cm). (gm) weight (gm) plant cluster. (cm) pod. Cluster I. 34.00. 6.20. 29.64. 4.89. 4.71. 13.15. 3.29. 6.69. 8.74. Cluster II. 35.17. 61.00. 31.29. 5.26.

  4. Vigna un

    African Journals Online (AJOL)

    user

    2010-11-11

    Nov 11, 2010 ... storage duration on the levels of anti-nutrients: nitrates, oxalates and ... local markets, sorted to remove blemished leaves and foreign materials, washed in ... C. Fermentation, heat-treatment and drying of vegetables led to ...

  5. Vigna unguiculata

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-08

    Jul 8, 2015 ... significant economic importance worldwide with high protein and mineral ... Therefore, the rapid spread of this parasitic weed to new regions would constitute a severe threat to cowpea .... way to develop stable and durable Striga resistant cultivars. .... before reaching reproductive stage due to severe attack.

  6. Resistencia a sequía terminal en frijol negro tropical Comportamiento de variedades de maíz normal y con alta calidad de proteína para la región Golfo de México

    Directory of Open Access Journals (Sweden)

    Mark Frahm

    2003-01-01

    Full Text Available Con el objetivo de identificar cultivares de frijol negro tropical con resistencia a sequía y adaptación a la región Centroamericana, se diseñó un proyecto piloto colaborativo entre los programas de frijol de Zamorano, Honduras; Veracruz, México y la Universidad Estatal de Michigan (MSU; EE.UU, en el año 2002. Se desarrollaron dos poblaciones de líneas endog ámicas recombinantes (RILs derivadas de cruces entre la lí- nea resistente a sequía B98311 de MSU con TLP 19 y VAX 5, dos líneas mejoradas del CIAT con resistencia a enfermedades y adaptadas a las condiciones de América Central y México. Ambas poblaciones se evaluaron bajo riego y sequía terminal en Zamorano, Honduras y Veracruz, México. Los rendimientos se vieron reducidos por la sequía y por Macrophomina phaseolina, hongo causal de la pudrición carbonosa. El estrés por sequía, la presión de la enfermedad y los bajos rendimientos, contribuyeron a la obtención de altos coeficientes de variación, lo que hizo difícil la identificación y selecci ón de líneas superiores. La selección se basó en la posici ón de la media geométrica del rendimiento (MG calculada para cada línea con los datos de ambos tratamientos, riego y sequía. La línea L88-63 ocupó el primer lugar en la MG del rendimiento en ambas localidades. Evaluaciones posteriores conducidas en Honduras y Michigan, confirmaron el alto potencial de rendimiento y amplia adaptación de la línea L88- 63. El mejoramiento de la resistencia a la sequía en ambientes del trópico bajo, requiere la incorporación adicional de resistencia a M. phaseolina en las nuevas líneas consideradas para liberarse como nuevas variedades en esta región.

  7. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  8. Genotypic Variation in Phosphorus Use Efficiency for Symbiotic Nitrogen Fixation in Cowpea (Vigna Unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A. [LRI-SRA, Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Abdou, M. Malam [Laboratoire Banques de genes CERRA / KOLLO, Institut National de Recherche Agronomique du Niger (INRAN), Niamey (Niger); Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier (France)

    2013-11-15

    Cowpea (Vigna unguiculata L. Walp) is an important food legume. In Africa, it is mostly cultivated under such environmental constraints as drought and pest, and nutrient deficiency. In particular low soil phosphorus strongly limits crop production for the poor farmers with limited access to P fertilizers. Therefore breeding cowpea for the tolerance to P deficiency is considered as an alternative to increase the productivity of traditional cowpea-cereal cropping systems in soils with low P availability. This paper reports cowpea genotypic-variation in P use efficiency for symbiotic nitrogen fixation as a contribution to select tolerant cowpea lines under P deficiency. Eighty cowpea cultivars inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 were pre-screened as a single replicate under hydroaeroponic culture for 6 weeks under P deficiency versus P sufficiency, namely 15 vs 30 {mu}mol plant{sup -1} week{sup -1}. Large variability in nodule number per plant, and in shoot growth as a function of nodule mass, was observed among the diversity of cowpea lines. From this pre-screening experiment, the 40 cowpea lines showing the highest SNF-potential, i.e. high nodulation linked with high N{sub 2}-dependent growth under P sufficiency, and the most contrasting tolerance to P deficiency, i.e. highest vs lowest N{sub 2}-dependent growth under P deficiency, were grown again in glasshouse hydroaeroponics with 6 replicates. As an illustration of the most contrasting lines, the nodulation was decreased under P deficiency by less than 20% for IT82E-18 whereas by more than 80% for IT95K-1105-5 or SUVITA 2. The variations in nodulation were correlated with variations in growth with mean value of additional growth per unit increase in nodule biomass of 23 g shoot DW g-1 nodule DW under P sufficiency, showing 3 lines showing exceptionally high potential for symbiotic nitrogen fixation, versus 28 g shoot DW g{sup -1} nodule DW showing large variation among lines

  9. The Effect of Shoot/Root Competition of Black night shade (Solanum nigrum on Growth and Seed Yield of Mung Bean (Vigna radiate L.

    Directory of Open Access Journals (Sweden)

    M Goldani

    2015-04-01

    Full Text Available In order to study the competition effects of Solanum nigrum on Vigna radiate yield, an additive experiment was conducts at Ferdowsi University of Mashhad experimental Greenhouse. The type of design was completely randomized block. Treatments included three density of Solanum nigrum (2, 4, and 6 plants m-2 and three types of competition (root, shoot and both of them planted at constant density of Vigna radiate plus weed free check in each block. The results indicated that competitions had significant effects (P

  10. In Vitro Seeds Germination and Seedling Growth of Bambara Groundnut (Vigna subterranea (L.) Verdc. (Fabaceae)).

    Science.gov (United States)

    Koné, Mongomaké; Koné, Tchoa; Silué, Nakpalo; Soumahoro, André Brahima; Kouakou, Tanoh Hilaire

    2015-01-01

    Bambara groundnut (Vigna subterranea (L.) Verdc.) is an indigenous grain legume. It occupies a prominent place in the strategies to ensure food security in sub-Saharan Africa. Development of an efficient in vitro regeneration system, a prerequisite for genetic transformation application, requires the establishment of optimal conditions for seeds germination and plantlets development. Three types of seeds were inoculated on different basal media devoid of growth regulators. Various strengths of the medium of choice and the type and concentration of carbon source were also investigated. Responses to germination varied with the type of seed. Embryonic axis (EA) followed by seeds without coat (SWtC) germinated rapidly and expressed a high rate of germination. The growth performances of plantlets varied with the basal medium composition and the seeds type. The optimal growth performances of plants were displayed on half strength MS basal medium with SWtC and EA as source of seeds. Addition of 3% sucrose in the culture medium was more suitable for a maximum growth of plantlets derived from EA.

  11. Genetic diversity of Rhizobia isolates from Amazon soils using cowpea (Vigna unguiculata as trap plant

    Directory of Open Access Journals (Sweden)

    F.V. Silva

    2012-06-01

    Full Text Available The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium.

  12. Vigna subterranea ammonium transporter gene (VsAMT1: Some bioinformatics insights

    Directory of Open Access Journals (Sweden)

    Adewole T. Adetunji

    2015-12-01

    Full Text Available Ammonium transporters (AMTs play a role in the uptake of ammonium, the form in which nitrogen is preferentially absorbed by plants. Vigna subterranea (VsAMT1 and Solanum tuberosum (StAMT1 AMT1s were characterized using molecular biology and bioinformatics methods. AMT1-specific primers were designed and used to amplify the AMT1 internal regions. Nucleotide sequencing, alignment and phylogenetic analysis assigned VsAMT1 and StAMT1 to the AMT1 family. The deduced amino acid sequences showed that VsAMT1 is 92% and 89% similar to Phaseolus vulgaris PvAMT1.1 and Glycine max AMT1 respectively, while StAMT1 is 92% similar to Solanum lycopersicum LeAMT1.1, and correspond to the 5th–10th trans-membrane domains. Residues VsAMT1 D23 and StAMT1 D15 are predicted to be essential for ammonium transport, while mutations of VsAMT1 W1A-L and S87A and StAMT1 S76A may further enhance ammonium transport. In addition to nitrogen uptake from the roots, VsAMT1 may also contribute to interactions with rhizobia.

  13. The AVRDC - The World Vegetable Center mungbean (Vigna radiata) core and mini core collections.

    Science.gov (United States)

    Schafleitner, Roland; Nair, Ramakrishnan Madhavan; Rathore, Abhishek; Wang, Yen-wei; Lin, Chen-yu; Chu, Shu-hui; Lin, Pin-yun; Chang, Jian-Cheng; Ebert, Andreas W

    2015-04-29

    Large ex situ germplasm collections generally harbor a wide range of crop diversity. AVRDC--The World Vegetable Center is holding in trust the world's second largest mungbean (Vigna radiata) germplasm collection with more than 6,700 accessions. Screening large collections for traits of interest is laborious and expensive. To enhance the access of breeders to the diversity of the crop, mungbean core and mini core collections have been established. The core collection of 1,481 entries has been built by random selection of 20% of the accessions after geographical stratification and subsequent cluster analysis of eight phenotypic descriptors in the whole collection. Summary statistics, especially the low differences of means, equal variance of the traits in both the whole and core collection and the visual inspection of quantile-quantile plots comparing the variation of phenotypic traits present in both collections indicated that the core collection well represented the pattern of diversity of the whole collection. The core collection was genotyped with 20 simple sequence repeat markers and a mini core set of 289 accessions was selected, which depicted the allele and genotype diversity of the core collection. The mungbean core and mini core collections plus their phenotypic and genotypic data are available for distribution to breeders. It is expected that these collections will enhance the access to biodiverse mungbean germplasm for breeding.

  14. Increased stability of thylakoid components in Vigna sinensis seedlings grown under ultraviolet-B enhanced radiation

    International Nuclear Information System (INIS)

    Nedunchezhian, N.; Kulandaivelu, G.

    1994-01-01

    Chloroplasts isolated from Vigna sinensis L. seedlings grown under cool fluorescent (control chloroplasts) and ultraviolet-B (UV-B)-enhanced fluorescent (UV chloroplasts) radiation, when incubated at 10, 20, 30 and 40-degrees-C, showed large variations in the photosynthetic electron transport reactions. The overall electron transport activity in both control and UV chloroplasts incubated at 40-degrees-C decreased rapidly. In contrast to this, at 30-degrees-C the control chloroplasts got inactivated very rapidly during the 30 min of incubation while the UV chloroplasts showed high stability. A similar trend was also noticed at 20-degrees-C. At 10-degrees-C, although the rate of inactivation was slow, UV chloroplasts were more stable than control chloroplasts. A similar trend was noticed in photosystem (PS) 2 activity. In contrast to overall electron transport and PS2 reactions, PS1 activity showedonly marginal changes at all temperatures. The polypeptide profiles of chloroplasts exposed to UV-B irradiation for 60 min at different temperatures revealed marked decreases in the level of the 23 and 33 kDa polypeptides in control chloroplasts while in UV chloroplasts these polypeptides were highly stable. In addition, UV chloroplasts contained several new polypeptides of both high and low molecular masses. The polypeptide pattern indicated that higher photochemical activity of UV chloroplasts over the control chloroplasts could be due to stabilization of PS2 core complexes by the new polypeptides induced under UV-B enhanced radiation

  15. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars ( Vigna unguiculata L. Walp)

    Science.gov (United States)

    Ocloo, F. C. K.; Darfour, B.; Ofosu, D. O.; Wilson, D. D.

    2012-01-01

    Cowpeas ( Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly ( p>0.05) affected by the radiation. There was no significant ( p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly ( p>0.05) the acceptability of the treated cowpea cultivars.

  16. Simultaneous selection for cowpea (Vigna unguiculata L.) genotypes with adaptability and yield stability using mixed models.

    Science.gov (United States)

    Torres, F E; Teodoro, P E; Rodrigues, E V; Santos, A; Corrêa, A M; Ceccon, G

    2016-04-29

    The aim of this study was to select erect cowpea (Vigna unguiculata L.) genotypes simultaneously for high adaptability, stability, and yield grain in Mato Grosso do Sul, Brazil using mixed models. We conducted six trials of different cowpea genotypes in 2005 and 2006 in Aquidauana, Chapadão do Sul, Dourados, and Primavera do Leste. The experimental design was randomized complete blocks with four replications and 20 genotypes. Genetic parameters were estimated by restricted maximum likelihood/best linear unbiased prediction, and selection was based on the harmonic mean of the relative performance of genetic values method using three strategies: selection based on the predicted breeding value, having considered the performance mean of the genotypes in all environments (no interaction effect); the performance in each environment (with an interaction effect); and the simultaneous selection for grain yield, stability, and adaptability. The MNC99542F-5 and MNC99-537F-4 genotypes could be grown in various environments, as they exhibited high grain yield, adaptability, and stability. The average heritability of the genotypes was moderate to high and the selective accuracy was 82%, indicating an excellent potential for selection.

  17. Distribution and Prevalence of Parasitic Nematodes of Cowpea (Vigna unguiculata) in Burkina Faso.

    Science.gov (United States)

    Sawadogo, A; Thio, B; Kiemde, S; Drabo, I; Dabire, C; Ouedraogo, J; Mullens, T R; Ehlers, J D; Roberts, P A

    2009-06-01

    A comprehensive survey of the plant parasitic nematodes associated with cowpea (Vigna unguiculata) production fields was carried out in the three primary agro-climatic zones of Burkina Faso in West Africa. Across the three zones, a total of 109 samples were collected from the farms of 32 villages to provide a representative coverage of the cowpea production areas. Samples of rhizosphere soil and samples of roots from actively growing cowpea plants were collected during mid- to late-season. Twelve plant-parasitic nematode genera were identified, of which six appeared to have significant parasitic potential on cowpea based on their frequency and abundance. These included Helicotylenchus, Meloidogyne, Pratylenchus, Scutellonema, Telotylenchus, and Tylenchorhynchus. Criconemella and Rotylenchulus also had significant levels of abundance and frequency, respectively. Of the primary genera, Meloidogyne, Pratylenchus, and Scutellonema contained species which are known or suspected to cause losses of cowpea yield in other parts of the world. According to the prevalence and distribution of these genera in Burkina Faso, their potential for damage to cowpea increased from the dry Sahelian semi-desert zone in the north (annual rainfall < 600 mm/year), through the north-central Soudanian zone (annual rainfall of 600-800 mm/year), to the wet Soudanian zone (annual rainfall ≥ 1000 mm) in the more humid south-western region of the country. This distribution trend was particularly apparent for the endoparasitic nematode Meloidogyne and the migratory endoparasite Pratylenchus.

  18. Prioritising in situ conservation of crop resources: a case study of African cowpea (Vigna unguiculata).

    Science.gov (United States)

    Moray, C; Game, E T; Maxted, N

    2014-06-17

    Conserving crop wild relatives (CWR) is critical for maintaining food security. However, CWR-focused conservation plans are lacking, and are often based on the entire genus, even though only a few taxa are useful for crop improvement. We used taxonomic and geographic prioritisation to identify the best locations for in situ conservation of the most important (priority) CWR, using African cowpea (Vigna unguiculata (L.) Walp.) as a case study. Cowpea is an important crop for subsistence farmers in sub-Saharan Africa, yet its CWR are under-collected, under-conserved and under-utilised in breeding. We identified the most efficient sites to focus in situ cowpea CWR conservation and assessed whether priority CWR would be adequately represented in a genus-based conservation plan. We also investigated whether priority cowpea CWR are likely to be found in existing conservation areas and in areas important for mammal conservation. The genus-based method captured most priority CWR, and the distributions of many priority CWR overlapped with established conservation reserves and targets. These results suggest that priority cowpea CWR can be conserved by building on conservation initiatives established for other species.

  19. Effect of gamma irradiation and cooking on cowpea bean grains ( Vigna unguiculata L. Walp)

    Science.gov (United States)

    Lima, Keila dos Santos Cople; Souza, Luciana Boher e.; Godoy, Ronoel Luiz de Oliveira; França, Tanos Celmar Costa; Lima, Antônio Luís dos Santos

    2011-09-01

    Leguminous plants are important sources of proteins, vitamins, carbohydrates, fibers and minerals. However, some of their non-nutritive elements can present undesirable side effects like flatulence provoked by the anaerobic fermentation of oligosaccharides, such as raffinose and stachyose, in the gut. A way to avoid this inconvenience, without any change in the nutritional value and post-harvesting losses, is an irradiation process. Here, we evaluated the effects of gamma irradiation on the amino acids, thiamine and oligosaccharide contents and on the fungi and their toxin percentages in cowpea bean ( Vigna unguiculata L. Walp) samples. For irradiation doses of 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 kGy the results showed no significant differences in content for the uncooked samples. However, the combination of irradiation and cooking processes reduced the non-nutritive factors responsible for flatulence. Irradiation also significantly reduced the presence of Aspergillus, Penicilium, Rhizopus and Fusarium fungi and was shown to be efficient in grain conservation for a storage time of 6 months.

  20. Diallelic analysis to obtain cowpea (Vigna unguiculata L. Walp.) populations tolerant to water deficit.

    Science.gov (United States)

    Rodrigues, E V; Damasceno-Silva, K J; Rocha, M M; Bastos, E A

    2016-05-13

    The purpose of this study was to identify parents and obtain segregating populations of cowpea (Vigna unguiculata L. Walp.) with the potential for tolerance to water deficit. A full diallel was performed with six cowpea genotypes, and two experiments were conducted in Teresina, PI, Brazil in 2011 to evaluate 30 F2 populations and their parents, one under water deficit and the other under full irrigation. A triple-lattice experimental design was used, with six 2-m-long rows in each plot. Sixteen plants were sampled per plot. The data were subjected to analysis of variance, and general and specific combining ability estimates were obtained based on the means. Additive effects were more important than non-additive effects, and maternal inheritance had occurred. The genotypes BRS Xiquexique, Pingo de Ouro-1-2, and MNC99-510F-16-1 were the most promising for use in selection programs aimed at water deficit tolerance. The hybrid combinations Pingo de Ouro-1-2 x BRS Xiquexique, BRS Xiquexique x Santo Inácio, CNCx 698-128G x MNC99-510F-16-1, Santo Inácio x CNCx 698-128G, MNC99-510F-16-1 x BRS Paraguaçu, MNC99- 510F-16-1 x Pingo de Ouro-1-2, and MNC99-510F-16-1 x BRS Xiquexique have the potential to increase grain production and tolerate water deficit.

  1. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Lo, Sassoum; Muñoz-Amatriaín, María; Boukar, Ousmane; Herniter, Ira; Cisse, Ndiaga; Guo, Yi-Ning; Roberts, Philip A; Xu, Shizhong; Fatokun, Christian; Close, Timothy J

    2018-04-19

    Cowpea (Vigna unguiculata L. Walp) is a warm-season legume with a genetically diverse gene-pool composed of wild and cultivated forms. Cowpea domestication involved considerable phenotypic changes from the wild progenitor, including reduction of pod shattering, increased organ size, and changes in flowering time. Little is known about the genetic basis underlying these changes. In this study, 215 recombinant inbred lines derived from a cross between a cultivated and a wild cowpea accession were used to evaluate nine domestication-related traits (pod shattering, peduncle length, flower color, days to flowering, 100-seed weight, pod length, leaf length, leaf width and seed number per pod). A high-density genetic map containing 17,739 single nucleotide polymorphisms was constructed and used to identify 16 quantitative trait loci (QTL) for these nine traits. Based on annotations of the cowpea reference genome, genes within these regions are reported. Four regions with clusters of QTL were identified, including one on chromosome 8 related to increased organ size. This study provides new knowledge of the genomic regions controlling domestication-related traits in cowpea as well as candidate genes underlying those QTL. This information can help to exploit wild relatives in cowpea breeding programs.

  2. Active aggregation among sexes in bean flower thrips (Megalurothrips sjostedti) on cowpea (Vigna unguiculata).

    Science.gov (United States)

    Niassy, Saliou; Ekesi, Sunday; Maniania, Nguya K; Orindi, Benedict; Moritz, Gerald B; de Kogel, Willem J; Subramanian, Sevgan

    2016-01-01

    Male sexual aggregations are a common territorial, mating-related or resource-based, behaviour observed in diverse organisms, including insects such as thrips. The influence of factors such as plant substrate, time of day, and geographic location on aggregation of thrips is uncertain, therefore we monitored the dispersion of male and female bean flower thrips (BFT), Megalurothrips sjostedti (Trybom) (Thysanoptera: Thripidae), on cowpea, Vigna unguiculata (L.) Walp. (Fabaceae), over three cowpea growth stages and across three cowpea-growing areas of Kenya. Our results indicated that for all the crop growth stages, the density of BFTs varied over the time of day, with higher densities at 10:00, 13:00, and 16:00 hours than at 07:00 hours. Thrips densities did not differ among blocks at the budding stage, but they did at peak flowering and podding stages. Dispersion indices suggested that both male and female BFTs were aggregated. Active male aggregation occurred only on green plant parts and it varied across blocks, crop stages, and locations. Similarly, active female aggregation was observed in peak flowering and podding stages. Such active aggregation indicates a semiochemical or behaviour-mediated aggregation. Identification of such a semiochemical may offer new opportunities for refining monitoring and management strategies for BFT on cowpea, the most important grain legume in sub-Saharan Africa.

  3. Highly distinct chromosomal structures in cowpea (Vigna unguiculata), as revealed by molecular cytogenetic analysis.

    Science.gov (United States)

    Iwata-Otsubo, Aiko; Lin, Jer-Young; Gill, Navdeep; Jackson, Scott A

    2016-05-01

    Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. However, little is known about its genome or chromosome structure. We used molecular cytogenetics to characterize the structure of pachytene chromosomes to advance our knowledge of chromosome and genome organization of cowpea. Our data showed that cowpea has highly distinct chromosomal structures that are cytologically visible as brightly DAPI-stained heterochromatic regions. Analysis of the repetitive fraction of the cowpea genome present at centromeric and pericentromeric regions confirmed that two retrotransposons are major components of pericentromeric regions and that a 455-bp tandem repeat is found at seven out of 11 centromere pairs in cowpea. These repeats likely evolved after the divergence of cowpea from common bean and form chromosomal structure unique to cowpea. The integration of cowpea genetic and physical chromosome maps reveals potential regions of suppressed recombination due to condensed heterochromatin and a lack of pairing in a few chromosomal termini. This study provides fundamental knowledge on cowpea chromosome structure and molecular cytogenetics tools for further chromosome studies.

  4. Sprouting characteristics and associated changes in nutritional composition of cowpea (Vigna unguiculata).

    Science.gov (United States)

    Devi, Chingakham Basanti; Kushwaha, Archana; Kumar, Anil

    2015-10-01

    Cowpea (Vigna unguiculata), is an important arid legume with a good source of energy, protein, vitamins, minerals and dietary fibre. Sprouting of legumes enhances the bioavailability and digestibility of nutrients and therefore plays an important role in human nutrition. Improved varieties of grain cowpea viz. Pant Lobia-1 (PL-1) and Pant Lobia-2 (PL-2) and Pant Lobia-3 (PL-3) were examined for sprouting characteristics and associated changes in nutritional quality. Soaking time, sprouting time and sprouting temperature combinations for desirable sprout length of ¼ to ½ inch for cowpea seed samples were standardized. All the observations were taken in triplicate except soaking time, where six observations were taken in a completely randomized design of three treatments. Results revealed that optimum soaking time of PL-1 and PL-2 seed was 3 h whereas PL-3 required 9 h. Sprouting period of 24 h at 25 °C was found to be desirable for obtaining good sprouts. Significant improvement in nutritional quality was observed after sprouting at 25 °C for 24 h; protein increased by 9-12 %, vitamin C increased by 4-38 times, phytic acid decreased by 4-16 times, trypsin inhibitor activity decreased by 28-55 % along with an increase of 8-20 % in in-vitro protein digestibility.

  5. Toxic effects of Pb2+ on growth of cowpea (Vigna unguiculata)

    International Nuclear Information System (INIS)

    Kopittke, Peter M.; Asher, Colin J.; Kopittke, Rosemary A.; Menzies, Neal W.

    2007-01-01

    A concentration as low as 1 μM lead (Pb) is highly toxic to plants, but previous studies have typically related plant growth to the total amount of Pb added to a solution. In the present experiment, the relative fresh mass of cowpea (Vigna unguiculata) was reduced by 10% at a Pb 2+ activity of 0.2 μM for the shoots and at a Pb 2+ activity of 0.06 μM for the roots. The primary site of Pb 2+ toxicity was the root, causing severe reductions in root growth, loss of apical dominance (shown by an increase in branching per unit root length), the formation of localized swellings behind the root tips (due to the initiation of lateral roots), and the bending of some root tips. In the root, Pb was found to accumulate primarily within the cell walls and intercellular spaces. - The Pb 2+ ion reduced the growth of cowpea by 10% at a solution activity of 0.2 μM for the shoots and 0.06 μM for the roots

  6. 28-Homobrassinolide mitigates boron induced toxicity through enhanced antioxidant system in Vigna radiata plants.

    Science.gov (United States)

    Yusuf, Mohammad; Fariduddin, Qazi; Ahmad, Aqil

    2011-11-01

    The objective of this study was to establish relationship between boron induced oxidative stress and antioxidant system in Vigna radiata plants and also to investigate whether brassinosteroids will enhance the level of antioxidant system that could confer tolerance to the plants from the boron induced oxidative stress. The mung bean (V. radiata cv. T-44) plants were administered with 0.50, 1.0 and 2.0 mM boron at 6 d stage for 7 d along with nutrient solution. At 13 d stage, the seedlings were sprayed with deionized water (control) or 10(-8) M of 28-homobrassinolide and plants were harvested at 21 d stage to assess growth, leaf gas-exchange traits and biochemical parameters. The boron treatments diminished growth, water relations and photosynthetic attributes along with nitrate reductase and carbonic anhydrase activity in the concentration dependent manner whereas, it enhanced lipid peroxidation, electrolyte leakage, accumulation of H(2)O(2) as well as proline, and various antioxidant enzymes in the leaves of mung bean which were more pronounced at higher concentrations of boron. However, the follow-up application of 28-homobrassinolide to the boron stressed plants improved growth, water relations and photosynthesis and further enhanced the various antioxidant enzymes viz. catalase, peroxidase and superoxide dismutase and content of proline. The elevated level of antioxidant enzymes as well as proline could have conferred tolerance to the B-stressed plants resulting in improved growth, water relations and photosynthetic attributes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. TRUE METABOLIZABLE ENERGY AND DIGESTIBILITY OF FIVE Vigna unguiculata VARIETIES IN CHICKENS

    Directory of Open Access Journals (Sweden)

    Luis Armando Sarmiento-Franco

    2010-11-01

    Full Text Available This study was carried out to evaluate the effect of heat-treatment on grain true metabolizable energy (TME, dry matter and gross energy digestibilities of five Vigna unguiculata varieties: H82, T782, TM97, C666 y XL. The grain of the former three varieties were heat-treated, and offered raw or cooked, whereas grain of the late two varieties were used only row, resulting in a total of eight treatments. The heat treatment consisted of watering the grains with boiling water for 30 minutes and drying at 60°C.  Forty-five Hubbard male chickens (2.1 ± 0.2 kg housed in individual wire pens were used to evaluate the treatments. Five chickens from each treatment were fed 40 g of treated grain in mash form, using the force-feeding technique. Additionally, five fasted chickens were used to calculate the endogenous energy and DM losses. The data were submitted to an analysis of variance according to the randomized statistical model; to evaluate the effect of heat treatment orthogonal contrasts were performed. There were no significant differences in all the variables neither among varieties nor between heat treatments (P>0.05. TME values in this study were similar to those found in the literature and equivalent to the TME value of soybean meal, a conventional feedstuff used in the poultry industry.

  8. Evaluation of ecophysiological characteristics of intercropping of millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    A. Ghanbari

    2016-04-01

    Full Text Available In order to evaluate millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L. intercropping, an experiment was conducted during 2008-2009 at Agriculture Research Center of Zabol University, Iran. The experiment was as randomized complete block design with three replications. Treatment s consisted of sole crop of millet, sole crop of cowpea, 25% millet + 100% cowpea, 50% millet + 50% cowpea, 75% millet + 100% cowpea and 100% millet + 100% cowpea. The results showed that intercropping treatments had significant effect (P < 1% on millet and bean seed yield, LER, dry matter of weeds, PAR, temperature and (P < 5% on soil moisture content. The highest seed yield of millet and cowpea obtained from treatments of sole crops. The LER for most intercrops was greater than one which indicated that intercropping had advantage over sole crop. For weeds management and control the results indicated that weed suppressing effects in intercropping treatments is better than sole crops treatment, so that the lowest dry matter of weeds obtained from 100% millet + 100% cowpea treatment. PAR in all of stages showed that the highest PAR interception obtained from intercropping treatments specially 100% millet + 100% cowpea treatment. In addition to the lowest of soil moisture content and temperature obtained from this treatment.

  9. Improvement of the Chinese bean [Vigna Unguiculata (L.) Walp.], through radioinduced mutagenesis

    International Nuclear Information System (INIS)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Solis M, M.; Cervantes S, T.; Cruz T, E. de la

    2006-01-01

    The advances in the process of genetic improvement of the Chinese bean (Vigna Unguiculata (L.) are presented, high nutritious value that it is evaluating as alternative for marginal areas producers of the State of Guerrero. The method of improvement applied it is recurrent radiation, continued by selection cycles applying the method of progeny by plant. The applied radiation doses were 200 and 250 Gray. The established selection approaches are: resistant plants or tolerant to the plagues attack and illnesses, vigorous, with more height to the first sheath, of compact and certain growth, with short internodes, bigger number of sheaths by plant and of grains by sheath, bigger number of grain size, among others. The obtained results show that the dose that induces bigger variability and that it has propitiated the biggest quantity in possible mutants it is 200Gy. Precocious plants with more height to the first sheath, with certain growth as well as with bigger number and sheaths size have been detected. The selected plants have incorporated to an increment process by means of the progeny method by plant. (Author)

  10. A study on Maruca vitrata infestation of Yard-long beans (Vigna unguiculata subspecies sesquipedalis

    Directory of Open Access Journals (Sweden)

    R.C. Jayasinghe

    2015-09-01

    Full Text Available Globally, Maruca vitrata (Geyer is a serious yield constraint on food legumes including Yard-long bean (Vigna unguiculata subspecies sesquipedalis. However, there is a dearth of information on its damage potential, distribution and population dynamics in Yard-long beans. In the present study, the level of M. vitrata larval infestation on flowers and pods of Yard-long beans in Sri Lanka was determined with respect to three consecutive cropping seasons, Yala, Off and Maha. Results indicated that larval infestation and abundance varied with developmental stage of flowers and pods, cropping season and their combined interactive effects. Flowers of Yard-long beans were more prone to M. vitrata larval attack compared to pods. Abundance and level of infestation of M. vitrata varied with plant parts, having a ranking of flower buds (highest > open flowers > mature pods > immature pods (lowest. Peak infestation was observed six and eight weeks after planting on flowers and pods, respectively. Among the three cropping seasons, M. vitrata infestation was found to be higher during Maha and Off seasons compared to Yala. The findings of this study contribute to the identified knowledge gap regarding the field biology of an acknowledged important pest, M. vitrata, in a previously understudied crop in Sri Lanka.

  11. Toxic effects of low concentrations of Cu on nodulation of cowpea (Vigna unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Kopittke, Peter M. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia)]. E-mail: p.kopittke@uq.edu.au; Dart, Peter J. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia); Menzies, Neal W. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia)

    2007-01-15

    Although Cu is phytotoxic at Cu{sup 2+} activities as low as 1-2 {mu}M, the effect of Cu{sup 2+} on the nodulation of legumes has received little attention. The effect of Cu{sup 2+} on nodulation of cowpea (Vigna unguiculata (L.) Walp. cv. Caloona) was examined in a dilute solution culture system utilising a cation exchange resin to buffer solution Cu{sup 2+}. The nodulation process was more sensitive to increasing Cu{sup 2+} activities than both shoot and root growth; whilst a Cu{sup 2+} activity of 1.0 {mu}M corresponded to a 10% reduction in the relative yield of the shoots and roots, a Cu{sup 2+} activity of 0.2 {mu}M corresponded to a 10% reduction in nodulation. This reduction in nodulation with increasing Cu{sup 2+} activity was associated with an inhibition of root hair formation in treatments containing {>=}0.77 {mu}M Cu{sup 2+}, rather than to a reduction in the size of the Rhizobium population. - The nodulation process was more sensitive to increasing Cu{sup 2+} activities than either shoot or root growth.

  12. Cluster analysis technique for assessing variability in cowpea (Vigna unguiculata L. Walp accessions from Nigeria

    Directory of Open Access Journals (Sweden)

    Ajayi Abiola Toyin

    2013-01-01

    Full Text Available The genetic variability among 10 accessions of cowpea, Vigna unguiculata (L. Walp was studied by the use of 13 qualitative and 13 quantitative traits. From the results on qualitative traits, dendrogram grouped the 10 accessions into two major clusters, 1 and 2.Cluster 1 had 3 accessions and cluster 2 had 2 sub-clusters (I and II, having 2 accessions in sub-cluster I and 5 accessions in sub-cluster II. The dendrogram revealed two major clusters, 1 and 2, for quantitative data, for the 10 accessions. At distance of 4 and 6, cluster 1 had two sub-clusters (I and II, with sub-cluster I having 5 accessions, sub-cluster II having 4 accessions while cluster 2 had only 1 accession. This study made the observation that identification of the right agro-morphological traits of high discriminating capacity is essential, before embarking on any genetic diversity; as it was revealed that some traits discriminated more efficiently among the accessions than others. A group of accessions, which are NGSA1, NGSA2, NGSA3, NGSA4, NGSA7, NGSA9 and NGSA10, was identified as being different from the others for number of seeds per pod, pod length, plant height, peduncle length, seed weight and number of pods per plant. These accessions may be good for cowpea improvement programs.

  13. PRODUCTION COMPONENTS OF Vigna unguiculata (L. Walp IRRIGATED WITH BRACKISH WATER UNDER DIFFERENT LEACHING FRACTIONS

    Directory of Open Access Journals (Sweden)

    JOSÉ FRANCISCO DE CARVALHO

    2016-01-01

    Full Text Available The objective of this work was to evaluate the production components of cowpea ( Vigna unguiculata L. Walp subjected to irrigation with brackish water and different leaching fractions. The experiment was conducted in a lysimeter system of the Department of Agricultural Engineering of the Federal Rural University of Pernambuco, Recife campus. The treatments, consisting of two water salinity levels (ECw (1.2 and 3.3 dS m - 1 and five leaching fractions (0, 5, 10, 15 and 20%, were evaluated using a completely randomized design in a 2x5 factorial arrangement with four replications. The variables evaluated were: number of pods per plant, 100 - grain weight, number of grains per pod, grain and shoot dry weight, grain yield and harvest index. The soil salinity increased with increasing salinity of the water used for irrigation, and reduced with increasing leaching fraction. The salinity of the water used for irrigation influenced only the variables number of pods per plant and grain yield. The estimated leaching fractions of 9.1% and 9.6% inhibited the damage caused by salinity on the number of pods per plant and grain yield, respectively. Therefore, the production of V. unguiculata irrigated with brackish water, leaching salts from the plant root environment, is possible under the conditions evaluated.

  14. Effect of gamma irradiation and cooking on cowpea bean grains (Vigna unguiculata L. Walp)

    Energy Technology Data Exchange (ETDEWEB)

    Santos Cople Lima, Keila dos, E-mail: keila@ime.eb.br [Nuclear Engineering Department, Military Institute of Engineering, Rio de Janeiro/RJ, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil); Boher e Souza, Luciana [Nuclear Engineering Department, Military Institute of Engineering, Rio de Janeiro/RJ, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil); Oliveira Godoy, Ronoel Luiz de [Technological Center, Embrapa Food Agroindustry, Av. das Americas, 29501, CEP 23020-470 Rio de Janeiro/RJ (Brazil); Costa Franca, Tanos Celmar; Santos Lima, Antonio Luis dos [Chemical Engineering Department, Military Institute of Engineering, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil)

    2011-09-15

    Leguminous plants are important sources of proteins, vitamins, carbohydrates, fibers and minerals. However, some of their non-nutritive elements can present undesirable side effects like flatulence provoked by the anaerobic fermentation of oligosaccharides, such as raffinose and stachyose, in the gut. A way to avoid this inconvenience, without any change in the nutritional value and post-harvesting losses, is an irradiation process. Here, we evaluated the effects of gamma irradiation on the amino acids, thiamine and oligosaccharide contents and on the fungi and their toxin percentages in cowpea bean (Vigna unguiculata L. Walp) samples. For irradiation doses of 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 kGy the results showed no significant differences in content for the uncooked samples. However, the combination of irradiation and cooking processes reduced the non-nutritive factors responsible for flatulence. Irradiation also significantly reduced the presence of Aspergillus, Penicilium, Rhizopus and Fusarium fungi and was shown to be efficient in grain conservation for a storage time of 6 months. - Highlights: > In this study we evaluated cowpea beans subjected to different doses of gamma irradiation > Cowpea bean grains represent an important source of vegetal protein for Brazilian population. > Non-nutritive factors were reduced by irradiation and cooking. > Several genera of fungus were reduced by irradiation without affecting the nutritional content. > Irradiation helps the cooking process preserving thermosensible nutrients.

  15. Toxic effects of Pb{sup 2+} on growth of cowpea (Vigna unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Kopittke, Peter M. [School of Land, Crop and Food Sciences and CRC for Contamination Assessment and Remediation of the Environment, University of Queensland, St. Lucia, Queensland 4072 (Australia)], E-mail: p.kopittke@uq.edu.au; Asher, Colin J. [School of Land, Crop and Food Sciences, University of Queensland, St. Lucia, Queensland 4072 (Australia); Kopittke, Rosemary A. [Department of Primary Industries and Fisheries, 80 Meiers Road, Indooroopilly, Queensland 4068 (Australia); Menzies, Neal W. [School of Land, Crop and Food Sciences and CRC for Contamination Assessment and Remediation of the Environment, University of Queensland, St. Lucia, Queensland 4072 (Australia)

    2007-11-15

    A concentration as low as 1 {mu}M lead (Pb) is highly toxic to plants, but previous studies have typically related plant growth to the total amount of Pb added to a solution. In the present experiment, the relative fresh mass of cowpea (Vigna unguiculata) was reduced by 10% at a Pb{sup 2+} activity of 0.2 {mu}M for the shoots and at a Pb{sup 2+} activity of 0.06 {mu}M for the roots. The primary site of Pb{sup 2+} toxicity was the root, causing severe reductions in root growth, loss of apical dominance (shown by an increase in branching per unit root length), the formation of localized swellings behind the root tips (due to the initiation of lateral roots), and the bending of some root tips. In the root, Pb was found to accumulate primarily within the cell walls and intercellular spaces. - The Pb{sup 2+} ion reduced the growth of cowpea by 10% at a solution activity of 0.2 {mu}M for the shoots and 0.06 {mu}M for the roots.

  16. De novo transcriptome assembly of two Vigna angularis varieties collected from Korea

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2016-06-01

    Full Text Available The adzuki bean (Vigna angularis, a member of the family Fabaceae, is widely grown in Asia, from East Asia to the Himalayas. The adzuki bean is known as an ingredient that adds sweetness to diverse desserts made in Eastern Asian countries. Libraries prepared from two V. angularis varieties referred to as Taejin Black and Taejin Red were paired-end sequenced using the Illumina HiSeq 2000 system. The raw data in this study can be available in NCBI SRA database with accession numbers of SRR3406660 and SRR3406553. After de novo transcriptome assembly using Trinity, we obtained 324,219 and 280,056 transcripts from Taejin Black and Taejin Red, respectively. We predicted a total of 238,321 proteins and 179,519 proteins for Taejin Black and Taejin Red, respectively, by the TransDecoder program. We carried out BLASTP on the predicted proteins against the Swiss-Prot protein sequence database to predict the putative functions of identified proteins. Taken together, we provide transcriptomes of two adzuki bean varieties by RNA-Seq, which might be usefully applied to generate molecular markers.

  17. Biochemical Changes under Chromium Stress on Germinating Seedlings of Vigna radiata

    Directory of Open Access Journals (Sweden)

    Bhavin SUTHAR

    2014-03-01

    Full Text Available Hexavalant chromium is considered the most toxic form because of its high solubility in water. Cr is known to induce production of elevated concentration of reactive oxygen species (ROS resulted in macromolecule damage. Plants are having unique mechanisms to overcome ROS induced damage by accumulation of proline, ascorbate and glutathione and increasing the activities of antioxidant enzymes such as superoxide dismutase (SOD, catalase (CAT, glutathione reductase (GR, and ascorbate peroxidaes (APX, peroxidise (POX. In the present investigation effects of chromium on seed germination of Mung bean (Vigna radiata 'Gujarat Mung-4’ were studied. Seeds were treated with different Cr concentrations (50, 100, 150 and 200 4M for seven days. On 7th day root and shoot length was measured and activities of antioxidant enzyme SOD, APX, POX, CAT and GR were checked along with protein, proline and lipid peroxidation. It was observed that there is gradual decrease in shoot and root length with respect to the increase in Cr concentration. Level of lipid peroxidation significantly increased along with proline and antioxidant enzyme activity at higher Cr concentration. Lipid peroxidation is an indication of membrane damage due to elevated production of reactive oxygen species (ROS. To combat oxidative damage by ROS antioxidant enzyme activity increased significantly, which indicates that antioxidant enzymes (SOD, CAT, APX and GR play a crucial role during Cr stress during germination of V. radiata.

  18. Toxic effects of low concentrations of Cu on nodulation of cowpea (Vigna unguiculata)

    International Nuclear Information System (INIS)

    Kopittke, Peter M.; Dart, Peter J.; Menzies, Neal W.

    2007-01-01

    Although Cu is phytotoxic at Cu 2+ activities as low as 1-2 μM, the effect of Cu 2+ on the nodulation of legumes has received little attention. The effect of Cu 2+ on nodulation of cowpea (Vigna unguiculata (L.) Walp. cv. Caloona) was examined in a dilute solution culture system utilising a cation exchange resin to buffer solution Cu 2+ . The nodulation process was more sensitive to increasing Cu 2+ activities than both shoot and root growth; whilst a Cu 2+ activity of 1.0 μM corresponded to a 10% reduction in the relative yield of the shoots and roots, a Cu 2+ activity of 0.2 μM corresponded to a 10% reduction in nodulation. This reduction in nodulation with increasing Cu 2+ activity was associated with an inhibition of root hair formation in treatments containing ≥0.77 μM Cu 2+ , rather than to a reduction in the size of the Rhizobium population. - The nodulation process was more sensitive to increasing Cu 2+ activities than either shoot or root growth

  19. Effects of ozone on growth, net photosynthesis and yield of two African varieties of Vigna unguiculata.

    Science.gov (United States)

    Tetteh, Rashied; Yamaguchi, Masahiro; Wada, Yoshiharu; Funada, Ryo; Izuta, Takeshi

    2015-01-01

    To assess the effects of O(3)on growth, net photosynthesis and yield of two African varieties of cowpea(Vigna unguiculata L.), Blackeye and Asontem were exposed as potted plants to air that was either filtered to remove O(3) (FA), non-filtered air (NF), non-filtered with added O3 of approximately 50 nL L(-1) (ppb) from 11:00 to 16:00 (NF + O(3)) for 88 days in open-top chambers. The mean O(3) concentration (11:00-16:00) during the exposure period had a range from 16 ppb in the FA treatment to 118 ppb in the NF + O(3) treatment. Net photosynthetic rate and leaf area per plant were significantly reduced by exposure to O(3), reducing the growth of both varieties. Exposure to O(3) significantly reduced the 100-seed weight and number of seeds per pod. As a result, cowpea yield was significantly reduced by long-term exposure to O(3), with no difference in sensitivity between the varieties.

  20. Identification of Bradyrhizobium elkanii Genes Involved in Incompatibility with Vigna radiata

    Directory of Open Access Journals (Sweden)

    Hien P. Nguyen

    2017-12-01

    Full Text Available The establishment of a root nodule symbiosis between a leguminous plant and a rhizobium requires complex molecular interactions between the two partners. Compatible interactions lead to the formation of nitrogen-fixing nodules, however, some legumes exhibit incompatibility with specific rhizobial strains and restrict nodulation by the strains. Bradyrhizobium elkanii USDA61 is incompatible with mung bean (Vigna radiata cv. KPS1 and soybean cultivars carrying the Rj4 allele. Here, we explored genetic loci in USDA61 that determine incompatibility with V. radiata KPS1. We identified five novel B. elkanii genes that contribute to this incompatibility. Four of these genes also control incompatibility with soybean cultivars carrying the Rj4 allele, suggesting that a common mechanism underlies nodulation restriction in both legumes. The fifth gene encodes a hypothetical protein that contains a tts box in its promoter region. The tts box is conserved in genes encoding the type III secretion system (T3SS, which is known for its delivery of virulence effectors by pathogenic bacteria. These findings revealed both common and unique genes that are involved in the incompatibility of B. elkanii with mung bean and soybean. Of particular interest is the novel T3SS-related gene, which causes incompatibility specifically with mung bean cv. KPS1.

  1. Reduction in flatulence factors in mung beans (Vigna radiata) using low-dose gamma-irradiation

    International Nuclear Information System (INIS)

    Machaiah, J.P.; Pednekar, M.D.; Thomas, P.

    1999-01-01

    Mungbeans (Vigna radiata), control and gamma-irradiated at insect disinfestation dose levels (0.25 and 0.75 kGy) were germinated (0-6 Bays) and the qualitative and quantitative changes in soluble carbohydrates were studied in detail. The key flatulence-producing raffinose family oligosaccharides inmungbeans were degraded in the irradiated samples at the onset of the germination (0-2 days) compared to the control where it occurred much later (>4days). However, the reducing sugars, mainly glucose, fructose and galactose, which are metabolised easily, were enhanced in the irradiated samples. At low dose (0.25 kGy), irradiation had no effect on germination and sprout length, indicating that irradiated beans are suitable for use as sprouted beans. These observations clearly indicate that gamma-irradiation at insect disinfestation dose levels improved the digestibility and nutritional quality of mung beans by reducing the content of oligosaccharides responsible for intestinal gas production. (C) 1999 Society of Chemical Industry

  2. Growth, photosynthesis, and antioxidant responses of Vigna unguiculata L. treated with hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Syed Aiman Hasan

    2016-12-01

    Full Text Available Cowpea (Vigna unguiculata L. is an important legume well grown in semiarid and arid environment. Hydrogen peroxide solutions (0.1, 0.5, 1.0, and 1.5 mM have been used to optimize growth and photosynthetic performance of cowpea plant at two growth stages [30 and 45 DAS (days of sowing]. Foliar application of H2O2 at 0.5 > 1.0 mM solution at 29 DAS optimally promoted the photosynthetic attributes [leaf chlorophyll content, net photosynthetic rate (PN, water use efficiency, and maximum quantum yield of PSII (Fv/Fm] and growth performance [root and shoot length; fresh and dry weight] of plants where the responses were more significant at the later growth stage. It was favored by activity of enzymes as carbonic anhydrase [CA; E.C. 4.2.1.1] and nitrate reductase [NR, E.C. 1.6.6.1] and those of antioxidant enzymes viz. peroxidase [POX; EC 1.11.1.7], catalase [CAT; EC 1.11.1.6], and superoxide dismutase [SOD; EC 1.15.1.1] and leaf proline content. Strengthened root system and antioxidant activity, particularly leaf proline level appeared to be the key factor for efficient photosynthesis and growth responses.

  3. Increased antioxidant activity and polyphenol metabolites in methyl jasmonate treated mung bean (Vigna radiata sprouts

    Directory of Open Access Journals (Sweden)

    Li LI

    Full Text Available Abstract Mung bean sprouts are a popular health food both in China and worldwide. We determined the optimal concentration of exogenous methyl jasmonate (MeJA for the promotion of the sprouting in mung beans (Vigna radiata. The 1,1-diphenyl-2- picrylhydrazyl radical (DPPH scavenging test showed that MeJA application resulted in significantly improved antioxidant capacity in the sprouts 72 h later. Measurement of total polyphenols in MeJA-treated beans from 0 to 168 h, using Folin–Ciocalteu colorimetry, showed that the polyphenols changing was significantly correlated with antioxidant activity. The main polyphenols isovitexin, kaempferol-3-O-rutinoside, daidzein, genistein, isoquercitrin, p-coumaric acid, and caffeic acid were quantified using high-performance liquid chromatography (HPLC/QqQ MS and partial least squares discriminant analysis (PLS-DA. MeJA promoted the production of polyphenols, metabolites, and antioxidants in the sprouts; therefore, its use may allow sprouts to be prepared more quickly or increase their nutritional value.

  4. Determinación de la composición físico-química y de la digestibilidad in vitro de dos variedades de frijol común Phaseolus vulgaris L. estimación del contenido de pectina y celulosa en el residuo indigerible

    OpenAIRE

    Víquez Rodríguez, Floribeth; Bonilla Leiva, Ana Ruth

    2000-01-01

    El propósito de este estudio fue determinar, mediante un estudio de digestibilidad in vitro, la porción indigerible presente en dos variedades de frijol común Phaseolus vulgaris L. consumidas en Costa Rica y cuantificar en dicha porción, dos de los principales polisacáridos no almidonosos causantes de flatulencia: pectina y celulosa. Se determinaron además, las principales características físicas (tamaño y tasa de absorción de agua) y químicas (contenido de proteínas, grasa, cenizas y carbohi...

  5. Improvement of the antioxidant and hypolipidaemic effects of cowpea flours (Vigna unguiculata) by fermentation: results of in vitro and in vivo experiments.

    Science.gov (United States)

    Kapravelou, Garyfallia; Martínez, Rosario; Andrade, Ana M; López Chaves, Carlos; López-Jurado, María; Aranda, Pilar; Arrebola, Francisco; Cañizares, Francisco J; Galisteo, Milagros; Porres, Jesús M

    2015-04-01

    The antioxidant capacity and hypolipidaemic effects of Vigna unguiculata, as well as their potential improvement by different fermentation and thermal processes were studied using in vitro and in vivo methods. Phenolic content and reducing capacity of legume acetone extract were significantly increased by different fermentation processes, and by the thermal treatment of fermented legume flours. TBARS inhibiting capacity was increased by fermentation but not by thermal treatment. A higher ability to decrease Cu(2+)/H2O2-induced electrophoretic mobility of LDL was found in fermented when compared to raw legume extracts, and a higher protective effect on short term metabolic status of HT-29 cells was found for raw and lactobacillus-fermented Vigna followed by naturally fermented Vigna extracts. Significant improvements in plasma antioxidant capacity and hepatic activity of antioxidant enzymes were observed in rats that consumed fermented legume flours when compared to the untreated legume or a casein-methionine control diet. In addition, liver weight and plasma levels of cholesterol and triglycerides were also positively affected by untreated or naturally fermented Vigna. V. unguiculata has demonstrated its potential as a functional food with interesting antioxidant and lipid lowering properties, which can be further augmented by fermentation processes associated or not to thermal processing. © 2014 Society of Chemical Industry.

  6. Population structure analysis and association mapping of seed antioxidant content in USDA cowpea (Vigna unguiculata L. Walp.) core collection using SNPs

    Science.gov (United States)

    Cowpea (Vigna unguiculata (L) Walp.) is an important legume and the antioxidants in cowpea seeds have been recognized as health-promoting compounds for human. The objectives of this study were to analyze the population structure of cowpea collections using single nucleotide polymorphism (SNP) and to...

  7. Alleviation of Cu and Pb rhizotoxicities in cowpea (Vigna unguiculata) as related to ion activities at root-cell plasma membrane surface

    Science.gov (United States)

    Cations, such as Ca and Mg, are generally thought to alleviate toxicities of trace metals through site-specific competition (as incorporated in the biotic ligand model, BLM). Short term (48 h) experiments were conducted using cowpea (Vigna unguiculata L. Walp.) seedlings in simple nutrient solution...

  8. Biogenic synthesis and spatial distribution of silver nanoparticles in the legume mungbean plant (Vigna radiata L.).

    Science.gov (United States)

    Kumari, Rima; Singh, Jay Shankar; Singh, Devendra Pratap

    2017-01-01

    The present investigation aimed to study the in vivo synthesis of silver nanoparticles (AgNPs) in the legume Vigna radiata. The level of plant metabolites such as total phenolics, lipid, terpenoids, alkaloids and amino acid increased by 65%, 133%, 19%, 67% and 35%, respectively, in AgNO 3 (100 mg L -1 ) treated plants compared to control. Whereas protein and sugar contents in the treated plants were reduced by 38% and 27%, respectively. FTIR analysis of AgNO 3 (20-100 mg L -1 ) treated plants exhibited changes in the IR regions between 3297 and 3363 cm -1 , 1635-1619 cm -1 , 1249-1266 cm -1 and that corresponded to alterations in OH groups of carbohydrates, OH and NH groups of amide I and II regions of protein, when compared with the control. Transmission electron micrographs showed the spatial distribution of AgNPs in the chloroplast, cytoplasmic spaces, vacuolar and nucleolar plant regions. Metal quantification in different tissues of plants exposed to 20-100 mg L -1 AgNO 3 showed about a 22 fold accumulation of Ag in roots as compared to shoots. The phytotoxic parameters such as percent seed germination and shoot elongation remained almost unaltered at low AgNO 3 doses (20-50 mg L -1 ). However, at higher levels of exposure (100 mg L -1 ), the percent seed germination as well as root and shoot elongation exhibited concentration dependent decline. In conclusion, synthesis of AgNPs in V. radiata particularly at lower doses of AgNO 3 , could be used as a sustainable and environmentally safe technology for large scale production of metal nanoparticles. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. Quarantine treatment by gamma radiation for different development stages of Callosobruchus maculatus in bean Vigna sinensis

    International Nuclear Information System (INIS)

    Arthur, Valter; Machi, André R.; Franco, Suely S.H.

    2017-01-01

    The loss of stored grain caused by insects generates a problem of economic order of importance, due to concern about the increased supply of food for the world population is expanding. Associated with this fact, there is the problem of nutritional deficiency due to lack of protein, especially for the less privileged populations. The use of ionizing radiation in grains and products stored without a doubt can solve the problem of the losses in these products, since it does not induce resistance to insects and leaves no toxic residue in the products, and is considered an effective and safe method. The aim of the experiment was to determine the effect of ionizing radiation from cobalt-60 as a quarantine treatment for the different stages of development of Callosobruchus maculatus (Fabr., 1972) (Coleóptera, Chysomilidae) in bean Vigna sinensis. The experiment was conducted in the laboratory of Radiobiology and Environment CENA/USP, Piracicaba, SP, Brazil. Bean samples infested with eggs, larvae, pre-pupae and pupae C. maculatus, the experiment consisted of 4 replicates for each stage of the insect's life cycle, and each repetition consisted of 20 individuals (eggs, larvae, pre-pupae and pupae), a total of 200 subjects per treatment which were irradiated with doses of 0 (control), 25, 50, 75 and 100 Gy, a source of cobalt-60, Gammabeam-650 type, in a rate dose of 1.3 kGy / h. The experiment was conducted in a room with a relative of 25 ± 2 ° C temperature and humidity of 70 ± 5%. After 35 days of irradiation process were carried out evaluations of the number of insects emerged in each repetition within the treatments. From the results obtained it was concluded that the dose lethal to eggs and larvae was 25 Gy, while for pre-pupae was 50 Gy, to pupae 100 Gy was not sufficient to control the adult emergence. (author)

  10. [Use of cowpea (Vigna sinensis) as a chicken complement in an infant formula].

    Science.gov (United States)

    Modernell, Marisa Guerra; Granito, Marisela; Paolini, Mariangel; Olaizola, Cristina

    2008-09-01

    Legumes represent an important protein source worldwide. In Venezuela, they are generally prepared at home and are consumed by adults, as soup or stew, while children eat them in very small quantities. In order to include legumes in the children's diet, the following work was done using cowpea (Vigna sinensis) as an complement of chicken in the preparation of a nutritionally balanced formula, adapted to the requirements of children. Several formulas were developed and three of them were selected based on their acceptability. In the first formula, the protein source was only of chicken. In the second formula, the chicken was partially substituted by cowpea, and in the third formula, the protein source was only made of cowpea. Other formula ingredients included rice, pumpkin (Curcubita maxima), carrot and some seasonings. Proximal analysis, protein quality (as protein efficiency ratio and protein digestibility) and sensory evaluation (7-point hedonic scale) were performed on the formulas. The proximal composition was similar in the three formulas: protein (3.5%), fat (1.3%) and carbohydrates (19.7%), with a good distribution of the energy contribution (98.9 kcal/100 g or 413.8 kJ/100 g). The protein quality and protein digestibility were higher for the chicken-cowpea formula than for the cowpea one. The acceptability with the mothers was higher for the chicken-cowpea formula than for the cowpea one. The acceptability of the chicken-cowpea formula with children was 77% (7-point hedonic facial scale) and 92% (measuring consumption). Due to the high acceptability and good protein quality, the chicken-cowpea formula could be included in the lunch meal of the children in daycare homes.

  11. Evaluation of aminoacids in irradiated beans (Vigna unguiculata (L.) Walp) by high performance liquid chromatography (HPLC)

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Keila S. Cople; Souza, Luciana B.; Coelho, Maysa J.; Lima, Antonio L. Santos; Hernandes, Nilber K. [Instituto Militar de Engenharia (IME), Rio de Janeiro, RJ (Brazil). Secao de Engenharia Nuclear]. E-mail: keila@ime.eb.br; Godoy, Ronoel L.O. [EMBRAPA Agroindustria de Alimentos, Rio de Janeiro, RJ (Brazil)]. E-mail: ronoel@ctaa.embrapa.br

    2007-07-01

    Fradinho-bean (Vigna unguiculata (L.) Walp) is originated from Africa and is known in Brazil as 'caupi', 'corda' or 'macassar'. It is grown in the interior of Northeast Brazil (semi-arid region) and can be found in parts of the North, being one of the most important components of people's diet in those regions. The Northeast area produces around 429,375 ton of fradinho-bean per year. Leguminous plants are very important sources of proteins, vitamins, carbohydrates and minerals. This kind of bean is an excellent source of proteins (around 23- 25% of its nutritional content), being superior to regular beans (Phaseolus vulgaris). The irradiation process is an alternative to avoid post-harvesting losses, without changing the nutritional value of food. This study has the objective to evaluate the effect of different gamma irradiation doses (0.0; 0.5; 1.0; 2.5; 5.0 and 10.0 kGy) on aminoacid content of fradinho-bean by high performance liquid chromatography (HPLC) and the accompanying of the grains during storage time of 6 months. After irradiation, the bean grains went through a milling process in order to make flour for posterior extraction. A liquid chromatographer Waters, model Alliance 2695, with fluorescent detector Waters 2475, having a mobile phase with gradient elution of sodium acetate. acetonitrile and Milli-Q water, was employed. The flux used was 1 mL/min and the injection volume of 10 {mu}L. The column (C 18 150.0 x 3.9 mm) was kept at 36 deg C. The results show that gamma irradiation is a promise process for fradinho bean during conservation storage time of 6 months, until the dose of 10.0 kGy. Even the most radio-sensitive aminoacids like aromatics and basic lateral chains were preserved. (author)

  12. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars (Vigna unguiculata L. Walp)

    International Nuclear Information System (INIS)

    Ocloo, F.C.K.; Darfour, B.; Ofosu, D.O.; Wilson, D.D.

    2012-01-01

    Cowpeas (Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly (p>0.05) affected by the radiation. There was no significant (p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p>0.05) the acceptability of the treated cowpea cultivars. - Highlights: → We investigated the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. → Four cowpea cultivars were irradiated at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. → Physical parameters were not significantly (p>0.05) affected by the radiation. → Sensory attributes considered were not significantly influenced by the radiation doses used.

  13. Effects of cowpea (Vigna unguiculata) root mucilage on microbial community response and capacity for phenanthrene remediation.

    Science.gov (United States)

    Sun, Ran; Belcher, Richard W; Liang, Jianqiang; Wang, Li; Thater, Brian; Crowley, David E; Wei, Gehong

    2015-07-01

    Biodegradation of polycyclic aromatic hydrocarbons (PAHs) is normally limited by their low solubility and poor bioavailability. Prior research suggests that biosurfactants are synthesized as intermediates during the production of mucilage at the root tip. To date the effects of mucilage on PAH degradation and microbial community response have not been directly examined. To address this question, our research compared 3 cowpea breeding lines (Vigna unguiculata) that differed in mucilage production for their effects on phenanthrene (PHE) degradation in soil. The High Performance Liquid Chromatography results indicated that the highest PHE degradation rate was achieved in soils planted with mucilage producing cowpea line C1, inoculated with Bradyrhizobium, leading to 91.6% PHE disappearance in 5 weeks. In root printing tests, strings treated with mucilage and bacteria produced larger clearing zones than those produced on mucilage treated strings with no bacteria or bacteria inoculated strings. Experiments with 14C-PHE and purified mucilage in soil slurry confirmed that the root mucilage significantly enhanced PHE mineralization (82.7%), which is 12% more than the control treatment without mucilage. The profiles of the PHE degraders generated by Denaturing gradient gel electrophoresis suggested that cowpea C1, producing a high amount of root mucilage, selectively enriched the PHE degrading bacteria population in rhizosphere. These findings indicate that root mucilage may play a significant role in enhancing PHE degradation and suggests that differences in mucilage production may be an important criterion for selection of the best plant species for use in phytoremediation of PAH contaminated soils. Copyright © 2015. Published by Elsevier B.V.

  14. A novel symbiovar (aegeanense) of the genus Ensifer nodulates Vigna unguiculata.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-10-01

    Cowpea (Vigna unguiculata) forms nitrogen-fixing root nodules with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium, although a few studies have reported the isolation of fast-growing rhizobia under laboratory and field conditions. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, very limited information is available on cowpea rhizobia in European soils. The aim of this study was to study the genetic and phenotypic diversity of indigenous cowpea-nodulating rhizobia in Greece. The genetic diversity of indigenous rhizobia associated with cowpea was investigated through a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into three groups. Based on the analysis of the 16S rRNA genes, IGS and on the concatenation of six housekeeping genes (recA, glnII, gyrB, truA, thrA and SMc00019), rhizobial isolates were classified within the species Ensifer fredii. However, symbiotic gene phylogenies, based on nodC, nifH and rhcRST genes, showed that the Ensifer isolates are markedly diverged from type and reference strains of E. fredii and formed one clearly separate cluster. The E. fredii strains were able to nodulate and fix nitrogen in cowpea but not in soybean and common bean. The present study showed that cowpea is nodulated under field conditions by fast-growing rhizobia belonging to the species E. fredii. Based on the phylogenies, similarity levels of symbiotic genes and the host range, the Ensifer isolates may constitute a new symbiovar for which the name 'aegeanense' is proposed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. Genetic variation for phytic acid content in mungbean (Vigna radiata L. Wilczek

    Directory of Open Access Journals (Sweden)

    Vinod Janardan Dhole

    2015-03-01

    Full Text Available Mungbean (Vigna radiata L. Wilczek is a short-duration legume crop cultivated for seeds that are rich in protein and carbohydrates. Mungbeans contain phytic acid (PA, an anti-nutritional factor that is the main storage form of organic phosphorus in seeds. It is a strong inhibitor against the absorption of nutrients including iron, zinc, calcium and magnesium in monogastric animals. Genotypes with low phytic acid (lpa in seed may show increased assimilation of nutrients and be useful in breeding lpa cultivars. The present study was conducted to identify lpa sources, genetic variation, heritability, and association with seed coat color, inorganic phosphorus (IP, and seed size in 102 mungbean genotypes including released varieties, land races, mutants, and wild species grown in two seasons: summer 2011 and rabi 2012. PA and IP in dry seeds were estimated by modified colorimetric method and Chen's modified method, respectively. PA, IP, and 100-seed weight differed significantly in the two seasons. PA content in 102 genotypes ranged from 5.74 to 18.98 mg g− 1 and 5.85 to 20.02 mg g− 1 in summer 2011 and rabi 2012, respectively. High heritability was found for PA (0.87 and 0.86 and seed size (0.82 and 0.83 but low heritability for IP (0.61 and 0.60. A negative correlation was found between PA and seed size (r = − 0.183 and − 0.267. Yellow and green seed coat genotypes contained significantly less PA than black seed coat genotypes. Cluster analysis revealed the distinctness of wild species, land races and cultivated varieties on the basis of PA content. The genotypes YBSM (6.001 mg g− 1 and JL-781 (6.179 mg g− 1 showed lowest PA. These lpa sources can be used to develop high-yielding mungbean cultivars with low phytic acid.

  16. Variabilidade e correlações entre caracteres agronômicos em caupi (Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Lopes Ângela Celis de Almeida

    2001-01-01

    Full Text Available O caupi (Vigna unguiculata (L. Walp é um alimento básico das populações do Nordeste brasileiro, devendo merecer atenção com vistas a melhoria da qualidade de grãos, resistência a doenças e pragas e aumento de produtividade. Este trabalho teve por objetivo estudar a variabilidade e o potencial genético de 28 linhagens, escolhidas após uma seleção para cor, tamanho de grãos e resistência a viroses. A produtividade apresentou coeficiente de variação genético de 23,90%, e o valor agronômico, de 3,56%. O número de vagens por pedúnculo apresentou a menor estimativa do coeficiente de determinação genético (4,51%, e o peso de 100 grãos, a maior (81,74%. O coeficiente de determinação genético da produtividade foi de 34,15%. As maiores estimativas de ganho genético foram as do peso de 100 grãos (21,73% e da produtividade (19,77%. As correlações genotípicas foram superiores às fenotípicas e às de ambiente, destacando-se as correlações entre número de ramos secundários e produtividade (68,13%, e valor agronômico e produtividade (100%. Estes resultados mostram amplas possibilidades de seleção entre as linhagens com relação à maioria dos caracteres estudados.

  17. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ved Parkash [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Department of Zoology, Panjab University, Chandigarh 160014 (India); Singh, Harminder Pal, E-mail: hpsingh_01@yahoo.com [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Kohli, Ravinder Kumar; Batish, Daizy Rani [Department of Botany, Panjab University, Chandigarh 160014 (India)

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 {mu}W cm{sup -2}; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H{sub 2}O{sub 2}) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at {>=}2 h), and radicle and plumule growths ({>=}1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H{sub 2}O{sub 2} accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  18. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    International Nuclear Information System (INIS)

    Sharma, Ved Parkash; Singh, Harminder Pal; Kohli, Ravinder Kumar; Batish, Daizy Rani

    2009-01-01

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 μW cm -2 ; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H 2 O 2 ) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at ≥2 h), and radicle and plumule growths (≥1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H 2 O 2 accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  19. Phosphorus Response and Amino Acid Composition of Different Green Gram (Vigna radiata L. Genotypes from Myanmar

    Directory of Open Access Journals (Sweden)

    M. Kywe

    2007-10-01

    Full Text Available Mungbean or green gram (Vigna radiata L. is an important component of rice-based cropping systems in Myanmar, where grain yields of around 800 kg ha^(-1 are much below its yield potential of 3000 kg ha^(-1. The reasons for this shortfall are as under-investigated as is the genotype-specific response of this crop to phosphorus (P application, which is critically low in many Myanmar soils, and the genetic variation in grain quality. For green gram quality, the concentration of lysine, an essential amino acid is particularly important given its scarcity in many cereal-based diets of Southeast Asia. The purpose of this study therefore was to investigate the effects of P application on the root and shoot growth, yield and its components for a range of green gram varieties, and to analyse the protein concentration and amino acid composition in green gram seed of different origins. To this end from 2001 to 2003, field experiments were conducted under rain-fed conditions in Yezin and Nyaung Oo. Fifteen landraces and five introduced green gram cultivars were grown at two levels of P (0 and 15 kg ha^(-1. There were large genotypic differences in P effects and a significant interaction between green gram genotypes and P for shoot and root growth. An unexpected benefit of P application was a reduction of pest and plant virus infestation in the field. Significant genotypic differences in the amino acid profile of seeds were also observed. The results indicate the potential for breeding efforts to increase seed yield and protein quality in green gram.

  20. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars (Vigna unguiculata L. Walp)

    Energy Technology Data Exchange (ETDEWEB)

    Ocloo, F.C.K., E-mail: fidelis_ocloo@yahoo.com [Radiation Technology Centre, Biotechnology and Nuclear Agriculture Research Institute, Ghana Atomic Energy Commission. P.O. Box LG 80, Legon (Ghana); Darfour, B.; Ofosu, D.O. [Radiation Technology Centre, Biotechnology and Nuclear Agriculture Research Institute, Ghana Atomic Energy Commission. P.O. Box LG 80, Legon (Ghana); Wilson, D.D. [Department of Zoology, University of Ghana, Legon (Ghana)

    2012-01-15

    Cowpeas (Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly (p>0.05) affected by the radiation. There was no significant (p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p>0.05) the acceptability of the treated cowpea cultivars. - Highlights: > We investigated the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. > Four cowpea cultivars were irradiated at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. > Physical parameters were not significantly (p>0.05) affected by the radiation. > Sensory attributes considered were not significantly influenced by the radiation doses used.

  1. Quarantine treatment by gamma radiation for different development stages of Callosobruchus maculatus in bean Vigna sinensis

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, Valter; Machi, André R.; Franco, Suely S.H., E-mail: arthur@cena.usp.br [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). laboratório de Radiobiologia e Ambiente; Fontes, Lucia da Silva, E-mail: lsfontes@uol.com.br [Universidade Federal do Piauí (UFPI), Teresina, PI (Brazil). Dept. de Biologia; Harder, Márcia N.C., E-mail: marcia.harder@fatec.sp.gov.br [Faculdade de Tecnologia de Piracicaba (FATEC), SP (Brazil). Dep. Roque Trevisan; Rossi, Rodrigo S.; Arthur, Paula B.; Franco, José G., E-mail: paula.arthur@hotmail.com, E-mail: zegilmar60@gamil.com, E-mail: gilmita@uol.com.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

    2017-07-01

    The loss of stored grain caused by insects generates a problem of economic order of importance, due to concern about the increased supply of food for the world population is expanding. Associated with this fact, there is the problem of nutritional deficiency due to lack of protein, especially for the less privileged populations. The use of ionizing radiation in grains and products stored without a doubt can solve the problem of the losses in these products, since it does not induce resistance to insects and leaves no toxic residue in the products, and is considered an effective and safe method. The aim of the experiment was to determine the effect of ionizing radiation from cobalt-60 as a quarantine treatment for the different stages of development of Callosobruchus maculatus (Fabr., 1972) (Coleóptera, Chysomilidae) in bean Vigna sinensis. The experiment was conducted in the laboratory of Radiobiology and Environment CENA/USP, Piracicaba, SP, Brazil. Bean samples infested with eggs, larvae, pre-pupae and pupae C. maculatus, the experiment consisted of 4 replicates for each stage of the insect's life cycle, and each repetition consisted of 20 individuals (eggs, larvae, pre-pupae and pupae), a total of 200 subjects per treatment which were irradiated with doses of 0 (control), 25, 50, 75 and 100 Gy, a source of cobalt-60, Gammabeam-650 type, in a rate dose of 1.3 kGy / h. The experiment was conducted in a room with a relative of 25 ± 2 ° C temperature and humidity of 70 ± 5%. After 35 days of irradiation process were carried out evaluations of the number of insects emerged in each repetition within the treatments. From the results obtained it was concluded that the dose lethal to eggs and larvae was 25 Gy, while for pre-pupae was 50 Gy, to pupae 100 Gy was not sufficient to control the adult emergence. (author)

  2. Influence of distillery effluent on germination and growth of mung bean (Vigna radiata) seeds

    Energy Technology Data Exchange (ETDEWEB)

    Kannan, A. [Biomembrane Toxicology Division, Industrial Toxicology Research Centre, Post Box No. 80, M.G. Marg, Lucknow 226001 (India); Upreti, Raj K. [Biomembrane Toxicology Division, Industrial Toxicology Research Centre, Post Box No. 80, M.G. Marg, Lucknow 226001 (India)], E-mail: upretirk@rediffmail.com

    2008-05-01

    Distillery effluent or spent wash discharged as waste water contains various toxic chemicals that can contaminate water and soil and may affect the common crops if used for agricultural irrigation. Toxic nature of distillery effluent is due to the presence of high amounts of organic and inorganic chemical loads and its high-acidic pH. Experimental effects of untreated (Raw) distillery effluent, discharged from a distillery unit (based on fermentation of alcohol from sugarcane molasses), and the post-treatment effluent from the outlet of conventional anaerobic treatment plant (Treated effluent) of the distillery unit were studied in mung bean (Vigna radiata, L.R. Wilczek). Mung bean is a commonly used legume crop in India and its neighboring countries. Mung bean seeds were presoaked for 6 h and 30 h, respectively, in different concentrations (5-20%, v/v) of each effluent and germination, growth characters, and seedling membrane enzymes and constituents were investigated. Results revealed that the leaching of carbohydrates and proteins (solute efflux) were much higher in case of untreated effluent and were also dependent to the presoaking time. Other germination characters including percentage of germination, speed of germination index, vigor index and length of root and embryonic axis revealed significant concentration-dependent decline in untreated effluent. Evaluation of seedlings membrane transport enzymes and structural constituents (hexose, sialic acid and phospholipids) following 6 h presoaking of seeds revealed concentration-dependent decline, which were much less in treated effluent as compared to the untreated effluent. Treated effluent up to 10% (v/v) concentration reflected low-observed adverse effect levels.

  3. Effect of Nitrogen Nutritional Stress on some Mineral Nutrients and Photosynthetic Apparatus of Zea mays L. and Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Akinbode Foluso OLOGUNDUDU

    2013-08-01

    Full Text Available The study investigated the responses of maize (Zea mays L. and cowpea (Vigna unguiculata L. Walp. seedlings metabolic activities and photosynthetic apparatus to nitrogen nutritional stress. Germination of seeds was done using treated sand in sixty plastic pots and the seedlings were divided into four nutrient regimes. A group of the seedlings was nutrient stressed by administering 200 ml of complete nutrient solution minus nitrogen (-N while the other groups were fed with five times (X5N and ten times (X10N the optimal concentration of nitrogen and the last regime was fed with full nutrient solution (FN. The photosynthetic parameters studied included chlorophylls ‘a’ and ‘b’ respectively; carotenes and xanthophyll while the mineral elements investigated include potassium, calcium and magnesium. The result of the growth analysis showed that nitrogen deficiency promotes an increase in the content of abscisic acid (ABA, causing stomatal closure and a reduction in photosynthesis. This explains the higher rate of leaf abscission in -N plants. A comparison of calcium ion and magnesium ion concentrations in both optimal and stressed conditions reveals that the two ions show antagonism in uptake. There is a correlation between nitrogen and magnesium accumulation as magnesium ion plays a vital role in chlorophyll biosynthesis, protein synthesis and photosynthesis. The pattern of accumulation of photosynthetic apparatus in both maize and cowpea follow a similar pattern. Chlorophyll a dictated the growth pattern of other photosynthetic apparatus in both Zea mays and Vigna unguiculata.

  4. Effect of Nitrogen Nutritional Stress on Some Growth Parameters of Zea mays L. and Vigna unguiculata (L. Walp.

    Directory of Open Access Journals (Sweden)

    Akinbode Foluso OLOGUNDUDU

    2013-02-01

    Full Text Available This study investigated the responses of maize (Zea mays L. and cowpea (Vigna unguiculata L. Walp. seedlings growth parameters to nitrogen nutritional stress. This was with a view to determining whether nitrogen nutritional stress would retard or enhance maize and cowpea growth, partly, wholly or not at all through its effect on biomass accumulation and some morphological parameters. Germination of seeds was done using treated sand in sixty plastic pots. A group of the seedlings was nutrient stressed by administering 200 ml of complete nutrient solution minus nitrogen (-N while the other groups were fed with five times (X5N and ten times (X10N the optimal concentration of nitrogen and the last regime was fed with full nutrient solution (FN. The effects of optimal concentration and nitrogen stress on the growth rates (as measured by their fresh and dry weight were studied. The result of the growth analysis showed that there was increase in shoot height with supraoptimal concentrations of nitrogen treatments (X10N and X5N while there was a decrease in shoot height with minus nitrogen (-N regimes. The observed higher biomass (dry matter yield under the FN regimes in both Zea mays and Vigna unguiculata were attributed to optimal nutrient assimilation rate.

  5. Efficacy of insecticides against army worm (spodoptera mauritia) on mung bean (vigna radiata l.) under arid climate

    International Nuclear Information System (INIS)

    Abbas, G.; Aslam, M.; Khokhar, M.B.; Khattak, J.Z.K.; Malik, A.U.

    2011-01-01

    Influence of Bifenthrine (Talstar) at the rate 375 ml ha/sup -1/, Deltaphos 10+350 EC at the rate 500 ml ha/sup -1/, Lorsban 40 EC at the rate 850 ml ha/sup -1/, Triazofos (20/400 EC) at the rate 750 ml ha/sup -1/and Karate 5 EC at the rate 1250 ml ha/sup -1/ was studied on mung bean (Vigna radiata L.) yield under arid climate at Adaptive Research Farm, Karor during two kharif seasons of 2007 and 2008. Experiments were laid out in randomized complete block design with six a test variety. All the chemicals showed significant impact on mung crop as compared to that in control treatments. AZRI- 2006, a promising variety of mung bean (Vigna radiata L.) for arid climate was used as plots, but the treatment of Deltaphos 10+350 EC at the rate 350 ml ha/sup -1/consistently proved better than other treatments. (author)

  6. Ionizing radiation induced changes in phenotype, photosynthetic pigments and free polyamine levels in Vigna radiata (L.) Wilczek

    International Nuclear Information System (INIS)

    Sengupta, Mandar; Chakraborty, Anindita; Raychaudhuri, Sarmistha Sen

    2013-01-01

    Effects of gamma rays on the free polyamine (PA) levels were studied in Vigna radiata (L.) Wilczek. Seeds exposed to different doses of gamma rays were checked for damage on phenotype, germination frequency and alteration in photosynthetic pigments. Free polyamine levels were estimated from seeds irradiated in dry and water imbibed conditions. Polyamine levels of seedlings grown from irradiated seeds, and irradiated seedlings from unexposed seeds were also measured. Damage caused by gamma irradiation resulted in decrease in final germination percentage and seedling height. Photosynthetic pigments decreased in a dose dependent manner as marker of stress. Polyamines decreased in irradiated dry seeds and in seedlings grown from irradiated seeds. Radiation stress induced increase in free polyamines was seen in irradiated imbibed seeds and irradiated seedlings. Response of polyamines towards gamma rays is dependent on the stage of the life cycle of the plant. - Highlights: ► Gamma irradiation of Vigna radiata (L.) Wilczek seeds and seedlings. ► Decrease in germination frequency. ► Increase in seedling injury with increased dosage of gamma rays. ► Decrease in chlorophyll and carotenoid pigments. ► Change in free polyamine levels

  7. Assembled genomic and tissue-specific transcriptomic data resources for two genetically distinct lines of Cowpea ( Vigna unguiculata (L.) Walp).

    Science.gov (United States)

    Spriggs, Andrew; Henderson, Steven T; Hand, Melanie L; Johnson, Susan D; Taylor, Jennifer M; Koltunow, Anna

    2018-02-09

    Cowpea ( Vigna unguiculata (L.) Walp) is an important legume crop for food security in areas of low-input and smallholder farming throughout Africa and Asia. Genetic improvements are required to increase yield and resilience to biotic and abiotic stress and to enhance cowpea crop performance. An integrated cowpea genomic and gene expression data resource has the potential to greatly accelerate breeding and the delivery of novel genetic traits for cowpea. Extensive genomic resources for cowpea have been absent from the public domain; however, a recent early release reference genome for IT97K-499-35 ( Vigna unguiculata  v1.0, NSF, UCR, USAID, DOE-JGI, http://phytozome.jgi.doe.gov/) has now been established in a collaboration between the Joint Genome Institute (JGI) and University California (UC) Riverside. Here we release supporting genomic and transcriptomic data for IT97K-499-35 and a second transformable cowpea variety, IT86D-1010. The transcriptome resource includes six tissue-specific datasets for each variety, with particular emphasis on reproductive tissues that extend and support the V. unguiculata v1.0 reference. Annotations have been included in our resource to allow direct mapping to the v1.0 cowpea reference. Access to this resource provided here is supported by raw and assembled data downloads.

  8. A SNP and SSR Based Genetic Map of Asparagus Bean (Vigna. unguiculata ssp. sesquipedialis) and Comparison with the Broader Species

    Science.gov (United States)

    Xu, Pei; Wu, Xiaohua; Wang, Baogen; Liu, Yonghua; Ehlers, Jeffery D.; Close, Timothy J.; Roberts, Philip A.; Diop, Ndeye-Ndack; Qin, Dehui; Hu, Tingting; Lu, Zhongfu; Li, Guojing

    2011-01-01

    Asparagus bean (Vigna. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea [Vigna. unguiculata (L.) Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as ‘long beans’ or ‘asparagus beans’. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs), with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs) identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level. PMID:21253606

  9. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  10. La collection de base des espèces sauvages de Phaseolus et Vigna : historique, gestion et conservation

    Directory of Open Access Journals (Sweden)

    Thierry Vanderborght

    1998-01-01

    Full Text Available The base collection of wild species of Phaseolus and Vigna: history, management and conservation.The National Botanic Garden of Belgium ensures the management of a base collection of botanical and wild forms in the tribe Phaseoleae and the sub-tribe Phaseolinae. The main objective is to conserve on a long terni basic the largest possible genetic diversity through seed semples stored at - 20°C. The collection provided the basic material for the investigations conducted at the University Faculty of Agricultural Sciences of Gembloux in fields as diverse as taxonomy, genome analysis, definition of genetic réservoirs, agronomie and chemical evaluations, interspecific hybridization and plant breeding. The results have allowed to becter understand the organization of genetic diversity in the studied plant material and to highlight the wealthy genetic potentiel of the collection. The latter should be preserved and valorized for the genetic improvement of food legumes, in particular within the two genera Phaseolus and Vigna.

  11. Adzuki beans (Vigna angularis seed quality under several drying conditions Qualidade de sementes de feijão adzuki (Vigna angularis submetidas a diversas condições de secagem

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.Objetivou-se no presente trabalho analisar o processo de secagem do feijão adzuki (Vigna angularis, bem como avaliar a qualidade das sementes, submetidas à secagem em diversas condições de ar. Foram utilizados grãos de feijão adzuki (Vigna angularis, colhidos com teor de água de 1,14 (decimal base seca e secos até o teor de 0,11 (decimal base seca. A secagem do feijão adzuki foi realizada em secador experimental mantido nas temperaturas controladas de 30, 40, 50, 60 e 70 ºC e umidades relativas de 52,0; 28,0; 19,1; 13,1 e 6,8%, respectivamente. Para analisar a qualidade fisiológica e tecnológica das sementes realizou-se o teste de germinação, Índice de Velocidade de Germinação (IVG, condutividade elétrica e absorção de água, respectivamente. Nas condições em que foi desenvolvido o presente trabalho,conclui-se que o tempo de secagem do feijão adzuki diminui para as temperaturas mais elevadas do ar de 60 e 70 ºC e afetam as qualidades fisiológica e tecnológica das sementes. Assim, para

  12. Association analysis of salt tolerance in cowpea (Vigna unguiculata (L.) Walp) at germination and seedling stages.

    Science.gov (United States)

    Ravelombola, Waltram; Shi, Ainong; Weng, Yuejin; Mou, Beiquan; Motes, Dennis; Clark, John; Chen, Pengyin; Srivastava, Vibha; Qin, Jun; Dong, Lingdi; Yang, Wei; Bhattarai, Gehendra; Sugihara, Yuichi

    2018-01-01

    This is the first report on association analysis of salt tolerance and identification of SNP markers associated with salt tolerance in cowpea. Cowpea (Vigna unguiculata (L.) Walp) is one of the most important cultivated legumes in Africa. The worldwide annual production in cowpea dry seed is 5.4 million metric tons. However, cowpea is unfavorably affected by salinity stress at germination and seedling stages, which is exacerbated by the effects of climate change. The lack of knowledge on the genetic underlying salt tolerance in cowpea limits the establishment of a breeding strategy for developing salt-tolerant cowpea cultivars. The objectives of this study were to conduct association mapping for salt tolerance at germination and seedling stages and to identify SNP markers associated with salt tolerance in cowpea. We analyzed the salt tolerance index of 116 and 155 cowpea accessions at germination and seedling stages, respectively. A total of 1049 SNPs postulated from genotyping-by-sequencing were used for association analysis. Population structure was inferred using Structure 2.3.4; K optimal was determined using Structure Harvester. TASSEL 5, GAPIT, and FarmCPU involving three models such as single marker regression, general linear model, and mixed linear model were used for the association study. Substantial variation in salt tolerance index for germination rate, plant height reduction, fresh and dry shoot biomass reduction, foliar leaf injury, and inhibition of the first trifoliate leaf was observed. The cowpea accessions were structured into two subpopulations. Three SNPs, Scaffold87490_622, Scaffold87490_630, and C35017374_128 were highly associated with salt tolerance at germination stage. Seven SNPs, Scaffold93827_270, Scaffold68489_600, Scaffold87490_633, Scaffold87490_640, Scaffold82042_3387, C35069468_1916, and Scaffold93942_1089 were found to be associated with salt tolerance at seedling stage. The SNP markers were consistent across the three models and

  13. Transcriptome sequencing of mung bean (Vigna radiate L.) genes and the identification of EST-SSR markers.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen

    2015-01-01

    Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  14. Soil compaction and gamma radiation ({sup 60}Co) in the development of the cowpea beans [Vigna unguiculata, (L) Walp]; Compactacao do solo e radiacao gama ({sup 60}Co) no desenvolvimento do feijao caupi [Vigna unguiculata, (L) Walp

    Energy Technology Data Exchange (ETDEWEB)

    Viana, Eliane Ferreira; Colaco, Waldeciro [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear. Radioagronomia]. E-mails: aroucha@ufpe.br; wcolaco@ufpe.br

    2005-08-15

    The objective is to investigate the effect of compaction and increased doses of gamma radiation on the development of cowpea [Vigna unguiculata, (L) Walp] var. IPA-206 cultivated in a Neossolo fluvic soil, artificially compacted. Significant differences were observed in plant height, with the increase doses in soil density (1.30 Mg.m{sup -3} - compacted soil and 1.70 Mg.m{sup -3} - non-compacted soil), and in response to increased doses of irradiation (y-rays) [ [0, 100, 200 and 300 Gy). The diameter of the stem was significantly reduced in response to the increase in soil density, however the same did not occur in relation to the doses of irradiation (y-rays) holding capacity of the soil was reduced in response to the increase in soil density. (author)

  15. Effect of storage on the amino acid composition and biological quality of irradiated macacar beans Vigna unguiculata (L.) Walp

    International Nuclear Information System (INIS)

    Coelho, L.C.B.B.; de Medeiros, R.B.; Flores, H.

    1978-01-01

    The effects of two doses of gamma radiation (100 and 1,000 krad) upon the stability over a 6-month storage period of the amino acid composition and protein efficiency ratio (PER) of the macacar bean Vigna unguiculata (L.) Walp were investigated. No important differences were noted when the aminograms of irradiated and nonirradiated beans, either raw or cooked were compared. Nevertheless, the losses of lysine, arginine, and histidine due to cooking were greater in the irradiated beans. The PER of nonirradiated was higher than that of irradiated beans before and after the 6 months of storage, and was always lowest in the beans subjected to the higher dose of radiation. Qualitatively, an association was observed between the nutritional value (PER) and small decreases in the content of certain amino acids which resulted mainly from increased thermal lability of the irradiated bean protein

  16. Constituents from Vigna vexillata and Their Anti-Inflammatory Activity

    Directory of Open Access Journals (Sweden)

    Guo-Feng Chen

    2012-08-01

    Full Text Available The seeds of Vigna genus are important food resources and there have already been many reports regarding their bioactivities. In our preliminary bioassay, the chloroform layer of methanol extracts of V. vexillata demonstrated significant anti-inflammatory bioactivity. Therefore, the present research is aimed to purify and identify the anti-inflammatory principles of V. vexillata. One new sterol (1 and two new isoflavones (2,3 were reported from the natural sources for the first time and their chemical structures were determined by the spectroscopic and mass spectrometric analyses. In addition, 37 known compounds were identified by comparison of their physical and spectroscopic data with those reported in the literature. Among the isolates, daidzein (23, abscisic acid (25, and quercetin (40 displayed the most significant inhibition of superoxide anion generation and elastase release.

  17. Effect of Gamma Irradiation Doses and Micro Elements on Some Physical, Chemical and Crop Parameters of Vigna sinensis

    International Nuclear Information System (INIS)

    Hussein, L.O.S.; Saleh, O.I.; Abdullah, M.I.

    2011-01-01

    The present work aim to expose Vigna sinensis L. (cowpea) seeds to gamma rays at dose levels 40, 80 and 120 Gy and to spray the growing plants with micro elements; boron (B) and zinc (Zn) after one month of planting; until harvest date, for increasing crop quality and quantity. Some physical parameters, some chemical analysis, the yield and net percentage of the produced crop were evaluated. The result obtained refer that, the 40 Gy dose enhanced most of physical, chemical and yield parameters of cowpea crop. Moreover, the harvested crop was increased and improved in case of those produced from plants sprayed with different concentrations of B or Zn plus 40 Gy dose as compared with the other treatments used followed by the dose of 80 Gy. Meanwhile, the dose of 120 Gy gave the least enhancement on the quality and quantity of the aforementioned treatments in cowpea crop

  18. Genetic variability in dinitrogen fixation between cowpea [Vigna unguiculata (L.) Walp] cultivars determined using the nitrogen-15 isotope dilution technique

    International Nuclear Information System (INIS)

    Ndiaye, M.A.F.; Spencer, M.M.; Gueye, M.

    2000-01-01

    N fixed in 16 cultivars of cowpea [Vigna unguiculata (L.) Walp] inoculated with effective Bradyrhizobium strains collected from the West African MIRCEN culture collection was measured by 15N isotope dilution technique. In all plant parts, significant differences in the percentage of N derived from the atmosphere (%Ndfa) and the amount of Ndfa occurred between the cultivars. Ndoute variety exhibited the highest %Ndfa (74.33% in shoots; 60.90% in roots) and accumulated more fixed N (960 mg N plant–1 and 38 mg N plant–1 in shoots and roots, respectively). Therefore this cultivar should be selected as the highest N-fixing cowpea cultivar. It also should be used in a breeding programme to contribute to the development of cultivars that could stimulate an intensive use of cowpea in many different cropping systems in Africa with a view to maintaining soil fertility. (Authors)

  19. Identification of water storage tissue in the stem of cowpea plant (Vigna unguliculata Walp) by neutron radiography

    International Nuclear Information System (INIS)

    Nakanishi, T.M.; Don-Jin, K.; Ishii, R.; Matsubayashi, M.

    1999-01-01

    Cowpea (Vigna unguliculata Walp) is considered one of the most drought resistant species among the pulse crops. It was suggested that in the lower part of the stem, parenchymatous tissue for storing water has been developed for the function of drought resistance. However, such tissue has not been identified yet. In order to identify the water storing tissue in the stem of cowpea plant, the authors performed neutron radiography, which provides a non-destructive image of water distribution pattern in a plant. Common bean plant and soybean plant were used as references. Comparing the neutron radiograph for the stems of the plants, i.e., cowpea, common bean and soybean plants, the parenchymatous tissue with water storing function was distinguished in the intermode between primary leaf and the first trifoliate leaf specifically in cowpea plant. (author)

  20. Effect of (/sup 60/cobalt) gamma rays on growth and root rot diseases in mungbean (vigna radiata L.)

    International Nuclear Information System (INIS)

    Ikram, N.; Dawar, S.; Zaki, M.J.; Abass, Z.

    2010-01-01

    Present investigation showed that gamma rays influences suppressive effect on root rot fungi such as Macrophomina phaseolina (Tassi) Goid, Rhizoctonia solani Kuhn and Fusarium spp., and inducive effect on growth parameters of mung bean (Vigna radiata L.). Seeds of mung bean were treated with gamma rays (/sup 60/Cobalt) at time periods of 0 and 4 minutes and stored for 90 days at room temperature to determine its effect on growth parameters and infection of root infecting fungi. All treatments of gamma rays enhanced the growth parameters as compared to untreated plants. Infection of M. phaseolina, R. solani and Fusarium spp., were significantly decreased on mung bean seeds treated with gamma rays. Gamma rays significantly increased the growth parameters and controlled the root rot fungi up to 90 days of storage of seeds. (author)

  1. Antioxidant Activity of the Extracts of Some Cowpea (Vigna unguiculata (L Walp. Cultivars Commonly Consumed in Pakistan

    Directory of Open Access Journals (Sweden)

    Vincenzo De Feo

    2013-02-01

    Full Text Available The present investigation has been carried out to determine the antioxidant activity of the methanolic extracts obtained from four cultivars of cowpea (Vigna unguiculata (L Walp. seeds. Phenolic compounds present in the extracts showed the antioxidant and antiradical properties when investigated using a linoleic acid peroxidation model, FRAP, ORAC and TRAP assays, as well as DPPH, hydroxyl, nitric oxide and superoxide radical scavenging activity. The HPLC analysis of the cowpea extracts showed the presence of neochlorogenic acid, chlorogenic acid and caffeic acids. The results indicated that methanolic extract of the cowpea resembled in the aforementioned activities those from other leguminous seeds and pulses. Phenolic constituents contained in cowpea may have a future role as ingredients in the development of functional foods.

  2. Phylogenetic multilocus sequence analysis of indigenous slow-growing rhizobia nodulating cowpea (Vigna unguiculata L.) in Greece.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-04-01

    Cowpea (Vigna unguiculata) is a promiscuous grain legume, capable of establishing efficient symbiosis with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, little is known about the genetic and symbiotic diversity of indigenous cowpea rhizobia in European soils. In the present study, the genetic and symbiotic diversity of indigenous rhizobia isolated from field-grown cowpea nodules in three geographically different Greek regions were studied. Forty-five authenticated strains were subjected to a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into seven groups and representative strains of each group were further analyzed. The analysis of the rrs gene showed that the strains belong to different species of the genus Bradyrhizobium. The analysis of the 16S-23S IGS region showed that the strains from each geographic region were characterized by distinct IGS types which may represent novel phylogenetic lineages, closely related to the type species of Bradyrhizobium pachyrhizi, Bradyrhizobium ferriligni and Bradyrhizobium liaoningense. MLSA analysis of three housekeeping genes (recA, glnII, and gyrB) showed the close relatedness of our strains with B. pachyrhizi PAC48 T and B. liaoningense USDA 3622 T and confirmed that the B. liaoningense-related isolate VUEP21 may constitute a novel species within Bradyrhizobium. Moreover, symbiotic gene phylogenies, based on nodC and nifH genes, showed that the B. pachyrhizi-related isolates belonged to symbiovar vignae, whereas the B. liaoningense-related isolates may represent a novel symbiovar. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L. Based on Transcriptome Data.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Rice bean (Vigna umbellata (Thunb. Ohwi & Ohashi is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length of 986 bp. Of these unigenes, 38,840 (33.2% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases. Furthermore, 30,170 (76.3% could be classified into gene ontology categories, 25,451 (64.4% into Swiss-Prot categories and 21,982 (55.6% into KOG database categories (E-value < 1.0E-5. A total of 9,301 (23.5% were mapped onto 118 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. A total of 3,011 genic SSRs were identified as potential molecular markers. AG/CT (30.3%, AAG/CTT (8.1% and AGAA/TTCT (20.0% are the three main repeat motifs. A total of 300 SSR loci were randomly selected for validation by using PCR amplification. Of these loci, 23 primer pairs were polymorphic among 32 rice bean accessions. A UPGMA dendrogram revealed three major clusters among 32 rice bean accessions. The large number of SSR-containing sequences and genic SSRs in this study will be valuable for the construction of high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  4. Efficacy of Carbofuran in Controlling Root-Knot Nematode (Meloidogyne javanica Whitehead, 1949) on Cultivars of Bambara Groundnut (Vigna subterranea (L.) Verdc.) in Yola, Nigeria

    OpenAIRE

    Jada, M. Y.; Gungula, D. T.; Jacob, I.

    2011-01-01

    Bambara groundnut (Vigna subterrenea L. Verdc.) is an important crop produced in Adamawa State of Nigeria. However, the production of the crop is seriously threatened by root-knot nematodes (RKNs; Meloidogyne spp.). Since cultural methods have not been very effective in controlling RKN, carbofuran was evaluated to determine its efficacy in controlling M. javanica in Yola during 2002 and 2003. Three bambara groundnut cultivars (Kwachanjiwa, Kwaheuma, and Kwatolotolo) were evaluated using three...

  5. Evaluacion fisicoquimica, microbiologica y sensorial de una salsa y una bebida funcional a base de extracto de frijol rojo (Phaseolus vulgaris con pulpa de Guayaba en el municipio de Valledupar

    Directory of Open Access Journals (Sweden)

    Edwin J Fl

    2017-10-01

    Full Text Available Objetivo: evaluar de manera fisicoquímica, microbiológica y sensorial una salsa y una bebida funcional a base de extracto de fríjol rojo (phaseolus vulgaris con pulpa de guayaba. Metodología: el trabajo se desarrolló en una planta piloto, donde se tuvieron en cuenta la pulpa de la fruta y granos de frijoles rojos comercializados en los diferentes supermercados de la ciudad de Valledupar donde se tomaron muestras representativas de 5 kilos de guayaba y 5 kilos de fríjol para la obtención de la bebida y, con base en la NTC 659, se aplicó un diseño factorial de 22. Resultados: La consistencia de la salsa de extracto de fríjol rojo con mayor contenido de proteína (11,3 % fue el atributo de mayor aceptación por parte de los evaluadores no entrenados con 67,3 %, y el color fue el de menor aceptación con 53,3 %. Sin embargo, en forma general, el producto tuvo una preferencia de 61 %. El sabor de la bebida tipo néctar con mayor contenido de proteína (11% a base de extracto de fríjol rojo y extracto de guayaba fue el atributo que tuvo el mayor porcentaje de aceptación por parte de los evaluadores no entrenados, con 70,6%, y la consistencia fue el atributo con menor porcentaje de aceptación con 61,3. Sin embargo, otra vez en forma general, considerados todos los atributos, la bebida tuvo una preferencia de 64,5%. Conclusiones: la composición mineral (Fe, Na, K, Ca y Mg tanto de la salsa de extracto de fríjol como de la bebida a base de extracto de fríjol rojo y extracto de guayaba fueron aportes valiosos, sobre todo en el contenido del potasio y del calcio, que contribuyen a mantener la estabilidad muscular y gástrica del ser humano.

  6. Characterisation and determination of virus resistance among cowpea [Vigna unguiculata (L.) Walp.] Genotypes

    International Nuclear Information System (INIS)

    Tettey, Carlos Kweku

    2017-07-01

    Several households in Ghana feed on cowpea [Vigna unguiculata (L.) Walp.] which serves as good source of protein. However, cowpea viral diseases and the lack of adaptable cultivars have become a limiting factor in cowpea production. This work therefore sought to explore morphogenetic diversity and viral resistance traits in cowpea germplasm to improve productivity. Thirty-eight exotic and local cowpea genotypes were cultivated at the Teaching and Research Field of the School of Agriculture, the University of Cape Coast. Two plants were maintained per stand at planting distance of 50 cm x 30 cm with three replications in a randomized complete block layout during the major (June – September) and minor seasons (November – February). The cowpea genotypes were characterised using both morphological and molecular methods to assess diversity in the coastal savanna agro-ecological zone of Ghana. They were also screened for resistance to cowpea viruses using visual scale on-field and DAS-ELISA protocol. The cowpeas showed significant (P < 0.05) variations in plant height, canopy diameter, number of branches, area of leaf, days to 50% flowering, days to pod maturity, pod length, number of seeds per pod and hundred seed weight. There were significant and positive correlations between pod weight and seed yield (r = 0.985, P < 0.05), plant height and canopy diameter (r = 0.576, P < 0.05), canopy diameter and number of branches (r = 0.576) as well as pod length and the number of seeds per pod (r = 0.530, P < 0.05). Hundred seed weight ranged from 10.03 g to 22.7 g. On the whole, 23 quantitative and qualitative parameters differentiated the cowpea genotypes into two main clusters with sub-clusters. Genomic analysis involving nine polymorphic SSR primers showed a mean genetic diversity of 0.7, polymorphic information content of 0.67 and allele frequency of 0.4 among the cowpea genotypes, which were differentiated into two main clusters with sub-clusters. Incidence and severity

  7. CGKB: an annotation knowledge base for cowpea (Vigna unguiculata L. methylation filtered genomic genespace sequences

    Directory of Open Access Journals (Sweden)

    Spraggins Thomas A

    2007-04-01

    Full Text Available Abstract Background Cowpea [Vigna unguiculata (L. Walp.] is one of the most important food and forage legumes in the semi-arid tropics because of its ability to tolerate drought and grow on poor soils. It is cultivated mostly by poor farmers in developing countries, with 80% of production taking place in the dry savannah of tropical West and Central Africa. Cowpea is largely an underexploited crop with relatively little genomic information available for use in applied plant breeding. The goal of the Cowpea Genomics Initiative (CGI, funded by the Kirkhouse Trust, a UK-based charitable organization, is to leverage modern molecular genetic tools for gene discovery and cowpea improvement. One aspect of the initiative is the sequencing of the gene-rich region of the cowpea genome (termed the genespace recovered using methylation filtration technology and providing annotation and analysis of the sequence data. Description CGKB, Cowpea Genespace/Genomics Knowledge Base, is an annotation knowledge base developed under the CGI. The database is based on information derived from 298,848 cowpea genespace sequences (GSS isolated by methylation filtering of genomic DNA. The CGKB consists of three knowledge bases: GSS annotation and comparative genomics knowledge base, GSS enzyme and metabolic pathway knowledge base, and GSS simple sequence repeats (SSRs knowledge base for molecular marker discovery. A homology-based approach was applied for annotations of the GSS, mainly using BLASTX against four public FASTA formatted protein databases (NCBI GenBank Proteins, UniProtKB-Swiss-Prot, UniprotKB-PIR (Protein Information Resource, and UniProtKB-TrEMBL. Comparative genome analysis was done by BLASTX searches of the cowpea GSS against four plant proteomes from Arabidopsis thaliana, Oryza sativa, Medicago truncatula, and Populus trichocarpa. The possible exons and introns on each cowpea GSS were predicted using the HMM-based Genscan gene predication program and the

  8. Growth dynamics of two bean varieties (Phaseolus vulgaris L.. l. Growth analysis by fixed periods Dinámica de crecimiento de dos variedades de frijol (phaseolus vulgaris L. l. análisis de crecimiento por periodos fijos

    Directory of Open Access Journals (Sweden)

    Maldonado Gustavo

    1993-12-01

    frijol
    (P. vulgarís, L. comprende una serie de etapas sin las cuales no ocurrirla la formacion de frutos y en la cual el aumento de materia seca depende del comportamiento fisiológico y del hábito de crecimiento. El presente estudio evaluó el proceso de crecimiento conjuntamente con estos factores, con el propósito de establecer la diferencia en comportamiento y la
    relación entre el hábito y los índices de crecimiento en las variedades de frijol "ICA-Cerinza" de habito de crecimiento determinado e "ICA-Tundama" de habito de crecimiento indeterminado. Las variedades fueron sembradas en parcelas de 40,5 m2 y en hileras a 0,50 x 0,12 m. en un diseño de bloques completos al azar con cuatro repeticiones, en las
    cuales se tomaron muestras de tres plantas cada siete dias, a partir de los 15 y hasta los 78 dias después de emergencia. Se evaluó el peso total, el peso seco de los tallos, el peso seco de las hojas y el área foliar. A partir de éstos, se calcularon la tasa relativa de crecimiento (TRC, la tasa de asimilación neta (TAN, la relación de área foliar (RAF, la
    relación de peso foliar (RPF y el área foliar especifica
    (AFE. En las evaluaciones realizadas a los 15, 71 y 78 dias, el análisis de crecimiento por el método clásico, sólo, permitió determinar diferencias en materia seca total, de tallos, de hojas y en área foliar. Resultados similares se hallaron al analizarlos indices. La TRC fue ligeramente más alta en la variedad Cerinza que en la variedad Tundama, sin embargo,
    los valores por evaluación no fueron significativamente
    diferentes entre las dos variedades, a excepción de
    los obtenidos a los 78 D.D.E.. La TAN tuvo un comportamiento similar a la TRC y estas dos variables se correlacionaron positiva y significativamente. La RAF mostró una tendencia decreciente de tipo lineal en la variedad Cerinza, mientras que en la variedad Tundama fue de tipo cuadratico, con valores altos en las primeras y últimas

  9. Construction of an SSR and RAD-Marker Based Molecular Linkage Map of Vigna vexillata (L.) A. Rich.

    Science.gov (United States)

    Marubodee, Rusama; Ogiso-Tanaka, Eri; Isemura, Takehisa; Chankaew, Sompong; Kaga, Akito; Naito, Ken; Ehara, Hiroshi; Tomooka, Norihiko

    2015-01-01

    Vigna vexillata (L.) A. Rich. (tuber cowpea) is an underutilized crop for consuming its tuber and mature seeds. Wild form of V. vexillata is a pan-tropical perennial herbaceous plant which has been used by local people as a food. Wild V. vexillata has also been considered as useful gene(s) source for V. unguiculata (cowpea), since it was reported to have various resistance gene(s) for insects and diseases of cowpea. To exploit the potential of V. vexillata, an SSR-based linkage map of V. vexillata was developed. A total of 874 SSR markers successfully amplified single DNA fragment in V. vexillata among 1,336 SSR markers developed from Vigna angularis (azuki bean), V. unguiculata and Phaseolus vulgaris (common bean). An F2 population of 300 plants derived from a cross between salt resistant (V1) and susceptible (V5) accessions was used for mapping. A genetic linkage map was constructed using 82 polymorphic SSR markers loci, which could be assigned to 11 linkage groups spanning 511.5 cM in length with a mean distance of 7.2 cM between adjacent markers. To develop higher density molecular linkage map and to confirm SSR markers position in a linkage map, RAD markers were developed and a combined SSR and RAD markers linkage map of V. vexillata was constructed. A total of 559 (84 SSR and 475 RAD) markers loci could be assigned to 11 linkage groups spanning 973.9 cM in length with a mean distance of 1.8 cM between adjacent markers. Linkage and genetic position of all SSR markers in an SSR linkage map were confirmed. When an SSR genetic linkage map of V. vexillata was compared with those of V. radiata and V. unguiculata, it was suggested that the structure of V. vexillata chromosome was considerably differentiated. This map is the first SSR and RAD marker-based V. vexillata linkage map which can be used for the mapping of useful traits.

  10. Description du système racinaire de trois espèces fourragères en zone soudano-sahélienne: Andropogon gayanus, Vigna unguiculata et Stylosanthes hamata

    OpenAIRE

    Groot, J.J.R.; Traoré, M.; Koné, D.

    1998-01-01

    Description of root systems of three fodder crops in the Soudano-Sahelian area: Andropogon gayanus, Vigna unguiculata and Stylosanthes hamata. Root systems of fodder crops (Andropogon gayanus, Vigna unguiculata and Stylosanthes hamata) were studied at two Research Stations in Mali in 1992, using soil monoliths. In this method, roots are studied throughout the soil profile in cubical compartments of 1 dm3. Root biomass production of A. gayanus planted in 1951 was 4 t.ha-1 against 5 t.ha-1 ...

  11. Estadísticos vitales de Bemisia tabaci biotipo B en frijol e interacción con el parasitoide Amitus fuscipennis: Life history parameters and absence of hostparasitoid interaction with Amitus fuscipennis Bemisia tabaci biotype B in bean

    Directory of Open Access Journals (Sweden)

    María del Rosario Manzano Martínez

    2009-10-01

    Full Text Available Se determinaron los estadísticos vitales de la mosca blanca Bemisia tabaci biotipo B en condiciones de laboratorio (26 °C ± 2 °C y 80 ± 5 % de HR en fríjol cultivar ICA-Pijao. Los valores promedios fueron: longevidad 34 ± 1.64 días, fecundidad de 211.4 ± 15.1 huevos/hembra y tasa de oviposición de 6.1 ± 0.28 huevos/día. La tasa neta reproductiva fue de 137.8. El tiempo generacional de 43.8 días y la tasa intrínseca de crecimiento poblacional (r m de 0.125. Estos valores son coincidentes con los reportados en la literatura e indicaron la utilidad del frijol (Phaseolus vulgaris L ICA-Pijao para la multiplicación de B. tabaci. No se logró la reproducción de Amitus fuscipennis en B. tabaci. Estudios de comportamiento mostraron que el parasitoide permaneció solo 617.3 seg en promedio en foliolos infestados con la mosca blanca, la mayor parte del tiempo lo invirtió en caminar (46.4%, limpiarse el cuerpo (35.6% y permanecer quieta (16.7%. A. fuscipennis solo tocó una vez accidentalmente una ninfa de B. tabaci, pero no la examinó con las antenas ni la ovipositó. Los resultados indican que A. fuscipennis no es un enemigo natural potencial de B. tabaci biotipo B.Life-history parameters of the whitefly Bemisia tabaci biotipo B were determined at laboratory conditions at 26 °C ± 2 °C y 80 ± 5 % de RH on bean ICA-Pijao. Mean longevity of the whitefly was 34 ± 1,64 days, mean total fecundity was 211,4 ± 15,1 eggs per female with a daily oviposition rate of 6,1 ± 0,28 eggs per day. Net reproduction rate was 137,8. Generation Time was 43,8 days and the intrinsic rate of population increase r m was 0,125. These values are according to previous ones reported and support usefulness of ICA-Pijao bean for B. tabaci rearing. It was not possible to rear Amitus fuscipennis from B. tabaci. Behaviour studies showed that the parasitoid stayed only average 617,3 s on whitefly infested leaflets. It invested most of the time walking (46

  12. Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

    Science.gov (United States)

    Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

    2014-03-01

    16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

  13. Evaluating the freezing impact on the proximate composition of immature cowpea (Vigna unguiculata L.) pods: classical versus spectroscopic approaches.

    Science.gov (United States)

    Machado, Nelson; Oppolzer, David; Ramos, Ana; Ferreira, Luis; Rosa, Eduardo As; Rodrigues, Miguel; Domínguez-Perles, Raúl; Barros, Ana Irna

    2017-10-01

    Freezing represents a common conservation practice regarding vegetal foodstuffs. Since compositional features need to be monitored during storage, the development of rapid monitoring tools suitable for assessing nutritional characteristics arises as a pertinent issue. In this study, cowpea (Vigna unguiculata L.) pods, both fresh and after 6 and 9 months of freezing at -18 °C, were evaluated by high-performance liquid chromatography for their content of protein as well as of essential and nonessential amino acids, while their Fourier transform infrared spectra in the mid infrared (MIR) and near infrared (NIR) ranges were concomitantly registered to assess the feasibility of this approach for the traceability of these frozen matrices. For the NIR interval, the application of the 1st derivative to the spectral data retrieved the best results, while for lower concentrations the application of the Savitzky-Golay algorithm was indispensable to achieve quantification models for the amino acids. MIR is also suitable for this purpose, though being unable to quantify amino acids with concentrations below 0.07 mmol g -1 dry weight, irrespective of the data treatment used. The spectroscopic approach constitutes a methodology suitable for monitoring the impact of freezing on the nutritional properties of cowpea pods, allowing accurate quantification of the protein and amino acid contents, while NIR displayed better performance. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  14. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi, E-mail: shilpi@dbeb.iitd.ac.in

    2015-06-30

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture.

  15. A protein with amino acid sequence homology to bovine insulin is present in the legume Vigna unguiculata (cowpea

    Directory of Open Access Journals (Sweden)

    Venâncio T.M.

    2003-01-01

    Full Text Available Since the discovery of bovine insulin in plants, much effort has been devoted to the characterization of these proteins and elucidation of their functions. We report here the isolation of a protein with similar molecular mass and same amino acid sequence to bovine insulin from developing fruits of cowpea (Vigna unguiculata genotype Epace 10. Insulin was measured by ELISA using an anti-human insulin antibody and was detected both in empty pods and seed coats but not in the embryo. The highest concentrations (about 0.5 ng/µg of protein of the protein were detected in seed coats at 16 and 18 days after pollination, and the values were 1.6 to 4.0 times higher than those found for isolated pods tested on any day. N-terminal amino acid sequencing of insulin was performed on the protein purified by C4-HPLC. The significance of the presence of insulin in these plant tissues is not fully understood but we speculate that it may be involved in the transport of carbohydrate to the fruit.

  16. In silico genome-wide identification and characterization of the glutathione S-transferase gene family in Vigna radiata.

    Science.gov (United States)

    Vaish, Swati; Awasthi, Praveen; Tiwari, Siddharth; Tiwari, Shailesh Kumar; Gupta, Divya; Basantani, Mahesh Kumar

    2018-05-01

    Plant glutathione S-transferases (GSTs) are integral to normal plant metabolism and biotic and abiotic stress tolerance. The GST gene family has been characterized in diverse plant species using molecular biology and bioinformatics approaches. In the current study, in silico analysis identified 44 GSTs in Vigna radiata. Of the total 44 GSTs identified, chromosomal locations of 31 GSTs were confirmed. The pI value of GST proteins ranged from 5.10 to 9.40. The predicted molecular weights ranged from 13.12 to 50 kDa. Subcellular localization analysis revealed that all GSTs were predominantly localized in the cytoplasm. The active site amino acids were confirmed to be serine in tau, phi, theta, zeta, and TCHQD; cysteine in lambda, DHAR, and omega; and tyrosine in EF1G. The gene architecture conformed to the two-exon/one-intron and three-exon/two-intron organization in the case of tau and phi classes, respectively. MEME analysis identified 10 significantly conserved motifs with the width of 8-50 amino acids. The motifs identified were either specific to a specific GST class or were shared by multiple GST classes. The results of the current study will be of potential importance in the characterization of the GST gene family in V. radiata, an economically important leguminous crop.

  17. Effect of biologically treated petroleum sludge on seed germination and seedling growth of Vigna unguiculata (L. Walp. (Fabaceae

    Directory of Open Access Journals (Sweden)

    Jeyabalan Sangeetha

    2014-06-01

    Full Text Available The present investigation was carried out to study the response of different concentrations of treated petroleum sludge on seed germination, root and shoot length and tolerance of Vigna unguiculata (L. Walp. The biologically treated petroleum sludge with bacterial consortium showed 54.8% reduction in total petroleum hydrocarbons. Treated sludge was utilized with agricultural soil in known concentration for the assessment of growth of V. unguiculata. A remarkable absence of seed germination was observed at higher sludge concentration. The different concentrations of treated petroleum sludge showed severe decline on the length, weight and vigour index of the tested seedlings with increasing sludge concentrations. The results showed that the difference in rate of seed germination was significant among various concentrations. Under environmental stress condition, germination is the most critical phase of life cycle in crop plants. In this present study, the high oil content found to alter the osmotic relation between seed and water and thus reduce the amount of water absorbed. It was concluded that the concentration of nutrients and oil present in the treated sludge were toxic to the plant.

  18. Nontarget effects of chemical pesticides and biological pesticide on rhizospheric microbial community structure and function in Vigna radiata.

    Science.gov (United States)

    Singh, Sunil; Gupta, Rashi; Kumari, Madhu; Sharma, Shilpi

    2015-08-01

    Intensive agriculture has resulted in an indiscriminate use of pesticides, which demands in-depth analysis of their impact on indigenous rhizospheric microbial community structure and function. Hence, the objective of the present work was to study the impact of two chemical pesticides (chlorpyrifos and cypermethrin) and one biological pesticide (azadirachtin) at two dosages on the microbial community structure using cultivation-dependent approach and on rhizospheric bacterial communities involved in nitrogen cycle in Vigna radiata rhizosphere through cultivation-independent technique of real-time PCR. Cultivation-dependent study highlighted the adverse effects of both chemical pesticide and biopesticide on rhizospheric bacterial and fungal communities at different plant growth stages. Also, an adverse effect on number of genes and transcripts of nifH (nitrogen fixation); amoA (nitrification); and narG, nirK, and nirS (denitrification) was observed. The results from the present study highlighted two points, firstly that nontarget effects of pesticides are significantly detrimental to soil microflora, and despite being of biological origin, azadirachtin exerted negative impact on rhizospheric microbial community of V. radiata behaving similar to chemical pesticides. Hence, such nontarget effects of chemical pesticide and biopesticide in plants' rhizosphere, which bring out the larger picture in terms of their ecotoxicological effect, demand a proper risk assessment before application of pesticides as agricultural amendments.

  19. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata.

    Science.gov (United States)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-06-30

    With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Combined Effects of Ozone and Drought on the Physiology and Membrane Lipids of Two Cowpea (Vigna unguiculata (L.) Walp) Cultivars.

    Science.gov (United States)

    Rebouças, Deborah Moura; De Sousa, Yuri Maia; Bagard, Matthieu; Costa, Jose Helio; Jolivet, Yves; De Melo, Dirce Fernandes; Repellin, Anne

    2017-03-03

    The interactive effects of drought and ozone on the physiology and leaf membrane lipid content, composition and metabolism of cowpea (Vigna unguiculata (L.) Walp.) were investigated in two cultivars (EPACE-1 and IT83-D) grown under controlled conditions. The drought treatment (three-week water deprivation) did not cause leaf injury but restricted growth through stomatal closure. In contrast, the short-term ozone treatment (130 ppb 12 h daily during 14 day) had a limited impact at the whole-plant level but caused leaf injury, hydrogen peroxide accumulation and galactolipid degradation. These effects were stronger in the IT83-D cultivar, which also showed specific ozone responses such as a higher digalactosyl-diacylglycerol (DGDG):monogalactosyldiacylglycerol (MGDG) ratio and the coordinated up-regulation of DGDG synthase (VuDGD2) and ω-3 fatty acid desaturase 8 (VuFAD8) genes, suggesting that membrane remodeling occurred under ozone stress in the sensitive cultivar. When stresses were combined, ozone did not modify the stomatal response to drought and the observed effects on whole-plant physiology were essentially the same as when drought was applied alone. Conversely, the drought-induced stomatal closure appeared to alleviate ozone effects through the reduction of ozone uptake.

  1. Using artificial neural networks to select upright cowpea (Vigna unguiculata) genotypes with high productivity and phenotypic stability.

    Science.gov (United States)

    Barroso, L M A; Teodoro, P E; Nascimento, M; Torres, F E; Nascimento, A C C; Azevedo, C F; Teixeira, F R F

    2016-11-03

    Cowpea (Vigna unguiculata) is grown in three Brazilian regions: the Midwest, North, and Northeast, and is consumed by people on low incomes. It is important to investigate the genotype x environment (GE) interaction to provide accurate recommendations for farmers. The aim of this study was to identify cowpea genotypes with high adaptability and phenotypic stability for growing in the Brazilian Cerrado, and to compare the use of artificial neural networks with the Eberhart and Russell (1966) method. Six trials with upright cowpea genotypes were conducted in 2005 and 2006 in the States of Mato Grosso do Sul and Mato Grosso. The data were subjected to adaptability and stability analysis by the Eberhart and Russell (1966) method and artificial neural networks. The genotypes MNC99-537F-4 and EVX91-2E-2 provided grain yields above the overall environment means, and exhibited high stability according to both methods. Genotype IT93K-93-10 was the most suitable for unfavorable environments. There was a high correlation between the results of both methods in terms of classifying the genotypes by their adaptability and stability. Therefore, this new approach would be effective in quantifying the GE interaction in upright cowpea breeding programs.

  2. NaCl Effects on In Vitro Germination and Growth of Some Senegalese Cowpea (Vigna unguiculata (L.) Walp.) Cultivars

    Science.gov (United States)

    Thiam, Mahamadou; Ourèye SY, Mame

    2013-01-01

    Cowpea (Vigna unguiculata (L.) Walp.) is one of the most important grain legumes in sub-Saharian regions. It contributes to man food security by providing a protein-rich diet. However, its production is limited by abiotic stresses such as salinity. This study aims to evaluate the salt tolerance of 15 cowpea cultivars, at germination stage. The seed germination process consisted of sowing them in agarified water (8 g·L−1) supplemented with 6 different concentrations of NaCl (0, 10, 50, 100, 150, and 200 mM). Results highlighted that high salt concentrations drastically reduced germination and significantly delayed the process for all varieties. A cowpea varietal effect towards the salt tolerance was noticed. Genotypes Diongoma, 58-78, and 58-191 were more salt-tolerant cultivars while Mougne and Yacine were more salt-sensitive ones as confirmed in the three groups of the dendrogram. NaCl effects on the early vegetative growth of seedlings were assessed with a tolerant (58-191) and a susceptible (Yacine) cultivar. Morphological (length and dry biomass) and physiological (chlorophyll and proline contents) parameter measurements revealed a negative effect of high (NaCl). However, 58-191 was much more salt tolerant, and the chlorophyll and proline contents were higher than those of Yacine genotype at increasing salt concentrations. PMID:25937976

  3. New observations on gametogenic development and reproductive experimental tools to support seed yield improvement in cowpea [Vigna unguiculata (L.) Walp].

    Science.gov (United States)

    Salinas-Gamboa, Rigel; Johnson, Susan D; Sánchez-León, Nidia; Koltunow, Anna M G; Vielle-Calzada, Jean-Philippe

    2016-06-01

    Cowpea reproductive tools. Vigna unguiculata L. Walp. (cowpea) is recognized as a major legume food crop in Africa, but seed yields remain low in most varieties adapted to local conditions. The development of hybrid cowpea seed that could be saved after each generation, enabling significant yield increases, will require manipulation of reproductive development from a sexual to an asexual mode. To develop new technologies that could support the biotechnological manipulation of reproductive development in cowpea, we examined gametogenesis and seed formation in two transformable, African-adapted, day-length-insensitive varieties. Here, we show that these two varieties exhibit distinct morphological and phenological traits but share a common developmental sequence in terms of ovule formation and gametogenesis. We present a reproductive calendar that allows prediction of male and female gametogenesis on the basis of sporophytic parameters related to floral bud size and reproductive organ development, determining that gametogenesis occurs more rapidly in the anther than in the ovule. We also show that the mode of megagametogenesis is of the Polygonum-type and not Oenothera-type, as previously reported. Finally, we developed a whole-mount immunolocalization protocol and applied it to detect meiotic proteins in the cowpea megaspore mother cell, opening opportunities for comparing the dynamics of protein localization during male and female meiosis, as well as other reproductive events in this emerging legume model system.

  4. RESIDU PESTISIDA PADA SAYURAN KUBIS (Brassica oleracea L. DAN KACANG PANJANG ( Vigna sinensis L. YANG DIPASARKAN DI PASAR BADUNG DENPASAR

    Directory of Open Access Journals (Sweden)

    K Agung Sudewa

    2012-11-01

    Full Text Available Pesticides residue of organophosphate and carbamate i.e. diazinon, chlorpyriphos, fentoate, carbaril and BPMC were tested on cabbage (Brassica oleracea L. and long bean (Vigna sinensis L.. The purpose of this study was to know the level of pesticides residue remaining on cabbage and long bean marketed in Badung Market, Denpasar.The samples were determined proportionally based on purposive sampling method. The proportion of sample was 10% of the total cabbage and snake bean sold in Badung market.Result of present study showed that residue of insecticides such as diazinon, chlorpyriphos, fentoate, carbaril, and BPMC remaining on the head of cabbage and snake bean marketed in Badung market was affected by the frequencies of their use in the field, in which chlorpyriphos was used by 60-65% of the farmers and carbaril by 40% of the farmers. Their residues on cabbage anf snake bean were 0.525 ppm and 1.296 ppm for chlorpyriphos (organophosphate; 0.303 ppm and 0.471 ppm for carbaril (carbamate. These result suggested that residue of chlorpyriphos on cabbage and snake bean were higher than MRL (Maximum Residue Limit for vegetable crops, i.e. 0.5 ppm.

  5. Tolerance and toxicity levels of boron in mung bean (vigna radiata (l.) wilczek) cultivars at early growth stages

    International Nuclear Information System (INIS)

    Hasnain, A.; Mahmood, S.; Akhtar, S.; Malik, S.A.; Bashir, N.

    2011-01-01

    Boron (B) toxicity has been recognized as a serious problem in arid and semi arid regions of the world. This study was aimed to determine critical levels of B by studying phenotypic variation for B-tolerance/ toxicity at the germination and seedling stage in three mung bean (Vigna radiata) cultivars; M-6, M-8 and 96009. Boron levels ranging from 0-20 ppm were applied using Boric acid. Germination, growth and photosynthetic attributes were significantly (p<0.001) influenced by varying B levels. However, the cultivars were significantly invariable for germination, seedling height and leaf number. B levels (5-10 ppm) appeared to be nutritionally critical whereas, 15-20 ppm induced B toxicity. The toxicity was expressed in terms of reduction in plant's growth as well as by visible symptoms which included chlorosis and necrosis of the foliage. The present study also demonstrated variation in B tolerance at the seedling stage in these cultivars. Among the tested cultivars, M-6 and M-8 exhibited better growth responses as compared with 96009. Fresh biomass and shoot: root ratio appeared to serve as selection criteria for B tolerance. The study further suggested screening of cultivars/ accessions on a large scale to explore more diversity of traits as well as the use of biochemical markers for mechanistic understanding of B tolerance. (author)

  6. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    International Nuclear Information System (INIS)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-01-01

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture

  7. Detection and validation of single feature polymorphisms in cowpea (Vigna unguiculata L. Walp using a soybean genome array

    Directory of Open Access Journals (Sweden)

    Wanamaker Steve

    2008-02-01

    Full Text Available Abstract Background Cowpea (Vigna unguiculata L. Walp is an important food and fodder legume of the semiarid tropics and subtropics worldwide, especially in sub-Saharan Africa. High density genetic linkage maps are needed for marker assisted breeding but are not available for cowpea. A single feature polymorphism (SFP is a microarray-based marker which can be used for high throughput genotyping and high density mapping. Results Here we report detection and validation of SFPs in cowpea using a readily available soybean (Glycine max genome array. Robustified projection pursuit (RPP was used for statistical analysis using RNA as a surrogate for DNA. Using a 15% outlying score cut-off, 1058 potential SFPs were enumerated between two parents of a recombinant inbred line (RIL population segregating for several important traits including drought tolerance, Fusarium and brown blotch resistance, grain size and photoperiod sensitivity. Sequencing of 25 putative polymorphism-containing amplicons yielded a SFP probe set validation rate of 68%. Conclusion We conclude that the Affymetrix soybean genome array is a satisfactory platform for identification of some 1000's of SFPs for cowpea. This study provides an example of extension of genomic resources from a well supported species to an orphan crop. Presumably, other legume systems are similarly tractable to SFP marker development using existing legume array resources.

  8. Yield and Yield Components of Vetch (Vigna radiata as Affected by the Use of Vermicompost and Phosphate Bio-fertilizer

    Directory of Open Access Journals (Sweden)

    Mohammad Mehdi Rahimi

    2016-06-01

    Full Text Available To evaluate the effects different levels of phosphate biofertilizer barvar-2 and vermi compost on yield and yield components of vetch plant (Vigna radiata L.in Yasouj a factorial experiments was performed in completely randomized design in crop year of 2013. Experimental treatments were phosphate biofertilizer barvar-2 at 3 levels (0, 50, 100 gram per hectare and vermicompost at 4 levels (0, 10, 20, 30 ton per hectare. In this study stem height, root length, biological yield, seed yield and harvest index was measured. ANOVA and comparison of means showed that vermicompost significantly increased stem height, economic and biological yields. Results, also, indicated that highest yield and biomass, 4.3 and 18.8 g/plant, observed respectively when 100 g/ha of barvar-2 and 30 t/ha of vermi compost were used. Using both of phosphate biofertilizer barvar-2 and vermicompost was better than their individnal usage. This indicates that combined use of these 2 factors would produce higher yield. It can be concluded that application of 100 g/ha of barvar-2 and 30 t/ha of vermicompost would a proper recommendation.

  9. Economic evaluation (quantitative for Mung bean (Vigna radiata production in the Kamin Region, Sadat Shahr, Fars province

    Directory of Open Access Journals (Sweden)

    Mahmood Reza Sadikhani

    2016-11-01

    Full Text Available Although one of the biggest disadvantages of an economic evaluation, is volatility of price and instability of economic conditions, But for land use planning, economic considerations play a key role in land use and making decision. Cost is an important factor that encourage farmers to grow special crop. Thus, in addition to the qualitative and quantitative evaluation, Land Suitability can be based on net or gross profit per unit area of land to be assessed in economic terms. The economic evaluation is based on net income or gross income from the land. The purpose of this study was to assess the economic evaluation for part of Saadat Shahr (Kamin region for Mung bean (Vigna radiata. 8 drilled profiles in order to see the profiles were chosen and after collecting data on real output, the variable cost of producing the product and the critical values and estimated gross profit are calculated and land suitability classes were determined. The results showed that one unit has a moderate suitability (S2 and two units have suitable classes (S1 from separate units.

  10. Research Paper ISSN 0189-6016©2009

    African Journals Online (AJOL)

    hole udder. Buffalo, Cow, Goat. Bombax ceiba. (Semal-Bombaceae). Bark of Bombax ceiba mixed with seeds of Glycine max and grind with water to eat. Vigna mungo. (Kali dal-Fabaceae). Seed powders mixed with ... (Pyaj-Liliaceae). Bulb is grinded and mixed with black salt and used to drink with water. Zingiber officinale.

  11. Species of the genus Uromyces (Basidiomycota: Pucciniales) from ...

    African Journals Online (AJOL)

    During a survey of rust fungi from Leepa Valley, Azad Jammu and Kashmir (AJ and K), Pakistan, four species of Uromyces were found parasitizing four plant species. These include Uromyces appendiculatus on Vigna mungo, Uromyces capitatus on Desmodium elegans, Uromyces penniseti on Pennisetum lanatum and ...

  12. Exploration of indigenous agrowastes for cellulase production by ...

    African Journals Online (AJOL)

    Regional agrowastes such as Vigna mungo, Saccharum spontaneum and Brassica campestris were collected and biohydrolysis of these substrates for cellulase production were carried out by Aspergillus niger. Proximate composition of each agrowastes was analyzed based on dry weight, to have an insight view of their ...

  13. Effect of Dodonaea viscosa Jacq. residues on growth and yield of ...

    African Journals Online (AJOL)

    This study was to evaluate the effect of Dodonaea viscosa Jacq. residues on mungbean (Vigna mungo L.Hepper) local cultivar. An experiment [using randomized complete block design (RCBD) design] with three replications was conducted in 2010. The trial comprised of four treatments such as mulching, incorporation into ...

  14. Comportamento hídrico e crescimento do feijão vigna cultivado em solos salinizados Hydric behaviour and growth of cowpea cultivated in salinized soils

    Directory of Open Access Journals (Sweden)

    José B. M. Coelho

    2013-04-01

    Full Text Available A salinização dos solos reduz a capacidade das plantas de absorver água o que, em geral, provoca diminuição na sua taxa de crescimento. As respostas das plantas ao estresse salino são melhor correlacionadas com o potencial osmótico do que com a condutividade elétrica do extrato de saturação do solo. Com o objetivo de avaliar os efeitos do estresse salino no crescimento, evapotranspiração e potencial osmótico foliar do feijoeiro vigna [Vigna unguiculata L. (Walp.] conduziu-se um experimento em casa de vegetação da Universidade Federal Rural de Pernambuco (Recife, PE, Brasil. Os tratamentos constaram de um arranjo fatorial 2 x 4 composto de duas texturas de solo e quatro níveis de salinidade do solo (4, 8 e 12 dS m-1 a 25 ºC além da testemunha sem a adição de sais com cinco repetições. Concluiu-se que a salinidade do solo causa redução no consumo de água, no potencial osmótico foliar, na altura das plantas, no número de folhas e na biomassa seca da parte aérea do feijoeiro vigna.Soil salinization reduces the capacity of plants to absorb water, and in general causes decrease in plant growth. Plant responses to salt stress are better correlated with osmotic potential compared to electrical conductivity of soil saturation extract. In order to evaluate the effect of salt stress on growth, water use and leaf osmotic potential of cowpea [Vigna unguiculata L. (Walp.], an experiment was carried out in a greenhouse of the Federal Rural University of Pernambuco (Recife-PE, Brazil. The Treatments were in a factorial arrangement of 2 x 4, comprising of two soil textures and four levels of soil salinity (4, 8 and 12 dS m-1 at 25 °C, and the control without salt addition with five replications. It was concluded that soil salinity causes reduction in water consumption, leaf osmotic potential, plant height, number of leaves and dry biomass of shoot of cowpea.

  15. Nodulação e produtividade de Vigna unguiculata (L. Walp. por cepas de rizóbio em Bom Jesus, PI Yield and nodulation of Vigna unguiculata (L. Walp. inoculated with rhizobia strains in Bom Jesus, PI

    Directory of Open Access Journals (Sweden)

    Elaine Martins Costa

    2011-03-01

    Full Text Available Objetivou-se avaliar a resposta de Vigna unguiculata (L. Walp. cv. "BR 17 Gurguéia" à inoculação com duas cepas isoladas de solos de mineração de bauxita em reabilitação: UFLA 3-164 e UFLA 3-155 e três cepas INPA 03 11B (BR 3301; UFLA 03 84 (BR 3302 e BR 3267 (SEMIA 6462, autorizadas pelo MAPA como inoculantes para a cultura do feijão-caupi. O experimento foi conduzido em campo na Universidade Federal do Piauí, Campus Professora Cinobelina Elvas, Bom Jesus, PI. Utilizou-se o delineamento experimental em blocos casualizados com sete tratamentos e com seis repetições, sendo cinco cepas citadas e dois controles não inoculados, um com N-mineral (70 kg ha-1 de N e outra sem N mineral. Foram avaliados a nodulação (número e massa seca de nódulos, o crescimento (massa seca da parte aérea, o rendimento de grãos e o teor e acúmulo de nitrogênio na parte aérea e nos grãos, além da eficiência relativa. A inoculação das sementes com as cepas de bactérias diazotróficas simbióticas resultou em rendimentos de grãos equivalente à testemunha adubada com nitrogênio mineral. A cepa em fase de teste, UFLA 3-155 apresentou rendimento de grãos igual à cepa recomendada INPA 03 11B (BR 3301, podendo também ser testada em outras regiões brasileiras. Entre as cepas aprovadas pelo MAPA a INPA 03 11B (BR 3301 apresentou a maior produção de grãos.It evaluates the effect of inoculation with two rhizobia strains isolated from soils under rehabilitation after bauxite mining: UFLA 3-164 and UFLA 3-155, compared to inoculation with strains INPA 03 11B (BR 3301; UFLA 03 84 (BR 3302 and BR 3267 (SEMIA 6462, officially authorized as inoculant to cowpea by MAPA, in Vigna unguiculata (L. Walp cv. "BR 17 Gurgueia". The experiment was carried out at the 'Universidade Federal do Piauí, Campus Professora Cinobelina Elvas, Bom Jesus, PI,' in a randomized block design, white seven treatments and six replications. Treatments were the five strains and

  16. Phosphorus Use Efficiency for Symbiotic Fixation Nitrogen in Voandzou (Vigna Subterranea) Using Isotopic Exchange Method in Rhizotron

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A.; Rabeharisoa, L. [Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Masse, D. [Institut de Recherche pour le Developpement, UMR Eco and Sols, Montpellier, (France); Amenc, L.; Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier, (France); Morel, C. [INRA-ENITA, Villenave d' Ornon (France)

    2013-11-15

    Low bioavailability of nitrogen and phosphorus is one of the main constraints in the acid soils with high P-fixing capacity. Plants adapt to low nutrient availability through various biological and physico-chemical mechanisms. Since genetic variation of N{sub 2} fixation exists in numerous legume species, optimization of symbiotic nitrogen fixation (SNF) under P deficiency could be a way to the replenishment of soil fertility in tropical soils. As the genetic potential of crops like Vigna subterranea (Bambara groundnut or voandzou) is little studied, although its agronomic potential is interesting for the farmers of Africa, a physiological study through legume screening for N{sub 2} fixation was performed with 54 cultivars from Madagascar, Niger and Mali, inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 in hydroponic culture under P deficiency and sufficiency (30 and 75 {mu}mol KH{sub 2}PO{sub 4} plant{sup -1} week {sup -1}, respectively), corresponding respectively to 28 and 70 mg P kg{sup -1} of soil. Large variability of nodulation and plant biomass was found among cultivars. These two parameters were generally correlated and the slope of the plant biomass regression as a function of nodulation was considered as an indicator of the efficiency in use of the rhizobial symbiosis. For the two cultivars most tolerant to P deficiency, V1 and V4 from Madagascar, the increase in use efficiency of the rhizobial symbiosis under P deficiency was linked with an increase in nodulated root O{sub 2} consumption linked to N{sub 2} fixation, and in phytase gene expression observed on the nodule sections by in situ RT- PCR. As the complexity of P compartments makes it difficult to assess the P bioavailability in the plant rhizosphere, an isotopic {sup 32}P exchange method was carried out in a rhizotron in order to assess the direct effect of the roots on P mobilization in rhizosphere soil, comparing V1 and V4 with 28 or 70 mg P kg{sup -1} of soil. Throughout

  17. Halopriming of seeds imparts tolerance to NaCl and PEG induced stress in Vigna radiata (L.) Wilczek varieties.

    Science.gov (United States)

    Jisha, K C; Puthur, Jos T

    2014-07-01

    The investigation was carried out to study the effect of halopriming on NaCl and polyethylene glycol-6000 (PEG-6000) induced stress tolerance potential of three Vigna radiata (L.) Wilczek varieties, with varied abiotic stress tolerance potential. Halopriming is a seed priming technique in which the seeds were soaked in various salt solutions (in this study NaCl was used). The results of the study indicated that the application of stresses (both NaCl and PEG) induced retardation of growth attributes (measured in terms of shoot length, fresh weight, dry weight) and decrease in physiological attributes like total chlorophyll content, metabolites, photosynthetic and mitochondrial activity of the seedlings in all three V. radiata (L.) varieties. However, halopriming of the seeds could reduce the extent of decrease in these biological attributes. NaCl and PEG stress also caused increase in MDA content (a product of membrane lipid peroxidation) in all the varieties studied and this increase was significantly minimized under halopriming. From the present investigation it was evident that among the green gram varieties studied, Pusa Vishal, a NaCl tolerant variety showed enhanced tolerance to NaCl and PEG induced stress, when the seeds were subjected to halopriming followed by Pusa Ratna (stress sensitive variety). Pusa 9531 (drought tolerant variety) also showed positive halopriming effects but it was less significant when compared to other two varieties. It could be concluded that halopriming improved the drought and salinity stress tolerance potential of all varieties and it was significantly higher in the Pusa Vishal as compared to Pusa 9531 and Pusa Ratna.

  18. Physicochemical and micro-structural properties of flours, starch and proteins from two varieties of legumes: bambara groundnut (Vigna subterranea).

    Science.gov (United States)

    Kaptso, Kuaté Giscard; Njintang, Yanou Nicolas; Nguemtchouin, Mbouga Marie Goletti; Scher, Joël; Hounhouigan, Joseph; Mbofung, Carl Moses

    2015-08-01

    This work is part of a large study aimed to evaluate the potential of bambara groundnut (Vigna subterranea) flour as starting raw material for the preparation of a widely cherished legume-based food product known as koki. Towards this objective, the flours from two varieties of bambara groundnut along with their respective starch and protein isolates were analyzed for some physicochemical and microstructural properties. It was observed that bambara flour contained appreciable amount of proteins (24.0-25.5 g/100 g), carbohydrates (57.9-61.7 g/100 g), fiber (3.45-3.68 g/100 g) and ash (3.65-3.85 g/100 g) with marginal differences between both varieties. The properties of starch and proteins isolated from the flours were different from one variety to another. In particular the starch granules of the white variety were larger (size range 10-35 μm) and polygonal while those from the black variety were smaller (size range 6-15 μm) and spherical in shape. In addition, the peak of gelatinization temperature was higher for white variety (81.7 °C) than for black variety (77.5 °C). The gelatinization temperature and the enthalpy of gelatinization of starch in the flours were systematically lower than for the starch isolates, suggesting an interaction of starch with other components on the gelatinization process.

  19. Characterization of a novel Y2K-type dehydrin VrDhn1 from Vigna radiata.

    Science.gov (United States)

    Lin, Chia-Hui; Peng, Po-Hsin; Ko, Chia-Yun; Markhart, Albert H; Lin, Tsai-Yun

    2012-05-01

    A novel dehydrin gene (VrDhn1) was isolated from an embryo cDNA library of Vigna radiata (L.) Wilczek (mungbean) variety VC1973A. The intronless VrDhn1 gene encodes a protein belonging to the Y(2)K-type dehydrin family. VrDhn1 protein accumulated in embryos and cotyledons during seed maturation and disappeared 2 days after seed imbibition (DAI). The expression of VrDhn1 mRNA and accumulation of VrDhn1 protein were at high levels in mature seeds, but neither mRNA nor protein was detected in mungbean vegetative tissues under normal growth conditions. The VrDhn1 mRNA level was extremely high in mature seeds and decreased to ∼30% at 1 DAI, and was not detectable at ~7 DAI. Tissue dehydration, salinity and exogenous ABA markedly induced VrDhn1 transcripts in plants as measured by quantitative real-time reverse transcription-PCR (qRT-PCR). VrDhn1 protein was not detected using immunoblots in seedlings under stress treatments. In mature seeds or 1 DAI seedlings, VrDhn1 proteins were immunolocalized in the nucleus and cytoplasm. VrDhn1 exhibited low affinity for non-specific interaction with DNA using electrophoretic mobility shift assays (EMSAs), and the exogenous addition of Zn(2+) or Ni(2+) stimulated interaction. The His-tagged VrDhn1 (30.17 kDa) protein showed a molecular mass of 63.1 kDa on gel filtration, suggesting a dimer form. This is the first report showing that a Y(2)K-type VrDhn1 enters the nucleus and interacts with DNA during seed maturation.

  20. Combined efficacy of Vigna radiata (L. R. Wilczek and Amorphophallus paeoniifolius (Dennst. Nicolson on serum lipids in albino rats

    Directory of Open Access Journals (Sweden)

    P.B. Benil

    2017-09-01

    Full Text Available Coronary Artery Disease (CAD is a major killer disease throughout the world. Dyslipidemia is a major contributor to the risk of CAD. Several dietary articles traditionally used in India and other South Asian countries reduced dyslipidemia. The present study was undertaken to evaluate the combined effect of Mung bean (Vigna radiata and Elephant foot yam (Amorphophallus paeoniifolius on serum lipids and atherogenic indices in albino rats and to compare it with a standard drug Cholestyramine. Thirty healthy albino rats of both sexes (150–200 g were randomized to 5 groups of 6 animals each. The grouping were done based on the following criteria: Group I: Normal Control Group, Group II: (Standard Group: Cholestyramine resin 5 mg/kg bw, Group III: (Half Dose Group: Drug powder at 540 mg/kg bw, Group IV: (Effective Dose Group: Drug powder at 1080 mg/kg bw, and Group V: (Double Dose Group: Drug powder at 2160 mg/kg bw. Lipid profile was estimated at the beginning and after 30 days of treatment. The Effective and Double doses of the drug reduced Total cholesterol along with levels of Triglycerides, Low density lipoprotein and Very low density lipoprotein levels significantly (p < 0.01 along with a significant (p < 0.01 increase in high density lipoproteins (HDL in rats. There was also significant (p < 0.01 improvement in atherogenic indices like Castelli Risk Index I, Non HDL C/HDL, Castelli risk Index II, TG/HDL, Atherogenic coefficient and Atherogenic Index of Plasma. The combination of powdered sprouted mung bean and yam powder have excellent lipid lowering potential.

  1. Genetic diversity and a population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L. Walp.] germplasm collection

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    2017-10-01

    Full Text Available Cowpea (Vigna unguiculata is an important legume crop with diverse uses. The species is presently a minor crop, and evaluation of its genetic diversity has been very limited. In this study, a total of 200 genic and 100 genomic simple sequence repeat (SSR markers were developed from cowpea unigene and genome sequences, respectively. Among them, 27 genic and 27 genomic SSR markers were polymorphic and were used for assessment of genetic diversity and population structure in 105 selected cowpea accessions. A total of 155 alleles and 2.9 alleles per marker were identified, and the average polymorphic information content (PIC value was 0.3615. The average PIC of genomic SSRs (0.3996 was higher than that of genic SSRs (0.3235, and most of the polymorphic genomic SSRs were composed of di- and trinucleotide repeats (51.9% and 37.0% of all loci, respectively. The low level of detected genetic diversity may be attributed to a severe genetic bottleneck that occurred during the cowpea domestication process. The accessions were classified by structure and cluster analysis into four subgroups that correlated well with their geographic origins or collection sites. The classification results were also consistent with the results from principal coordinate analysis and can be used as a guide during future germplasm collection and selection of accessions as breeding materials for cultivar improvement. The newly developed genic and genomic SSR markers described in this study will be valuable genomic resources for the assessment of genetic diversity, population structure, evaluation of germplasm accessions, construction of genetic maps, identification of genes of interest, and application of marker-assisted selection in cowpea breeding programs.

  2. Expanding the repertoire of microsatellite markers for polymorphism studies in Indian accessions of mung bean (Vigna radiata L. Wilczek).

    Science.gov (United States)

    Shrivastava, Divya; Verma, Priyanka; Bhatia, Sabhyata

    2014-09-01

    Limited availability of validated, polymorphic microsatellite markers in mung bean (Vigna radiata), an important food legume of India, has been a major hurdle towards its improvement and higher yield. The present study was undertaken in order to develop a new set of microsatellite markers and utilize them for the analysis of genetic diversity within mung bean accessions from India. A GA/CT enriched library was constructed from V. radiata which resulted in 1,250 putative recombinant clones of which 850 were sequenced. SSR motifs were identified and their flanking sequences were utilized to design 328 SSR primer pairs. Of these, 48 SSR markers were employed for assessing genetic diversity among 76 mung bean accessions from various geographical locations in India. Two hundred and thirty four alleles with an average of 4.85 alleles per locus were detected at 48 loci. The polymorphic information content (PIC) per locus varied from 0.1 to 0.88 (average: 0.49 per locus). The observed and expected heterozygosities ranged from 0.40 to 0.95 and 0.40 to 0.81 respectively. Based on Jaccard's similarity matrix, a dendrogram was constructed using the unweighted pair-group method with arithmetic averages (UPGMA) analysis which revealed that one accession from Bundi, Rajasthan was clustered out separately while remaining accessions were grouped into two major clusters. The markers generated in this study will help in expanding the repertoire of the available SSR markers thereby facilitating analysis of genetic diversity, molecular mapping and ultimately broadening the scope for genetic improvement of this legume.

  3. Mechanism of Resistance in Mungbean [Vigna radiata (L. R. Wilczek var. radiata] to bruchids, Callosobruchus spp. (Coleoptera: Bruchidae

    Directory of Open Access Journals (Sweden)

    Abdul R. War

    2017-06-01

    Full Text Available Mungbean [Vigna radiata (L. R. Wilczek var. radiata] is an important pulse crop in Asia, and is consumed as dry seeds and as bean sprouts. It is an excellent source of digestible protein. Bruchids [Callosobruchus chinensis (L. and Callosobruchus maculatus (F.] are the important pests of mungbean and cause damage in the field and in storage. Bruchid infestation reduces the nutritional and market value of the grain and renders seeds unfit for human consumption, agricultural and commercial uses. These pests are controlled mainly by fumigation with highly toxic chemicals such as carbon disulfide, phosphene, and methyl bromide, or by dusting with several other insecticides, which leave residues on the grain, thus, threatening food safety. Some plant-based extracts have been found useful in controlling bruchids, but are not fully successful due to their short-term activity, rapid degradability, and potentially negative effect on seed germination. Although some wild sources of bruchid resistance in mungbean have been reported, which have been used to develop bruchid- resistant lines, undesirable genetic linkages threaten the proper exploitation of genetic diversity from wild germplasm into commercial cultivars. Further, biotype variation in bruchids has rendered some mungbean lines susceptible that otherwise would have been resistant to the pest. Host plant resistance is a cost-effective and a safe alternative to control bruchids in mungbean and is associated with morphological, biochemical, and molecular traits. These traits affect insect growth and development, thereby, reduce the yield losses by the pests. Understanding the defense mechanisms against insect pests could be utilized in exploiting these traits in crop breeding. This review discusses different traits in mungbean involved in defense against bruchids and their utility in pest management. We also highlight the breeding constraints for developing bruchid-resistant mungbean and how can these

  4. Simple and rapid methods for purification and characterization of active coagulants from the seeds of Vigna unguiculata and Parkinsonia aculeata.

    Science.gov (United States)

    Marobhe, N J; Dalhammar, G; Gunaratna, K R

    2007-06-01

    The coagulating properties of aqueous crude extracts and purified proteins of Vigna unguiculata and Parkinsonia aculeata seeds, which are traditional water coagulants in rural areas of Tanzania, were studied. The coagulation activity assays were done using one millilitre (ml) of kaolin water samples. Coagulating proteins were purified in two-step ion exchange chromatography. The properties of coagulant protein were compared with Moringa oleifera. Coagulating components eluted by 0.6 M NaCl in both coagulants are cationic proteins that have the molecular mass of about 6 kDa, which is very similar to that of M. oleifera. The proteins of V. unguiculata and P. aculeata eluted by 0.3 M NaCl also harbour coagulation activity but proteins eluted with 0.6 M NaCl have higher activity. The dosage for coagulation using purified proteins of both coagulants is about 5 to 10 times lower than that of crude seed extracts. The optimum floc settling time of water treated by crude seed extracts and purified proteins ranged between two and two and half hours. Coagulating proteins of both coagulants eluted by 0.6 M NaCl are thermoresistant and retained coagulation activity of 87% to 92% after boiling for two hours at 80 degrees C and one hour at 95 degrees C. Thermotolerant proteins of V. unguiculata eluted by 0.6 M NaCl and P. aculeata have wider pH range of 5.5 to 8.5 for coagulation activity than those of M. oleifera proteins. The present investigation reveals the possibility of using purified natural coagulants for water treatment to produce safe drinking water.

  5. Changes in some biophysical and biochemical parameters of mungbean [vigna radiata (L.) wilczek] grown on chromium-contaminated soils treated with solid tea wastage

    International Nuclear Information System (INIS)

    Azmat, R.; Akhtar, H.

    2010-01-01

    The success of solid tea wastage treatment technology in remediating chromium (111) contamination in the soil has been demonstrated on growth of Vigna radiata. The present research was designed to study the effect of chromium (Cr3/sup +/) on plant growth, potassium (K), phosphorus (P), protease activity and proline profile of Vigna radiata as a bio indicator in the presence and absence of the solid tea surface as a bio sorbent to control the mobility of Cr3/sup +/ in the soil. Results showed toxic effects of Cr3/ sup +/ on plant growth and development, which include high protease activity with prominent proline and decreased potassium and phosphorus contents at elevated concentration of metal. Proline content is the only amino acid that accumulates to a greater extent in the leaves of plants under stress. An increase in proline contents in leaves, stem and root with high concentration of Cr3/s sup +/ gets reduced in a solid tea wastage amended plants. Metabolic alteration by Cr3/ sup +/exposure and their control by solid tea wastage already described in the first report, showed direct effect on enzymes or other metabolites or by its ability to generate reactive oxygen species which may cause oxidative stress. It is suggested that the plant can grow under chromium stress if some suitable adsorbent (like tea wastage) is mixed with the soil which can protect the plants from the phyto toxicity of Cr 3/sup +/ by altering various metabolic processes. (author)

  6. A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2017-09-01

    Full Text Available Cowpea [Vigna unguiculata (L. Walp.] is an annual legume of economic importance and widely grown in the semi-arid tropics. However, high-density genetic maps of cowpea are still lacking. Here, we identified 34,868 SNPs (single nucleotide polymorphisms that were distributed in the cowpea genome based on the RAD sequencing (restriction-site associated DNA sequencing technique using a population of 170 individuals (two cowpea parents and 168 F2:3 progenies. Of these, 17,996 reliable SNPs were allotted to 11 consensus linkage groups (LGs. The length of the genetic map was 1,194.25 cM in total with a mean distance of 0.066 cM/SNP marker locus. Using this map and the F2:3 population, combined with the CIM (composite interval mapping method, eleven quantitative trait loci (QTL of yield-related trait were detected on seven LGs (LG4, 5, 6, 7, 9, 10, and 11 in cowpea. These QTL explained 0.05–17.32% of the total phenotypic variation. Among these, four QTL were for pod length, four QTL for thousand-grain weight (TGW, two QTL for grain number per pod, and one QTL for carpopodium length. Our results will provide a foundation for understanding genes related to grain yield in the cowpea and genus Vigna.

  7. Variación patogénica y fuentes de resistencia a Colletotrichum lindemuthianum Sacc & magn Scrib., patógeno de la antracnosis del frijol, en Colombia Variación patogénica y fuentes de resistencia a Colletotrichum lindemuthianum (Sacc & Magn Scrib., patógeno de la antracnosis del fríjol, en Colombia

    Directory of Open Access Journals (Sweden)

    Cobo S. Felipe

    1987-03-01

    Full Text Available Pathogenic variation studies with colombian isolates of Colletotrichum lindemuthianum (Sacc & Magn Scrib., the anthracnose bean pathogen, were conducted under laboratory and greenhouse conditions at CIAT, Colombia. In addition, bean germplam with cormercial grain color was evaluated with the objective of identifying resistant varieties and sources of resistance to the existing variation. To this purpose, 17 isolates of C. lindemuthianum collected at the principal Colombian bean zones, were inoculated on 21 American and European differential bean varieties.En los laboratorios e invernaderos del programa de fitopatología de fríjol del CIAT, se estudió la variación patogénica de aislamientos colombianos de Colletotrichum lindemuthianum (Sacc& Magn Scrib. También se evaluó germoplasma de frijol con grano de color comercial con el objetivo de identificar líneas resistentes y fuentes de resistencia a la variación existente. Para este fin, 17 aislamientos de C.lindemuthianum, colectados en las principales zonas frijoleras colombianas se inocularon sobre 21 variedades diferenciales.

  8. A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.).

    Science.gov (United States)

    Misra, Vikram A; Wang, Yu; Timko, Michael P

    2017-11-22

    Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed

  9. Diel pattern of circadian clock and storage protein gene expression in leaves and during seed filling in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Weiss, Julia; Terry, Marta I; Martos-Fuentes, Marina; Letourneux, Lisa; Ruiz-Hernández, Victoria; Fernández, Juan A; Egea-Cortines, Marcos

    2018-02-14

    Cowpea (Vigna unguiculata) is an important source of protein supply for animal and human nutrition. The major storage globulins VICILIN and LEGUMIN (LEG) are synthesized from several genes including LEGA, LEGB, LEGJ and CVC (CONVICILIN). The current hypothesis is that the plant circadian core clock genes are conserved in a wide array of species and that primary metabolism is to a large extent controlled by the plant circadian clock. Our aim was to investigate a possible link between gene expression of storage proteins and the circadian clock. We identified cowpea orthologues of the core clock genes VunLHY, VunTOC1, VunGI and VunELF3, the protein storage genes VunLEG, VunLEGJ, and VunCVC as well as nine candidate reference genes used in RT-PCR. ELONGATION FACTOR 1-A (ELF1A) resulted the most suitable reference gene. The clock genes VunELF3, VunGI, VunTOC1 and VunLHY showed a rhythmic expression profile in leaves with a typical evening/night and morning/midday phased expression. The diel patterns were not completely robust and only VungGI and VungELF3 retained a rhythmic pattern under free running conditions of darkness. Under field conditions, rhythmicity and phasing apparently faded during early pod and seed development and was regained in ripening pods for VunTOC1 and VunLHY. Mature seeds showed a rhythmic expression of VunGI resembling leaf tissue under controlled growth chamber conditions. Comparing time windows during developmental stages we found that VunCVC and VunLEG were significantly down regulated during the night in mature pods as compared to intermediate ripe pods, while changes in seeds were non-significant due to high variance. The rhythmic expression under field conditions was lost under growth chamber conditions. The core clock gene network is conserved in cowpea leaves showing a robust diel expression pattern except VunELF3 under growth chamber conditions. There appears to be a clock transcriptional reprogramming in pods and seeds compared to

  10. Effect of bambara groundnut flour (Vigna subterranea (L.) Verdc.) supplementation on chemical, physical, nutritional and sensory evaluation of wheat bread.

    Science.gov (United States)

    Abdualrahman, Mohammed A Y; Ali, Ali O; Elkhalifa, Elamin A; Sulieman, Abdelmoneim E

    2012-09-01

    Bambara groundnut (Vigna subterrenea (L) Verdc) is a major source of vegetable protein in sub-Saharan Africa. And the aim of this study was to enhance the nutritional value of wheat bread through the addition of bambara groundnut flour to wheat four. For this, bambara groundnut seeds were soaked in tap water, manually decorticated, sun dried and milled into fine flour. Proximate analysis of flours of de-hulled bambara groundnut and wheat were conducted. Flour of de-hulled bambara groundnut was used for bread supplementation in ratios of 5, 10 and 15%. Rheological properties of the control flour and wheat flour supplemented with 10% of de-hulled bambara groundnut flour were conducted. The total area and dough development time increased. However, water absorption, stability and extensibility respectively decreased, from 71.3; 8.5; 190 in the control flour to 71.0; 5.5; 180 in the 10% supplemented flour. The increases in the resistance to extension and proportional number from 260 to 280 and 1.37 to 1.56, respectively resulted in stiff dough. The most important effect of wheat bread supplementation was the improvement of protein quantity from 13.74 +/- 0.02% for the control bread to 15.49 +/- 0.02, 17.00 +/- 0.05 and 18.98 +/- 0.02% for the 5, 10 and 15% blending ratios, respectively. The in-vitro protein digestibility progressively increased from 84.33 +/- 0.03 in the control bread to 85.42 +/- 0.04, 86.57 +/- 0.04 and 87.64 +/- 0.03 in breads containing 5, 10 and 15% bambara groundnut flour. The sensory attributes of different types of bread showed that, a significant difference was observed in texture, colour and overall acceptability. However, the panelists gave higher score for 10% de-hulled bambara groundnut flour bread than bread made from other blends. The loaf weights, loaf volume and specific volume increased. However, while the loaf weight increased with addition of 15% de-hulled bambara groundnut flour, both of loaf volume and specific volume decreased

  11. Effect of soaking and fermentation on content of phenolic compounds of soybean (Glycine max cv. Merit) and mung beans (Vigna radiata [L] Wilczek).

    Science.gov (United States)

    María Landete, José; Hernández, Teresa; Robredo, Sergio; Dueñas, Montserrat; de Las Rivas, Blanca; Estrella, Isabel; Muñoz, Rosario

    2015-03-01

    Mung beans (Vigna radiata [L] Wilczek) purchased from a Spanish company as "green soybeans", showed a different phenolic composition than yellow soybeans (Glycine max cv. Merit). Isoflavones were predominant in yellow soybeans, whereas they were completely absent in the green seeds on which flavanones were predominant. In order to enhance their health benefits, both types of bean were subjected to technological processes, such as soaking and fermentation. Soaking increased malonyl glucoside isoflavone extraction in yellow beans and produced an increase in apigenin derivatives in the green beans. Lactobacillus plantarum CECT 748 T fermentation produced an increase in the bioactivity of both beans since a conversion of glycosylated isoflavones into bioactive aglycones and an increase of the bioactive vitexin was observed in yellow and green beans, respectively. In spite of potential consumer confusion, since soybean and "green soybean" are different legumes, the health benefits of both beans were enhanced by lactic fermentation.

  12. Barrières pré-zygotiques chez les hybrides entre formes sauvages du niébé, Vigna unguilata (L. Walp.

    Directory of Open Access Journals (Sweden)

    Baudoin JP.

    2006-01-01

    Full Text Available Hybrids pre-zygotic barriers between wild forms of cowpea. The wild forms of cowpea, Vigna unguiculata, constitute an important gene pool insufficiently exploited for the improvement of the cultivated form. In order to promote the use of these wild forms in the genetic improvement programmes, we undertook to understand the various incompatibility reactions which appear in the crosses between wild forms. Efforts were concentrated to understand the incompatibility barriers in the hybridizations between subsp. baoulensis NI 933 and the other wild forms of V. unguiculata. Thanks to the use of the aniline blue fluorescence, we observed a high frequency of pre-zygotic barriers. They appear in three sites, i.e. the higher and lower third of the style, and within the ovary. However, these incompatibility barriers are not absolute. Indeed, in our hybridizations, more than 4% of the ovules were fertilized in the various studied combinations.

  13. Induction of heat shock-like proteins in Vigna sinensis seedlings growing under ultraviolet-B (280-320 nm) enhanced radiation

    International Nuclear Information System (INIS)

    Nedunchezhian, N.; Annamalainathan, K.; Kulandaivelu, G.

    1992-01-01

    The effect of ultraviolet-B (UV-B) enhanced fluorescent radiation on protein profile and protein synthesis has been investigated in Vigna sinensis L. cv. Walp seedlings growing at various temperatures. In seedlings growing at 30°C, UV-B radiation decreased the level of several proteins as seen in Coomassie brilliant blue stained gel. However, fluorography of the same gel indicates induction of three sets of proteins in the range of 70. 53 and 16 k Da. Such induction under UV-B enhanced radiation resembled that found after heat shock treatments. In seedlings at 10 and 20°C, induction of such proteins varied both qualitatively and quantitatively. At 40°C. UV-B enhanced radiation caused a cumulative effect with temperature. Strong induction of specific proteins by UV-B radiation in seedlings growing under normal temperature indicates a possible protective role

  14. Efficacy of Carbofuran in Controlling Root-Knot Nematode (Meloidogyne javanica Whitehead, 1949 on Cultivars of Bambara Groundnut (Vigna subterranea (L. Verdc. in Yola, Nigeria

    Directory of Open Access Journals (Sweden)

    M. Y. Jada

    2011-01-01

    Full Text Available Bambara groundnut (Vigna subterrenea L. Verdc. is an important crop produced in Adamawa State of Nigeria. However, the production of the crop is seriously threatened by root-knot nematodes (RKNs; Meloidogyne spp.. Since cultural methods have not been very effective in controlling RKN, carbofuran was evaluated to determine its efficacy in controlling M. javanica in Yola during 2002 and 2003. Three bambara groundnut cultivars (Kwachanjiwa, Kwaheuma, and Kwatolotolo were evaluated using three application timings (at planting, 3 and 6 weeks after planting, and none. Results indicated that applying carbofuran at planting provided the greatest reduction in M. javanica population levels, which lead to increased yields in bambara groundnuts compared to the other two application timings. Furthermore, both Kwachanjiwa and Kwatolotolo provided similar high yields compared to Kwaheuma, which was most likely related to the M. javanica tolerance in these cultivars.

  15. Performance of cowpea (Vigna unguiculata) and pearl millet (Pennisetum glaucum) intercropped under Parkia biglobosa in an agroforestry system in Burkina Faso

    DEFF Research Database (Denmark)

    Osman, Ahmed Nur; Ræbild, Anders; Christiansen, Jørgen Lindskrog

    2011-01-01

    In agroforestry systems, crop yields under trees are often low compared to outside. This study explored crop management under trees for improved production and income for farmers. Cowpea (Vigna unguiculata) and pearl millet (Pennisetum glaucum) sole and intercrops were grown under and outside...... the trees and intercrops flowered earlier than sole crops. Cowpea sole crops had significant grain yield losses of up to 21% under trees compared to outside, and pearl millet yield was reduced up to 67% under trees. Intercrop yields were less affected by growth under trees. LER was significantly higher...... under the trees than outside, and were always larger than unity indicating benefits of intercropping over sole cropping. Intercropping with two rows of cowpea and one row of millet gave significantly higher economic benefit than mixture with one row of each of the crops. Results indicate...

  16. Effect of Nano-ZnO Particle Suspension on Growth of Mung (Vigna radiata and Gram (Cicer arietinum Seedlings Using Plant Agar Method

    Directory of Open Access Journals (Sweden)

    Pramod Mahajan

    2011-01-01

    Full Text Available The present study demonstrates an effect of nano-ZnO particles on the growth of plant seedlings of mung (Vigna radiate and gram (Cicer arietinum. The study was carried out in plant agar media to prevent precipitation of water-insoluble nanoparticles in the test units. Various concentrations of nano-ZnO particles in suspension form were introduced to the agar media, and their effect on the root and shoot growth of the seedlings was examined. The main experimental approach, using correlative light and scanning electron microscopy provided evidence of adsorption of nanoparticles on the root surface. Absorption of nanoparticles by seedlings root was also detected by inductive coupled plasma/atomic emission spectroscopy (ICP-AES. It was found that at certain optimum concentration, the seedlings displayed good growth over control, and beyond that, retardation in growth was observed.

  17. Nitrogen fixation by mung bean (Vigna radiata L.) under field conditions in the Philippines as quantified by 15N isotope dilution

    International Nuclear Information System (INIS)

    Rosales, C.M.; Rivera, F.; Hautia, R.A.; Del Rosario, E.

    1995-05-01

    Nitrogen fixation by five mung bean genotypes (Vigna radiata L.) was estimated using two reference crops at two locations in the Philippines. The percentage of N derived from fixation and the amount of N-fixed ranged from 64 to 87% and 43 to 85 kg N/ha respectively at one location and from 36.6 to 72% and 21 to 85 kg N/ha at another location using cotton as reference crop. Maize was not a good reference crop. The highest mung bean seed yields obtained were 1.99 t/ha and 0.86 t/ha in the two locations. As to residual benefits, corn dry matter seeds yield were higher when grown following N 2 -fixing mung bean than after non-fixing corn or cotton. (author). 25 refs., 1 fig., 5 tabs

  18. Isolation and screening of rhizobia for auxin biosynthesis and growth promotion of mung bean (Vigna radiata L. seedlings under axenic conditions

    Directory of Open Access Journals (Sweden)

    Muhammad Ashfaq Anjum, Zahir Ahmad Zahir, Muhammad Arshad and Muhammad Ashraf

    2011-04-01

    Full Text Available A series of screening experiments to evaluate the effectiveness of rhizobia for producing auxins and improvegrowth and nodulation of mungbean (Vigna radiata L. were carried out under axenic conditions. Forty fouriolatess of rhizobia were isolated using standard procedures. Auxin biosynthesis by these rhizobial isolates wasdetermined in the absence and presence of L-Trp, a physiological precursor of auxins. Rhizobial isolates variedwidely in auxins biosynthesis capabilities. On the basis of auxins biosynthesis, a pouch experiment was conductedfor screening thirty four efficient isolates of rhizobia for the growth promotion of mung bean. Results of pouch studyshowed that inoculation with selected rhizobial isolates increased the root /shoot length, fresh, and dry shoot weightof mung bean up to 33, 59, 71, 148, 107 and 188%, respectively, over untreated control. Further studies are neededunder glasshouse and field conditions for confirmation of these results.

  19. Effect of extrusion conditions and lipoxygenase inactivation treatment on the physical and nutritional properties of corn/cowpea (Vigna unguiculata) blends.

    Science.gov (United States)

    Sosa-Moguel, Odri; Ruiz-Ruiz, Jorge; Martínez-Ayala, Alma; González, Rolando; Drago, Silvina; Betancur-Ancona, David; Chel-Guerrero, Luis

    2009-01-01

    The influence of lipoxygenase inactivation and extrusion cooking on the physical and nutritional properties of corn/cowpea (Vigna unguiculata) blends was studied. Corn was blended in an 80:15 proportion with cowpea flour treated to inactivate lipoxygenase (CI) or non-inactivated cowpea flour (CNI). Extrusion variables were temperature (150 degrees C, 165 degrees C and 180 degrees C) and moisture (15%, 17% and 19%). Based on their physical properties, the 165 degrees C/15% corn:CNI, and 165 degrees C/15% corn:CI, and 150 degrees C/15% corn:CI blends were chosen for nutritional quality analysis. Extrudate chemical composition indicated high crude protein levels compared with standard corn-based products. With the exception of lysine, essential amino acids content in the three treatments met FAO requirements. Extrusion and lipoxygenase inactivation are promising options for developing corn/cowpea extruded snack products with good physical properties and nutritional quality.

  20. Observations préliminaires de la variabilité entre quelques morphotypes de voandzou (Vigna subterranea L. Verdc., Fabaceae de Côte d'Ivoire

    Directory of Open Access Journals (Sweden)

    Zoro Bi IA.

    2005-01-01

    Full Text Available Preliminary observations of variability between some morphotypes of bambara groundnut (Vigna subterranea L. Verdc., Fabaceae from Côte d’Ivoire. Bambara groundnut (Vigna subterranea L. Verdc., is a food legume mainly cultivated by women for whom it represents a source of income for the household. In Côte d’Ivoire, the cultivation of bambara groundnut is located in the western and northern parts of the country. These zones are characterised by contrasted agroecology including tropical rain forest and dry savanna. In these zones, bambara groundnut plays a key role in both food and culture of peoples. Four morphotypes of Côte d’Ivoire (ICU, BPR, RBU, NFU were used in a preliminary study to assess the phenotypic variability between morphotypes. For each morphotype, 100 individuals were sampled to analyse 26 agromorphological traits selected from the list of bambara groundnut descriptors. Results of statistical analyses showed an important variability among morphotypes suggesting that 22 of these characters could be powerful to distinguish diversity among bambara groundnut morphotypes of Côte d’Ivoire. Three morphotypes (ICU, BPR and RBU show a shorter reproductive cycle than the other (NFU. In our experimental conditions, morphotypes with a shorter reproductive cycle give a higher percentage of matured pods (87 to 95%, compared to morphotype NFU (60%. The morphotype ICU was particularly earlier, maturing 90 days after sowing (DAS, whereas the long reproductive cycle morphotype (NFU required about 137 days. Based on the analysed agronomic traits, possibilities to improve bambara groundnut yield and to promote its cultivation in Côte d’Ivoire are discussed.

  1. Effet comparé des poudres de Nicotiana tabacum L, Cymbopogon citratus (D.C. Stapf et de l'huile de Ricinus communis L sur la conservation des graines de Vigna unguiculata (L Walp

    Directory of Open Access Journals (Sweden)

    Gakuru, S.

    1995-01-01

    Full Text Available Compared Effect of Nicotiana tabacum L, Cymbopogon citratus (D.C. Stapf Powders and Castor Oil Ricinus communis L. on Conservation of Cowpea Vigna Unguiculata (L. Walp Grains. The effect of powder of tobacco Nicotiana tabacum L. and citronella grass Cymbopogon citratus (D.C. Stapf and castor oil Ricinus communis L. on conservation of cowpea Vigna unguiculata (L. Walp. grains was investigated in Kisangani, Zaire. After 5 months of conservation, infestation rates by bean weevil Acanthoscelides obtectus Say were 72.5 %, 74.5 %, 49.5 % and 5 % respectively for the check, the samples treated by 1 % of citronella grass and tobacco powder and 1 % of castor oil. The powder dose of 7.5 % did not give more interesting results.

  2. Influence du décalage du semis du niébé (Vigna unguiculata (L.) Walp) par rapport au maïs (Zea mays L.) sur la croissance et le rendement du niébé

    OpenAIRE

    Osiru, DSO.; Ocaya, CP.; Adipala, E.

    2002-01-01

    Effect of Time of Planting Cowpea (Vigna unguiculata (L.) Walp) Relative to Maize (Zea mays L.) on Growth and Yield of Cowpea. Field investigations were carried out for three seasons in two locations of Uganda to examine yield benefits when cowpea and maize are planted under intensive farming conditions. Additive mixtures of cowpea were planted into maize thrice at 2 weekly intervals together with sole crops. Time of introducing cowpea into maize significantly affected both the growth and yie...

  3. COWPEA (VIGNA UNGUICULATA)

    African Journals Online (AJOL)

    DR. AMINU

    The protein contents of the weaning food blends met ... Dietary Allowance (RDA) for infants (0 – 1 year), though the fat contents were ... foods along side breast milk as from four months, ... grams (100g) of the cleaned pearl millet (raw grain).

  4. Vigna subterranea L. Verdc

    African Journals Online (AJOL)

    2015-07-04

    Jul 4, 2015 ... This leads to significant non-productive water losses through soil ... esized that total crop water use could be improved if crop estab- lishment was ...... which allowed for maintenance of high tissue water potential. The red ...

  5. (VIGNA SUBTERRANEA [L.] VERDC.)

    African Journals Online (AJOL)

    User

    2015-12-02

    Dec 2, 2015 ... Latin America, probably through the slave trade, and is found in Sri-Lanka, Malaysia, Philippines and India, and. Brazil (Rassel, 1960; Goli et al., 1997). Bambara nut is an important source of dietary protein in sub-Saharan Africa, with protein levels of 16-25%. (Brough et al., 1993); carbohydrates and oil ...

  6. Vigna subterranea L. Verdc

    African Journals Online (AJOL)

    2012-05-14

    May 14, 2012 ... Effects of irrigation levels and seed coat colour on growth, development, yield and water-use efficiency of local bambara groundnut landrace selections were ..... Therefore, there is a need to down-regulate photosynthesis in.

  7. (Vigna radiata) seeds

    African Journals Online (AJOL)

    hp

    and maximum activity was observed at 70°C. The optimal pH value of the enzyme activity was found to be 5.2. There was a ... expresses its isozymes in many plants such as soyabean .... Firstly, it can change the ionization of the enzyme.

  8. (Vigna radiata (L.) Wilczek)

    Indian Academy of Sciences (India)

    hectare with 1.02 million tonne production (average during. 2000–2003). This crop provides ... rinsed with 70% ethanol for 10–15 min and dried at room temperature overnight. .... gating generation led to differentiation. Cluster IV exhibited.

  9. Construction and analysis of an SSH cDNA library of early heat-induced genes of Vigna aconitifolia variety RMO-40.

    Science.gov (United States)

    Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar

    2012-11-01

    Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.

  10. Nutritive Evaluation of the Bambara Groundnut Ci12 Landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] Produced in Côte d'Ivoire.

    Science.gov (United States)

    Yao, Denis N'Dri; Kouassi, Kouakou Nestor; Erba, Daniela; Scazzina, Francesca; Pellegrini, Nicoletta; Casiraghi, Maria Cristina

    2015-09-07

    The nutritional evaluation of the Bambara groundnut Ci12 landrace (Vigna subterranea (L.) Verdc.) seeds produced in Côte d'Ivoire shows a 19% content of protein, containing all the essential amino acids with tryptophan as the limiting amino acid, a total dietary fiber level of 10%, with a low soluble fraction content, and a fat content of 1.4%, with a high proportion of total unsaturated fatty acids (61%) of which 36% were n-6 fatty acids. This legume contains phosphorus, as the major mineral, followed by magnesium and calcium, and trace elements (iron, copper and zinc). It is characterized by the same amount of α-tocopherol and antioxidant capacity as common legumes. The high concentration of essential amino acids, n-6 fatty acids and minerals, mainly Fe, in the Ci12 landrace of Bambara groundnut indicates that this local legume has the potentiality to improve the nutritional status in Côte d'Ivoire and it could be regarded as a nutrient dense food.

  11. Nutritive Evaluation of the Bambara Groundnut Ci12 Landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] Produced in Côte d’Ivoire

    Science.gov (United States)

    N’Dri Yao, Denis; Kouassi, Kouakou Nestor; Erba, Daniela; Scazzina, Francesca; Pellegrini, Nicoletta; Casiraghi, Maria Cristina

    2015-01-01

    The nutritional evaluation of the Bambara groundnut Ci12 landrace (Vigna subterranea (L.) Verdc.) seeds produced in Côte d’Ivoire shows a 19% content of protein, containing all the essential amino acids with tryptophan as the limiting amino acid, a total dietary fiber level of 10%, with a low soluble fraction content, and a fat content of 1.4%, with a high proportion of total unsaturated fatty acids (61%) of which 36% were n-6 fatty acids. This legume contains phosphorus, as the major mineral, followed by magnesium and calcium, and trace elements (iron, copper and zinc). It is characterized by the same amount of α-tocopherol and antioxidant capacity as common legumes. The high concentration of essential amino acids, n-6 fatty acids and minerals, mainly Fe, in the Ci12 landrace of Bambara groundnut indicates that this local legume has the potentiality to improve the nutritional status in Côte d’Ivoire and it could be regarded as a nutrient dense food. PMID:26370971

  12. Influence of Rhizobacterium Inoculation on NaCl Salinity Tolerance in Pusa Sukomal and RC101 Varieties of Cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Sadhna Chaturvedi

    2017-06-01

    Full Text Available Soil salinity is one of the most severe factors limiting growth and physiological response in cowpea plants. In the present study, the effect of rhizobacterium strains BR2 and BR3 on the growth of cowpea (Vigna unguiculata L. varieties—Pusa Sukomal and RC101—tolerance to 0, 25, 50, and 75 mM concentrations of NaCl salinity was evaluated. The rate of growth, in general, was high in plants irrigated with 25 mM NaCl saline water as compared to control, and thereafter, the growth reduced with increase in salinity concentrations. The results revealed that treating the seeds with rhizobacteria accompanied by NaCl salinity increased growth parameters of the cowpea plant as compared to the seeds irrigated with sodium chloride alone. Treatment with rhizobacteria mitigated the harmful effect of NaCl, and the growth was significantly better than the plants growing in saline water without rhizobacterium inoculation. The overall performance of Pusa Sukomal with BR3 strain was found to be better than the other combinations tested. Flowering in field plants started within 45 days of sowing, and the seeds in plants irrigated with saline water, in the presence of rhizobacterium, were found to be healthy as compared to control seeds. Seed protein profile was analyzed by SDS PAGE gel studies.

  13. Curbing the Growth of Wax Bean (Vigna unguiculata L. via a Novel Complex of Nano Zinc Oxide/Vermicompost

    Directory of Open Access Journals (Sweden)

    Farideh BEHBOUDI

    2016-12-01

    Full Text Available Vermicompost (VC samples were prepared from manure and spent mushroom compost (SMC and were impregnated with zinc oxide nanoparticles (ZnO NPs, giving ZnO NPs/VC complexes that were added into the soil in which wax beans (Vigna unguiculata L. were then planted. The study was carried out through a factorial experiment in a randomized complete block design with three factors. The experimental factors included: ZnO NPs (0, 0.4, 0.8 and 1.2 mg kg-1, two substrate types (cow manure and SMC and VC (2.5, 5 and 7.5 weight percentages. To the substrate types, adult earthworms (Eisenia fetida were added. Specifically, after three months, the prepared VC was soaked in ZnO NPs solutions, mixed with soil (according to cultivation substrate weight, then employed in wet plantation of wax beans. The obtained results showed that with increasing ZnO NPs, leaves’ chlorophyll, grains number per pod, stem length, hundred grains weight, grain yield, and the grain protein content significantly decreased. In general, the usage of these NPs in the applied amounts could curb the undesired growth of this species.

  14. Treatment of Cr/sup 3+/ contaminated soil by solid tea wastage I. A study of physiological processes of Vigna radiata

    International Nuclear Information System (INIS)

    Azmat, R.; Akhter, Y.; Sara Qureshi, S.; Ahmed, T.

    2010-01-01

    This study describes the option of using domestic tea waste in soil contaminated with the Cr/sup 3+/ trace metal due to industrial and mine activity, continuously discharging in the land and aquatic resources. This disposal of industrial wastage without proper treatment is responsible for the lowering of crop productivity with the accumulation of essential and non essential trace metals in the plants. On the other hand domestic waste management in soil and aquatic resources are also accountable for the reduced field productivity. This research discusses the proper domestic waste management in the agriculture land for the cultivation of crop in the contaminated soil. Vigna radiata has been selected as a crop to check the effects of Cr/sup 3+/ and its deletion in the contaminated soil. The highest yield was obtained when soil was mixed with tea wastage instead of spreaded tea wastage. Seed germination, morphology and physiology of 15 days old plant showed remarkable improvement in the plant growth including seed germination with activated tea wastage in the presence of Cr/sup 3+/ as compared to those plants which were grown in Cr/sup 3+/ contaminated soil only. Biochemical analysis of seedling showed an increase in the concentration of chlorophyll, carbohydrates, protein and amino acids, which confirms the remediation of contaminated soil through tea wastage. It was concluded that proper use of domestic waste can be helpful to increase the soil fertility and can concentrate the heavy toxic metals in it through complex formation. (author)

  15. Characterization of VuMATE1 expression in response to iron nutrition and aluminum stress reveals adaptation of rice bean (Vigna umbellata to acid soils through cis regulation

    Directory of Open Access Journals (Sweden)

    Meiya eLiu

    2016-04-01

    Full Text Available Rice bean (Vigna umbellata VuMATE1 appears to be constitutively expressed at vascular system but root apex, and Al stress extends its expression to root apex. Whether VuMATE1 participates in both Al tolerance and Fe nutrition, and how VuMATE1 expression is regulated is of great interest. In this study, the role of VuMATE1 in Fe nutrition was characterized through in planta complementation assays. The transcriptional regulation of VuMATE1 was investigated through promoter analysis and promoter-GUS reporter assays. The results showed that the expression of VuMATE1 was regulated by Al stress but not Fe status. Complementation of frd3-1 with VuMATE1 under VuMATE1 promoter could not restore phenotype, but restored with 35SCaMV promoter. Immunostaining of VuMATE1 revealed abnormal localization of VuMATE1 in vasculature. In planta GUS reporter assay identified Al-responsive cis-acting elements resided between -1228 and -574 bp. Promoter analysis revealed several cis-acting elements, but transcription is not simply regulated by one of these elements. We demonstrated that cis regulation of VuMATE1 expression is involved in Al tolerance mechanism, while not involved in Fe nutrition. These results reveal the evolution of VuMATE1 expression for better adaptation of rice bean to acidic soils where Al stress imposed but Fe deficiency pressure released.

  16. Use of two varieties of hard-to-cook beans (Phaseolus vulgaris) and cowpeas (Vigna unguiculata) in the processing of koki (a steamed legume product).

    Science.gov (United States)

    Mbofung, C M; Rigby, N; Waldron, K

    1999-01-01

    Koki is a nutritious cowpea-based food product usually processed by steam cooking whipped cowpea (Vigna unguiculata) paste mixed with spices and palm oil. A study was carried out to investigate the effect of the partial replacement of cowpeas (CP) with hard-to-cook (HTC) beans on the chemical, nutritional and sensory characteristics of koki. Towards this objective, two varieties of beans--Phaseolus vulgaris (red kidney beans--RKB and mottled brown beans--MBB), each with the HTC defect, were separately incorporated into cowpea paste in the following Bean:CP ratios 0:100, 20:80, 30:70, 40:60, 50:50, 60:40 and processed into koki. Incorporation of dry HTC beans into cowpeas in the making of koki affected the bulking properties of the uncooked paste, the nutrient composition, essential amino acid content, antinutritional factors, digestibility as well as the sensory attributes of cooked koki. Sensory tests showed that a highly acceptable, nutritious and digestible koki can be processed from cowpeas partially replaced with dry HTC bean paste up to levels of about 40-50% depending on the variety of dry bean used.

  17. Impact of pesticides on plant growth promotion of Vigna radiata and non-target microbes: comparison between chemical- and bio-pesticides.

    Science.gov (United States)

    Gupta, Sukriti; Gupta, Rashi; Sharma, Shilpi

    2014-08-01

    To compare the target and non-target effects of two chemical-pesticides (chlorpyrifos and endosulfan) with that of a bio-pesticide (azadirachtin), Vigna radiata (mung bean) was grown in a randomized pot experiment with recommended and higher application rates of pesticides. Colony counts enumerating specific microbial populations, viz. fungi, Pseudomonas, nitrogen-fixing bacteria, and phosphate-solubilizing microorganisms, were performed. In addition, several plant growth parameters such as root and shoot lengths were also monitored. It was observed that the pesticides exerted a suppressive effect on different microbial communities under study in the initial 30 days period. The bacterial and fungal populations in chlorpyrifos treated plants increased thereafter. Endosulfan resulted in enhancement of fungi and nitrogen-fixing bacteria, although phosphate-solubilizing microorganisms were suppressed at higher application rates. Azadirachtin, which is gaining popularity owing to its biological origin, did not result in enhancement of any microbial populations; on the other hand, it had a deleterious effect on phosphate-solubilizing bacteria. This study is the first to evaluate the non-target effects of pesticides with a comparison between chemical- and bio-pesticides, and also stresses the importance of critical investigation of bio-pesticides before their wide spread application in agriculture.

  18. Biochemical studies of amylase, lipase and protease in Callosobruchus maculatus (Coleoptera: Chrysomelidae) populations fed with Vigna unguiculata grain cultivated with diazotrophic bacteria strains.

    Science.gov (United States)

    Silva, L B; Torres, É B; Nóbrega, R A S; Lopes, G N; Vogado, R F; Pavan, B E; Fernandes-Junior, P I

    2017-12-01

    The objective of this study was to evaluate the enzymatic activity of homogenates of insects fed on grain of cowpea, Vigna unguiculata (L.), cultivars grown with different nitrogen sources. For the experiment we used aliquots of the homogenate of 100 unsexed adult insects, emerged from 10 g of grain obtained from four cowpea cultivars: 'BRS Acauã', 'BRS Carijó', 'BRS Pujante', and 'BRS Tapaihum' grown under different regimes of nitrogen sources: mineral fertilizer, inoculation with strains of diazotrophs (BR 3267, BR 3262, BR 3299; INPA 03-11B, 03-84 UFLA, as well as the control (with soil nitrogen). The parameters evaluated were enzymatic activities of insect protease, amylase and lipase and the starch content of the grains. There were differences in the enzymatic activity of amylase, lipase and protease of insect homogenate according to the food source. A lower activity of the enzyme amylase from C. maculatus homogenate was observed when insects were fed grain of the cultivar BRS Carijó. A lower activity of lipase enzyme from C. maculatus homogenate was observed when the insects fed on grain from the interaction of the cultivar Tapaihum inoculated with BR 3262 diazotrophs. The lowest proteolytic activity was observed in homogenate of insects fed on interaction of 'BRS Carijó' inoculated with BR 3262 diazotrophs. Starch content correlated positively with the amylase activity of C. maculatus homogenate. The cultivar BRS Carijó had a different behavior from the other cultivars, according to the cluster analysis.

  19. Cowpea (Vigna unguiculata L. Walp), a renewed multipurpose crop for a more sustainable agri-food system: nutritional advantages and constraints.

    Science.gov (United States)

    Gonçalves, Alexandre; Goufo, Piebiep; Barros, Ana; Domínguez-Perles, Raúl; Trindade, Henrique; Rosa, Eduardo A S; Ferreira, Luis; Rodrigues, Miguel

    2016-07-01

    The growing awareness of the relevance of food composition for human health has increased the interest of the inclusion of high proportions of fruits and vegetables in diets. To reach the objective of more balanced diets, an increased consumption of legumes, which constitutes a sustainable source of essential nutrients, particularly low-cost protein, is of special relevance. However, the consumption of legumes also entails some constraints that need to be addressed to avoid a deleterious impact on consumers' wellbeing and health. The value of legumes as a source of nutrients depends on a plethora of factors, including genetic characteristics, agro-climatic conditions, and postharvest management that modulate the dietary effect of edible seeds and vegetative material. Thus, more comprehensive information regarding composition, especially their nutritional and anti-nutritional compounds, digestibility, and alternative processing procedures is essential. These were the challenges to write this review, which focusses on the nutritional and anti-nutritional composition of Vigna unguiculata L. Walp, an emerging crop all over the world intended to provide a rational support for the development of valuable foods and feeds of increased commercial value. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp) consumed in Brazil.

    Science.gov (United States)

    Pereira, Elenilda J; Carvalho, Lucia M J; Dellamora-Ortiz, Gisela M; Cardoso, Flávio S N; Carvalho, José L V

    2016-01-01

    The cowpea (Vigna unguiculata L. Wap.) is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  1. Use of ex vitro composite plants to study the interaction of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides

    Science.gov (United States)

    2012-01-01

    Background Cowpea (Vigna unguiculata L.) is an important grain and forage legume grown throughout sub-Saharan Africa primarily by subsistence farmers on poor, drought prone soils. Genetic improvement of the crop is being actively pursued and numerous functional genomics studies are underway aimed at characterizing gene controlling key agronomic characteristics for disease and pest resistances. Unfortunately, similar to other legumes, efficient plant transformation technology is a rate-limiting step in analysis of gene function in cowpea. Results Here we describe an optimized protocol for the rapid generation of transformed hairy roots on ex vitro composite plants of cowpea using Agrobacterium rhizogenes. We further demonstrate the applicability of cowpea composite plants to study gene expression involved in the resistance response of the plant roots to attack by the root parasitic weed, Striga gesnerioides. The utility of the new system and critical parameters of the method are described and discussed herein. Conclusions Cowpea composite plants offer a rapid alternative to methods requiring stable transformation and whole plant regeneration for studying gene expression in resistance or susceptibility responses to parasitic weeds. Their use can likely be readily adapted to look at the effects of both ectopic gene overexpression as well as gene knockdown of root associated defense responses and to the study of a broader range of root associated physiological and aphysiological processes including root growth and differentiation as well as interactions with other root pests, parasites, and symbionts. PMID:22741546

  2. A multi-parent advanced generation inter-cross (MAGIC) population for genetic analysis and improvement of cowpea (Vigna unguiculata L. Walp.).

    Science.gov (United States)

    Huynh, Bao-Lam; Ehlers, Jeffrey D; Huang, Bevan Emma; Muñoz-Amatriaín, María; Lonardi, Stefano; Santos, Jansen R P; Ndeve, Arsenio; Batieno, Benoit J; Boukar, Ousmane; Cisse, Ndiaga; Drabo, Issa; Fatokun, Christian; Kusi, Francis; Agyare, Richard Y; Guo, Yi-Ning; Herniter, Ira; Lo, Sassoum; Wanamaker, Steve I; Xu, Shizhong; Close, Timothy J; Roberts, Philip A

    2018-03-01

    Multi-parent advanced generation inter-cross (MAGIC) populations are an emerging type of resource for dissecting the genetic structure of traits and improving breeding populations. We developed a MAGIC population for cowpea (Vigna unguiculata L. Walp.) from eight founder parents. These founders were genetically diverse and carried many abiotic and biotic stress resistance, seed quality and agronomic traits relevant to cowpea improvement in the United States and sub-Saharan Africa, where cowpea is vitally important in the human diet and local economies. The eight parents were inter-crossed using structured matings to ensure that the population would have balanced representation from each parent, followed by single-seed descent, resulting in 305 F 8 recombinant inbred lines each carrying a mosaic of genome blocks contributed by all founders. This was confirmed by single nucleotide polymorphism genotyping with the Illumina Cowpea Consortium Array. These lines were on average 99.74% homozygous but also diverse in agronomic traits across environments. Quantitative trait loci (QTLs) were identified for several parental traits. Loci with major effects on photoperiod sensitivity and seed size were also verified by biparental genetic mapping. The recombination events were concentrated in telomeric regions. Due to its broad genetic base, this cowpea MAGIC population promises breakthroughs in genetic gain, QTL and gene discovery, enhancement of breeding populations and, for some lines, direct releases as new varieties. © 2018 The Authors. The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  3. A major QTL corresponding to the Rk locus for resistance to root-knot nematodes in cowpea (Vigna unguiculata L. Walp.).

    Science.gov (United States)

    Huynh, Bao-Lam; Matthews, William C; Ehlers, Jeffrey D; Lucas, Mitchell R; Santos, Jansen R P; Ndeve, Arsenio; Close, Timothy J; Roberts, Philip A

    2016-01-01

    Genome resolution of a major QTL associated with the Rk locus in cowpea for resistance to root-knot nematodes has significance for plant breeding programs and R gene characterization. Cowpea (Vigna unguiculata L. Walp.) is a susceptible host of root-knot nematodes (Meloidogyne spp.) (RKN), major plant-parasitic pests in global agriculture. To date, breeding for host resistance in cowpea has relied on phenotypic selection which requires time-consuming and expensive controlled infection assays. To facilitate marker-based selection, we aimed to identify and map quantitative trait loci (QTL) conferring the resistance trait. One recombinant inbred line (RIL) and two F2:3 populations, each derived from a cross between a susceptible and a resistant parent, were genotyped with genome-wide single nucleotide polymorphism (SNP) markers. The populations were screened in the field for root-galling symptoms and/or under growth-chamber conditions for nematode reproduction levels using M. incognita and M. javanica biotypes. One major QTL was mapped consistently on linkage group VuLG11 of each population. By genotyping additional cowpea lines and near-isogenic lines derived from conventional backcrossing, we confirmed that the detected QTL co-localized with the genome region associated with the Rk locus for RKN resistance that has been used in conventional breeding for many decades. This chromosomal location defined with flanking markers will be a valuable target in marker-assisted breeding and for positional cloning of genes controlling RKN resistance.

  4. Polyphenolic extracts from cowpea (Vigna unguiculata) protect colonic myofibroblasts (CCD18Co cells) from lipopolysaccharide (LPS)-induced inflammation--modulation of microRNA 126.

    Science.gov (United States)

    Ojwang, Leonnard O; Banerjee, Nivedita; Noratto, Giuliana D; Angel-Morales, Gabriela; Hachibamba, Twambo; Awika, Joseph M; Mertens-Talcott, Susanne U

    2015-01-01

    Cowpea (Vigna unguiculata) is a drought tolerant crop with several agronomic advantages over other legumes. This study evaluated varieties from four major cowpea phenotypes (black, red, light brown and white) containing different phenolic profiles for their anti-inflammatory property on non-malignant colonic myofibroblasts (CCD18Co) cells challenged with an endotoxin (lipopolysaccharide, LPS). Intracellular reactive oxygen species (ROS) assay on the LPS-stimulated cells revealed antioxidative potential of black and red cowpea varieties. Real-time qRT-PCR analysis in LPS-stimulated cells revealed down-regulation of proinflammatory cytokines (IL-8, TNF-α, VCAM-1), transcription factor NF-κB and modulation of microRNA-126 (specific post-transcriptional regulator of VCAM-1) by cowpea polyphenolics. The ability of cowpea polyphenols to modulate miR-126 signaling and its target gene VCAM-1 were studied in LPS-stimulated endothelial cells transfected with a specific inhibitor of miR-126, and treated with 10 mg GAE/L black cowpea extract where the extract in part reversed the effect of the miR-126 inhibitor. This suggests that cowpea may exert their anti-inflammatory activities at least in part through induction of miR-126 that then down-regulate VCAM-1 mRNA and protein expressions. Overall, Cowpea therefore is promising as an anti-inflammatory dietary component.

  5. Tillage and residue management effect on soil properties, crop performance and energy relations in greengram (Vigna radiata L. under maize-based cropping systems

    Directory of Open Access Journals (Sweden)

    J.R. Meena

    2015-12-01

    Full Text Available Effect of tillage and crop residue management on soil properties, crop performance, energy relations and economics in greengram (Vigna radiata L. was evaluated under four maize-based cropping systems in an Inceptisol of Delhi, India. Soil bulk density, hydraulic conductivity and aggregation at 0–15 cm layer were significantly affected both by tillage and cropping systems, while zero tillage significantly increased the soil organic carbon content. Yields of greengram were significantly higher in maize–chickpea and maize–mustard systems, more so with residue addition. When no residue was added, conventional tillage required 20% higher energy inputs than the zero tillage, while the residue addition increased the energy output in both tillage practices. Maize–wheat–greengram cropping system involved the maximum energy requirement and the cost of production. However, the largest net return was obtained from the maize–chickpea–greengram system under the conventional tillage with residue incorporation. Although zero tillage resulted in better aggregation, C content and N availability in soil, and reduced the energy inputs, cultivation of summer greengram appeared to be profitable under conventional tillage system with residue incorporation.

  6. Effect of Trichoderma harzianum biomass and Bradyrhizobium sp. strain NC 92 to control leaf blight disease of bambara groundnut (Vigna subterranea caused by Rhizoctonia solani in the field

    Directory of Open Access Journals (Sweden)

    Mana Kanjanamaneesathian

    2007-01-01

    Full Text Available Four hundred and sixty two strains of Trichoderma spp. were isolated from 23 soil samples in which groundnut (Arachis hypogaea L. and bambara groundnut (Vigna subterranea L. had been planted in Songkhla, Phattalung, Nakhon Si Thammarat, Narathiwat and Yala provinces. These fungi were tested against Rhizoctonia solani, a causal agent of leaf blight of bambara groundnut, using dual culture technique on PDA medium. Among 462 isolates tested, 226 isolates had an ability to overgrow R. solani completely. Further testing found 13 isolates having the ability to parasitize mycelia of R. solani. Among these isolates, ThB-1-54 produced a cellulolytic enzyme on congo-red agar. This isolate was later identified as T. harzianum Rifai. In the field test, applying biomass of the isolate ThB-1-54 cultured on ground mesocarp fiber of oil palm, the combination of the isolate ThB-1-54 on ground mesocarp fiber of oil palm and Bradyrhizobium sp. (strain NC 92, or fungicide (iprodione had no effect on disease severity, yield, or the amount of total nitrogen content in stems or seeds of bambara groundnut plant.

  7. A facile biomimetic preparation of highly stabilized silver nanoparticles derived from seed extract of Vigna radiata and evaluation of their antibacterial activity

    Science.gov (United States)

    Choudhary, Manoj Kumar; Kataria, Jyoti; Cameotra, Swaranjit Singh; Singh, Jagdish

    2016-01-01

    The significant antibacterial activity of silver nanoparticles draws the major attention toward the present nanobiotechnology. Also, the use of plant material for the synthesis of metal nanoparticles is considered as a green technology. In this context, a non-toxic, eco-friendly, and cost-effective method has been developed for the synthesis of silver nanoparticles using seed extract of mung beans ( Vigna radiata). The synthesized nanoparticles have been characterized by UV-visible spectroscopy (UV-Vis), Fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM), atomic absorption spectroscopy (AAS), and X-ray diffraction (XRD). The UV-visible spectrum showed an absorption peak at around 440 nm. The different types of phytochemicals present in the seed extract synergistically reduce the Ag metal ions, as each phytochemical is unique in terms of its structure and antioxidant function. The colloidal silver nanoparticles were observed to be highly stable, even after 5 months. XRD analysis showed that the silver nanoparticles are crystalline in nature with face-centered cubic geometry and the TEM micrographs showed spherical particles with an average size of 18 nm. Further, the antibacterial activity of silver nanoparticles was evaluated by well-diffusion method and it was observed that the biogenic silver nanoparticles have an effective antibacterial activity against Escherichia coli and Staphylococcus aureus. The outcome of this study could be useful for nanotechnology-based biomedical applications.

  8. Exogenous Spermidine Alleviates Low Temperature Injury in Mung Bean (Vigna radiata L. Seedlings by Modulating Ascorbate-Glutathione and Glyoxalase Pathway

    Directory of Open Access Journals (Sweden)

    Kamrun Nahar

    2015-12-01

    Full Text Available The role of exogenous spermidine (Spd in alleviating low temperature (LT stress in mung bean (Vigna radiata L. cv. BARI Mung-3 seedlings has been investigated. Low temperature stress modulated the non-enzymatic and enzymatic components of ascorbate-glutathione (AsA-GSH cycle, increased H2O2 content and lipid peroxidation, which indicate oxidative damage of seedlings. Low temperature reduced the leaf relative water content (RWC and destroyed leaf chlorophyll, which inhibited seedlings growth. Exogenous pretreatment of Spd in LT-affected seedlings significantly increased the contents of non-enzymatic antioxidants of AsA-GSH cycle, which include AsA and GSH. Exogenous Spd decreased dehydroascorbate (DHA, increased AsA/DHA ratio, decreased glutathione disulfide (GSSG and increased GSH/GSSG ratio under LT stress. Activities of AsA-GSH cycle enzymes such as ascorbate peroxidase (APX, monodehydroascorbate reductase (MDHAR, dehydroascorbate reductase (DHAR and glutathione reductase (GR increased after Spd pretreatment in LT affected seedlings. Thus, the oxidative stress was reduced. Protective effects of Spd are also reflected from reduction of methylglyoxal (MG toxicity by improving glyoxalase cycle components, and by maintaining osmoregulation, water status and improved seedlings growth. The present study reveals the vital roles of AsA-GSH and glyoxalase cycle in alleviating LT injury.

  9. Silicon and Nitrate Differentially Modulate the Symbiotic Performances of Healthy and Virus-Infected Bradyrhizobium-nodulated Cowpea (Vigna unguiculata), Yardlong Bean (V. unguiculata subsp. sesquipedalis) and Mung Bean (V. radiata).

    Science.gov (United States)

    Izaguirre-Mayoral, Maria Luisa; Brito, Miriam; Baral, Bikash; Garrido, Mario José

    2017-09-15

    The effects of 2 mM silicon (Si) and 10 mM KNO₃ (N)-prime signals for plant resistance to pathogens-were analyzed in healthy and Cowpea chlorotic mottle virus (CCMV) or Cowpea mild mottle virus (CMMV)-infected Bradyrhizobium -nodulated cowpea, yardlong bean and mung bean plants. In healthy plants of the three Vigna taxa, nodulation and growth were promoted in the order of Si + N > N > Si > controls. In the case of healthy cowpea and yardlong bean, the addition of Si and N decreased ureide and α-amino acids (AA) contents in the nodules and leaves in the order of Si + N> N > Si > controls. On the other hand, the addition of N arrested the deleterious effects of CCMV or CMMV infections on growth and nodulation in the three Vigna taxa. However, the addition of Si or Si + N hindered growth and nodulation in the CCMV- or CMMV-infected cowpea and yardlong bean, causing a massive accumulation of ureides in the leaves and nodules. Nevertheless, the AA content in leaves and nodules of CCMV- or CMMV-infected cowpea and yardlong bean was promoted by Si but reduced to minimum by Si + N. These results contrasted to the counteracting effects of Si or Si + N in the CCMV- and CMMV-infected mung bean via enhanced growth, nodulation and levels of ureide and AA in the leaves and nodules. Together, these observations suggest the fertilization with Si + N exclusively in virus-free cowpea and yardlong bean crops. However, Si + N fertilization must be encouraged in virus-endangered mung bean crops to enhance growth, nodulation and N-metabolism. It is noteworthy to see the enhanced nodulation of the three Vigna taxa in the presence of 10 mM KNO₃.

  10. Influence de différents traitements de prégermination des graines de Vigna unguiculata (L. Walp. sur les performances germinatives et la tolérance au stress hydrique

    Directory of Open Access Journals (Sweden)

    Boucelha, L.

    2015-01-01

    Full Text Available Influence of different pre-germination treatments of Vigna unguiculata (L. Walp. seeds on germination performance and water stress tolerance. Description of the subject. Priming or hardening is a pregermination treatment. This treatment consists of incorporating an osmotic seed treatment (osmopriming or a hormonal (hormopriming and/or a redehydration (hydropriming treatment. The approach allows the elimination of dormancy, homogenization (synchronization of germination, better growth, earlier flowering and a tolerance to abiotic stresses such as drought and salinity. In this kind of treatment, the seed is soaked and then dehydrated before radicle breakthrough, i.e. during the reversible phase of germination. Thus, the seed can return to its initial stage without any damage. Objectives. In this paper, we aimed to study the consequences of hydropriming and osmopriming (by PEG6000 at 10 and 30% on cowpea seeds (Vigna unguiculata, on germination performance and on the water stress tolerance of plants from these seeds. Method. Vigna unguiculata seeds were hydroprimed, hydroprimed twice or osmoprimed (with PEG6000 10 and 30%. For each treatment, germination performance (germination capacity, speed and the water stress tolerance of the plants were studied. Results. Results showed that increased hardness of the seed allowed a faster, more uniform germination and better growth of both the radicle and aerial parts. We also demonstrated that a double redehydration was more effective in improving these parameters. Conclusions. Application of these pretreatments, adapted according to the plant species, will has the capacity to improve seed germination and crop yield, as well as tolerance to water deficit.

  11. Laboratory Rearing of the Legume Pod Borer, Maruca vitrata Fabricius

    African Journals Online (AJOL)

    user1

    Maruca vitrata is a major pest of mung bean (Vigna mungo) (Zahid et al.,. 2008) which is locally ... eggs were placed in a plastic container for hatching to provide the first laboratory ... (10.1 + 0.2). A sex ratio (M: F) of 1:1 was observed in both diets. .... because the success in rearing of M. vitrata in laboratory relies heavily on.

  12. Genotypic difference in "1"3"7Cs accumulation and transfer from the contaminated field in Fukushima to azuki bean (Vigna angularis)

    International Nuclear Information System (INIS)

    Win, Khin Thuzar; Oo, Aung Zaw; Kojima, Katsuhiro; Salem, Djedidi; Yamaya, Hiroko; Bellingrath-Kimura, Sonoko Dorothea; Tomooka, Norihiko; Kaga, Akito; Ohkama-Ohtsu, Naoko; Yokoyama, Tadashi

    2016-01-01

    The screening of mini-core collection of azuki bean accessions (Vigna angularis (Willd.) Ohwi & Ohashi) for comparative uptake of "1"3"7Cs in their edible portions was done in field trials on land contaminated by the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. Ninety seven azuki bean accessions including their wild relatives from a Japanese gene bank, were grown in a field in the Fukushima prefecture, which is located approximately 51 km north of FDNPP. The contamination level of the soil was 3665 ± 480 Bq kg"−"1 dry weight ("1"3"7Cs, average ± SD). The soil type comprised clay loam, where the sand: silt: clay proportion was 42:21:37. There was a significant varietal difference in the biomass production, radiocaesium accumulation and transfer factor (TF) of radiocaesium from the soil to edible portion. Under identical agricultural practice, the extent of "1"3"7Cs accumulation by seeds differed between the accessions by as much as 10-fold. Inter-varietal variation was expressed at the ratio of the maximum to minimum observed "1"3"7Cs transfer factor for seeds ranged from 0.092 to 0.009. The total biomass, time to flowering and maturity, and seed yield had negative relationship to "1"3"7Cs activity concentration in seeds. The results suggest that certain variety/varieties of azuki bean which accumulated less "1"3"7Cs in edible portion with preferable agronomic traits are suitable to reduce the "1"3"7Cs accumulation in food chain on contaminated land. - Highlights: • Varietal difference in the biomass, "1"3"7Cs accumulation and transfer factor was found in azuki. • "1"3"7Cs accumulation by seeds differed between the azuki bean accessions by as much as 10 folds. • Different accumulation patterns among the azuki bean accessions depends on their growth performance.

  13. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp consumed in Brazil

    Directory of Open Access Journals (Sweden)

    Elenilda J. Pereira

    2016-03-01

    Full Text Available Background: The cowpea (Vigna unguiculata L. Wap. is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. Objectives: The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Methods: Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. Results: When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Conclusions: Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  14. Increase in the yield of mung bean (Vigna radiata [L.] R. Wilczek) with storage of radiation-modified kappa-carrageenan

    International Nuclear Information System (INIS)

    Aurigue, F.B.; Montefalcon, D.R.V.; Dela Cruz, R.M.M.; Abad, L.V.

    2015-01-01

    Kappa-carrageenan is a sulphated polysaccharide naturally present in seaweeds. Upon gamma radiation, radiolysis produces low molecular weight κ-carrageenan with the cleavage of some of its sulphate groups. Consequently, the acidic solution may further hydrolyze κ-carrageenan. The study aims to determine the effects of application by foliar spraying of freshly prepared irradiated κ-carrageenan solution and those which has been stored for 3 months on the yield of potted mungbean (Vigna radiata) plants. Foliar application of radiation-modified κ-carrageenan solution on the Kulabo variety two weeks after sowing, at flower initiation, and at fruit formation stage resulted in 30.8% increase in pod yield and 50.2% increase in seed yield compared to plants similarly treated with NitroPlus inoculants only. Pod yield and seed yield advantage over the control plants (no inoculants and no fertilizer) were 57.2% and 83% respectively no fertilizer was used in all treatments. These result confirm the previous finding that irradiated κ-carrageenan solution sprayed every two weeks inoculants only. There was 200% yield advantage over the negative control. The increase in yield is attributed to the longer length of pod, higher number of seed per pod, heavier 100-seed weight. Interestingly, the 3 months-old solution gave better result compared to a freshly irradiated one. There was 26.5% and 26.8% difference in pod yield and seed yield, respectively. Compared with the Control plants of the Kulabo variety, those sprayed with stored κ-carrageenan solution had 105% advantage in seed yield. It was proposed that the degradation process of the oligo-κ-carrageenan continue during storage because of the acidic nature of the solution. Undoubtedly, irradiated κ-carrageenan solution has plant growth promoting activity that increase yield mung bean by spraying on the leaves at least three times before fruit development.(author)

  15. Gel-free/label-free proteomic, photosynthetic, and biochemical analysis of cowpea (Vigna unguiculata [L.] Walp.) resistance against Cowpea severe mosaic virus (CPSMV).

    Science.gov (United States)

    Varela, Anna Lidia N; Komatsu, Setsuko; Wang, Xin; Silva, Rodolpho G G; Souza, Pedro Filho N; Lobo, Ana Karla M; Vasconcelos, Ilka M; Silveira, Joaquim A G; Oliveira, Jose T A

    2017-06-23

    Cowpea severe mosaic virus (CPSMV) causes significant losses in cowpea (Vigna unguiculata) production. In this present study biochemical, physiological, and proteomic analysis were done to identify pathways and defense proteins that are altered during the incompatible interaction between the cowpea genotype BRS-Marataoã and CPSMV. The leaf protein extracts from mock- (MI) and CPSMV-inoculated plantlets (V) were evaluated at 2 and 6days post-inoculation (DPI). Data support the assumptions that increases in biochemical (high hydrogen peroxide, antioxidant enzymes, and secondary compounds) and physiological responses (high photosynthesis index and chlorophyll content), confirmed by label-free comparative proteomic approach, in which quantitative changes in proteasome proteins, proteins related to photosynthesis, redox homeostasis, regulation factors/RNA processing proteins were observed may be implicated in the resistance of BRS-Marataoã to CPSMV. This pioneering study provides information for the selection of specific pathways and proteins, altered in this incompatible relationship, which could be chosen as targets for detailed studies to advance our understanding of the molecular, physiological, and biochemistry basis of the resistance mechanism of cowpea and design approachs to engineer plants that are more productive. This is a pioneering study in which an incompatible relationship between a resistant cowpea and Cowpea severe mosaic virus (CPSMV) was conducted to comparatively evaluate proteomic profiles by Gel-free/label-free methodology and some physiological and biochemical parameters to shed light on how a resistant cowpea cultivar deals with the virus attack. Specific proteins and associated pathways were altered in the cowpea plants challenged with CPSMV and will contribute to our knowledge on the biological process tailored by cowpea in response to CPSMV. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Effect of Long Period Cooling Storage on the Nucleic Acid of Harvested Cowpea Seeds ( Vigna Sinensis L.) Treated by Gamma Irradiation and Micro Elements

    International Nuclear Information System (INIS)

    Saleh, O.I.; Salama, I.M.

    2015-01-01

    Cowpea seeds ( Vigna sinensis L.) were exposed to 40 and 80 Gy gamma radiation, in order to study the effect of long period under cooling storage by using RAPD and ISSR PCR facilities. The obtained results indicated that RAPD protocol gave 65% monomorphic and 56% polymorphic fragments between the samples as compared to storage and non-storage controls. While , ISSR protocol gave 83% monomorphic and 85% polymorphic fragments. It should be mentioned that other percentage s 86% and 91% were found among samples in case of using another primers. The results could be summarized as follow: 1-Primer OP - B01 gave 7 monomorphic and 13 polymorphic fragments (65%). 2 - The Primer OP - B02 and Primer OP - B05 gave 4 monomorphic fragments with 14 polymorphic fragments (79%). 3 - The Primer HA-98 gave 4 monomorphic fragments with 19 detected polymorphic 83%. 4 - The Primer HA - 99 and HB-12 gave 3 monomorphic fragments and 17 polymorphic 85 and 86%, respectively. 5 - The Primer HB - 13 gave 2 monomorphic fragments with 21 detected polymorphic fragments 91%. 6 - The primer HA-98 gave 83% while the primer HA - 99 gave 85%. The previous results showed some polymorphism differences among the samples, while the primer HB-12 gave 86% and the primer HB-13 91% exhibited high levels of polymorphism. The DNA of stored cowpea seeds which were exposed to 80 Gy in the presence of zinc showed the highest differentiation , while radiation dose 40 Gy treated with zinc or boron, 80 Gy with boron and 40 or 80 Gy treatment alone compared to the two controls (storage and non storage)

  17. Transcriptional profiling of root-knot nematode induced feeding sites in cowpea (Vigna unguiculata L. Walp. using a soybean genome array

    Directory of Open Access Journals (Sweden)

    Das Sayan

    2010-08-01

    Full Text Available Abstract Background The locus Rk confers resistance against several species of root-knot nematodes (Meloidogyne spp., RKN in cowpea (Vigna unguiculata. Based on histological and reactive oxygen species (ROS profiles, Rk confers a delayed but strong resistance mechanism without a hypersensitive reaction-mediated cell death process, which allows nematode development but blocks reproduction. Results Responses to M. incognita infection in roots of resistant genotype CB46 and a susceptible near-isogenic line (null-Rk were investigated using a soybean Affymetrix GeneChip expression array at 3 and 9 days post-inoculation (dpi. At 9 dpi 552 genes were differentially expressed in incompatible interactions (infected resistant tissue compared with non-infected resistant tissue and 1,060 genes were differentially expressed in compatible interactions (infected susceptible tissue compared with non-infected susceptible tissue. At 3 dpi the differentially expressed genes were 746 for the incompatible and 623 for the compatible interactions. When expression between infected resistant and susceptible genotypes was compared, 638 and 197 genes were differentially expressed at 9 and 3 dpi, respectively. Conclusions In comparing the differentially expressed genes in response to nematode infection, a greater number and proportion of genes were down-regulated in the resistant than in the susceptible genotype, whereas more genes were up-regulated in the susceptible than in the resistant genotype. Gene ontology based functional categorization revealed that the typical defense response was partially suppressed in resistant roots, even at 9 dpi, allowing nematode juvenile development. Differences in ROS concentrations, induction of toxins and other defense related genes seem to play a role in this unique resistance mechanism.

  18. Genome wide linkage disequilibrium in Chinese asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm: implications for domestication history and genome wide association studies.

    Science.gov (United States)

    Xu, P; Wu, X; Wang, B; Luo, J; Liu, Y; Ehlers, J D; Close, T J; Roberts, P A; Lu, Z; Wang, S; Li, G

    2012-07-01

    Association mapping of important traits of crop plants relies on first understanding the extent and patterns of linkage disequilibrium (LD) in the particular germplasm being investigated. We characterize here the genetic diversity, population structure and genome wide LD patterns in a set of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm from China. A diverse collection of 99 asparagus bean and normal cowpea accessions were genotyped with 1127 expressed sequence tag-derived single nucleotide polymorphism markers (SNPs). The proportion of polymorphic SNPs across the collection was relatively low (39%), with an average number of SNPs per locus of 1.33. Bayesian population structure analysis indicated two subdivisions within the collection sampled that generally represented the 'standard vegetable' type (subgroup SV) and the 'non-standard vegetable' type (subgroup NSV), respectively. Level of LD (r(2)) was higher and extent of LD persisted longer in subgroup SV than in subgroup NSV, whereas LD decayed rapidly (0-2 cM) in both subgroups. LD decay distance varied among chromosomes, with the longest (≈ 5 cM) five times longer than the shortest (≈ 1 cM). Partitioning of LD variance into within- and between-subgroup components coupled with comparative LD decay analysis suggested that linkage group 5, 7 and 10 may have undergone the most intensive epistatic selection toward traits favorable for vegetable use. This work provides a first population genetic insight into domestication history of asparagus bean and demonstrates the feasibility of mapping complex traits by genome wide association study in asparagus bean using a currently available cowpea SNPs marker platform.

  19. Sensitivity studies of the common bean (Vigna unguiculata) and maize (Zea mays) to different soil types from the crude oil drilling site at Kutchalli, Nigeria

    Energy Technology Data Exchange (ETDEWEB)

    Anoliefo, G.O. [Dept. of Botany, Univ. of Benin, Benin City (Nigeria); Isikhuemhen, O.S. [Dept. of Natural Resources and Environmental Design, NC Agricultural and Technical State Univ., Greensboro, NC (United States); Ohimain, E.I. [Rohi Biotechnologies Ltd., Port Harcourt (Nigeria)

    2006-02-15

    Background, aims and scope. The economic growth that Nigeria has enjoyed as a result of oil revenue has its drawback through exposure of people in the oil producing areas to environmental contamination, due largely to the increase in the movement of oil. Activities associated with oil well drilling on agricultural lands have led to serious economic losses on the communities affected. The local people in most of these communities are peasants who do not know how to react to drilling wastes or polluted fields where they have their crops. A case under study is the Kutchalli oil drilling area. Methods. Waste pit soil from drilling waste dumps in Kutchalli oil drilling area was tested whole and in combinations with 'clean' soil for their abilities to support plant growth and development in common bean (Vigna unguiculata) and maize (Zea mays). Seed germination, plant height, leaf area, biomass accumulation, respiratory activity as well as soil chemical analysis were used to access the ability of waste pit soil to support plant growth and development in the test plants. Results, discussion and conclusions. Waste pit soil completely inhibited the germination of bean and maize seeds. Waste pit soil in combinations with different proportions of Kutchalli soil gave growth (germination, height of plants, number of leaves, leaf area, etc.) values that were inferior to the control soil (Kutchalli) and the independent control soil (Monguno). Seeds planted in the test soil combinations containing waste pit soil showed significantly low respiratory activity. Waste pit soil seems to be toxic to plant growth and development. Drilling mud in combination with native Kutchalli soil significantly enhanced plant growth and development. Recommendations and outlook. The seed germination, growth and development inhibition by waste pit soil suggests its toxicity. We want to suggest the need for strict control and monitoring of waste pit soil in oil drilling sites. (orig.)

  20. Caracterização química, atividade antioxidante e formulação de doces com feijão azuki (Vigna angularis

    Directory of Open Access Journals (Sweden)

    Daniela Castilho Orsi

    2017-08-01

    Full Text Available Resumo No Japão, o feijão azuki é comumente usado na elaboração de doce, observando-se que a sua casca vermelha é rica em antioxidantes. No Brasil, o feijão azuki ainda é pouco consumido e o doce de feijão é pouco conhecido pelos brasileiros. O objetivo deste estudo foi caracterizar quimicamente o feijão azuki vermelho (Vigna angularis, bem como avaliar a influência do cozimento sobre o seu teor de compostos fenólicos e a sua atividade antioxidante. Buscou-se também avaliar a composição química dos doces formulados com feijão azuki. Os resultados obtidos para a composição química mostraram que o feijão azuki apresentou elevados teores de carboidratos (65,60 g/100 g e proteínas (17,87 g/100 g. O feijão azuki cozido, comparado ao feijão azuki cru, perdeu grande parte dos compostos fenólicos, mas ainda manteve quase metade da atividade antioxidante. Os doces de feijão azuki em massa e em pasta apresentaram, respectivamente, alto teor de carboidratos de 67,09 e 46,20 g/100 g, teores de proteínas de 4,02 e 6,48 g/100 g, e baixo teor de lipídios de 0,33 e 2,73 g/100 g. O feijão azuki vermelho mostrou ter um bom potencial tecnológico para sua utilização no processamento dos doces de feijão.

  1. CARACTERÍSTICAS DA SOLUBILIDADE PROTÉICA E ISOLAMENTO DA GLOBULINA PRINCIPAL DE CAUPÍ (Vigna unguiculata (L. Walp. CULTIVAR BR 14-MULATO

    Directory of Open Access Journals (Sweden)

    Valdir Augusto NEVES

    2009-07-01

    Full Text Available

    O objetivo do trabalho foi determinar a composição química, características de solubilidade das proteínas e o isolamento da globulina principal de caupí cultivar BR-14 Mulato. A farinha descorticada apresentou 29,32% de proteína, 3,59% de cinzas, 1,4% de extrato etéreo. A solubilidade das proteínas da farinha mostrou-se dependente das condições de extração, tais como: tipo e concentração de sal, tempo e pH. A extração fracionada e seqüencial das proteínas mostrou que 77,94% da proteína total foi solubilizada, a fração globulina com 41,99% do total, seguido da albumina 10,11% e glutelina 7,81%. A globulina principal isolada e submetida à cromatografia de filtração em gel mostrou um peso molecular de 174 kDa. Apresentou um elevado grau de homogeneidade na eletroforese em gel de poliacrilamida contendo dodecilsulfato de sódio, revelando ser constituída de cerca de 5 subunidades, com predomínio de duas majoritárias na faixa de 40 a 50 kDa e um teor de glícides de 1,10%. PALAVRAS-CHAVE: Caupí BR-14 MULATO; Vigna unguiculata; composição química; solubilidade; fracionamento.

  2. Transcriptional Slippage and RNA Editing Increase the Diversity of Transcripts in Chloroplasts: Insight from Deep Sequencing of Vigna radiata Genome and Transcriptome.

    Directory of Open Access Journals (Sweden)

    Ching-Ping Lin

    Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.

  3. Resistência de genótipos de feijão-caupi [Vigna unguiculata (L. Walp.] ao Ataque do Caruncho Callosobruchus maculatus (Fabr. (Coleoptera: Chrysomelidae

    Directory of Open Access Journals (Sweden)

    Westerllanya Medeiros

    2017-04-01

    Abstract. The Cowpea weevil Callosobruchus maculatus (Fabr. is considered the main Prague during storage of grains of Cowpea [Vigna unguiculata (L. Walp.]. Due to the economic losses caused by this insect, is of paramount importance to develop studies to select varieties resistant to this pest. In this study assessed the effect of genotypes of V. unguiculata about the behavior and the development of C. maculatus in two consecutive generations. The study was conducted in laboratory with conditions of temperature and relative humidity monitored, in completely randomized design using BRS Epace 10, Capela, BRS Urubuquara, BRS Pajeu, Itaim, BRS Rouxinol, Pingo de ouro, BRS Corujinha, IT85 F-2687 and BR 17 Gurguéia genotypes with eight repetitions. In each genotype were confined 10 adults of c. maculatus for it was held the oviposition. After a period of five days, the adults were removed from the pots containing the genotypes. Waited-if the emergence of adults (first generation and new infestation was held in the same access to obtain the second generation. The parameters evaluated were number of eggs, egg viability, total number of adults emergency, viability of immature phase, average period of development and dry weight of adults. IT85 F2687 genotype presented resistance of non-preference for oviposition and the genotypes BR 17 Gurguéia and BRS Urubuquara presented antibiose type resistance in relation to C. maculatus. BR 17 Gurguéia genotype was the strongest among the genotypes studied in relation to c. maculatus. The genotypes Capela and Itaim were characterized as susceptible to C. maculatus.

  4. Kajian Jumlah Biji per Lubang Tanam dan Paket Pupuk terhadap Pertumbuhan dan Hasil Kacang Hijau (Vigna radiata L. Varietas Vima-1

    Directory of Open Access Journals (Sweden)

    I PUTU PANCA DIANTARA PUTRA

    2016-05-01

    Full Text Available Study of the Number of the Amount of Beed a Hole Planting and Packages Fertilizer onGrowth and Yield of Mung Bean (Vigna radiata L. Varieties Vima-1. Mung bean (Vignaradiata L. is one of bean plant – nuts for many consumption in Indonesia. The low productwas’nt cultivation techniques that supposed to, including the amount of seed each holeplanting and fertilizer giving them. The study aims to determine the amount seed hole theplanting and fertilizer best to the growth and yield of mung bean varieties vima-1. Researchcarried out in Subak Basangbe, Perean Kangin village, Baturiti – Tabanan, in October –December, 2014. The study was designed using a factorial randomized block design. The firstfactor the amount of seed a hole planting (1, 2, 3 seed, factor two of fertilizer (organicfertilizer compost, fertilizer chemical urea + TSP + KCl, organic fertilizer liquid biourin,organic fertilizer compost and fertilizer chemical urea + TSP + KCl, organic fertilizercompost and organic fertilizer liquid biourin, fertilizer chemical urea + TSP + KCl andorganic fertilizer liquid biourin. The growth of mung bean varieties Vima-1 is mainly ofplant height and number of leaves affected very real by the number of seeds planting hole andfertilizer package. Treatment of the amount of seed planting hole and fertilizer packages tovery significant effect on yield components, especially the number of pods and number ofseeds of plants on mung bean varieties Vima-1. Treatment of the amount of seed planting holeaffects most of the components of plant growth and yield components of mung bean. Thehighest yield on three planting seeds per hole that is 3,67 t / ha dry weight oven.

  5. Preferência do pulgão-preto, Aphis craccivora Koch, a diferentes genótipos de feijão-de-corda, Vigna unguiculata (L. Walp Black aphid, Aphis craccivora Koch, preference to different cowpea, Vigna unguiculata (L. Walp. cultivars

    Directory of Open Access Journals (Sweden)

    João Gutemberg Leite Moraes

    2007-12-01

    Full Text Available Este trabalho foi desenvolvido visando a avaliar a resposta de cultivares de feijão-de-corda, Vigna unguiculata (L. Walp., à presença do pulgão-preto (Aphis craccivora Koch. Os experimentos foram conduzidos de agosto a outubro de 2004, em casa-de-vegetação da Universidade Federal do Ceará (UFC. As cultivares foram: "Epace-10", "Epace-11", "Patativa", "Pingo de Ouro", "Pitiúba", "BR-10 Piauí", "BR-12 Canindé", "BR-14 Mulato" e "BR-17 Gurguéia". O experimento constou de três ensaios, cada um com cinco tratamentos e seis repetições, sendo o delineamento estatístico inteiramente casualizado. Os genótipos foram cultivados em copos plásticos de 300ml e mantidos em gaiolas protegidas por tela antiafídeos. As plantas foram infestadas após doze dias do plantio através da liberação de cinco fêmeas adultas do pulgão-preto por planta. As avaliações foram realizadas após o terceiro e o quinto dia da infestação, constando da contagem direta das formas adulta e jovem do inseto presentes nas plantas. Os dados obtidos foram analisados através de análise de variância e pelo teste de Tukey em 5% de probabilidade de erro. As cultivares "Epace-10" e "Patativa" foram as menos preferidas por A. craccivora.This research was conducted with the intention of evaluating the response of different cowpea, Vigna unguiculata (L. Walp, cultivars to the black aphid (Aphis craccivora Koch. The bioassays were conducted from August through October of 2004 in a greenhouse at the Ceará Federal University (UFC campus. The cowpea cultivars used were: Epace-10, Epace-11, Patativa, Pingo de Ouro, Pitiúba, BR-10 Piauí, BR-12 Canindé, BR-14 Mulato and BR-17 Gurguéia. Each assay had five treatments and six replications in a completely randomized block design. The genotypes were raised in a 300ml plastic cup and maintained in cages protected by an insect proof net. Plants were infested twelve days after planting with five adult females per plant

  6. Effet du mode de conservation de l'huile de Jatropha curcas L. sur son efficacité dans la lutte contre les principaux insectes ravageurs du niébé (Vigna unguiculata (L. Walp. au Niger

    Directory of Open Access Journals (Sweden)

    Abdoul Habou, Z.

    2014-01-01

    Full Text Available Influence of the Conservation Mode of Jatropha curcas L. oil on its Efficacy in the Control of Major Insect Pests of Cowpea (Vigna unguiculata (L. Walp in Niger. Jatropha curcas oil has an insecticidal activity harnessed by the farmers in Niger. In this study, we compared the insecticidal activity of two batches of oil conserved during 70 days, one exposed to light and the other kept in the dark. The insecticidal efficacy was evaluated in a field with three concentrations (5, 10 and 15% trial on the main pests of Cowpea (Vigna unguiculata (L. Walp and in a laboratory test on Megalurothrips sjostedti Trybon (Thysanoptera: Thripidae with different concentrations of crude oil (50; 100; 150 and 200 µl. No difference in insecticidal effect was found between the two modes of oil conservation, both in the laboratory and in the field. In the field, regardless of the mode of conservation, the concentrations of 10% of J. curcas oil enables a reduction of over than 80% of thrips, aphids, and bugs compared to the control. Its increased seeds yield more than 50%. The concentration of 15% gives an insecticidal effect comparable to that of the reference treatment (deltaméthrine but induces phytotoxicity symptoms on the leaves of Cowpea.

  7. Interdependence of plant water status with photosynthetic performance and root defense responses in Vigna radiata (L.) Wilczek under progressive drought stress and recovery.

    Science.gov (United States)

    Sengupta, Debashree; Guha, Anirban; Reddy, Attipalli Ramachandra

    2013-10-05

    The present study investigates the interdependence of plant water status with foliar and root responses in Vigna radiata L.Wilczek under progressive drought. Vegetatively-mature V. radiata plants were subjected to water withdrawal for 3 and 6days (D3 and D6, respectively) and then re-watered subsequently for 6days (6R) for stress-recovery. Changes in plant water status were expressed in terms of leaf and root moisture contents (LMC and RMC, respectively) and leaf relative water content (LRWC). Progressive drought caused apparent decrease in LRWC, LMC and RMC depicting significant level of dehydration of leaf and root tissues. Stomatal limitation alone could not account for the observed decrease in net CO2 assimilation rates (Pn) due to comparatively less decrease in sub-stomatal CO2 (Ci) concentrations with respect to other gas exchange parameters indicating possible involvement of non-stomatal limitations. Analysis of polyphasic chl a fluorescence kinetics during progressive drought showed decreased energy connectivity among PSII units as defined by a positive L-band with highest amplitude during D6. Efficiency of electron flux from OEC towards PSII acceptor side was not significantly affected during drought conditions as evidenced by the absence of a positive K-band. Increasing root-level water-limitation enforced a gradual oxidative stress through H2O2 accumulation and membrane lipid peroxidation in V. radiata roots exhibiting drastic enhancement of proline content and a significant but gradual increase in ascorbic acid content as well as guaiacol peroxidase activity under progressive drought. Expression analysis of Δ(1) pyrroline-5-carboxylate synthetase (P5CS) through real time PCR and enzyme activity studies showed a strong positive correlation between VrP5CS gene expression, enzyme activity and proline accumulation in the roots of V. radiata under progressive drought and recovery. Drought-induced changes in root moisture content (RMC) showed positive linear

  8. Global changes in gene expression during compatible and incompatible interactions of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides.

    Science.gov (United States)

    Huang, Kan; Mellor, Karolina E; Paul, Shom N; Lawson, Mark J; Mackey, Aaron J; Timko, Michael P

    2012-08-17

    Cowpea, Vigna unguiculata L. Walp., is one of the most important food and forage legumes in the semi-arid tropics. While most domesticated forms of cowpea are susceptible to the root parasitic weed Striga gesnerioides, several cultivars have been identified that show race-specific resistance. Cowpea cultivar B301 contains the RSG3-301 gene for resistance to S. gesnerioides race SG3, but is susceptible to race SG4z. When challenged by SG3, roots of cultivar B301 develop a strong resistance response characterized by a hypersensitive reaction and cell death at the site of parasite attachment. In contrast, no visible response occurs in B301 roots parasitized by SG4z. Gene expression in the roots of the cowpea cultivar B301 during compatible (susceptible) and incompatible (resistant) interactions with S. gesnerioides races SG4z and SG3, respectively, were investigated at the early (6 days post-inoculation (dpi)) and late (13 dpi) stages of the resistance response using a Nimblegen custom design cowpea microarray. A total of 111 genes were differentially expressed in B301 roots at 6 dpi; this number increased to 2102 genes at 13 dpi. At 13 dpi, a total of 1944 genes were differentially expressed during compatible (susceptible) interactions of B301 with SG4z. Genes and pathways involved in signal transduction, programmed cell death and apoptosis, and defense response to biotic and abiotic stress were differentially expressed in the early resistance response; at the later time point, enrichment was primarily for defense-related gene expression, and genes encoding components of lignifications and secondary wall formation. In compatible interactions (B301-SG4z), multiple defense pathways were repressed, including those involved in lignin biosynthesis and secondary cell wall modifications, while cellular transport processes for nitrogen and sulfur were increased. Distinct changes in global gene expression profiles occur in host roots following successful and unsuccessful

  9. Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species.

    Science.gov (United States)

    Pottorff, Marti; Ehlers, Jeffrey D; Fatokun, Christian; Roberts, Philip A; Close, Timothy J

    2012-06-12

    Cowpea [Vigna unguiculata (L.) Walp] exhibits a considerable variation in leaf shape. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Leaf morphology was studied in the cowpea RIL population, Sanzi (sub-globose leaf shape) x Vita 7 (hastate leaf shape). A QTL for leaf shape, Hls (hastate leaf shape), was identified on the Sanzi x Vita 7 genetic map spanning from 56.54 cM to 67.54 cM distance on linkage group 15. SNP marker 1_0910 was the most significant over the two experiments, accounting for 74.7% phenotypic variance (LOD 33.82) in a greenhouse experiment and 71.5% phenotypic variance (LOD 30.89) in a field experiment. The corresponding Hls locus was positioned on the cowpea consensus genetic map on linkage group 4, spanning from 25.57 to 35.96 cM. A marker-trait association of the Hls region identified SNP marker 1_0349 alleles co-segregating with either the hastate or sub-globose leaf phenotype. High co-linearity was observed for the syntenic Hls region in Medicago truncatula and Glycine max. One syntenic locus for Hls was identified on Medicago chromosome 7 while syntenic regions for Hls were identified on two soybean chromosomes, 3 and 19. In all three syntenic loci, an ortholog for the EZA1/SWINGER (AT4G02020.1) gene was observed and is the candidate gene for the Hls locus. The Hls locus was identified on the cowpea physical map via SNP markers 1_0910, 1_1013 and 1_0992 which were identified in three BAC contigs; contig926, contig821 and contig25. This study has demonstrated how integrated genomic resources can be utilized for a candidate gene approach. Identification of genes which control leaf morphology may be utilized to improve the quality of cowpea leaves for vegetable and or forage markets as well as contribute to more fundamental research understanding the control of leaf shape in legumes.

  10. Contribución de Vigna unguiculata L. a la sustentabilidad de sistemas de cultivo de caña de azúcar

    Directory of Open Access Journals (Sweden)

    Oscar Eduardo Sanclemente Reyes

    2015-12-01

    Full Text Available  Con el objetivo de evaluar la contribución del abono verde (AV Vigna unguiculata L., a la producción sostenible de caña de azúcar (CA Saccharum officinarum L. Var. CC 85-92 en un Vertisol del Valle del Cauca (Colombia, se usó diseño experimental en bloques completos al azar y cinco repeticiones. Los tratamientos fueron: (C Control- soca de CA, (AV1 siembra 1X1 AV- CA, (AV2 siembra 2X1 AV- CA, (AV1+R siembra 1X1 AV inoculada con Rhizobium sp.- CA, y (AV2+R siembra 2X1 AV inoculada con Rhizobium sp.- CA. Se evaluó el aporte de biomasa del AV, la biomasa de arvenses asociadas y la humedad del suelo, durante el mes dos. En maduración de CA (mes once se evaluó la concentración de sólidos y sacarosa en tallos. En cosecha de CA (mes trece se evaluaron las toneladas de caña por hectárea (TCH, el rendimiento y las toneladas de azúcar por hectárea (TAH, como efecto de los tratamientos. Se observó que el inóculo Rhizobium sp., no tuvo efectos aparentes, por baja especificidad simbiótica con el AV. El AV2, registró aporte significativo (p<0.05 de materia seca (14.5 t ha-1 incidiendo en reducción de arvenses y retención de humedad (161 m3 ha-1, frente al C. El AV1 registró productividad en TCH (131.5 t ha-1 y TAH (15.5 t ha-1, significativamente (p<0.05 altas con respecto a los demás tratamientos. Estos resultados muestran las bondades del uso de sistemas intercalados AV- caña de azúcar, sobre la economía y sustentabilidad del sector.

  11. Genic SNP markers and legume synteny reveal candidate genes underlying QTL for Macrophomina phaseolina resistance and maturity in cowpea [Vigna unguiculata (L Walp.

    Directory of Open Access Journals (Sweden)

    Ehlers Jeffrey D

    2011-01-01

    Full Text Available Abstract Background Macrophomina phaseolina is an emerging and devastating fungal pathogen that causes significant losses in crop production under high temperatures and drought stress. An increasing number of disease incidence reports highlight the wide prevalence of the pathogen around the world and its contribution toward crop yield suppression. In cowpea [Vigna unguiculata (L Walp.], limited sources of low-level host resistance have been identified, the genetic basis of which is unknown. In this study we report on the identification of strong sources of host resistance to M. phaseolina and the genetic mapping of putative resistance loci on a cowpea genetic map comprised of gene-derived single nucleotide polymorphisms (SNPs and amplified fragment length polymorphisms (AFLPs. Results Nine quantitative trait loci (QTLs, accounting for between 6.1 and 40.0% of the phenotypic variance (R2, were identified using plant mortality data taken over three years in field experiments and disease severity scores taken from two greenhouse experiments. Based on annotated genic SNPs as well as synteny with soybean (Glycine max and Medicago truncatula, candidate resistance genes were found within mapped QTL intervals. QTL Mac-2 explained the largest percent R2 and was identified in three field and one greenhouse experiments where the QTL peak co-located with a SNP marker derived from a pectin esterase inhibitor encoding gene. Maturity effects on the expression of resistance were indicated by the co-location of Mac-6 and Mac-7 QTLs with maturity-related senescence QTLs Mat-2 and Mat-1, respectively. Homologs of the ELF4 and FLK flowering genes were found in corresponding syntenic soybean regions. Only three Macrophomina resistance QTLs co-located with delayed drought-induced premature senescence QTLs previously mapped in the same population, suggesting that largely different genetic mechanisms mediate cowpea response to drought stress and Macrophomina infection

  12. Evaluation of sowing patterns and weed control on mung bean (Vigna radiate L. Wilczek - black cumin (Nigella sativa L. intercropping system

    Directory of Open Access Journals (Sweden)

    parviz Rezvani Moghadam

    2016-04-01

    Full Text Available In order to study different arrangements and weed controls effects on mung bean (Vigna radiate L. Wilczek – black cumin (Nigella sativa L. intercropping an experiment was conducted at the Research Station of Faculty of Agriculture, Ferdowsi University of Mashhad, Iran, during growing season 2005 – 2006. Sixteen treatments comprising combinations of eight sowing patterns [A1: Sole black cumin, A2: Sole mung bean, A3: 3 rows black cumin– 2 rows mung bean, A4: 3 rows black cumin – 2 rows mung bean, A5: 2 rows black cumin – 1 rows mung bean, A6: 1 row black cumin – 2 rows mung bean, A7: 3 rows black cumin – 3 rows mung bean (Striped, A8: 1 row black cumin – 1 row mung bean (alternative rows] and two weed controls [V1: unweeded, V2: completely hand weeding] were arranged in a factorial experiment based on randomized complete block design with three replications. Results showed that in intercropping systems leaf area index (LAI of mung bean reduced but in the case of black cumin increased. Mung bean total dry matter in intercropping system did not differ comparing with sole crop but total dry matter in black cumin increased. All yield components in both crops affected by sowing patterns and weed control treatments. Number of branches/plant, number of pods or follicules/plant and number of seed/pods or follicules increased in A8, A4, A5 and A3 sowing patterns in mung bean and A3, A5 and A7 sowing patterns in black cumin compared with other arrangements. By increasing mung bean ratio in rows, the number of weed species, weed density, dry weight of weeds and abundance of weed species decreased. In unweeded treatment, number of branches/plant, number of pods or follicules/plant and number of seed/pods or follicules decreased in both crops. Land equivalent ratio (LER was more than 1.00 in all sowing patterns.

  13. Analysis of ibuprofen and its main metabolites in roots, shoots, and seeds of cowpea (Vigna unguiculata L. Walp) using liquid chromatography-quadrupole time-of-flight mass spectrometry: uptake, metabolism, and translocation.

    Science.gov (United States)

    Picó, Yolanda; Alvarez-Ruiz, Rodrigo; Wijaya, Leonard; Alfarhan, Ahmed; Alyemeni, Mohammed; Barceló, Damià

    2018-01-01

    A liquid chromatography quadruple time-of-flight mass spectrometry (LC-QqTOF-MS/MS) method was developed for simultaneous quantitative analysis of ibuprofen (IBU), 1- and 2-hydroxyibuprofen (1-OH IBU and 2-OH IBU), and carboxyibuprofen (CBX IBU) while preserving the ability of the instrument to get precursor and product ion mass spectra of non-target compounds. The trigger was the precursor ions reaching 100 cps intensity. Sample preparation was carried out by ultrasound solid-liquid extraction with methanol as extraction solvent at pH  70% for all target analytes at low and high concentration levels. The lowest limit of quantification was cowpea (Vigna unguiculata (L.) Walp) treated at high IBU concentrations and its presence in vegetables irrigated with treated water. Up to 46 metabolites, mostly hydroxylated metabolites and conjugates with hexosides and amino acids, were identified. The most abundant metabolites were also identified in an eggplant sample. Graphical Abstract ᅟ Ibuprofen metabolite identification.

  14. Effect of tillage and crop residues management on mungbean (vigna radiata (L.) wilczek) crop yield, nitrogen fixation and water use efficiency in rainfed areas

    International Nuclear Information System (INIS)

    Mohammad, W.; Shehzadi, S.; Shah, S.M.; Shah, Z.

    2010-01-01

    A field experiment was conducted to study the effect of crop residues and tillage practices on BNF, WUE and yield of mungbean (Vigna radiata (L.) Wilczek) under semi arid rainfed conditions at the Livestock Research Station, Surezai, Peshawar in North West Frontier Province (NWFP) of Pakistan. The experiment comprised of two tillage i) conventional tillage (T1) and ii) no-tillage (T0) and two residues i) wheat crop residues retained (+) and ii) wheat crop residues removed (-) treatments. Basal doses of N at the rate of 20: P at the rate of 60 kg ha-1 were applied to mungbean at sowing time in the form of urea and single super phosphate respectively. Labelled urea having 5% 15N atom excess was applied at the rate of 20 kg N ha-1 as aqueous solution in micro plots (1m2) in each treatment plot to assess BNF by mungbean. Similarly, maize and sorghum were grown as reference crops and were fertilized with 15N labelled urea as aqueous solution having 1% 15N atom excess at the rate of 90 kg N ha/sup -1/. The results obtained showed that mungbean yield (grain/straw) and WUE were improved in notillage treatment as compared to tillage treatment. Maximum mungbean grain yield (1224 kg ha/sup -1/) and WUE (6.61kg ha/sup -1 mm/sup -1/) were obtained in no-tillage (+ residues) treatment. The N concentration in mungbean straw and grain was not significantly influenced by tillage or crop residue treatments. The amount of fertilizer-N taken up by straw and grain of mungbean was higher under no-tillage with residues-retained treatment but the differences were not significant. The major proportion of N (60.03 to 76.51%) was derived by mungbean crop from atmospheric N2 fixation, the remaining (19.6 to 35.91%) was taken up from the soil and a small proportion (3.89 to 5.89%) was derived from the applied fertilizer in different treatments. The maximum amount of N fixed by mungbean (82.59 kg ha/sup -1/) was derived in no-tillage with wheat residue-retained treatment. By using sorghum as

  15. PIGMENTOS FOTOSSITETICOS E PRODUÇÃO DE FEIJÃO Vigna ungüiculada L. Walp SOB SALINIDADE E ADUBAÇÃO NITROGENADA

    Directory of Open Access Journals (Sweden)

    Guilherme de Freitas Furtado

    2014-08-01

    Full Text Available Estudaram-se acúmulo de pigmentos foliares e a produção do feijão vigna cv. BRS Pajeú submetidos diferentes níveis de salinidade da água de irrigação e doses de nitrogênio. O experimento foi desenvolvido em lisímetros de drenagem, no período de junho a setembro de 2013 em ambiente protegido da UEAg/CTRN/UFCG. Utilizou-se o delineamento experimental em blocos casualizados, em esquema fatorial 5 x 5, com três repetições, testando-se cinco níveis de condutividade elétrica da água de irrigação - CEa (0,9; 1,8; 2,7; 3,6 e 4,5 dS m-1 e cinco doses de adubação nitrogenada (70; 100; 130; 160 e 190% da recomendação indicada para ensaio em vaso. Avaliaram-se o teor de clorofila ‘a’ (CL a, teor de clorofila ‘b’ (CL b teor de clorofila total (CLT, razão clorofila ‘a’ e clorofila ‘b’ (CL a/CL b, teor de carotenóides (CAT, o conteúdo relativo de água (CRA, florescimento inicial (FI, o número de flores por planta (NFP, a taxa de abortamento (TA, o número de grãos por vagens (NGV e o número de grãos por planta (NGP. O teor de CL a não foi influenciada pelos tratamentos aplicados, sendo em média 13,66 µg g-1 MF-1. A irrigação com água salina proporcionou redução no teor de CL b, CLT, CL a/CL b, CAT e o CRA. A adubação nitrogenada promoveu decréscimo da razão CL a/CL b. A salinidade retardou o florescimento inicial, reduziu o número de flores por planta, o número de grãos por vagem e o número de grãos por planta. A taxa de abortamento de flores foi elevada com o incremento da condutividade elétrica da água. O nitrogênio proporcionou efeito significativo para o número de grãos por vagem. Não houve interação entre a salinidade da água de irrigação e a fertilização nitrogenada para nenhuma variável analisada.

  16. Assessment of genetic diversity in Vigna unguiculata L. (Walp) accessions using inter-simple sequence repeat (ISSR) and start codon targeted (SCoT) polymorphic markers.

    Science.gov (United States)

    Igwe, David Okeh; Afiukwa, Celestine Azubike; Ubi, Benjamin Ewa; Ogbu, Kenneth Idika; Ojuederie, Omena Bernard; Ude, George Nkem

    2017-11-17

    Assessment of genetic diversity of Vigna unguiculata (L.) Walp (cowpea) accessions using informative molecular markers is imperative for their genetic improvement and conservation. Use of efficacious molecular markers to obtain the required knowledge of the genetic diversity within the local and regional germplasm collections can enhance the overall effectiveness of cowpea improvement programs, hence, the comparative assessment of Inter-simple sequence repeat (ISSR) and Start codon targeted (SCoT) markers in genetic diversity of V. unguiculata accessions from different regions in Nigeria. Comparative analysis of the genetic diversity of eighteen accessions from different locations in Nigeria was investigated using ISSR and SCoT markers. DNA extraction was done using Zymogen Kit according to its manufacturer's instructions followed by amplifications with ISSR and SCoT and agarose gel electrophoresis. The reproducible bands were scored for analyses of dendrograms, principal component analysis, genetic diversity, allele frequency, polymorphic information content, and population structure. Both ISSR and SCoT markers resolved the accessions into five major clusters based on dendrogram and principal component analyses. Alleles of 32 and 52 were obtained with ISSR and SCoT, respectively. Numbers of alleles, gene diversity and polymorphic information content detected with ISSR were 9.4000, 0.7358 and 0.7192, while SCoT yielded 11.1667, 0.8158 and 0.8009, respectively. Polymorphic loci were 70 and 80 in ISSR and SCoT, respectively. Both markers produced high polymorphism (94.44-100%). The ranges of effective number of alleles (Ne) were 1.2887 ± 0.1797-1.7831 ± 0.2944 and 1.7416 ± 0.0776-1.9181 ± 0.2426 in ISSR and SCoT, respectively. The Nei's genetic diversity (H) ranged from 0.2112 ± 0.0600-0.4335 ± 0.1371 and 0.4111 ± 0.0226-0.4778 ± 0.1168 in ISSR and SCoT, respectively. Shannon's information index (I) from ISSR and SCoT were 0

  17. Tamaño de Parcela Experimental y Número de Repeticiones para Ensayos de Rendimiento con Caupi, Vigna ungiculata (l Walp

    Directory of Open Access Journals (Sweden)

    Escobar Soto Carlos

    1990-09-01

    Full Text Available La presente investigación se realizó con el propósito de estimar el tamaño óptimo de parcela experimental y el número de repeticiones para ensayos de rendimiento con caupl Vigna ungiculata (L Walp. El ensayo de campo, ensayo en blanco de 20 surcos de 25 m cada uno, se sembró durante el segundo semestre de 1990, en el Centro de Investigación Cotové, municipio de Santa Fe de Antioquia, propiedad de la Facultad de Ciencias Agropecuarias de la Universidad Nacional de Colombia, Seccional Medellín. La zona de vida corresponde a la de bosque seco tropical (bs -T. Se sembró la variedad experimental Licatur-1 OCA Calamar, a 0,60 m entre surcos y 0,10 m entre plantas dentro de surcos. La unidad básica se consideró de un surco de un metro de longitud. Para la estimación del tamaño óptimo de parcela experimental se combinaron las unidades básicas para obtener arreglos de diferentes tamaños y formas, a los que se determinó el coeficiente de variación GVij: CVij –Sij/Yij i:1,2, ... L;j = 1, 2, ... A Con el conjunto de los CVij se obtuvo un modelo de regresión cuya expresión real se asume que es un modelo cuadrático en (largo y r (ancho, esto es: CVij= β12+β1α +β2γ+β21αˆ2+β22γˆ2+β12αγ El tamaño óptimo de parcela experimental se estimó en unidades de 6 surcos (a 0,60 m. entre sí de 5 m de longitud (0,10 m entre plantas dentro de surcos, con un coeficiente de variación del 16%. El número de repeticiones estimado, para lograr un coeficiente de variación de 16% y una precisión razonable del 25% es de 4, asumiendo que las pruebas de comparación se hagan con un nivel de significancia de 0,05. A partir del modelo de regresión encontrado, para valores constantes del coeficiente de variación y número de surcos se estimó longitud de los mismos y con todos estos datos se generó una familia de curvas, de tal suerte que para un valor deseado de CV se puede escoger entre varias alternativas de tamaño de

  18. Comparative nutritional analysis between Vigna radiata and Vigna ...

    African Journals Online (AJOL)

    Yomi

    2012-03-27

    Mar 27, 2012 ... was prepared and their functional properties (foaming, nitrogen solubility index and SDS gel electrophoresis) ... analysis enhances their acceptability in food industry. ... system during processing, storage, cooking and con-.

  19. Vigna subterranea (L.) Verdc. Fabaceae

    African Journals Online (AJOL)

    PR BOKO

    Désinfection en surface des graines et préparation de l'explant. Les graines ont subi un trempage rapide (1min) dans l'éthanol 70 % (v/v), suivi de l'immersion pendant 30 min dans l'hypochlorite de calcium 7 % (m/v). Elles ont ensuite été abondamment rincées dans de l'eau distillée stérile. Après 48 heures d'imbibition à ...

  20. Atividade inseticida de óleos essenciais e fixos sobre Callosobruchus maculatus (FABR., 1775 (Coleoptera: Bruchidae em grãos de caupi [Vigna unguiculata (L. WALP.] Insecticide activity of essential and fixed oils in Callosobruchus maculatus (FABR., 1775 (Coleoptera: Bruchidae in cowpea grains [Vigna unguiculata (L. WALP.

    Directory of Open Access Journals (Sweden)

    Adriana Carla Ribeiro Lopes Pereira

    2008-06-01

    Full Text Available O caruncho, Callosobruchus maculatus (Fabr., é considerado a praga mais importante do caupi, Vigna unguiculata (L. Walp., armazenado em regiões tropicais e subtropicais. Visando minimizar os efeitos indesejáveis dos inseticidas químicos sintéticos, o controle dessa praga com óleos de origem vegetal vem se constituindo numa alternativa promissora, de baixo custo e segura para os aplicadores e consumidores. Foram testados os óleos essenciais [(Cymbopogon martini (Roxb. J.F. Watson], Piper aduncum L., Piper hispidinervum C.DC., Melaleuca sp., Lippia gracillis Shauer e fixos (Helianthus annuus L, Sesamum indicum L, Gossypium hirsutum L., Glycine max (L. Merr. e Caryocar brasiliense Camb., em grãos de caupi, cv. Sempre Verde. Os óleos foram utilizados nas concentrações 10, 20, 30, 40 e 50mL/20g, correspondendo a 0,5, 1,0, 1,5, 2,0 e 2,5 L/t e impregnados aos grãos no interior de recipientes de plástico, com auxílio de pipetador automático e agitados manualmente durante dois minutos. Parcelas de 20g de caupi foram infestadas com oito fêmeas de C. maculatus, com 0 a 48 h de idade. Cada óleo foi testado, separadamente, em delineamento inteiramente casualisado com seis repetições. Os óleos essenciais de C. martini, P. aduncum e L. gracillis causaram 100% de mortalidade em todas as concentrações, P. hispidinervum a partir de 1,5 L/t e Melaleuca sp. nas concentrações de 2,0 e 2,5 L/t. A redução do número de ovos viáveis e de insetos emergidos foi de 100% para todos os óleos essenciais, exceto Melaleuca sp. Por outro lado, os óleos fixos, apesar de apresentarem baixa mortalidade em todas as concentrações testadas, reduziram em praticamente 100% o número de ovos viáveis e de insetos emergidos.The weevil Callosobruchus maculatus (Fabr. is considered the most important pest of cowpea, Vigna unguiculata (L. Walp., stored in tropical and subtropical regions. Focusing to minimize the undesired effects of synthetic chemical

  1. Phosphoinositolphosphate (PIP) cascade induction by hypertonic stress of plant tissue

    International Nuclear Information System (INIS)

    Srivastava, A.; Jacoby, B.

    1989-01-01

    Inositol 1,4,5-trisphosphate (IP 3 ) was determined by competition with [ 3 H]-IP 3 for binding to an IP 3 specific protein. A hypertonic mannitol, sorbitol or lactose shock induced an increase in the rate of K + uptake and raised the IP 3 content of Beta vulgaris slices, excised Vigna mungo and Sorghum bicolor roots, as well as attached V. mungo roots. Increased K + uptake could also be induced by compounds that artificially induce the PIP cascade, or mimic it's products. A hypertonic shock, administered to intact B. vulgaris slices, further enhanced the phosphorylation of a 20 kD protein in the plasmalemma. Maximal IP 3 content was found 10 min after hypertonic induction and maximal K + uptake was obtained 10 min later. The effect of a continuous hypertonic treatment on IP 3 content, but not on K + uptake, was transient. Li + decreased the rate of IP 3 metabolism

  2. Supplementation of native grass hay with cowpea (Vigna unguiculata hay, wilted leucaena (Leucaena leucocephala forage, wilted tagasaste (Chamaecytisus palmensis forage or a wheat middling for young Friesian x Zebu (Boran crossbred steers

    Directory of Open Access Journals (Sweden)

    Tuomo Varvikko

    1992-03-01

    Full Text Available A 100-day experiment of a randomized block design was conducted with forty Friesian x Zebu (Boran crossbred growing steers to compare the value of wheat middling, an agro-industrial by-product (diet W, cowpea (Vigna unguiculata hay (diet C, and wilted forages of leucaena (Leucaena leucocephala, diet L and tagasaste (Chamaecytisus palmensis, diet T as cattle feed. These feeds were fed daily at a level of 1.5 kg (on an air dry basis to supplement the basal diet (diet H of native hay. A mineral supplement containing 50 g bone meal and 10 g common salt was also given daily. The steers were group-fed, but during the last two weeks at the end of the experiment the animals were housed individually in feeding pens to estimate the feed intake and apparent digestibilities of the diets. The animals were weighed at the beginning of the experiment, thereafter every two weeks, and finally at the end of the experiment. The animals consumed all the offered supplements, except for tagasaste forage, of which one third remained unconsumed. The mean daily total dry matter intake during the individual feeding period ranged from 4.0 to 5.0 kg between the diets (P

  3. Development and characterization of a new set of genomic microsatellite markers in rice bean (Vigna umbellata (Thunb.) Ohwi and Ohashi) and their utilization in genetic diversity analysis of collections from North East India.

    Science.gov (United States)

    Iangrai, Banshanlang; Pattanayak, Arunava; Khongwir, D Evanoreen Ann; Pale, Gratify; Gatphoh, Emica Mary; Das, Alpana; Chrungoo, Nikhil Kumar

    2017-01-01

    Rice bean [Vigna umbellate (Thumb.) Ohwi and Ohashi] is an underutilized crop believed to be domesticated in the Myanmar-Thailand region of Asia. In India, rice bean is mainly cultivated in the North-Eastern Hills, which is a hotspot for biological diversity. A 5' anchored PCR was used to develop microsatellite markers in rice bean. Twenty-eight specific primer pairs were designed and employed to characterize sixty five ricebean accessions collected from North East India. A total of 179 alleles were amplified with an average of 6.393 alleles per locus. The gene diversity was high (mean 0.534) in the accessions collected from Darjeeling, Nagaland and Manipur, which are bordering areas with East Nepal and Myanmar, respectively. Exceptionally high outcrossing rate was observed in the entire population. Population structure analysis identified three distinct clusters in which accessions collected from areas bordering Myanmar and East Nepal grouped separately. Using a combination of STRUCTURE and Principal Coordinate Analysis, relative affinity of the intermediate accessions could be established. However, differences in allelic counts among populations were non-significant. The results showed that there is a high level of genetic diversity within the accessions, with high outcrossing rate.

  4. The Combined Intervention with Germinated Vigna radiata and Aerobic Interval Training Protocol Is an Effective Strategy for the Treatment of Non-Alcoholic Fatty Liver Disease (NAFLD and Other Alterations Related to the Metabolic Syndrome in Zucker Rats

    Directory of Open Access Journals (Sweden)

    Garyfallia Kapravelou

    2017-07-01

    Full Text Available Metabolic syndrome (MetS is a group of related metabolic alterations that increase the risk of developing non-alcoholic fatty liver disease (NAFLD. Several lifestyle interventions based on dietary treatment with functional ingredients and physical activity are being studied as alternative or reinforcement treatments to the pharmacological ones actually in use. In the present experiment, the combined treatment with mung bean (Vigna radiata, a widely used legume with promising nutritional and health benefits that was included in the experimental diet as raw or 4 day-germinated seed flour, and aerobic interval training protocol (65–85% VO2 max has been tested in lean and obese Zucker rats following a 2 × 2 × 2 (2 phenotypes, 2 dietary interventions, 2 lifestyles factorial ANOVA (Analysis of Variance statistical analysis. Germination of V. radiata over a period of four days originated a significant protein hydrolysis leading to the appearance of low molecular weight peptides. The combination of 4 day-germinated V. radiata and aerobic interval training was more efficient compared to raw V. radiata at improving the aerobic capacity and physical performance, hepatic histology and functionality, and plasma lipid parameters as well as reverting the insulin resistance characteristic of the obese Zucker rat model. In conclusion, the joint intervention with legume sprouts and aerobic interval training protocol is an efficient treatment to improve the alterations of glucose and lipid metabolism as well as hepatic histology and functionality related to the development of NAFLD and the MetS.

  5. The Combined Intervention with Germinated Vigna radiata and Aerobic Interval Training Protocol Is an Effective Strategy for the Treatment of Non-Alcoholic Fatty Liver Disease (NAFLD) and Other Alterations Related to the Metabolic Syndrome in Zucker Rats.

    Science.gov (United States)

    Kapravelou, Garyfallia; Martínez, Rosario; Nebot, Elena; López-Jurado, María; Aranda, Pilar; Arrebola, Francisco; Cantarero, Samuel; Galisteo, Milagros; Porres, Jesus M

    2017-07-19

    Metabolic syndrome (MetS) is a group of related metabolic alterations that increase the risk of developing non-alcoholic fatty liver disease (NAFLD). Several lifestyle interventions based on dietary treatment with functional ingredients and physical activity are being studied as alternative or reinforcement treatments to the pharmacological ones actually in use. In the present experiment, the combined treatment with mung bean ( Vigna radiata ), a widely used legume with promising nutritional and health benefits that was included in the experimental diet as raw or 4 day-germinated seed flour, and aerobic interval training protocol (65-85% VO₂ max) has been tested in lean and obese Zucker rats following a 2 × 2 × 2 (2 phenotypes, 2 dietary interventions, 2 lifestyles) factorial ANOVA (Analysis of Variance) statistical analysis. Germination of V. radiata over a period of four days originated a significant protein hydrolysis leading to the appearance of low molecular weight peptides. The combination of 4 day-germinated V. radiata and aerobic interval training was more efficient compared to raw V. radiata at improving the aerobic capacity and physical performance, hepatic histology and functionality, and plasma lipid parameters as well as reverting the insulin resistance characteristic of the obese Zucker rat model. In conclusion, the joint intervention with legume sprouts and aerobic interval training protocol is an efficient treatment to improve the alterations of glucose and lipid metabolism as well as hepatic histology and functionality related to the development of NAFLD and the MetS.

  6. Effects of substituting roasted soybean (Glycine max seeds by those of cowpea (Vigna unguiculata, and of the protein level in the diet, on growth performance and profitability of local-breed chickens (Gallus gallus in Burkina

    Directory of Open Access Journals (Sweden)

    S. Ouattara

    2014-07-01

    Full Text Available This study aimed to evaluate the effects of substituting roasted seeds of soya (Glycine max by those of cowpea (Vigna unguiculata, and of the protein level in the diet, on growth performance and economic profitability of local-breed chickens (Gallus gallus in Burkina Faso. Three hundred 12-day-old chicks were divided into 12 batches of 25 chicks each. Four diets incorporating seeds of cowpea or soya, with different protein levels for starting and growing/finishing, were prepared. Data on various parameters (body weight, weight gain, intake and feed conversion, mortality were recorded once every two weeks from the 12th to the 138th day of age. At the 138th day, four chickens (two males and two females from each batch were slaughtered to assess the characteristics of carcasses and selected organs. The comparative profitability of the different treatments was evaluated. Results indicate that the substitution of roasted seeds of soya by those of cowpea had no devaluing effect on growth performance nor on carcass characteristics of the local chicken. In addition, the use of these seeds did not decrease profitability. Lastly, increasing the protein level in the diets significantly (p ≤ 0.05 improved weight gains and reduced the duration of the breeding period by two weeks.

  7. Involvement of abscisic acid in regulating antioxidative defense systems and IAA-oxidase activity and improving adventitious rooting in mung bean [Vigna radiata (L.) Wilczek] seedlings under cadmium stress.

    Science.gov (United States)

    Li, Shi-Weng; Leng, Yan; Feng, Lin; Zeng, Xiao-Ying

    2014-01-01

    In vitro experiments were conducted to investigate the effects of abscisic acid (ABA) and Cd on antioxidative defense systems and indole-3-acetic acid (IAA) oxidase during adventitious rooting in mung bean [Vigna radiata (L.) Wilczek] seedlings. The exogenous ABA significantly enhanced the number and fresh weight of the adventitious roots. CdCl2 strongly inhibited adventitious rooting. Pretreatment with 10 μM ABA clearly alleviated the inhibitory effect of Cd on rooting. ABA significantly reduced superoxide dismutase (SOD), ascorbate peroxidase (APX), peroxidase (POD), and catalase (CAT) activities, as well as the levels of glutathione (GSH) and ascorbic acid (ASA) during adventitious rooting. ABA strongly increased IAA-oxidase activity during the induction (0-12 h) and expression (after 48 h) phases and increased the phenols levels. Cd treatment significantly reduced the activities of SOD, APX, POD, and IAA oxidase, as well as GSH level. Cd strongly increased ASA levels. ABA pretreatment counteracted Cd-induced alterations of certain antioxidants and antioxidative enzymes, e.g., remarkably rescued APX and POD activities, reduced the elevated SOD and CAT activities and ASA levels, and recovered the reduced GSH levels, caused by Cd stress. Thus, the physiological effects of the combination of ABA and Cd treatments were opposite of those obtained with Cd treatment alone, suggesting that ABA involved in the regulation of antioxidative defense systems and the alleviation of wounding- and Cd-induced oxidative stress.

  8. Effects of Cropping System and Cowpea Variety on Symbiotic Potential and Yields of Cowpea (Vigna unguiculata L. Walp and Pearl Millet (Pennisetum glaucum L. in the Sudano-Sahelian Zone of Mali

    Directory of Open Access Journals (Sweden)

    Zoumana Kouyaté

    2012-01-01

    Full Text Available Many cowpea varieties (Vigna unguiculata L. Walp have been proposed by research in Mali. None of these varieties were investigated for their symbiotic potential in terms of root nodulation and mycorrhizal infection. An experiment was conducted at Cinzana Research Station, from 2007 to 2009 with an objective to identify a cowpea variety with high symbiotic potential which may improve millet/cowpea cropping global production. Randomized complete block (RCBD design with a factorial combination of 3 cowpea varieties (IT89KD-374, CZ1-94-23-1, and CZ11-94-5C and 2 cropping systems (millet/cowpea intercropping and cowpea-millet rotation was used. On farm test was conducted to evaluate CZ11-94-5C and IT89KD-374 nodulation performance. Cowpea variety CZ11-94-5-C had the highest nodule number and nodule weight. Millet/cowpea alternate rows intercropping (1/1, only, had a significant influence on cowpea root infection rates by mycorrhizae, on the 45th day after emergence. IT89KD-374 gave the best cowpea grain yield (1540 kg ha−1 in sole crop. The highest millet grain yield (1650 kg ha−1 was obtained under CZ11-94-5C-millet rotation. Farmers' fields assessments results confirmed CZ11-94-5C performance on research station. The CZ11-94-5C cowpea variety needs to be more characterized.

  9. High yielding mutants of blackgram variety 'PH-25'

    International Nuclear Information System (INIS)

    Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

    2001-01-01

    Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

  10. Increased UV-B radiation reduces N2-fixation in tropical leguminous crops

    International Nuclear Information System (INIS)

    Anupa Singh

    1997-01-01

    Net photosynthesis, leaf area, biomass, and number, size and activity of nodules were examined in three leguminous plants subjected under field conditions to supplemental UV-B radiation equivalent to a 15% ozone depletion at 25 degrees N latitude. Enhanced UV-B radiation adversely affected the net photosynthetic rate, growth characteristics and nodule activity in all three species. Maximum reduction in net photosynthesis occurred in Phaseolus mungo cv. Pant U-30, whereas the greatest reduction in nitrogenase activity occurred in Vigna radiata. (author)

  11. Uptake rate of nitrogen from soil and fertilizer, and N derived from symbiotic fixation in cowpea (Vigna unguiculata (L.) Walp.) and common bean (Phaseolus vulgaris L.) determined using the 15N isotope

    International Nuclear Information System (INIS)

    Brito, Marciano de Medeiros Pereira; Muraoka, Takashi; Silva, Edson Cabral da

    2009-01-01

    Common bean (Phaseolus vulgaris L.) and cowpea (Vigna unguiculata (L.) Walp.) are among the main sources of plant protein for a large part of the world population, mainly that of low income, and nitrogen is the main constituent of these proteins. The objectives of this study were to evaluate, through the 15 N-dilution technique and using rice and non-nodulating soybean as control plants, the relative contributions of nitrogen sources (symbiotically fixed N, soil native N and fertilizer N) on the growth of common bean and cowpea and to compare the isotopic technique (ID) with the difference methods (DM) for the evaluation of symbiotic N 2 fixation. The study was carried out in a greenhouse of the Center for Nuclear Energy in Agriculture - CENA/USP, Sao Paulo State, Brazil, using 5 kg pots with a Typic Haplustox (Dystrophic Red-Yellow Latosol). The experiment was arranged in completely randomized blocks, with 16 treatments and three replications, in an 8 x 2 factorial design. The treatments were eight sampling times: 7, 24, 31, 38, 47, 58, 68 and 78 days after sowing (DAS) and two crops: common bean and cowpea. An N rate of 10 mg kg -1 soil was used, as urea, enriched with an excess of 10 % of 15 N atoms. Symbiotic N fixation supplied the bean and cowpea plants with the greatest amount of accumulated N, followed, in decreasing order, by soil and fertilizer. The highest rate of N symbiotic fixation was observed at the pre-flowering growth stage of the bean and cowpea plants. After the initial growth stage, 24 DAS, rice and non nodulating soybean were appropriate control plants to evaluate symbiotic N fixation. There was a good agreement between ID and DM, except in the initial growth stage of the crops. (author)

  12. Desenvolvimento do feijão caupi (vigna unguiculata l.walp utilizando as cinzas de bagaço da cana-de-açúcar e efluente tratado

    Directory of Open Access Journals (Sweden)

    José Airlys Garcia de Menezes

    2013-09-01

    Full Text Available A grande quantidade de cinzas gerada pelos engenhos, proveniente da queima do bagaço da cana-de-açúcar, ou seja, a necessidade de redução de emissões advindas dessa queima, fazem com que se busquem alternativas para diminuir essas emissões, assim como para a utilização racional dessas cinzas em diversas culturas, como na produção do feijão caupi.O presente trabalho teve como objetivo avaliar os efeitos das cinzas de bagaço de cana-de-açúcar com efluente tratados, no desenvolvimento inicial da cultura do Feijão caupi (Vigna unguiculata L.Walp. O estudo foi desenvolvido na estação de tratamento de esgoto da Faculdade de Tecnologia CENTEC – FATEC Cariri, utilizando-se de tratamentos T1- Efluente tratado do filtro anaeróbio juntamente com as cinzas do bagaço da cana-de-açúcar; T2- Água proveniente de poço juntamente com as cinzas do bagaço da cana-de-açúcar; T3- Água proveniente de poço sem aplicação de cinzas; com três épocas de coletas, compondo um modelo de experimento inteiramente casualizado. Contudo os valores de altura e o diâmetro caulinar foram mais elevados nas plantas cultivadas com a aplicação das cinzas de bagaço de cana-de-açúcar com efluente tratados. Normal 0 21 false false false PT-BR X-NONE X-NONE

  13. Actinobacteria Associated With Arbuscular Mycorrhizal Funneliformis mosseae Spores, Taxonomic Characterization and Their Beneficial Traits to Plants: Evidence Obtained From Mung Bean (Vigna radiata) and Thai Jasmine Rice (Oryza sativa)

    Science.gov (United States)

    Lasudee, Krisana; Tokuyama, Shinji; Lumyong, Saisamorn; Pathom-aree, Wasu

    2018-01-01

    In this study, we report on the isolation of actinobacteria obtained from spores of Funneliformis mosseae and provide evidence for their potential in agricultural uses as plant growth promoters in vitro and in vivo. Actinobacteria were isolated from spores of F. mosseae using the dilution plate technique and media designed for the selective isolation of members of specific actinobacterial taxa. Six strains namely 48, S1, S3, S4, S4-1 and SP, were isolated and identified based on16S rRNA gene sequences. Phylogenetic analysis showed that isolate SP belonged to the genus Pseudonocardia with P. nantongensis KLBMP 1282T as its closest neighbor. The remaining isolates belonged to the genus Streptomyces. Two isolates, 48 and S3 were most closely related to S. thermocarboxydus DSM 44293T. Isolates S4 and S4-1 shared the highest 16S RNA gene similarity with S. pilosus NBRC 127772T. Isolate S1 showed its closest relationship with the type strain of S. spinoverrucosus NBRC14228T. The ability of these isolates to produce indole-3-acetic acid (IAA), siderophores and the ability to solubilize phosphate in vitro were examined. All isolates produced siderophores, four isolates produced IAA and two isolates solubilized inorganic phosphate at varying levels. S. thermocarboxydus isolate S3 showed the highest IAA production with high activities of phosphate solubilization and siderophore production. The inoculation of mung beans (Vigna radiata) with this strain resulted in a significant increase in fresh weight, root length and total length as an effect of IAA production. In an experiment with rice (Oryza sativa), S. thermocarboxydus isolate S3 promoted the growth of rice plants grown in low nutritional soil under induced drought stress. This report supports the view that the inoculation of rice with plant growth promoting actinobacteria mitigates some adverse effects of low nutrient and drought stress on rice. PMID:29942292

  14. Uptake rate of nitrogen from soil and fertilizer, and N derived from symbiotic fixation in cowpea (Vigna unguiculata (L.) Walp.) and common bean (Phaseolus vulgaris L.) determined using the {sup 15}N isotope; Marcha de absorcao do nitrogenio do solo, do fertilizante e da fixacao simbiotica em feijao-caupi (Vigna unguiculata (L.) Walp.) e feijao-comum (Phaseolus vulgaris L.) determinada com uso de {sup 15}N

    Energy Technology Data Exchange (ETDEWEB)

    Brito, Marciano de Medeiros Pereira; Muraoka, Takashi; Silva, Edson Cabral da [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba SP (Brazil)], e-mail: marcianobrito@hotmail.com, e-mail: muraoka@cena.usp.br, e-mail: ecsilva@cena.usp.br

    2009-07-15

    Common bean (Phaseolus vulgaris L.) and cowpea (Vigna unguiculata (L.) Walp.) are among the main sources of plant protein for a large part of the world population, mainly that of low income, and nitrogen is the main constituent of these proteins. The objectives of this study were to evaluate, through the {sup 15}N-dilution technique and using rice and non-nodulating soybean as control plants, the relative contributions of nitrogen sources (symbiotically fixed N, soil native N and fertilizer N) on the growth of common bean and cowpea and to compare the isotopic technique (ID) with the difference methods (DM) for the evaluation of symbiotic N{sub 2} fixation. The study was carried out in a greenhouse of the Center for Nuclear Energy in Agriculture - CENA/USP, Sao Paulo State, Brazil, using 5 kg pots with a Typic Haplustox (Dystrophic Red-Yellow Latosol). The experiment was arranged in completely randomized blocks, with 16 treatments and three replications, in an 8 x 2 factorial design. The treatments were eight sampling times: 7, 24, 31, 38, 47, 58, 68 and 78 days after sowing (DAS) and two crops: common bean and cowpea. An N rate of 10 mg kg{sup -1} soil was used, as urea, enriched with an excess of 10 % of {sup 15}N atoms. Symbiotic N fixation supplied the bean and cowpea plants with the greatest amount of accumulated N, followed, in decreasing order, by soil and fertilizer. The highest rate of N symbiotic fixation was observed at the pre-flowering growth stage of the bean and cowpea plants. After the initial growth stage, 24 DAS, rice and non nodulating soybean were appropriate control plants to evaluate symbiotic N fixation. There was a good agreement between ID and DM, except in the initial growth stage of the crops. (author)

  15. Effect of Six Different Audio Frequencies on Growth of Cowpea ( Vigna unguiculata ) during Seedling Stage%6种不同声频对豇豆苗期生长影响的研究

    Institute of Scientific and Technical Information of China (English)

    姜仕仁; 黄俊

    2011-01-01

    [目的]研究不同类型、频率特征的声波对豇豆苗期生长的影响.[方法]以古典音乐与昆虫鸣声的混合声波(MI)、杜鹃鸣声、蟋蟀鸣声、单一频率的400 Hz声波和多种频率合成的F5,Fn声波进行试验比较,对豇豆苗高、苗重进行测定,采用EXCEL进行统计分析和多重比较.[结果]经6种不同类型和频率声频处理后,豇豆苗期生长状况均显著优于对照组,表明声波能显著促进株高生长,对豇豆苗期助长效果较好的是400Hz、杜鹃鸣声和蟋蟀鸣声,其次是MI,Fn和F5;与对照组相比,杜鹃鸣声和蟋蟀鸣声处理组在生长期间能显著促进苗株增重.[结论]不同类型、频率特征的声波对豇豆苗期生长都有明显的助长作用,但作用效果有所差异.%[ Objective] The aim was to study the effects of acoustic waves with different types and frequency characteristics on the growth of cowpea (Vigna unguiculata) during seedling stage. [ Method] The insect-music mixed sound (MS), cuckoo acoustic song, cricket acoustic song, single 400 Hz frequency acoustic wave, F5 and Fn acoustic waves composed of different frequencies were designed to investigate the effects on height and weight of cowpea seedling, and experimental data were statistically analyzed and multiple-compared by EXCEL. [ Result ] After treatment by six different types and frequencies of acoustic waves, the growth situations of cowpea were better than control. This indicated that acoustic waves could significantly promote height growth of plant. The treatments with good growth promotion effect included 400 Hz frequency acoustic wave, cuckoo acoustic song and cricket acoustic song, followed by MI, Fn and F5. Cuckoo and cricket acoustic song treatment could promote the weight of cowpea seedling during growth stage. [ Conclusion ] Acoustic waves with different types and frequency characteristics had significant growth-promotion effect on growth of cowpea during seedling stage, but

  16. 6种不同声频对豇豆苗期生长的影响%Effect of Six Different Acoustic Frequencies on Growth of Cowpea(Vigna unguiculata)during Its Seedling Stage

    Institute of Scientific and Technical Information of China (English)

    黄俊; 姜仕仁

    2011-01-01

    [Objective] The aim was to study the effects of sound waves with different types and frequency characteristics on the growth of cowpea(Vigna unguiculata)during seedling stage.[Method] The insect-music mixed sound(MI),cuckoo acoustic song,cricket acoustic song,single 400 Hz frequency sound wave,F5 and Fn sound waves composed of different frequencies were designed to investigate their effects on height and weight of cowpea seedling,and experimental data were statistically analyzed and multiple-compared by EXCEL.[Result] After treatment by sound waves with six different types and frequencies,the growth situations of cowpea were better than that in control.This indicated that sound waves could significantly promote height growth of plant.The treatments with good growth-promotion effect included 400 Hz frequency sound wave,cuckoo acoustic song and cricket acoustic song,followed by MI,Fn and F5.Cuckoo and cricket acoustic song treatment could promote the weight of cowpea seedling during seedling stage.[Conclusion] Sound waves with different types and frequency characteristics had significant growth-promotion effect on growth of cowpea during seedling stage,but their effects were different.%[目的]研究不同类型、频率特征的声波对豇豆苗期生长的影响。[方法]以古典音乐与昆虫鸣声的混合声波(MI)、杜鹃鸣声、蟋蟀鸣声、单一频率的400Hz声波和多种频率合成的F5、Fn声波进行试验比较,对豇豆苗高、苗重进行测定,采用EXCEL进行统计分析和多重比较。[结果]经6种不同类型和频率声频处理后,豇豆苗期生长生长状况均显著优于对照组,表明声波能显著促进株高生长,对豇豆苗期助长效果较好的是400Hz、杜鹃鸣声和蟋蟀鸣声,其次是MI、Fn和F5;与对照组相比,杜鹃鸣声和蟋蟀鸣声处理组在生长期间能显著促进苗株增

  17. BALANCE PARCIAL DE NITRÓGENO EN EL SISTEMA DE CULTIVO DE MAÍZ (Zea mays L. CON COBERTURA DE LEGUMINOSAS EN CHIAPAS, MÉXICO

    Directory of Open Access Journals (Sweden)

    José David Álvarez-Solís

    2016-01-01

    Full Text Available El potencial de las leguminosas para mejorar la fertilidad del suelo y sostener la producción de cultivos asociados como el maíz, varía entre especies. Este trabajo evalúa la contribución de 3 leguminosas como cultivos de cobertura (CC en el balance parcial de Nitrógeno (N en el cultivo de maíz. Fue realizado en Ejido La Bella Ilusión, Maravilla Tenejapa, estado de Chiapas, México, con 4 tratamientos en asociación al cultivo de maíz: 1 frijol nescafé (Mucuna pruriens, 2 frijol arroz (Vigna umbellata, 3 frijol común (Phaseolus vulgaris y 4 testigo sin leguminosa. Se midió la producción de biomasa y el contenido de N, en las leguminosas y el maíz. Se hizo un balance parcial de N, que consideró el suministro de N de la biomasa de leguminosas y la extracción de N en la cosecha del maíz. La producción de biomasa seca de las leguminosas en la cosecha fue significativamente (p≤0,05 mayor en asociación con los frijoles arroz y nescafé (1290 y 1139 kg.ha-1 que en frijol común (470 kg.ha-1, con un contenido total de 35,4; 25,7 y 8,9 kg.ha-1 N, respectivamente. El rendimiento de grano de maíz fue 2390,5 kg.ha-1; se identificó que la extracción de N fue mayor en el grano, seguido de rastrojo, raíz, bráctea y olote, con 20,9; 9,4; 7,2; 2,0 y 1,5 kg.ha-1 N, respectivamente. El balance parcial de N mostró valores positivos con los frijoles arroz y nescafé, lo que indica su importancia para compensar la extracción de N del grano o de la mazorca del maíz.

  18. Isolation and Characterization of NADP+ -Linked Isocitrate Dehydrogenase in Germinating Urd Bean Seeds (Phaseolus mungo

    Directory of Open Access Journals (Sweden)

    Pramod Kumar Srivastava

    2010-06-01

    Full Text Available Isocitrate dehydrogenase (EC 1.1.1.42 has been purified to homogeneity from germinating urd bean seeds. The enzyme NADP+ -linked isocitrate dehydrogenase is a tetrameric protein (molecular weight 130,000; gel filtration made up of four identical monomers (sub unit molecular weight about 32,000-33,000; PAGE in presence of sodium dodecyl sulphate. Thermal inactivation of purified enzyme at 40 °C, 45 °C and 50 °C shows single exponential loss of enzyme activity suggesting that the inactivation of this enzyme follows simple first order kinetics (rate constants for purified enzyme 0.020, 0.043 and 0.077 min–1 at 40 °C, 45 °C and 50 °C respectively. Thermal inactivation in presence of glutathione and dithiothretol at 45 °C and 50 °C also follows simple first order kinetics, but the presence of these compounds protects the loss of enzyme activity. The enzyme shows optimum activity at pH 7.3-8.0. The variation of Vmax and Km at different pH values (6.5-8.0 suggests that proton behaves as an "Uncompetitive Inhibitor". A basic group is present at the active site of enzyme which is accessible for protonation in this pH range in the presence of substrate only, with a pKa equal to 6.8. Successive dialysis against EDTA and phosphate buffer, pH 7.5 at 0-4 °C gives an enzymatically inactive protein. Thermal inactivation of this protein at 45 °C and 50 °C shows an exponential loss of enzyme activity as in the case of untreated (native enzyme. Full activity is restored on adding Mn2+ (3.75mM to a solution of this protein. Addition of Mg2+, Zn2+, Co2+ and Cu2+ brings about partial recovery. Alkali metal ions bring about 75% inhibition at 4mM concentration. The inhibition is stronger at high concentration of Na+ and K+ . Other metal ions are not effective.

  19. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    haulm growth at the expense of the tubers (Ewing,. 1981), increased rate of respiration (Sale, 1974), reduced dry matter accumulation (Bushnell, 1925), delayed tuber initiation (Menzel, 1980, Nowak and. Coleborne, 1989) and maturity (Amadi, 2005) and a significant loss of tuber yield and quality (Levy, 1983,. 1984).

  20. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    enable movement and measurement in built-up areas. Green et al (1999) ... Akure, Nigeria. M. A. Isogun, Department of Geology, Obafemi Awolowo University, Ile-Ife, Nigeria .... their Significance in Refuse Dump Classification. Variations in ...

  1. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    In recent years molecular sieve catalysts have ... 43. I. P. Okoye, Department of Pure & Industrial Chemistry, University of Port Harcourt, P. M. B. 5323 Choba, Port-Harcourt. .... “Nature and. Localization of poisoning carbonaceous matter.

  2. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    Following the first appearance of T. b. gambiense parasitaemia, the animals developed ... of sleep and wakefulness between weeks 8 and 10 when the animals were in the classical diurnal sleepiness with 8 -. 10 sleep ..... transgenic mice.

  3. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    batatas,14.27 ± 0.41mg/100g of calcium ... B1, 4.57 ± 0.86mg/100g; folic acid, 3.24±0.00mg/100g occurred in P. .... reactions e.g. glycogen and protein synthesis (Robson ... excess loss of sodium can occur during intense ... Deficiency leads to.

  4. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    a more reliable and decentralized information system, meant to improve reporting .... This is done after the exchange of the .... Communication: it is simplified for the ... Picture. Passport Photograph of Buyer (must have). WITNESS 1. Character.

  5. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    2003-07-20

    Jul 20, 2003 ... E. B. Ntasin, Department of Geology and Environmental Science, .... of the aircraft cable and secured by cable clamps. The ..... automatic recording system to detect the critical ... control and triggering mechanism of landslides.

  6. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    existing information to assist fish farmers. MATERIALS AND METHODS ... J. F. Alfred-Ockiya, Department of Fisheries, Faculty of Agricultural Technology, Niger Delta University, Wilberforce Island,. Bayelsa State .... Biometrics, 11: 1- 42.

  7. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    (p≥0.05) in the soil pH, zinc and copper contents between and within treatments throughout the study period, indicating that ... interferes with water and nutrient supply to plants. (Grummer .... increased energy (carbon) demand since the oil.

  8. Purification And Characterization Of Vigna unguiculata Cultiver ...

    African Journals Online (AJOL)

    AspII had a Km value 1.25 mM for asparagine and a pH optimum at 8.0. Asp II had a temperature optimum and heat stability at 40 oC. The fodder cultivar asp II activity was specific for Lasparagine and did not hydrolyze D-asparagine. It is not specific for. L-glutamine. Ni2+ and Co2+ had activator effects on asp II but other

  9. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    A three-dimensional study is made to improve the theoretical approach of spectral response of bifacial polycrystalline silicon solar cells. This study has allowed taking into account new parameters like grain size and grain boundaries recombination velocity, which reduce the cell efficiency. Losses in emitter region and ...

  10. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    About 5g of each. 15 ... E. D. Paul, National Research Institute for Chemical Technology, P.M.B 1052, Zaria, Nigeria. O. B. Adesina .... by phosphorylation, and can be used for cell signaling. ... products seems an unlikely human health problem.

  11. (Vigna unguiculata (L.) Walp.) through Agrobacterium transformation ...

    African Journals Online (AJOL)

    Administrator

    2011-09-26

    Sep 26, 2011 ... two 24-mer primers homologous to the Bar gene were used in the. PCR analysis. The base sequences of the primers are as follows: GUS P1 5'-TTG CCC AGC TAT CTG TCA CTT CAC T-3'. GUS P2 5'-ATG TCA CAT CAA TCC ACT TGC TTT G-3'. Bar P1 5'-GGG ACT TCA GCA GGT GGG TGT AGA-3'.

  12. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    OLS is best with large negative or positive correlation, while 3SLS is best with feebly correlated error terms in the case .... the asymptotic covariance matrix of the FIML estimator achieves the ... defined only when all equations in the system are.

  13. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    GLOBAL JOURNAL OF PURE AND APPLIED SCIENCES VOL 15, NO. ... Both quantitative and qualitative analytical methods were implemented ... S. S. Ikiensikimama, Department of Chemical Engineering, University of Lagos, Lagos, Nigeria.

  14. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    Aspartame and Sucrose are food additives widely used ... additives and their toxic potential in humans. Thus ..... GPCRs) that activated the enzyme, leading to the .... class with maternal diet and the dimension of ... Biological Psychiatry, 28.

  15. Marcha de absorção do nitrogênio do solo, do fertilizante e da fixação simbiótica em feijão-caupi (Vigna unguiculata (L. walp. e feijão-comum (Phaseolus vulgaris L. determinada com uso de 15N Uptake rate of nitrogen from soil and fertilizer, and n derived from symbiotic fixation in cowpea (Vigna unguiculata (L. walp. and common bean (Phaseolus vulgaris L. determined using the 15N isotope

    Directory of Open Access Journals (Sweden)

    Marciano de Medeiros Pereira Brito

    2009-08-01

    Full Text Available O feijão-comum e o feijão-caupi estão entre as principais fontes de proteína vegetal para grande parte da população mundial, sobretudo aquela de baixa renda, e o N é o principal constituinte de proteínas. Os objetivos deste trabalho foram de avaliar, por meio da técnica isotópica e tendo como plantas-controle arroz e soja não nodulante, as contribuições relativas das fontes de N (N2-fixação simbiótica, N-solo e N-fertilizante no desenvolvimento do feijão-comum e caupi ao longo do ciclo e comparar o método isotópico (MI com o método da diferença (MD para avaliação da fixação simbiótica de N2. A pesquisa foi realizada em casa de vegetação no Centro de Energia Nuclear na Agricultura - CENA/USP, utilizando-se vasos com 5 kg de terra de um Latossolo Vermelho-Amarelo distrófico. O delineamento experimental foi o de blocos casualizados com 16 tratamentos e três repetições. Os tratamentos (fatorial 8 x 2 compreenderam oito épocas de coleta: 17, 24, 31, 38, 47, 58, 68 e 78 dias após a semeadura (DAS e duas culturas: feijão-comum e feijão-caupi. Utilizou-se uma dose de 10 mg kg-1 de N no solo, na forma de ureia, enriquecida com 10 % de átomos de 15N em excesso. A fixação simbiótica forneceu a maior parte do N acumulado nas plantas de feijão e caupi, seguida, em ordem decrescente, pelo solo e fertilizante. A maior taxa de fixação simbiótica de N ocorreu a partir da fase de prefloração do feijão e do caupi. Após a fase inicial (24 DAS, o arroz e a soja não nodulante tornaram-se adequadas plantas-controle da fixação simbiótica de N2. Houve boa concordância entre o MI e o MD, exceto nos estádios iniciais das culturas.Common bean (Phaseolus vulgaris L. and cowpea (Vigna unguiculata (L. Walp. are among the main sources of plant protein for a large part of the world population, mainly that of low income, and nitrogen is the main constituent of these proteins. The objectives of this study were to evaluate

  16. Avances del mejoramiento genético participativo del frijol en Cuba

    Directory of Open Access Journals (Sweden)

    Rodobaldo Ortiz-P\\u00E9rez

    2006-01-01

    Full Text Available Las actividades de Fitomejoramiento Participativo fueron conducidas con agricultores del municipio de San Antonio de los Baños de la provincia La Habana y campesinos de la comunidad la Palma de la provincia de Pinar del Río durante 2001 al 2004. En la fase de diagnóstico en las áreas de intervención del proyecto, más del 80 % de los agricultores no utilizaban la semilla del sistema formal; por lo tanto, las variedades obtenidas por los programas de mejoramiento no llegaban a la mayoría de los agricultores. Se buscó un mecanismo alternativo para introducir diversidad genética a las localidades mediante las ferias de diversidad, cuyo objetivo principal ha estado dirigido a facilitar el flujo de semilla de los institutos de investigaciones hacia el agricultor y viceversa. Posterior al desarrollo de las ferias de diversidad se continúa con la experimentación campesina en fincas y cooperativas, desarrollándose una amplia red experimental difícil de lograrse sin la participación de los productores. La experimentación campesina, el aumento de la eficiencia en la finca, incluyendo el aumento del rendimiento de sus parcelas, el aumento de la diversidad por el uso de mayor número de variedades, y una mayor proporción de área dedicada a estas variedades; todo lo cual redunda en un mejoramiento de la vida del campesino y su familia

  17. Effect of external pH on the cytoplasmic and vacuolar pHs in Mung bean root-tip cells

    International Nuclear Information System (INIS)

    Torimitsu, Keiichi; Yazaki, Yoshiaki; Nagasuka, Kinuyo; Ohta, Eiji; Sakata, Makoto

    1984-01-01

    The effect of the external pH on the intracellular pH in mung bean (Vigna mungo (L.) Hepper) root-tip cells was investigated with the 31 P nuclear magnetic resonance (NMR) method. The 31 P NMR spectra showed three peaks caused by cytoplasmic G-6-P, cytoplasmic Psub(i) and vacuolar Psub(i). The cytoplasmic and vacuolar pHs could be determined by comparing the Psub(i) chemical shifts with the titration curve. When the external pH was changed over a range from pH 3 to 10, the cytoplasmic pH showed smaller changes than the vacuolar pH, suggesting that the former is regulated more strictly than the latter. The H + -ATPase inhibitor, DCCD, caused the breakdown of the mechanism that regulates the intracellular pH. H + -ATPase appears to have an important part in the regulation of the intracellular pH. (author)

  18. Field evaluations of N2 fixation by grain legumes in Pakistan

    International Nuclear Information System (INIS)

    Hafeez, F.Y.; Ahmad, T.; Asad, T.; Malik, K.; Shah, N.H.; Danso, S.K.A.

    1998-01-01

    Studies were undertaken with four legume species that are economically important in Pakistan, to gain an understanding of how host-genotype, rhizobial-strain, and environmental factors affect the root-nodule N 2 -fixing symbiosis of field-grown plants. Strong responses to inoculation were obtained with lentil (Lens culinaris) that showed significant host-genotype x rhizobial strain interaction. In contrast, only one of eight mung-bean (Vigna radiata) genotypes and none of five black-gram (V. mungo) genotypes responded positively to inoculation; however, negative effects of inoculation were cautionary that host-genotype x rhizobial strain interactions must nevertheless be considered. Trials with chickpea (Cicer arietinum) indicated that biomass, grain yield and total N may be used as indicators of the amount of N fixed for large screening trials in which employment of the 15 N-dilution technique would be prohibitively expensive

  19. Induced variation in pod and seed traits of wild and cultivated beans

    International Nuclear Information System (INIS)

    Ignacimuthu, S.; Babu, C.R.

    1992-01-01

    With a view to evaluate the induced genetic variation in yield traits of wild and cultivated urd and mung bean, seeds of Vigna radiata. V. mungo (cultivars) and V. sublobata (wild relative) were given mutagenic treatments. Different concentrations of EMS and gamma rays were used as mutagens separately and in combination. Genetic variation in yield traits was analysed in M 2 plants. There was a broad spectrum of induced variability in most yield traits. Genetic variance, heritability and genetic advance were high in most of the traits. The results demonstrate that induced mutations are random, polydirectional and quantitative in nature. The wild relative is more resistant than the cultivars. (author). 14 refs., 4 tabs

  20. INFLUENCE OF VERMICOMPOST ON THE PHYSICO-CHEMICAL AND BIOLOGICAL PROPERTIES IN DIFFERENT TYPES OF SOIL ALONG WITH YIELD AND QUALITY OF THE PULSE CROP-BLACKGRAM

    Directory of Open Access Journals (Sweden)

    K. Parthasarathi, M. Balamurugan, L. S. Ranganathan

    2008-01-01

    Full Text Available Field experiments were conducted during 2002-2003 on clay loam, sandy loam and red loam soil at Sivapuri, Chidambaram, Tamil Nadu, to evaluate the efficacy of vermicompost on the physico-chemical and biological characteristics of the soils and on the yield and nutrient content of blackgram - Vigna mungo, in comparison to inorganic fertilizers nitrogen, phosphorous, potassium. Vermicompost had increased the pore space, reduced particle and bulk density, increased water holding capacity, cation exchange capacity, reduced pH and electrical conductivity, increased organic carbon content, available nitrogen, phosphorous, potassium and microbial population and activity in all the soil types, particularly clay loam. The yield and quality (protein and sugar content in seed of blackgram was enhanced in soils, particularly clay loam soil. On the contrary, the application of inorganic fertilizers has resulted in reduced porosity, compaction of soil, reduced carbon and reduced microbial activity.

  1. Impact of mutant varieties of blackgram in realising improved productivity

    International Nuclear Information System (INIS)

    Pawar, S.E.

    2001-01-01

    Blackgram (Vigna mungo L. Hepper) is an important pulse crop extensively grown in India. It is the cheapest source of protein for millions of Indians. The seeds contain about 22% protein. The area under cultivation in India is about 3.25 million hectares with an annual production of 1.45 million tons. About 70% of the total area is in the Central and Southern part of the country, which contributes about 77% of the total production. In the past there have been attempts to increase the production and productivity of this crop using conventional breeding approaches at different Agricultural Research Centres. However, the yield remains around 500 kg/ha. We have used induced mutation techniques to break the yield barrier. The induced mutations were used in cross breeding to synthesise an ideal plant type with high yield potential suitable for different agroclimatic conditions

  2. Improving productivity promoting traits in wild and cultivated urd and mung beans

    International Nuclear Information System (INIS)

    Ignacimuthu, S.; Babu, C.R.

    1989-01-01

    Photosynthetic rate, RuBP Carboxylase activity, glycolate oxidase activity, malate dehydrogenase activity, specific leaf weight, harvest index and yield were estimated in the normal and 10 Krad dose treated M 2 plants of Vigna sublobata (wild), V. radiata and V. mungo (cultivars) with the objective of locating and utilizing productivity promoting gene assemblies as well as to understand the role of natural and artificial selections in moulding yield promoting gene combinations. The results suggest that there is higher photosynthetic rate and RuPB Case activity in the 10 Krad treated M 2 plants. There is lesser glycolate oxidase activity and malate dehydrogenase activity. There is also positive correlation among net leaf assimilation rate, RuBP Case activity, SLW, HI and yield. These observations imply that domestication accompanied by directional selection did a lter substantially the productivity traits and productivity promoting gene assemblies. (author). 26 refs., 3 tabs

  3. Impact of mine waste dumps on growth and biomass of economically important crops.

    Science.gov (United States)

    Mathiyazhagan, Narayanan; Natarajan, Devarajan

    2012-11-01

    The present study aimed to investigate the effect of magnesite and bauxite waste dumps on growth and biochemical parameters of some edible and economically important plants such as Vigna radiata, V. mungo, V. unguiculata, Eleusine coracana, Cajanus cajan, Pennisetum glaucum, Macrotyloma uniflorum, Oryza sativa, Sorghum bicolour, Sesamum indicum, Ricinus communis, Brassica juncea, Gossypium hirsutum and Jatropha curcas. The growth rate of all the crops was observed in the range of 75 to 100% in magnesite and 15 to 100% in bauxite mine soil. The moisture content of roots and shoots of all the crops were in the range of 24 to 77, 20 to 88% and 42 to 87, 59 to 88% respectively. The height of the crops was in the range of 2.6 to 48 cm in magnesite soil and 3 to 33 cm in bauxite soil. Thus the study shows that both mine soils reflects some physical and biomolecule impact on selected crops.

  4. Fuentes de resistencia a la antracnosis y la mancha angular en frijol común para Costa Rica

    Directory of Open Access Journals (Sweden)

    Rodolfo Araya

    2000-01-01

    Full Text Available Sources of resistance to anthracnose and angular leaf spot in common bean for Costa Rica. The objective of this study was to select sources of resistance to angular leaf spot and anthracnose from a diverse group of germplasm with known resistance to these diseases and other abiotic and biotic factors. Atotal of 173 common beans that included 46 landraces and 127 breeding lines were evaluated at two locations (Estación Experimental Fabio Baudrit Moreno and Sub-Estacion Experimental Fraijanes, both of Universidad de Costa Rica in 1996 and 1997. A mixture of four races (races 9, 10, 547, and 1024 of maximum virulence and coverage in Costa Rica of the anthracnose pathogen was used to inoculate four times. Because of high natural incidence of angular leaf spot, inoculation was not necessary. Twenty-one landraces and 13 breeding lines were resistant (disease score of 3 or less to antracnose. Only five landraces (G 12529, G 14934, G 19428, G 19696, and G 19831, one improved cultivar (ICA Tundama, and a breeding line UCR 55 had intermediate reaction (disease score between 4 and 6. Thus, for angular leaf spot evaluation of a much broader range of germplasm of common bean and other related species is suggested

  5. Comportamiento de variedades cubanas y venezolanas de frijol común, cultivados en condiciones de sequía

    Directory of Open Access Journals (Sweden)

    Domínguez-Suárez, Amalia

    2016-09-01

    Full Text Available In the majority of common- bean productive zones, the potential yields are never reached. This is because common bean is cultivated under non favorable climatic conditions. The identification of varieties with good yields, under conditions of drought, is all a challenge. For that purpose, the aim of the present work was to evaluate productive cultivar's indicators of common bean, in conditions of drought, at the "Empresa Socialista Mixta Leguminosas del ALBA" at Urachiche's zone, Yaracuy's state, Venezuela. All used seeds were previously evaluated in conditions of experimental drought, and the more tolerant candidates were detected. An in-bloc at random design with three repetitions was used, and planting was made in three rows of 7 m in length x 0.80 m in width, with a density of 357 seeds per variety, for repetition. The average weight per plot of land, average number of pods per plants, average number of seeds per pod, and the weight of one hundred seeds were determined upon harvest. The statistical analysis was carried out using InfoStat version 2011. Among the Venezuelan evaluated genotypes, Gen 13, Gen 15 and Tacarigua stand out for their yields. Among the Cuban selected cultivars, Bolita 42 and BAT 304 showed the best results.

  6. Management of foliar and soilborne pathogens of cowpea ( Vigna ...

    African Journals Online (AJOL)

    White and pink garlic extracts were tested for their antifungal potentials on mycelial radial growth, spores and sclerotial production of Macrophomina phaseolina (Tassi) Goid, Colletotrichum destructivum O gara and Colletotrichum capsici (Syd) Butler and Bisby pathogens of cowpea in vitro. Water or ethanol extracts of ...

  7. Effects of Enzyme Supplementation of Raw Bambara Nut ( Vigna ...

    African Journals Online (AJOL)

    A 4-week study was conducted to investigate the effects of graded levels of raw Bambara nut waste (RBW) and supplementary enzyme (Roxazyme G) on nutrient utilization and hematological parameters of broiler finishers. Ninety-six 6-week old broiler birds were randomly divided into 8 groups of 12 birds each. The groups ...

  8. Timing of insecticidal application in vigna unguiculata (l.) Walp, cv ...

    African Journals Online (AJOL)

    In the 1990 planting, there was no significant difference in yield of treated and untreated plants (P = 0.05), but all treatments except at 7 DEA significantly reduced pod damage by the legume pod borer, Maruca testulalis Geyr. Though some of the treatments significantly reduced the percentage of seed damage when ...

  9. Inheritanceof seed coat colour pattern in cowpea [ Vigna ...

    African Journals Online (AJOL)

    Hybridization experiments were conducted in the screen house to study the inheritance of seed colour pattern in cowpea. Cowpea varieties of varying seed coat colour were used as parents for the investigation. Parental, F1 and segregating F2 populations were raised in the field and the study revealed that self colour ...

  10. Genetic diversity in green gram [Vigna radiata (L.)] landraces ...

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... nitrogen fixer for maintaining soil fertility. However ... use of radioactive elements makes it more costly and tedious. ... Figure 1. Geographic distribution of sampling localities of wild green gram in Southern Tamil Nadu, India.

  11. Genetic linkage map of cowpea (Vigna unguiculata (L.) Walp) using ...

    African Journals Online (AJOL)

    DR.ADETUNMBI

    2016-05-18

    May 18, 2016 ... Constructed map provides basic information that could assist in genetic improvement of .... mix contains two universal (FRET) fluorescent resonance energy transfer cassettes. (FAM and HEX), ROX™ passive reference dye, Taq polymerase, free nucleotides and MgCl2 in an optimized buffer solution, while ...

  12. Growth and Yield Responses of Vegetable Cowpea ( Vigna ...

    African Journals Online (AJOL)

    The amendment of acidic soil with lime application enhances nutrient availability for optimum vegetable cowpea production. Field experiments were conducted in the teaching and research farm of Michael Okpara University of Agriculture, Umudike during 2006 and 2007 cropping seasons to determine the growth and yield ...

  13. Assessment of Phaseolus vulgaris L and Vigna unguiculata (L ...

    African Journals Online (AJOL)

    SAM

    2014-04-09

    Apr 9, 2014 ... searching natural compounds with biological activity. .... remain permanently open access under the terms of the Creative Commons Attribution License 4.0 ... (TLC) plate silica gel 60 F254 (Merck 2 × 6 cm), each plate was.

  14. Genetic linkage map of cowpea ( Vigna unguiculata (L.) Walp) using ...

    African Journals Online (AJOL)

    Genetic linkage maps provide a genomic framework for quantitative trait loci identification applied in marker assisted selection breeding in crops with limited resources. It serves as a powerful tool to breeders for analysing the mode of inheritance of genes of interest and monitoring of the transmission of target genes from ...

  15. Management of foliar and soilborne pathogens of cowpea (Vigna ...

    African Journals Online (AJOL)

    SAM

    2014-04-23

    Apr 23, 2014 ... spores and sclerotial production of Macrophomina phaseolina (Tassi) Goid, Colletotrichum destructivum O gara .... out using the same method but was concentrated to about 2 ml with ..... Plant clinic handbook IMI. Technical.

  16. Variability studies in some qualitative characters of cowpea ( Vigna ...

    African Journals Online (AJOL)

    Two types of flower colour were observed, purple and white. With the exception of the Upper East Region accessions which showed only white flower colour, accessions from all the other regions showed both white and purple colours with the accessions with purple colour in the majority. In most of the accessions from the ...

  17. Purification and characterization of amine oxidase from Vigna ...

    African Journals Online (AJOL)

    user1

    2012-09-27

    Sep 27, 2012 ... volume of 50 mM potassium phosphate buffer (pH 8.0), dialyzed 3 times against ... and subsequently soaked in distilled water to stop the reaction. A duplicate ... The effects of ethylenediaminetetraacetic acid (EDTA), a metal.

  18. Genetic analysis of seed proteins contents in cowpea ( Vigna ...

    African Journals Online (AJOL)

    In order to select cowpea genotypes with high food value, 10 varieties were genetically screened in Ngaoundéré (Cameroon) for seed crude protein and its soluble fractions contents. Five divergent lines were studied through a 5 x 5 half diallel cross mating. The genotypes presented a significant genetic variability for these ...

  19. Effect of Malting on the Chemical Composition of Cowpea ( Vigna ...

    African Journals Online (AJOL)

    The out-of-steep grains were germinated in the dark for 72 hours and oven dried at 50 °C. The malts were analyzed for diastatic activity and their contents of moisture, protein, sugar, fat, peroxidation products, phytate, tannin and trypsin inhibitor. Results: After malting, the diastatic activity of cowpea increased from 28.87 to ...

  20. Effects of high plant cowpeas ( Vigna unguculata ) and animal ...

    African Journals Online (AJOL)

    Serum bicarbonate values of baseline rats were significantly higher (P<0.01) in rats fed casein diet and cowpeas diets. However, urinary bicarbonate value of the casein fed rat was significantly higher (P<0.01) than that of baseline and cowpeas fed rats. This study has shown that the intake of high casein diet leads to an ...

  1. Water use characteristics of a bambara groundnut ( Vigna ...

    African Journals Online (AJOL)

    Bambara groundnut is slow to establish and this has negative implications for total water use. Consideration of bambara groundnut as a water-efficient crop for dry areas will benefit from an understanding of water use efficiency and water use characteristics during establishment. We investigated whether there is an ...

  2. Breeding in bambara groundnut (Vigna subterranea (L.) Verdc ...

    African Journals Online (AJOL)

    This paper shows how different strategies have been combined to establish the basis of a strategic breeding programme in bambara groundnut. The paper also illustrates the use of landraces in the bambara groundnut breeding programme, as an example of the contribution that landraces can make to increasing ...

  3. Chemical composition of Lablab purpureus and Vigna unguiculata ...

    African Journals Online (AJOL)

    Esnart Mukumbo

    2018-02-06

    Feb 6, 2018 ... condensed tannins, and saponins using standard methods. ..... Analysis of variance was used to determine the effects of legume species and ..... of tannins in the plant kingdom: hydrolysable tannins (HTs) and condensed.

  4. Effect of variety mixtures on cowpea (Vigna unguiculata) vegetable ...

    African Journals Online (AJOL)

    jokonya

    AN EVALUATION OF SIX COWPEA VARIETIES GROWN ... provide cheap sources of protein, micronutrients and mineral elements that can ... traditional vegetables is that, these leafy vegetables are present in most home ..... REFERENCES. 1.

  5. Inheritance of lodging components in mungbean (vigna radiata (l.) wilczek)

    International Nuclear Information System (INIS)

    Khattak, G.S.S.; Rehman, S.

    2011-01-01

    Inheritance of lodging related traits in mungbean i.e., average inter-nodal length and average circumference of the main stem were studied using Triple Test Cross (TTC) technique. Both traits showed highly significant differences among treatments and between first (P1) and second parent (P2) of a cross ML-5 x Ramzan used as third tester in the TTC combination. The traits showed significant total epi stasis. (i, and j + l types). Additive X additive (i type) interactions were non-significant whereas additive X dominance and dominance x dominance (j and l types) interactions were highly significant for both traits. This shows the complex nature of inheritance of lodging components in mungbean. Diverse genetic background of lines is indicated by the significant epi static effect contributed by individual lines for average inter-nodal length and average circumference of the main stem. In case of average inter-nodal length, the genotypes Var. 6601 and Chakwal 97 contributed major portion of negative and positive non-allelic interaction, respectively, to the total epi stasis of average inter-nodal length. Genotypes NFM 13-1 and NM 92 imparted major portion of positive and negative non-allelic interaction, respectively to total epi stasis of average circumference of the main stem. Improvement in mungbean lodging resistance through breeding for short inter-nodal length and thick/more circumference of the main stem, bi-parental hybridization between suitable recombinants in F2 generation is suggested to produce better genetic combinations through which the accumulations of desired genes could be achieved for selection in advanced generation. (author)

  6. Fungal species associated with Vigna unguiculata (L.) Walp (Cowpea)

    African Journals Online (AJOL)

    Aspergillus niger Van Tieghem, Botryodiplodia theobromae (Pat) Novel, Fusarium oxysporum Schlecht and Rhizopus stolonifer Ehrenb ex Link were isolated from both blotter and agar methods. Botryodiplodia theobromae had the highest mean occurrence (42.37%) followed by Fusarium oxysporum (30.02%), Aspergillus ...

  7. Genetic analysis of Myanmar Vigna species in responses to salt ...

    African Journals Online (AJOL)

    user

    2011-02-28

    Feb 28, 2011 ... Salinity stress induced two new bands between 45 and 22 kDa, respectively, in salt .... 107875 National Institute of Agricultural Science (NIAS), Japan (India origin). V7 ..... American Society of Civil Engineers. New York.

  8. Genetic diversity of Bambara groundnut (Vigna subterranea (L ...

    African Journals Online (AJOL)

    FORRESTER

    2015-01-28

    Jan 28, 2015 ... The existence of genetic diversity in germplasm collections is crucial for cultivar development. ... program for Bambara groundnut, a thorough under- ..... na* = Observed number of alleles; ne* = Effective number of alleles ...

  9. Genetic variability in cowpea (Vigna unguiculata (L.) Walp.) genotypes

    African Journals Online (AJOL)

    sive protein in human diets with grains containing about. 23–25% protein ... Keywords: heritability, phenotype, principal component analysis, variance. Introduction .... be due to genotype, environment, and the interaction of genotype and ...

  10. Storing cowpea (Vigna unguiculata) seeds in active cattle kraals for ...

    African Journals Online (AJOL)

    Yomi

    2012-10-09

    Oct 9, 2012 ... propagation of crops through seeds (Hartmann et al.,. 1988). Previously, Bremner and Krogmeier (1989) demonstrated that the adverse effect of urea fertilisers on seed germination in soil was due to ammonia and CO2, which are released during hydrolysis of urea by soil urease. Apparently, in this storage ...

  11. FIXING ABILITY OF COWPEA (Vigna unguiculata (L) Walp)

    African Journals Online (AJOL)

    sys01

    2011-09-03

    Sep 3, 2011 ... mixture and later thinned to two plants per stand at two weeks after planting (2 WAP).,This gave a total population of about 80, 000 plants per ... nitrogen requirement from the atmosphere. Root nodules formed by soil rhizobia ..... solar radiation requirements on growth and nitrogen fixation of soybean,.

  12. Genetic engineering in Cowpea (Vigna unguiculata): history, status and prospects.

    Science.gov (United States)

    Citadin, Cristiane T; Ibrahim, Abdulrazak B; Aragão, Francisco J L

    2011-01-01

    In the last three decades, a number of attempts have been made to develop reproducible protocols for generating transgenic cowpea that permit the expression of genes of agronomic importance. Pioneer works focused on the development of such systems vis-à-vis an in vitro culture system that would guarantee de novo regeneration of transgenic cowpea arising from cells amenable to one form of gene delivery system or another, but any such system has eluded researchers over the years. Despite this apparent failure, significant progress has been made in generating transgenic cowpea, bringing researchers much nearer to their goal than thirty years ago. Now, various researchers have successfully established transgenic procedures for cowpea with evidence of inherent transgenes of interest, effected by progenies in a Mendelian fashion. New opportunities have thus emerged to optimize existing protocols and devise new strategies to ensure the development of transgenic cowpea with desirable agronomic traits. This review chronicles the important milestones in the last thirty years that have marked the evolution of genetic engineering of cowpea. It also highlights the progress made and describes new strategies that have arisen, culminating in the current status of transgenic technologies for cowpea.

  13. Mycological evaluation of the phylloplane of Vigna unguiculata (L ...

    African Journals Online (AJOL)

    PROF HORSFALL

    2018-04-15

    Apr 15, 2018 ... plate technique and eleven fungal isolates were obtained from nine of the cultivars. Pathogenicity ... southern pea, field pea, china pea, crowder pea, lubia, niebe ... nutritious providing protein, vitamins and minerals. Fatokun ...

  14. Performance of five bambara groundnut ( Vigna subterranea (L ...

    African Journals Online (AJOL)

    The need to promote drought tolerant crop cultivars acceptable to consumers cannot be ... it a crop of choice to achieve food security especially in the dry areas of Africa. ... up of water bodies even when irrigation facilities are available, research on crops with ... Sowing dates have been identified to affect the yield of the crop.

  15. Effects of feeding different levels of cowpea (Vigna unguiculata) on ...

    African Journals Online (AJOL)

    glucose by the hexokinase method (Gemeni, ENI Company). Total protein was ... compared by an 8 by 2 chi-square contingency test, using sin- .... small intestinal morphology caused by feeding cowpea diet ... Similar views were documented.

  16. Effect of high plant protein cowpeas ( Vigna unguculata ) and animal ...

    African Journals Online (AJOL)

    Recent trends in weight loss diets have been formulated that led to a substantial increase in protein intake. It has however been established that high protein intake impacts negatively on already compromised kidney, while its effect on a healthy kidney remains unclear. Our aim therefore was to study the effect of animal ...

  17. Stable gene transformation in cowpea (Vigna unguiculata L. walp ...

    African Journals Online (AJOL)

    The size of microcarriers, microflight distance and helium pressure significantly affected transient expression of reporter genes. A total of 1692 explants were bombarded with DNA-coated particles and placed on 3 mg/l bialaphos selective medium. Only 12 regenerated shoots produced seeds eventually, and all were Gus ...

  18. Isolation and screening of fungal isolates from bambara ( Vigna ...

    African Journals Online (AJOL)

    African Journal of Clinical and Experimental Microbiology. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 18, No 3 (2017) >. Log in or Register to get access to full text downloads.

  19. A comparative genetic diversity analysis in mungbean ( Vigna ...

    African Journals Online (AJOL)

    Amplified fragment length polymorphism (AFLP) and inter-simple sequence repeat (ISSR) markers were used to study the DNA polymorphism in elite mungbean genotypes. A total of nine AFLP primer combination and 22 ISSR primers were used. Amplification of genomic DNA of the 30 genotypes, using AFLP analysis, ...

  20. Effect of urdbean leaf crinkle virus infection on total soluble protein and antioxidant enzymes in blackgram plants

    International Nuclear Information System (INIS)

    Ashfaq, M.; Mughal, S.M.; Khan, A.; Javed, N.; Sahi, S.T.; Shahid, M.

    2010-01-01

    Urdbean leaf crinkle virus (ULCV) is a common, wide spread, destructive and economically important disease causing systemic infection in blackgram (Vigna mungo (L.) Hepper), resulting in extreme crinkling, curling, puckering and rugosity of leaves, and yield reductions. Effect of viral infection was investigated on total soluble proteins and antioxidant enzymes activity in two genotypes viz., Mash-88-susceptible and CM-2002-resistant, at different growth stages under both the inoculated and un-inoculated conditions. ULCV infection resulted in significant increase in total soluble protein contents of the leaves in both genotypes. In healthy plant, super oxide dismutase (SOD), catalase (CAT) and peroxidase (PO) showed similar activity levels. In inoculated plants of Mash-88, SOD and PO activities decreased and increased non-significantly at all growth stages, respectively. The activities of PO and SOD increased and decreased significantly after 15 and 30 days of inoculation in resistant genotype, respectively. No significant changes in catalase (CAT) activity were detected in ULCV-infected leaves over the control. It was concluded that the super oxide dismutase and peroxidases might be associated with resistance/susceptibility to ULCV infection. (author)

  1. Agricultural activities of the malayali tribal for subsistence and economic needs in the mid elevation forest of pachamalai hills, eastern ghats, Tamil nadu

    Directory of Open Access Journals (Sweden)

    V. Anburaja

    2012-06-01

    Full Text Available This paper is aimed to study the Agricultural activities of the Malayali Tribal for Subsistence and Economic needs in the mid elevation forest of Pachamalai Hills, Eastern Ghats, Tamil nadu. About 8 percent of the Indian population belongs to a category listed as “Scheduled Tribes” enumerated in the Schedule to Article 342 of the Constitution of India. Tribal people has been seen to be strongly associated with the forests, hills and remote areas, practicing a unique life style, having a unique set of cultural and religious beliefs. For millennia, tribal communities have lived in forests and survived on hunting and gathering. However, with growing population and resource pressure, it is now witnessing that a rise in livelihoods based on settled farming. In the study area, cereals are the major crop cultivated for their edible grains. The tribal people living in the hills tops of the study area were cultivated 11 major agricultural crops. They are, Eleusine coracana, Panicum miliare, Oryza sativa (verity I (Mara Nellu, Oryza sativa (verity II, Manihot esculenta, Macrotyloma uniflorum, Vigna mungo, Sesamum orientale, Paspalum sp, Pennisetum americanum and Setaria italica. Among them, Paspalum sp gives the maximum yield with 655 kg acre-1.

  2. A higher yielding mutant of black gram with improved nodule formation

    International Nuclear Information System (INIS)

    Singh, R.K.; Raghuvanshi, S.S.

    1987-01-01

    Dry seeds of black gram (Vigna mungo (L) Hopper) var. T 9 with 12.2% moisture content were irradiated at 10, 20 and 30 krad of gamma rays. This was followed by combined treatment of one set in each dose with freshly prepared 0. 25% EMS in phosphate buffer at 7.0 pH at 30± deg. C for 6 hours. In M 2 population of 20 krad two mutants with pentafoliate instead of trifoliate leaves were found. This character was true breeding in M 3 M 6 generation. Crosses revealed monogenic recessive inheritance of this character. The proposed gene symbol is p5. This mutant has normal maturity period and the plant height is the same as T 9 (ca. 50 cm). Preliminary yield trials indicate superiority of the mutant line over control. The mutant line also shows a significant improvement in number and weight of root nodules, potentially improving green manuring value. Improvement of root nodulation in mungbean mutants was reported before by others

  3. A higher yielding mutant of black gram with improved nodule formation

    Energy Technology Data Exchange (ETDEWEB)

    Singh, R K; Raghuvanshi, S S [Plant Genetic Unit, Department of Botany, University of Lucknow (India)

    1987-07-01

    Dry seeds of black gram (Vigna mungo (L) Hopper) var. T{sub 9} with 12.2% moisture content were irradiated at 10, 20 and 30 krad of gamma rays. This was followed by combined treatment of one set in each dose with freshly prepared 0. 25% EMS in phosphate buffer at 7.0 pH at 30{+-} deg. C for 6 hours. In M{sub 2} population of 20 krad two mutants with pentafoliate instead of trifoliate leaves were found. This character was true breeding in M{sub 3} M{sub 6} generation. Crosses revealed monogenic recessive inheritance of this character. The proposed gene symbol is p5. This mutant has normal maturity period and the plant height is the same as T{sub 9} (ca. 50 cm). Preliminary yield trials indicate superiority of the mutant line over control. The mutant line also shows a significant improvement in number and weight of root nodules, potentially improving green manuring value. Improvement of root nodulation in mungbean mutants was reported before by others.

  4. Genetic improvement of black gram using induced mutations

    International Nuclear Information System (INIS)

    Pawar, S.E.; Manjaya, J.G.; Souframanien, J.; Bhatkar, S.M.

    2000-01-01

    Induced mutagenesis is an important tool for creating genetic variability in crop plants and has played a significant role in the development of many crop varieties. Genetic improvement of black gram (Vigna mungo L. Hepper) through induced mutations has been in progress at BARC for the past three decades. Mutation studies of genotype EC-168200 have resulted in isolating large number of mutants with distinct morphological characters. TAU-5, an early maturing mutant was identified as a resistant donor for yellow mosaic virus (YMV) disease by the All India Pulse Improvement Project, ICAR, Kanpur. TAU-5 was used in cross breeding with elite cultivars like T-9, TPU-4 and LBG-17. Twelve selections with high yield potential suitable for both kharif and rabi cultivation have been developed. One of the selections TU94-2 has been released for commercial cultivation for southern zone during 1999. The work on the development of YMV resistant genotypes is in progress and will be discussed. (author)

  5. Temperatura óptima y etapa fenológica para determinar la termoestabilidad de la membrana celular en maíz y frijol

    OpenAIRE

    Castro Nava, S

    2013-01-01

    La necesidad de encontrar plantas tolerantes al calor obliga a buscar nuevas estrategias de medición de esta respuesta. La termoestabilidad de la membrana celular mediante la medición de la pérdida de electrolitos por daños ocasionados a la membrana es un criterio fisiológico de selección indirecto. Sin embargo, es necesario realizar adaptaciones al método original dependiendo de la especie. El objetivo del estudio fue probar tres niveles de temperatura en el método de termoestabilidad de la ...

  6. Evaluación de la fijación de nitrógeno por cepas de Rhizobium que nodulan Frijol (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    María Inés Ballesteros

    2010-07-01

    Full Text Available La capacidad de fijar nitrógeno de ocho cepas de Rhizohium fue evaluada incdiante dos ensayos de invernadero, en solución nutritiva, con cinco variedades de fríjol: ICA CITARA, ICA PIJAO, DIACOL CATIO, ANDINO y PVA 916. Se determinó en floración el peso seco de la parle aérea, peso seco de nodulos y nitrógeno total en la planta por el método de microkjeldahi. Las cepas de mejor comportamiento en cuanto a nitrógeno fijado fueron en su orden : CIAT 144, CIAT 899, y CIAT 2; aunque en general la respuesta de las cepas fue diferente con la variedad de Iríjol se logró un porcentaje promedio de nitrógeno fijado del orden del 28% comparado con los controles que recibieron nitrógeno combinado (Ensayo 2. Las cepas CIAT 71 15 y CIAT 632 presentaron la menor efectividad con las variedades ensayadas. Se encontró correlación altamente significativa entre el rendimiento en peso seco y el nitrógeno fijado para todas las variedades de fríjol.

  7. Association analysis of salt tolerance in cowpea (Vigna unguiculata (L.) Walp) at germination and seedling stages

    Science.gov (United States)

    Cowpea is one of the most important cultivated legumes in Africa. The worldwide annual production in cowpea dry seed is 5.4 million metric tons. However, cowpea is unfavorably affected by salinity stress at germination and seedling stages, which is exacerbated by the effects of climate change. The l...

  8. Dual-purpose cowpea ( Vigna unguiculata (L.) Walp.) straw as sole ...

    African Journals Online (AJOL)

    L.) Walp.) (IT89KD-391; IT86D-716; IT86D-719; IT81D-994) using 24 West African dwarf (WAD) rams solefed the straw over a 60-d period. Voluntary dry matter (57 to 88 g kg-1 W0.75 d-1), organic matter (OM) ranged from 50.5 to 78.9 g kg-1 ...

  9. Studies on chemical and physical mutagens' induced polygenic variability in mungbean (Vigna radiata (L.) Wilczek)

    International Nuclear Information System (INIS)

    Sangwan, H.P.S.; Singh, M.P.

    1990-01-01

    Full text: Pulses used to be and still are cultivated on marginal lands under poor management conditions which result in low production. Genotypes which could respond to better management have been eliminated by past selection. It is, therefore, difficult and challenging to breed high yielding varieties in pulse crops with the limited genetic variability available. Induced mutations could supplement this variability. Extensive studies on genotype-mutagen interaction were undertaken with six varieties of mungbean having contrasting seed characteristics, morphological traits and genetic backgrounds. Each variety was treated with 300 Gy and 600 Gy of gamma rays, 0.1 and 0.5% of EMS, and 0.1 and 0.05 of SA. Dry seeds, water soaked and phosphate buffer soaked seeds served as controls. The following observations were made: differential response of varieties to mutagen treatments - irrespective of the variety or the characters; gamma-rays proved to be more effective than chemical mutagens; mutagenic treatments resulted in development of early maturing mutants that can fit well in multiple cropping systems particularly in raising a mung crop after the wheat harvest. The fact that some mutants were detected in M 4 with significant increase in yield and marginal improvement in protein content generation suggests the possibility of improving both characters provided a large population is screened. (author)

  10. Symbiotic functioning and bradyrhizobial biodiversity of cowpea (Vigna unguiculata L. Walp. in Africa

    Directory of Open Access Journals (Sweden)

    Dakora Felix D

    2010-03-01

    Full Text Available Abstract Background Cowpea is the most important food grain legume in Sub-Saharan Africa. However, no study has so far assessed rhizobial biodiversity and/or nodule functioning in relation to strain IGS types at the continent level. In this study, 9 cowpea genotypes were planted in field experiments in Botswana, South Africa and Ghana with the aim of i trapping indigenous cowpea root-nodule bacteria (cowpea "rhizobia" in the 3 countries for isolation, molecular characterisation using PCR-RFLP analysis, and sequencing of the 16S - 23S rDNA IGS gene, ii quantifying N-fixed in the cowpea genotypes using the 15N natural abundance technique, and iii relating the levels of nodule functioning (i.e. N-fixed to the IGS types found inside nodules. Results Field measurements of N2 fixation revealed significant differences in plant growth, δ15N values, %Ndfa and amounts of N-fixed between and among the 9 cowpea genotypes in Ghana and South Africa. Following DNA analysis of 270 nodules from the 9 genotypes, 18 strain IGS types were found. Relating nodule function to the 18 IGS types revealed significant differences in IGS type N2-fixing efficiencies. Sequencing the 16S - 23S rDNA gene also revealed 4 clusters, with cluster 2 forming a distinct group that may be a new Bradyrhizobium species. Taken together, our data indicated greater biodiversity of cowpea bradyrhizobia in South Africa relative to Botswana and Ghana. Conclusions We have shown that cowpea is strongly dependant on N2 fixation for its N nutrition in both South Africa and Ghana. Strain IGS type symbiotic efficiency was assessed for the first time in this study, and a positive correlation was discernible where there was sole nodule occupancy. The differences in IGS type diversity and symbiotic efficiency probably accounts for the genotype × environment interaction that makes it difficult to select superior genotypes for use across Africa. The root-nodule bacteria nodulating cowpea in this study all belonged to the genus Bradyrhizobium. Some strains from Southern Africa were phylogenetically very distinct, suggesting a new Bradyrhizobium species.

  11. Effects of EMS, NMU and gamma-rays in Vigna radiata(L) Wilczek

    International Nuclear Information System (INIS)

    Chaturvedi, S.N.; Singh, V.P.

    1981-01-01

    Irrespective of the varieties involved, EMS for germination, NMU for pollen fertility and gamma-rays for seed fertility and seedling height in M 1 generation and NMU for chlorophyll mutations were proved to be most efficient. A distinct difference in genotypic response was also noticed. Variety Pusa Baisakhi was also found to be more sensitive than variety S-8. (author)

  12. Effets De La Cuisson Ou De L\\'extrusion Du Niebe ( Vigna ...

    African Journals Online (AJOL)

    Quatre rations R0, R1, R2 et R3 contenant respectivement 0% de niébé, 15% de niébé cru, cuit ou extrudé ont été utilisées. Il ressort que la ration R2 a été la plus consommée comparée à toutes les autres. Le gain de poids et l'indice de consommation enregistrés dans le lot R2 n'ont pas été différents (P>0,05) de ceux du ...

  13. Evaluation of yield in Gamma Radiated Lines Selected from Mutated Generations of Mungbean (Vigna radiata)

    International Nuclear Information System (INIS)

    Aye Thandar; Phyu Hnin Htike; Myo Myint

    2010-12-01

    The induced mutation through different gamma radiation frequencies 50, 100, 150, 200, 250, 300, 350, 400, 450 and 500Gy in mungbean was studied for yield components in M3 generation. A Randomized Complete Block Design (RCBD) was employed with three replications in this experiment. The data collected from M3 generation were subjected to statistical analysis with the help of Excel (Microsoft office 2007) and for pairs wise comparison of groups was by SPSS program.In primary yield components, there were no significant difference in M3 generation of pods per plant, pod length and seeds per pod except 100 seeds weight. The plant treated with 250 Gy and 400Gy exploited the maximum value of one hundred seeds weight and yield per plant , respectively. Although there was no significant difference in secondary yield components; 50% flowering days, 50% maturity days and plant height in this generation, highest plant height at 200Gy and early flowering and maturity at 300Gy were obserded. The selection of individual plants in the M3 generation was carried out for high yield. In mutant selection, 250Gy and 400Gy revealed relatively more number of plants having good characters such as more number of pods per plant and longer pod length but not in other treatments and control.

  14. Gas exchange and mass distribution of the cowpea (Vigna unguiculata [L.] Walp. under water deficit

    Directory of Open Access Journals (Sweden)

    Cardona-Ayala Carlos Enrique

    2013-12-01

    Full Text Available Drought tolerance is important for the survival and productivity of plants in environments where drought periods are increasing as a result of climate variability attributable to natural causes and climate change caused by human activities. The objective of this study was to evaluate the dynamics of photosynthesis (A, stomatal conductance (gs and intrinsic water-use efficiency (WUE=A/gs as a function of soil moisture content over a period of drought and the post-stress recovery of 14 cowpea genotypes. The studied genotypes tolerated soil moisture tensions close to -2 Mpa with no permanent wilting. Starting at a soil hydric potential of -0.7 MP a, decreases in photosynthesis (A, stomatal conductance (gs and transpiration (E were evident, as well as an increase in A/gs, which varied by genotype. Estimating with regression models allowed for the discrimination of the degrees of drought tolerance between the cultivars. At 4 days after resuming hydration, no significant differences were found between the means of A, gs, A/gs and E, suggesting drought tolerance in all genotypes. The genotypes: L-047 and L-034 conserved between 4 and 6 leaves, displaying the highest delayed leaf senescence during drought. Furthermore, they presented the highest biomass at 16 days post-stress recovery

  15. Kenaf (Hibiscus cannabinus) and cowpea (Vigna unguiculata) as sugarcane cover crops

    Science.gov (United States)

    A Louisiana sugarcane field is typically replanted every four years due to declining yields, and, although, it is a costly process, it is both necessary and an opportunity to maximize the financial return during the next four year cropping cycle. Fallow planting systems (FPS) during the fallow perio...

  16. Determination of Urease Biochemical Properties of Asparagus Bean (Vigna unguiculata ssp sesquipedalis L.)

    Science.gov (United States)

    Zusfahair; Ningsih, D. R.; Fatoni, A.; Pertiwi, D. S.

    2018-04-01

    Urease is enzyme that plays a role in nitrogen metabolism during plant germination. Plants that produce a lot of urease are grains. This study used asparagus bean as source of urease. The purpose of this research is to learn the effect of germination time on the activity of urease enzyme from asparagus bean and its biochemical properties. The research was started by germination of asparagus bean on day 2, 4, 6, 8, 10 and 12. Asparagus bean sprouts were extracted using acetone and separated by centrifugation to obtain the crude extract of urease. The biochemical properties of the crude extract of urease was further determined including: the effect of temperature, pH, substrate concentration, and metal addition to urease activity. The urease activity is determined by the Nessler method. The germination time of asparagus bean in yielding urease enzyme reached the optimum activity on the 8th day with activity value of 593.7 U/mL. The biochemical properties of urease from asparagus bean have optimum activity at 35 °C, pH 7.0 and substrate concentration 0.125% with activity value of 600 U/mL. Addition of CaCl2, SnCl2 and ZnCl2 metals decrease the activity of urease.

  17. Genetics of productive peduncles on main stem and branches in mungbean (vigna radiata (L.) wilczek)

    International Nuclear Information System (INIS)

    Khattak, G.S.

    2010-01-01

    Components of genetic variation for productive peduncles on main stem and branches in mungbean were estimated using triple test cross procedure. Treatments used for estimation of genetic variation for both traits exhibited highly significant differences which indicate the existence of considerable genetic variation among inbred lines, testers and developed recombinants. Epistatic effect showed significant role in the inheritance of both traits. Productive peduncles on main stem exhibited almost equal values for both i type, and j + l type non-allelic interaction whereas i type interactions value was more compared to j + l type interactions in productive peduncles on branches. This indicated that additive x additive type non-allelic interaction plays an important role in the inheritance of productive peduncles on branches. The complex inheritance of both traits can be exploited for improvement by delay in selection until the material is advanced through bulk procedure. (author)

  18. Overexpression Analysis of emv2 gene coding for Late Embryogenesis Abundant Protein from Vigna radiata (Wilczek

    Directory of Open Access Journals (Sweden)

    Rajesh S.

    2008-10-01

    Full Text Available Late embryogenesis abundant (LEA proteins are speculated to protect against water stress deficit in plants. An over expression system for mungbean late embryogenesis abundant protein, emv2 was constructed in a pET29a vector, designated pET-emv2 which is responsible for higher expression under the transcriptional/translational control of T7/lac promoter incorporated in the Escherichia coli BL21 (DE3.Induction protocol was optimized for pET recombinants harboring the target gene. Overexpressed EMV2 protein was purified to homogeneity and the protein profile monitored by SDS-PAGE.

  19. Antioxidant activities of bambara groundnut (Vigna subterranea) protein hydrolysates and their membrane ultrafiltration fractions.

    Science.gov (United States)

    Arise, Abimbola K; Alashi, Adeola M; Nwachukwu, Ifeanyi D; Ijabadeniyi, Oluwatosin A; Aluko, Rotimi E; Amonsou, Eric O

    2016-05-18

    In this study, the bambara protein isolate (BPI) was digested with three proteases (alcalase, trypsin and pepsin), to produce bambara protein hydrolysates (BPHs). These hydrolysates were passed through ultrafiltration membranes to obtain peptide fractions of different sizes (fractions were investigated for antioxidant activities. The membrane fractions showed that peptides with sizes 3 kDa. This is in agreement with the result obtained for the ferric reducing power, metal chelating and hydroxyl radical scavenging activities where higher molecular weight peptides exhibited better activity (p fractions. However, for all the hydrolysates, the low molecular weight peptides were more effective diphenyl-1-picrylhydrazyl (DPPH) radical scavengers but not superoxide radicals when compared to the bigger peptides. In comparison with glutathione (GSH), BPHs and their membrane fractions had better (p fractions that did not show any metal chelating activity. However, the 5-10 kDa pepsin hydrolysate peptide fractions had greater (88%) hydroxyl scavenging activity than GSH, alcalase and trypsin hydrolysates (82%). These findings show the potential use of BPHs and their peptide fraction as antioxidants in reducing food spoilage or management of oxidative stress-related metabolic disorders.

  20. Analysis of pre- and post-harvest practices of cowpea ( Vigna ...

    African Journals Online (AJOL)

    International Journal of Biological and Chemical Sciences ... Practices such as farming and storage conditions may influence the production ... Cowpea infestation by insects on farm and in storage was a major problem mentioned by farmers.

  1. Complete sterility studies in three mutants of cowpea (Vigna Unguiculata (L.) walp

    International Nuclear Information System (INIS)

    Adu-Dapaah, H. K.; Singh, B. B.; Fatokun, C. A.

    1999-01-01

    Three completely-sterile cowpea mutants IT85D-3625, IT85D-3628, IT85D-3641 obtained from spontaneous mutation and gamma irradiation were-characterized. Reciprocal crosses between them and fertile plants failed to set pods. These lines showed significant differences with respect to various traits such as number of pollen grain per anther, anther length and width, plant height, anther indehiscence,unopened flower buds, and premature abortion of pods and seeds. The major cause of sterility was chromosome aberrations. Complete sterility in each of the three lines was conditioned by a simple recessive gene pair. Sterility in each of the three mutants was associated with floral aberrations. The symbols cs 1 , cs 2 and cs 3 are being assigned to IT85D-3625, IT85D-2628 and IT85D-3641 respectively. The three mutants were homogeneous with reference to sterility inheritance. (au)

  2. Studies on mutagenic effect on genetic variability in green gram (Vigna radiata (L. ) Wilczek)

    Energy Technology Data Exchange (ETDEWEB)

    Krishnaswami, S; Rathinam, M [Tamil Nadu Agricultural Univ. Coimbatore (India). Dept. of Agricultural Botany

    1982-03-01

    With a view to finding out the effect of mutagenic treatments on heritability in green gram, two cultivars, showing extremes of sensitivity to mutagen, were subjected to two levels each of gamma irradiation and EMS separately and conjointly and the M/sub 2/ generation raised. Families of the higher dose in each treatment were advanced to the M/sub 3/ and the genetic parameters of the various growth and yield attributes, besides seed yield, studied. Barring plant height, heritability of all other traits registered an increase under the mutagen effect. No consistency was evident in the superiority of one mutagen over the other, their behaviour varying with the cultivar and the character studied. Consequent to enhancement in heritability, correlations between the characters underwent alterations under the mutagens.

  3. Proanthocyanidin profile of cowpea (Vigna unguiculata) reveals catechin-O-glucoside as the dominant compound.

    Science.gov (United States)

    Ojwang, Leonnard O; Yang, Liyi; Dykes, Linda; Awika, Joseph

    2013-08-15

    Proanthocyanidin (PA) profile and content can have important nutritional and health implications on plant foods. Six diverse cowpea phenotypes (black, red, green, white, light-brown and golden-brown) were investigated for PA composition using normal-phase HPLC and reversed-phase UPLC-TQD-MS. Catechin and (epi)afzelechin were the major flavan-3-ol units. Unusual composition was observed in all cowpea phenotypes with significant degrees of glycosylation in the monomers and dimers. The PA content of cowpea (dry basis) ranged between 2.2 and 6.3 mg/g. Monomeric flavan-3-ols were the largest group of PA (36-69%) in cowpea, with catechin-7-O-glucoside accounting for most (about 88%) of the monomers. The oligomers with degree of polymerization (DP) 2-4 ranged from 0.41 to 1.3 mg/g (15-20%), whereas DP>10 polymers accounted for only 13.5% of PA. Future studies that highlight the impact of the unusual cowpea PA profile on nutritional and bioactive properties of this important legume are warranted. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Determination of some mineral components of cowpea (Vigna unguiculata (L.) Walp) using instrumental neutron activation analysis

    International Nuclear Information System (INIS)

    Asante, I.K; Acheampong, A.O.; Adu-Dapaah, H.

    2007-01-01

    Some mineral elements in the seeds of the cowpea were determined using instrumental neutron activation analysis. The cowpea cultivars were made up of improved varieties (Soronko, Gbeho, Ayiyi, Asontem, Asontem1, Bengpla, Asetenapa and Adom), farmers' accessions (87/7, 87/1, 87/27, 87/147, 87/34, 87/49, 87/83, 87/157, 87/149, 87/30, 87/153, 96/046, 87/137, 96/129, BTB 96/091, OAA 96/30, BTB 96/054), and experimental materials (IT870-677-2, Caroni, Kaase Market, 1977 and 1239). A total of 14 elements (Al, Ca, Mg, V, Mn, Br, Cl, K, Na, Zn, Cu, Ta, Si and In) were detected in the seeds of the 30 cowpea cultivars. Five of the elements (Na, K, Mg, Ca and Cl) identified are classified as major elements in the human body, while four (Mn, Zn, V, Si) are trace elements. The major elements K, Na, Ca, Mg and Cl were detected in high concentration in cultivars 96/129, 87/137, Ayiyi, 87/34 and 87/49, respectively. The trace elements Mn, Zn, V, Si, Cu and Al were detected in high concentration in cultivars 87/34, 87/27, 87/34, Bengpla, 87/34 and 87/34, respectively. From the results the following accessions could be selected and incorporated into a cowpea mineral nutritional improvement programme: 96/129, 87/137, Ayiyi, 87/34, 87/49 and 87/27. The presence of the five major elements and the trace elements indicates that cowpea has a rich source of mineral elements and, therefore, can be used to improve the diet of both humans and livestock. (au)

  5. Genetic differentiation and diversity upon genotype and phenotype in cowpea (Vigna unguiculata L. Walp.)

    Science.gov (United States)

    The evolution of species is complex and subtle, which always associates with the genetic variation and environment adaption during active/ passive spread or migration. In crops, this process is usually driven and influenced by human activities such as domestication, cultivation and immigration. One ...

  6. Additive interactions of unrelated viruses in mixed infections of cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Nsa, Imade Y; Kareem, Kehinde T

    2015-01-01

    This study was carried out to determine the effects of single infections and co-infections of three unrelated viruses on three cowpea cultivars (one commercial cowpea cultivar "White" and 2 IITA lines; IT81D-985 and TVu 76). The plants were inoculated with Cowpea aphid-borne mosaic virus (CABMV), genus Potyvirus, Cowpea mottle virus (CMeV), genus Carmovirus and Southern bean mosaic virus (SBMV), genus Sobemovirus singly and in mixture (double and triple) at 10, 20, and 30 days after planting (DAP). The treated plants were assessed for susceptibility to the viruses, growth, and yield. In all cases of infection, early inoculation resulted in higher disease severity compared with late infection. The virus treated cowpea plants were relatively shorter than buffer inoculated control plants except the IT81D-985 plants that were taller and produced more foliage. Single infections by CABMV, CMeV, and SBMV led to a complete loss of seeds in the three cowpea cultivars at 10 DAP; only cultivar White produced some seeds at 30 DAP. Double and triple virus infections led to a total loss of seeds in all three cowpea cultivars. None of the virus infected IITA lines produced any seeds except IT81D-985 plants co-infected with CABMV and SBMV at 30 DAP with a reduction of 80%. Overall, the commercial cultivar "White" was the least susceptible to the virus treatments and produced the most yield (flowers, pods, and seeds). CABMV was the most aggressive of these viruses and early single inoculations with this virus resulted in the premature death of some of the seedlings. The presence of the Potyvirus, CABMV in the double virus infections did not appear to increase disease severity or yield loss. There was no strong evidence for synergistic interactions between the viruses in the double virus mixtures.

  7. Screening selected genotypes of cowpea [Vigna unguiculata (L.) Walp.] for salt tolerance during seedling growth stage.

    Science.gov (United States)

    Gogile, A; Andargie, M; Muthuswamy, M

    2013-07-15

    The environmental stress such as, salinity (soil or water) are serious obstacles for field crops especially in the arid and semi-arid parts of the world. This study was conducted to assess the potential for salt tolerance of cowpea genotypes during the seedling stage. The experimental treatments were 9 cowpea genotypes and 4 NaCl concentrations (0, 50, 100 and 200 mM) and they were tested in greenhouse. The experimental design was completely randomized design in factorial combination with three replications. Data analysis was carried out using SAS (version 9.1) statistical software. Seedling shoots and root traits, seedling shoots and root weight, number of leaves and total biological yield were evaluated. The analyzed data revealed highly significant (p cowpea genotypes, treatments and their interactions. It is found that salt stress significantly decreased root length, shoot length, seedling shoot and root weight of cowpea genotypes. The extent of decrease varied with genotypes and salt concentrations. Most genotypes were highly susceptible to 200 mM NaCl concentration. The correlation analysis revealed positive and significant association among most of the parameters. Genotypes 210856, 211557 and Asebot were better salt tolerant. The study revealed the presence of broad intra specific genetic variation in cowpea varieties for salt stress with respect to their early biomass production.

  8. Genetic Diversity and Population Structure of Cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Xiong, Haizheng; Shi, Ainong; Mou, Beiquan; Qin, Jun; Motes, Dennis; Lu, Weiguo; Ma, Jianbing; Weng, Yuejin; Yang, Wei; Wu, Dianxing

    2016-01-01

    The genetic diversity of cowpea was analyzed, and the population structure was estimated in a diverse set of 768 cultivated cowpea genotypes from the USDA GRIN cowpea collection, originally collected from 56 countries. Genotyping by sequencing was used to discover single nucleotide polymorphism (SNP) in cowpea and the identified SNP alleles were used to estimate the level of genetic diversity, population structure, and phylogenetic relationships. The aim of this study was to detect the gene pool structure of cowpea and to determine its relationship between different regions and countries. Based on the model-based ancestry analysis, the phylogenetic tree, and the principal component analysis, three well-differentiated genetic populations were postulated from 768 worldwide cowpea genotypes. According to the phylogenetic analyses between each individual, region, and country, we may trace the accession from off-original, back to the two candidate original areas (West and East of Africa) to predict the migration and domestication history during the cowpea dispersal and development. To our knowledge, this is the first report of the analysis of the genetic variation and relationship between globally cultivated cowpea genotypes. The results will help curators, researchers, and breeders to understand, utilize, conserve, and manage the collection for more efficient contribution to international cowpea research.

  9. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Dhanasekar, P; Reddy, K S

    2015-02-01

    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  10. Diversity in 113 cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers.

    Science.gov (United States)

    Egbadzor, Kenneth F; Ofori, Kwadwo; Yeboah, Martin; Aboagye, Lawrence M; Opoku-Agyeman, Michael O; Danquah, Eric Y; Offei, Samuel K

    2014-01-01

    Single Nucleotide Polymorphism (SNP) markers were used in characterization of 113 cowpea accessions comprising of 108 from Ghana and 5 from abroad. Leaf tissues from plants cultivated at the University of Ghana were genotyped at KBioscience in the United Kingdom. Data was generated for 477 SNPs, out of which 458 revealed polymorphism. The results were used to analyze genetic dissimilarity among the accessions using Darwin 5 software. The markers discriminated among all of the cowpea accessions and the dissimilarity values which ranged from 0.006 to 0.63 were used for factorial plot. Unexpected high levels of heterozygosity were observed on some of the accessions. Accessions known to be closely related clustered together in a dendrogram drawn with WPGMA method. A maximum length sub-tree which comprised of 48 core accessions was constructed. The software package structure was used to separate accessions into three groups, and the programme correctly identified varieties that were known hybrids. The hybrids were those accessions with numerous heterozygous loci. The structure plot showed closely related accessions with similar genome patterns. The SNP markers were more efficient in discriminating among the cowpea germplasm than morphological, seed protein polymorphism and simple sequence repeat studies reported earlier on the same collection.

  11. Association mapping of aphid resistance in USDA cowpea (Vigna unguiculata L. Walp.) core collection using SNPs

    Science.gov (United States)

    Cowpea aphid (CPA; Aphis craccivora) is a destructive insect pest of cowpea, as well as other legume crops including alfalfa, beans, chickpea, lentils, lupins and peanuts. The utilization of aphid resistance in cowpea breeding is one of the most efficient and environmental friendly methods to contro...

  12. New molecular features of cowpea bean (Vigna unguiculata, l. Walp) β-vignin.

    Science.gov (United States)

    de Souza Ferreira, Ederlan; Capraro, Jessica; Sessa, Fabio; Magni, Chiara; Demonte, Aureluce; Consonni, Alessandro; Augusto Neves, Valdir; Maffud Cilli, Eduardo; Duranti, Marcello; Scarafoni, Alessio

    2018-02-01

    Cowpea seed β-vignin, a vicilin-like globulin, proved to exert various health favourable effects, including blood cholesterol reduction in animal models. The need of a simple scalable enrichment procedure for further studies for tailored applications of this seed protein is crucial. A chromatography-independent fractionation method allowing to obtain a protein preparation with a high degree of homogeneity was used. Further purification was pursued to deep the molecular characterisation of β-vignin. The results showed: (i) differing glycosylation patterns of the two constituent polypeptides, in agreement with amino acid sequence features; (ii) the seed accumulation of a gene product never identified before; (iii) metal binding capacity of native protein, a property observed only in few other legume seed vicilins.

  13. Phenological development in bambara groundnut (Vigna subterranea) transferred from 14 to 11 h photoperiods.

    NARCIS (Netherlands)

    Linnemann, A.R.

    1996-01-01

    The developmental phase in which photoperiod sensitivity for podding occurs was determined for two bambara groundnut genotypes grown in 1987 and 1990 in glasshouse experiments in the Netherlands, namely genotypes ‘Tiga Nicuru’ from Mali (day-neutral for flowering and photoperiod-sensitive for

  14. Penambahan kelapa (Cocos nucifera dan kacang tolo (Vigna unguiculata terhadap nilai indeks glikemik singkong (Manihot utilissima

    Directory of Open Access Journals (Sweden)

    Rini Astuti

    2013-07-01

    Full Text Available Backgound: The glycemic index (GI is a notion that defences the glycaemic potency of foods. Foods with low GI will be digested and turned into glucose gradually and slowly. As a result blood glucose peak will not be so high and its fluctuation relatively in short time. Although cassava is a good source of carbohydrate, it has a high GI and low protein. Its GI factor needs to be reduced by any efforts to make it a healthy alternative food in spite of rice. Objective: To analize the effect of adding coconut and black-eyed pea to the GI factor of cassava. Method: The study used experimental observation design. There were three groups of treatment with 9 persons in each goup. After fasting for 10 hours, blood glucose were tested and 50 g of true glucose were given. Blood glucose of the subjects were tested again after 30, 60, 90 and 120 minutes giving true glucose. Next on the seventh day, they were given boiled cassava, cassava with coconut (sawut and cassava with black-eyed pea (gintul. After which their blood glucose were also tested. Results: GI factor of steam cassava, shredded cassava and shredded cassava with black-eyed pea (gintul was 100,40; 70,90; and 61,88; respectively. There was a significant difference of GI level between three products (p=0,031. Conclusion: Food processing by adding coconut and black-eyed pea has effect in reducing the GI level of cassava.

  15. Modelling climate change impact: A case of bambara groundnut (Vigna subterranea)

    Science.gov (United States)

    Mabhaudhi, Tafadzwanashe; Chibarabada, Tendai Polite; Chimonyo, Vimbayi Grace Petrova; Modi, Albert Thembinkosi

    2018-06-01

    Climate change projections for southern Africa indicate low and erratic rainfall as well as increasing frequency and intensity of rainfall extremes such as drought. The 2015/16 drought devastated large parts of southern Africa and highlighted the need for drought tolerant crops. Bambara groundnut is an African indigenous crop, commonly cultivated in southern Africa, with a higher potential for drought tolerance compared to other staple legumes. AquaCrop model was used to evaluate the impacts of climate change on yield, water use (ET) and water productivity (WP) of bambara groundnut using climate change data representative of the past (1961-1991), present (1995-2025), mid-century (2030-2060) and late century (2065-2095) obtained from five global circulation models (GCMs). The carbon dioxide (CO2) file selected was for the A2 scenario. The model was run at a sub-catchment level. Model simulations showed that yield and WP of bambara groundnut will increase over time. The mean values of yield at the different time scales across the GCMs showed that yield of bambara groundnut increased by ∼9% from the past to the present, will increase by ∼15% from the present to mid-century and will increase by 6% from mid-to late-century. The simulated results of ET showed seasonal ranges of 703-796 mm. Of this, 45% was lost to soil evaporation, suggesting the need for developing bambara groundnut varieties with faster establishment and high canopy cover. Model simulations showed an increase in WP by ∼13% from the past to present and ∼15% from the present to mid-century and ∼11% from mid-century to late century. While the results of these simulations are preliminary, they confirm the view that bambara groundnut is a potential future crop suitable for cultivation in marginal agricultural production areas. Future research should focus on crop improvement to improve current yield of bambara groundnut.

  16. Enhancing the digestibility of cowpea (Vigna unguiculata) by traditional processing and fermentation

    NARCIS (Netherlands)

    Madode, Y.E.; Nout, M.J.R.; Bakker, E.J.; Linnemann, A.R.; Hounhouigan, D.J.; Boekel, van M.A.J.S.

    2013-01-01

    Flatulence is an important drawback for the consumption of legumes. Therefore, the ability of traditional processing (dehulling, boiling, soaking) and fermentation (bacterial, fungal or yeast) of cowpeas to reduce flatulence was investigated. Raw and processed cowpeas were assessed for their

  17. Development of iron and zinc enriched mungbean (Vigna radiata L.) cultivars with agronomic traits in consideration

    NARCIS (Netherlands)

    Singh, R.

    2013-01-01

    Malnutrition in India, particularly among women, children and adolescents is an emergency that needs immediate attention in this fast growing and developing country. Micronutrient deficiencies are threatening public health in India more and more. Deficiencies of micronutrients drastically affect

  18. The genotoxic effect of lead and zinc on bambara groundnut (Vigna ...

    African Journals Online (AJOL)

    Oladele Sunday

    pollution can lead to some irreversible cytogenetic effects in plants and higher organisms. ... disease caused by consumption of mercury. .... Chromosome aberrations in bambara groundnut root tips cells treated with different concentrations of ...

  19. Evaluation of the Genetic Variation of Cowpea Landraces (Vigna unguiculata from Western Cameroon Using Qualitative Traits

    Directory of Open Access Journals (Sweden)

    Toscani NGOMPE-DEFFO

    2017-12-01

    Full Text Available Characterization of the genetic diversity and analysis of the genetic relationship between accessions of a crop species is a key step in breeding superior cultivars. The main objective of the hereby study was to determine the genetic variation between 30 cowpea accessions collected throughout the eight divisions of the Western Region of Cameroon using qualitative traits. Phenotypic variation of these accessions was evaluated using diversity indices and cluster analyses. A total of twenty qualitative traits were used for the study. Fifteen of them (75% were polymorphic, displaying each at least two phenotypic classes. The monomorphic characters were growth pattern, leaf color, leaf hairiness, plant hairiness and pod hairiness, each with only one phenotypic class. Results showed a relatively significant level of genetic diversity among the studied cowpea accessions. Overall, the average of the observed and effective number of phenotypic classes per qualitative trait were Na = 2.350 and Ne = 1.828 respectively. The Nei’s genetic diversity and the Shannon weaver diversity index were He = 0.369, ranging from zero (monomorphic trait to 0.655 (growth habit and H’ = 0.609, ranging from zero (monomorphic trait to 0.996 (seed crowding, respectively. The dendrogram constructed from the twenty qualitative traits revealed 05 accessions clusters with the number of accessions in each cluster varying from one to eleven. Information obtained from this study is likely be useful for future cowpea breeding program.

  20. Association studies and legume synteny reveal haplotypes determining seed size in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Mitchell R Lucas

    2013-04-01

    Full Text Available Highly specific seed market classes for cowpea and other grain legumes exists because grain is most commonly cooked and consumed whole. Size, shape, color, and texture are critical features of these market classes and breeders target development of cultivars for market acceptance. Resistance to biotic and abiotic stresses that are absent from elite breeding material are often introgressed through crosses to landraces or wild relatives. When crosses are made between parents with different grain quality characteristics, recovery of progeny with acceptable or enhanced grain quality is problematic. Thus genetic markers for grain quality traits can help in pyramiding genes needed for specific market classes. Allelic variation dictating the inheritance of seed size can be tagged and used to assist the selection of large-seeded lines. In this work we applied SNP genotyping and knowledge of legume synteny to characterize regions of the cowpea genome associated with seed size. These marker-trait associations will enable breeders to use marker based selection approaches to increase the frequency of progeny with large seed. For ~800 samples derived from eight bi-parental populations, QTL analysis was used to identify markers linked to ten trait determinants. In addition, the population structure of 171 samples from the USDA core collection was identified and incorporated into a genome-wide association study which supported more than half of the trait-associated regions important in the bi-parental populations. Seven of the total ten QTL were supported based on synteny to seed size associated regions identified in the related legume soybean. In addition to delivering markers linked to major trait determinants in the context of modern breeding, we provide an analysis of the diversity of the USDA core collection of cowpea to identify genepools, migrants, admixture, and duplicates.