WorldWideScience

Sample records for frameshift mutation 3905inst

  1. DNA evolved to minimize frameshift mutations

    OpenAIRE

    Agoni, Valentina

    2013-01-01

    Point mutations can surely be dangerous but what is worst than to lose the reading frame?! Does DNA evolved a strategy to try to limit frameshift mutations?! Here we investigate if DNA sequences effectively evolved a system to minimize frameshift mutations analyzing the transcripts of proteins with high molecular weights.

  2. Mutational patterns in the frameshift-regulating site of HIV-1 selected by protease inhibitors.

    Science.gov (United States)

    Knops, Elena; Brakier-Gingras, Léa; Schülter, Eugen; Pfister, Herbert; Kaiser, Rolf; Verheyen, Jens

    2012-05-01

    Sustained suppression of viral replication in HIV-1 infected patients is especially hampered by the emergence of HIV-1 drug resistance. The mechanisms of drug resistance mainly involve mutations directly altering the interaction of viral enzymes and inhibitors. However, protease inhibitors do not only select for mutations in the protease but also for mutations in the precursor Gag and Pol proteins. In this study, we analysed the frameshift-regulating site of HIV-1 subtype B isolates, which also encodes for Gag and Pol proteins, classified as either treatment-naïve (TN) or protease inhibitor resistant (PI-R). HIV-1 Gag cleavage site mutations (G435E, K436N, I437V, L449F/V) especially correlated with protease inhibitor resistance mutations, but also Pol cleavage site mutations (D05G, D05S) could be assigned to specific protease resistance profiles. Additionally, two Gag non-cleavage site mutations (S440F, H441P) were observed more often in HIV-1 isolates carrying protease resistance mutations. However, in dual luciferase assays, the frameshift efficiencies of specific clones did not reveal any effect from these mutations. Nevertheless, two patterns of mutations modestly increased the frameshift rates in vitro, but were not specifically accumulating in PI-resistant HIV-1 isolates. In summary, HIV-1 Gag cleavage site mutations were dominantly selected in PI-resistant HIV-1 isolates but also Pol cleavage site mutations influenced resistance profiles in the protease. Additionally, Gag non-cleavage site mutations accumulated in PI-resistant HIV-1 isolates, but were not related to an increased frameshift efficiency.

  3. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 92; Issue 1. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic fibrosis patient. Sondess Hadj Fredj Monia Boudaya Sabrine Oueslati Safa Sahnoun Chaima Sahli Hajer Siala Khedija Boussetta Amina Bibi Taieb Messaoud. Research Note Volume 92 Issue 1 April ...

  4. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 92; Issue 1. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic fibrosis patient. Sondess Hadj Fredj Monia Boudaya Sabrine Oueslati Safa Sahnoun Chaima Sahli Hajer Siala Khedija Boussetta Amina Bibi Taieb Messaoud. Research Note Volume 92 Issue 1 April ...

  5. Heterozygous CAV1 frameshift mutations (MIM 601047 in patients with atypical partial lipodystrophy and hypertriglyceridemia

    Directory of Open Access Journals (Sweden)

    Alston Lindsay

    2008-01-01

    Full Text Available Abstract Background Mice with a deleted Cav1 gene encoding caveolin-1 develop adipocyte abnormalities and insulin resistance. From genomic DNA of patients with atypical lipodystrophy and hypertriglyceridemia who had no mutations in any known lipodystrophy gene, we used DNA sequence analysis to screen the coding regions of human CAV1 (MIM 601047. Results We found a heterozygous frameshift mutation in CAV1, designated I134fsdelA-X137, in a female patient who had atypical partial lipodystrophy, with subcutaneous fat loss affecting the upper part of her body and face, but sparing her legs, gluteal region and visceral fat stores. She had severe type 5 hyperlipoproteinemia, with recurrent pancreatitis. In addition, she had some atypical features, including congenital cataracts and neurological findings. Her father was also heterozygous for this mutation, and had a similar pattern of fat redistribution, hypertriglyceridemia and congenital cataracts, with milder neurological involvement. An unrelated patient had a different heterozygous frameshift mutation in the CAV1 gene, designated -88delC. He also had a partial lipodystrophy phenotype, with subcutaneous fat loss affecting the arms, legs and gluteal region, but sparing his face, neck and visceral fat stores. He also had severe type 5 hyperlipoproteinemia, with recurrent pancreatitis; however he had no clinically apparent neurological manifestations. The mutations were absent from the genomes of 1063 healthy individuals. Conclusion Thus, very rare CAV1 frameshift mutations appear to be associated with atypical lipodystrophy and hypertriglyceridemia.

  6. Frameshift mutation hotspot identified in Smith-Magenis syndrome: case report and review of literature

    Directory of Open Access Journals (Sweden)

    Dudding Tracy

    2010-10-01

    Full Text Available Abstract Smith-Magenis syndrome (SMS is a complex syndrome involving intellectual disabilities, sleep disturbance, behavioural problems, and a variety of craniofacial, skeletal, and visceral anomalies. While the majority of SMS cases harbor an ~3.5 Mb common deletion on 17p11.2 that encompasses the retinoic acid induced-1 (RAI1 gene, some patients carry small intragenic deletions or point mutations in RAI1. We present data on two cases of Smith-Magenis syndrome with mutation of RAI1. Both cases are phenotypically consistent with SMS and RAI1 mutation but also have other anomalies not previously reported in SMS, including spontaneous pneumothoraces. These cases also illustrate variability in the SMS phenotype not previously shown for RAI1 mutation cases, including hearing loss, absence of self-abusive behaviours, and mild global delays. Sequencing of RAI1 revealed mutation of the same heptameric C-tract (CCCCCCC in exon 3 in both cases (c.3103delC one case and and c.3103insC in the other, resulting in frameshift mutations. Of the seven reported frameshift mutations occurring in poly C-tracts in RAI1, four cases (~57% occur at this heptameric C-tract. Collectively, these results indicate that this heptameric C-tract is a preferential hotspot for single nucleotide insertion/deletions (SNindels and therefore, should be considered a primary target for analysis in patients suspected for mutations in RAI1. We expect that as more patients are sequenced for mutations in RAI1, the incidence of frameshift mutations in this hotspot will become more evident.

  7. Frameshift mutation hotspot identified in Smith-Magenis syndrome: case report and review of literature.

    Science.gov (United States)

    Truong, Hoa T; Dudding, Tracy; Blanchard, Christopher L; Elsea, Sarah H

    2010-10-08

    Smith-Magenis syndrome (SMS) is a complex syndrome involving intellectual disabilities, sleep disturbance, behavioural problems, and a variety of craniofacial, skeletal, and visceral anomalies. While the majority of SMS cases harbor an ~3.5 Mb common deletion on 17p11.2 that encompasses the retinoic acid induced-1 (RAI1) gene, some patients carry small intragenic deletions or point mutations in RAI1. We present data on two cases of Smith-Magenis syndrome with mutation of RAI1. Both cases are phenotypically consistent with SMS and RAI1 mutation but also have other anomalies not previously reported in SMS, including spontaneous pneumothoraces. These cases also illustrate variability in the SMS phenotype not previously shown for RAI1 mutation cases, including hearing loss, absence of self-abusive behaviours, and mild global delays. Sequencing of RAI1 revealed mutation of the same heptameric C-tract (CCCCCCC) in exon 3 in both cases (c.3103delC one case and and c.3103insC in the other), resulting in frameshift mutations. Of the seven reported frameshift mutations occurring in poly C-tracts in RAI1, four cases (~57%) occur at this heptameric C-tract. Collectively, these results indicate that this heptameric C-tract is a preferential hotspot for single nucleotide insertion/deletions (SNindels) and therefore, should be considered a primary target for analysis in patients suspected for mutations in RAI1. We expect that as more patients are sequenced for mutations in RAI1, the incidence of frameshift mutations in this hotspot will become more evident.

  8. A frame-shift mutation of PMS2 is a widespread cause of Lynch syndrome

    DEFF Research Database (Denmark)

    Clendenning, Mark; Senter, Leigha; Hampel, Heather

    2008-01-01

    BACKGROUND: When compared to the other mismatch repair genes involved in Lynch syndrome, the identification of mutations within PMS2 has been limited (syndrome cases...... are caused by PMS2. This disparity is primarily due to complications in the study of this gene caused by interference from pseudogene sequences. METHODS: Using a recently developed method for detecting PMS2 specific mutations, we have screened 99 patients who are likely candidates for PMS2 mutations based...... on immunohistochemical analysis. RESULTS: We have identified a frequently occurring frame-shift mutation (c.736_741del6ins11) in 12 ostensibly unrelated Lynch syndrome patients (20% of patients we have identified with a deleterious mutation in PMS2, n=61). These individuals all display the rare allele (population...

  9. Frequent alteration of MLL3 frameshift mutations in microsatellite deficient colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Watanabe

    Full Text Available MLL3 is a histone 3-lysine 4 methyltransferase with tumor-suppressor properties that belongs to a family of chromatin regulator genes potentially altered in neoplasia. Mutations in MLL3 were found in a whole genome analysis of colorectal cancer but have not been confirmed by a separate study.We analyzed mutations of coding region and promoter methylation in MLL3 using 126 cases of colorectal cancer. We found two isoforms of MLL3 and DNA sequencing revealed frameshift and other mutations affecting both isoforms of MLL3 in colorectal cancer cells and 19 of 134 (14% primary colorectal samples analyzed. Moreover, frameshift mutations were more common in cases with microsatellite instability (31% both in CRC cell lines and primary tumors. The largest isoform of MLL3 is transcribed from a CpG island-associated promoter that has highly homology with a pseudo-gene on chromosome 22 (psiTPTE22. Using an assay which measured both loci simultaneously we found prominent age related methylation in normal colon (from 21% in individuals less than 25 years old to 56% in individuals older than 70, R = 0.88, p<0.001 and frequent hypermethylation (83% in both CRC cell lines and primary tumors. We next studied the two loci separately and found that age and cancer related methylation was solely a property of the pseudogene CpG island and that the MLL3 loci was unmethylated.We found that frameshift mutations of MLL3 in both CRC cells and primary tumor that were more common in cases with microsatellite instability. Moreover, we have shown CpG island-associated promoter of MLL3 gene has no DNA methylation in CRC cells but also primary tumor and normal colon, and this region has a highly homologous of pseudo gene (psiTPTE22 that was age relate DNA methylation.

  10. A rapid and effective method for screening, sequencing and reporter verification of engineered frameshift mutations in zebrafish

    Directory of Open Access Journals (Sweden)

    Sergey V. Prykhozhij

    2017-06-01

    Full Text Available Clustered regularly interspaced palindromic repeats (CRISPR/Cas-based adaptive immunity against pathogens in bacteria has been adapted for genome editing and applied in zebrafish (Danio rerio to generate frameshift mutations in protein-coding genes. Although there are methods to detect, quantify and sequence CRISPR/Cas9-induced mutations, identifying mutations in F1 heterozygous fish remains challenging. Additionally, sequencing a mutation and assuming that it causes a frameshift does not prove causality because of possible alternative translation start sites and potential effects of mutations on splicing. This problem is compounded by the relatively few antibodies available for zebrafish proteins, limiting validation at the protein level. To address these issues, we developed a detailed protocol to screen F1 mutation carriers, and clone and sequence identified mutations. In order to verify that mutations actually cause frameshifts, we created a fluorescent reporter system that can detect frameshift efficiency based on the cloning of wild-type and mutant cDNA fragments and their expression levels. As proof of principle, we applied this strategy to three CRISPR/Cas9-induced mutations in pycr1a, chd7 and hace1 genes. An insertion of seven nucleotides in pycr1a resulted in the first reported observation of exon skipping by CRISPR/Cas9-induced mutations in zebrafish. However, of these three mutant genes, the fluorescent reporter revealed effective frameshifting exclusively in the case of a two-nucleotide deletion in chd7, suggesting activity of alternative translation sites in the other two mutants even though pycr1a exon-skipping deletion is likely to be deleterious. This article provides a protocol for characterizing frameshift mutations in zebrafish, and highlights the importance of checking mutations at the mRNA level and verifying their effects on translation by fluorescent reporters when antibody detection of protein loss is not possible.

  11. Effects of the umuC36 mutation on ultraviolet-radiation-induced base-change and frameshift mutations in Escherichia coli

    International Nuclear Information System (INIS)

    Kato, T.; Nakano, E.

    1981-01-01

    The effects of the umuC36 mutation on the induction of base-change and frameshift mutations were studied. An active umuC gene was necessary in either the uvr + or uvr - strains of Escherichia coli K12 for UV- and X-ray-induced mutations to His + , ColE and Spc, which are presumably base-change mutations, but it was not essential for ethyl methanesulphonate or N-methyl-N'-nitro-N-nitrosoguanidine-induced His + mutations. In contrast, only 1 out of 13 trp - frameshift mutations examined was UV reversible, and the process of mutagenesis was umuC + -dependent, whereas a potent frameshift mutagen, ICR191, effectively induced Trp + mutations in most of the strains regardless of the umu + or umuC genetic background. These results suggest that base substitutions are a major mutational type derived from the umuC + -dependent pathway of error-prone repair. (orig.)

  12. Microsatellite instability derived JAK1 frameshift mutations are associated with tumor immune evasion in endometrioid endometrial cancer

    NARCIS (Netherlands)

    Stelloo, Ellen; Versluis, Marco A; Nijman, Hans W; de Bruyn, Marco; Plat, Annechien; Osse, Elisabeth M; van Dijk, Reinhardt H; Nout, Remi A; Creutzberg, Carien L; de Bock, Geertruida H; Smit, Vincent T; Bosse, Tjalling; Hollema, Harry

    2016-01-01

    JAK1 frameshift mutations may promote cancer cell immune evasion by impeding upregulation of the antigen presentation pathway in microsatellite unstable endometrial cancers (ECs). This study investigated the JAK1 mutation frequency, its functional implication in immune evasion and its prognostic

  13. Detection of coding microsatellite frameshift mutations in DNA mismatch repair-deficient mouse intestinal tumors.

    Science.gov (United States)

    Woerner, Stefan M; Tosti, Elena; Yuan, Yan P; Kloor, Matthias; Bork, Peer; Edelmann, Winfried; Gebert, Johannes

    2015-11-01

    Different DNA mismatch repair (MMR)-deficient mouse strains have been developed as models for the inherited cancer predisposing Lynch syndrome. It is completely unresolved, whether coding mononucleotide repeat (cMNR) gene mutations in these mice can contribute to intestinal tumorigenesis and whether MMR-deficient mice are a suitable molecular model of human microsatellite instability (MSI)-associated intestinal tumorigenesis. A proof-of-principle study was performed to identify mouse cMNR-harboring genes affected by insertion/deletion mutations in MSI murine intestinal tumors. Bioinformatic algorithms were developed to establish a database of mouse cMNR-harboring genes. A panel of five mouse noncoding mononucleotide markers was used for MSI classification of intestinal matched normal/tumor tissues from MMR-deficient (Mlh1(-/-) , Msh2(-/-) , Msh2(LoxP/LoxP) ) mice. cMNR frameshift mutations of candidate genes were determined by DNA fragment analysis. Murine MSI intestinal tumors but not normal tissues from MMR-deficient mice showed cMNR frameshift mutations in six candidate genes (Elavl3, Tmem107, Glis2, Sdccag1, Senp6, Rfc3). cMNRs of mouse Rfc3 and Elavl3 are conserved in type and length in their human orthologs that are known to be mutated in human MSI colorectal, endometrial and gastric cancer. We provide evidence for the utility of a mononucleotide marker panel for detection of MSI in murine tumors, the existence of cMNR instability in MSI murine tumors, the utility of mouse subspecies DNA for identification of polymorphic repeats, and repeat conservation among some orthologous human/mouse genes, two of them showing instability in human and mouse MSI intestinal tumors. MMR-deficient mice hence are a useful molecular model system for analyzing MSI intestinal carcinogenesis. © 2014 Wiley Periodicals, Inc.

  14. A CNGB1 frameshift mutation in Papillon and Phalene dogs with progressive retinal atrophy.

    Directory of Open Access Journals (Sweden)

    Saija J Ahonen

    Full Text Available Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA or degeneration resembles human retinitis pigmentosa (RP and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10(-8 with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes.

  15. Back-translation for discovering distant protein homologies in the presence of frameshift mutations

    Directory of Open Access Journals (Sweden)

    Noé Laurent

    2010-01-01

    Full Text Available Abstract Background Frameshift mutations in protein-coding DNA sequences produce a drastic change in the resulting protein sequence, which prevents classic protein alignment methods from revealing the proteins' common origin. Moreover, when a large number of substitutions are additionally involved in the divergence, the homology detection becomes difficult even at the DNA level. Results We developed a novel method to infer distant homology relations of two proteins, that accounts for frameshift and point mutations that may have affected the coding sequences. We design a dynamic programming alignment algorithm over memory-efficient graph representations of the complete set of putative DNA sequences of each protein, with the goal of determining the two putative DNA sequences which have the best scoring alignment under a powerful scoring system designed to reflect the most probable evolutionary process. Our implementation is freely available at http://bioinfo.lifl.fr/path/. Conclusions Our approach allows to uncover evolutionary information that is not captured by traditional alignment methods, which is confirmed by biologically significant examples.

  16. Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutations in mammalian cells

    International Nuclear Information System (INIS)

    Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.

    1988-01-01

    The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage

  17. A natural frameshift mutation in Campanula EIL2 correlates with ethylene insensitivity in flowers

    DEFF Research Database (Denmark)

    Jensen, Line; Hegelund, Josefine Nymark; Olsen, Andreas

    2016-01-01

    BACKGROUND: The phytohormone ethylene plays a central role in development and senescence of climacteric flowers. In ornamental plant production, ethylene sensitive plants are usually protected against negative effects of ethylene by application of chemical inhibitors. In Campanula, flowers...... are sensitive to even minute concentrations of ethylene. RESULTS: Monitoring flower longevity in three Campanula species revealed C. portenschlagiana (Cp) as ethylene sensitive, C. formanekiana (Cf) with intermediate sensitivity and C. medium (Cm) as ethylene insensitive. We identified key elements in ethylene...... and in response to ethylene. In contrast, EIL2 was found only in Cf and Cm. We identified a natural mutation in Cmeil2 causing a frameshift which resulted in difference in expression levels of EIL2, with more than 100-fold change between Cf and Cm in young flowers. CONCLUSIONS: This study shows that the naturally...

  18. Clinical Characteristics of Wolfram Syndrome in Chinese Population and a Novel Frameshift Mutation in WFS1.

    Science.gov (United States)

    Duan, Lian; Li, Qian; Tong, An-Li; Mao, Jiang-Feng; Yu, Miao; Yuan, Tao; Chai, Xiao-Feng; Gu, Feng

    2018-01-01

    Wolfram syndrome (WS) is a rare, degenerative, and hereditary disorder characterized by ear diabetes mellitus (DM) and optic atrophy (OA). We aim to characterize clinical features in Chinese patients who had been poorly studied until now. We performed a retrospective review of patients with WS seen in the Peking Union Medical College Hospital from 2002 to 2017. Data including demographic data, clinical presentations, examination results, family history, and genetic analysis were described. Six patients with WS were identified, meeting the diagnostic criteria of the coincidence of DM and OA before 15 years old or the existence of two WFS1 mutations. All were male, with the median age of 14.5 years (range 10-19 years). Blood glucose impairment, OA, and diabetes insipidus were present in all (100%), hearing impairment in four (66.7%), urological abnormalities in four (66.7%), neurological abnormalities in one (16.7%), and endocrine disorder in one (16.7%). Rare presentation includes cataract, glaucoma, and spina bifida occulta. Diabetes was insulin-dependent and not ketosis onset, with antibody to glutamic acid decarboxylase and islet cell negative. Genetic analysis revealed mutations in WFS1 in three patients. A novel frameshift mutation (p.Asp151Glufs*93) was identified in exon 4 of WFS1 . Our series of WS patients indicated that WS is a degenerative disease with a wide and variable spectrum, characterized by ear non-autoimmune DM and bilateral OA. Genetic analysis is recommended when suspected of WS.

  19. Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations

    Directory of Open Access Journals (Sweden)

    Eiklid Kristin L

    2011-08-01

    Full Text Available Abstract Background Rett syndrome (RTT is an X-linked dominant neurodevelopmental disorder, which is usually caused by de novo mutations in the MECP2 gene. More than 70% of the disease causing MECP2 mutations are eight recurrent C to T transitions, which almost exclusively arise on the paternally derived X chromosome. About 10% of the RTT cases have a C-terminal frameshift deletion in MECP2. Only few RTT families with a segregating MECP2 mutation, which affects female carriers with a phenotype of mental retardation or RTT, have been reported in the literature. In this study we describe two new RTT families with three and four individuals, respectively, and review the literature comparing the type of mutations and phenotypes observed in RTT families with those observed in sporadic cases. Based on these observations we also investigated origin of mutation segregation to further improve genetic counselling. Methods MECP2 mutations were identified by direct sequencing. XCI studies were performed using the X-linked androgen receptor (AR locus. The parental origin of de novo MECP2 frameshift mutations was investigated using intronic SNPs. Results In both families a C-terminal frameshift mutation segregates. Clinical features of the mutation carriers vary from classical RTT to mild mental retardation. XCI profiles of the female carriers correlate to their respective geno-/phenotypes. The majority of the de novo frameshift mutations occur on the paternally derived X chromosome (7/9 cases, without a paternal age effect. Conclusions The present study suggests a correlation between the intrafamilial phenotypic differences observed in RTT families and their respective XCI pattern in blood, in contrast to sporadic RTT cases where a similar correlation has not been demonstrated. Furthermore, we found de novo MECP2 frameshift mutations frequently to be of paternal origin, although not with the same high paternal occurrence as in sporadic cases with C to T

  20. Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations

    Science.gov (United States)

    2011-01-01

    Background Rett syndrome (RTT) is an X-linked dominant neurodevelopmental disorder, which is usually caused by de novo mutations in the MECP2 gene. More than 70% of the disease causing MECP2 mutations are eight recurrent C to T transitions, which almost exclusively arise on the paternally derived X chromosome. About 10% of the RTT cases have a C-terminal frameshift deletion in MECP2. Only few RTT families with a segregating MECP2 mutation, which affects female carriers with a phenotype of mental retardation or RTT, have been reported in the literature. In this study we describe two new RTT families with three and four individuals, respectively, and review the literature comparing the type of mutations and phenotypes observed in RTT families with those observed in sporadic cases. Based on these observations we also investigated origin of mutation segregation to further improve genetic counselling. Methods MECP2 mutations were identified by direct sequencing. XCI studies were performed using the X-linked androgen receptor (AR) locus. The parental origin of de novo MECP2 frameshift mutations was investigated using intronic SNPs. Results In both families a C-terminal frameshift mutation segregates. Clinical features of the mutation carriers vary from classical RTT to mild mental retardation. XCI profiles of the female carriers correlate to their respective geno-/phenotypes. The majority of the de novo frameshift mutations occur on the paternally derived X chromosome (7/9 cases), without a paternal age effect. Conclusions The present study suggests a correlation between the intrafamilial phenotypic differences observed in RTT families and their respective XCI pattern in blood, in contrast to sporadic RTT cases where a similar correlation has not been demonstrated. Furthermore, we found de novo MECP2 frameshift mutations frequently to be of paternal origin, although not with the same high paternal occurrence as in sporadic cases with C to T transitions. This suggests

  1. A novel frameshift mutation in CX46 associated with hereditary dominant cataracts in a Chinese family

    Directory of Open Access Journals (Sweden)

    Xiu-Kun Cui

    2017-05-01

    Full Text Available AIM: To investigate the genetic mutations that are associated the hereditary autosomal dominant cataract in a Chinese family. METHODS: A Chinese family consisting of 20 cataract patients (including 9 male and 11 female and 2 unaffected individuals from 5 generations were diagnosed to be a typical autosomal dominant cataract pedigree. Genomic DNA samples were extracted from the peripheral blood cells of the participants in this pedigree. Exon sequence was used for genetic mutation screening. In silico analysis was used to study the structure characteristics of connexin 46 (CX46 mutant. Immunoblotting was conduceted for testing the expression of CX46. RESULTS: To determine the involved genetic mutations, 11 well-known cataract-associated genes (cryaa, cryab, crybb1, crybb2, crygc, crygd, Gja3, Gja8, Hsf4, Mip and Pitx3 were chosen for genetic mutation test by using exon sequencing. A novel cytosine insertion at position 1195 of CX46 cDNA (c.1194_1195ins C was found in the samples of 5 tested cataract patients but not in the unaffected 2 individuals nor in normal controls, which resulted in 30 amino acids more extension in CX46C-terminus (cx46fs400 compared with the wild-type CX46. In silico protein structure analysis indicated that the mutant showed distinctive hydrophobicity and protein secondary structure compared with the wild-type CX46. The immunoblot results revealed that CX46 protein, which expressed in the aging cataract lens tissues, was absence in the proband lens. In contrast, CX50, alpha A-crystallin and alphaB-crystallin expressed equally in both proband and aging cataract tissues. Those results revealed that the cx46fs400 mutation could impair CX46 protein expression. CONCLUSION: The insertion of cytosine at position 1195 of CX46 cDNA is a novel mutation site that is associated with the autosomal dominant cataracts in this Chinese family. The C-terminal frameshift mutation is involved in regulating CX46 protein expression.

  2. Frameshift mutations in dentin phosphoprotein and dependence of dentin disease phenotype on mutation location

    NARCIS (Netherlands)

    Nieminen, P.; Papagiannoulis-Lascarides, L.; Waltimo-Siren, J.; Ollila, P.; Karjalainen, S.; Arte, S.; Veerkamp, J.; Tallon Walton, V.; Chimenos Küstner, E.; Siltanen, T.; Holappa, H.; Lukinmaa, P.L.; Alaluusua, S.

    2011-01-01

    We describe results from a mutational analysis of the region of the dentin sialophosphoprotein (DSPP) gene encoding dentin phosphoprotein (DPP) in 12 families with dominantly inherited dentin diseases. In eight families (five mutations in the N-terminal third of DPP), the clinical and radiologic

  3. Clinical Characteristics of Wolfram Syndrome in Chinese Population and a Novel Frameshift Mutation in WFS1

    Directory of Open Access Journals (Sweden)

    Lian Duan

    2018-02-01

    Full Text Available ObjectiveWolfram syndrome (WS is a rare, degenerative, and hereditary disorder characterized by ear diabetes mellitus (DM and optic atrophy (OA. We aim to characterize clinical features in Chinese patients who had been poorly studied until now.MethodsWe performed a retrospective review of patients with WS seen in the Peking Union Medical College Hospital from 2002 to 2017. Data including demographic data, clinical presentations, examination results, family history, and genetic analysis were described.ResultsSix patients with WS were identified, meeting the diagnostic criteria of the coincidence of DM and OA before 15 years old or the existence of two WFS1 mutations. All were male, with the median age of 14.5 years (range 10–19 years. Blood glucose impairment, OA, and diabetes insipidus were present in all (100%, hearing impairment in four (66.7%, urological abnormalities in four (66.7%, neurological abnormalities in one (16.7%, and endocrine disorder in one (16.7%. Rare presentation includes cataract, glaucoma, and spina bifida occulta. Diabetes was insulin-dependent and not ketosis onset, with antibody to glutamic acid decarboxylase and islet cell negative. Genetic analysis revealed mutations in WFS1 in three patients. A novel frameshift mutation (p.Asp151Glufs*93 was identified in exon 4 of WFS1.ConclusionOur series of WS patients indicated that WS is a degenerative disease with a wide and variable spectrum, characterized by ear non-autoimmune DM and bilateral OA. Genetic analysis is recommended when suspected of WS.

  4. Identification of a novel frameshift mutation in PITX2 gene in a Chinese family with Axenfeld-Rieger syndrome.

    Science.gov (United States)

    Yin, Hou-fa; Fang, Xiao-yun; Jin, Chong-fei; Yin, Jin-fu; Li, Jin-yu; Zhao, Su-juan; Miao, Qi; Song, Feng-wei

    2014-01-01

    Axenfeld-Rieger syndrome (ARS) is phenotypically and genetically heterogeneous. In this study, we identified the underlying genetic defect in a Chinese family with ARS. A detailed family history and clinical data were recorded. The ocular phenotype was documented using slit-lamp photography and systemic anomalies were also documented where available. The genomic DNA was extracted from peripheral blood leukocytes. All coding exons and intron-exon junctions of paired-like homeodomain transcription factor 2 (PITX2) gene and the forkhead box C1 (FOXC1) gene were amplified by polymerase chain reaction (PCR) and screened for mutation by direct DNA sequencing. Variations detected in exon 5 of PITX2 were further evaluated with cloning sequencing. The exon 5 of PITX2 was also sequenced in 100 healthy controls, unrelated to the family, for comparison. Structural models of the wild type and mutant homeodomain of PITX2 were investigated by SWISS-MODEL. Affected individuals exhibited variable ocular phenotypes, whereas the systemic anomalies were similar. After direct sequencing and cloning sequencing, a heterozygous deletion/insertion mutation c.198_201delinsTTTCT (p.M66Ifs*133) was revealed in exon 5 of PITX2. This mutation co-segregated with all affected individuals in the family and was not found either in unaffected family members or in 100 unrelated controls. We detected a novel frameshift mutation p.M66Ifs*133 in PITX2 in a Chinese family with ARS. Although PITX2 mutations and polymorphisms have been reported from various ethnic groups, we report for the first time the identification of a novel deletion/insertion mutation that causes frameshift mutation in the homeodomain of PITX2 protein.

  5. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    Science.gov (United States)

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  6. SOS1 frameshift mutations cause pure mucosal neuroma syndrome, a clinical phenotype distinct from multiple endocrine neoplasia type 2B.

    Science.gov (United States)

    Owens, Martina; Kivuva, Emma; Quinn, Anthony; Brennan, Paul; Caswell, Richard; Lango Allen, Hana; Vaidya, Bijay; Ellard, Sian

    2016-05-01

    Mucosal neuromas, thickened corneal nerves and marfanoid body habitus are characteristic phenotypic features of multiple endocrine neoplasia type 2B (MEN2B) and often provide an early clue to the diagnosis of the syndrome. Rarely, patients present with typical physical features of MEN2B but without associated endocrinopathies (medullary thyroid carcinoma or pheochromocytoma) or a RET gene mutation; this clinical presentation is thought to represent a distinct condition termed 'pure mucosal neuroma syndrome'. Exome sequencing was performed in two unrelated probands with mucosal neuromas, thickened corneal nerves and marfanoid body habitus, but no MEN2B-associated endocrinopathy or RET gene mutation. Sanger sequencing was performed to confirm mutations detected by exome sequencing and to test in family members and 3 additional unrelated index patients with mucosal neuromas or thickened corneal nerves. A heterozygous SOS1 gene frameshift mutation (c.3266dup or c.3248dup) was identified in each proband. Sanger sequencing showed that proband 1 inherited the c.3266dup mutation from his affected mother, while the c.3248dup mutation had arisen de novo in proband 2. Sanger sequencing also identified one further novel SOS1 mutation (c.3254dup) in one of the 3 additional index patients. Our results demonstrate the existence of pure mucosal neuroma syndrome as a clinical entity distinct from MEN2B that can now be diagnosed by genetic testing. © 2015 John Wiley & Sons Ltd.

  7. Multiple nevoid basal cell carcinoma syndrome associated with congenital orbital teratoma, caused by a PTCH1 frameshift mutation.

    Science.gov (United States)

    Rodrigues, A L; Carvalho, A; Cabral, R; Carneiro, V; Gilardi, P; Duarte, C P; Puente-Prieto, J; Santos, P; Mota-Vieira, L

    2014-07-25

    Gorlin-Goltz syndrome, or nevoid basal cell carcinoma syndrome (NBCCS), is a rare autosomal dominant disorder caused by mutations in the PTCH1 gene and shows a high level of penetrance and variable expressivity. The syndrome is characterized by developmental abnormalities or neoplasms and is diagnosed with 2 major criteria, or with 1 major and 2 minor criteria. Here, we report a new clinical manifestation associated with this syndrome in a boy affected by NBCCS who had congenital orbital teratoma at birth. Later, at the age of 15 years, he presented with 4 major and 4 minor criteria of NBCCS, including multiple basal cell carcinoma and 2 odontogenic keratocysts of the jaw, both confirmed by histology, more than 5 palmar pits, calcification of the cerebral falx, extensive meningeal calcifications, macrocephaly, hypertelorism, frontal bosses, and kyphoscoliosis. PTCH1 mutation analysis revealed the heterozygous germline mutation c.290dupA. This mutation generated a frameshift within exon 2 and an early premature stop codon (p.Asn97LysfsX43), predicting a truncated protein with complete loss of function. Identification of this mutation is useful for genetic counseling. Although the clinical symptoms are well-known, our case contributes to the understanding of phenotypic variability in NBCCS, highlighting that PTCH1 mutations cannot be used for predicting disease burden and reinforces the need of a multidisciplinary team in the diagnosis, treatment, and follow-up of NBCCS patients.

  8. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  9. Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1

    DEFF Research Database (Denmark)

    Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars

    2016-01-01

    -threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based...

  10. De novo MECP2 frameshift mutation in a boy with moderate mental retardation, obesity and gynaecomastia.

    NARCIS (Netherlands)

    Kleefstra, T.; Yntema, H.G.; Oudakker, A.R.; Romein, T.; Sistermans, E.A.; Nillessen, W.; Bokhoven, J.H.L.M. van; Vries, L.B.A. de; Hamel, B.C.J.

    2002-01-01

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder caused by mutations in the MECP2 gene, with apparent lethality in male embryos. However, recent studies indicate that mutations in the MECP2 gene can cause congenital encephalopathy, an Angelman-like phenotype and even nonspecific mental

  11. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic ...

    Indian Academy of Sciences (India)

    More than 1800 CFTR (cystic fibrosis transmembrane con- ductance regulator gene) sequence variations have been identified in the cystic fibrosis (CF) mutation database. (http://www.genet.sickkids.on.ca/cftr/). For North African populations, however, the nature and frequency of the major. CFTR mutations remain unclear, ...

  12. Novel compound heterozygous frameshift mutations of C2orf37 in a ...

    Indian Academy of Sciences (India)

    ganglia, T-wave abnormalities and depressed insulin-like growth factor 1 levels. A mutation in the C2orf37 gene was described as the cause of WSS in 2008 in the Saudi families including the ones originally described by Woodhouse and Sakati (Alazami et al. 2008). Additional mutations in. C2orf37 were also described by ...

  13. A homozygous frameshift mutation in the HOXC13 gene underlies pure hair and nail ectodermal dysplasia in a Syrian family.

    Science.gov (United States)

    Farooq, Muhammad; Kurban, Mazen; Fujimoto, Atsushi; Fujikawa, Hiroki; Abbas, Ossama; Nemer, Georges; Saliba, Jessica; Sleiman, Rima; Tofaili, Mona; Kibbi, Abdul-Ghani; Ito, Masaaki; Shimomura, Yutaka

    2013-04-01

    Pure hair and nail ectodermal dysplasia (PHNED) is a rare genetic disorder characterized by hypotrichosis or complete alopecia, as well as nail dystrophy. Mutations in the type II hair keratin gene KRT85 and the HOXC13 gene on chromosome 12q have recently been identified in families with autosomal-recessive PHNED. In the present study, we have analyzed a consanguineous Syrian family with an affected girl having complete alopecia and nail dystrophy since birth. The family clearly showed linkage to chromosome 12q13.13-12q14.3, which excluded the KRT85 gene. Sequencing of another candidate gene HOXC13 within the linkage interval identified a homozygous frameshift mutation (c.355delC; p.Leu119Trpfs*20). Expression studies in cultured cells revealed that the mutant HOXC13 protein mislocalized within the cytoplasm, and failed to upregulate the promoter activities of its target genes. Our results strongly suggest crucial roles of the HOXC13 gene in the development of hair and nails in humans. © 2013 Wiley Periodicals, Inc.

  14. An exon 53 frameshift mutation in CUBN abrogates cubam function and causes Imerslund-Gräsbeck syndrome in dogs.

    Science.gov (United States)

    Fyfe, John C; Hemker, Shelby L; Venta, Patrick J; Fitzgerald, Caitlin A; Outerbridge, Catherine A; Myers, Sherry L; Giger, Urs

    2013-08-01

    Cobalamin malabsorption accompanied by selective proteinuria is an autosomal recessive disorder known as Imerslund-Gräsbeck syndrome in humans and was previously described in dogs due to amnionless (AMN) mutations. The resultant vitamin B12 deficiency causes dyshematopoiesis, lethargy, failure to thrive, and life-threatening metabolic disruption in the juvenile period. We studied 3 kindreds of border collies with cobalamin malabsorption and mapped the disease locus in affected dogs to a 2.9Mb region of homozygosity on canine chromosome 2. The region included CUBN, the locus encoding cubilin, a peripheral membrane protein that in concert with AMN forms the functional intrinsic factor-cobalamin receptor expressed in ileum and a multi-ligand receptor in renal proximal tubules. Cobalamin malabsorption and proteinuria comprising CUBN ligands were demonstrated by radiolabeled cobalamin uptake studies and SDS-PAGE, respectively. CUBN mRNA and protein expression were reduced ~10 fold and ~20 fold, respectively, in both ileum and kidney of affected dogs. DNA sequencing demonstrated a single base deletion in exon 53 predicting a translational frameshift and early termination codon likely triggering nonsense mediated mRNA decay. The mutant allele segregated with the disease in the border collie kindred. The border collie disorder indicates that a CUBN mutation far C-terminal from the intrinsic factor-cobalamin binding site can abrogate receptor expression and cause Imerslund-Gräsbeck syndrome. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. A Newly Described Bovine Type 2 Scurs Syndrome Segregates with a Frame-Shift Mutation in TWIST1

    Science.gov (United States)

    Capitan, Aurélien; Grohs, Cécile; Weiss, Bernard; Rossignol, Marie-Noëlle; Reversé, Patrick; Eggen, André

    2011-01-01

    The developmental pathways involved in horn development are complex and still poorly understood. Here we report the description of a new dominant inherited syndrome in the bovine Charolais breed that we have named type 2 scurs. Clinical examination revealed that, despite a strong phenotypic variability, all affected individuals show both horn abnormalities similar to classical scurs phenotype and skull interfrontal suture synostosis. Based on a genome-wide linkage analysis using Illumina BovineSNP50 BeadChip genotyping data from 57 half-sib and full-sib progeny, this locus was mapped to a 1.7 Mb interval on bovine chromosome 4. Within this region, the TWIST1 gene encoding a transcription factor was considered as a strong candidate gene since its haploinsufficiency is responsible for the human Saethre-Chotzen syndrome, characterized by skull coronal suture synostosis. Sequencing of the TWIST1 gene identified a c.148_157dup (p.A56RfsX87) frame-shift mutation predicted to completely inactivate this gene. Genotyping 17 scurred and 20 horned founders of our pedigree as well as 48 unrelated horned controls revealed a perfect association between this mutation and the type 2 scurs phenotype. Subsequent genotyping of 32 individuals born from heterozygous parents showed that homozygous mutated progeny are completely absent, which is consistent with the embryonic lethality reported in Drosophila and mouse suffering from TWIST1 complete insufficiency. Finally, data from previous studies on model species and a fine description of type 2 scurs symptoms allowed us to propose different mechanisms to explain the features of this syndrome. In conclusion, this first report on the identification of a potential causal mutation affecting horn development in cattle offers a unique opportunity to better understand horn ontogenesis. PMID:21814570

  16. A frameshift mutation in MC1R and a high frequency of somatic reversions cause black spotting in pigs.

    Science.gov (United States)

    Kijas, J M; Moller, M; Plastow, G; Andersson, L

    2001-06-01

    Black spotting on a red or white background in pigs is determined by the E(P) allele at the MC1R/Extension locus. A previous comparison of partial MC1R sequences revealed that E(P) shares a missense mutation (D121N) with the E(D2) allele for dominant black color. Sequence analysis of the entire coding region now reveals a second mutation in the form of a 2-bp insertion at codon 23 (nt67insCC). This mutation expands a tract of six C nucleotides to eight and introduces a premature stop codon at position 56. This frameshift mutation is expected to cause a recessive red color, which was in fact observed in some breeds with the E(P) allele present (Tamworth and Hereford). RT-PCR analyses were conducted using skin samples taken from both spotted and background areas of spotted pigs. The background red area had transcript only from the mutant nt67insCC MC1R allele, whereas the black spot also contained a transcript without the 2-bp insertion. This indicates that black spots are due to somatic reversion events that restore the frame and MC1R function. The phenotypic expression of the E(P) allele is highly variable and the associated coat color ranges from red, red with black spots, white with black spots, to almost completely solid black. In several breeds of pigs the phenotypic manifestation of this allele has been modified by selection for or against black spots.

  17. Novel frameshift mutation in the KCNQ1 gene responsible for Jervell and Lange-Nielsen syndrome

    Directory of Open Access Journals (Sweden)

    Azam Amirian

    2018-01-01

    Full Text Available Objective(s: Jervell and Lange–Nielsen syndrome is an autosomal recessive disorder caused by mutations in KCNQ1 or KCNE1 genes. The disease is characterized by sensorineural hearing loss and long QT syndrome. Methods: Here we present a 3.5-year-old female patient, an offspring of consanguineous marriage, who had a history of recurrent syncope and congenital sensorineural deafness. The patient and the family members were screened for mutations in KCNQ1 gene by linkage analysis and DNA sequencing. Results: DNA sequencing showed a c.1532_1534delG (p. A512Pfs*81 mutation in the KCNQ1 gene in homozygous form. The results of short tandem repeat (STR markers showed that the disease in the family is linked to the KCNQ1 gene. The mutation was confirmed in the parents in heterozygous form. Conclusion: This is the first report of this variant in KCNQ1 gene in an Iranian family. The data of this study could be used for early diagnosis of the condition in the family and genetic counseling.

  18. Identification of a novel frameshift mutation in the ILDR1 gene in a UAE family, mutations review and phenotype genotype correlation.

    Directory of Open Access Journals (Sweden)

    Abdelaziz Tlili

    Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.

  19. A novel frameshift mutation in the sterol 27-hydroxylase gene in an Egyptian family with cerebrotendinous xanthomatosis without cataract.

    Science.gov (United States)

    Abdel-Hamid, Mohamed S; Issa, Mahmoud Y; Otaify, Ghada A; Zaki, Maha S

    2017-04-01

    Cerebrotendinous xanthomatosis (CTX) is a rare autosomal recessive lipid storage disorder caused by deficiency of the mitochondrial cytochrome P450 sterol 27-hydroxylase enzyme encoded by CYP27A1 gene. CTX is characterized by tendon xanthomas, juvenile cataracts and multiple progressive neurological symptoms. Here we report on the clinical and molecular findings of a 35-years old Egyptian patient with CTX without cataract. Parents were first cousins with family history of two deceased sibs with mild impaired cognitive functions and epilepsy without appearance of tendon xanthomas. Our proband had learning disabilities and developed seizures at 9 years old. Tendon xanthomata appeared at the age of 16 and his neurological symptoms remained stationary till 28 years followed by progressive cerebello-pyramidal signs, dementia and psychiatric disturbance. Cataract was not evident in our patient. Brain MRI showed the characteristic focal lesions appeared as xanthomas in cerebellum and occipital horns of lateral ventricles. Molecular study identified a novel homozygous frameshift mutation in CYP27A1 gene, c.1169delT (p.K391Rfs*17). Our study emphasizes the important role of early genetic testing in prevention of morbidity and mortality of the disease and proper counseling. Moreover, it shows that the absence of cataract should not rule out the diagnosis of CTX.

  20. Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

    Science.gov (United States)

    Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

    2015-01-01

    Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

  1. A CHRNB1 frameshift mutation is associated with familial arthrogryposis multiplex congenita in Red dairy cattle.

    Science.gov (United States)

    Agerholm, Jørgen S; McEvoy, Fintan J; Menzi, Fiona; Jagannathan, Vidhya; Drögemüller, Cord

    2016-06-30

    Bovine arthrogryposis multiplex congenita (AMC) is a syndromic term for a congenital condition characterized by multiple joint contractures. Rare inherited forms of bovine AMC have been reported in different breeds. For AMC in Angus cattle a causative genomic deletion encompassing the agrin (AGRN) gene, encoding an essential neural regulator that induces the aggregation of acetylcholine receptors (AChRs), is known. In 2015, three genetically related cases of generalized AMC affecting Red dairy calves were diagnosed in Denmark. The family history of three affected calves suggested an autosomal recessive inheritance. Single nucleotide polymorphism (SNP) genotyping showed a single genomic region of extended homozygosity of 21.5 Mb on chromosome 19. Linkage analysis revealed a maximal parametric LOD score of 1.8 at this region. By whole genome re-sequencing of the three cases, two private homozygous non-synonymous variants were detected in the critical interval. Both variants, located in the myosin phosphatase Rho interacting protein (MPRIP) and the cholinergic receptor nicotinic beta 1 subunit gene (CHRNB1), were perfectly associated with the AMC phenotype. Previously described CHRNB1 variants in humans lead to a congenital myasthenic syndrome with impaired neuromuscular transmission. The cattle variant represents a single base deletion in the first exon of CHRNB1 (c.55delG) introducing a premature stop codon (p.Ala19Profs47*) in the second exon, truncating 96 % of the protein. This study provides the first phenotypically and genetically characterized example of a bovine AMC phenotype that represents an inherited neuromuscular disorder corresponding to human congenital myasthenic syndrome. The identified CHRNB1 loss of function variant is predicted to have a deleterious effect on fetal AChR function, which could explain the lethal phenotype reported in this study. The identification of this candidate causative mutation thus widens the known phenotypic spectrum of

  2. N-acetoxy-N-2-acetylaminofluorene induced frameshift mutations: a comparison between the DNA modification spectrum and the mutation spectrum

    International Nuclear Information System (INIS)

    Fuchs, R.P.P.; Koffel-Schwartz, N.; Daune, M.

    1983-01-01

    We describe the analysis of forward mutations induced in the tetracycline resistance gene of the plasmid pBR322 by directing the reaction of the carcinogen N-acetoxy-N-2-acetylaminofluorene (N-AcO-AAF) to a small restriction fragment (BamHI, SalI) that is located in the proximal part of the antibiotic-resistance gene. Mutant plasmids obtained both in wild type and excision repair deficient (uvrA) bacterial cells are compared. Preliminary data showing the distribution of the -AAF adducts along this restriction fragments are discussed in relation to the observed spectrum of mutations. 20 references, 4 figures

  3. A Frameshift Mutation in the Cubilin Gene (CUBN) in Border Collies with Imerslund-Gräsbeck Syndrome (Selective Cobalamin Malabsorption)

    Science.gov (United States)

    Owczarek-Lipska, Marta; Jagannathan, Vidhya; Drögemüller, Cord; Lutz, Sabina; Glanemann, Barbara

    2013-01-01

    Imerslund-Gräsbeck syndrome (IGS) or selective cobalamin malabsorption has been described in humans and dogs. IGS occurs in Border Collies and is inherited as a monogenic autosomal recessive trait in this breed. Using 7 IGS cases and 7 non-affected controls we mapped the causative mutation by genome-wide association and homozygosity mapping to a 3.53 Mb interval on chromosome 2. We re-sequenced the genome of one affected dog at ∼10× coverage and detected 17 non-synonymous variants in the critical interval. Two of these non-synonymous variants were in the cubilin gene (CUBN), which is known to play an essential role in cobalamin uptake from the ileum. We tested these two CUBN variants for association with IGS in larger cohorts of dogs and found that only one of them was perfectly associated with the phenotype. This variant, a single base pair deletion (c.8392delC), is predicted to cause a frameshift and premature stop codon in the CUBN gene. The resulting mutant open reading frame is 821 codons shorter than the wildtype open reading frame (p.Q2798Rfs*3). Interestingly, we observed an additional nonsense mutation in the MRC1 gene encoding the mannose receptor, C type 1, which was in perfect linkage disequilibrium with the CUBN frameshift mutation. Based on our genetic data and the known role of CUBN for cobalamin uptake we conclude that the identified CUBN frameshift mutation is most likely causative for IGS in Border Collies. PMID:23613799

  4. Phenotypic variability in a seven-generation Swedish family segregating autosomal dominant hearing impairment due to a novel EYA4 frameshift mutation

    DEFF Research Database (Denmark)

    Frykholm, Carina; Klar, Joakim; Arnesson, Hanna

    2015-01-01

    Linkage to an interval overlapping the DFNA10 locus on chromosome 6q22-23 was found through genome wide linkage analysis in a seven-generation Swedish family segregating postlingual, autosomal dominant nonsyndromic sensorineural hearing impairment. A novel heterozygous frame-shift mutation (c.579......-sectional and longitudinal deterioration of pure tone average (PTA) once the process of hearing deterioration had started, and no gender, parent-of-origin or family branch differences on PTA could be found. Age at onset varied between the family branches. In summary, this is the ninth published genetically verified DFNA10...

  5. A novel frameshift mutation of SMPX causes a rare form of X-linked nonsyndromic hearing loss in a Chinese family.

    Directory of Open Access Journals (Sweden)

    Zhijie Niu

    Full Text Available X-linked hearing impairment is the rarest form of genetic hearing loss (HL and represents only a minor fraction of all cases. The aim of this study was to investigate the cause of X-linked inherited sensorineural HL in a four-generation Chinese family. A novel duplication variant (c.217dupA, p.Ile73Asnfs*5 in SMPX was identified by whole-exome sequencing. The frameshift mutation predicted to result in the premature truncation of the SMPX protein was co-segregated with the HL phenotype and was absent in 295 normal controls. Subpopulation screening of the coding exons and flanking introns of SMPX was further performed for 338 Chinese patients with nonsydromic HL by Sanger sequencing, and another two potential causative substitutions (c.238C>A and c.55A>G in SMPX were identified in additional sporadic cases of congenital deafness. Collectively, this study is the first to report the role of SMPX in Chinese population and identify a novel frameshift mutation in SMPX that causes not only nonsyndromic late-onset progressive HL, but also congenital hearing impairment. Our findings extend the mutation and phenotypic spectrum of the SMPX gene.

  6. A Novel Frameshift Mutation (c.5387_5388insTT) in NIPBL in Cornelia de Lange Syndrome with Severe Phenotype.

    Science.gov (United States)

    Kang, Min Jae; Ahn, Soo Min; Hwang, Il Tae

    2018-01-01

    Cornelia de Lange syndrome (CdLS) is a developmental disorder which is characterized by typical facial features, upper extremity malformations, and growth and cognitive delays. The genes involved in CdLS encode the cohesin complex and its associated proteins; and NIPBL mutations, which account for half of the cases, result in severe CdLS phenotypes. We describe a girl with CdLS, presenting with typical facial dysmorphism, cleft palate, hypertrichosis, upper limb hypertonicity, flexion contracture of elbows, micromelia, bilateral hearing loss, gastroesophageal reflux, and severe pyloric stenosis. We detected a heterozygous frameshift mutation in NIPBL (c.5387_5388ins(TT), p.Leu1796Phefs*8) which is a novel mutation. © 2018 by the Association of Clinical Scientists, Inc.

  7. Postmortem diagnosis of Marfan syndrome in a case of sudden death due to aortic rupture: Detection of a novel FBN1 frameshift mutation.

    Science.gov (United States)

    Wang, Yunyun; Chen, Shu; Wang, Rongshuai; Huang, Sizhe; Yang, Mingzhen; Liu, Liang; Liu, Qian

    2016-04-01

    To investigate the sudden death of a 36-year-old Chinese man, a medicolegal autopsy was performed, combining forensic pathological examinations and genetic sequencing analysis to diagnose the cause of death. Genomic DNA samples were extracted from blood and subjected to high-throughput sequencing. Major findings included a dilated aortic root with a ruptured and dissected aorta and consequent tamponade of the pericardial sac. Moreover, arachnodactyly and other skeletal deformities were noted. By sequencing the fibrillin-1 gene (FBN1), five genetic variations were found, including four previously known single nucleotide polymorphisms (SNPs) and a novel frameshift mutation, leading to the diagnosis of Marfan syndrome. The frameshift mutation (c.4921delG, p.glu1641llysFsX9) detected in exon 40 led to a stop codon after the next 8 amino acids. The four SNPs included a splice site mutation (c.3464-5 G>A, rs11853943), a synonymous mutation (p.Asn625Asn, rs25458), and two missense mutations (p.Pro1148Ala, rs140598; p.Cys472Tyr, rs4775765). Genetic screening was recommended for the relatives as it was reported that the father and brother of the deceased had died at the ages of 40 and 25, respectively, from sudden cardiac failure. The son of the deceased lacked the relevant mutations. This report emphasizes the important contribution of medicolegal postmortem analysis on the molecular pathogenesis study of Marfan syndrome and early diagnosis of at-risk relatives. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Identification of a novel frameshift mutation in the DMD gene as the cause of muscular dystrophy in a Norfolk terrier dog.

    Science.gov (United States)

    Jenkins, Christopher A; Forman, Oliver P

    2015-01-01

    A Norfolk terrier was referred to the Animal Health Trust neurology department with suspected dystrophin-deficient muscular dystrophy (DD-MD), which was confirmed by clinical workup and immunohistochemistry. Exon resequencing of the canine Duchenne Muscular Dystrophy (DMD) gene was undertaken to screen for potential disease causing mutations. The sequence data generated from all coding DMD exons revealed a 1 bp deletion in exon 22, causing a frameshift and premature termination of the coding sequence. Gene expression analysis indicated reduced levels of dystrophin transcript in the DD-MD case and western blot confirmed the absence of full length protein. The finding represents a novel mutation causing DD-MD in the dog.

  9. A disease-associated frameshift mutation in caveolin-1 disrupts caveolae formation and function through introduction of a de novo ER retention signal.

    Science.gov (United States)

    Copeland, Courtney A; Han, Bing; Tiwari, Ajit; Austin, Eric D; Loyd, James E; West, James D; Kenworthy, Anne K

    2017-11-01

    Caveolin-1 (CAV1) is an essential component of caveolae and is implicated in numerous physiological processes. Recent studies have identified heterozygous mutations in the CAV1 gene in patients with pulmonary arterial hypertension (PAH), but the mechanisms by which these mutations impact caveolae assembly and contribute to disease remain unclear. To address this question, we examined the consequences of a familial PAH-associated frameshift mutation in CAV1 , P158PfsX22, on caveolae assembly and function. We show that C-terminus of the CAV1 P158 protein contains a functional ER-retention signal that inhibits ER exit and caveolae formation and accelerates CAV1 turnover in Cav1 -/- MEFs. Moreover, when coexpressed with wild-type (WT) CAV1 in Cav1 -/- MEFs, CAV1-P158 functions as a dominant negative by partially disrupting WT CAV1 trafficking. In patient skin fibroblasts, CAV1 and caveolar accessory protein levels are reduced, fewer caveolae are observed, and CAV1 complexes exhibit biochemical abnormalities. Patient fibroblasts also exhibit decreased resistance to a hypo-osmotic challenge, suggesting the function of caveolae as membrane reservoir is compromised. We conclude that the P158PfsX22 frameshift introduces a gain of function that gives rise to a dominant negative form of CAV1, defining a new mechanism by which disease-associated mutations in CAV1 impair caveolae assembly. © 2017 Copeland, Han, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  10. Epistatic participation of REV1 and REV3 in the formation of UV-induced frameshift mutations in cell cycle-arrested yeast cells

    International Nuclear Information System (INIS)

    Heidenreich, Erich; Eisler, Herfried; Steinboeck, Ferdinand

    2006-01-01

    Mutations arising in times of cell cycle arrest may provide a selective advantage for unicellular organisms adapting to environmental changes. For multicellular organisms, however, they may pose a serious threat, in that such mutations in somatic cells contribute to carcinogenesis and ageing. The budding yeast Saccharomyces cerevisiae presents a convenient model system for studying the incidence and the mechanisms of stationary-phase mutation in a eukaryotic organism. Having studied the emergence of frameshift mutants after several days of starvation-induced cell cycle arrest, we previously reported that all (potentially error-prone) translesion synthesis (TLS) enzymes identified in S. cerevisiae did not contribute to the basal level of spontaneous stationary-phase mutations. However, we observed that an increased frequency of stationary-phase frameshift mutations, brought about by a defective nucleotide excision repair (NER) pathway or by UV irradiation, was dependent on Rev3p, the catalytic subunit of the TLS polymerase zeta (Pol ζ). Employing the same two conditions, we now examined the effect of deletions of the genes coding for polymerase eta (Pol η) (RAD30) and Rev1p (REV1). In a NER-deficient strain background, the increased incidence of stationary-phase mutations was only moderately influenced by a lack of Pol η but completely reduced to wild type level by a knockout of the REV1 gene. UV-induced stationary-phase mutations were abundant in wild type and rad30Δ strains, but substantially reduced in a rev1Δ as well as a rev3Δ strain. The similarity of the rev1Δ and the rev3Δ phenotype and an epistatic relationship evident from experiments with a double-deficient strain suggests a participation of Rev1p and Rev3p in the same mutagenic pathway. Based on these results, we propose that the response of cell cycle-arrested cells to an excess of exo- or endogenously induced DNA damage includes a novel replication-independent cooperative function of Rev1p and

  11. Molecular characterization of WFS1 in an Iranian family with Wolfram syndrome reveals a novel frameshift mutation associated with early symptoms.

    Science.gov (United States)

    Sobhani, Maryam; Tabatabaiefar, Mohammad Amin; Rajab, Asadollah; Kajbafzadeh, Abdol-Mohammad; Noori-Daloii, Mohammad Reza

    2013-10-10

    Wolfram syndrome (WS) is a rare autosomal recessive neurodegenerative disorder that represents a likely source of childhood diabetes especially among countries in the consanguinity belt. The main responsible gene is WFS1 for which over one hundred mutations have been reported from different ethnic groups. The aim of this study was to identify the molecular etiology of WS and to perform a possible genotype-phenotype correlation in Iranian kindred. An Iranian family with two patients was clinically studied and WS was suspected. Genetic linkage analysis via 5 STR markers was carried out. For identification of mutations, DNA sequencing of WFS1 including all the exons, exon-intron boundaries and the promoter was performed. Linkage analysis indicated linkage to the WFS1 region. After DNA sequencing of WFS1, one novel pathogenic mutation, which causes frameshift alteration c.2177_2178insTCTTC (or c.2173_2177dupTCTTC) in exon eight, was found. The genotype-phenotype correlation analysis suggests that the presence of the homozygous mutation may be associated with early onset of disease symptoms. This study stresses the necessity of considering the molecular analysis of WFS1 in childhood diabetes with some symptoms of WS. © 2013 Elsevier B.V. All rights reserved.

  12. A novel COL4A1 frameshift mutation in familial kidney disease: the importance of the C-terminal NC1 domain of type IV collagen.

    Science.gov (United States)

    Gale, Daniel P; Oygar, D Deren; Lin, Fujun; Oygar, P Derin; Khan, Nadia; Connor, Thomas M F; Lapsley, Marta; Maxwell, Patrick H; Neild, Guy H

    2016-11-01

    Hereditary microscopic haematuria often segregates with mutations of COL4A3, COL4A4 or COL4A5 but in half of families a gene is not identified. We investigated a Cypriot family with autosomal dominant microscopic haematuria with renal failure and kidney cysts. We used genome-wide linkage analysis, whole exome sequencing and cosegregation analyses. We identified a novel frameshift mutation, c.4611_4612insG:p.T1537fs, in exon 49 of COL4A1. This mutation predicts truncation of the protein with disruption of the C-terminal part of the NC1 domain. We confirmed its presence in 20 family members, 17 with confirmed haematuria, 5 of whom also had stage 4 or 5 chronic kidney disease. Eleven family members exhibited kidney cysts (55% of those with the mutation), but muscle cramps or cerebral aneurysms were not observed and serum creatine kinase was normal in all individuals tested. Missense mutations of COL4A1 that encode the CB3 [IV] segment of the triple helical domain (exons 24 and 25) are associated with HANAC syndrome (hereditary angiopathy, nephropathy, aneurysms and cramps). Missense mutations of COL4A1 that disrupt the NC1 domain are associated with antenatal cerebral haemorrhage and porencephaly, but not kidney disease. Our findings extend the spectrum of COL4A1 mutations linked with renal disease and demonstrate that the highly conserved C-terminal part of the NC1 domain of the α1 chain of type IV collagen is important in the integrity of glomerular basement membrane in humans. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA.

  13. A frame-shift mutation of PMS2 is a widespread cause of Lynch syndrome

    DEFF Research Database (Denmark)

    Clendenning, Mark; Senter, Leigha; Hampel, Heather

    2008-01-01

    BACKGROUND: When compared to the other mismatch repair genes involved in Lynch syndrome, the identification of mutations within PMS2 has been limited (... are caused by PMS2. This disparity is primarily due to complications in the study of this gene caused by interference from pseudogene sequences. METHODS: Using a recently developed method for detecting PMS2 specific mutations, we have screened 99 patients who are likely candidates for PMS2 mutations based...

  14. Tigecycline resistance in Acinetobacter baumannii mediated by frameshift mutation in plsC, encoding 1-acyl-sn-glycerol-3-phosphate acyltransferase.

    Science.gov (United States)

    Li, X; Liu, L; Ji, J; Chen, Q; Hua, X; Jiang, Y; Feng, Y; Yu, Y

    2015-03-01

    Acinetobacter baumannii is an important pathogen of healthcare-associated infections and shows multidrug resistance. With the increasing application of tigecycline, isolates resistant to this antibiotic are of growing concern clinically. However, the definitive mechanism of tigecycline resistance remains unclear. To explore the mechanism of tigecycline resistance in A. baumannii, a tigecycline-resistant strain was obtained by increasing the concentration of the antimicrobial in liquid culture. Three mutations were identified by the whole genome comparison, including one synonymous substitution in a hypothetical protein and a frameshift mutation in plsC and omp38. The plsC gene was confirmed to cause decreased susceptibility to tigecycline by a complementation experiment and cellular membrane change was detected by flow cytometry. By measuring the relative growth rate, the fitness cost of plsC was estimated to be approximately 8 %. In conclusion, plsC was found to play an important role in tigecycline resistance in A. baumannii. The minor fitness cost of plsC indicates a high risk of the emergence and development of tigecycline resistance in A. baumannii.

  15. Novel frameshift mutation in theKCNQ1gene responsible for Jervell and Lange-Nielsen syndrome.

    Science.gov (United States)

    Amirian, Azam; Dalili, Seyed Mohammad; Zafari, Zahra; Saber, Siamak; Karimipoor, Morteza; Akbari, Vahid; Fazelifar, Amir Farjam; Zeinali, Sirous

    2018-01-01

    Jervell and Lange-Nielsen syndrome is an autosomal recessive disorder caused by mutations in KCNQ1 or KCNE1 genes. The disease is characterized by sensorineural hearing loss and long QT syndrome. Here we present a 3.5-year-old female patient, an offspring of consanguineous marriage, who had a history of recurrent syncope and congenital sensorineural deafness. The patient and the family members were screened for mutations in KCNQ1 gene by linkage analysis and DNA sequencing. DNA sequencing showed a c.1532_1534delG (p. A512Pfs*81) mutation in the KCNQ1 gene in homozygous form. The results of short tandem repeat (STR) markers showed that the disease in the family is linked to the KCNQ1 gene. The mutation was confirmed in the parents in heterozygous form. This is the first report of this variant in KCNQ1 gene in an Iranian family. The data of this study could be used for early diagnosis of the condition in the family and genetic counseling.

  16. DVL1 frameshift mutations clustering in the penultimate exon cause autosomal-dominant Robinow syndrome

    DEFF Research Database (Denmark)

    White, Janson; Mazzeu, Juliana F; Hoischen, Alexander

    2015-01-01

    -canonical signaling gene WNT5A underlie a subset of autosomal-dominant Robinow syndrome (DRS) cases, but most individuals with DRS remain without a molecular diagnosis. We performed whole-exome sequencing in four unrelated DRS-affected individuals without coding mutations in WNT5A and found heterozygous DVL1 exon 14...... in our study suggest that truncation of the C-terminal domain of DVL1, a protein hypothesized to have a downstream role in the Wnt-5a non-canonical pathway, is a common cause of DRS....

  17. A cis-eQTL of HLA-DRB1 and a frameshift mutation of MICA contribute to the pattern of association of HLA alleles with cervical cancer.

    Science.gov (United States)

    Chen, Dan; Gyllensten, Ulf

    2014-04-01

    The association of classic human leukocyte antigen (HLA) alleles with risk of cervical cancer has been extensively studied, and a protective effect has consistently been found for DRB1*1301, DQA1*0103, and/or DQB1*0603 (these three alleles are in perfect linkage disequilibrium [LD] and often occur on the same haplotype in Europeans), while reports have differed widely with respect to the effect of HLA-B*07, DRB1*1501, and/or DQB1*0602 (the last two alleles are also in perfect LD in Europeans). It is not clear whether the reported HLA alleles are responsible for the differences in cervical cancer susceptibility, or if functional variants at other locations within the major histocompatibility complex (MHC) region may explain the effect. In order to assess the relative contribution of both classic HLA alleles and single-nucleotide polymorphisms (SNPs) within the MHC region to cervical cancer susceptibility, we have imputed classic HLA alleles in 1034 cervical cancer patients and 3948 controls in a Swedish population for an integrated analysis. We found that the protective haplotype DRB1*1301-DQA1*0103-DQB1*0603 has a direct effect on cervical cancer and always occurs together with the C allele of a HLA-DRB1 cis-eQTL (rs9272143), which increases the expression of HLA-DRB1. The haplotype rs9272143C-DRB1*1301-DQA1*0103-DQB1*0603 conferred the strongest protection against cervical cancer (odds ratio [OR] = 0.41, 95% confidence interval [CI] = 0.32-0.52, P = 6.2 × 10(-13)). On the other hand, the associations with HLA-B*0702 and DRB1*1501-DQB1*0602 are attributable to the joint effects of both the HLA-DRB1 cis-eQTL (rs9272143) and a frameshift mutation (G inserion of rs67841474, also known as A5.1) of the MHC class I polypeptide-related sequence A gene (MICA). Variation in LD between the classic HLA loci, rs9272143 and rs67841474 between populations may explain the different associations of HLA-B*07 and DRB1*1501-DQB1*0602 with cervical cancer between studies. The

  18. Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa [version 2; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Shamsudheen Karuthedath Vellarikkal

    2016-07-01

    Full Text Available Dystrophic epidermolysis bullosa simplex (DEB is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES. Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India.

  19. Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa [version 1; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Shamsudheen Karuthedath Vellarikkal

    2016-05-01

    Full Text Available Dystrophic epidermolysis bullosa simplex (DEB is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES. Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India.

  20. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang [Univ. of Illinois, Chicago, IL (United States)

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  1. An Exon-Based Comparative Variant Analysis Pipeline to Study the Scale and Role of Frameshift and Nonsense Mutation in the Human-Chimpanzee Divergence

    OpenAIRE

    Yu, GongXin

    2009-01-01

    Chimpanzees and humans are closely related but differ in many deadly human diseases and other characteristics in physiology, anatomy, and pathology. In spite of decades of extensive research, crucial questions about the molecular mechanisms behind the differences are yet to be understood. Here I report ExonVar, a novel computational pipeline for Exon-based human-chimpanzee comparative Variant analysis. The objective is to comparatively analyze mutations specifically those that caused th...

  2. Increased bone turnover, osteoporosis, progressive tibial bowing, fractures, and scoliosis in a patient with a final-exon SATB2 frameshift mutation.

    Science.gov (United States)

    Boone, Philip M; Chan, Yiu Man; Hunter, Jill V; Pottkotter, Louis E; Davino, Nelson A; Yang, Yaping; Beuten, Joke; Bacino, Carlos A

    2016-11-01

    Haploinsufficiency of SATB2 causes cleft palate, intellectual disability with deficient speech, facial and dental abnormalities, and other variable features known collectively as SATB2-associated syndrome. This phenotype was accompanied by osteoporosis, fractures, and tibial bowing in two previously reported adult patients; each possessed SATB2 mutations either predicted or demonstrated to escape nonsense-mediated decay, suggesting that the additional bone defects result from a dominant negative effect and/or age-dependent penetrance. These hypotheses remain to be confirmed, as do the specific downstream defects causing bone abnormalities. We report a SATB2 mutation (c.2018dupA; p.(H673fs)) in a 15-year-old patient whose SATB2-associated syndrome phenotype is accompanied by osteoporosis, fractures, progressive tibial bowing, and scoliosis. As this homeodomain-disrupting and predicted truncating mutation resides within the final exon of SATB2, escape from nonsense-mediated decay is likely. Thus, we provide further evidence of bone phenotypes beyond those typically associated with SATB2-associated syndrome in individuals with potential dominant-negative SATB2 alleles, as well as evidence for age-dependence of bone features. Elevations in alkaline phosphatase, urinary N-telopeptide/creatinine ratio, and osteocalcin in the patient indicate increased bone turnover. We propose surveillance and treatment with osteoclast inhibitors to prevent fractures and to slow progressive bone deformities. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. An Exon-Based Comparative Variant Analysis Pipeline to Study the Scale and Role of Frameshift and Nonsense Mutation in the Human-Chimpanzee Divergence

    Directory of Open Access Journals (Sweden)

    GongXin Yu

    2009-01-01

    important biological processes such as T cell lineage development, the pathogenesis of inflammatory diseases, and antigen induced cell death. A “less-is-more” model was previously established to illustrate the role of the gene inactivation and disruptions during human evolution. Here this analysis suggested a different model where the chimpanzee-specific exon-disrupting mutations may act as additional evolutionary force that drove the human-chimpanzee divergence. Finally, the analysis revealed a number of sequencing errors in the chimpanzee and human genome sequences and further illustrated that they could be corrected without resequencing.

  4. Alternative splicing and tissue-specific elastin misassembly act as biological modifiers of human elastin gene frameshift mutations associated with dominant cutis laxa.

    Science.gov (United States)

    Sugitani, Hideki; Hirano, Eiichi; Knutsen, Russell H; Shifren, Adrian; Wagenseil, Jessica E; Ciliberto, Christopher; Kozel, Beth A; Urban, Zsolt; Davis, Elaine C; Broekelmann, Thomas J; Mecham, Robert P

    2012-06-22

    Elastin is the extracellular matrix protein in vertebrates that provides elastic recoil to blood vessels, the lung, and skin. Because the elastin gene has undergone significant changes in the primate lineage, modeling elastin diseases in non-human animals can be problematic. To investigate the pathophysiology underlying a class of elastin gene mutations leading to autosomal dominant cutis laxa, we engineered a cutis laxa mutation (single base deletion) into the human elastin gene contained in a bacterial artificial chromosome. When expressed as a transgene in mice, mutant elastin was incorporated into elastic fibers in the skin and lung with adverse effects on tissue function. In contrast, only low levels of mutant protein incorporated into aortic elastin, which explains why the vasculature is relatively unaffected in this disease. RNA stability studies found that alternative exon splicing acts as a modifier of disease severity by influencing the spectrum of mutant transcripts that survive nonsense-mediated decay. Our results confirm the critical role of the C-terminal region of tropoelastin in elastic fiber assembly and suggest tissue-specific differences in the elastin assembly pathway.

  5. Alternative Splicing and Tissue-specific Elastin Misassembly Act as Biological Modifiers of Human Elastin Gene Frameshift Mutations Associated with Dominant Cutis Laxa*

    Science.gov (United States)

    Sugitani, Hideki; Hirano, Eiichi; Knutsen, Russell H.; Shifren, Adrian; Wagenseil, Jessica E.; Ciliberto, Christopher; Kozel, Beth A.; Urban, Zsolt; Davis, Elaine C.; Broekelmann, Thomas J.; Mecham, Robert P.

    2012-01-01

    Elastin is the extracellular matrix protein in vertebrates that provides elastic recoil to blood vessels, the lung, and skin. Because the elastin gene has undergone significant changes in the primate lineage, modeling elastin diseases in non-human animals can be problematic. To investigate the pathophysiology underlying a class of elastin gene mutations leading to autosomal dominant cutis laxa, we engineered a cutis laxa mutation (single base deletion) into the human elastin gene contained in a bacterial artificial chromosome. When expressed as a transgene in mice, mutant elastin was incorporated into elastic fibers in the skin and lung with adverse effects on tissue function. In contrast, only low levels of mutant protein incorporated into aortic elastin, which explains why the vasculature is relatively unaffected in this disease. RNA stability studies found that alternative exon splicing acts as a modifier of disease severity by influencing the spectrum of mutant transcripts that survive nonsense-mediated decay. Our results confirm the critical role of the C-terminal region of tropoelastin in elastic fiber assembly and suggest tissue-specific differences in the elastin assembly pathway. PMID:22573328

  6. Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

    Science.gov (United States)

    Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

    2018-03-01

    There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

  7. Dynamic pathways of -1 translational frameshifting.

    Science.gov (United States)

    Chen, Jin; Petrov, Alexey; Johansson, Magnus; Tsai, Albert; O'Leary, Seán E; Puglisi, Joseph D

    2014-08-21

    Spontaneous changes in the reading frame of translation are rare (frequency of 10(-3) to 10(-4) per codon), but can be induced by specific features in the messenger RNA (mRNA). In the presence of mRNA secondary structures, a heptanucleotide 'slippery sequence' usually defined by the motif X XXY YYZ, and (in some prokaryotic cases) mRNA sequences that base pair with the 3' end of the 16S ribosomal rRNA (internal Shine-Dalgarno sequences), there is an increased probability that a specific programmed change of frame occurs, wherein the ribosome shifts one nucleotide backwards into an overlapping reading frame (-1 frame) and continues by translating a new sequence of amino acids. Despite extensive biochemical and genetic studies, there is no clear mechanistic description for frameshifting. Here we apply single-molecule fluorescence to track the compositional and conformational dynamics of individual ribosomes at each codon during translation of a frameshift-inducing mRNA from the dnaX gene in Escherichia coli. Ribosomes that frameshift into the -1 frame are characterized by a tenfold longer pause in elongation compared to non-frameshifted ribosomes, which translate through unperturbed. During the pause, interactions of the ribosome with the mRNA stimulatory elements uncouple EF-G catalysed translocation from normal ribosomal subunit reverse-rotation, leaving the ribosome in a non-canonical intersubunit rotated state with an exposed codon in the aminoacyl-tRNA site (A site). tRNA(Lys) sampling and accommodation to the empty A site and EF-G action either leads to the slippage of the tRNAs into the -1 frame or maintains the ribosome into the 0 frame. Our results provide a general mechanistic and conformational framework for -1 frameshifting, highlighting multiple kinetic branchpoints during elongation.

  8. A case of cerebrotendinous xanthomatosis mimicking the clinical phenotype of mitochondrial disease with a novel frame-shift mutation (c. 43_44 delGG) in CYP27A1 gene exon 1.

    Science.gov (United States)

    Koge, Junpei; Hayashi, Shintaro; Yamaguchi, Hiroo; Tateishi, Takahisa; Murai, Hiroyuki; Kira, Jun-Ichi

    2016-10-28

    A 37-old-male with a history of early childhood mental retardation was admitted to our hospital. He experienced recurrent syncopes at 23 years old, and at age 35 gait disturbance and hearing impairment developed gradually and worsened over time. His grandparents were in a consanguineous marriage. He was of short stature and absent of tendon xanthomas. Neurological examinations revealed scanning speech, dysphagia, right sensorineural hearing loss, spasticity in both upper and lower extremities, and spastic gait. Tendon reflexes were brisk throughout, and Babinski and Chaddock reflexes were both positive bilaterally. Laboratory tests revealed elevated lactate and pyruvate concentrations in both serum and cerebrospinal fluid. Fluid attenuated inversion recovery magnetic resonance imaging showed high intensity lesions in the bilateral cerebellar hemispheres, pyramidal tracts in the brainstem, and internal capsules symmetrically. Brain magnetic resonance spectroscopy measurements revealed an elevated lactate/creatine plus phosphocreatine ratio and a decreased N-acetyl-aspartate/creatine plus phosphocreatine ratio in the cerebellum. At this point, mitochondrial diseases, particularly myoclonic epilepsy with ragged-red fibers (MERRF), to be the most likely cause. We performed a biopsy of his left biceps brachii muscle, showing variations in fiber size with occasional central nuclei and very few ragged-red fibers. Blood mitochondrial respiratory enzyme assays showed normal values with elevated citrate synthase activity, and mitochondrial DNA analyses for MERRF revealed no pathogenic mutations. We then explored other possibilities and detected an elevated serum cholestanol concentration of 20.4 μg/ml (reference value CYP27A1 gene exon1, leading to a diagnosis of cerebrotendinous xanthomatosis (CTX). This case emphasizes importance of awareness of CTX as a possibility when patients present with clinical phenotypes mimicking mitochondrial diseases, but with negative

  9. Evidence for a Rad18-independent frameshift mutagenesis pathway in human cell-free extracts.

    Directory of Open Access Journals (Sweden)

    Régine Janel-Bintz

    Full Text Available Bypass of replication blocks by specialized DNA polymerases is crucial for cell survival but may promote mutagenesis and genome instability. To gain insight into mutagenic sub-pathways that coexist in mammalian cells, we examined N-2-acetylaminofluorene (AAF-induced frameshift mutagenesis by means of SV40-based shuttle vectors containing a single adduct. We found that in mammalian cells, as previously observed in E. coli, modification of the third guanine of two target sequences, 5'-GGG-3' (3G and 5'-GGCGCC-3' (NarI site, induces -1 and -2 frameshift mutations, respectively. Using an in vitro assay for translesion synthesis, we investigated the biochemical control of these events. We showed that Pol eta, but neither Pol iota nor Pol zeta, plays a major role in the frameshift bypass of the AAF adduct located in the 3G sequence. By complementing PCNA-depleted extracts with either a wild-type or a non-ubiquitinatable form of PCNA, we found that this Pol eta-mediated pathway requires Rad18 and ubiquitination of PCNA. In contrast, when the AAF adduct is located within the NarI site, TLS is only partially dependent upon Pol eta and Rad18, unravelling the existence of alternative pathways that concurrently bypass this lesion.

  10. A novel FLNC frameshift and an OBSCN variant in a family with distal muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Rossi, Daniela; Palmio, Johanna; EvilaÈ, Anni; Galli, Lucia; Barone, Virginia; Caldwell, Tracy A.; Policke, Rachel A.; Aldkheil, Esraa; Berndsen, Christopher E.; Wright, Nathan T.; Malfatti, Edoardo; Brochier, Guy; Pierantozzi, Enrico; Jordanova, Albena; Guergueltcheva, Velina; Romero, Norma Beatriz; Hackman, Peter; Eymard, Bruno; Udd, Bjarne; Sorrentino, Vincenzo (Antwerp); (U. Sofia); (Siena); (Tampere); (J Madison); (Helsinki)

    2017-10-26

    A novel FLNC c.5161delG (p.Gly1722ValfsTer61) mutation was identified in two members of a French family affected by distal myopathy and in one healthy relative. This FLNC c.5161delG mutation is one nucleotide away from a previously reported FLNC mutation (c.5160delC) that was identified in patients and in asymptomatic carriers of three Bulgarian families with distal muscular dystrophy, indicating a low penetrance of the FLNC frameshift mutations. Given these similarities, we believe that the two FLNC mutations alone can be causative of distal myopathy without full penetrance. Moreover, comparative analysis of the clinical manifestations indicates that patients of the French family show an earlier onset and a complete segregation of the disease. As a possible explanation of this, the two French patients also carry a OBSCN c.13330C>T (p.Arg4444Trp) mutation. The p.Arg4444Trp variant is localized within the OBSCN Ig59 domain that, together with Ig58, binds to the ZIg9/ZIg10 domains of titin at Z-disks. Structural and functional studies indicate that this OBSCN p.Arg4444Trp mutation decreases titin binding by ~15-fold. On this line, we suggest that the combination of the OBSCN p.Arg4444Trp variant and of the FLNC c.5161delG mutation, can cooperatively affect myofibril stability and increase the penetrance of muscular dystrophy in the French family.

  11. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  12. Model of the pathway of −1 frameshifting: Long pausing

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2016-03-01

    Full Text Available It has been characterized that the programmed ribosomal −1 frameshifting often occurs at the slippery sequence on the presence of a downstream mRNA pseudoknot. In some prokaryotic cases such as the dnaX gene of Escherichia coli, an additional stimulatory signal—an upstream, internal Shine–Dalgarno (SD sequence—is also necessary to stimulate the efficient −1 frameshifting. However, the molecular and physical mechanism of the −1 frameshifting is poorly understood. Here, we propose a model of the pathway of the −1 translational frameshifting during ribosome translation of the dnaX −1 frameshift mRNA. With the model, the single-molecule fluorescence data (Chen et al. (2014 [29] on the dynamics of the shunt either to long pausing or to normal translation, the tRNA transit and sampling dynamics in the long-paused rotated state, the EF-G sampling dynamics, the mean rotated-state lifetimes, etc., are explained quantitatively. Moreover, the model is also consistent with the experimental data (Yan et al. (2015 [30] on translocation excursions and broad branching of frameshifting pathways. In addition, we present some predicted results, which can be easily tested by future optical trapping experiments.

  13. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    Directory of Open Access Journals (Sweden)

    Suneeth F Mathew

    Full Text Available HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon' contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1.

  14. Mutasi titik hingga mutasi frameshift gen INSR exon 22 pada pasien penderita diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Fatchiyah Fatchiyah

    2012-02-01

    Full Text Available Mutations of human insulin and insulin receptor family can lead autosomal dominant syndrome on diabetes, fasting hyperinsulinemia, and insulin receptor family can lead autosomal dominant syndrome on diabetes, fasting hyperinsulinemia, and insulin resistant. The aim of this research was to identify mutation types of hINSR gene exon 22 which mutation hot spot region. To analyze hINSR gene exon 22 of DM patient and control, we isolated DNA from their blood. DNA was then amplified by PCR using a set of primer for exon 22. PCR product was sequenced by Sequencer and nucleotide sequence analyzed by BLAST analysis. According to Gene Bank database, hINSR gene has two variant with Gene ID 3643, at chromosome 19p13.3-p13.2, and has 22 exons with mRNA 4200bp. The result of research showed that the mutation types of hINS gene exon 22 of DM patients are point mutation, single base deletion and substitution. We found mutation of single deletion at Met eletion at Met1295 Cys1295 and Glut1300 Gly1300, also point mutation are at Met1296 Ser1296 and Trp1299 Ala1299 and Met1389 Iso1389. Because these two deletion are so close, the polypeptids sequence of these changed as frameshift mutation, normal IR has six amino acids -Met Arg Met Cys rp lut- and DM patient has differed the five amino acids - Cys Ala Ser Ala Gly. According to the mutation of DM patient, the IR protein function against tyrosine kinase become abnormal, perhaps its were correlated with genetic syndrom genetic syndrome of insulin resistance. e of insulin resistance.

  15. Structural diversity of frameshifting signals : reprogramming the programmed

    NARCIS (Netherlands)

    Yu, Chien-Hung

    2011-01-01

    Programmed ribosomal frameshifting (PRF) is one kind of recoding events that is mostly utilized by RNA viruses to synthesize more proteins with defined ratio from their compact genome and it is known that the stoichiometric is critical to virus infection and propagation. Two cis-acting RNA elements

  16. High frequency of +1 programmed ribosomal frameshifting in Euplotes octocarinatus

    OpenAIRE

    Wang, Ruanlin; Xiong, Jie; Wang, Wei; Miao, Wei; Liang, Aihua

    2016-01-01

    Programmed ?1 ribosomal frameshifting (?1 PRF) has been identified as a mechanism to regulate the expression of many viral genes and some cellular genes. The slippery site of ?1 PRF has been well characterized, whereas the +1 PRF signal and the mechanism involved in +1 PRF remain poorly understood. Previous study confirmed that +1 PRF is required for the synthesis of protein products in several genes of ciliates from the genus Euplotes. To accurately assess the frequency of genes requiring fr...

  17. An Expanded CAG Repeat in Huntingtin Causes +1 Frameshifting*

    OpenAIRE

    Saffert, Paul; Adamla, Frauke; Schieweck, Rico; Atkins, John F.; Ignatova, Zoya

    2016-01-01

    Maintenance of triplet decoding is crucial for the expression of functional protein because deviations either into the −1 or +1 reading frames are often non-functional. We report here that expression of huntingtin (Htt) exon 1 with expanded CAG repeats, implicated in Huntington pathology, undergoes a sporadic +1 frameshift to generate from the CAG repeat a trans-frame AGC repeat-encoded product. This +1 recoding is exclusively detected in pathological Htt variants, i.e. those with expanded re...

  18. Screening for calreticulin mutations in a cohort of patients suspected ...

    African Journals Online (AJOL)

    Of the 36 types of insertions and deletions identified, type 1 (a. 52-base pair deletion) and type 2 (a 5-base pair insertion) mutations account for >80% of CALR mutations.[7] Phenotypic differences between type 1 and type 2 carriers have been implicated. [3] All recurrent mutations cause a frameshift in the region encoding.

  19. Gene expression patterns of chicken neuregulin 3 in association with copy number variation and frameshift deletion.

    Science.gov (United States)

    Abe, Hideaki; Aoya, Daiki; Takeuchi, Hiro-Aki; Inoue-Murayama, Miho

    2017-07-21

    NRG3 are structural mutations that occurred before the establishment of commercial chicken lines. Our results further suggest that the putative frameshift deletion in exon 2 may potentially affect the expression level of particular isoforms of chicken NRG3.

  20. A Frameshift in CSF2RB Predominant Among Ashkenazi Jews Increases Risk for Crohn's Disease and Reduces Monocyte Signaling via GM-CSF.

    Science.gov (United States)

    Chuang, Ling-Shiang; Villaverde, Nicole; Hui, Ken Y; Mortha, Arthur; Rahman, Adeeb; Levine, Adam P; Haritunians, Talin; Evelyn Ng, Sok Meng; Zhang, Wei; Hsu, Nai-Yun; Facey, Jody-Ann; Luong, Tramy; Fernandez-Hernandez, Heriberto; Li, Dalin; Rivas, Manuel; Schiff, Elena R; Gusev, Alexander; Schumm, L Phillip; Bowen, Beatrice M; Sharma, Yashoda; Ning, Kaida; Remark, Romain; Gnjatic, Sacha; Legnani, Peter; George, James; Sands, Bruce E; Stempak, Joanne M; Datta, Lisa W; Lipka, Seth; Katz, Seymour; Cheifetz, Adam S; Barzilai, Nir; Pontikos, Nikolas; Abraham, Clara; Dubinsky, Marla J; Targan, Stephan; Taylor, Kent; Rotter, Jerome I; Scherl, Ellen J; Desnick, Robert J; Abreu, Maria T; Zhao, Hongyu; Atzmon, Gil; Pe'er, Itsik; Kugathasan, Subra; Hakonarson, Hakon; McCauley, Jacob L; Lencz, Todd; Darvasi, Ariel; Plagnol, Vincent; Silverberg, Mark S; Muise, Aleixo M; Brant, Steven R; Daly, Mark J; Segal, Anthony W; Duerr, Richard H; Merad, Miriam; McGovern, Dermot P B; Peter, Inga; Cho, Judy H

    2016-10-01

    Crohn's disease (CD) has the highest prevalence in Ashkenazi Jewish populations. We sought to identify rare, CD-associated frameshift variants of high functional and statistical effects. We performed exome sequencing and array-based genotype analyses of 1477 Ashkenazi Jewish individuals with CD and 2614 Ashkenazi Jewish individuals without CD (controls). To validate our findings, we performed genotype analyses of an additional 1515 CD cases and 7052 controls for frameshift mutations in the colony-stimulating factor 2-receptor β common subunit gene (CSF2RB). Intestinal tissues and blood samples were collected from patients with CD; lamina propria leukocytes were isolated and expression of CSF2RB and granulocyte-macrophage colony-stimulating factor-responsive cells were defined by adenomatous polyposis coli (APC) time-of-flight mass cytometry (CyTOF analysis). Variants of CSF2RB were transfected into HEK293 cells and the expression and functions of gene products were compared. In the discovery cohort, we associated CD with a frameshift mutation in CSF2RB (P = 8.52 × 10(-4)); the finding was validated in the replication cohort (combined P = 3.42 × 10(-6)). Incubation of intestinal lamina propria leukocytes with granulocyte-macrophage colony-stimulating factor resulted in high levels of phosphorylation of signal transducer and activator of transcription (STAT5) and lesser increases in phosphorylation of extracellular signal-regulated kinase and AK straining transforming (AKT). Cells co-transfected with full-length and mutant forms of CSF2RB had reduced pSTAT5 after stimulation with granulocyte-macrophage colony-stimulating factor, compared with cells transfected with control CSF2RB, indicating a dominant-negative effect of the mutant gene. Monocytes from patients with CD who were heterozygous for the frameshift mutation (6% of CD cases analyzed) had reduced responses to granulocyte-macrophage colony-stimulating factor and markedly decreased activity of

  1. Mutation induction in Haemophilus influenzae by ICR-191. Pt. 1

    International Nuclear Information System (INIS)

    Perdue, S.W.; Kimball, R.F.; McGray, P.C.; Tennessee Univ., Oak Ridge

    1981-01-01

    The investigation of mutagenic mechanisms in Haemophilus influenzae has been confined until now to mutagens that normally produce mainly base pair substitutions. This paper describes the development of a system suitable for detecting frameshift mutations induced by ICR-191. The system involves reversions from thymidine dependence to thymidine independence. Evidence is presented from a comparison of the responses to ICR-191 and to N-methyl-N'-nitro-N-nitrosoguanidine that the system is specific for frameshift mutations. The genetic recombination involved in transformation leads to a marked increase in spontaneous reversion of the frameshift mutations but not of the base substitution mutations. Presumably, this is a consequence of mispairing, with consequent change in the number of bases, during the recombination. (orig.)

  2. Programmed Ribosomal Frameshifting Mediates Expression of the α-Carboxysome.

    Science.gov (United States)

    Chaijarasphong, Thawatchai; Nichols, Robert J; Kortright, Kaitlyn E; Nixon, Charlotte F; Teng, Poh K; Oltrogge, Luke M; Savage, David F

    2016-01-16

    Many bacteria employ a protein organelle, the carboxysome, to catalyze carbon dioxide fixation in the Calvin Cycle. Only 10 genes from Halothiobacillus neapolitanus are sufficient for heterologous expression of carboxysomes in Escherichia coli, opening the door to detailed mechanistic analysis of the assembly process of this complex (more than 200MDa). One of these genes, csoS2, has been implicated in assembly but ascribing a molecular function is confounded by the observation that the single csoS2 gene yields expression of two gene products and both display an apparent molecular weight incongruent with the predicted amino acid sequence. Here, we elucidate the co-translational mechanism responsible for the expression of the two protein isoforms. Specifically, csoS2 was found to possess -1 frameshifting elements that lead to the production of the full-length protein, CsoS2B, and a truncated protein, CsoS2A, which possesses a C-terminus translated from the alternate frame. The frameshifting elements comprise both a ribosomal slippery sequence and a 3' secondary structure, and ablation of either sequence is sufficient to eliminate the slip. Using these mutants, we investigated the individual roles of CsoS2B and CsoS2A on carboxysome formation. In this in vivo formation assay, cells expressing only the CsoS2B isoform were capable of producing intact carboxysomes, while those with only CsoS2A were not. Thus, we have answered a long-standing question about the nature of CsoS2 in this model microcompartment and demonstrate that CsoS2B is functionally distinct from CsoS2A in the assembly of α-carboxysomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Evaluation of point mutations in dystrophin gene in Iranian ...

    Indian Academy of Sciences (India)

    Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants. [Haghshenas M., Akbari M. T., Zare Karizi S., Khordadpoor Deilamani F., Nafissi S. and Salehi Z. 2016 Evaluation of point mutations in dystrophin gene in Iranian Duchenne and Becker muscular ...

  4. Overlapping genetic codes for overlapping frameshifted genes in Testudines, and Lepidochelys olivacea as special case.

    Science.gov (United States)

    Seligmann, Hervé

    2012-12-01

    Mitochondrial genes code for additional proteins after +2 frameshifts by reassigning stops to code for amino acids, which defines overlapping genetic codes for overlapping genes. Turtles recode stops UAR → Trp and AGR → Lys (AGR → Gly in the marine Olive Ridley turtle, Lepidochelys olivacea). In Lepidochelys the +2 frameshifted mitochondrial Cytb gene lacks stops, open reading frames from other genes code for unknown proteins, and for regular mitochondrial proteins after frameshifts according to the overlapping genetic code. Lepidochelys' inversion between proteins coded by regular and overlapping genetic codes substantiates the existence of overlap coding. ND4 differs among Lepidochelys mitochondrial genomes: it is regular in DQ486893; in NC_011516, the open reading frame codes for another protein, the regular ND4 protein is coded by the frameshifted sequence reassigning stops as in other turtles. These systematic patterns are incompatible with Genbank/sequencing errors and DNA decay. Random mixing of synonymous codons, conserving main frame coding properties, shows optimization of natural sequences for overlap coding; Ka/Ks analyses show high positive (directional) selection on overlapping genes. Tests based on circular genetic codes confirm programmed frameshifts in ND3 and ND4l genes, and predicted frameshift sites for overlap coding in Lepidochelys. Chelonian mitochondria adapt for overlapping gene expression: cloverleaf formation by antisense tRNAs with predicted anticodons matching stops coevolves with overlap coding; antisense tRNAs with predicted expanded anticodons (frameshift suppressor tRNAs) associate with frameshift-coding in ND3 and ND4l, a potential regulation of frameshifted overlap coding. Anaeroby perhaps switched between regular and overlap coding genes in Lepidochelys. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Screening for BRCA2 mutations in 81 Dutch breast-ovarian cancer families

    NARCIS (Netherlands)

    Peelen, T.; van Vliet, M.; Bosch, A.; Bignell, G.; Vasen, H. F.; Klijn, J. G.; Meijers-Heijboer, H.; Stratton, M.; van Ommen, G. J.; Cornelisse, C. J.; Devilee, P.

    2000-01-01

    We have analysed 81 families with a history of breast and/or ovarian cancer for the presence of germline mutations in BRCA2 with a number of different mutation screening techniques. The protein truncation test (PTT) for exons 10 and 11 detected four different frame-shifting mutations in six of these

  6. A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

    Directory of Open Access Journals (Sweden)

    Alexandre Bolze

    Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

  7. Expanding the Mutation Spectrum of Ichthyosis with Confetti.

    Science.gov (United States)

    Lim, Young H; Choate, Keith A

    2016-10-01

    Ichthyosis with confetti is a rare, autosomal dominant disorder caused by frameshift mutations in KRT10 or KRT1 and characterized by the development of white, genetically revertant macules in red, diseased skin. All cases result from mutations affecting the tail domains of keratin-10 or keratin-1, and Suzuki et al. expand the mutation spectrum for ichthyosis with confetti caused by mutations in KRT1, showing that a polyarginine frameshift in the keratin-1 tail can also cause this disorder. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. HIV-1 and Human PEG10 Frameshift Elements Are Functionally Distinct and Distinguished by Novel Small Molecule Modulators.

    Directory of Open Access Journals (Sweden)

    Tony S Cardno

    Full Text Available Frameshifting during translation of viral or in rare cases cellular mRNA results in the synthesis of proteins from two overlapping reading frames within the same mRNA. In HIV-1 the protease, reverse transcriptase, and integrase enzymes are in a second reading frame relative to the structural group-specific antigen (gag, and their synthesis is dependent upon frameshifting. This ensures that a strictly regulated ratio of structural proteins and enzymes, which is critical for HIV-1 replication and viral infectivity, is maintained during protein synthesis. The frameshift element in HIV-1 RNA is an attractive target for the development of a new class of anti HIV-1 drugs. However, a number of examples are now emerging of human genes using -1 frameshifting, such as PEG10 and CCR5. In this study we have compared the HIV-1 and PEG10 frameshift elements and shown they have distinct functional characteristics. Frameshifting occurs at several points within each element. Moreover, frameshift modulators that were isolated by high-throughput screening of a library of 114,000 lead-like compounds behaved differently with the PEG10 frameshift element. The most effective compounds affecting the HIV-1 element enhanced frameshifting by 2.5-fold at 10 μM in two different frameshift reporter assay systems. HIV-1 protease:gag protein ratio was affected by a similar amount in a specific assay of virally-infected cultured cell, but the modulation of frameshifting of the first-iteration compounds was not sufficient to show significant effects on viral infectivity. Importantly, two compounds did not affect frameshifting with the human PEG10 element, while one modestly inhibited rather than enhanced frameshifting at the human element. These studies indicate that frameshift elements have unique characteristics that may allow targeting of HIV-1 and of other viruses specifically for development of antiviral therapeutic molecules without effect on human genes like PEG10 that

  9. Recombinant tagging system using ribosomal frameshifting to monitor protein expression.

    Science.gov (United States)

    Han, Se Jong; Cho, Sayeon; Lowehhaupt, Ky; Park, So-Young; Sim, Sang Jun; Kim, Yang-Gyun

    2013-03-01

    For rapid and accurate quantitation of recombinant proteins during expression and after purification, we introduce a new tagging strategy that expresses both target proteins and limitedly tagged target proteins together in a single cell at a constant ratio by utilizing cis-elements of programmed -1 ribosomal frameshifting (-1RFS) as an embedded device. -1RFS is an alternative reading mechanism that effectively controls protein expression by many viruses. When a target gene is fused to the enhanced green fluorescent protein (EGFP) gene with a -1RFS element implanted between them, the unfused target and the target-GFP fusion proteins are expressed at a fixed ratio. The expression ratio between these two protein products is adjustable simply by changing -1RFS signals. This limited-tagging system would be valuable for the real-time monitoring of protein expression when optimizing expression condition for a new protein, and in monitoring large-scale bioprocesses without a large metabolic burden on host cells. Furthermore, this strategy allows for the direct measurement of the quantity of a protein on a chip surface and easy application to proteomewide study of gene products. Copyright © 2012 Wiley Periodicals, Inc.

  10. Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting

    DEFF Research Database (Denmark)

    Hansen, Thomas Møller; Reihani, S Nader S; Oddershede, Lene B

    2007-01-01

    downstream from the slippery sequence. Although the mechanism is not well understood, frameshifting is known to be stimulated by an mRNA structure such as a pseudoknot. Here, we show that the efficiency of frameshifting relates to the mechanical strength of the pseudoknot. Two pseudoknots derived from...... of frameshifting required a nearly 2-fold larger unfolding force than the other. The observed energy difference cannot be accounted for by any existing model. We propose that the degree of ribosomal frameshifting is related to the mechanical strength of RNA pseudoknots. Our observations support the "9 A model......" that predicts some physical barrier is needed to force the ribosome into the -1 frame. Also, our findings support the recent observation made by cryoelectron microscopy that mechanical interaction between a ribosome and a pseudoknot causes a deformation of the A-site tRNA. The result has implications...

  11. FSscan: a mechanism-based program to identify +1 ribosomal frameshift hotspots

    OpenAIRE

    Liao, Pei-Yu; Choi, Yong Seok; Lee, Kelvin H.

    2009-01-01

    In +1 programmed ribosomal frameshifting (PRF), ribosomes skip one nucleotide toward the 3?-end during translation. Most of the genes known to demonstrate +1 PRF have been discovered by chance or by searching homologous genes. Here, a bioinformatic framework called FSscan is developed to perform a systematic search for potential +1 frameshift sites in the Escherichia coli genome. Based on a current state of the art understanding of the mechanism of +1 PRF, FSscan calculates scores for a 16-nt...

  12. SHIFT: server for hidden stops analysis in frame-shifted translation.

    Science.gov (United States)

    Gupta, Arun; Singh, Tiratha Raj

    2013-02-23

    Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

  13. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    Science.gov (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-06

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Common Β- Thalassaemia Mutations in

    Directory of Open Access Journals (Sweden)

    P Azarfam

    2005-01-01

    Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.

  15. TNF Lectin-Like Domain Restores Epithelial Sodium Channel Function in Frameshift Mutants Associated with Pseudohypoaldosteronism Type 1B

    Directory of Open Access Journals (Sweden)

    Anita Willam

    2017-05-01

    Full Text Available Previous in vitro studies have indicated that tumor necrosis factor (TNF activates amiloride-sensitive epithelial sodium channel (ENaC current through its lectin-like (TIP domain, since cyclic peptides mimicking the TIP domain (e.g., solnatide, showed ENaC-activating properties. In the current study, the effects of TNF and solnatide on individual ENaC subunits or ENaC carrying mutated glycosylation sites in the α-ENaC subunit were compared, revealing a similar mode of action for TNF and solnatide and corroborating the previous assumption that the lectin-like domain of TNF is the relevant molecular structure for ENaC activation. Accordingly, TNF enhanced ENaC current by increasing open probability of the glycosylated channel, position N511 in the α-ENaC subunit being identified as the most important glycosylation site. TNF significantly increased Na+ current through ENaC comprising only the pore forming subunits α or δ, was less active in ENaC comprising only β-subunits, and showed no effect on ENaC comprising γ-subunits. TNF did not increase the membrane abundance of ENaC subunits to the extent observed with solnatide. Since the α-subunit is believed to play a prominent role in the ENaC current activating effect of TNF and TIP, we investigated whether TNF and solnatide can enhance αβγ-ENaC current in α-ENaC loss-of-function frameshift mutants. The efficacy of solnatide has been already proven in pathological conditions involving ENaC in phase II clinical trials. The frameshift mutations αI68fs, αT169fs, αP197fs, αE272fs, αF435fs, αR438fs, αY447fs, αR448fs, αS452fs, and αT482fs have been reported to cause pseudohypoaldosteronism type 1B (PHA1B, a rare, life-threatening, salt-wasting disease, which hitherto has been treated only symptomatically. In a heterologous expression system, all frameshift mutants showed significantly reduced amiloride-sensitive whole-cell current compared to wild type αβγ-ENaC, whereas membrane

  16. Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients

    DEFF Research Database (Denmark)

    Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J

    2013-01-01

    Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic...

  17. Enhancement of +1 frameshift by polyamines during translation of polypeptide release factor 2 in Escherichia coli.

    Science.gov (United States)

    Higashi, Kyohei; Kashiwagi, Keiko; Taniguchi, Shiho; Terui, Yusuke; Yamamoto, Kaneyoshi; Ishihama, Akira; Igarashi, Kazuei

    2006-04-07

    Polypeptide release factor 2 (RF2) in Escherichia coli is known to be synthesized by a +1 frameshift at the 26th UGA codon of RF2 mRNA. Polyamines were found to stimulate the +1 frameshift of RF2 synthesis, an effect that was reduced by excess RF2. Polyamine stimulation of +1 frameshift of RF2 synthesis was observed at the early logarithmic phase, which is the important phase in determination of the overall rate of cell growth. A Shine-Dalgarno-like sequence was necessary for an efficient +1 frameshift of RF2 synthesis, but not for polyamine stimulation. Spectinomycin, tetracycline, streptomycin, and neomycin reduced polyamine stimulation of the +1 frameshift of RF2 synthesis. The results suggest that a structural change of the A site on 30 S ribosomal subunits is important for polyamine stimulation of the +1 frameshift. The level of mRNAs of ribosomal proteins and elongation factors having UAA as termination codon was enhanced by polyamines, and OppA synthesis from OppA mRNA having UAA as termination codon was more enhanced by polyamines than that from OppA mRNA having a UGA termination codon. Furthermore, synthesis of ribosomal protein L20 and elongation factor G from the mRNAs having a UAA termination codon was enhanced by polyamines at the level of translation and transcription. The results suggest that some protein synthesis from mRNAs having a UAA termination codon is enhanced at the level of translation through polyamine stimulation of +1 frameshift of RF2 synthesis. It is concluded that prfB encoding RF2 is a new member of the polyamine modulon.

  18. A novel founder MYO15A frameshift duplication is the major cause of genetic hearing loss in Oman.

    Science.gov (United States)

    Palombo, Flavia; Al-Wardy, Nadia; Ruscone, Guido Alberto Gnecchi; Oppo, Manuela; Kindi, Mohammed Nasser Al; Angius, Andrea; Al Lamki, Khalsa; Girotto, Giorgia; Giangregorio, Tania; Benelli, Matteo; Magi, Alberto; Seri, Marco; Gasparini, Paolo; Cucca, Francesco; Sazzini, Marco; Al Khabori, Mazin; Pippucci, Tommaso; Romeo, Giovanni

    2017-02-01

    The increased risk for autosomal recessive disorders is one of the most well-known medical implications of consanguinity. In the Sultanate of Oman, a country characterized by one of the highest rates of consanguineous marriages worldwide, prevalence of genetic hearing loss (GHL) is estimated to be 6/10 000. Families of GHL patients have higher consanguinity rates than the general Omani population, indicating a major role for recessive forms. Mutations in GJB2, the most commonly mutated GHL gene, have been sporadically described. We collected 97 DNA samples of GHL probands, affected/unaffected siblings and parents from 26 Omani consanguineous families. Analyzing a first family by whole-exome sequencing, we identified a novel homozygous frameshift duplication (c.1171_1177dupGCCATCT) in MYO15A, the gene linked to the deafness locus DFNB3. This duplication was then found in a total of 8/26 (28%) families, within a 849 kb founder haplotype. Reconstruction of haplotype structure at MYO15A surrounding genomic regions indicated that the founder haplotype branched out in the past two to three centuries from a haplotype present worldwide. The MYO15A duplication emerges as the major cause of GHL in Oman. These findings have major implications for the design of GHL diagnosis and prevention policies in Oman.

  19. Novel compound heterozygous frameshift mutations of C2orf37 in a ...

    Indian Academy of Sciences (India)

    Woodhouse–Sakati syndrome (WSS, MIM: 241080), a rare autosomal recessive disorder characterized by hypogo- nadism, alopecia, diabetes mellitus, mental retardation and extrapyramidal manifestations, was first described in a few consanguineous Saudi families (Woodhouse and Sakati. 1983) and is now recognized in ...

  20. Transcriptional profile analysis of RPGRORF15 frameshift mutation identifies novel genes associated with retinal degeneration.

    Science.gov (United States)

    Genini, Sem; Zangerl, Barbara; Slavik, Julianna; Acland, Gregory M; Beltran, William A; Aguirre, Gustavo D

    2010-11-01

    To identify genes and molecular mechanisms associated with photoreceptor degeneration in a canine model of XLRP caused by an RPGR exon ORF15 microdeletion. Methods. Expression profiles of mutant and normal retinas were compared by using canine retinal custom cDNA microarrays. qRT-PCR, Western blot analysis, and immunohistochemistry (IHC) were applied to selected genes, to confirm and expand the microarray results. At 7 and 16 weeks, respectively, 56 and 18 transcripts were downregulated in the mutant retinas, but none were differentially expressed (DE) at both ages, suggesting the involvement of temporally distinct pathways. Downregulated genes included the known retina-relevant genes PAX6, CHML, and RDH11 at 7 weeks and CRX and SAG at 16 weeks. Genes directly or indirectly active in apoptotic processes were altered at 7 weeks (CAMK2G, NTRK2, PRKCB, RALA, RBBP6, RNF41, SMYD3, SPP1, and TUBB2C) and 16 weeks (SLC25A5 and NKAP). Furthermore, the DE genes at 7 weeks (ELOVL6, GLOD4, NDUFS4, and REEP1) and 16 weeks (SLC25A5 and TARS2) are related to mitochondrial functions. qRT-PCR of 18 genes confirmed the microarray results and showed DE of additional genes not on the array. Only GFAP was DE at 3 weeks of age. Western blot and IHC analyses also confirmed the high reliability of the transcriptomic data. Several DE genes were identified in mutant retinas. At 7 weeks, a combination of nonclassic anti- and proapoptosis genes appear to be involved in photoreceptor degeneration, whereas at both 7 and 16 weeks, the expression of mitochondria-related genes indicates that they may play a relevant role in the disease process.

  1. A novel frameshift mutation of Chediak-Higashi syndrome and treatment in the accelerated phase

    Directory of Open Access Journals (Sweden)

    X.L. Wu

    Full Text Available Chediak-Higashi syndrome (CHS is a rare autosomal recessive immunodeficiency disease characterized by frequent infections, hypopigmentation, progressive neurologic deterioration and hemophagocytic lymphohistiocytosis (HLH, known as the accelerated phase. There is little experience in the accelerated phase of CHS treatment worldwide. Here, we present a case of a 9-month-old boy with continuous high fever, hypopigmentation of the skin, enlarged lymph nodes, hepatosplenomegaly and lung infection. He was diagnosed with CHS by gene sequencing, and had entered the accelerated phase. After 8 weeks of therapy, the boy had remission and was prepared for allogenic stem cell transplantation.

  2. A novel frameshift mutation of Chediak-Higashi syndrome and treatment in the accelerated phase.

    Science.gov (United States)

    Wu, X L; Zhao, X Q; Zhang, B X; Xuan, F; Guo, H M; Ma, F T

    2017-03-23

    Chediak-Higashi syndrome (CHS) is a rare autosomal recessive immunodeficiency disease characterized by frequent infections, hypopigmentation, progressive neurologic deterioration and hemophagocytic lymphohistiocytosis (HLH), known as the accelerated phase. There is little experience in the accelerated phase of CHS treatment worldwide. Here, we present a case of a 9-month-old boy with continuous high fever, hypopigmentation of the skin, enlarged lymph nodes, hepatosplenomegaly and lung infection. He was diagnosed with CHS by gene sequencing, and had entered the accelerated phase. After 8 weeks of therapy, the boy had remission and was prepared for allogenic stem cell transplantation.

  3. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic ...

    Indian Academy of Sciences (India)

    fibrosis patient. SONDESS HADJ FREDJ1, MONIA BOUDAYA1, SABRINE OUESLATI1, SAFA SAHNOUN1, CHAIMA SAHLI1,. HAJER SIALA1, KHEDIJA BOUSSETTA2, AMINA BIBI1 and TAIEB MESSAOUD1∗. 1Biochemistry Laboratory and 2Department of Pediatrics, Children's Hospital, Bab Saadoun Square 1007 Tunis, ...

  4. Molecular mechanisms of induced-mutations

    International Nuclear Information System (INIS)

    Kato, Takeshi

    1985-01-01

    The outcome of recent studies on mechanisms of induced-mutations is outlined with particular emphasis on the dependence of recA gene function in Escherichia coli. Genes involved in spontaneous mutation and x-ray- and chemical-induced mutation and genes involved in adaptive response are presented. As for SOS mutagenesis, SOS-induced regulation mechanisms and mutagenic routes are described. Furthermore, specificity of mutagens themselves are discussed in relation to mechanisms of base substitution, frameshift, and deletion mutagenesis. (Namekawa, K.)

  5. Novel mutation in CNTNAP1 results in congenital hypomyelinating neuropathy.

    Science.gov (United States)

    Mehta, Paulomi; Küspert, Melanie; Bale, Tejus; Brownstein, Catherine A; Towne, Meghan C; De Girolami, Umberto; Shi, Jiahai; Beggs, Alan H; Darras, Basil T; Wegner, Michael; Piao, Xianhua; Agrawal, Pankaj B

    2017-05-01

    Congenital hypomyelinating neuropathy (CHN) is a rare congenital neuropathy that presents in the neonatal period and has been linked previously to mutations in several genes associated with myelination. A recent study has linked 4 homozygous frameshift mutations in the contactin-associated protein 1 (CNTNAP1) gene with this condition. We report a neonate with CHN who was found to have absent sensory nerve and compound muscle action potentials and hypomyelination on nerve biopsy. On whole exome sequencing, we identified a novel CNTNAP1 homozygous missense mutation (p.Arg388Pro) in the proband, and both parents were carriers. Molecular modeling suggests that this variant disrupts a β-strand to cause an unstable structure and likely significant changes in protein function. This report links a missense CNTNAP1 variant to the disease phenotype previously associated only with frameshift mutations. Muscle Nerve 55: 761-765, 2017. © 2016 Wiley Periodicals, Inc.

  6. Frameshifting in the P6 cDNA Phage Display System

    Directory of Open Access Journals (Sweden)

    Veerle Somers

    2010-12-01

    Full Text Available Phage display is a powerful technique that enables easy identification of targets for any type of ligand. Targets are displayed at the phage surface as a fusion protein to one of the phage coat proteins. By means of a repeated process of affinity selection on a ligand, specific enrichment of displayed targets will occur. In our studies using C-terminal display of cDNA fragments to phage coat protein p6, we noticed the occasional enrichment of targets that do not contain an open reading frame. This event has previously been described in other phage display studies using N-terminal display of targets to phage coat proteins and was due to uncommon translational events like frameshifting. The aim of this study was to examine if C-terminal display of targets to p6 is also subjected to frameshifting. To this end, an enriched target not containing an open reading frame was selected and an E-tag was coupled at the C-terminus in order to measure target display at the surface of the phage. The tagged construct was subsequently expressed in 3 different reading frames and display of both target and E-tag measured to detect the occurrence of frameshifting. As a result, we were able to demonstrate display of the target both in the 0 and in the +1 reading frame indicating that frameshifting can also take place when C-terminal fusion to minor coat protein p6 is applied.

  7. Ribosome excursions during mRNA translocation mediate broad branching of frameshift pathways.

    Science.gov (United States)

    Yan, Shannon; Wen, Jin-Der; Bustamante, Carlos; Tinoco, Ignacio

    2015-02-26

    Programmed ribosomal frameshifting produces alternative proteins from a single transcript. -1 frameshifting occurs on Escherichia coli's dnaX mRNA containing a slippery sequence AAAAAAG and peripheral mRNA structural barriers. Here, we reveal hidden aspects of the frameshifting process, including its exact location on the mRNA and its timing within the translation cycle. Mass spectrometry of translated products shows that ribosomes enter the -1 frame from not one specific codon but various codons along the slippery sequence and slip by not just -1 but also -4 or +2 nucleotides. Single-ribosome translation trajectories detect distinctive codon-scale fluctuations in ribosome-mRNA displacement across the slippery sequence, representing multiple ribosomal translocation attempts during frameshifting. Flanking mRNA structural barriers mechanically stimulate the ribosome to undergo back-and-forth translocation excursions, broadly exploring reading frames. Both experiments reveal aborted translation around mutant slippery sequences, indicating that subsequent fidelity checks on newly adopted codon position base pairings lead to either resumed translation or early termination. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Mutation rates of TGFBR2 and ACVR2 coding microsatellites in human cells with defective DNA mismatch repair.

    Directory of Open Access Journals (Sweden)

    Heekyung Chung

    Full Text Available Microsatellite instability promotes colonic tumorigenesis through generating frameshift mutations at coding microsatellites of tumor suppressor genes, such as TGFBR2 and ACVR2. As a consequence, signaling through these TGFbeta family receptors is abrogated in DNA Mismatch repair (MMR-deficient tumors. How these mutations occur in real time and mutational rates of these human coding sequences have not previously been studied. We utilized cell lines with different MMR deficiencies (hMLH1-/-, hMSH6-/-, hMSH3-/-, and MMR-proficient to determine mutation rates. Plasmids were constructed in which exon 3 of TGFBR2 and exon 10 of ACVR2 were cloned +1 bp out of frame, immediately after the translation initiation codon of an enhanced GFP (EGFP gene, allowing a -1 bp frameshift mutation to drive EGFP expression. Mutation-resistant plasmids were constructed by interrupting the coding microsatellite sequences, preventing frameshift mutation. Stable cell lines were established containing portions of TGFBR2 and ACVR2, and nonfluorescent cells were sorted, cultured for 7-35 days, and harvested for flow cytometric mutation detection and DNA sequencing at specific time points. DNA sequencing revealed a -1 bp frameshift mutation (A9 in TGFBR2 and A7 in ACVR2 in the fluorescent cells. Two distinct fluorescent populations, M1 (dim, representing heteroduplexes and M2 (bright, representing full mutants were identified, with the M2 fraction accumulating over time. hMLH1 deficiency revealed 11 (5.91 x 10(-4 and 15 (2.18 x 10(-4 times higher mutation rates for the TGFBR2 and ACVR2 microsatellites compared to hMSH6 deficiency, respectively. The mutation rate of the TGFBR2 microsatellite was approximately 3 times higher in both hMLH1 and hMSH6 deficiencies than the ACVR2 microsatellite. The -1 bp frameshift mutation rates of TGFBR2 and ACVR2 microsatellite sequences are dependent upon the human MMR background.

  9. Birt-Hogg-Dubé syndrome: novel FLCN frameshift deletion in daughter and father with renal cell carcinomas.

    Science.gov (United States)

    Näf, Ernst; Laubscher, Dominik; Hopfer, Helmut; Streit, Markus; Matyas, Gabor

    2016-01-01

    Germline mutation of the FLCN gene causes Birt-Hogg-Dubé syndrome (BHD), a rare autosomal dominant condition characterized by skin fibrofolliculomas, lung cysts, spontaneous pneumothorax and renal tumours. We identified a hitherto unreported pathogenic FLCN frameshift deletion c.563delT (p.Phe188Serfs*35) in a family of a 46-year-old woman presented with macrohematuria due to bilateral chromophobe renal carcinomas. A heritable renal cancer was suspected due to the bilaterality of the tumour and as the father of this woman had suffered from renal cancer. Initially, however, BHD was overlooked by the medical team despite the highly suggestive clinical presentation. We assume that BHD is underdiagnosed, at least partially, due to low awareness of this variable condition and to insufficient use of appropriate genetic testing. Our study indicates that BHD and FLCN testing should be routinely considered in patients with positive family or personal history of renal tumours. In addition, we demonstrate how patients and their families can play a driving role in initiating genetic diagnosis, presymptomatic testing of at-risk relatives, targeted disease management, and genetic counselling of rare diseases such as BHD.

  10. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    Science.gov (United States)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  11. A very mild form of non-Herlitz junctional epidermolysis bullosa : BP180 rescue by outsplicing of mutated exon 30 coding for the COL15 domain

    NARCIS (Netherlands)

    Pasmooij, AMG; van Zalen, S; Nijenhuis, AM; Kloosterhuis, AJ; Zuiderveen, J; Jonkman, MF; Pas, HH

    Mutations in the gene COL17A1 cause non-Herlitz junctional epidermolysis bullosa. Here, we describe a patient who, despite two heterozygous mutations in COL17A1, has an extremely mild form of the disease missing most of the characteristic clinical features. DNA analysis revealed a frame-shift

  12. A truncating mutation of HDAC2 in human cancers confers resistance to histone deacetylase inhibition

    DEFF Research Database (Denmark)

    Ropero, S; Fraga, MF; Ballestar, E

    2006-01-01

    arising in individuals with hereditary nonpolyposis colorectal cancer syndrome. The presence of the HDAC2 frameshift mutation causes a loss of HDAC2 protein expression and enzymatic activity and renders these cells more resistant to the usual antiproliferative and proapoptotic effects of histone...

  13. 40 CFR 798.5265 - The salmonella typhimurium reverse mutation assay.

    Science.gov (United States)

    2010-07-01

    ... mean number of revertant colonies per plate and standard deviation shall be presented for test chemical... revertant colonies per plate, standard deviation. (vi) Dose-response relationship, if applicable. (g... chemicals which cause base changes or frameshift mutations in the genome of this organism. (b) Definitions...

  14. Novel ELN mutation in a family with supravalvular aortic stenosis and intracranial aneurysm

    DEFF Research Database (Denmark)

    Jelsig, Anne Marie; Urban, Zsolt; Hucthagowder, Vishwanathan

    2017-01-01

    stenosis, various other arterial stenoses, sudden death, and intracranial aneurysms. A frameshift mutation in exon 12, not described before, was detected in the affected family members. This report emphasises the importance of family history, genetic counselling, and demonstrates the great variability...

  15. Senior-Loken syndrome: A novel NPHP5 gene mutation in a family ...

    African Journals Online (AJOL)

    Makia J Marafie

    2014-01-08

    Jan 8, 2014 ... is Senior-Loken syndrome, a hereditary heterogeneous multiorgan disorder, which combines neph- ronophthisis with ... Case report: Here, we are reporting two children from an Arab family with a novel frameshift mutation found in ..... diseases, which are scattered in the Arab world and Middle. East to help ...

  16. Screening of 1331 Danish breast and/or ovarian cancer families identified 40 novel BRCA1 and BRCA2 mutations

    DEFF Research Database (Denmark)

    Hansen, Thomas V O; Jønson, Lars; Steffensen, Ane Y

    2011-01-01

    and BRCA2 in high risk breast and/or ovarian cancer families. The mutations were detected via pre-screening using dHPLC or high-resolution melting and direct sequencing. We identified 16 variants in BRCA1, including 9 deleterious frame-shift mutations, 2 intronic variants, 4 missense mutations, and 1......Germ-line mutations in the tumour suppressor genes BRCA1 and BRCA2 predispose to breast and ovarian cancer. Since 1999 we have performed mutational screening of breast and/or ovarian cancer patients in East Denmark. During this period we have identified 40 novel sequence variations in BRCA1...... synonymous variant. The remaining 24 variants were identified in BRCA2, including 10 deleterious mutants (6 frame-shift and 4 nonsense), 2 intronic variants, 10 missense mutations and 2 synonymous variants. The frequency of the variants of unknown significance was examined in control individuals. Moreover...

  17. Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (α1S expressing two complementary protein fragments

    Directory of Open Access Journals (Sweden)

    Mortenson Lindsay

    2001-12-01

    Full Text Available Abstract Background The L-type Ca2+ channel formed by the dihydropyridine receptor (DHPR of skeletal muscle senses the membrane voltage and opens the ryanodine receptor (RyR1. This channel-to-channel coupling is essential for Ca2+ signaling but poorly understood. We characterized a single-base frame-shift mutant of α1S, the pore subunit of the DHPR, that has the unusual ability to function voltage sensor for excitation-contraction (EC coupling by virtue of expressing two complementary hemi-Ca2+ channel fragments. Results Functional analysis of cDNA transfected dysgenic myotubes lacking α1S were carried out using voltage-clamp, confocal Ca2+ indicator fluoresence, epitope immunofluorescence and immunoblots of expressed proteins. The frame-shift mutant (fs-α1S expressed the N-terminal half of α1S (M1 to L670 and the C-terminal half starting at M701 separately. The C-terminal fragment was generated by an unexpected restart of translation of the fs-α1S message at M701 and was eliminated by a M701I mutation. Protein-protein complementation between the two fragments produced recovery of skeletal-type EC coupling but not L-type Ca2+ current. Discussion A premature stop codon in the II-III loop may not necessarily cause a loss of DHPR function due to a restart of translation within the II-III loop, presumably by a mechanism involving leaky ribosomal scanning. In these cases, function is recovered by expression of complementary protein fragments from the same cDNA. DHPR-RyR1 interactions can be achieved via protein-protein complementation between hemi-Ca2+ channel proteins, hence an intact II-III loop is not essential for coupling the DHPR voltage sensor to the opening of RyR1 channel.

  18. Profile of TP53 gene mutations in sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Suitiala, Tuula

    2010-01-01

    Genetic alterations underlying the development of the cancer of the nose and paranasal sinuses (sinonasal cancer, SNC), a rare cancer that can be included in the group of head and neck cancers, are still largely unknown. We recently reported that TP53 mutations are a common feature of SNC......, with an overall frequency of 77%, and they show association to adenocarcinoma and wood-dust exposure [15]. In this study, we report in detail the sequence change for 159 TP53 mutations identified by direct sequencing. More than half of the mutations (60%, 95/159) were missense mutations; there were also 28 (18......%) frameshift or nonsense mutations, and 36 (23%) intronic or silent mutations. In coding region, the most common base change detected was C-->T transition (43/125; 34% of base changes in the coding region). G-->T transversions occurred at a frequency of 10% (12/125), which is less than reported in mutation...

  19. NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features

    DEFF Research Database (Denmark)

    Andersen, Morten Tolstrup; Andersen, Mette Klarskov; Christiansen, D.H.

    2008-01-01

    Frameshift mutations of the nucleophosmin gene (NPM1) were recently reported as a frequently occurring abnormality in patients with de novo acute myeloid leukemia (AML). To evaluate the frequency of NPM1 mutations in patients with therapy-related myelodysplasia (t-MDS) and therapy-related AML (t......-/-7, the most frequent abnormalities of t-MDS/t-AML, were not observed (P=0.002). This raises the question whether some of the cases presenting NPM1 mutations were in fact cases of de novo leukemia. The close association to class I mutations and the inverse association to class II mutations suggest...

  20. [Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

    Science.gov (United States)

    Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

    2008-06-01

    To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

  1. Translational recoding as a feedback controller: systems approaches reveal polyamine-specific effects on the antizyme ribosomal frameshift

    Science.gov (United States)

    Rato, Claudia; Amirova, Svetlana R.; Bates, Declan G.; Stansfield, Ian; Wallace, Heather M.

    2011-01-01

    The antizyme protein, Oaz1, regulates synthesis of the polyamines putrescine, spermidine and spermine by controlling stability of the polyamine biosynthetic enzyme, ornithine decarboxylase. Antizyme mRNA translation depends upon a polyamine-stimulated +1 ribosomal frameshift, forming a complex negative feedback system in which the translational frameshifting event may be viewed in engineering terms as a feedback controller for intracellular polyamine concentrations. In this article, we present the first systems level study of the characteristics of this feedback controller, using an integrated experimental and modeling approach. Quantitative analysis of mutant yeast strains in which polyamine synthesis and interconversion were blocked revealed marked variations in frameshift responses to the different polyamines. Putrescine and spermine, but not spermidine, showed evidence of co-operative stimulation of frameshifting and the existence of multiple ribosome binding sites. Combinatorial polyamine treatments showed polyamines compete for binding to common ribosome sites. Using concepts from enzyme kinetics and control engineering, a mathematical model of the translational controller was developed to describe these complex ribosomal responses to combinatorial polyamine effects. Each one of a range of model predictions was successfully validated against experimental frameshift frequencies measured in S-adenosylmethionine-decarboxylase and antizyme mutants, as well as in the wild-type genetic background. PMID:21303766

  2. HNPCC: Six new pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Epplen Joerg T

    2004-06-01

    Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.

  3. A novel PCCB mutation in a Thai patient with propionic acidemia identified by exome sequencing.

    Science.gov (United States)

    Porntaveetus, Thantrira; Srichomthong, Chalurmpon; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

    2015-01-01

    Propionic acidemia (PA) is an inborn error of metabolism, caused by mutations in either the PCCA or PCCB gene, leading to mitochondrial accumulation of propionyl-CoA and its by-products. Here we report a 6-year-old Thai boy with PA who was born to consanguineous parents. Exome sequencing identified a novel homozygous frameshift insertion (c.379_380insA; p.T127NfsX160) in the PCCB gene, expanding its mutational spectrum.

  4. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

    2014-02-15

    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

  5. The mutational spectrum in Waardenburg syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Read, A.P.; Tassabehji, M.; Liu, X.Z. [and others

    1994-09-01

    101 individuals or families with Waardenburg syndrome (WS) or related abnormalities have been screened for mutations in the PAX3 gene. PAX3 mutations were seen in 19 of 35 individuals or families with features of Type I Waardenburg syndrome. None of the 47 Type 2 WS families showed any PAX3 mutation, nor did any of 19 individuals with other neural crest syndromes or pigmentary disturbances. PAX3 mutations included substitutions of highly conserved amino acids, splice site mutations, nonsense mutations and frameshifting deletions or insertions. One patient (with Type 1 WS, mental retardation and growth retardation) had a chromosomal deletion of 7-8 Mb encompassing the PAX3 gene. Mutations were seen in each of exons 2-6, with a concentration in the 5{prime} part of the paired box (exon 2) and the 3{prime} part of the homeobox (exon 6). There was no evident relation between the molecular change and the clinical manifestations in mutation carriers. We conclude that PAX3 dosage effects very specifically produce dystopia canthorum, the distinguishing feature of Type 1 WS, and variably produce the other features of Type 1 WS depending on genetic background or chance events. Two of the Type 2 families showed linkage to markers from 3p14, the location of the MITF gene. MITF encodes a basic helix-loop-helix-zipper protein which is the homologue of the mouse microphthalmia gene product. It is likely that mutations in MITF cause some but not all Type 2 WS.

  6. Unusual long survival despite severe lung disease of a child with biallelic loss of function mutations in ABCA-3

    Directory of Open Access Journals (Sweden)

    P. El Boustany

    Full Text Available Homozygous or compound heterozygous for frameshift or nonsense mutations in the ATP–binding cassette transporter A3 (ABCA3 is associated with neonatal respiratory failure and death within the first year of life without lung transplantation. We report the case of a newborn baby girl who developed severe respiratory distress soon after birth. She was diagnosed with compound heterozygous frameshift mutation of the ABCA3 gene. Despite extensive treatment (intravenous corticosteroids pulse therapy, oral corticosteroids, azithromycin, and hydroxychloroquine, she developed chronic respiratory failure. As the parents refused cardio-pulmonary transplantation and couldn't resolve to an accompaniment of end of life, a tracheostomy was performed resulting in continuous mechanical ventilation. A neurodevelopmental delay and an overall muscular dystrophy were noted. At the age of 5 years, after 2 episodes of pneumothorax, the patient died from severe respiratory failure. To our knowledge, this was the first case of a child with compound heterozygous frameshift mutation who posed such an ethical dilemma with a patient surviving till the age of five years. Keywords: ABCA3 deficiency, Compound heterozygous frameshift mutation, Neonatal respiratory failure, Tracheostomy, Mechanical ventilation, Ethical dilemma

  7. Immunodeficiency associated with FCN3 mutation and ficolin-3 deficiency

    DEFF Research Database (Denmark)

    Munthe-Fog, Lea; Hummelshøj, Tina; Honoré, Christian

    2009-01-01

    Ficolin-3, encoded by the FCN3 gene and expressed in the lung and liver, is a recognition molecule in the lectin pathway of the complement system. Heterozygosity for an FCN3 frameshift mutation (rs28357092), leading to a distortion of the C-terminal end of the molecule, occurs in people without...... disease (allele frequency among whites, 0.01). We describe a patient with recurrent infections who was homozygous for this mutation, who had undetectable serum levels of ficolin-3, and who had a deficiency in ficolin-3-dependent complement activation....

  8. Using exome data to identify malignant hyperthermia susceptibility mutations.

    Science.gov (United States)

    Gonsalves, Stephen G; Ng, David; Johnston, Jennifer J; Teer, Jamie K; Stenson, Peter D; Cooper, David N; Mullikin, James C; Biesecker, Leslie G

    2013-11-01

    Malignant hyperthermia susceptibility (MHS) is a life-threatening, inherited disorder of muscle calcium metabolism, triggered by anesthetics and depolarizing muscle relaxants. An unselected cohort was screened for MHS mutations using exome sequencing. The aim of this study was to pilot a strategy for the RYR1 and CACNA1S genes. Exome sequencing was performed on 870 volunteers not ascertained for MHS. Variants in RYR1 and CACNA1S were annotated using an algorithm that filtered results based on mutation type, frequency, and information in mutation databases. Variants were scored on a six-point pathogenicity scale. Medical histories and pedigrees were reviewed for malignant hyperthermia and related disorders. The authors identified 70 RYR1 and 53 CACNA1S variants among 870 exomes. Sixty-three RYR1 and 41 CACNA1S variants passed the quality and frequency metrics but the authors excluded synonymous variants. In RYR1, the authors identified 65 missense mutations, one nonsense, two that affected splicing, and one non-frameshift indel. In CACNA1S, 48 missense, one frameshift deletion, one splicing, and one non-frameshift indel were identified. RYR1 variants predicted to be pathogenic for MHS were found in three participants without medical or family histories of MHS. Numerous variants, previously described as pathogenic in mutation databases, were reclassified by the authors as being of unknown pathogenicity. Exome sequencing can identify asymptomatic patients at risk for MHS, although the interpretation of exome variants can be challenging. The use of exome sequencing in unselected cohorts is an important tool to understand the prevalence and penetrance of MHS, a critical challenge for the field.

  9. Fitness is strongly influenced by rare mutations of large effect in a microbial mutation accumulation experiment.

    Science.gov (United States)

    Heilbron, Karl; Toll-Riera, Macarena; Kojadinovic, Mila; MacLean, R Craig

    2014-07-01

    Our understanding of the evolutionary consequences of mutation relies heavily on estimates of the rate and fitness effect of spontaneous mutations generated by mutation accumulation (MA) experiments. We performed a classic MA experiment in which frequent sampling of MA lines was combined with whole genome resequencing to develop a high-resolution picture of the effect of spontaneous mutations in a hypermutator (ΔmutS) strain of the bacterium Pseudomonas aeruginosa. After ∼644 generations of mutation accumulation, MA lines had accumulated an average of 118 mutations, and we found that average fitness across all lines decayed linearly over time. Detailed analyses of the dynamics of fitness change in individual lines revealed that a large fraction of the total decay in fitness (42.3%) was attributable to the fixation of rare, highly deleterious mutations (comprising only 0.5% of fixed mutations). Furthermore, we found that at least 0.64% of mutations were beneficial and probably fixed due to positive selection. The majority of mutations that fixed (82.4%) were base substitutions and we failed to find any signatures of selection on nonsynonymous or intergenic mutations. Short indels made up a much smaller fraction of the mutations that were fixed (17.4%), but we found evidence of strong selection against indels that caused frameshift mutations in coding regions. These results help to quantify the amount of natural selection present in microbial MA experiments and demonstrate that changes in fitness are strongly influenced by rare mutations of large effect. Copyright © 2014 by the Genetics Society of America.

  10. Hepatitis C Virus Frameshift/Alternate Reading Frame Protein Suppresses Interferon Responses Mediated by Pattern Recognition Receptor Retinoic-Acid-Inducible Gene-I.

    Directory of Open Access Journals (Sweden)

    Seung Bum Park

    Full Text Available Hepatitis C virus (HCV actively evades host interferon (IFN responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I (RIG-I-mediated IFN induction. Expression of frameshift/alternate reading frame protein (F/ARFP from HCV -2/+1 frame in Huh7 hepatoma cells suppressed type I IFN responses stimulated by HCV RNA pathogen-associated molecular pattern (PAMP and poly(IC. The suppression occurred independently of other HCV factors; and activation of interferon stimulated genes, TNFα, IFN-λ1, and IFN-λ2/3 was likewise suppressed by HCV F/ARFP. Point mutations in the full-length HCV sequence (JFH1 genotype 2a strain were made to introduce premature termination codons in the -2/+1 reading frame coding for F/ARFP while preserving the original reading frame, which enhanced IFNα and IFNβ induction by HCV. The potentiation of IFN response by the F/ARFP mutations was diminished in Huh7.5 cells, which already have a defective RIG-I, and by decreasing RIG-I expression in Huh7 cells. Furthermore, adding F/ARFP back via trans-complementation suppressed IFN induction in the F/ARFP mutant. The F/ARFP mutants, on the other hand, were not resistant to exogenous IFNα. Finally, HCV-infected human liver samples showed significant F/ARFP antibody reactivity, compared to HCV-uninfected control livers. Therefore, HCV F/ARFP likely cooperates with other viral factors to suppress type I and III IFN induction occurring through the RIG-I signaling pathway. This study identifies a novel mechanism of pattern recognition receptor modulation by HCV and suggests a biological function of the HCV alternate reading frame in the modulation of host innate immunity.

  11. A Crohn's disease-associated NOD2 mutation suppresses transcription of human IL10 by inhibiting activity of the nuclear ribonucleoprotein hnRNP-A1.

    NARCIS (Netherlands)

    Noguchi, E.; Homma, Y.; Kang, X.; Netea, M.G.; Ma, X.

    2009-01-01

    A common mutation in the gene encoding the cytoplasmic sensor Nod2, involving a frameshift insertion at nucleotide 3020 (3020insC), is strongly associated with Crohn's disease. How 3020insC contributes to this disease is a controversial issue. Clinical studies have identified defective production of

  12. Screening of 1331 Danish breast and/or ovarian cancer families identified 40 novel BRCA1 and BRCA2 mutations

    DEFF Research Database (Denmark)

    Hansen, Thomas V O; Jønson, Lars; Steffensen, Ane Y

    2011-01-01

    Germ-line mutations in the tumour suppressor genes BRCA1 and BRCA2 predispose to breast and ovarian cancer. Since 1999 we have performed mutational screening of breast and/or ovarian cancer patients in East Denmark. During this period we have identified 40 novel sequence variations in BRCA1...... and BRCA2 in high risk breast and/or ovarian cancer families. The mutations were detected via pre-screening using dHPLC or high-resolution melting and direct sequencing. We identified 16 variants in BRCA1, including 9 deleterious frame-shift mutations, 2 intronic variants, 4 missense mutations, and 1......, the presumed significance of the missense mutations was predicted in silico using the align GVGD algorithm. In conclusion, the mutation screening identified 40 novel variants in the BRCA1 and BRCA2 genes and thereby extends the knowledge of the BRCA1/BRCA2 mutation spectrum. Nineteen of the mutations were...

  13. Identification of a Danish breast/ovarian cancer family double heterozygote for BRCA1 and BRCA2 mutations

    DEFF Research Database (Denmark)

    Steffensen, Ane Y; Jønson, Lars; Ejlertsen, Bent

    2010-01-01

    Mutations in the two breast cancer susceptibility genes BRCA1 and BRCA2 are associated with increased risk of breast and ovarian cancer. Patients with mutations in both genes are rarely reported and often involve Ashkenazi founder mutations. Here we report the first identification of a Danish...... breast and ovarian cancer family heterozygote for mutations in the BRCA1 and BRCA2 genes. The BRCA1 nucleotide 5215G > A/c.5096G > A mutation results in the missense mutation Arg1699Gln, while the BRCA2 nucleotide 859 + 4A > G/c.631 + 4A > G is novel. Exon trapping experiments and reverse transcriptase...... (RT)-PCR analysis revealed that the BRCA2 mutation results in skipping of exon 7, thereby introducing a frameshift and a premature stop codon. We therefore classify the mutation as disease causing. Since the BRCA1 Arg1699Gln mutation is also suggested to be disease-causing, we consider this family...

  14. A Novel Mutation in the EDAR Gene Causes Severe Autosomal Recessive Hypohidrotic Ectodermal Dysplasia

    DEFF Research Database (Denmark)

    Henningsen, Emil; Svendsen, Mathias Tiedemann; Lildballe, D. L.

    2014-01-01

    nasal discharge. The girl was the second born child of first-cousin immigrants from Northern Iraq. A novel homozygous mutation (c.84delC) in the EDAR gene was identified. This mutation most likely causes a frameshift in the protein product (p.S29fs*74). This results in abolition of all ectodysplasin......-mediated NF-kB signalling. This complete loss-of-function mutation likely accounts for the severe clinical abnormalities in ectodermal structures in the described patient. (C) 2014 Wiley Periodicals, Inc....

  15. Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

    DEFF Research Database (Denmark)

    Christiansen, L; Ged, C; Hombrados, I

    1999-01-01

    , confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...... to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual...

  16. Frequent somatic reversion of KRT1 mutations in ichthyosis with confetti.

    Science.gov (United States)

    Choate, Keith A; Lu, Yin; Zhou, Jing; Elias, Peter M; Zaidi, Samir; Paller, Amy S; Farhi, Anita; Nelson-Williams, Carol; Crumrine, Debra; Milstone, Leonard M; Lifton, Richard P

    2015-04-01

    Widespread reversion of genetic disease is rare; however, such events are particularly evident in some skin disorders in which normal clones develop on a background of affected skin. We previously demonstrated that mutations in keratin 10 (KRT10) cause ichthyosis with confetti (IWC), a severe dominant disorder that is characterized by progressive development of hundreds of normal skin spots via revertant mosaicism. Here, we report on a clinical and histological IWC subtype in which affected subjects have red, scaly skin at birth, experience worsening palmoplantar keratoderma in childhood, and develop hundreds of normal skin spots, beginning at around 20 years of age, that increase in size and number over time. We identified a causal de novo mutation in keratin 1 (KRT1). Similar to IWC-causing KRT10 mutations, this mutation in KRT1 resulted in a C-terminal frameshift, replacing 22 C-terminal amino acids with an alternate 30-residue peptide. Mutant KRT1 caused partial collapse of the cytoplasmic intermediate filament network and mislocalized to the nucleus. As with KRT10 mutations causing IWC, reversion of KRT1 mutations occurred via mitotic recombination. Because reversion is not observed with other disease-causing keratin mutations, the results of this study implicate KRT1 and KRT10 C-terminal frameshift mutations in the high frequency of revertant mosaicism in IWC.

  17. Rare mutations predisposing to familial adenomatous polyposis in Greek FAP patients

    International Nuclear Information System (INIS)

    Mihalatos, Markos; Fountzilas, George; Agnantis, Niki J; Nasioulas, Georgios; Apessos, Angela; Dauwerse, Hans; Velissariou, Voula; Psychias, Aristidis; Koliopanos, Alexander; Petropoulos, Konstantinos; Triantafillidis, John K; Danielidis, Ioannis

    2005-01-01

    Familial Adenomatous Polyposis (FAP) is caused by germline mutations in the APC (Adenomatous Polyposis Coli) gene. The vast majority of APC mutations are point mutations or small insertions / deletions which lead to truncated protein products. Splicing mutations or gross genomic rearrangements are less common inactivating events of the APC gene. In the current study genomic DNA or RNA from ten unrelated FAP suspected patients was examined for germline mutations in the APC gene. Family history and phenotype were used in order to select the patients. Methods used for testing were dHPLC (denaturing High Performance Liquid Chromatography), sequencing, MLPA (Multiplex Ligation – dependent Probe Amplification), Karyotyping, FISH (Fluorescence In Situ Hybridization) and RT-PCR (Reverse Transcription – Polymerase Chain Reaction). A 250 Kbp deletion in the APC gene starting from intron 5 and extending beyond exon 15 was identified in one patient. A substitution of the +5 conserved nucleotide at the splice donor site of intron 9 in the APC gene was shown to produce frameshift and inefficient exon skipping in a second patient. Four frameshift mutations (1577insT, 1973delAG, 3180delAAAA, 3212delA) and a nonsense mutation (C1690T) were identified in the rest of the patients. Screening for APC mutations in FAP patients should include testing for splicing defects and gross genomic alterations

  18. Compound heterozygous ASPM mutations in Pakistani MCPH families

    DEFF Research Database (Denmark)

    Muhammad, Farooq; Mahmood Baig, Shahid; Hansen, Lars

    2009-01-01

    Autosomal recessive primary microcephaly (MCPH) is characterized by reduced head circumference (50% of all reported families. In spite of the high frequency of MCPH in Pakistan only one case of compound heterozygosity for mutations in ASPM has been reported yet. In this large MCPH study we...... confirmed compound heterozygosity in two and homozygous mutations in 20 families, respectively, showing that up to 10% of families with MCPH caused by ASPM are compound heterozygous. In total we identified 16 different nonsense or frameshift mutations of which 12 were novel thereby increasing the number...... of mutations in ASPM significantly from 35 to 47. We found no correlation between the severity of the condition and the site of truncation. We suggest that the high frequency of compound heterozygosity observed in this study is taken into consideration as part of future genetic testing and counseling...

  19. Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. (Royal Postgraduate Medical School, London (United Kingdom)); Vulliamy, T. (Hammersmith Hospital, London (United Kingdom))

    1993-11-01

    Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

  20. A negative feedback modulator of antigen processing evolved from a frameshift in the cowpox virus genome.

    Directory of Open Access Journals (Sweden)

    Jiacheng Lin

    2014-12-01

    Full Text Available Coevolution of viruses and their hosts represents a dynamic molecular battle between the immune system and viral factors that mediate immune evasion. After the abandonment of smallpox vaccination, cowpox virus infections are an emerging zoonotic health threat, especially for immunocompromised patients. Here we delineate the mechanistic basis of how cowpox viral CPXV012 interferes with MHC class I antigen processing. This type II membrane protein inhibits the coreTAP complex at the step after peptide binding and peptide-induced conformational change, in blocking ATP binding and hydrolysis. Distinct from other immune evasion mechanisms, TAP inhibition is mediated by a short ER-lumenal fragment of CPXV012, which results from a frameshift in the cowpox virus genome. Tethered to the ER membrane, this fragment mimics a high ER-lumenal peptide concentration, thus provoking a trans-inhibition of antigen translocation as supply for MHC I loading. These findings illuminate the evolution of viral immune modulators and the basis of a fine-balanced regulation of antigen processing.

  1. Large-scale mass spectrometry-based analysis of Euplotes octocarinatus supports the high frequency of +1 programmed ribosomal frameshift

    OpenAIRE

    Wang, Ruanlin; Zhang, Zhiyun; Du, Jun; Fu, Yuejun; Liang, Aihua

    2016-01-01

    Programmed ribosomal frameshifting (PRF) is commonly used to express many viral and some cellular genes. We conducted a genome-wide investigation of +1 PRF in ciliate Euplotes octocarinatus through genome and transcriptome sequencing and our results demonstrated that approximately 11.4% of genes require +1 PRF to produce complete gene products. While nucleic acid-based evidence for candidate genes with +1 PRF is strong, only very limited information is available at protein levels to date. In ...

  2. Adenine Enrichment at the Fourth CDS Residue in Bacterial Genes Is Consistent with Error Proofing for +1 Frameshifts.

    Science.gov (United States)

    Abrahams, Liam; Hurst, Laurence D

    2017-12-01

    Beyond selection for optimal protein functioning, coding sequences (CDSs) are under selection at the RNA and DNA levels. Here, we identify a possible signature of "dual-coding," namely extensive adenine (A) enrichment at bacterial CDS fourth sites. In 99.07% of studied bacterial genomes, fourth site A use is greater than expected given genomic A-starting codon use. Arguing for nucleotide level selection, A-starting serine and arginine second codons are heavily utilized when compared with their non-A starting synonyms. Several models have the ability to explain some of this trend. In part, A-enrichment likely reduces 5' mRNA stability, promoting translation initiation. However T/U, which may also reduce stability, is avoided. Further, +1 frameshifts on the initiating ATG encode a stop codon (TGA) provided A is the fourth residue, acting either as a frameshift "catch and destroy" or a frameshift stop and adjust mechanism and hence implicated in translation initiation. Consistent with both, genomes lacking TGA stop codons exhibit weaker fourth site A-enrichment. Sequences lacking a Shine-Dalgarno sequence and those without upstream leader genes, that may be more error prone during initiation, have greater utilization of A, again suggesting a role in initiation. The frameshift correction model is consistent with the notion that many genomic features are error-mitigation factors and provides the first evidence for site-specific out of frame stop codon selection. We conjecture that the NTG universal start codon may have evolved as a consequence of TGA being a stop codon and the ability of NTGA to rapidly terminate or adjust a ribosome. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  4. Detection of a novel silent deletion, a missense mutation and a nonsense mutation in TCOF1.

    Science.gov (United States)

    Fujioka, Hirotaka; Ariga, Tadashi; Horiuchi, Katsumi; Ishikiriyama, Satoshi; Oyama, Kimie; Otsu, Makoto; Kawashima, Kunihiro; Yamamoto, Yuhei; Sugihara, Tsuneki; Sakiyama, Yukio

    2008-12-01

    Treacher Collins syndrome (TCS) is a disorder of craniofacial development, that is caused by mutations in the TCOF1 gene. TCS is inherited as an autosomal dominant trait, and haploinsufficiency of the TCOF1 gene product treacle is proposed to be etiologically involved. Mutational analysis of the TCOF1 gene was done in 10 patients diagnosed with TCS using single-strand conformation polymorphism and direct sequencing. Among these 10 patients, a novel 9 bp deletion was found, together with a previously reported 2 bp deletion, a novel missense mutation and a novel nonsense mutation in three different families. Familial studies allowed judgment of whether these abnormal findings were responsible for the TCS phenotype, or not. The 9 bp deletion of three amino acids Lys-Glu-Lys (1378-1380), which was located in the nuclear localization domain of treacle, seemed not essential for the treacle function. In contrast, the novel mutation of Ala26Val is considered to affect the LisH domain, an important domain of treacle. All of the mutations thus far detected in exon 5 have resulted in frameshift, but a nonsense mutation was detected (Lys159Stop). The information obtained in the present study provides additional insights into the functional domains of treacle.

  5. Heterozygous mutations in the LDL receptor-related protein 5 (LRP5) gene are associated with primary osteoporosis in children.

    Science.gov (United States)

    Hartikka, Heini; Mäkitie, Outi; Männikkö, Minna; Doria, Andrea S; Daneman, Alan; Cole, William G; Ala-Kokko, Leena; Sochett, Etienne B

    2005-05-01

    Three of 20 patients with juvenile osteoporosis were found to have a heterozygous mutation in the LRP5 gene. No mutations were found in the type I collagen genes. Mutations in the other family members with similar bone phenotype confirmed that LRP5 has a role in both juvenile and adult osteoporosis. The gene encoding the low-density lipoprotein receptor-related protein 5 (LRP5) gene has recently been shown to affect bone mass accrual during growth and to be involved in osteoporosis-pseudoglioma syndrome and a high bone mass phenotype. Mutations in the type I collagen genes (COL1A1 and COL1A2) are known to cause osteogenesis imperfecta, characterized by increased bone fragility. Here we analyzed COL1A1, COL1A2, and LRP5 for mutations in 20 pediatric patients with primary osteoporosis characterized by low BMD, recurrent fractures, and absent extraskeletal manifestations. No mutations were detected in the type I collagen genes, but two missense mutations (A29T and R1036Q) and one frameshift mutation (C913fs) were found in the LRP5 gene in three of the patients. The frameshift mutation was also seen in the proband's father and brother, who both were found to have significant osteoporosis. R1036Q was observed in the proband's mother and two brothers, who all had osteoporosis. These results indicate that heterozygous mutations in the LRP5 gene can cause osteoporosis in both children and adults.

  6. A novel TSC2 mutation in a Chinese family with tuberous sclerosis ...

    Indian Academy of Sciences (India)

    Supplementary data, J. Genet. 93, 169-172. Figure 1. Amino acid changes caused by the deletion c.2690delT. The mutation (p.Phe897SerfsX947) resulted in a frameshift and a run of 50 missense amino acids followed by a premature stop codon (TGA), resulting in a truncation protein of 946 amino acids. Journal of Genetics ...

  7. Two novel NIPBL gene mutations in Chinese patients with Cornelia de Lange syndrome.

    Science.gov (United States)

    Mei, Libin; Liang, Desheng; Huang, Yanru; Pan, Qian; Wu, Lingqian

    2015-01-25

    Cornelia de Lange syndrome (CdLS) is a dominantly inherited developmental disorder characterized by distinctive facial features, mental retardation, and upper limb defects, with the involvement of multiple organs and systems. To date, mutations have been identified in five genes responsible for CdLS: NIPBL, SMC1A, SMC3, RAD21, and HDAC8. Here, we present a clinical and molecular characterization of five unrelated Chinese patients whose clinical presentation is consistent with that of CdLS. There were no chromosomal abnormalities in the five children. In three patients, DNA sequencing revealed a previously reported frameshift mutation c.2479delA (p.Arg827GlyfsX20), and two novel mutations including a heterozygous mutation c.6272 G>T (p.Cys2091Phe) and a frameshift mutation c.1672delA (p.Thr558LeufsX7) in NIPBL. For the remaining patients, large deletions and/or duplications within the NIPBL gene were excluded as playing a role in the pathogenesis, by Multiplex Ligation-dependent Probe Amplification (MLPA) analysis. These findings broaden the mutation spectrum of NIPBL and further our understanding of the diverse and variable effects of NIPBL mutations on CdLS. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Juvenil polypose-syndrom og hereditær hæmoragisk telangiektasi hos en patient med SMAD4-mutation

    DEFF Research Database (Denmark)

    Jelsig, Anne Marie; Tørring, Pernille Mathiesen; Wikman, Friedrik

    2014-01-01

    Germ line mutations in SMAD4 can cause both juvenile polyposis syndrome and hereditary haemorrhagic telangiectasia syndrome. In this case we present a 37-year-old man with a frameshift mutation in SMAD4. The patient had multiple polyps in the gastrointestinal tract and was diagnosed with colon ca...... cancer at the age of 21 and gastro-oesophageal junction cancer at the age of 37. Furthermore the patient had telangiectasias and recurrent epistaxis....

  9. Novel and recurrent BRCA1/BRCA2 mutations in early onset and familial breast and ovarian cancer detected in the Program of Genetic Counseling in Cancer of Valencian Community (eastern Spain). Relationship of family phenotypes with mutation prevalence.

    Science.gov (United States)

    de Juan Jiménez, Inmaculada; García Casado, Zaida; Palanca Suela, Sarai; Esteban Cardeñosa, Eva; López Guerrero, José Antonio; Segura Huerta, Ángel; Chirivella González, Isabel; Sánchez Heras, Ana Beatriz; Juan Fita, Ma José; Tena García, Isabel; Guillen Ponce, Carmen; Martínez de Dueñas, Eduardo; Romero Noguera, Ignacio; Salas Trejo, Dolores; Goicoechea Sáez, Mercedes; Bolufer Gilabert, Pascual

    2013-12-01

    During the first 6 years of the Program of Genetic Counselling in Cancer of Valencia (eastern Spain), 310 mutations (155 in BRCA1 and 155 in BRCA2) in 1,763 hereditary breast (BC) and ovarian cancer (OC) families were identified. Of the mutations found 105 were distinct (53 in BRCA1 and 52 in BRCA2), eight new and 37 recurrent. Two of the novel mutations were frame-shift placed in exons 2 and 11 of BRCA1 and the remaining six were placed in BRCA2; four frame-shift (three in exon 11 and one in exon 23), one deletion of the entire exon 19 and one in the intervening sequence of exon 22. The BRCA1 mutations with higher recurrence were c.66_68delAG, c.5123C > A, c.1961delA, c.3770_3771delAG and c.5152+5G > A that covered 45.2% of mutations of this gene. The age of onset of BCs of c.68_69delAG mutation carriers occurs later than for the other recurrent mutations of this gene (45 vs. 37 years; p = 0.008). The BRCA2 mutations with higher recurrence were c.9026_9030delATCAT, c.3264insT and c.8978_8991del14 which represented 43.2% of all mutations in this gene, being the most recurrent mutation by far c.9026_9030delATCAT that represents 21.3% of BRCA2 mutations and 10.6% of all mutations. Probands with family histories of BC and OC, or OC and/or BC in at least two first degree relatives, were the more likely to have BRCA1/BRCA2 mutations (35.2% of the total mutations). And that most BRCA1mutations (73.19% mutations) occurred in probands with early-onset BC or with family history of OC.

  10. The FOXA2 transcription factor is frequently somatically mutated in uterine carcinosarcomas and carcinomas.

    Science.gov (United States)

    Le Gallo, Matthieu; Rudd, Meghan L; Urick, Mary Ellen; Hansen, Nancy F; Merino, Maria J; Mutch, David G; Goodfellow, Paul J; Mullikin, James C; Bell, Daphne W

    2018-01-01

    Uterine carcinosarcomas (UCSs) are a rare but clinically aggressive form of cancer. They are biphasic tumors consisting of both epithelial and sarcomatous components. The majority of uterine carcinosarcomas are clonal, with the carcinomatous cells undergoing metaplasia to give rise to the sarcomatous component. The objective of the current study was to identify novel somatically mutated genes in UCSs. We whole exome sequenced paired tumor and nontumor DNAs from 14 UCSs and orthogonally validated 464 somatic variants using Sanger sequencing. Fifteen genes that were somatically mutated in at least 2 tumor exomes were Sanger sequenced in another 39 primary UCSs. Overall, among 53 UCSs in the current study, the most frequently mutated of these 15 genes were tumor protein p53 (TP53) (75.5%), phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) (34.0%), protein phosphatase 2, regulatory subunit A, alpha (PPP2R1A) (18.9%), F-box and WD repeat domain containing 7 (FBXW7) (18.9%), chromodomain helicase DNA binding protein 4 (CHD4) (17.0%), and forkhead box A2 (FOXA2) (15.1%). FOXA2 has not previously been implicated in UCSs and was predominated by frameshift and nonsense mutations. One UCS with a FOXA2 frameshift mutation expressed truncated FOXA2 protein by immunoblotting. Sequencing of FOXA2 in 160 primary endometrial carcinomas revealed somatic mutations in 5.7% of serous, 22.7% of clear cell, 9% of endometrioid, and 11.1% of mixed endometrial carcinomas, the majority of which were frameshift mutations. Collectively, the findings of the current study provide compelling genetic evidence that FOXA2 is a pathogenic driver gene in the etiology of primary uterine cancers, including UCSs. Cancer 2018;124:65-73. © 2017 American Cancer Society. © 2017 American Cancer Society.

  11. Mutation analysis of the gene involved in adrenoleukodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Oost, B.A. van; Ligtenberg, M.J.L. [Univ. Hospital Nijmegen (Netherlands); Kemp, S.; Bolhuis, P.A. [Academic Medical Center, Amsterdam (Netherlands)

    1994-09-01

    A gene responsible for the X-linked genetic disorder adrenoleukodystrophy (ALD) that is characterized by demyelination of the nervous system and adrenocortical insufficiency has been identified by positional cloning. The gene encodes an ATP-binding transporter which is located in the peroxisomal membrane. Deficiency of the gene leads to accumulation of unsaturated very long chain fatty acids due to impaired peroxisomal {beta}-oxidation. A systematic analysis of the open reading frame of the ALD gene unraveled the mutations in 28 different families using reverse transcriptase-PCR followed by direct sequencing. No entire gene deletions or drastic promoter mutations have been detected. Only in one family did the mutation involved multiple exons. The remaining mutations were subtle alterations leading to missense (about 50%) or nonsense mutations, frameshifts or splice acceptor site defects. In one patient a single codon was missing. Mutations affecting a single amino acid were concentrated in the region between the third and fourth putative membrane spanning fragments and in the ATP-binding domain. This overview of mutations aids in the determination of structural and functional important regions and facilitates the screening for mutations in other ALD patients. The detection of mutations in virtually all ALD families tested indicates that the isolated gene is the only gene responsible for ALD located in Xq28.

  12. Mutation analysis in Norwegian families with hereditary hemorrhagic telangiectasia: founder mutations in ACVRL1.

    Science.gov (United States)

    Heimdal, K; Dalhus, B; Rødningen, O K; Kroken, M; Eiklid, K; Dheyauldeen, S; Røysland, T; Andersen, R; Kulseth, M A

    2016-02-01

    Hereditary hemorrhagic telangiectasia (HHT, Osler-Weber-Rendu disease) is an autosomal dominant inherited disease defined by the presence of epistaxis and mucocutaneous telangiectasias and arteriovenous malformations (AVMs) in internal organs. In most families (~85%), HHT is caused by mutations in the ENG (HHT1) or the ACVRL1 (HHT2) genes. Here, we report the results of genetic testing of 113 Norwegian families with suspected or definite HHT. Variants in ENG and ACVRL1 were found in 105 families (42 ENG, 63 ACVRL1), including six novel variants of uncertain pathogenic significance. Mutation types were similar to previous reports with more missense variants in ACVRL1 and more nonsense, frameshift and splice-site mutations in ENG. Thirty-two variants were novel in this study. The preponderance of ACVRL1 mutations was due to founder mutations, specifically, c.830C>A (p.Thr277Lys), which was found in 24 families from the same geographical area of Norway. We discuss the importance of founder mutations and present a thorough evaluation of missense and splice-site variants. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Mutation detection and prenatal diagnosis of XLHED pedigree

    Directory of Open Access Journals (Sweden)

    Yao Lin

    2017-08-01

    Full Text Available Background The phenotypic characters of X -linked Hypohidrotic Ectodermal Dysplasia (XLHED are the dysplasia of epithelial- and mesenchymal-derived organs. Ectodysplasin (EDA is the causative gene of XLHED. Methods The current study reported a large Chinese XLHED pedigree. The genomic DNA of adult and fetus was extracted from peripheral blood and shed chorion cell respectively. The nucleotide variation in EDA gene was screened through direct sequencing the coding sequence. The methylation state of EDA gene’s promoter was evaluated by pyrosequencing. Results This Chinese XLHED family had two male patients and three carriers. All of them were with a novel EDA frameshift mutation. The mutation, c.172-173insGG, which leads to an immediate premature stop codon in exon one caused severe structural changes of EDA. Prenatal diagnosis suggested that the fetus was a female carrier. The follow-up observation of this child indicated that she had mild hypodontia of deciduous teeth at age six. The methylation level of EDA gene’s promoter was not related to carriers’ phenotype changes in this family. Discussion We reported a new frameshift mutation of EDA gene in a Chinese family. Prenatal diagnosis can help to predict the disease status of the fetus.

  14. ENG mutational mosaicism in a family with hereditary hemorrhagic telangiectasia

    DEFF Research Database (Denmark)

    Tørring, Pernille M; Kjeldsen, Anette D; Ousager, Lilian Bomme

    2018-01-01

    BACKGROUND: Hereditary hemorrhagic telangiectasia (HHT) is an autosomal dominant genetic disorder caused by mutations in ENG, ACVRL1, or SMAD4. Around 90% of HHT patients present with a heterozygous pathogenic genetic variation. Almost all cases of HHT have a family history. Very few cases are de...... novo or mosaicism. We describe a case with mutational mosaicism that would not be observed in the clinical routine when using Sanger sequencing or a NGS read coverage below app. 100. METHODS: DNA was extracted from peripheral blood leukocytes, and buccal swabs. The coding region, exon-intron boundaries......, and the flanking sequences of the genes were sequenced by NGS. RESULTS: The proband had clinical HHT fulfilling the Curaçao criteria and genetic testing identified a frameshift mutation in ENG. The mother of the proband, also with clinical HHT, was found negative when analyzing DNA from blood for the familial...

  15. Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

    Energy Technology Data Exchange (ETDEWEB)

    Ionasescu, V.; Ionasescu, R.; Searby, C. [Univ. of Iowa Hospitals and Clinics, Iowa City, IA (United States)

    1996-06-14

    We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these families showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.

  16. [X-linked adrenoleukodystrophy ABCD1 gene mutation analysis in China].

    Science.gov (United States)

    Pan, Hong; Xiong, Hui; Zhang, Yue-hua; Wu, Ye; Bao, Xin-hua; Jiang, Yu-wu; Wu, Xi-ru

    2004-02-01

    To investigate mutations of ABCD1 gene in X- linked adrenoleukodystrophy (ALD) patients in China. Polymerase chain reaction and DNA direct sequencing were employed to analyze the 10 exons of ABCD1 gene in 25 ALD patients. Seventeen mutations in different exons (except exons 4, 9 and 10) were identified in 18 of 25 patients. Most of the mutations were missense mutations, including R182P, G266R, H283D, S404P, N509I, R518G, L520Q, Q556R, S606L and R617C, four (H283D, S40 4P, N509I, R518G) of 10 missense mutations were novel. Also identified were 3 nonsense mutations (W132X, W242X, W595X), 1 dinucleotides deletion mutation (1414 del AG) resulting in frameshift, and 1 base pair deletion at splice acceptor site (IVS5-6 del C). Two synonymous mutations (L516L and V349V) appeared simultaneously in 2 unrelated patients, and no other mutations could be found with them in all 10 exons screened. There were no hot spot mutations in ABCD1 gene in China. Mutations in gene were found over 70% of patients with ALD in China. The ABCD1 gene mutations identified revealed no obvious correlation between the type of mutation and phenotype.

  17. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2.

    Science.gov (United States)

    Nangalia, J; Massie, C E; Baxter, E J; Nice, F L; Gundem, G; Wedge, D C; Avezov, E; Li, J; Kollmann, K; Kent, D G; Aziz, A; Godfrey, A L; Hinton, J; Martincorena, I; Van Loo, P; Jones, A V; Guglielmelli, P; Tarpey, P; Harding, H P; Fitzpatrick, J D; Goudie, C T; Ortmann, C A; Loughran, S J; Raine, K; Jones, D R; Butler, A P; Teague, J W; O'Meara, S; McLaren, S; Bianchi, M; Silber, Y; Dimitropoulou, D; Bloxham, D; Mudie, L; Maddison, M; Robinson, B; Keohane, C; Maclean, C; Hill, K; Orchard, K; Tauro, S; Du, M-Q; Greaves, M; Bowen, D; Huntly, B J P; Harrison, C N; Cross, N C P; Ron, D; Vannucchi, A M; Papaemmanuil, E; Campbell, P J; Green, A R

    2013-12-19

    Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. We performed exome sequencing of samples obtained from 151 patients with myeloproliferative neoplasms. The mutation status of the gene encoding calreticulin (CALR) was assessed in an additional 1345 hematologic cancers, 1517 other cancers, and 550 controls. We established phylogenetic trees using hematopoietic colonies. We assessed calreticulin subcellular localization using immunofluorescence and flow cytometry. Exome sequencing identified 1498 mutations in 151 patients, with medians of 6.5, 6.5, and 13.0 mutations per patient in samples of polycythemia vera, essential thrombocythemia, and myelofibrosis, respectively. Somatic CALR mutations were found in 70 to 84% of samples of myeloproliferative neoplasms with nonmutated JAK2, in 8% of myelodysplasia samples, in occasional samples of other myeloid cancers, and in none of the other cancers. A total of 148 CALR mutations were identified with 19 distinct variants. Mutations were located in exon 9 and generated a +1 base-pair frameshift, which would result in a mutant protein with a novel C-terminal. Mutant calreticulin was observed in the endoplasmic reticulum without increased cell-surface or Golgi accumulation. Patients with myeloproliferative neoplasms carrying CALR mutations presented with higher platelet counts and lower hemoglobin levels than patients with mutated JAK2. Mutation of CALR was detected in hematopoietic stem and progenitor cells. Clonal analyses showed CALR mutations in the earliest phylogenetic node, a finding consistent with its role as an initiating mutation in some patients. Somatic mutations in the endoplasmic reticulum chaperone CALR were found in a majority of patients with myeloproliferative neoplasms with nonmutated JAK2. (Funded by the Kay

  18. Singlet oxygen-induced mutations in M13 lacZ phage DNA.

    OpenAIRE

    Decuyper-Debergh, D; Piette, J; Van de Vorst, A

    1987-01-01

    The mutagenic consequences of damages to M13 mp19 RF DNA produced by singlet oxygen have been determined in a forward mutational system capable of detecting all classes of mutagenic events. When the damaged M13 mp19 RF DNA is used to transfect competent E. coli JM105 cells, a 16.6-fold increase in mutation frequency is observed at 5% survivors when measured as a loss of alpha-complementation. The enhanced mutagenicity is largely due to single-nucleotide substitutions, frameshift events and do...

  19. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population.

    Science.gov (United States)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos; Melin, Beatrice; Nordling, Margareta; Stenmark-Askmalm, Marie; Lindblom, Annika; Nilbert, Mef

    2016-11-01

    Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2. After 20 years of genetic counseling and genetic testing for Lynch syndrome, we have compiled the mutation spectrum in Sweden with the aim to provide a population-based perspective on the contribution from the different MMR genes, the various types of mutations and the influence from founder mutations. Mutation data were collected on a national basis from all laboratories involved in genetic testing. Mutation analyses were performed using mainly Sanger sequencing and multiplex ligation-dependent probe amplification. A total of 201 unique disease-predisposing MMR gene mutations were identified in 369 Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder mutation that accounted for 15% of the families with mutations in MLH1. In conclusion, the Swedish Lynch syndrome mutation spectrum is diverse with private MMR gene mutations in two-thirds of the families, has a significant contribution from internationally recognized mutations and a limited effect from founder mutations.

  20. Novel missense MTTP gene mutations causing abetalipoproteinemia.

    Science.gov (United States)

    Miller, Sharon A; Burnett, John R; Leonis, Mike A; McKnight, C James; van Bockxmeer, Frank M; Hooper, Amanda J

    2014-10-01

    The microsomal triglyceride transfer protein (MTTP) plays a critical role in the formation of hepatic very low density lipoprotein. Abetalipoproteinemia (ABL) is a rare, naturally occurring extreme form of MTTP inhibition, which is characterized by the virtual absence of apolipoprotein (apo) B-containing lipoproteins in blood. The goal of this study was to examine the effect that four novel MTTP missense mutations had on protein interactions, expression and lipid-transfer activity, and to determine which mutations were responsible for the ABL phenotype observed in two patients. In two patients with ABL, we identified in MTTP a novel frameshift mutation (K35Ffs*37), and four novel missense mutations, namely, G264R, Y528H, R540C, and N649S. When transiently expressed in COS-7 cells, all missense MTTP mutations interacted with apoB17, apoB48, and protein disulfide isomerase. Mutations Y528H and R540C, however, displayed negligible levels of MTTP activity and N649S displayed a partial reduction relative to the wild-type MTTP. In contrast, G264R retained full lipid-transfer activity. These studies indicate that missense mutations Y528H, R540C, and N649S appear to cause ABL by reducing MTTP activity rather than by reducing binding of MTTP with protein disulfide isomerase or apoB. The region of MTTP containing amino acids 528 and 540 constitutes a critical domain for its lipid-transfer activity. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Nocturnal frontal lobe epilepsy caused by a mutation in the GATOR1 complex gene NPRL3.

    Science.gov (United States)

    Korenke, Georg-Christoph; Eggert, Marlene; Thiele, Holger; Nürnberg, Peter; Sander, Thomas; Steinlein, Ortrud K

    2016-03-01

    Mutations in NPRL3, one of three genes that encode proteins of the mTORC1-regulating GATOR1 complex, have recently been reported to cause cortical dysplasia with focal epilepsy. We have now analyzed a multiplex epilepsy family by whole exome sequencing and identified a frameshift mutation (NM_001077350.2; c.1522delG; p.E508Rfs*46) within exon 13 of NPRL3. This truncating mutation causes an epilepsy phenotype characterized by early childhood onset of mainly nocturnal frontal lobe epilepsy. The penetrance in our family was low (three affected out of six mutation carriers), compared to families with either ion channel- or DEPDC5-associated familial nocturnal frontal lobe epilepsy. The absence of apparent structural brain abnormalities suggests that mutations in NPRL3 are not necessarily associated with focal cortical dysplasia but might be able to cause epilepsy by different, yet unknown pathomechanisms. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  2. Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

    1996-07-26

    Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

  3. Loss-of-function mutations of STXBP1 in patients with epileptic encephalopathy.

    Science.gov (United States)

    Yamamoto, Toshiyuki; Shimojima, Keiko; Yano, Tamami; Ueda, Yuki; Takayama, Rumiko; Ikeda, Hiroko; Imai, Katsumi

    2016-03-01

    Epileptic encephalopathy, which commences during early infancy, is a severe epileptic syndrome that manifests as age-dependent seizures and severe developmental delay. The syntaxin-binding protein 1 gene (STXBP1) is one of the genes responsible for epileptic encephalopathy. We conducted a cohort study to analyze STXBP1 in 42 patients with epileptic encephalopathy. We identified four novel mutations: two splicing mutations, a frameshift mutation, and a nonsense mutation. All of these mutations were predicted to cause loss-of-function. This result suggests loss-of-function is a common mechanism underlying STXBP1-related epileptic encephalopathy. The four patients showed epileptic features consistent with STXBP1-related epileptic encephalopathy, but showed variable radiological findings, including brain volume loss and myelination delay. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  4. TP53 mutation spectrum in smokers and never smoking lung cancer patients

    Directory of Open Access Journals (Sweden)

    Ann Rita Halvorsen

    2016-05-01

    Full Text Available AbstractBackground: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer.Methods: We analysed tumour tissue from 394 non-small cell carcinomas including adenocarcinomas (n=229, squamous cell carcinomas (n=112, large cell carcinomas (n=30 and others (n=23 for mutations in TP53 by the use of Sanger sequencing (n=394 and next generation sequencing (n=100. Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65% of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3% compared to adenocarcinomas (9.1%.Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, as also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers.

  5. Novel GABRG2 mutations cause familial febrile seizures

    Science.gov (United States)

    Boillot, Morgane; Morin-Brureau, Mélanie; Picard, Fabienne; Weckhuysen, Sarah; Lambrecq, Virginie; Minetti, Carlo; Striano, Pasquale; Zara, Federico; Iacomino, Michele; Ishida, Saeko; An-Gourfinkel, Isabelle; Daniau, Mailys; Hardies, Katia; Baulac, Michel; Dulac, Olivier; Leguern, Eric; Nabbout, Rima

    2015-01-01

    Objective: To identify the genetic cause in a large family with febrile seizures (FS) and temporal lobe epilepsy (TLE) and subsequently search for additional mutations in a cohort of 107 families with FS, with or without epilepsy. Methods: The cohort consisted of 1 large family with FS and TLE, 64 smaller French families recruited through a national French campaign, and 43 Italian families. Molecular analyses consisted of whole-exome sequencing and mutational screening. Results: Exome sequencing revealed a p.Glu402fs*3 mutation in the γ2 subunit of the GABAA receptor gene (GABRG2) in the large family with FS and TLE. Three additional nonsense and frameshift GABRG2 mutations (p.Arg136*, p.Val462fs*33, and p.Pro59fs*12), 1 missense mutation (p.Met199Val), and 1 exonic deletion were subsequently identified in 5 families of the follow-up cohort. Conclusions: We report GABRG2 mutations in 5.6% (6/108) of families with FS, with or without associated epilepsy. This study provides evidence that GABRG2 mutations are linked to the FS phenotype, rather than epilepsy, and that loss-of-function of GABAA receptor γ2 subunit is the probable underlying pathogenic mechanism. PMID:27066572

  6. X-ray-induced mutations in Escherichia coli K-12 strains with altered DNA polymerase I activities

    International Nuclear Information System (INIS)

    Nagata, Yuki; Kawata, Masakado; Komura, Jun-ichiro; Ono, Tetsuya; Yamamoto, Kazuo

    2003-01-01

    Spectra of ionizing radiation mutagenesis were determined by sequencing X-ray-induced endogenous tonB gene mutations in Escherichia coli polA strains. We used two polA alleles, the polA1 mutation, defective for Klenow domain, and the polA107 mutation, defective for flap domain. We demonstrated that irradiation of 75 and 50 Gy X-rays could induce 3.8- and 2.6-fold more of tonB mutation in polA1 and polA107 strains, respectively, than spontaneous level. The radiation induced spectrum of 51 tonB mutations in polA1 and 51 in polA107 indicated that minus frameshift, A:T→T:A transversion and G:C→T:A transversion were the types of mutations increased. Previously, we have reported essentially the same X-ray-induced tonB mutation spectra in the wild-type strain. These results indicate that (1) X-rays can induce minus frameshift, A:T→T:A transversion and G:C→T:A transversion in E. coli and (2) presence or absence of polymerase I (PolI) of E. coli does not have any effects on the process of X-ray mutagenesis

  7. Novel COL4A1 mutations cause cerebral small vessel disease by haploinsufficiency.

    Science.gov (United States)

    Lemmens, Robin; Maugeri, Alessandra; Niessen, Hans W M; Goris, An; Tousseyn, Thomas; Demaerel, Philippe; Corveleyn, Anniek; Robberecht, Wim; van der Knaap, Marjo S; Thijs, Vincent N; Zwijnenburg, Petra J G

    2013-01-15

    Mutations in COL4A1 have been identified in families with hereditary small vessel disease of the brain presumably due to a dominant-negative mechanism. Here, we report on two novel mutations in COL4A1 in two families with porencephaly, intracerebral hemorrhage and severe white matter disease caused by haploinsufficiency. Two families with various clinical presentations of cerebral microangiopathy and autosomal dominant inheritance were examined. Clinical, neuroradiological and genetic investigations were performed. Electron microscopy of the skin was also performed. In one of the families, sequence analysis revealed a one base deletion, c.2085del, leading to a frameshift and a premature stopcodon, p.(Gly696fs). In the other family, a splice site mutation was identified, c.2194-1G>A, which most likely leads to skipping of an exon with a frameshift and premature termination as a result. In fibroblasts of affected individuals from both the families, nonsense-mediated decay (NMD) of the mutant COL4A1 messenger RNAs (mRNAs) and a clear reduction of COL4A1 protein expression were demonstrated, indicating haploinsufficiency of COL4A1. Moreover, thickening of the capillary basement membrane in the skin was documented, similar to reports in patients with COL4A1 missense mutations. These findings suggest haploinsufficiency, a different mechanism from the commonly assumed dominant-negative effect, for COL4A1 mutations as a cause of (antenatal) intracerebral hemorrhage and white matter disease.

  8. Two novel RAD21 mutations in patients with mild Cornelia de Lange syndrome-like presentation and report of the first familial case.

    Science.gov (United States)

    Minor, Agata; Shinawi, Marwan; Hogue, Jacob S; Vineyard, Marisa; Hamlin, Damara R; Tan, Christopher; Donato, Kirsten; Wysinger, Latrice; Botes, Shaun; Das, Soma; Del Gaudio, Daniela

    2014-03-10

    Cornelia de Lange syndrome (CdLS) is a developmental disorder characterized by limb reduction defects, characteristic facial features and impaired cognitive development. Mutations in the NIPBL gene predominate; however, mutations in other cohesin complex genes have also been implicated, particularly in atypical and mild CdLS cases. Missense mutations and whole gene deletions in RAD21 have been identified in children with growth retardation, minor skeletal anomalies and facial features that overlap findings in individuals with CdLS. We report the first intragenic deletion and frameshift mutations identified in RAD21 in two patients presenting with atypical CdLS. One patient had an in-frame deletion of exon 13, while the second patient had a c.592_593dup frameshift mutation. The first patient presented with developmental delay, hypospadias, inguinal hernia and dysmorphic features while, the second patient presented with developmental delay, characteristic facial features, hirsutism, and hand and feet anomalies, with the first patient being milder than the second. The in-frame deletion mutation was found to be inherited from the mother who had a history of melanoma and other unspecified medical problems. This study expands the spectrum of RAD21 mutations and emphasizes the clinical utility of performing RAD21 mutation analysis in patients presenting with atypical forms of CdLS. Moreover, the variability of clinical presentation within families and low penetrance of mutations as well as the significance of performing molecular genetic testing in mildly affected patients are discussed. Published by Elsevier B.V.

  9. Screening for SH3TC2 gene mutations in a series of demyelinating recessive Charcot-Marie-Tooth disease (CMT4).

    Science.gov (United States)

    Piscosquito, Giuseppe; Saveri, Paola; Magri, Stefania; Ciano, Claudia; Gandioli, Claudia; Morbin, Michela; Bella, Daniela D; Moroni, Isabella; Taroni, Franco; Pareyson, Davide

    2016-09-01

    Charcot-Marie-Tooth disease type 4C (CMT4C) is an autosomal recessive (AR) demyelinating neuropathy associated to SH3TC2 mutations, characterized by early onset, spine deformities, and cranial nerve involvement. We screened 43 CMT4 patients (36 index cases) with AR inheritance, demyelinating nerve conductions, and negative testing for PMP22 duplication, GJB1 and MPZ mutations, for SH3TC2 mutations. Twelve patients (11 index cases) had CMT4C as they carried homozygous or compound heterozygous mutations in SH3TC2. We found six mutations: three nonsense (p.R1109*, p.R954*, p.Q892*), one splice site (c.805+2T>C), one synonymous variant (p.K93K) predicting altered splicing, and one frameshift (p.F491Lfs*32) mutation. The splice site and the frameshift mutations are novel. Mean onset age was 7 years (range: 1-14). Neuropathy was moderate-to-severe. Scoliosis was present in 11 patients (severe in 4), and cranial nerve deficits in 9 (hearing loss in 7). Scoliosis and cranial nerve involvement are frequent features of this CMT4 subtype, and their presence should prompt the clinician to look for SH3TC2 gene mutations. In our series of undiagnosed CMT4 patients, SH3TC2 mutation frequency is 30%, confirming that CMT4C may be the most common AR-CMT type. © 2016 Peripheral Nerve Society.

  10. Expanding the Clinical and Genetic Spectrum of KRT1, KRT2 and KRT10 Mutations in Keratinopathic Ichthyosis.

    Science.gov (United States)

    Hotz, Alrun; Oji, Vinzenz; Bourrat, Emmanuelle; Jonca, Nathalie; Mazereeuw-Hautier, Juliette; Betz, Regina C; Blume-Peytavi, Ulrike; Stieler, Karola; Morice-Picard, Fanny; Schönbuchner, Ines; Markus, Susanne; Schlipf, Nina; Fischer, Judith

    2016-05-01

    Twenty-six families with keratinopathic ichthyoses (epidermolytic ichthyosis, superficial epidermolytic ichthyosis or congenital reticular ichthyosiform erythroderma) were studied. Epidermolytic ichthyosis is caused by mutations in the genes KRT1 or KRT10, mutations in the gene KRT2 lead to superficial epidermolytic ichthyosis, and congenital reticular ichthyosiform erythroderma is caused by frameshift mutations in the genes KRT10 or KRT1, which lead to the phenomenon of revertant mosaicism. In this study mutations were found in KRT1, KRT2 and KRT10, including 8 mutations that are novel pathogenic variants. We report here the first case of a patient with congenital reticular ichthyosiform erythroderma carrying a mutation in KRT10 that does not lead to an arginine-rich reading frame. Novel clinical features found in patients with congenital reticular ichthyosiform erythroderma are described, such as mental retardation, spasticity, facial dysmorphisms, symblepharon and malposition of the 4th toe.

  11. Beta-thalassaemia mutations in northern India (Delhi).

    Science.gov (United States)

    Madan, N; Sharma, S; Rusia, U; Sen, S; Sood, S K

    1998-03-01

    The present study was undertaken to define beta-thalassaemia mutations prevalent in northern India (Delhi). Forty six children of beta-thalassaemia major and their families were investigated. DNA was extracted from leucocytes and screened for mutations prevalent in the Indian population. These mutations included 619bp deletion, IVS 1-1 (G-T), IVS 1-5 (G-C), frameshift mutations FS 8/9 (+G), FS 41/42 (-CTTT), Codon 16(-C), Codon 15 (G-A), codon 30 (G-C), IVS 1-110 (G-A) and -88 (C-T). 619 bp deletion mutation was detected directly by amplification of DNA by PCR followed by agarose gel electrophoresis. Other mutations were studied by DNA amplification and dot blot hybridization using synthetic normal and mutant oligonucleotide probes labelled at 5' end with gamma-32 P-ATP. Five mutations accounted for all the chromosomes in 46 patients. 619 bp deletion mutation was found to be the commonest mutation (34.8%) followed by IVS 1-5 (G-C) in 22.8 per cent, IVS 1-1 (G-T) in 19.6 per cent, FS 8/9 (+G) in 13 per cent and FS 41/42 (-CTTT) in 9.8 per cent. Nineteen (41.3%) patients were homozygous and 27 (58.7%) double heterozygous for different beta-thalassaemia mutations. This observation of limited number of mutations is significant and will be useful in planning strategies for prenatal diagnosis of beta-thalassaemia in northern India.

  12. Role of mutation in Pseudomonas aeruginosa biofilm development.

    Directory of Open Access Journals (Sweden)

    Tim C R Conibear

    2009-07-01

    Full Text Available The survival of bacteria in nature is greatly enhanced by their ability to grow within surface-associated communities called biofilms. Commonly, biofilms generate proliferations of bacterial cells, called microcolonies, which are highly recalcitrant, 3-dimensional foci of bacterial growth. Microcolony growth is initiated by only a subpopulation of bacteria within biofilms, but processes responsible for this differentiation remain poorly understood. Under conditions of crowding and intense competition between bacteria within biofilms, microevolutionary processes such as mutation selection may be important for growth; however their influence on microcolony-based biofilm growth and architecture have not previously been explored. To study mutation in-situ within biofilms, we transformed Pseudomonas aeruginosa cells with a green fluorescent protein gene containing a +1 frameshift mutation. Transformed P. aeruginosa cells were non-fluorescent until a mutation causing reversion to the wildtype sequence occurs. Fluorescence-inducing mutations were observed in microcolony structures, but not in other biofilm cells, or in planktonic cultures of P. aeruginosa cells. Thus microcolonies may represent important foci for mutation and evolution within biofilms. We calculated that microcolony-specific increases in mutation frequency were at least 100-fold compared with planktonically grown cultures. We also observed that mutator phenotypes can enhance microcolony-based growth of P. aeruginosa cells. For P. aeruginosa strains defective in DNA fidelity and error repair, we found that microcolony initiation and growth was enhanced with increased mutation frequency of the organism. We suggest that microcolony-based growth can involve mutation and subsequent selection of mutants better adapted to grow on surfaces within crowded-cell environments. This model for biofilm growth is analogous to mutation selection that occurs during neoplastic progression and tumor

  13. Frameshifted beta-amyloid precursor protein (APP(+1)) is a secretory protein, and the level of APP(+1) in cerebrospinal fluid is linked to Alzheimer pathology

    NARCIS (Netherlands)

    Hol, Elly M.; van Dijk, Renske; Gerez, Lisya; Sluijs, Jacqueline A.; Hobo, Barbara; Tonk, Martijn T.; de Haan, Annett; Kamphorst, Wouter; Fischer, David F.; Benne, Rob; van Leeuwen, Fred W.

    2003-01-01

    Molecular misreading of the beta-amyloid precursor protein (APP) gene generates mRNA with dinucleotide deletions in GAGAG motifs. The resulting truncated and partly frameshifted APP protein ( APP(+1)) accumulates in the dystrophic neurites and the neurofibrillary tangles in the cortex and

  14. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and Kelp fly virus.

    Directory of Open Access Journals (Sweden)

    Steven M Valles

    Full Text Available Solenopsis invicta virus 3 (SINV-3 is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV, an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order.

  15. The identification of point mutations in Duchenne muscular dystrophy patients by using reverse-transcription PCR and the protein truncation test

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)

    1995-08-01

    The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.

  16. A novel heterozygous SOX2 mutation causing congenital bilateral anophthalmia, hypogonadotropic hypogonadism and growth hormone deficiency.

    Science.gov (United States)

    Macchiaroli, Annamaria; Kelberman, Daniel; Auriemma, Renata Simona; Drury, Suzanne; Islam, Lily; Giangiobbe, Sara; Ironi, Gabriele; Lench, Nicholas; Sowden, Jane C; Colao, Annamaria; Pivonello, Rosario; Cavallo, Luciano; Gasperi, Maurizio; Faienza, Maria Felicia

    2014-01-25

    Heterozygous de novo mutations in SOX2 have been reported in approximately 10-20% of patients with unilateral or bilateral anophthalmia or microphthalmia. An additional phenotype of hypopituitarism, with anterior pituitary hypoplasia and hypogonadotropic hypogonadism, has been reported in patients carrying SOX2 alterations. We report a novel heterozygous mutation in the SOX2 gene in a male affected with congenital bilateral anophthalmia, hypogonadotrophic hypogonadism and growth hormone deficiency. The mutation we describe is a cytosine deletion in position 905 (c905delC) which causes frameshift and an aberrant C-terminal domain. Our report highlights the fact that subjects affected with eye anomalies and harboring SOX2 mutations are at high risk for gonadotropin deficiency, which has important implications for their clinical management. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Variability in Chromatin Architecture and Associated DNA Repair at Genomic Positions Containing Somatic Mutations.

    Science.gov (United States)

    Lim, Byungho; Mun, Jihyeob; Kim, Yong Sung; Kim, Seon-Young

    2017-06-01

    Dynamic chromatin structures result in differential chemical reactivity to mutational processes throughout the genome. To identify chromatin features responsible for mutagenesis, we compared chromatin architecture around single-nucleotide variants (SNV), insertion/deletions (indels), and their context-matched, nonmutated positions. We found epigenetic differences between genomic regions containing missense SNVs and those containing frameshift indels across multiple cancer types. Levels of active histone marks were higher around frameshift indels than around missense SNV, whereas repressive histone marks exhibited the reverse trend. Accumulation of repressive histone marks and nucleosomes distinguished mutated positions (both SNV and indels) from the context-matched, nonmutated positions, whereas active marks were associated with substitution- and cancer type-specific mutagenesis. We also explained mutagenesis based on genome maintenance mechanisms, including nucleotide excision repair (NER), mismatch repair (MMR), and DNA polymerase epsilon (POLE). Regional NER variation correlated strongly with chromatin features; NER machineries exhibited shifted or depleted binding around SNV, resulting in decreased NER at mutation positions, especially at sites of recurrent mutations. MMR-deficient tumors selectively acquired SNV in regions with high active histone marks, especially H3K36me3, whereas POLE-deficient tumors selectively acquired indels and SNV in regions with low active histone marks. These findings demonstrate the importance of fine-scaled chromatin structures and associated DNA repair mechanisms in mutagenesis. Cancer Res; 77(11); 2822-33. ©2017 AACR . ©2017 American Association for Cancer Research.

  18. NPHS1 gene mutations confirm congenital nephrotic syndrome in four Brazilian cases: A novel mutation is described.

    Science.gov (United States)

    Guaragna, Mara S; Cleto, Thaís Lira; Souza, Marcela Lopes; Lutaif, Anna Cristina G B; de Castro, Luiz Cláudio Gonçalves; Penido, Maria Goretti Moreira Guimarães; Maciel-Guerra, Andréa T; Belangero, Vera M S; Guerra-Junior, Gil; De Mello, Maricilda P

    2016-09-01

    Autosomal recessive mutations in NPHS1 gene are a common cause of congenital nephrotic syndrome (CNS). The disorder is characterized by massive proteinuria that manifests in utero or in the neonatal period during the first 3 months of life. NPHS1 encodes nephrin, a member of the immunoglobulin family of cell adhesion molecules and the main protein expressed at the renal slit diaphragm. Currently, there are approximately 250 mutations described in the NPHS1 gene distributed among all nephrin domains. The main objective of this study was to perform the analysis of the NPHS1 gene in patients with congenital nephrotic syndrome in order to determine the molecular cause of the disease. Direct sequencing of NPHS1 gene in four children was performed. Each patient was heterozygous for two pathogenic mutations disclosing the molecular cause of the disease in 100% of the cases. We identified six different mutations, consisting of one in-frame deletion, one frameshift, and four missense substitutions. The p.Val736Met mutation that is described here for the first time was considered pathogenic by different mutation predictive algorithms. Regardless of the type of mutation, three patients had a bad outcome and died Despite the small size of the cohort, this study contributed to the increasing number of deleterious mutations in the NPHS1 gene by describing a new mutation. Also, since we identified NPHS1 pathogenic mutations as the cause of the disease in all cases analyzed, it might be a frequent cause of CNS in the South Eastern region of Brazil, although the analysis of a larger sample is required to obtain more indicative epidemiological data. © 2015 Asian Pacific Society of Nephrology.

  19. Mutation of RET proto-oncogene in Hirschsprung’s disease and intestinal neuronal dysplasia

    Science.gov (United States)

    Tou, Jin-Fa; Li, Min-Ju; Guan, Tao; Li, Ji-Cheng; Zhu, Xiong-Kai; Feng, Zhi-Gang

    2006-01-01

    AIM: To investigate the genetic relationship between Hirschsprung’s disease (HD) and intestinal neuronal dysplasia (IND) in Chinese population. METHODS: Peripheral blood samples were obtained from 30 HD patients, 20 IND patients, 18 HD/IND combined patients and 20 normal individuals as control. Genomic DNA was extracted according to standard procedure. Exons 11,13,15,17 of RET proto-oncogene were amplified by polymerase chain reaction (PCR). The mutations of RET proto-oncogene were analyzed by single strand conformational polymorphism (SSCP) and sequencing of the positive amplified products was performed. RESULTS: Eight germline sequence variants were detected. In HD patients, 2 missense mutations in exon 11 at nucleotide 15165 G→A (G667S), 2 frameshift mutations in exon 13 at nucleotide 18974 (18974insG), 1 missense mutation in exon 13 at nucleotide 18919 A→G (K756E) and 1 silent mutation in exon 15 at nucleotide 20692 G→A(Q916Q) were detected. In HD/IND combined patients, 1 missense mutation in exon 11 at nucleotide 15165 G→A and 1 silent mutation in exon 13 at nucleotide 18888 T→G (L745L) were detected. No mutation was found in IND patients and controls. CONCLUSION: Mutation of RET proto-oncogene is involved in the etiopathogenesis of HD. The frequency of RET proto-oncogene mutation is quite different between IND and HD in Chinese population. IND is a distinct clinical entity genetically different from HD. PMID:16534860

  20. Mutations in the gene for X-linked adrenoleukodystrophy in patients with different clinical phenotypes

    Energy Technology Data Exchange (ETDEWEB)

    Braun, A.; Ambach, H.; Kammerer, S.; Rolinski, B.; Roscher, A.; Rabl, W. [Univ. of Munich (Germany); Stoeckler, S. [Univ. of Graz (Germany); Gaertner, J. [Univ. of Duesseldorf (Germany); Zierz, S. [Univ. of Bonn (Germany)

    1995-04-01

    Recently, the gene for the most common peroxisomal disorder, X-linked adrenoleukodystrophy (X-ALD), has been described encoding a peroxisomal membrane transporter protein. We analyzed the entire protein-coding sequence of this gene by reverse-transcription PCR, SSCP, and DNA sequencing in five patients with different clinical expressions were cerebral childhood ALD, adrenomyecloneuropathy (AMN), and {open_quotes}Addison disease only{close_quotes} (AD) phenotype. In the three patients exhibiting the classical picture of severe childhood ALD we identified in the 5{prime} portion of the X-ALD gene a 38-bp deletion that causes a frameshift mutation, a 3-bp deletion leading to a deletion of an amino acid in the ATP-binding domain of the ALD protein, and a missense mutation. In the patient with the clinical phenotype of AMN, a nonsense mutation in codon 212, along with a second site mutation at codon 178, was observed. Analysis of the patient with the ADO phenotype revealed a further missense mutation at a highly conserved position in the ALDP/PMP70 comparison. The disruptive nature of two mutations (i.e., the frameshift and the nonsense mutation) in patients with biochemically proved childhood ALD and AMN further strongly supports the hypothesis that alterations in this gene play a crucial role in the pathogenesis of X-ALD. Since the current biochemical techniques for X-ALD carrier detection in affected families lack sufficient reliability, our procedure described for systematic mutation scanning is also capable of improving genetic counseling and prenatal diagnosis. 19 refs., 6 figs., 3 tabs.

  1. Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension. Retarded secretion and proteasomal degradation.

    Science.gov (United States)

    Komaru, Keiichi; Ishida, Yoko; Amaya, Yoshihiro; Goseki-Sone, Masae; Orimo, Hideo; Oda, Kimimitsu

    2005-04-01

    In the majority of hypophosphatasia patients, reductions in the serum levels of alkaline phosphatase activity are caused by various missense mutations in the tissue-nonspecific alkaline phosphatase (TNSALP) gene. A unique frame-shift mutation due to a deletion of T at cDNA number 1559 [TNSALP (1559delT)] has been reported only in Japanese patients with high allele frequency. In this study, we examined the molecular phenotype of TNSALP (1559delT) using in vitro translation/translocation system and COS-1 cells transiently expressing this mutant protein. We showed that the mutant protein not only has a larger molecular size than the wild type enzyme by approximately 12 kDa, reflecting an 80 amino acid-long extension at its C-terminus, but that it also lacks a glycosylphosphatidylinositol anchor. In support of this, alkaline phosphatase activity of the cells expressing TNSALP (1559delT) was localized at the juxtanucleus position, but not on the cell surface. However, only a limited amount of the newly synthesized protein was released into the medium and the rest was polyubiquitinated, followed by degradation in the proteasome. SDS/PAGE and analysis by sucrose-density-gradient analysis indicated that TNSALP (1559delT) forms a disulfide-bonded high-molecular-mass aggregate. Interestingly, the aggregate form of TNSALP (1559delT) exhibited a significant enzyme activity. When all three cysteines at positions of 506, 521 and 577 of TNSALP (1559delT) were replaced with serines, the aggregation disappeared and instead this modified mutant protein formed a noncovalently associated dimer, strongly indicating that these cysteine residues in the C-terminal region are solely responsible for aggregate formation by cross-linking the catalytically active dimers. Thus, complete absence of TNSALP on cell surfaces provides a plausible explanation for a severe lethal phenotype of a homozygote hypophosphatasia patient carrying TNSALP (1559delT).

  2. [Suspected pathogenic mutation identified in two cases with oculocutaneous albinism].

    Science.gov (United States)

    He, Jiangmei; Zheng, Meiling; Zhang, Guilin; Hua, Ailing

    2015-08-01

    To detect potential mutations in genes related with non-syndromic oculocutaneous albinism I-IV and ocular albinism type I in two couples who had given births to children with albinism. All exons of the non-syndromic albinism related genes TYR, OCA2, TYRP-1, MITF, SLC45A2 and GPR143 were subjected to deep sequencing. The results were verified with Sanger sequencing. For the two female carriers, the coding region of the TYR gene was found to harbor a frameshift mutation c.925_926insC, which was also suspected to have been pathogenic. In one of the male partners, a nonsense mutations c.832C>T was found, which was also known to be pathogenic. Another male partner was found to harbor a TYR gene mutation c.346C>T, which was also known to be a pathogenic nonsense mutation. The coding region of the TYR gene c.925_926insC (p.Thr309ThrfsX9) probably underlies the OCA1 disease phenotype.

  3. Mitochondrial Mutation Rate, Spectrum and Heteroplasmy in Caenorhabditis elegans Spontaneous Mutation Accumulation Lines of Differing Population Size.

    Science.gov (United States)

    Konrad, Anke; Thompson, Owen; Waterston, Robert H; Moerman, Donald G; Keightley, Peter D; Bergthorsson, Ulfar; Katju, Vaishali

    2017-06-01

    Mitochondrial genomes of metazoans, given their elevated rates of evolution, have served as pivotal markers for phylogeographic studies and recent phylogenetic events. In order to determine the dynamics of spontaneous mitochondrial mutations in small populations in the absence and presence of selection, we evolved mutation accumulation (MA) lines of Caenorhabditis elegans in parallel over 409 consecutive generations at three varying population sizes of N = 1, 10, and 100 hermaphrodites. The N =1 populations should have a minimal influence of natural selection to provide the spontaneous mutation rate and the expected rate of neutral evolution, whereas larger population sizes should experience increasing intensity of selection. New mutations were identified by Illumina paired-end sequencing of 86 mtDNA genomes across 35 experimental lines and compared with published genomes of natural isolates. The spontaneous mitochondrial mutation rate was estimated at 1.05 × 10-7/site/generation. A strong G/C→A/T mutational bias was observed in both the MA lines and the natural isolates. This suggests that the low G + C content at synonymous sites is the product of mutation bias rather than selection as previously proposed. The mitochondrial effective population size per worm generation was estimated to be 62. Although it was previously concluded that heteroplasmy was rare in C. elegans, the vast majority of mutations in this study were heteroplasmic despite an experimental regime exceeding 400 generations. The frequencies of frameshift and nonsynonymous mutations were negatively correlated with population size, which suggests their deleterious effects on fitness and a potent role for selection in their eradication. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

    Science.gov (United States)

    Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

    2014-12-01

    Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

  5. Ornithine decarboxylase antizyme finder (OAF: Fast and reliable detection of antizymes with frameshifts in mRNAs

    Directory of Open Access Journals (Sweden)

    Atkins John F

    2008-04-01

    Full Text Available Abstract Background Ornithine decarboxylase antizymes are proteins which negatively regulate cellular polyamine levels via their affects on polyamine synthesis and cellular uptake. In virtually all organisms from yeast to mammals, antizymes are encoded by two partially overlapping open reading frames (ORFs. A +1 frameshift between frames is required for the synthesis of antizyme. Ribosomes change translation phase at the end of the first ORF in response to stimulatory signals embedded in mRNA. Since standard sequence analysis pipelines are currently unable to recognise sites of programmed ribosomal frameshifting, proper detection of full length antizyme coding sequences (CDS requires conscientious manual evaluation by a human expert. The rapid growth of sequence information demands less laborious and more cost efficient solutions for this problem. This manuscript describes a rapid and accurate computer tool for antizyme CDS detection that requires minimal human involvement. Results We have developed a computer tool, OAF (ODC antizyme finder for identifying antizyme encoding sequences in spliced or intronless nucleic acid sequenes. OAF utilizes a combination of profile hidden Markov models (HMM built separately for the products of each open reading frame constituting the entire antizyme coding sequence. Profile HMMs are based on a set of 218 manually assembled antizyme sequences. To distinguish between antizyme paralogs and orthologs from major phyla, antizyme sequences were clustered into twelve groups and specific combinations of profile HMMs were designed for each group. OAF has been tested on the current version of dbEST, where it identified over six thousand Expressed Sequence Tags (EST sequences encoding antizyme proteins (over two thousand antizyme CDS in these ESTs are non redundant. Conclusion OAF performs well on raw EST sequences and mRNA sequences derived from genomic annotations. OAF will be used for the future updates of the RECODE

  6. Loss of function JAK1 mutations occur at high frequency in cancers with microsatellite instability and are suggestive of immune evasion.

    Science.gov (United States)

    Albacker, Lee A; Wu, Jeremy; Smith, Peter; Warmuth, Markus; Stephens, Philip J; Zhu, Ping; Yu, Lihua; Chmielecki, Juliann

    2017-01-01

    Immune evasion is a well-recognized hallmark of cancer and recent studies with immunotherapy agents have suggested that tumors with increased numbers of neoantigens elicit greater immune responses. We hypothesized that the immune system presents a common selective pressure on high mutation burden tumors and therefore immune evasion mutations would be enriched in high mutation burden tumors. The JAK family of kinases is required for the signaling of a host of immune modulators in tumor, stromal, and immune cells. Therefore, we analyzed alterations in this family for the hypothesized signature of an immune evasion mutation. Here, we searched a database of 61,704 unique solid tumors for alterations in the JAK family kinases (JAK1/2/3, TYK2). We used The Cancer Genome Atlas and Cancer Cell Line Encyclopedia data to confirm and extend our findings by analyzing gene expression patterns. Recurrent frameshift mutations in JAK1 were associated with high mutation burden and microsatellite instability. These mutations occurred in multiple tumor types including endometrial, colorectal, stomach, and prostate carcinomas. Analyzing gene expression signatures in endometrial and stomach adenocarcinomas revealed that tumors with a JAK1 frameshift exhibited reduced expression of interferon response signatures and multiple anti-tumor immune signatures. Importantly, endometrial cancer cell lines exhibited similar gene expression changes that were expected to be tumor cell intrinsic (e.g. interferon response) but not those expected to be tumor cell extrinsic (e.g. NK cells). From these data, we derive two primary conclusions: 1) JAK1 frameshifts are loss of function alterations that represent a potential pan-cancer adaptation to immune responses against tumors with microsatellite instability; 2) The mechanism by which JAK1 loss of function contributes to tumor immune evasion is likely associated with loss of the JAK1-mediated interferon response.

  7. GNRHR biallelic and digenic mutations in patients with normosmic congenital hypogonadotropic hypogonadism

    Directory of Open Access Journals (Sweden)

    Catarina I Gonçalves

    2017-07-01

    Full Text Available Objective: Normosmic congenital hypogonadotropic hypogonadism (nCHH is a rare disorder characterised by lack of pubertal development and infertility, due to deficient production, secretion or action of gonadotropin-releasing hormone (GnRH and, unlike Kallmann syndrome, is associated with a normal sense of smell. Mutations in the GNRHR gene cause autosomal recessive nCHH. The aim of this study was to determine the prevalence of GNRHR mutations in a group of 40 patients with nCHH. Design: Cross-sectional study of 40 unrelated patients with nCHH. Methods: Patients were screened for mutations in the GNRHR gene by DNA sequencing. Results: GNRHR mutations were identified in five of 40 patients studied. Four patients had biallelic mutations (including a novel frameshift deletion p.Phe313Metfs*3, in two families in agreement with autosomal recessive inheritance. One patient had a heterozygous GNRHR mutation associated with a heterozygous PROKR2 mutation, thus suggesting a possible role of synergistic heterozygosity in the pathogenesis of the disorder. Conclusions: This study further expands the spectrum of known genetic defects associated with nCHH. Although GNRHR mutations are usually biallelic and inherited in an autosomal recessive manner, the presence of a monoallelic mutation in a patient should raise the possibility of a digenic/oligogenic cause of nCHH.

  8. Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.

    Science.gov (United States)

    Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi

    2016-12-01

    Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

  9. Assaying Mutations Associated With Gene Conversion Repair of a Double-Strand Break.

    Science.gov (United States)

    Dwivedi, Gajendrahar; Haber, James E

    2018-01-01

    DNA double-strand break (DSB) is a cytotoxic lesion and needs to be repaired immediately. There are several metabolic pathways evolved to repair a DSB. Gene conversion is one of the least error-prone pathway for repair of a DNA DSB. Despite this there is nearly 1000-fold increase in mutation rate associated with gene conversion. Not only higher mutation rate is associated with gene conversion but also there is a very distinct mutation profile compared to spontaneous mutation events. Gene conversion is characterized by the presence of very high frameshift mutation events and other complex mutations that are not present during regular DNA replication. Another DNA DSB repair pathway widely studied is "break-induced replication" (BIR). BIR has been shown to be highly mutagenic in nature. BIR may lead to chromosomal rearrangement and has potential to cause cluster mutations with serious disease implications. In this chapter, the design of assay systems to study various mutation types and experimental procedures to measure specific mutation frequency associated with gene conversion are discussed. © 2018 Elsevier Inc. All rights reserved.

  10. Identification of Two Novel LAMA2 Mutations in a Chinese Patient with Congenital Muscular Dystrophy.

    Science.gov (United States)

    Zhou, Jing; Tan, Jianxin; Ma, Dingyuan; Zhang, Jingjing; Cheng, Jian; Luo, Chunyu; Liu, Gang; Wang, Yuguo; Xu, Zhengfeng

    2018-01-01

    Merosin-deficient CMD type 1A (MDC1A), caused by mutations of laminin subunit alpha 2 (LAMA2), is a predominant subtype of congenital muscular dystrophy (CMD). Herein, we described a Chinese patient with MDC1A who was admitted to hospital 17 days after birth because of marasmus and feeding difficulties. Mutations were identified by targeted capture and next generation sequencing (NGS) and further confirmed by Sanger sequencing. Paternity was confirmed by short tandem repeat analysis. Physical examination showed malnutrition, poor suck and appendicular hypotonia. Her serum CK levels were 2483 and 1962 U/L at 2 and 4 months of age, respectively. Brain magnetic resonance imaging performed at 1 month of age presented hyperintensity on T2-weighted images, T1-weighted images in parietal and occipital lobes, and diffusion-weighted image (DWI) as well as hypointensity on fluid attenuated inversion recovery (FLAIR) image; however, the cerebellum and corpus arenaceum were normal. At 7 months of age, delayed developmental milestones were observed, and she failed to turn her body over and raise her head up. A point mutation (c.1782+2T > G) and a frameshift duplication (c.8217dupT) in the LAMA2 gene were identified by targeted capture and NGS and further confirmed by Sanger sequencing. Moreover, genotyping with multiple short tandem repeat markers confirmed paternity to demonstrate that the point mutation is de novo . The frameshift duplication (c.8217dupT), inherited from her mother, was predicted to cause a substitution of Pro (P) to Ser (S) at the 2740th amino-acid residue and generate a prematurely truncated protein. The in silico analysis suggests that the mutation (c.1782+2T > G) may lead to aberrant splicing of LAMA2. Our case further confirms the heterogeneous clinical spectrum of MDC1A and presents two novel LAMA2 mutations to expand the mutation spectrum of MDC1A.

  11. Identification of Two Novel LAMA2 Mutations in a Chinese Patient with Congenital Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Jing Zhou

    2018-02-01

    Full Text Available Merosin-deficient CMD type 1A (MDC1A, caused by mutations of laminin subunit alpha 2 (LAMA2, is a predominant subtype of congenital muscular dystrophy (CMD. Herein, we described a Chinese patient with MDC1A who was admitted to hospital 17 days after birth because of marasmus and feeding difficulties. Mutations were identified by targeted capture and next generation sequencing (NGS and further confirmed by Sanger sequencing. Paternity was confirmed by short tandem repeat analysis. Physical examination showed malnutrition, poor suck and appendicular hypotonia. Her serum CK levels were 2483 and 1962 U/L at 2 and 4 months of age, respectively. Brain magnetic resonance imaging performed at 1 month of age presented hyperintensity on T2-weighted images, T1-weighted images in parietal and occipital lobes, and diffusion-weighted image (DWI as well as hypointensity on fluid attenuated inversion recovery (FLAIR image; however, the cerebellum and corpus arenaceum were normal. At 7 months of age, delayed developmental milestones were observed, and she failed to turn her body over and raise her head up. A point mutation (c.1782+2T > G and a frameshift duplication (c.8217dupT in the LAMA2 gene were identified by targeted capture and NGS and further confirmed by Sanger sequencing. Moreover, genotyping with multiple short tandem repeat markers confirmed paternity to demonstrate that the point mutation is de novo. The frameshift duplication (c.8217dupT, inherited from her mother, was predicted to cause a substitution of Pro (P to Ser (S at the 2740th amino-acid residue and generate a prematurely truncated protein. The in silico analysis suggests that the mutation (c.1782+2T > G may lead to aberrant splicing of LAMA2. Our case further confirms the heterogeneous clinical spectrum of MDC1A and presents two novel LAMA2 mutations to expand the mutation spectrum of MDC1A.

  12. Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient

    Energy Technology Data Exchange (ETDEWEB)

    Choy, F.Y.M.; Humphries, M.L. [Univ. of Victoria, British Columbia (Canada); Ferreira, P. [Univ. of Alberta, Edmonton (Canada)

    1997-01-20

    Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed while the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.

  13. WDR62 is associated with the spindle pole and is mutated in human microcephaly

    OpenAIRE

    Nicholas, Adeline K; Khurshid, Maryam; Désir, Julie; Carvalho, Ofélia P; Cox, James J; Thornton, Gemma; Kausar, Rizwana; Ansar, Muhammad; Ahmad, Wasim; Verloes, Alain; Passemard, Sandrine; Misson, Jean-Paul; Lindsay, Susan; Gergely, Fanni; Dobyns, William B

    2010-01-01

    Autosomal recessive primary microcephaly (MCPH) is a disorder of neurodevelopment resulting in a small brain1,2. We identified WDR62 as the second most common cause of MCPH after finding homozygous missense and frame-shifting mutations in seven MCPH families. In human cell lines, we found that WDR62 is a spindle pole protein, as are ASPM and STIL, the MCPH7 and MCHP7 proteins3–5. Mutant WDR62 proteins failed to localize to the mitotic spindle pole. In human and mouse embryonic brain, we found...

  14. Novel FKBP10 Mutation in a Patient with Osteogenesis Imperfecta Type XI.

    Science.gov (United States)

    Seyedhassani, Seyed Mohammad; Hashemi-Gorji, Feyzollah; Yavari, Mahdieh; Harazi, Fahimeh; Yassaee, Vahid Reza

    2016-01-01

    Osteogenesis imperfecta (OI) is a set of clinically and genetically heterogeneous disorders with autosomal dominant, recessive and X-linked inheritance patterns. The aim of this study was to describe a novel genetic abnormality in a case of OI type XI with mild joint contractures, kyphoscoliosis, muscular atrophy, progressively deforming and multiple bone fractures in a consanguineous Iranian family. Based on the phenotype, investigation of two candidate genes, CRTAP (OI type VII) and FKBP10 (OI type XI) detected a novel homozygous frameshift mutation in the FKBP10 gene. This finding can be useful in accurate genetic counseling and prioritization of molecular analysis of OI in Iranian patients.

  15. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  16. Highly conserved RNA pseudoknots at the gag-pol junction of HIV-1 suggest a novel mechanism of −1 ribosomal frameshifting

    Science.gov (United States)

    Huang, Xiaolan; Yang, Yang; Wang, Guan; Cheng, Qiang; Du, Zhihua

    2014-01-01

    −1 programmed ribosomal frameshifting (PRF) is utilized by many viruses to synthesize their enzymatic (Pol) and structural (Gag) proteins at a defined ratio. For efficient −1 PRF, two cis-acting elements are required: a heptanucleotide frameshift site and a downstream stimulator such as a pseudoknot. We have analyzed the gag-pol junction sequences from 4254 HIV-1 strains. Approximately ninety-five percent of the sequences can form four pseudoknots PK1–PK4 (∼97% contain PK1, PK3, and PK4), covering ∼72 nt including the frameshift site. Some pseudoknots are mutually excluded due to sequence overlap. PK1 and PK3 arrange tandemly. Their stems form a quasi-continuous helix of ∼22 bp. We propose a novel mechanism for possible roles of these pseudoknots. Multiple alternative structures may exist at the gag-pol junction. In most strains, the PK1–PK3 tandem pseudoknots may dominate the structurally heterogeneous pool of RNA due to their greater overall stability. The tandem pseudoknots may function as a breaking system to slow down the ribosome. The ribosome unwinds PK1 and stem 1 of PK3 before it can reach the frameshift site. Then, PK4 can form rapidly because the intact stem 2 of PK3 makes up a large part of the stem 1 of PK4. The newly formed PK4 jams the entrance of the mRNA tunnel. The process then proceeds as in a typical case of −1 PRF. This mechanism incorporates several exquisite new features while still being consistent with the current paradigm of pseudoknot-dependent −1 PRF. PMID:24671765

  17. Novel SOX9 Gene Mutation in Campomelic Dysplasia with Autosomal Sex Reversal

    Directory of Open Access Journals (Sweden)

    Hui-Pin Hsiao

    2006-01-01

    Full Text Available Campomelic dysplasia (CD; OMIM #114290 is an autosomal dominant, frequently lethal dysplasia syndrome whose primary features include angular bowing and shortening of the limbs, and sex reversal in the majority of affected XY individuals. Most CD cases have heterozygous de novo mutations in the coding region of the transcription factor gene SOX9 (SRY-related high-mobility group [HMG] box 9 in chromosome 17q. Here, we report a novel mutation of SOX9 in a female neonate with CD with autosomal sex reversal. Respiratory distress and cyanosis were noted at birth, and endotracheal intubation with mechanical ventilation was performed due to respiratory failure. The presenting phenotypes included dysmorphic face with macrocephaly prominent forehead, low nasal bridge, cleft palate and micrognathia. Skeletal deformities characteristic of CD were observed, including narrow thoracic cage, hypoplastic scapulae, scoliosis and short limbs with anterolateral femoral and tibial bowing. The karyotype was 46,XY despite female external genitalia. SOX9 gene analysis revealed frameshift mutation (at nucleotide position 1095G →AT in the open reading frame, resulting in a frameshift with 211 new amino acids.

  18. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Isolated hypogonadotropic hypogonadism with SOX2 mutation and anophthalmia/microphthalmia in offspring

    Science.gov (United States)

    Stark, Zornitza; Storen, Rebecca; Bennetts, Bruce; Savarirayan, Ravi; Jamieson, Robyn V

    2011-01-01

    Isolated hypogonadotropic hypogonadism (IHH) is a genetically heterogeneous condition in which patients frequently require assisted reproduction to achieve fertility. In patients with IHH who are otherwise well, no particular increased risk of congenital anomalies in the resultant offspring has been highlighted. Heterozygous mutations in SOX2 are the commonest single-gene cause of anophthalmia/microphthalmia (A/M) and sometimes result in pituitary abnormalities. We report a family with a novel frameshift mutation in the SOX2 transactivation domain, p.Gly280AlafsX91, resulting in bilateral anophthalmia and subtle endocrinological abnormalities in a male sibling, and unilateral microphthalmia in a female sibling. The mutation is present in their mother who has IHH, but has no eye disorders or other anomalies. She underwent assisted reproduction to achieve fertility. This report has important implications for the evaluation of patients with IHH, particularly in the setting of planned infertility treatment. PMID:21326281

  20. TBC1D24 Mutations in a Sibship with Multifocal Polymyoclonus

    Directory of Open Access Journals (Sweden)

    Adeline Ngoh

    2017-04-01

    Full Text Available Background: Advances in molecular genetic technologies have improved our understanding of genetic causes of rare neurological disorders with features of myoclonus.Case Report: A family with two affected siblings, presenting with multifocal polymyoclonus and neurodevelopmental delay, was recruited for whole-exome sequencing following unyielding diagnostic neurometabolic investigations. Compound heterozygous mutations in TBC1D24, a gene previously associated with various epilepsy phenotypes and hearing loss, were identified in both siblings. The mutations included a missense change c.457G>A (p.Glu157Lys, and a novel frameshift mutation c.545del (p.Thr182Serfs*6.Discussion: We propose that TBC1D24-related diseases should be in the differential diagnosis for children with polymyoclonus. 

  1. Kinetics of gene and chromosome mutations induced by UV-C in yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Koltovaya, N.; Kokoreva, A.; Senchenko, D.; Shvaneva, N.; Zhuchkina, N.

    2017-01-01

    The systematic study of the kinetics of UV-induced gene and structural mutations in eukaryotic cells was carried out on the basis of model yeast S. cerevisiae. A variety of genetic assays (all types of base pair substitutions, frameshifts, forward mutations canl, chromosomal and plasmid rearrangements) in haploid strains were used. Yeast cells were treated by UV-C light of fluence of energy up to 200 J/m 2 . The kinetics of the induced gene and structural mutations is represented by a linear-quadratic and exponential functions. The slope of curves in log-log plots was not constant, had the value 2-4 and depended on the interval of doses. It was suggested that it is the superposition and dynamics of different pathways form the mutagenic responses of eukaryotic cells to UV-C light that cause the high-order curves. [ru

  2. Normosmic congenital hypogonadotropic hypogonadism due to TAC3/TACR3 mutations: characterization of neuroendocrine phenotypes and novel mutations.

    Directory of Open Access Journals (Sweden)

    Bruno Francou

    Full Text Available CONTEXT: TAC3/TACR3 mutations have been reported in normosmic congenital hypogonadotropic hypogonadism (nCHH (OMIM #146110. In the absence of animal models, studies of human neuroendocrine phenotypes associated with neurokinin B and NK3R receptor dysfunction can help to decipher the pathophysiology of this signaling pathway. OBJECTIVE: To evaluate the prevalence of TAC3/TACR3 mutations, characterize novel TACR3 mutations and to analyze neuroendocrine profiles in nCHH caused by deleterious TAC3/TACR3 biallelic mutations. RESULTS: From a cohort of 352 CHH, we selected 173 nCHH patients and identified nine patients carrying TAC3 or TACR3 variants (5.2%. We describe here 7 of these TACR3 variants (1 frameshift and 2 nonsense deleterious mutations and 4 missense variants found in 5 subjects. Modeling and functional studies of the latter demonstrated the deleterious consequence of one missense mutation (Tyr267Asn probably caused by the misfolding of the mutated NK3R protein. We found a statistically significant (p<0.0001 higher mean FSH/LH ratio in 11 nCHH patients with TAC3/TACR3 biallelic mutations than in 47 nCHH patients with either biallelic mutations in KISS1R, GNRHR, or with no identified mutations and than in 50 Kallmann patients with mutations in KAL1, FGFR1 or PROK2/PROKR2. Three patients with TAC3/TACR3 biallelic mutations had an apulsatile LH profile but low-frequency alpha-subunit pulses. Pulsatile GnRH administration increased alpha-subunit pulsatile frequency and reduced the FSH/LH ratio. CONCLUSION: The gonadotropin axis dysfunction associated with nCHH due to TAC3/TACR3 mutations is related to a low GnRH pulsatile frequency leading to a low frequency of alpha-subunit pulses and to an elevated FSH/LH ratio. This ratio might be useful for pre-screening nCHH patients for TAC3/TACR3 mutations.

  3. Novel BRCA1 and BRCA2 pathogenic mutations in Slovene hereditary breast and ovarian cancer families.

    Science.gov (United States)

    Novaković, Srdjan; Milatović, Maša; Cerkovnik, Petra; Stegel, Vida; Krajc, Mateja; Hočevar, Marko; Zgajnar, Janez; Vakselj, Aleš

    2012-11-01

    The estimated proportion of hereditary breast and ovarian cancers among all breast and ovarian cancer cases is 5-10%. According to the literature, inherited mutations in the BRCA1 and BRCA2 tumour-suppressor genes, account for the majority of hereditary breast and ovarian cancer cases. The aim of this report is to present novel mutations that have not yet been described in the literature and pathogenic BRCA1 and BRCA2 mutations which have been detected in HBOC families for the first time in the last three years. In the period between January 2009 and December 2011, 559 individuals from 379 families affected with breast and/or ovarian cancer were screened for mutations in the BRCA1 and BRCA2 genes. Three novel mutations were detected: one in BRCA1 - c.1193C>A (p.Ser398*) and two in BRCA2 - c.5101C>T (p.Gln1701*) and c.5433_5436delGGAA (p.Glu1811Aspfs*3). These novel mutations are located in the exons 11 of BRCA1 or BRCA2 and encode truncated proteins. Two of them are nonsense while one is a frameshift mutation. Also, 11 previously known pathogenic mutations were detected for the first time in the HBOC families studied here (three in BRCA1 and eight in BRCA2). All, except one cause premature formation of stop codons leading to truncation of the respective BRCA1 or BRCA2 proteins.

  4. Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

    Science.gov (United States)

    Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

    2013-01-01

    DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

  5. Interplay between DMD point mutations and splicing signals in Dystrophinopathy phenotypes.

    Directory of Open Access Journals (Sweden)

    Jonàs Juan-Mateu

    Full Text Available DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements.

  6. A forward mutation assay using ampicillin-resistance in Escherichia coli designed for investigating the mutagenicity of biological samples.

    Science.gov (United States)

    Bosworth, D; Crofton-Sleigh, C; Venitt, S

    1987-11-01

    The development of a bacterial mutation assay using forward mutation to ampicillin-resistance is described. It is a technically simple assay using Escherichia coli D494uvrB transformed with a multi-copy mutator plasmid pGW1700. Mutation is detected by an increase in the frequency of ampicillin-resistant colonies following treatment of bacteria with the test material during logarithmic growth. The determination of viable counts allows a correction factor to be applied to compensate for the effects of sample-induced growth enhancement or toxicity on the bacterial population. The assay has been tested with a range of reference mutagens. It is particularly sensitive to base-pair substitution mutagens, detecting these at doses equal to or less than those detected in the Salmonella/microsome assay or the SOS Chromotest. The assay also detects frameshift mutagens but with lower sensitivity than the Salmonella/microsome assay.

  7. A novel splicing mutation in COL1A1 gene caused type I osteogenesis imperfecta in a Chinese family.

    Science.gov (United States)

    Peng, Hao; Zhang, Yuhui; Long, Zhigao; Zhao, Ding; Guo, Zhenxin; Xue, Jinjie; Xie, Zhiguo; Xiong, Zhimin; Xu, Xiaojuan; Su, Wei; Wang, Bing; Xia, Kun; Hu, Zhengmao

    2012-07-10

    Osteogenesis imperfect (OI) is a heritable connective tissue disorder with bone fragility as a cardinal manifestation, accompanied by short stature, dentinogenesis imperfecta, hyperlaxity of ligaments and skin, blue sclerae and hearing loss. Dominant form of OI is caused by mutations in the type I procollagen genes, COL1A1/A2. Here we identified a novel splicing mutation c.3207+1G>A (GenBank ID: JQ236861) in the COL1A1 gene that caused type I OI in a Chinese family. RNA splicing analysis proved that this mutation created a new splicing site at c.3200, and then led to frameshift. This result further enriched the mutation spectrum of type I procollagen genes. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Naturally occurred frame-shift mutations in the tvb receptor gene are responsible for decreased susceptibility to subgroups B, D, and E avian leukosis virus infection in chicken

    Science.gov (United States)

    The group of highly related avian leukosis viruses (ALVs) in chickens were thought to have evolved from a common retroviral ancestor into six subgroups, A to E and J. These ALV subgroups use diverse cellular proteins encoded by four genetic loci in chickens as receptors to gain entry into host cells...

  9. In vivo mutations in human blood cells: Biomarkers for molecular epidemiology

    Energy Technology Data Exchange (ETDEWEB)

    Albertini, R.J.; Branda, R.F.; O' Neill, J.P. (Univ. of Vermont, Burlington (United States)); Nicklas, J.A.; Fuscoe, J.C. (Environmental Health Research and Testing, Inc., Research Triangle Park, NC (United States)); Skopek, T.R. (Univ. of North Carolina, Chapel Hill (United States))

    1993-03-01

    Mutations arising in vivo in recorder genes of human blood cells provide biomarkers for molecular epidemiology by serving as surrogates for cancer-causing genetic changes. Current markers include mutations of the glycophorin-A (GPA) or hemoglobin (Hb) genes, measured in red blood cells, or mutations of the hypoxanthine-guanine phosphoribosyltransferase (hprt) or HLA genes, measured in T-lymphocytes. Mean mutant frequencies (variant frequencies) for normal young adults are approximately: Hb (4 [times] 10[sup [minus]8]) < hprt (5 [times] 10[sup [minus]6]) = GPA (10 [times] 10[sup [minus]6]) < HLA (30 [times] 10[sup [minus]6]). Mutagen-exposed individuals show decided elevations. Molecular mutational spectra are also being defined. For the hprt marker system, about 15% of background mutations are gross structural alterations of the hprt gene (e.g., deletions); the remainder are point mutations (e.g., base substitutions or frameshifts). Ionizing radiations result in dose-related increases in total gene deletions. Large deletions may encompass several megabases as shown by co-deletions of linked markers. Possible hprt spectra for defining radiation and chemical exposures are being sought. In addition to their responsiveness to environmental mutagens/carcinogens, three additional findings suggest that the in vivo recorder mutations are relevant in vivo surrogates for cancer mutations. First, a large fraction of GPA and HLA mutations show exchanges due to homologous recombination, an important mutational event in cancer. Second, hprt mutations arise preferentially in dividing T-cells, which can accumulate additional mutations in the same clone, reminiscent of the multiple hits required in the evolution of malignancy. Finally, fetal hprt mutations frequently have characteristic deletions of hprt exons 2 and 3, which appear to be mediated by the VDJ recombinase that rearranges the T-cell receptor genes during thymic ontogeny. 60 refs., 3 tabs.

  10. Prognostic impact of mismatch repair genes germline defects in colorectal cancer patients: are all mutations equal?

    Science.gov (United States)

    Maccaroni, Elena; Bracci, Raffaella; Giampieri, Riccardo; Bianchi, Francesca; Belvederesi, Laura; Brugiati, Cristiana; Pagliaretta, Silvia; Del Prete, Michela; Scartozzi, Mario; Cascinu, Stefano

    2015-01-01

    Background Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRC) syndrome, caused by germline mutations in MisMatch Repair (MMR) genes, particularly in MLH1, MSH2 and MSH6. Patients with LS seem to have a more favourable prognosis than those with sporadic CRC, although the prognostic impact of different mutation types is unknown. Aim of our study is to compare survival outcomes of different types of MMR mutations in patients with LS-related CRC. Methods 302 CRC patients were prospectively selected on the basis of Amsterdam or Revised Bethesda criteria to undergo genetic testing: direct sequencing of DNA and MLPA were used to examine the entire MLH1, MSH2 and MSH6 coding sequence. Patients were classified as mutation-positive or negative according to the genetic testing result. Results A deleterious MMR mutation was found in 38/302 patients. Median overall survival (OS) was significantly higher in mutation-positive vs mutation-negative patients (102.6 vs 77.7 months, HR:0.63, 95%CI:0.46–0.89, p = 0.0083). Different types of mutation were significantly related with OS: missense or splicing-site mutations were associated with better OS compared with rearrangement, frameshift or non-sense mutations (132.5 vs 82.5 months, HR:0.46, 95%CI:0.16–0.82, p = 0.0153). Conclusions Our study confirms improved OS for LS-patients compared with mutation-negative CRC patients. In addition, not all mutations could be considered equal: the better prognosis in CRC patients with MMR pathogenic missense or splicing site mutation could be due to different functional activity of the encoded MMR protein. This matter should be investigated by use of functional assays in the future. PMID:26485756

  11. Molecular characterization of 21 X-ALD Portuguese families: identification of eight novel mutations in the ABCD1 gene.

    Science.gov (United States)

    Guimarães, Carla P; Lemos, Manuela; Sá-Miranda, Clara; Azevedo, Jorge E

    2002-05-01

    X-linked adrenoleukodystrophy (X-ALD) is the most common inherited peroxisomal disorder. The gene associated with X-ALD, ABCD1, encodes a peroxisomal ATP-binding cassette half-transporter. In this study, we describe the molecular characterization of 21 affected Portuguese families. The complete coding region of the ABCD1 gene was amplified by reverse transcription polymerase chain reaction (RT-PCR) or genomic PCR. After conformation-sensitive gel electrophoresis analysis, fragments with a conformational heteroduplex pattern were sequenced. Using this strategy, we have identified 14 missense mutations, two nonsense mutations, two splicing site defects, and three small deletions, two of them resulting in frameshifts. Eight of the genetic alterations characterized in this study are novel. The levels of the ABCD1 transcript as well as the levels of ALDP in cultured skin fibroblasts of male probands were also determined in most cases. The levels of the ABCD1 transcript in one patient (corresponding to a nonsense mutation) were below the detection limit of Northern-blotting analysis. ALDP was found at normal levels in only three patients, absent in five (corresponding to a double missense, two nonsense, and two frameshift mutations), and decreased in all the others.

  12. Impact of two myostatin (MSTN mutations on weight gain and lamb carcass classification in Norwegian White Sheep (Ovis aries

    Directory of Open Access Journals (Sweden)

    Blichfeldt Thor

    2010-01-01

    Full Text Available Abstract Background Our aim was to estimate the effect of two myostatin (MSTN mutations in Norwegian White Sheep, one of which is close to fixation in the Texel breed. Methods The impact of two known MSTN mutations was examined in a field experiment with Norwegian White Sheep. The joint effect of the two MSTN mutations on live weight gain and weaning weight was studied on 644 lambs. Carcass weight gain from birth to slaughter, carcass weight, carcass conformation and carcass fat classes were calculated in a subset of 508 lambs. All analyses were carried out with a univariate linear animal model. Results The most significant impact of both mutations was on conformation and fat classes. The largest difference between the genotype groups was between the wild type for both mutations and the homozygotes for the c.960delG mutation. Compared to the wild types, these mutants obtained a conformation score 5.1 classes higher and a fat score 3.0 classes lower, both on a 15-point scale. Conclusions Both mutations reduced fatness and increased muscle mass, although the effect of the frameshift mutation (c.960delG was more important as compared to the 3'-UTR mutation (c.2360G>A. Lambs homozygous for the c.960delG mutation grew more slowly than those with other MSTN genotypes, but had the least fat and the largest muscle mass. Only c.960delG showed dominance effects.

  13. Common mutations in the phosphofructokinase-M gene in Ashkenazi Jewish patients with glycogenesis VII - and their population frequency

    Energy Technology Data Exchange (ETDEWEB)

    Sherman, J.B.; Raben, N.; Nicastri, C.; Adams, E.M.; Plotz, P.H. (National Institutes of Health, Bethesda, MD (United States)); Argov, Z. (Hebrew Univ., Jerusalem (Israel)); Nakajima, Hiromu (Osaka Univ. (Japan)); Eng, C.M.; Cowan, T.M. (Univ. of Maryland School of Medicine, Baltimore, MD (United States))

    1994-08-01

    Phosphofructokinase (PFK) catalyzes the rate-limiting step of glycolysis. Deficiency of the muscle enzyme is manifested by exercise intolerance and a compensated hemolytic anemia. Case reports of this autosomal recessive disease suggest a predominance in Ashkenazi Jews in the United States. The authors have explored the genetic basis for this illness in nine affected families and surveyed the normal Ashkenazi population for the mutations found. Genomic DNA was amplified using PCR, and denaturing gradient-gel electrophoresis. The polymorphic exons were sequenced or digested with restriction enzymes. A previously described splicing mutation, [Delta]5, accounted for 11 (61%) of 18 abnormal alleles in the nine families. A single base deletion leading to a frameshift mutation in exon 22 ([Delta]C-22) was found in six of seven alleles. A third mutation, resulting in a nonconservative amino acid substitution in exon 4, accounted for the remaining allele. Thus, three mutations could account for an illness in this group, and two mutations could account for 17 of 18 alleles. In screening 250 normal Ashkenazi individuals for all three mutations, they found only one [Delta]5 allele. Clinical data revealed no correlation between the particular mutations and symptoms, but male patients were more symptomatic than females, and only males had frank hemolysis and hyperuricemia. Because PFK deficiency in Ashkenazi Jews is caused by a limited number of mutations, screening genomic DNA from peripheral blood for the described mutations in this population should enable rapid diagnosis without muscle biopsy. 41 refs., 4 figs., 2 tabs.

  14. Nucleotide sequence of Zygosaccharomyces bailii virus Z: Evidence for +1 programmed ribosomal frameshifting and for assignment to family Amalgaviridae.

    Science.gov (United States)

    Depierreux, Delphine; Vong, Minh; Nibert, Max L

    2016-06-02

    Zygosaccharomyces bailii virus Z (ZbV-Z) is a monosegmented dsRNA virus that infects the yeast Zygosaccharomyces bailii and remains unclassified to date despite its discovery >20years ago. The previously reported nucleotide sequence of ZbV-Z (GenBank AF224490) encompasses two nonoverlapping long ORFs: upstream ORF1 encoding the putative coat protein and downstream ORF2 encoding the RNA-dependent RNA polymerase (RdRp). The lack of overlap between these ORFs raises the question of how the downstream ORF is translated. After examining the previous sequence of ZbV-Z, we predicted that it contains at least one sequencing error to explain the nonoverlapping ORFs, and hence we redetermined the nucleotide sequence of ZbV-Z, derived from the same isolate of Z. bailii as previously studied, to address this prediction. The key finding from our new sequence, which includes several insertions, deletions, and substitutions relative to the previous one, is that ORF2 in fact overlaps ORF1 in the +1 frame. Moreover, a proposed sequence motif for +1 programmed ribosomal frameshifting, previously noted in influenza A viruses, plant amalgaviruses, and others, is also present in the newly identified ORF1-ORF2 overlap region of ZbV-Z. Phylogenetic analyses provided evidence that ZbV-Z represents a distinct taxon most closely related to plant amalgaviruses (genus Amalgavirus, family Amalgaviridae). We conclude that ZbV-Z is the prototype of a new species, which we propose to assign as type species of a new genus of monosegmented dsRNA mycoviruses in family Amalgaviridae. Comparisons involving other unclassified mycoviruses with RdRps apparently related to those of plant amalgaviruses, and having either mono- or bisegmented dsRNA genomes, are also discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Founding BRCA1 mutations in hereditary breast and ovarian cancer in southern Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Johannsson, O.; Hakansson, S.; Johannson, U. [Univ. Hospital, Lund (Sweden)] [and others

    1996-03-01

    Nine different germ-line mutations in the BRCA1 breast and ovarian cancer susceptibility gene were identified in 15 of 47 kindreds from southern Sweden, by use of SSCP and heteroduplex analysis of all exons and flanking intron region and by a protein-truncation test for exon 11, followed by direct sequencing. All but one of the mutations are predicted to give rise to premature translation termination and include seven frameshift insertions or deletions, a nonsense mutation, and a splice acceptor site mutation. The remaining mutation is a missense mutation (Cys61Gly) in the zinc-binding motif. Four novel Swedish founding mutations were identified: the nucleotide 2595 deletion A was found in five families, the C 1806 T nonsense mutation in three families, the 3166 insertion TGAGA in three families, and the nucleotide 1201 deletion 11 in two families. Analysis of the intragenic polymorphism D17S855 supports common origins of the mutations. Eleven of the 15 kindreds manifesting BRCA1 mutations were breast-ovarian cancer families, several of them with a predominant ovarian cancer phenotype. The set of 32 families in which no BRCA1 alterations were detected included 1 breast-ovarian cancer kindred manifesting clear linkage to the BRCA1 region and loss of the wild-type chromosome in associated tumors. Other tumor types found in BRCA1 mutation/haplotype carriers included prostatic, pancreas, skin, and lung cancer, a malignant melanoma, an oligodendroglioma, and a carcinosarcoma. In all, 12 of 16 kindreds manifesting BRCA1 mutation or linkage contained ovarian cancer, as compared with only 6 of the remaining 31 families (P < .001). The present study confirms the involvement of BRCA1 in disease predisposition for a subset of hereditary breast cancer families often characterized by ovarian cancers. 28 refs., 3 figs., 4 tabs.

  16. GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment

    Directory of Open Access Journals (Sweden)

    Tang Liang

    2009-04-01

    Full Text Available Abstract Background Mutations in GJB2 are the most common molecular defects responsible for autosomal recessive nonsyndromic hearing impairment (NSHI. The mutation spectra of this gene vary among different ethnic groups. Methods In order to understand the spectrum and frequency of GJB2 mutations in the Chinese population, the coding region of the GJB2 gene from 2063 unrelated patients with NSHI was PCR amplified and sequenced. Results A total of 23 pathogenic mutations were identified. Among them, five (p.W3X, c.99delT, c.155_c.158delTCTG, c.512_c.513insAACG, and p.Y152X are novel. Three hundred and seven patients carry two confirmed pathogenic mutations, including 178 homozygotes and 129 compound heterozygotes. One hundred twenty five patients carry only one mutant allele. Thus, GJB2 mutations account for 17.9% of the mutant alleles in 2063 NSHI patients. Overall, 92.6% (684/739 of the pathogenic mutations are frame-shift truncation or nonsense mutations. The four prevalent mutations; c.235delC, c.299_c.300delAT, c.176_c.191del16, and c.35delG, account for 88.0% of all mutantalleles identified. The frequency of GJB2 mutations (alleles varies from 4% to 30.4% among different regions of China. It also varies among different sub-ethnic groups. Conclusion In some regions of China, testing of the three most common mutations can identify at least one GJB2 mutant allele in all patients. In other regions such as Tibet, the three most common mutations account for only 16% the GJB2 mutant alleles. Thus, in this region, sequencing of GJB2 would be recommended. In addition, the etiology of more than 80% of the mutant alleles for NSHI in China remains to be identified. Analysis of other NSHI related genes will be necessary.

  17. Mutations in the hedgehog pathway genes SMO and PTCH1 in human gastric tumors.

    Directory of Open Access Journals (Sweden)

    Xi-De Wang

    Full Text Available The causal role of the hedgehog pathway in cancer has been best documented in basal cell carcinoma of the skin. To assess potential DNA alterations of the hedgehog pathway in gastric cancer, we sequenced SMO and PTCH1 genes in a set of 39 gastric tumors. Tumors were classified by histology based on the Lauren classification and Sanger sequencing was performed to obtain full length coding sequences. Genomic instability was evident in these tumors as a number of silent or missense mutations were found. In addition to those that are potential germline polymorphisms, we found three SMO missense mutations, and one PTCH1 frameshift mutation that are novel and have not been documented in basal cell carcinoma. Mutations were found in both intestinal and diffuse type gastric tumors as well as in tumors that exhibit both intestinal and diffuse features. mRNA expression of hedgehog pathway genes was also examined and their levels do not indicate unequivocal higher pathway activity in tumors with mutations than those without. In summary, SMO and/or PTCH1 mutations are present at low frequency in different histologic subtypes of gastric tumors and these do not appear to be driver mutations.

  18. Identities and frequencies of mutations of the otoferlin gene (OTOF) causing DFNB9 deafness in Pakistan

    Science.gov (United States)

    Choi, BY; Ahmed, ZM; Riazuddin, S; Bhinder, MA; Shahzad, M; Husnain, T; Riazuddin, S; Griffith, AJ; Friedman, TB

    2012-01-01

    Mutations in OTOF, encoding otoferlin, cause non-syndromic recessive hearing loss. The goal of our study was to define the identities and frequencies of OTOF mutations in a model population. We screened a cohort of 557 large consanguineous Pakistani families segregating recessive, severe-to-profound, prelingual-onset deafness for linkage to DFNB9. There were 13 families segregating deafness consistent with linkage to markers for DFNB9. We analyzed the genomic nucleotide sequence of OTOF and detected probable pathogenic sequence variants among all 13 families. These include the previously reported nonsense mutation p.R708X and 10 novel variants: 3 nonsense mutations (p.R425X, p.W536X, and p.Y1603X), 1 frameshift (c.1103_1104delinsC), 1 single amino acid deletion (p.E766del) and 5 missense substitutions of conserved residues (p.L573R, p.A1090E, p.E1733K, p.R1856Q and p.R1939W). OTOF mutations thus account for deafness in 13 (2.3%) of 557 Pakistani families. This overall prevalence is similar, but the mutation spectrum is different from those for Western populations. In addition, we demonstrate the existence of an alternative splice isoform of OTOF expressed in the human cochlea. This isoform must be required for human hearing because it encodes a unique alternative C-terminus affected by some DFNB9 mutations. PMID:19250381

  19. A review on non-syndromic tooth agenesis associated with PAX9 mutations

    Directory of Open Access Journals (Sweden)

    Nurul Hasyiqin Fauzi

    2018-02-01

    Full Text Available Summary: Tooth agenesis in the reduction of tooth number which includes hypodontia, oligodontia and anodontia is caused by disturbances and gene mutations that occur during odontogenesis. To date, several genetic mutations that unlock the causes of non-syndromic tooth agenesis are being discovered; these have been associated with certain illnesses because tooth development involves the interaction of several genes for tooth epithelium and mesenchyme odontogenesis. Mutation of candidate genes PAX9 and MSX1 have been identified as the main causes of hypodontia and oligodontia; meanwhile, AXIN2 mutation is associated with anodontia. Previous study using animal models reported that PAX9-deficient knockout mice exhibit missing molars due to an arrest of tooth development at the bud stage. PAX9 frameshift, missense and nonsense mutations are reported to be responsible; however, the most severe condition showed by the phenotype is caused by haploinsufficiency. This suggests that PAX9 is dosage-sensitive. Understanding the mechanism of genetic mutations will benefit clinicians and human geneticists in future alternative treatment investigations. Keywords: Hypodontia, Oligodontia, Mutation, PAX9

  20. Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.

    Science.gov (United States)

    Olson, Heather E; Tambunan, Dimira; LaCoursiere, Christopher; Goldenberg, Marti; Pinsky, Rebecca; Martin, Emilie; Ho, Eugenia; Khwaja, Omar; Kaufmann, Walter E; Poduri, Annapurna

    2015-09-01

    Rett syndrome and neurodevelopmental disorders with features overlapping this syndrome frequently remain unexplained in patients without clinically identified MECP2 mutations. We recruited a cohort of 11 patients with features of Rett syndrome and negative initial clinical testing for mutations in MECP2. We analyzed their phenotypes to determine whether patients met formal criteria for Rett syndrome, reviewed repeat clinical genetic testing, and performed exome sequencing of the probands. Using 2010 diagnostic criteria, three patients had classical Rett syndrome, including two for whom repeat MECP2 gene testing had identified mutations. In a patient with neonatal onset epilepsy with atypical Rett syndrome, we identified a frameshift deletion in STXBP1. Among seven patients with features of Rett syndrome not fulfilling formal diagnostic criteria, four had suspected pathogenic mutations, one each in MECP2, FOXG1, SCN8A, and IQSEC2. MECP2 mutations are highly correlated with classical Rett syndrome. Genes associated with atypical Rett syndrome, epilepsy, or intellectual disability should be considered in patients with features overlapping with Rett syndrome and negative MECP2 testing. While most of the identified mutations were apparently de novo, the SCN8A variant was inherited from an unaffected parent mosaic for the mutation, which is important to note for counseling regarding recurrence risks. © 2015 Wiley Periodicals, Inc.

  1. EIF2S3 Mutations Associated with Severe X-Linked Intellectual Disability Syndrome MEHMO.

    Science.gov (United States)

    Skopkova, Martina; Hennig, Friederike; Shin, Byung-Sik; Turner, Clesson E; Stanikova, Daniela; Brennerova, Katarina; Stanik, Juraj; Fischer, Ute; Henden, Lyndal; Müller, Ulrich; Steinberger, Daniela; Leshinsky-Silver, Esther; Bottani, Armand; Kurdiova, Timea; Ukropec, Jozef; Nyitrayova, Olga; Kolnikova, Miriam; Klimes, Iwar; Borck, Guntram; Bahlo, Melanie; Haas, Stefan A; Kim, Joo-Ran; Lotspeich-Cole, Leda E; Gasperikova, Daniela; Dever, Thomas E; Kalscheuer, Vera M

    2017-04-01

    Impairment of translation initiation and its regulation within the integrated stress response (ISR) and related unfolded-protein response has been identified as a cause of several multisystemic syndromes. Here, we link MEHMO syndrome, whose genetic etiology was unknown, to this group of disorders. MEHMO is a rare X-linked syndrome characterized by profound intellectual disability, epilepsy, hypogonadism and hypogenitalism, microcephaly, and obesity. We have identified a C-terminal frameshift mutation (Ile465Serfs) in the EIF2S3 gene in three families with MEHMO syndrome and a novel maternally inherited missense EIF2S3 variant (c.324T>A; p.Ser108Arg) in another male patient with less severe clinical symptoms. The EIF2S3 gene encodes the γ subunit of eukaryotic translation initiation factor 2 (eIF2), crucial for initiation of protein synthesis and regulation of the ISR. Studies in patient fibroblasts confirm increased ISR activation due to the Ile465Serfs mutation and functional assays in yeast demonstrate that the Ile465Serfs mutation impairs eIF2γ function to a greater extent than tested missense mutations, consistent with the more severe clinical phenotype of the Ile465Serfs male mutation carriers. Thus, we propose that more severe EIF2S3 mutations cause the full MEHMO phenotype, while less deleterious mutations cause a milder form of the syndrome with only a subset of the symptoms. © 2017 WILEY PERIODICALS, INC.

  2. KIT Mutation and Loss of 14q May Be Sufficient for the Development of Clinically Symptomatic Very Low-Risk GIST.

    Directory of Open Access Journals (Sweden)

    Olaf Karl Klinke

    Full Text Available The aim of this study was to determine the minimal set of genetic alterations required for the development of a very low risk clinically symptomatic gastro-intestinal stromal tumour within the stomach wall. We studied the genome of a very low-risk gastric gastro-intestinal stromal tumour by whole-genome sequencing, comparative genomic hybridisation and methylation profiling. The studied tumour harboured two typical genomic lesions: loss of the long arm of chromosome 14 and an activating mutation in exon 11 of KIT. Besides these genetic lesions, only two point mutations that may affect tumour progression were identified: A frame-shift deletion in RNF146 and a missense mutation in a zinc finger of ZNF407. Whilst the frameshift deletion in RNF146 seemed to be restricted to this particular tumour, a similar yet germline mutation in ZNF407 was found in a panel of 52 gastro-intestinal stromal tumours from different anatomical sites and different categories. Germline polymorphisms in the mitotic checkpoint proteins Aurora kinase A and BUB1 kinase B may have furthered tumour growth. The epigenetic profile of the tumour matches that of other KIT-mutant tumours. We have identified mutations in three genes and loss of the long arm of chromosome 14 as the so far minimal set of genetic abnormalities sufficient for the development of a very low risk clinically symptomatic gastric stromal tumour.

  3. Pancreatic Agenesis due to Compound Heterozygosity for a Novel Enhancer and Truncating Mutation in the PTF1A Gene.

    Science.gov (United States)

    Gabbay, Monica; Ellard, Sian; De Franco, Elisa; Moisés, Regina S

    2017-09-01

    Neonatal diabetes, defined as the onset of diabetes within the first six months of life, is very rarely caused by pancreatic agenesis. Homozygous truncating mutations in the PTF1A gene, which encodes a transcriptional factor, have been reported in patients with pancreatic and cerebellar agenesis, whilst mutations located in a distal pancreatic-specific enhancer cause isolated pancreatic agenesis. We report an infant, born to healthy non-consanguineous parents, with neonatal diabetes due to pancreatic agenesis. Initial genetic investigation included sequencing of KCNJ11, ABCC8 and INS genes, but no mutations were found. Following this, 22 neonatal diabetes associated genes were analyzed by a next generation sequencing assay. We found compound heterozygous mutations in the PTF1A gene: A frameshift mutation in exon 1 (c.437_462 del, p.Ala146Glyfs*116) and a mutation affecting a highly conserved nucleotide within the distal pancreatic enhancer (g.23508442A>G). Both mutations were confirmed by Sanger sequencing. Isolated pancreatic agenesis resulting from compound heterozygosity for truncating and enhancer mutations in the PTF1A gene has not been previously reported. This report broadens the spectrum of mutations causing pancreatic agenesis.

  4. Genetically engineered frameshifted YopN-TyeA chimeras influence type III secretion system function in Yersinia pseudotuberculosis.

    Directory of Open Access Journals (Sweden)

    Ayad A A Amer

    Full Text Available Type III secretion is a tightly controlled virulence mechanism utilized by many gram negative bacteria to colonize their eukaryotic hosts. To infect their host, human pathogenic Yersinia spp. translocate protein toxins into the host cell cytosol through a preassembled Ysc-Yop type III secretion device. Several of the Ysc-Yop components are known for their roles in controlling substrate secretion and translocation. Particularly important in this role is the YopN and TyeA heterodimer. In this study, we confirm that Y. pseudotuberculosis naturally produce a 42 kDa YopN-TyeA hybrid protein as a result of a +1 frame shift near the 3 prime of yopN mRNA, as has been previously reported for the closely related Y. pestis. To assess the biological role of this YopN-TyeA hybrid in T3SS by Y. pseudotuberculosis, we used in cis site-directed mutagenesis to engineer bacteria to either produce predominately the YopN-TyeA hybrid by introducing +1 frame shifts to yopN after codon 278 or 287, or to produce only singular YopN and TyeA polypeptides by introducing yopN sequence from Y. enterocolitica, which is known not to produce the hybrid. Significantly, the engineered 42 kDa YopN-TyeA fusions were abundantly produced, stable, and were efficiently secreted by bacteria in vitro. Moreover, these bacteria could all maintain functionally competent needle structures and controlled Yops secretion in vitro. In the presence of host cells however, bacteria producing the most genetically altered hybrids (+1 frameshift after 278 codon had diminished control of polarized Yop translocation. This corresponded to significant attenuation in competitive survival assays in orally infected mice, although not at all to the same extent as Yersinia lacking both YopN and TyeA proteins. Based on these studies with engineered polypeptides, most likely a naturally occurring YopN-TyeA hybrid protein has the potential to influence T3S control and activity when produced during Yersinia

  5. p53 mutation in carcinomas arising in ovarian cystic teratomas.

    Science.gov (United States)

    Fujii, T; Oguni, S; Kikuchi, M; Kanai, N; Saito, K

    1995-09-01

    Carcinomas arising in mature cystic teratomas of the ovaries from nine women were examined for the presence of p53 mutations. The nine tumors comprised six squamous cell carcinomas, one squamous cell carcinoma in situ, one undifferentiated small cell carcinoma, and one mucoepidermoid carcinoma. Abnormal nuclear accumulation of the p53 protein was observed in four of the tumors. Genomic DNA was extracted from formalin-fixed, paraffin-embedded tissue blocks and subjected to polymerase chain reaction (PCR) for specific amplification of the p53 gene exons 5-8, followed by direct chemiluminescence sequencing analysis. A frameshift mutation in exon 8 (codon 278, CCT > del T; stop at codon 344) was detected in one poorly differentiated squamous cell carcinoma. The samples were also evaluated for the possible association of 'benign' and 'malignant' types of human papillomavirus (HPV) by PCR using universal primer sets. None of the samples contained detectable HPV genome. These data suggest that p53 mutations are relatively uncommon in secondary carcinomas developing in ovarian dermoid cysts, although the number of samples studied was admittedly small.

  6. Compound heterozygous mutations (p.T561M and c.2422delT) in the TPO gene associated with congenital hypothyroidism.

    Science.gov (United States)

    Ma, Shao-Gang; Zheng, Xiao; Qiu, Ya-Li; Guo, Man-Li; Shao, Xiao-Juan

    2016-05-01

    The objective of the study was to determine the genetic basis of goitrous congenital hypothyroidism (GCH) in Chinese siblings. The proband and her younger brother with GCH were enrolled for molecular analysis of the dual oxidase 2 (DUOX2), dual oxidase maturation factor 2 (DUOXA2), and thyroid peroxidase (TPO) genes. Mutation screening was performed by Sanger sequencing the fragments amplified from genomic DNA. The detected mutations were verified among the close relatives of the patients and 105 controls. All participants underwent clinical examination and laboratory tests. Analysis of the TPO gene revealed two heterozygous mutations, the frameshift mutation c.2422delT in the exon14 of the TPO gene, that has been reported previously, and a novel missense mutation c.1682C>T (p.T561M) in the exon10 of the TPO gene. Nine family members of the patients were enrolled for mutation screening. The patients' parents and grandfathers harbored a single heterozygous mutation. The germline mutations from this family were consistent with an autosomal recessive inheritance pattern. No mutations in the DUOXA2 and DUOX2 genes were observed. The inactivating mutations (c.2422delT and p.T561M) in the TPO gene were identified in the Chinese siblings with GCH. The compound heterozygous mutations can cause GCH.

  7. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease.

    Science.gov (United States)

    Casari, G; De Fusco, M; Ciarmatori, S; Zeviani, M; Mora, M; Fernandez, P; De Michele, G; Filla, A; Cocozza, S; Marconi, R; Dürr, A; Fontaine, B; Ballabio, A

    1998-06-12

    Hereditary spastic paraplegia (HSP) is characterized by progressive weakness and spasticity of the lower limbs due to degeneration of corticospinal axons. We found that patients from a chromosome 16q24.3-linked HSP family are homozygous for a 9.5 kb deletion involving a gene encoding a novel protein, named Paraplegin. Two additional Paraplegin mutations, both resulting in a frameshift, were found in a complicated and in a pure form of HSP. Paraplegin is highly homologous to the yeast mitochondrial ATPases, AFG3, RCA1, and YME1, which have both proteolytic and chaperon-like activities at the inner mitochondrial membrane. Immunofluorescence analysis and import experiments showed that Paraplegin localizes to mitochondria. Analysis of muscle biopsies from two patients carrying Paraplegin mutations showed typical signs of mitochondrial OXPHOS defects, thus suggesting a mechanism for neurodegeneration in HSP-type disorders.

  8. A novel SERPINA1 mutation causing serum alpha(1-antitrypsin deficiency.

    Directory of Open Access Journals (Sweden)

    Darren N Saunders

    Full Text Available Mutations in the SERPINA1 gene can cause deficiency in the circulating serine protease inhibitor α(1-Antitrypsin (α(1AT. α(1AT deficiency is the major contributor to pulmonary emphysema and liver disease in persons of European ancestry, with a prevalence of 1 in 2500 in the USA. We present the discovery and characterization of a novel SERPINA1 mutant from an asymptomatic Middle Eastern male with circulating α(1AT deficiency. This 49 base pair deletion mutation (T379Δ, originally mistyped by IEF, causes a frame-shift replacement of the last sixteen α(1AT residues and adds an extra twenty-four residues. Functional analysis showed that the mutant protein is not secreted and prone to intracellular aggregation.

  9. Wiskott-Aldrich Syndrome With Normal-Sized Platelets in an Eighteen-Month-Old Boy: A Rare Mutation

    Directory of Open Access Journals (Sweden)

    Jayitri Mazumdar

    2015-07-01

    Full Text Available Introduction: Wiskott-Aldrich syndrome (WAS is an X-linked recessive disorder characterized by thrombocytopenia, eczema, and recurrent infections. The disease is usually associated with small defective platelets. Case Presentation: We described an 18-month-old boy who presented with lower gastrointestinal bleeding, eczema, and recurrent infections. There was pancytopenia with normal-sized platelets. In addition, the CD4 count was significantly low and serum IgA and IgE levels were increased. The diagnosis of WAS was confirmed by detecting a mutation of WAS gene, which was due to a deletion mutation resulting in frameshift (c.177DelT. Conclusions: Usually microplatelets with mean platelet volume of 4-5 fL are seen in WAS, but in this case, the patient had normal-sized platelets with a rare mutation of WAS gene. Therefore, high index of clinical suspicion is needed to diagnose WAS.

  10. Identification of a novel BRCA1 nucleotide 4803delCC/c.4684delCC mutation and a nucleotide 249T>A/c.130T>A (p.Cys44Ser) mutation in two Greenlandic Inuit families

    DEFF Research Database (Denmark)

    Hansen, Thomas van Overeem; Jønson, Lars; Albrechtsen, Anders

    2010-01-01

    Germ-line mutations in the tumour suppressor proteins BRCA1 and BRCA2 predispose to breast and ovarian cancer. We have recently identified a Greenlandic Inuit BRCA1 nucleotide 234T>G/c.115T>G (p.Cys39Gly) founder mutation, which at that time was the only disease-causing BRCA1/BRCA2 mutation...... identified in this population. Here, we describe the identification of a novel disease-causing BRCA1 nucleotide 4803delCC/c.4684delCC mutation in a Greenlandic Inuit with ovarian cancer. The mutation introduces a frameshift and a premature stop at codon 1572. We have also identified a BRCA1 nucleotide 249T......>A/c.130T>A (p.Cys44Ser) mutation in another Greenlandic individual with ovarian cancer. This patient share a 1-2 Mb genomic fragment, containing the BRCA1 gene, with four Danish families harbouring the same mutation, suggesting that the 249T>A/c.130T>A (p.Cys44Ser) mutation originates from a Danish...

  11. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation.

    Science.gov (United States)

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun

    2016-01-01

    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease.

  12. Germline PMS2 mutation screened by mismatch repair protein immunohistochemistry of colorectal cancer in Japan.

    Science.gov (United States)

    Sugano, Kokichi; Nakajima, Takeshi; Sekine, Shigeki; Taniguchi, Hirokazu; Saito, Shinya; Takahashi, Masahiro; Ushiama, Mineko; Sakamoto, Hiromi; Yoshida, Teruhiko

    2016-11-01

    Germline PMS2 gene mutations were detected by RT-PCR/direct sequencing of total RNA extracted from puromycin-treated peripheral blood lymphocytes (PBL) and multiplex ligation-dependent probe amplification (MLPA) analyses of Japanese patients with colorectal cancer (CRC) fulfilling either the revised Bethesda Guidelines or being an age at disease onset of younger than 70 years, and screened by mismatch repair protein immunohistochemistry of formalin-fixed paraffin embedded sections. Of the 501 subjects examined, 7 (1.40%) showed the downregulated expression of the PMS2 protein alone and were referred to the genetic counseling clinic. Germline PMS2 mutations were detected in 6 (85.7%), including 3 nonsense and 1 frameshift mutations by RT-PCR/direct sequencing and 2 genomic deletions by MLPA. No mutations were identified in the other MMR genes (i.e. MSH2, MLH1 and MSH6). The prevalence of the downregulated expression of the PMS2 protein alone was 1.40% among the subjects examined and IHC results predicted the presence of PMS2 germline mutations. RT-PCR from puromycin-treated PBL and MLPA may be employed as the first screening step to detect PMS2 mutations without pseudogene interference, followed by the long-range PCR/nested PCR validation using genomic DNA. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  13. Different inactivating mutations of the mineralocorticoid receptor in fourteen families affected by type I pseudohypoaldosteronism.

    Science.gov (United States)

    Sartorato, Paola; Lapeyraque, Anne-Laure; Armanini, Decio; Kuhnle, Ursula; Khaldi, Yasmina; Salomon, Rémi; Abadie, Véronique; Di Battista, Eliana; Naselli, Arturo; Racine, Alain; Bosio, Maurizio; Caprio, Massimiliano; Poulet-Young, Véronique; Chabrolle, Jean-Pierre; Niaudet, Patrick; De Gennes, Christiane; Lecornec, Marie-Hélène; Poisson, Elodie; Fusco, Anna Maria; Loli, Paola; Lombès, Marc; Zennaro, Maria-Christina

    2003-06-01

    We have analyzed the human mineralocorticoid receptor (hMR) gene in 14 families with autosomal dominant or sporadic pseudohypoaldosteronism (PHA1), a rare form of mineralocorticoid resistance characterized by neonatal renal salt wasting and failure to thrive. Six heterozygous mutations were detected. Two frameshift mutations in exon 2 (insT1354, del8bp537) and one nonsense mutation in exon 4 (C2157A, Cys645stop) generate truncated proteins due to premature stop codons. Three missense mutations (G633R, Q776R, L979P) differently affect hMR function. The DNA binding domain mutant R633 exhibits reduced maximal transactivation, although its binding characteristics and ED(50) of transactivation are comparable with wild-type hMR. Ligand binding domain mutants R776 and P979 present reduced or absent aldosterone binding, respectively, which is associated with reduced or absent ligand-dependent transactivation capacity. Finally, P979 possesses a transdominant negative effect on wild-type hMR activity, whereas mutations G633R and Q776R probably result in haploinsufficiency in PHA1 patients. We conclude that hMR mutations are a common feature of autosomal dominant PHA1, being found in 70% of our familial cases. Their absence in some families underscores the importance of an extensive investigation of the hMR gene and the role of precise diagnostic procedures to allow for identification of other genes potentially involved in the disease.

  14. Genotype-phenotype correlation in a large population of muscular dystrophy patients with LAMA2 mutations.

    LENUS (Irish Health Repository)

    Geranmayeh, Fatemeh

    2010-04-01

    Merosin deficient congenital muscular dystrophy 1A (MDC1A) results from mutations in the LAMA2 gene. We report 51 patients with MDC1A and examine the relationship between degree of merosin expression, genotype and clinical features. Thirty-three patients had absence of merosin and 13 showed some residual merosin. Compared to the residual merosin group, patients with absent merosin had an earlier presentation (<7days) (P=0.0073), were more likely to lack independent ambulation (P=0.0215), or require enteral feeding (P=0.0099) and ventilatory support (P=0.0354). We identified 33 novel LAMA2 mutations; these were distributed throughout the gene in patients with absent merosin, with minor clusters in exon 27, 14, 25 and 26 (55% of mutations). Patients with residual merosin often carried at least one splice site mutation and less frequently frameshift mutations. This large study identified novel LAMA2 mutations and highlights the role of immunohistochemical studies for merosin status in predicting clinical severity of MDC1A.

  15. [Analysis of UQCRB gene mutation in a child with mitochondrial complex III deficiency].

    Science.gov (United States)

    Zhang, Ting; Hong, Fang; Qian, Guling; Tong, Fan; Zhou, Xuelian; Huang, Xiaolei; Yang, Rulai; Huang, Xinwen

    2017-06-10

    To delineate the clinical, biochemical and genetic mutational characteristics of a child with mitochondrial complex III deficiency. Clinical information and results of auxiliary examination of the patient were analyzed. Next-generation sequencing of the mitochondrial genome and related nuclear genes was carried out. Suspected mutation was confirmed in both parents with Sanger sequencing. Heterozygous deletion was mapped with chromosomal microarray analysis and confirmed with real-time PCR. The patient presented with vomiting, polypnea, fever, metabolic acidosis, hyperlactatemia, hypoglycemia, dysfunction of coagulation and immune system, in addition with increased lactate dehydrogenase and creatine kinase isoenzyme. Elevation of blood alanine and acylcarnitines as well as urinary ketotic dicarboxylic acid were also noted. The patient also presented development delay, mental retardation and hypotonia. Sequence analysis revealed two mutations in the nuclear gene UQCRB, which included a previously reported frameshift mutation c.306_309delAAAA(p.Arg105Lysfs*22) and a novel large deletion encompassing the entire UQCRB gene. The clinical, biochemical and gene mutation characteristics of a child with mitochondrial complex III deficiency caused by mutations of the UQCRB gene have been delineated.

  16. One gene, two proteins: coordinated production of a copper chaperone by differential transcript formation and translational frameshifting in Escherichia coli.

    Science.gov (United States)

    Drees, Steffen L; Klinkert, Birgit; Helling, Stefan; Beyer, Dominik F; Marcus, Katrin; Narberhaus, Franz; Lübben, Mathias

    2017-11-01

    Programmed ribosomal frameshifting (PRF) is a translational anomaly causing the ribosome to shift into an alternative reading frame. PRFs are common in viral genomes, using a single nucleotide sequence to code for two proteins in overlapping frames. In bacteria and eukaryota, PRFs are less frequent. We report on a PRF in the copper detoxification system of Escherichia coli where a metallochaperone is generated out of the first 69 amino acids and a C-terminal out-of-frame glycine of the gene copA. copA besides codes for the P 1B -ATPase CopA, a membrane-integral protein and principal interaction target of the chaperone. To enhance the production of the frameshift-generated cytosolic copper binding protein a truncated transcript is produced from the monocistronic copA gene. This shorter transcript is essential for producing sufficient amounts of the chaperone to support the membrane pump. The findings close the gap in our understanding of the molecular physiology of cytoplasmic copper transport in E. coli, revealing that a chaperone-like entity is required for full functionality of the P 1B -ATPase copper pump. We, moreover, demonstrate that the primary transcriptional response to copper results in formation of the small transcript and concurrently, the metallochaperone plays a key role in resistance against copper shock. © 2017 John Wiley & Sons Ltd.

  17. Relationship between repair processes and mutation induction in bacteria. [UV radiation; methyl methanesulfonate; N-methyl-N/sup 1/-nitro-N-nitrosoguanidine; N-methyl-N-nitrosourea; N-ethyl-N-nitrosourea; ethyl methanesulfanate; N-ethyl-nitrosoguanidine; 4-nitroquinoline 1-oxide

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, R F

    1979-01-01

    The main repair and replication-associated processes that can influence the induction of mutations by various mutagens in bacteria are reviewed. These include both constitutive and induced, error-free and error-prone systems. The mutation yield from a treatment with a mutagen can be markedly affected by which of these systems is operating in a given bacterial species or strain. The effect of these systems on mutation induction by ultraviolet light, monofunctional alkylating agents, base analogues, and frameshift mutagens is discussed in some detail. The bearing of these studies on the practical problems of estimating hazards is briefly considered. 79 references.

  18. X-Linked Agammagobulinemia in a Large Series of North African Patients: Frequency, Clinical Features and Novel BTK Mutations.

    Science.gov (United States)

    Aadam, Zahra; Kechout, Nadia; Barakat, Abdelhamid; Chan, Koon-Wing; Ben-Ali, Meriem; Ben-Mustapha, Imen; Zidi, Fethi; Ailal, Fatima; Attal, Nabila; Doudou, Fatouma; Abbadi, Mohamed-Cherif; Kaddache, Chawki; Smati, Leila; Touri, Nabila; Chemli, Jalel; Gargah, Tahar; Brini, Ines; Bakhchane, Amina; Charoute, Hicham; Jeddane, Leila; El Atiqi, Sara; El Hafidi, Naïma; Hida, Mustapha; Saile, Rachid; Alj, Hanane Salih; Boukari, Rachida; Bejaoui, Mohamed; Najib, Jilali; Barbouche, Mohamed-Ridha; Lau, Yu-Lung; Mellouli, Fethi; Bousfiha, Ahmed Aziz

    2016-04-01

    X-linked agammagobulinemia (XLA) is a primary immunodeficiency caused by Bruton's tyrosine kinase (BTK) gene defect. XLA patients have absent or reduced number of peripheral B cells and a profound deficiency in all immunoglobulin isotypes. This multicenter study reports the clinical, immunological and molecular features of Bruton's disease in 40 North African male patients. Fifty male out of 63 (male and female) patients diagnosed with serum agammaglobulinemia and non detectable to less than 2% peripheral B cells were enrolled. The search for BTK gene mutations was performed for all of them by genomic DNA amplification and Sanger sequencing. We identified 33 different mutations in the BTK gene in 40 patients including 12 missense mutations, 6 nonsense mutations, 6 splice-site mutations, 5 frameshift, 2 large deletions, one complex mutation and one in-frame deletion. Seventeen of these mutations are novel. This large series shows a lower frequency of XLA among male patients from North Africa with agammaglobulinemia and absent to low B cells compared with other international studies (63.5% vs. 85%). No strong evidence for genotype-phenotype correlation was observed. This study adds to other reports from highly consanguineous North African populations, showing lower frequency of X-linked forms as compared to AR forms of the same primary immunodeficiency. Furthermore, a large number of novel BTK mutations were identified and could further help identify carriers for genetic counseling.

  19. Functional analysis of the novel TBX5 c.1333delC mutation resulting in an extended TBX5 protein

    Directory of Open Access Journals (Sweden)

    Ekman-Joelsson Britt-Marie

    2008-10-01

    Full Text Available Abstract Background Autosomal dominant Holt-Oram syndrome (HOS is caused by mutations in the TBX5 gene and is characterized by congenital heart and preaxial radial ray upper limb defects. Most of the TBX5 mutations found in patients with HOS cause premature truncation of the primary TBX5 transcript. TBX5 missense mutations alter the three-dimensional structure of the protein and result in failed nuclear localization or reduced binding to target DNA. In this study we present our functional analyses of the novel and unusual c.1333delC mutation found in a patient with classical HOS. Methods The functional impact of this novel mutation was assessed by investigating the intracellular localization of the resulting TBX5 protein and its ability to activate the expression of its downstream target ANF. Results The deletion of the cytosine is the first TBX5 frameshift mutation predicted to result in an elongated TBX5 protein with 74 miscoding amino acids and 62 supernumerary C-terminal amino acids. The c.1333delC mutation affects neither the nuclear localization, nor its colocalization with SALL4, but severely affects the activation of the ANF promoter. Conclusion The mutation c.1333delC does not locate within functional domains, but impairs the activation of the downstream target. This suggests that misfolding of the protein prevents its biological function.

  20. A novel de novo COL1A1 mutation in a Thai boy with osteogenesis imperfecta born to consanguineous parents

    Directory of Open Access Journals (Sweden)

    Siraprapa Tongkobpetch

    2017-09-01

    Full Text Available Abstract Osteogenesis imperfecta (OI is genetically heterogeneous. Mutations in COL1A1 and COL1A2 are responsible for at least 90% of the cases, which are transmitted in an autosomal dominant manner or are de novo events. We identified a Thai boy with OI whose parents were first cousins. Because the proband was the product of a consanguineous marriage, we hypothesized that he might be homozygous for a mutation in a known gene causing a recessive form of OI. Using whole exome sequencing (WES, we did not find any pathogenic mutations in any known gene responsible for an autosomal recessive form of OI. Instead, we identified a COL1A1 frameshift mutation, c.1290delG (p.Gly431Valfs*110 in heterozygosis. By Sanger sequencing, the mutation was confirmed in the proband, and not detected in his parents, indicating that it was a de novo mutation. These findings had implication for genetic counseling. In conclusion, we expanded the mutational spectrum of COL1A1 and provided another example of a de novo pathogenic mutation in heterozygosis in a patient born to consanguineous parents.

  1. Mutations in Danish patients with long QT syndrome and the identification of a large founder family with p.F29L in KCNH2

    DEFF Research Database (Denmark)

    Christiansen, Michael; Hedley, Paula L; Theilade, Juliane

    2014-01-01

    in KCNQ1, 28 in KCNH2, 9 in SCN5A, 3 in KCNE1 and 2 in KCNE2. Twenty-six of these have only been described in the Danish population and 18 are novel. One double heterozygote (1.4% of families) was found. A founder mutation, p.F29L in KCNH2, was identified in 5 "unrelated" families. Disease association......, in 31.2% of cases, was based on the type of mutation identified (nonsense, insertion/deletion, frameshift or splice-site). Functional data was available for 22.7% of the missense mutations. None of the mutations were found in 364 Danish alleles and only three, all functionally characterised, were...

  2. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    Science.gov (United States)

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  3. DMD Mutations in 576 Dystrophinopathy Families: A Step Forward in Genotype-Phenotype Correlations.

    Science.gov (United States)

    Juan-Mateu, Jonas; Gonzalez-Quereda, Lidia; Rodriguez, Maria Jose; Baena, Manel; Verdura, Edgard; Nascimento, Andres; Ortez, Carlos; Baiget, Montserrat; Gallano, Pia

    2015-01-01

    Recent advances in molecular therapies for Duchenne muscular dystrophy (DMD) require precise genetic diagnosis because most therapeutic strategies are mutation-specific. To understand more about the genotype-phenotype correlations of the DMD gene we performed a comprehensive analysis of the DMD mutational spectrum in a large series of families. Here we provide the clinical, pathological and genetic features of 576 dystrophinopathy patients. DMD gene analysis was performed using the MLPA technique and whole gene sequencing in blood DNA and muscle cDNA. The impact of the DNA variants on mRNA splicing and protein functionality was evaluated by in silico analysis using computational algorithms. DMD mutations were detected in 576 unrelated dystrophinopathy families by combining the analysis of exonic copies and the analysis of small mutations. We found that 471 of these mutations were large intragenic rearrangements. Of these, 406 (70.5%) were exonic deletions, 64 (11.1%) were exonic duplications, and one was a deletion/duplication complex rearrangement (0.2%). Small mutations were identified in 105 cases (18.2%), most being nonsense/frameshift types (75.2%). Mutations in splice sites, however, were relatively frequent (20%). In total, 276 mutations were identified, 85 of which have not been previously described. The diagnostic algorithm used proved to be accurate for the molecular diagnosis of dystrophinopathies. The reading frame rule was fulfilled in 90.4% of DMD patients and in 82.4% of Becker muscular dystrophy patients (BMD), with significant differences between the mutation types. We found that 58% of DMD patients would be included in single exon-exon skipping trials, 63% from strategies directed against multiexon-skipping exons 45 to 55, and 14% from PTC therapy. A detailed analysis of missense mutations provided valuable information about their impact on the protein structure.

  4. Mutational analysis of Btk, the defective gene in X-linked agammaglobulinemia

    Energy Technology Data Exchange (ETDEWEB)

    Conley, M.E.; Fitch-Hilgenberg, M.E.; Rohrer, J. [St. Jude Children`s Research Hospital, Memphis, TN (United States)

    1994-09-01

    Recent studies have shown that X-linked agammaglobulinemia (XLA), a disorder of B cell development, is due to mutations in an scr-like cytoplasmic tyrosine kinase, Btk. Thus far, mutations in this gene have been identified by sequencing of cDNA. To permit the detection of mutations in genomic DNA, we determined the structure of Btk and identified 19 exons in 37 kb of DNA. PCR primers were designed to amplify each exon with its splice sites. Two overlapping PCR products were employed for exons longer than 230 base pairs. Single strand conformation polymorphism (SSCP) analysis was used to screen genomic DNA from 30 unrelated families presumed to carry a mutation in Btk. It was possible to amplify DNA in every reaction from every patient. None of the DNA samples demonstrated more than one aberrant SSCP pattern. Twenty three mutations were detected in 25 families. Seven point mutations resulting in amino acid substitutions were seen. An additional 7 base pair substitutions gave rise to premature stop codons. Two splice defects were noted. Small insertions or deletions, all resulting in frameshifts and premature stop codons were seen in eight patients. One patient had an A to G transition in the ATG start codon. Two mutations, both at CpG dinucleotides, were seen in more than one family. Haplotype analysis, using CA repeats closely linked to Btk, demonstrated that the mutations in these families arose independently. We conclude from these studies that the mutations in Btk in patients with XLA are highly variable. Large deletions are uncommon, although small 1 to 4 bp insertions or deletions constitute as many as one third of the mutations. Further analysis of patients with amino acid substitutions will permit structure/function correlations.

  5. DMD Mutations in 576 Dystrophinopathy Families: A Step Forward in Genotype-Phenotype Correlations.

    Directory of Open Access Journals (Sweden)

    Jonas Juan-Mateu

    Full Text Available Recent advances in molecular therapies for Duchenne muscular dystrophy (DMD require precise genetic diagnosis because most therapeutic strategies are mutation-specific. To understand more about the genotype-phenotype correlations of the DMD gene we performed a comprehensive analysis of the DMD mutational spectrum in a large series of families. Here we provide the clinical, pathological and genetic features of 576 dystrophinopathy patients. DMD gene analysis was performed using the MLPA technique and whole gene sequencing in blood DNA and muscle cDNA. The impact of the DNA variants on mRNA splicing and protein functionality was evaluated by in silico analysis using computational algorithms. DMD mutations were detected in 576 unrelated dystrophinopathy families by combining the analysis of exonic copies and the analysis of small mutations. We found that 471 of these mutations were large intragenic rearrangements. Of these, 406 (70.5% were exonic deletions, 64 (11.1% were exonic duplications, and one was a deletion/duplication complex rearrangement (0.2%. Small mutations were identified in 105 cases (18.2%, most being nonsense/frameshift types (75.2%. Mutations in splice sites, however, were relatively frequent (20%. In total, 276 mutations were identified, 85 of which have not been previously described. The diagnostic algorithm used proved to be accurate for the molecular diagnosis of dystrophinopathies. The reading frame rule was fulfilled in 90.4% of DMD patients and in 82.4% of Becker muscular dystrophy patients (BMD, with significant differences between the mutation types. We found that 58% of DMD patients would be included in single exon-exon skipping trials, 63% from strategies directed against multiexon-skipping exons 45 to 55, and 14% from PTC therapy. A detailed analysis of missense mutations provided valuable information about their impact on the protein structure.

  6. Identification of novel mutations in Chinese Hans with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Yu Chaowen

    2011-12-01

    Full Text Available Abstract Background Autosomal dominant polycystic kidney disease (ADPKD is the most common inherited renal disease with an incidence of 1 in 400 to 1000. The disease is genetically heterogeneous, with two genes identified: PKD1 (16p13.3 and PKD2 (4q21. Molecular diagnosis of the disease in at-risk individuals is complicated due to the structural complexity of PKD1 gene and the high diversity of the mutations. This study is the first systematic ADPKD mutation analysis of both PKD1 and PKD2 genes in Chinese patients using denaturing high-performance liquid chromatography (DHPLC. Methods Both PKD1 and PKD2 genes were mutation screened in each proband from 65 families using DHPLC followed by DNA sequencing. Novel variations found in the probands were checked in their family members available and 100 unrelated normal controls. Then the pathogenic potential of the variations of unknown significance was examined by evolutionary comparison, effects of amino acid substitutions on protein structure, and effects of splice site alterations using online mutation prediction resources. Results A total of 92 variations were identified, including 27 reported previously. Definitely pathogenic mutations (ten frameshift, ten nonsense, two splicing defects and one duplication were identified in 28 families, and probably pathogenic mutations were found in an additional six families, giving a total detection level of 52.3% (34/65. About 69% (20/29 of the mutations are first reported with a recurrent mutation rate of 31%. Conclusions Mutation study of PKD1 and PKD2 genes in Chinese Hans with ADPKD may contribute to a better understanding of the genetic diversity between different ethnic groups and enrich the mutation database. Besides, evaluating the pathogenic potential of novel variations should also facilitate the clinical diagnosis and genetic counseling of the disease.

  7. Multi-layered mutation in hedgehog-related genes in Gorlin syndrome may affect the phenotype.

    Directory of Open Access Journals (Sweden)

    Shoko Onodera

    Full Text Available Gorlin syndrome is a genetic disorder of autosomal dominant inheritance that predisposes the affected individual to a variety of disorders that are attributed largely to heterozygous germline patched1 (PTCH1 mutations. PTCH1 is a hedgehog (Hh receptor as well as a repressor, mutation of which leads to constitutive activation of Hh pathway. Hh pathway encompasses a wide variety of cellular signaling cascades, which involve several molecules; however, no associated genotype-phenotype correlations have been reported. Recently, mutations in Suppressor of fused homolog (SUFU or PTCH2 were reported in patients with Gorlin syndrome. These facts suggest that multi-layered mutations in Hh pathway may contribute to the development of Gorlin syndrome. We demonstrated multiple mutations of Hh-related genes in addition to PTCH1, which possibly act in an additive or multiplicative manner and lead to Gorlin syndrome. High-throughput sequencing was performed to analyze exome sequences in four unrelated Gorlin syndrome patient genomes. Mutations in PTCH1 gene were detected in all four patients. Specific nucleotide variations or frameshift variations of PTCH1 were identified along with the inferred amino acid changes in all patients. We further filtered 84 different genes which are closely related to Hh signaling. Fifty three of these had enough coverage of over ×30. The sequencing results were filtered and compared to reduce the number of sequence variants identified in each of the affected individuals. We discovered three genes, PTCH2, BOC, and WNT9b, with mutations with a predicted functional impact assessed by MutationTaster2 or PolyPhen-2 (Polymorphism Phenotyping v2 analysis. It is noticeable that PTCH2 and BOC are Hh receptor molecules. No significant mutations were observed in SUFU. Multi-layered mutations in Hh pathway may change the activation level of the Hh signals, which may explain the wide phenotypic variability of Gorlin syndrome.

  8. Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

    Science.gov (United States)

    Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

    2018-03-01

    Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

  9. Spectrum of SMPD1 mutations in Asian-Indian patients with acid sphingomyelinase (ASM)-deficient Niemann-Pick disease.

    Science.gov (United States)

    Ranganath, Prajnya; Matta, Divya; Bhavani, Gandham SriLakshmi; Wangnekar, Savita; Jain, Jamal Mohammed Nurul; Verma, Ishwar C; Kabra, Madhulika; Puri, Ratna Dua; Danda, Sumita; Gupta, Neerja; Girisha, Katta M; Sankar, Vaikom H; Patil, Siddaramappa J; Ramadevi, Akella Radha; Bhat, Meenakshi; Gowrishankar, Kalpana; Mandal, Kausik; Aggarwal, Shagun; Tamhankar, Parag Mohan; Tilak, Preetha; Phadke, Shubha R; Dalal, Ashwin

    2016-10-01

    Acid sphingomyelinase (ASM)-deficient Niemann-Pick disease is an autosomal recessive lysosomal storage disorder caused by biallelic mutations in the SMPD1 gene. To date, around 185 mutations have been reported in patients with ASM-deficient NPD world-wide, but the mutation spectrum of this disease in India has not yet been reported. The aim of this study was to ascertain the mutation profile in Indian patients with ASM-deficient NPD. We sequenced SMPD1 in 60 unrelated families affected with ASM-deficient NPD. A total of 45 distinct pathogenic sequence variants were found, of which 14 were known and 31 were novel. The variants included 30 missense, 4 nonsense, and 9 frameshift (7 single base deletions and 2 single base insertions) mutations, 1 indel, and 1 intronic duplication. The pathogenicity of the novel mutations was inferred with the help of the mutation prediction software MutationTaster, SIFT, Polyphen-2, PROVEAN, and HANSA. The effects of the identified sequence variants on the protein structure were studied using the structure modeled with the help of the SWISS-MODEL workspace program. The p. (Arg542*) (c.1624C>T) mutation was the most commonly identified mutation, found in 22% (26 out of 120) of the alleles tested, but haplotype analysis for this mutation did not identify a founder effect for the Indian population. To the best of our knowledge, this is the largest study on mutation analysis of patients with ASM-deficient Niemann-Pick disease reported in literature and also the first study on the SMPD1 gene mutation spectrum in India. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. CtIP Mutations Cause Seckel and Jawad Syndromes.

    Directory of Open Access Journals (Sweden)

    Per Qvist

    2011-10-01

    Full Text Available Seckel syndrome is a recessively inherited dwarfism disorder characterized by microcephaly and a unique head profile. Genetically, it constitutes a heterogeneous condition, with several loci mapped (SCKL1-5 but only three disease genes identified: the ATR, CENPJ, and CEP152 genes that control cellular responses to DNA damage. We previously mapped a Seckel syndrome locus to chromosome 18p11.31-q11.2 (SCKL2. Here, we report two mutations in the CtIP (RBBP8 gene within this locus that result in expression of C-terminally truncated forms of CtIP. We propose that these mutations are the molecular cause of the disease observed in the previously described SCKL2 family and in an additional unrelated family diagnosed with a similar form of congenital microcephaly termed Jawad syndrome. While an exonic frameshift mutation was found in the Jawad family, the SCKL2 family carries a splicing mutation that yields a dominant-negative form of CtIP. Further characterization of cell lines derived from the SCKL2 family revealed defective DNA damage induced formation of single-stranded DNA, a critical co-factor for ATR activation. Accordingly, SCKL2 cells present a lowered apoptopic threshold and hypersensitivity to DNA damage. Notably, over-expression of a comparable truncated CtIP variant in non-Seckel cells recapitulates SCKL2 cellular phenotypes in a dose-dependent manner. This work thus identifies CtIP as a disease gene for Seckel and Jawad syndromes and defines a new type of genetic disease mechanism in which a dominant negative mutation yields a recessively inherited disorder.

  11. CTSC and Papillon-Lefèvre syndrome: detection of recurrent mutations in Hungarian patients, a review of published variants and database update.

    Science.gov (United States)

    Nagy, Nikoletta; Vályi, Péter; Csoma, Zsanett; Sulák, Adrienn; Tripolszki, Kornélia; Farkas, Katalin; Paschali, Ekaterine; Papp, Ferenc; Tóth, Lola; Fábos, Beáta; Kemény, Lajos; Nagy, Katalin; Széll, Márta

    2014-05-01

    Papillon-Lefèvre syndrome (PLS; OMIM 245000) is an autosomal recessive condition characterized by palmoplantar hyperkeratosis and periodontitis. In 1997, the gene locus for PLS was mapped to 11q14-21, and in 1999, variants in the cathepsin C gene (CTSC) were identified as causing PLS. To date, a total of 75 different disease-causing mutations have been published for the CTSC gene. A summary of recurrent mutations identified in Hungarian patients and a review of published mutations is presented in this update. Comparison of clinical features in affected families with the same mutation strongly confirm that identical mutations of the CTSC gene can give rise to multiple different phenotypes, making genotype-phenotype correlations difficult. Variable expression of the phenotype associated with the same CTSC mutation may reflect the influence of other genetic and/or environmental factors. Most mutations are missense (53%), nonsense (23%), or frameshift (17%); however, in-frame deletions, one splicing variant, and one 5' untranslated region (UTR) mutation have also been reported. The majority of the mutations are located in exons 5-7, which encodes the heavy chain of the cathepsin C protein, suggesting that tetramerization is important for cathepsin C enzymatic activity. All the data reviewed here have been submitted to the CTSC base, a mutation registry for PLS at http://bioinf.uta.fi/CTSCbase/.

  12. Assessment of the structural and functional impact of in-frame mutations of the DMD gene, using the tools included in the eDystrophin online database.

    Science.gov (United States)

    Nicolas, Aurélie; Lucchetti-Miganeh, Céline; Yaou, Rabah Ben; Kaplan, Jean-Claude; Chelly, Jamel; Leturcq, France; Barloy-Hubler, Frédérique; Le Rumeur, Elisabeth

    2012-07-09

    Dystrophin is a large essential protein of skeletal and heart muscle. It is a filamentous scaffolding protein with numerous binding domains. Mutations in the DMD gene, which encodes dystrophin, mostly result in the deletion of one or several exons and cause Duchenne (DMD) and Becker (BMD) muscular dystrophies. The most common DMD mutations are frameshift mutations resulting in an absence of dystrophin from tissues. In-frame DMD mutations are less frequent and result in a protein with partial wild-type dystrophin function. The aim of this study was to highlight structural and functional modifications of dystrophin caused by in-frame mutations. We developed a dedicated database for dystrophin, the eDystrophin database. It contains 209 different non frame-shifting mutations found in 945 patients from a French cohort and previous studies. Bioinformatics tools provide models of the three-dimensional structure of the protein at deletion sites, making it possible to determine whether the mutated protein retains the typical filamentous structure of dystrophin. An analysis of the structure of mutated dystrophin molecules showed that hybrid repeats were reconstituted at the deletion site in some cases. These hybrid repeats harbored the typical triple coiled-coil structure of native repeats, which may be correlated with better function in muscle cells. This new database focuses on the dystrophin protein and its modification due to in-frame deletions in BMD patients. The observation of hybrid repeat reconstitution in some cases provides insight into phenotype-genotype correlations in dystrophin diseases and possible strategies for gene therapy. The eDystrophin database is freely available: http://edystrophin.genouest.org/.

  13. A founder AGL mutation causing glycogen storage disease type IIIa in Inuit identified through whole-exome sequencing: a case series.

    Science.gov (United States)

    Rousseau-Nepton, Isabelle; Okubo, Minoru; Grabs, Rosemarie; Mitchell, John; Polychronakos, Constantin; Rodd, Celia

    2015-02-03

    Glycogen storage disease type III is caused by mutations in both alleles of the AGL gene, which leads to reduced activity of glycogen-debranching enzyme. The clinical picture encompasses hypoglycemia, with glycogen accumulation leading to hepatomegaly and muscle involvement (skeletal and cardiac). We sought to identify the genetic cause of this disease within the Inuit community of Nunavik, in whom previous DNA sequencing had not identified such mutations. Five Inuit children with a clinical and biochemical diagnosis of glycogen storage disease type IIIa were recruited to undergo genetic testing: 2 underwent whole-exome sequencing and all 5 underwent Sanger sequencing to confirm the identified mutation. Selected DNA regions near the AGL gene were also sequenced to identify a potential founder effect in the community. In addition, control samples from 4 adults of European descent and 7 family members of the affected children were analyzed for the specific mutation by Sanger sequencing. We identified a homozygous frame-shift deletion, c.4456delT, in exon 33 of the AGL gene in 2 children by whole-exome sequencing. Confirmation by Sanger sequencing showed the same mutation in all 5 patients, and 5 family members were found to be carriers. With the identification of this mutation in 5 probands, the estimated prevalence of genetically confirmed glycogen storage disease type IIIa in this region is among the highest worldwide (1:2500). Despite identical mutations, we saw variations in clinical features of the disease. Our detection of a homozygous frameshift mutation in 5 Inuit children determines the cause of glycogen storage disease type IIIa and confirms a founder effect. © 2015 Canadian Medical Association or its licensors.

  14. Mutations in BRCA1 and BRCA2 in breast cancer families: Are there more breast cancer-susceptibility genes?

    Energy Technology Data Exchange (ETDEWEB)

    Serova, O.M.; Mazoyer, S.; Putet, N. [CNRS, Lyon (France)] [and others

    1997-03-01

    To estimate the proportion of breast cancer families due to BRCA1 or BRCA2, we performed mutation screening of the entire coding regions of both genes supplemented with linkage analysis of 31 families, 8 containing male breast cancers and 23 site-specific female breast cancer. A combination of protein-truncation test and SSCP or heteroduplex analyses was used for mutation screening complemented, where possible, by the analysis of expression level of BRCA1 and BRCA2 alleles. Six of the eight families with male breast cancer revealed frameshift mutations, two in BRCA1 and four in BRCA2. Although most families with female site-specific breast cancers were thought to be due to mutations in either BRCA1 or BRCA2, we identified only eight mutations in our series of 23 site-specific female breast cancer families (34%), four in BRCA1 and four in BRCA2. According to the posterior probabilities calculated for mutation-negative families, based on linkage data and mutation screening results, we would expect 8-10 site-specific female breast cancer families of our series to be due to neither BRCA1 nor BRCA2. Thus, our results suggest the existence of at least one more major breast cancer-susceptibility gene. 24 refs., 1 fig., 3 tabs.

  15. Novel mutations in PRG4 gene in two Indian families with camptodactyly-arthropathy- coxa vara- pericarditis (CACP syndrome

    Directory of Open Access Journals (Sweden)

    Rajashree S Nandagopalan

    2014-01-01

    Full Text Available Background & objectives: Camptodactyly - arthropathy- coxa vara- pericarditis (CACP syndrome is an autosomal recessive disorder caused by mutations in the PRG4 (proteoglycan 4 gene. Hallmarks of the syndrome include congenital or early-onset camptodactyly and arthropathy with synovial hyperplasia, progressive coxa vara deformity and non-inflammatory pericardial effusions. Till date only around 25 pathogenic mutations have been reported in this gene and none have been reported from India. We report here the mutations in the PRG4 gene in three patients of CACP from two unrelated families from India. Methods: Molecular genetic studies were done for the three patients with the CACP syndrome, from two unrelated Indian families, through sequence analysis of all coding exons and the exon-intron boundaries of the PRG4 gene. Results: Two novel frame-shift deletion mutations leading to premature protein termination were found. One patient was identified to be homozygous for a 2 base pair deletion in exon 6 (c.2645_2646delGA and the two affected siblings from the other family were found to be homozygous for a 4 base pair deletion in exon 6 (c.2883_2886delAAGA. Conclusions: This is perhaps the first report of PRG4 mutations from India. Further mutation studies in Indian CACP cases will help to determine the mutation spectrum of the PRG4 gene in the Indian population and also help to further elucidate the molecular pathology and the genotype-phenotype correlation of this rare disease.

  16. Minimal Residual Disease Monitoring of Acute Myeloid Leukemia by Massively Multiplex Digital PCR in Patients with NPM1 Mutations.

    Science.gov (United States)

    Mencia-Trinchant, Nuria; Hu, Yang; Alas, Maria Antonina; Ali, Fatima; Wouters, Bas J; Lee, Sangmin; Ritchie, Ellen K; Desai, Pinkal; Guzman, Monica L; Roboz, Gail J; Hassane, Duane C

    2017-07-01

    The presence of minimal residual disease (MRD) is widely recognized as a powerful predictor of therapeutic outcome in acute myeloid leukemia (AML), but methods of measurement and quantification of MRD in AML are not yet standardized in clinical practice. There is an urgent, unmet need for robust and sensitive assays that can be readily adopted as real-time tools for disease monitoring. NPM1 frameshift mutations are an established MRD marker present in half of patients with cytogenetically normal AML. However, detection is complicated by the existence of hundreds of potential frameshift insertions, clonal heterogeneity, and absence of sequence information when the NPM1 mutation is identified using capillary electrophoresis. Thus, some patients are ineligible for NPM1 MRD monitoring. Furthermore, a subset of patients with NPM1-mutated AML will have false-negative MRD results because of clonal evolution. To simplify and improve MRD testing for NPM1, we present a novel digital PCR technique composed of massively multiplex pools of insertion-specific primers that selectively detect mutated but not wild-type NPM1. By measuring reaction end points using digital PCR technology, the resulting single assay enables sensitive and specific quantification of most NPM1 exon 12 mutations in a manner that is robust to clonal heterogeneity, does not require NPM1 sequence information, and obviates the need for maintenance of hundreds of type-specific assays and associated plasmid standards. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Multi-physiopathological consequences of the c.1392G>T CFTR mutation revealed by clinical and cellular investigations.

    Science.gov (United States)

    Farhat, Raed; El-Seedy, Ayman; El-Moussaoui, Kamal; Pasquet, Marie-Claude; Adolphe, Catherine; Bieth, Eric; Languepin, Jeanne; Sermet-Gaudelus, Isabelle; Kitzis, Alain; Ladevèze, Véronique

    2015-02-01

    This study combines a clinical approach and multiple level cellular analyses to determine the physiopathological consequences of the c.1392G>T (p.Lys464Asn) CFTR exon 10 mutation, detected in a CF patient with a frameshift deletion in trans and a TG(11)T(5) in cis. Minigene experiment, with different TG(m)T(n) alleles, and nasal cell mRNA extracts were used to study the impact of c.1392G>T on splicing in both in cellulo and in vivo studies. The processing and localization of p.Lys464Asn protein were evaluated, in cellulo, by western blotting analyses and confocal microscopy. Clinical and channel exploration tests were performed on the patient to determine the exact CF phenotype profile and the CFTR chloride transport activity. c.1392G>T affects exon 10 splicing by inducing its complete deletion and encoding a frameshift transcript. The polymorphism TG(11)T(5) aggravates the effects of this mutation on aberrant splicing. Analysis of mRNA obtained from parental airway epithelial cells confirmed these in cellulo results. At the protein level the p.Lys464Asn protein showed neither maturated form nor membrane localization. Furthermore, the in vivo channel tests confirmed the absence of CFTR activity. Thus, the c.1392G>T mutation alone or in association with the TG repeats and the poly T tract revealed obvious impacts on splicing and CFTR protein processing and functionality. The c.[T(5); 1392G>T] complex allele contributes to the CF phenotype by affecting splicing and inducing a severe misprocessing defect. These results demonstrate that the classical CFTR mutations classification is not sufficient: in vivo and in cellulo studies of a possible complex allele in a patient are required to provide correct CFTR mutation classification, adequate medical counseling, and adapted therapeutic strategies.

  18. An intronic ABCA3 mutation that is responsible for respiratory disease.

    Science.gov (United States)

    Agrawal, Amit; Hamvas, Aaron; Cole, F Sessions; Wambach, Jennifer A; Wegner, Daniel; Coghill, Carl; Harrison, Keith; Nogee, Lawrence M

    2012-06-01

    Member A3 of the ATP-binding cassette family of transporters (ABCA3) is essential for surfactant metabolism. Nonsense, missense, frameshift, and splice-site mutations in the ABCA3 gene (ABCA3) have been reported as causes of neonatal respiratory failure (NRF) and interstitial lung disease. We tested the hypothesis that mutations in noncoding regions of ABCA3 may cause lung disease. ABCA3-specific cDNA was generated and sequenced from frozen lung tissue from a child with fatal lung disease with only one identified ABCA3 mutation. ABCA3 was sequenced from genomic DNA prepared from blood samples obtained from the proband, parents, and other children with NRF. ABCA3 cDNA from the proband contained sequences derived from intron 25 that would be predicted to alter the structure and function of the ABCA3 protein. Genomic DNA sequencing revealed a heterozygous C>T transition in intron 25 trans to the known mutation, creating a new donor splice site. Seven additional infants with an ABCA3-deficient phenotype and inconclusive genetic findings had this same variant, which was not found in 2,132 control chromosomes. These findings support that this variant is a disease-causing mutation that may account for additional cases of ABCA3 deficiency with negative genetic studies.

  19. Molecular analysis of formaldehyde-induced mutations in human lymphoblasts and E. coli

    International Nuclear Information System (INIS)

    Crosby, R.M.; Richardson, K.K.; Craft, T.R.; Benforado, K.B.; Liber, H.L.; Skopek, T.R.

    1988-01-01

    The molecular nature of formaldehyde (HCHO)-induced mutations was studied in both human lymphoblasts and E. coli. Thirty HPRT - human lymphoblast colonies induced by eight repetitive 150 μM HCHO treatments were characterized by Southern blot analysis. Fourteen of these mutants (47%) had visible deletions of some or all of the X-linked HPRT bands, indicating that HCHO can induce large losses of DNA in human lymphoblasts. In E. coli., DNA alterations induced by HCHO were characterized with use of the xanthine guanine phosphoribosyl transferase (gpt) gene as the genetic target. Exposure of E. coli to 4 mM HCHO for 1 hr induced large insertions (41%), large deletions (18%), and point mutations (41%). Dideoxy DNA sequencing revealed that most of the point mutations were transversions at GC base pairs. In contrast, exposure of E. coli to 40 mM HCHO for 1 hr produced 92% point mutations, 62% of which were transitions at a single AT base pair in the gene. Therefore, HCHO is capable of producing different genetic alterations in E. coli at different concentrations, suggesting fundamental differences in the mutagenic mechanisms operating at the two concentrations used. Naked pSV2gpt plasmid DNA was exposed to 3.3 or 10 mM HCHO and transformed into E. coli. Most of the resulting mutations were frameshifts, again suggesting a different mutagenic mechanism

  20. Mutational effects of γ-rays and carbon ion beams on Arabidopsis seedlings

    International Nuclear Information System (INIS)

    Yoshihara, Ryohei; Nozawa, Shigeki; Hase, Yoshihiro; Sakamoto, Ayako N.; Narumi, Issay; Hidema, Jun

    2013-01-01

    To assess the mutational effects of radiation on vigorously proliferating plant tissue, the mutation spectrum was analyzed with Arabidopsis seedlings using the plasmid-rescue method. Transgenic plants containing the Escherichia coli rpsL gene were irradiated with γ-rays and carbon ion beams (320-MeV 12 C 6+ ), and mutations in the rpsL gene were analyzed. Mutant frequency increased significantly following irradiation by γ-rays, but not by 320-MeV 12 C 6+ . Mutation spectra showed that both radiations increased the frequency of frameshifts and other mutations, including deletions and insertions, but only γ-rays increased the frequency of total base substitutions. These results suggest that the type of DNA lesions which cause base substitutions were less often induced by 320-MeV 12 C 6+ than by γ-rays in Arabidopsis seedlings. Furthermore, γ-rays never increased the frequencies of G:C to T:A or A:T to C:G transversions, which are caused by oxidized guanine; 320-MeV 12 C 6+ , however, produced a slight increase in both transversions. Instead, γ-rays produced a significant increase in the frequency of G:C to A:T transitions. These results suggest that 8-oxoguanine has little effect on mutagenesis in Arabidopsis cells. (author)

  1. Identification of a novel mutation in an Indian patient with CAII deficiency syndrome

    Directory of Open Access Journals (Sweden)

    Shivaprasad C

    2010-01-01

    Full Text Available Carbonic anhydrase II (CAII deficiency syndrome characterized by osteopetrosis (OP, renal tubular acidosis (RTA, and cerebral calcifications is caused by mutations in the carbonic anhydrase 2 (CA2 gene. Severity of this disorder varies depending on the nature of the mutation and its effect on the protein. We present here, the clinical and radiographic details along with, results of mutational analysis of the CA2 gene in an individual clinically diagnosed with renal tubular acidosis, osteopetrosis and mental retardation and his family members to establish genotype-phenotype correlation. A novel homozygous deletion mutation c.251delT was seen in the patient resulting in a frameshift and a premature stop codon at amino acid position 90 generating a truncated protein leading to a complete loss of function and a consequential deficiency of the enzyme making this a pathogenic mutation. Confirmation of clinical diagnosis by molecular methods is essential as the clinical features of the CAII deficiency syndrome are similar to other forms of OP but the treatment modalities are different. Genetic confirmation of the diagnosis at an early age leads to the timely institution of therapy improving the growth potential, reduces other complications like fractures, and aids in providing prenatal testing and genetic counseling to the parents planning a pregnancy.

  2. De Novo Mutations in CHAMP1 Cause Intellectual Disability with Severe Speech Impairment

    Science.gov (United States)

    Hempel, Maja; Cremer, Kirsten; Ockeloen, Charlotte W.; Lichtenbelt, Klaske D.; Herkert, Johanna C.; Denecke, Jonas; Haack, Tobias B.; Zink, Alexander M.; Becker, Jessica; Wohlleber, Eva; Johannsen, Jessika; Alhaddad, Bader; Pfundt, Rolph; Fuchs, Sigrid; Wieczorek, Dagmar; Strom, Tim M.; van Gassen, Koen L.I.; Kleefstra, Tjitske; Kubisch, Christian; Engels, Hartmut; Lessel, Davor

    2015-01-01

    CHAMP1 encodes a protein with a function in kinetochore-microtubule attachment and in the regulation of chromosome segregation, both of which are known to be important for neurodevelopment. By trio whole-exome sequencing, we have identified de novo deleterious mutations in CHAMP1 in five unrelated individuals affected by intellectual disability with severe speech impairment, motor developmental delay, muscular hypotonia, and similar dysmorphic features including short philtrum and a tented upper and everted lover lip. In addition to two frameshift and one nonsense mutations, we found an identical nonsense mutation, c.1192C>T (p.Arg398∗), in two affected individuals. All mutations, if resulting in a stable protein, are predicted to lead to the loss of the functionally important zinc-finger domains in the C terminus of the protein, which regulate CHAMP1 localization to chromosomes and the mitotic spindle, thereby providing a mechanistic understanding for their pathogenicity. We thus establish deleterious de novo mutations in CHAMP1 as a cause of intellectual disability. PMID:26340335

  3. Novel homozygous AIRE mutation in a German patient with severe APECED.

    Science.gov (United States)

    von Schnurbein, J; Lahr, G; Posovszky, C; Debatin, K M; Wabitsch, M

    2008-10-01

    Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) is a rare autosomal recessive disorder typically presenting with chronic mucocutaneous candidiasis, hypoparathyroidism, and adrenal failure variably accompanied by other symptoms. APECED is caused by a mutation in the autoimmune regulator gene (AIRE). Today over 60 different mutations are known world-wide, most of them localized in exons 2, 8, and 10. We report here a German girl with rheumatoid factor positive arthritis, chronic mucocutaneous candidiasis, autoimmune hepatitis, chronic diarrhea, vitiligo, hypothyroidism, hypoparathyroidism, and adrenal failure who is homozygous for a novel mutation at the end of exon 3 of the AIRE gene (c.462G>A), within the conserved splice donor sequence. This mutation probably introduces a frameshift after amino acid 154 (p.Pro154fs) by skipping exon 4. In addition, we analyzed five other family members out of three generations for the AIRE gene mutation and for polymorphisms in the cytotoxic T lymphocyte antigen 4 (CTLA4) gene region and lymphoid protein tyrosine phosphatase (PTPN22) gene, which are associated with the occurrence of sporadic autoimmune Addison's disease, type 1 diabetes mellitus, and generalized vitiligo.

  4. A novel STXBP1 mutation causes typical Rett syndrome in a Japanese girl.

    Science.gov (United States)

    Yuge, Kotaro; Iwama, Kazuhiro; Yonee, Chihiro; Matsufuji, Mayumi; Sano, Nozomi; Saikusa, Tomoko; Yae, Yukako; Yamashita, Yushiro; Mizuguchi, Takeshi; Matsumoto, Naomichi; Matsuishi, Toyojiro

    2018-03-12

    Rett syndrome (RTT) is a neurodevelopmental disorder mostly caused by mutations in Methyl-CpG-binding protein 2 (MECP2); however, mutations in various other genes may lead to RTT-like phenotypes. Here, we report the first case of a Japanese girl with RTT caused by a novel syntaxin-binding protein 1 (STXBP1) frameshift mutation (c.60delG, p.Lys21Argfs*16). She showed epilepsy at one year of age, regression of acquired psychomotor abilities thereafter, and exhibited stereotypic hand and limb movements at 3 years of age. Her epilepsy onset was earlier than is typical for RTT patients. However, she fully met the 2010 diagnostic criteria of typical RTT. STXBP1 mutations cause early infantile epileptic encephalopathy (EIEE), various intractable epilepsies, and neurodevelopmental disorders. However, the case described here presented a unique clinical presentation of typical RTT without EIEE and a novel STXBP1 mutation. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  5. Novel LRP5 gene mutation in a patient with osteoporosis-pseudoglioma syndrome.

    Science.gov (United States)

    Marques-Pinheiro, Alice; Levasseur, Régis; Cormier, Catherine; Bonneau, Jessica; Boileau, Catherine; Varret, Mathilde; Abifadel, Marianne; Allanore, Yannick

    2010-03-01

    Osteoporosis-pseudoglioma syndrome (OPPG) is a rare autosomal recessive disorder characterised by severe juvenile-onset osteoporosis and congenital or early-onset blindness. This serious illness is due to mutations in the low-density lipoprotein receptor-related protein 5 (LRP5) that is a major actor in pathways involved in bone remodelling. Here, we report a novel frameshift mutation identified in a 22 year-old Tunisian boy of a consanguineous family. This patient had low bone mineral density (BMD), experienced multiple fractures during childhood and suffered ocular alterations with blindness. Direct DNA sequencing showed a homozygous 5 base pair insertion in exon 5 of the LRP5 gene. This new mutation is located in the first EGF-like domain and gives rise to a truncated protein of 384 amino acids. The functional significance of this mutation clearly indicates a loss-of-function mutation of the LRP5 gene leading to the observed OPPG phenotype. Rheumatologists must be aware of LRP5 gene that in addition to being a major gene in the mendelian disease that is OPPG syndrome seems to be involved in osteoporosis in the general population through some of its polymorphisms. Copyright 2009 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

  6. TP53 mutations in serous tubal intraepithelial carcinoma and concurrent pelvic high-grade serous carcinoma—evidence supporting the clonal relationship of the two lesions

    Science.gov (United States)

    Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming

    2016-01-01

    Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and ‘primary peritoneal’ (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. PMID:21990067

  7. TP53 mutations in serous tubal intraepithelial carcinoma and concurrent pelvic high-grade serous carcinoma--evidence supporting the clonal relationship of the two lesions.

    Science.gov (United States)

    Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming

    2012-02-01

    Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and 'primary peritoneal' (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  8. Hot-spot KIF5A mutations cause familial ALS

    Science.gov (United States)

    Yilmaz, Rüstem; Müller, Kathrin; Grehl, Torsten; Petri, Susanne; Meyer, Thomas; Grosskreutz, Julian; Weydt, Patrick; Ruf, Wolfgang; Neuwirth, Christoph; Weber, Markus; Pinto, Susana; Claeys, Kristl G; Schrank, Berthold; Jordan, Berit; Knehr, Antje; Günther, Kornelia; Hübers, Annemarie; Zeller, Daniel; Kubisch, Christian; Jablonka, Sibylle; Klopstock, Thomas; de Carvalho, Mamede; Sperfeld, Anne; Borck, Guntram; Volk, Alexander E; Dorst, Johannes; Weis, Joachim; Otto, Markus; Schuster, Joachim; Del Tredici, Kelly; Braak, Heiko; Danzer, Karin M; Freischmidt, Axel; Meitinger, Thomas; Strom, Tim M; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H; Weyen, Ute; Hermann, Andreas; Hagenacker, Tim; Koch, Jan Christoph; Lingor, Paul; Göricke, Bettina; Zierz, Stephan; Baum, Petra; Wolf, Joachim; Winkler, Andrea; Young, Peter; Bogdahn, Ulrich; Prudlo, Johannes; Kassubek., Jan

    2018-01-01

    Abstract Heterozygous missense mutations in the N-terminal motor or coiled-coil domains of the kinesin family member 5A (KIF5A) gene cause monogenic spastic paraplegia (HSP10) and Charcot-Marie-Tooth disease type 2 (CMT2). Moreover, heterozygous de novo frame-shift mutations in the C-terminal domain of KIF5A are associated with neonatal intractable myoclonus, a neurodevelopmental syndrome. These findings, together with the observation that many of the disease genes associated with amyotrophic lateral sclerosis disrupt cytoskeletal function and intracellular transport, led us to hypothesize that mutations in KIF5A are also a cause of amyotrophic lateral sclerosis. Using whole exome sequencing followed by rare variant analysis of 426 patients with familial amyotrophic lateral sclerosis and 6137 control subjects, we detected an enrichment of KIF5A splice-site mutations in amyotrophic lateral sclerosis (2/426 compared to 0/6137 in controls; P = 4.2 × 10−3), both located in a hot-spot in the C-terminus of the protein and predicted to affect splicing exon 27. We additionally show co-segregation with amyotrophic lateral sclerosis of two canonical splice-site mutations in two families. Investigation of lymphoblast cell lines from patients with KIF5A splice-site mutations revealed the loss of mutant RNA expression and suggested haploinsufficiency as the most probable underlying molecular mechanism. Furthermore, mRNA sequencing of a rare non-synonymous missense mutation (predicting p.Arg1007Gly) located in the C-terminus of the protein shortly upstream of the splice donor of exon 27 revealed defective KIF5A pre-mRNA splicing in respective patient-derived cell lines owing to abrogation of the donor site. Finally, the non-synonymous single nucleotide variant rs113247976 (minor allele frequency = 1.00% in controls, n = 6137), also located in the C-terminal region [p.(Pro986Leu) in exon 26], was significantly enriched in familial amyotrophic lateral sclerosis patients (minor

  9. MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

    Directory of Open Access Journals (Sweden)

    D. S. Mikhaylenko

    2016-01-01

    Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

  10. Novel SCARB2 mutation in action myoclonus-renal failure syndrome and evaluation of SCARB2 mutations in isolated AMRF features

    Directory of Open Access Journals (Sweden)

    Hopfner Franziska

    2011-10-01

    Full Text Available Abstract Background Action myoclonus-renal failure syndrome is a hereditary form of progressive myoclonus epilepsy associated with renal failure. It is considered to be an autosomal-recessive disease related to loss-of-function mutations in SCARB2. We studied a German AMRF family, additionally showing signs of demyelinating polyneuropathy and dilated cardiomyopathy. To test the hypothesis whether isolated appearance of individual AMRF syndrome features could be related to heterozygote SCARB2 mutations, we screened for SCARB2 mutations in unrelated patients showing isolated AMRF features. Methods In the AMRF family all exons of SCARB2 were analyzed by Sanger sequencing. The mutation screening of unrelated patients with isolated AMRF features affected by either epilepsy (n = 103, progressive myoclonus epilepsy or generalized epilepsy, demyelinating polyneuropathy (n = 103, renal failure (n = 192 or dilated cardiomyopathy (n = 85 was performed as high resolution melting curve analysis of the SCARB2 exons. Results A novel homozygous 1 bp deletion (c.111delC in SCARB2 was found by sequencing three affected homozygous siblings of the affected family. A heterozygous sister showed generalized seizures and reduction of nerve conduction velocity in her legs. No mutations were found in the epilepsy, renal failure or dilated cardiomyopathy samples. In the polyneuropathy sample two individuals with demyelinating disease were found to be carriers of a SCARB2 frameshift mutation (c.666delCCTTA. Conclusions Our findings indicate that demyelinating polyneuropathy and dilated cardiomyopathy are part of the action myoclonus-renal failure syndrome. Moreover, they raise the possibility that in rare cases heterozygous SCARB2 mutations may be associated with PNP features.

  11. Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.

    Science.gov (United States)

    Muhammad, Raj; Shakeel, Muhammad; Rehman, Shoaib U; Lodhi, Muhammad A

    2017-03-01

    β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0-8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division.

  12. Case Report: Whole exome sequencing identifies a novel frameshift insertion c.1325dupT (p.F442fsX2 in the tyrosine kinase domain of BTK gene in a young Indian individual with X-linked agammaglobulinemia [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Amit Rawat

    2017-08-01

    Full Text Available X-linked agammaglobulinemia (XLA is an extremely rare inherited primary immunodeficiency characterized by recurrent bacterial infections, decrease in number of mature B cells and low serum immunoglobulins. XLA is caused by mutations in the gene encoding Bruton's tyrosine kinase. We report a case of a young Indian boy suspected to have XLA. Immunophenotyping was performed for the affected child using CD20, CD19 and CD3 antibodies. Whole exome sequencing was performed using trio-based approach. The variants were further analyzed using capillary sequencing in the trio as well as maternal grandmother. Initial immunophenotyping in the affected child showed decreased count of CD19+ B cells. To strengthen the clinical findings and confirm the diagnosis of XLA, we performed whole exome sequencing. Our analysis identified a novel frameshift insertion (c.1325dupT in the BTK gene, which was further validated by Sanger sequencing. Our approach shows the potential in using whole exome sequencing to pinpoint the molecular lesion, enabling timely diagnosis and genetic counseling, and potentially offering prenatal genetic testing for the family.

  13. Evolution of Pseudomonas aeruginosa Antimicrobial Resistance and Fitness under Low and High Mutation Rates.

    Science.gov (United States)

    Cabot, Gabriel; Zamorano, Laura; Moyà, Bartolomé; Juan, Carlos; Navas, Alfonso; Blázquez, Jesús; Oliver, Antonio

    2016-01-04

    Pseudomonas aeruginosa, a major cause of nosocomial and chronic infections, is considered a paradigm of antimicrobial resistance development. However, the evolutionary trajectories of antimicrobial resistance and the impact of mutator phenotypes remain mostly unexplored. Therefore, whole-genome sequencing (WGS) was performed in lineages of wild-type and mutator (ΔmutS) strains exposed to increasing concentrations of relevant antipseudomonal agents. WGS provided a privileged perspective of the dramatic effect of mutator phenotypes on the accumulation of random mutations, most of which were transitions, as expected. Moreover, a frameshift mutagenic signature, consistent with error-prone DNA polymerase activity as a consequence of SOS system induction, was also seen. This effect was evidenced for all antibiotics tested, but it was higher for fluoroquinolones than for cephalosporins or carbapenems. Analysis of genotype versus phenotype confirmed expected resistance evolution trajectories but also revealed new pathways. Classical mechanisms included multiple mutations leading to AmpC overexpression (ceftazidime), quinolone resistance-determining region (QRDR) mutations (ciprofloxacin), oprD inactivation (meropenem), and efflux pump overexpression (ciprofloxacin and meropenem). Groundbreaking findings included gain-of-function mutations leading to the structural modification of AmpC (ceftazidime), novel DNA gyrase (GyrA) modification (ciprofloxacin), and the alteration of the β-lactam binding site of penicillin-binding protein 3 (PBP3) (meropenem). A further striking finding was seen in the evolution of meropenem resistance, selecting for specific extremely large (>250 kb) genomic deletions providing a growth advantage in the presence of the antibiotic. Finally, fitness and virulence varied within and across evolved antibiotic-resistant populations, but mutator lineages showed a lower biological cost for some antibiotics. Copyright © 2016, American Society for

  14. Bcl11b mutations identified in murine lymphomas increase the proliferation rate of hematopoietic progenitor cells

    Directory of Open Access Journals (Sweden)

    Söderkvist Peter

    2007-10-01

    Full Text Available Abstract Background The telomeric region of mouse chromosome 12 has previously shown frequent allelic loss in murine lymphoma. The Bcl11b gene has been identified and suggested as a candidate tumor suppressor gene within this region. In this study, we aimed to elucidate whether Bcl11b is mutated in lymphomas with allelic loss, and whether the mutations we detected conferred any effect on cell proliferation and apoptosis. Methods Mouse lymphomas induced by 1,3-butadiene or 2',3'-dideoxycytidine were analysed for mutations in the Bcl11b gene using single strand conformation analysis and direct DNA sequencing. Effects on cell proliferation by the detected mutations were studied by expressing wild-type and mutant Bcl11b in the cytokine-dependent hematopoietic progenitor cell line FDC-P1, lacking endogenous Bcl11b expression. Results Missense and frameshift (FS mutations were identified in 7 of 47 tumors (15%. Interestingly, all mutations were found between amino acids 778–844 which encode the three C-terminal DNA-binding zinc fingers. In FDC-P1 cells, wild-type Bcl11b suppressed cell proliferation, whereas the mutated versions (S778N, K828T, Y844C and FS823 enhanced proliferation several-fold. Conclusion The genetic alterations detected in this study suggest that the three C-terminal zinc fingers of Bcl11b are important for the DNA-binding. Cell proliferation was suppressed by overexpression of wild-type Bcl11b but enhanced by mutant Bcl11b, indicating that these mutations may be an important contributing factor to lymphomagenesis in a subset of tumors.

  15. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-04-01

    Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

  16. Muscarinic Acetylcholine Receptor M3 Mutation Causes Urinary Bladder Disease and a Prune-Belly-like Syndrome.

    Science.gov (United States)

    Weber, Stefanie; Thiele, Holger; Mir, Sevgi; Toliat, Mohammad Reza; Sozeri, Betül; Reutter, Heiko; Draaken, Markus; Ludwig, Michael; Altmüller, Janine; Frommolt, Peter; Stuart, Helen M; Ranjzad, Parisa; Hanley, Neil A; Jennings, Rachel; Newman, William G; Wilcox, Duncan T; Thiel, Uwe; Schlingmann, Karl Peter; Beetz, Rolf; Hoyer, Peter F; Konrad, Martin; Schaefer, Franz; Nürnberg, Peter; Woolf, Adrian S

    2011-11-11

    Urinary bladder malformations associated with bladder outlet obstruction are a frequent cause of progressive renal failure in children. We here describe a muscarinic acetylcholine receptor M3 (CHRM3) (1q41-q44) homozygous frameshift mutation in familial congenital bladder malformation associated with a prune-belly-like syndrome, defining an isolated gene defect underlying this sometimes devastating disease. CHRM3 encodes the M3 muscarinic acetylcholine receptor, which we show is present in developing renal epithelia and bladder muscle. These observations may imply that M3 has a role beyond its known contribution to detrusor contractions. This Mendelian disease caused by a muscarinic acetylcholine receptor mutation strikingly phenocopies Chrm3 null mutant mice. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  17. A family with attenuated familial adenomatous polyposis due to a mutation in the alternatively spliced region of APC exon 9.

    Science.gov (United States)

    Young, J; Simms, L A; Tarish, J; Buttenshaw, R; Knight, N; Anderson, G J; Bell, A; Leggett, B

    1998-01-01

    A family is presented with attenuated familial adenomatous polyposis of variable phenotype. The clinical features range from sparse right-sided polyposis and cancer in the proximal colon at the age of 34 to pan-colonic polyposis and cancer at the age of 68. Rectal sparing is common to all affected members. Heteroduplex analysis detected bands of altered mobility in exon 9 of the APC gene in all affected family members. Subsequently, a frameshift mutation was found in the alternatively spliced region of exon 9 at codon 398 which resulted in a stop signal 4 codons downstream. Alternatively spliced transcripts that delete the mutation were readily amplified from normal colonic mucosa and therefore create a mechanism for the attenuated phenotype seen in this family.

  18. Suppression of different classes of somatic mutations in Arabidopsis by vir gene-expressing Agrobacterium strains.

    Science.gov (United States)

    Shah, Jasmine M; Ramakrishnan, Anantha Maharasi; Singh, Amit Kumar; Ramachandran, Subalakshmi; Unniyampurath, Unnikrishnan; Jayshankar, Ajitha; Balasundaram, Nithya; Dhanapal, Shanmuhapreya; Hyde, Geoff; Baskar, Ramamurthy

    2015-08-26

    Agrobacterium infection, which is widely used to generate transgenic plants, is often accompanied by T-DNA-linked mutations and transpositions in flowering plants. It is not known if Agrobacterium infection also affects the rates of point mutations, somatic homologous recombinations (SHR) and frame-shift mutations (FSM). We examined the effects of Agrobacterium infection on five types of somatic mutations using a set of mutation detector lines of Arabidopsis thaliana. To verify the effect of secreted factors, we exposed the plants to different Agrobacterium strains, including wild type (Ach5), its derivatives lacking vir genes, oncogenes or T-DNA, and the heat-killed form for 48 h post-infection; also, for a smaller set of strains, we examined the rates of three types of mutations at multiple time-points. The mutation detector lines carried a non-functional β-glucuronidase gene (GUS) and a reversion of mutated GUS to its functional form resulted in blue spots. Based on the number of blue spots visible in plants grown for a further two weeks, we estimated the mutation frequencies. For plants co-cultivated for 48 h with Agrobacterium, if the strain contained vir genes, then the rates of transversions, SHRs and FSMs (measured 2 weeks later) were lower than those of uninfected controls. In contrast, co-cultivation for 48 h with any of the Agrobacterium strains raised the transposition rates above control levels. The multiple time-point study showed that in seedlings co-cultivated with wild type Ach5, the reduced rates of transversions and SHRs after 48 h co-cultivation represent an apparent suppression of an earlier short-lived increase in mutation rates (peaking for plants co-cultivated for 3 h). An increase after 3 h co-cultivation was also seen for rates of transversions (but not SHR) in seedlings exposed to the strain lacking vir genes, oncogenes and T-DNA. However, the mutation rates in plants co-cultivated for longer times with this strain subsequently

  19. Thymidine selectively enhances growth suppressive effects of camptothecin/irinotecan in MSI+ cells and tumors containing a mutation of MRE11

    DEFF Research Database (Denmark)

    Rodriguez, Rene; Hansen, Lasse Tengbjerg; Phear, Geraldine

    2008-01-01

    PURPOSE: DNA synthesis inhibitors and damaging agents are widely used in cancer therapy; however, sensitivity of tumors to such agents is highly variable. The response of tumor cells in culture to these agents is strongly influenced by the status of DNA damage response pathways. Here, we attempt...... is not a direct result of MMR, p53, or p21 status. However MMR-deficient cell lines containing an intronic frameshift mutation of MRE11 show greatest sensitivity to these agents. Increased sensitivity to this combination is also evident in vivo as thymidine enhances irinotecan-induced growth suppression of MMR......-deficient tumors carrying the MRE11 mutation in mouse xenografts. CONCLUSION: Irinotecan-thymidine combinations may be particularly effective when targeted to MSI+ tumors containing this readily detectable MRE11 mutation....

  20. A novel deletion mutation and structural abnormality in the Bruton's tyrosine kinase gene identified in a Chinese patient with X-linked agammaglobulinemia.

    Science.gov (United States)

    Wang, Shifu; Lu, Yanqin; Li, Hu; Wang, Zhaoxia; Mo, Xinkai; Chai, Zhengbin; Han, Jinxiang

    2014-01-01

    X-linked agammaglobulinemia (XLA) is a heritable primary immune deficiency disorder caused by mutation of Bruton's tyrosine kinase (BTK) gene. The main clinical characteristics of XLA are recurrent respiratory tract infections and profoundly low serum immunoglobulin levels and B cells. The clinical characteristics of a five-year-old Chinese boy with XLA were described. Mutations of BTK genes were identified by traditional DNA sequencing based on PCR. A three-dimensional model of the truncated BTK protein was constructed. Molecular analysis showed a point deletion of an adenine nucleotide at position 1427 (p.Tyr476Ser), which would cause a frameshift and premature termination at codon 484. Three-dimensional analysis showed that the truncated protein had lost the functional region for both ATP and substrate binding such that tyrosine kinase activity would be affected. The study identified a novel BTK mutation of one Chinese XLA patient. The truncated BTK model identified the loss of a functional domain.

  1. Treacher Collins syndrome: clinical implications for the paediatrician--a new mutation in a severely affected newborn and comparison with three further patients with the same mutation, and review of the literature.

    Science.gov (United States)

    Schlump, Jan-Ulrich; Stein, Anja; Hehr, Ute; Karen, Tanja; Möller-Hartmann, Claudia; Elcioglu, Nursel H; Bogdanova, Nadja; Woike, Hartmut Fritz; Lohmann, Dietmar R; Felderhoff-Mueser, Ursula; Linz, Annette; Wieczorek, Dagmar

    2012-11-01

    Treacher Collins syndrome (TCS) is the most common and well-known mandibulofacial dysostosis caused by mutations in at least three genes involved in pre-rRNA transcription, the TCOF1, POLR1D and POLR1C genes. We present a severely affected male individual with TCS with a heterozygous de novo frameshift mutation within the TCOF1 gene (c.790_791delAG,p.Ser264GlnfsX7) and compare the clinical findings with three previously unpublished, milder affected individuals from two families with the same mutation. We elucidate typical clinical features of TCS and its clinical implications for the paediatrician and mandibulofacial surgeon, especially in severely affected individuals and give a short review of the literature. The clinical data of these three families illustrate that the phenotype associated with this specific mutation has a wide intra- and interfamilial variability, which confirms that variable expressivity in carriers of TCOF1 mutations is not a simple consequence of the mutation but might be modified by the combination of genetic, environmental and stochastic factors. Being such a highly complex disease treatment of individuals with TCS should be tailored to the specific needs of each individual, preferably by a multidisciplinary team consisting of paediatricians, craniofacial surgeons and geneticists.

  2. Mapping Mutations on Phylogenies

    DEFF Research Database (Denmark)

    Nielsen, Rasmus

    2005-01-01

    This chapter provides a short review of recent methodologies developed for mapping mutations on phylogenies. Mapping of mutations, or character changes in general, using the maximum parsimony principle has been one of the most powerful tools in phylogenetics, and it has been used in a variety...... uncertainty in the mapping. Recently developed probabilistic methods can incorporate statistical uncertainty in the character mappings. In these methods, focus is on a probability distribution of mutational mappings instead of a single estimate of the mutational mapping....

  3. De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan

    2014-06-01

    Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. Early-onset epileptic encephalopathy with hearing loss in two siblings with TBC1D24 recessive mutations.

    Science.gov (United States)

    Stražišar, Barbara Gnidovec; Neubauer, David; Paro Panjan, Darja; Writzl, Karin

    2015-03-01

    Recent studies have shown that recessive mutations in the TBC1D24 gene cause a variety of epilepsy syndromes, DOORS syndrome and nonsyndromic deafness. We report on two siblings with hypotonia, early-onset epileptic encephalopathy, and severe developmental delay. The patients presented with clonic and myoclonic jerks within 1 h after birth. The seizures were resistant to treatment. Audiologic examination showed bilateral sensorineural hearing loss in both siblings. Genetic analysis revealed compound heterozygous mutations in the TBC1D24 gene: a novel missense mutation c.32A > G (p.Asp11Gly) in exon 2 and a frameshift mutation c.1008delT (p.His336Glnfs*12) in exon 4. This report supports previous observations that mutations in TBC1D24 cause diverse phenotypes. In fact, early-onset epileptic encephalopathy with sensorineural hearing loss is an additional phenotype observed in patients with recessive TBC1D24 mutations. Copyright © 2014 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  5. Genome duplication and mutations in ACE2 cause multicellular, fast-sedimenting phenotypes in evolved Saccharomyces cerevisiae.

    Science.gov (United States)

    Oud, Bart; Guadalupe-Medina, Victor; Nijkamp, Jurgen F; de Ridder, Dick; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc

    2013-11-05

    Laboratory evolution of the yeast Saccharomyces cerevisiae in bioreactor batch cultures yielded variants that grow as multicellular, fast-sedimenting clusters. Knowledge of the molecular basis of this phenomenon may contribute to the understanding of natural evolution of multicellularity and to manipulating cell sedimentation in laboratory and industrial applications of S. cerevisiae. Multicellular, fast-sedimenting lineages obtained from a haploid S. cerevisiae strain in two independent evolution experiments were analyzed by whole genome resequencing. The two evolved cell lines showed different frameshift mutations in a stretch of eight adenosines in ACE2, which encodes a transcriptional regulator involved in cell cycle control and mother-daughter cell separation. Introduction of the two ace2 mutant alleles into the haploid parental strain led to slow-sedimenting cell clusters that consisted of just a few cells, thus representing only a partial reconstruction of the evolved phenotype. In addition to single-nucleotide mutations, a whole-genome duplication event had occurred in both evolved multicellular strains. Construction of a diploid reference strain with two mutant ace2 alleles led to complete reconstruction of the multicellular-fast sedimenting phenotype. This study shows that whole-genome duplication and a frameshift mutation in ACE2 are sufficient to generate a fast-sedimenting, multicellular phenotype in S. cerevisiae. The nature of the ace2 mutations and their occurrence in two independent evolution experiments encompassing fewer than 500 generations of selective growth suggest that switching between unicellular and multicellular phenotypes may be relevant for competitiveness of S. cerevisiae in natural environments.

  6. HMG CoA Lyase (HL): Mutation detection and development of a bacterial expression system for screening the activity of mutant alleles from HL-deficient patients

    Energy Technology Data Exchange (ETDEWEB)

    Robert, M.F.; Ashmarina, L.; Poitier, E. [Hospital Ste-Justine, Montreal (Canada)] [and others

    1994-09-01

    HL catalyzes the last step of ketogenesis, and autosomal recessive HL deficiency in humans can cause episodes of hypoglycemia and coma. Structurally, HL is a dimer of identical 325-residue peptides which requires a reducing environment to maintain activity. We cloned the human and mouse HL cDNAs and genes and have performed mutation analysis on cells from 30 HL-deficient probands. Using SSCP and also genomic Southern analysis we have identified putative mutations on 53/60 alleles of these patients (88%). To date, we have found 20 mutations: 3 large deletions, 4 termination mutations, 5 frameshift mutations, and 8 missense mutations which we suspect to be pathogenic based on evolutionary conservation and/or our previous studies on purified HL protein. We have also identified 3 polymorphic variants. In order to directly test the activity of the missense mutations, we established a pGEX-based system, using a glutathione S transferase (GST)-HL fusion protein. Expressed wild-type GST-HL was insoluble. We previously located a reactive Cys at the C-terminus of chicken HL which is conserved in human HL. We produced a mutant HL peptide, C323S, which replaced Cys323 with Ser. Purified C323S is soluble and has similar kinetics to wild-type HL. C323S-containing GST-HL is soluble and enzymatically active. We are cloning and expressing the 8 missense mutations.

  7. The NOD2 3020insC Mutation in Women with Breast Cancer from the Bydgoszcz Region in Poland. First Results

    Directory of Open Access Journals (Sweden)

    Janiszewska Hanna

    2006-01-01

    Full Text Available Abstract The frameshift NOD2 gene mutation 3020insC is predominantly associated with Crohn's disease, but predisposes to many types of common cancers as well. We studied the frequency of this mutant NOD2 allele in 148 breast cancer women from the Bydgoszcz region in Poland. The NOD2 mutation was present in 8.8% of the patients. The mean age at breast cancer diagnosis of the mutation carriers was 43 years. We did not find any mutation in patients diagnosed with breast cancer after the age of 50 years. There was no association of the NOD2 mutation with a strong family history of breast cancer. On the contrary, the mutation frequency (11.4% was two times higher in women from families with a single case of breast cancer and with aggregation of other common types of cancer, especially digestive tract cancers. Low risk of breast cancer in the mutation carriers seems to be confirmed by finding the 3020insC mutation in three healthy parents of probands aged 73, 74 and 83 years, from three separate families.

  8. 1031-1034delTAAC (Leu125Stop: a novel familial UBE3A mutation causing Angelman syndrome in two siblings showing distinct phenotypes

    Directory of Open Access Journals (Sweden)

    De Molfetta Greice Andreotti

    2012-12-01

    Full Text Available Abstract Background More than 50 mutations in the UBE3A gene (E6-AP ubiquitin protein ligase gene have been found in Angelman syndrome patients with no deletion, no uniparental disomy, and no imprinting defect. Case Presentation We here describe a novel UBE3A frameshift mutation in two siblings who have inherited it from their asymptomatic mother. Despite carrying the same UBE3A mutation, the proband shows a more severe phenotype whereas his sister shows a milder phenotype presenting the typical AS features. Conclusions We hypothesized that the mutation Leu125Stop causes both severe and milder phenotypes. Potential mechanisms include: i maybe the proband has an additional problem (genetic or environmental besides the UBE3A mutation; ii since the two siblings have different fathers, the UBE3A mutation is interacting with a different genetic variant in the proband that, by itself, does not cause problems but in combination with the UBE3A mutation causes the severe phenotype; iii this UBE3A mutation alone can cause either typical AS or the severe clinical picture seen in the proband.

  9. Mutations in the WTX - gene are found in some high-grade microsatellite instable (MSI-H colorectal cancers

    Directory of Open Access Journals (Sweden)

    Scheel Silvio K

    2010-08-01

    Full Text Available Abstract Background Genetically, colorectal cancers (CRCs can be subdivided into tumors with chromosomal instability (CIN or microsatellite instability (MSI. In both types of CRCs genes that are involved in the degradation of β-CATENIN are frequently mutated. Whereas in CIN CRCs APC (Adenomatous Polyposis Coli is affected in most cases, high grade MSI (MSI-H CRCs frequently display mutations in various genes, like the APC-, AXIN2- or CTNNBI (β-CATENIN gene itself. Recently in Wilms tumors, WTX (Wilms tumor gene on the X-chromosome was discovered as another gene involved in the destruction of β-CATENIN. As the WTX-gene harbors a short T6-microsatellite in its N-terminal coding region, we hypothesized that frameshift-mutations might occur in MSI-H CRCs in the WTX gene, thus additionally contributing to the stabilization of β-CATENIN in human CRCs. Methods DNA was extracted from 632 formalin-fixed, paraffin-embedded metastatic CRCs (UICCIV and analyzed for MSI-H by investigating the stability of the highly sensitive microsatellite markers BAT25 and BAT26 applying fluorescence capillary electrophoresis (FCE. Then, in the MSI-H cases, well described mutational hot spot regions from the APC-, AXIN2- and CTNNBI genes were analyzed for genomic alterations by didesoxy-sequencing while the WTX T6-microsatellite was analyzed by fragment analysis. Additionally, the PCR products of T5-repeats were subcloned and mutations were validated using didesoxy-sequencing. Furthermore, the KRAS and the BRAF proto-oncogenes were analyzed for the most common activating mutations applying pyro-sequencing. mRNA expression of WTX from MSI-H and MSS cases and a panel of colorectal cancer cell lines was investigated using reverse transcription (RT- PCR and FCE. Results In our cohort of 632 metastatic CRCs (UICCIV we identified 41 MSI-H cases (6.5%. Two of the 41 MSI-H cases (4.8% displayed a frameshift mutation in the T6-repeat resulting in a T5 sequence. Only one case, a

  10. Functional characterization of two novel splicing mutations in the OCA2 gene associated with oculocutaneous albinism type II.

    Science.gov (United States)

    Rimoldi, Valeria; Straniero, Letizia; Asselta, Rosanna; Mauri, Lucia; Manfredini, Emanuela; Penco, Silvana; Gesu, Giovanni P; Del Longo, Alessandra; Piozzi, Elena; Soldà, Giulia; Primignani, Paola

    2014-03-01

    Oculocutaneous albinism (OCA) is characterized by hypopigmentation of the skin, hair and eye, and by ophthalmologic abnormalities caused by a deficiency in melanin biosynthesis. OCA type II (OCA2) is one of the four commonly-recognized forms of albinism, and is determined by mutation in the OCA2 gene. In the present study, we investigated the molecular basis of OCA2 in two siblings and one unrelated patient. The mutational screening of the OCA2 gene identified two hitherto-unknown putative splicing mutations. The first one (c.1503+5G>A), identified in an Italian proband and her affected sibling, lies in the consensus sequence of the donor splice site of OCA2 intron 14 (IVS14+5G>A), in compound heterozygosity with a frameshift mutation, c.1450_1451insCTGCCCTGACA, which is predicted to determine the premature termination of the polypeptide chain (p.I484Tfs*19). In-silico prediction of the effect of the IVS14+5G>A mutation on splicing showed a score reduction for the mutant splice site and indicated the possible activation of a newly-created deep-intronic acceptor splice site. The second mutation is a synonymous transition (c.2139G>A, p.K713K) involving the last nucleotide of exon 20. This mutation was found in a young African albino patient in compound heterozygosity with a previously-reported OCA2 missense mutation (p.T404M). In-silico analysis predicted that the mutant c.2139G>A allele would result in the abolition of the splice donor site. The effects on splicing of these two novel mutations were investigated using an in-vitro hybrid-minigene approach that led to the demonstration of the causal role of the two mutations and to the identification of aberrant transcript variants. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Broadening the phenotype of DFNB28: Mutations in TRIOBP are associated with moderate, stable hereditary hearing impairment.

    Science.gov (United States)

    Wesdorp, Mieke; van de Kamp, Jiddeke M; Hensen, Erik F; Schraders, Margit; Oostrik, Jaap; Yntema, Helger G; Feenstra, Ilse; Admiraal, Ronald J C; Kunst, Henricus P M; Tekin, Mustafa; Kanaan, Moien; Kremer, Hannie; Pennings, Ronald J E

    2017-04-01

    DFNB28 is characterized by prelingual, severe to profound sensorineural hearing impairment (HI). It is associated with mutations in exon 6 and 7 of TRIOBP and has not been reported in the European population. Here, we describe two isolated cases of Dutch origin with congenital, moderate HI and compound heterozygous mutations in TRIOBP. Three of the mutations are novel, one nonsense mutation (c.5014G>T (p.Gly1672*)) and two frameshift mutations (c.2653del (p.Arg885Alafs*120) and c.3460_3461del (p.Leu1154Alafs*29)). The fourth mutation is the known c.3232dup (p.Arg1078Profs*6) mutation. Longitudinal audiometric analyses in one of the subjects revealed that HI was stable over a period of 15 years. Vestibular function was normal. Predicted effects of the mutations do not explain the relatively mild phenotype in the presented subjects, whereas location of the mutation might well contribute to the milder HI in one of the subjects. It is known that isoform classes TRIOBP-4 and TRIOBP-5 are important for stereocilia stability and rigidity. To our knowledge, p.Gly1672* is the first pathogenic variant identified in DFNB28 that does not affect isoform class TRIOBP-4. This suggests that a single TRIOBP copy to encode wildtype TRIOBP-4 is insufficient for normal hearing, and that at least one TRIOBP copy to encode TRIOBP-5 is indispensable for normal inner ear function. Furthermore, this study demonstrates that DFNB28 can be milder than reported so far and that mutations in TRIOBP are thus associated with a heterogeneous phenotype. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. A novel PITX2 mutation in non-syndromic oro-dental anomalies.

    Science.gov (United States)

    Intarak, Narin; Theerapanon, Thanakorn; Ittiwut, Chupong; Suphapeetiporn, Kanya; Porntaveetus, Thantrira; Shotelersuk, Vorasuk

    2017-11-09

    To identify oro-dental characteristics and genetic etiology of a family affected with non-syndromic oro-dental anomalies. Physical and oral features were characterised. DNA was collected from an affected Thai family. Whole exome sequencing was employed to identify the pathogenic variants associated with inherited oro-dental anomalies. The presence of the identified mutation was confirmed by Sanger sequencing. We observed unique oro-dental manifestations including oligodontia, retained primary teeth, taurodont molars, peg-shaped maxillary central incisors, high attached frenum with nodule, and midline diastema in the proband and her mother. Mutation analyses revealed a novel heterozygous frameshift deletion, c.573_574delCA, p.L193QfsX5, in exon 5 of PITX2A in affected family members. The amino acid alterations, localised in the transcriptional activation domain 2 in the C terminus of PITX2, were evolutionarily conserved. Mutations in PITX2 have been associated with autosomal-dominant Axenfeld-Rieger syndrome and non-syndromic eye abnormalities, but never been found to cause isolated oral anomalies. This study for the first time demonstrates that the PITX2 mutation could lead to non-syndromic oro-dental anomalies in humans. We propose that the specific location in the C-terminal domain of PITX2 is exclusively necessary for tooth development. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  13. Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

    Directory of Open Access Journals (Sweden)

    Weining Rong

    Full Text Available Usher syndrome (USH is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

  14. Clinical and mutational features of Vietnamese children with X-linked agammaglobulinemia.

    Science.gov (United States)

    Vu, Quang Van; Wada, Taizo; Le, Huong Thi Minh; Le, Hai Thanh; Van Nguyen, Anh Thi; Osamu, Ohara; Yachie, Akihiro; Nguyen, Sang Ngoc

    2014-05-28

    X-linked agammaglobulinemia (XLA) is a primary immune deficiency characterized by recurrent bacterial infections and profoundly depressed serum immunoglobulin levels and circulating mature B cells. It is caused by mutations of the Bruton tyrosine kinase (BTK) gene and is the most common form of inherited antibody deficiency. To our knowledge, this is the first report of XLA from Vietnam. We investigated the BTK gene mutations and clinical features of four unrelated Vietnamese children. The mean ages at onset and at diagnosis were 2.5 and 8 years, respectively. All patients had a medical history of otitis media, pneumonia, and septicemia at the time of diagnosis. Other infections reported included sinusitis, bronchiectasis, arthritis, skin infections, meningitis, and recurrent diarrhea. We identified one previously reported mutation (c.441G >A) and three novel mutations: two frameshifts (c.1770delG and c.1742 delG), and one nonsense (c.1249A >T). The delayed diagnosis may be attributable to insufficient awareness of this rare disease on the background of frequent infections even in the immunocompetent pediatric population in Vietnam. Our results further support the importance of molecular genetic testing in diagnosis of XLA.

  15. Rediscovery by Whole Genome Sequencing: Classical Mutations and Genome Polymorphisms in Neurospora crassa

    Energy Technology Data Exchange (ETDEWEB)

    McCluskey, Kevin; Wiest, Aric E.; Grigoriev, Igor V.; Lipzen, Anna; Martin, Joel; Schackwitz, Wendy; Baker, Scott E.

    2011-06-02

    Classical forward genetics has been foundational to modern biology, and has been the paradigm for characterizing the role of genes in shaping phenotypes for decades. In recent years, reverse genetics has been used to identify the functions of genes, via the intentional introduction of variation and subsequent evaluation in physiological, molecular, and even population contexts. These approaches are complementary and whole genome analysis serves as a bridge between the two. We report in this article the whole genome sequencing of eighteen classical mutant strains of Neurospora crassa and the putative identification of the mutations associated with corresponding mutant phenotypes. Although some strains carry multiple unique nonsynonymous, nonsense, or frameshift mutations, the combined power of limiting the scope of the search based on genetic markers and of using a comparative analysis among the eighteen genomes provides strong support for the association between mutation and phenotype. For ten of the mutants, the mutant phenotype is recapitulated in classical or gene deletion mutants in Neurospora or other filamentous fungi. From thirteen to 137 nonsense mutations are present in each strain and indel sizes are shown to be highly skewed in gene coding sequence. Significant additional genetic variation was found in the eighteen mutant strains, and this variability defines multiple alleles of many genes. These alleles may be useful in further genetic and molecular analysis of known and yet-to-be-discovered functions and they invite new interpretations of molecular and genetic interactions in classical mutant strains.

  16. Ataxia Oculomotor Apraxia Type 1 in the Siblings of a Family: A Novel Mutation.

    Science.gov (United States)

    Karimzadeh, Parvaneh; Khayatzadeh Kakhki, Simin; Esmail Nejad, Shaghayegh Sadat; Houshmand, Masood; Ghofrani, Mohammad

    2017-01-01

    Although AOA1 (ataxia oculomotor apraxia1) is one of the most common causes of autosomal recessive cerebellar ataxias in Japanese population, it is reported from all over the world. The clinical manifestations are similar to ataxia telangiectasia in which non-neurological manifestations are absent and include almost 10% of autosomal recessive cerebellar ataxias. Dysarthria and gait disorder are the most two common and typical manifestations. Oculomotor apraxia is usually seen a few years after the manifestations start. APTX gene on 9p13.3 chromosome is expressed in the cells of all human body tissues and different mutations had been discovered. Here we report two siblings (a girl and a boy) of consanguineous parents visited at Mofid Pediatrics Hospital in 2015, with history of gait ataxia, titubation, tremor, and oculomotor apraxia around five yr old and after that. The brother showed symptoms of disease earlier and more severe than his sister did. After ruling out the common etiologies of progressive ataxia, we did genetic study for AOA1 that showed a homozygous frameshift mutation as c.418_418 del was found. This mutation was not reported before so this was a new mutation in APTX gene.

  17. Mutation spectrum of MLL2 in a cohort of kabuki syndrome patients

    Directory of Open Access Journals (Sweden)

    Renieri Alessandra

    2011-06-01

    Full Text Available Abstract Background Kabuki syndrome (Niikawa-Kuroki syndrome is a rare, multiple congenital anomalies/mental retardation syndrome characterized by a peculiar face, short stature, skeletal, visceral and dermatoglyphic abnormalities, cardiac anomalies, and immunological defects. Recently mutations in the histone methyl transferase MLL2 gene have been identified as its underlying cause. Methods Genomic DNAs were extracted from 62 index patients clinically diagnosed as affected by Kabuki syndrome. Sanger sequencing was performed to analyze the whole coding region of the MLL2 gene including intron-exon junctions. The putative causal and possible functional effect of each nucleotide variant identified was estimated by in silico prediction tools. Results We identified 45 patients with MLL2 nucleotide variants. 38 out of the 42 variants were never described before. Consistently with previous reports, the majority are nonsense or frameshift mutations predicted to generate a truncated polypeptide. We also identified 3 indel, 7 missense and 3 splice site. Conclusions This study emphasizes the relevance of mutational screening of the MLL2 gene among patients diagnosed with Kabuki syndrome. The identification of a large spectrum of MLL2 mutations possibly offers the opportunity to improve the actual knowledge on the clinical basis of this multiple congenital anomalies/mental retardation syndrome, design functional studies to understand the molecular mechanisms underlying this disease, establish genotype-phenotype correlations and improve clinical management.

  18. Analysis of mutations in the human HPRT gene induced by accelerated heavy-ion irradiation

    International Nuclear Information System (INIS)

    Kagawa, Yasuhiro; Yatagai, Fumio; Hanaoka, Fumio; Suzuki, Masao; Kase, Youko; Kobayashi, Akiko; Hirano, Masahiko; Kato, Takesi; Watanabe, Masami.

    1995-01-01

    Multiplex PCR analysis of HPRT(-) mutations in human embryo (HE) cells induced by 230 keV/μm carbon-ion irradiation showed no large deletion around the exon regions of the locus gene in contrast to the irradiations at different LETs. To identify these mutations, the sequence alterations in a cDNA of hprt gene were determined for 18 mutant clones in this study. Missing of exon 6 was the most frequent mutational event (10 clones), and missing of both exons 6 and 8 was next most frequent event (6 clones), then base substitutions (2 clones). These characteristics were not seen in a similar analysis of spontaneous mutations, which showed base substitution (5 clones), frameshift (2 clones), missing of both exons 2 and 3 (2 clones), and a single unidentified clone. Direct sequencing and restriction enzyme digestion of the genomic DNA of the mutants which showed missing of exons 6 and 8 in the cDNA, supports the possibility that they were induced by aberrant mRNA splicing. (author)

  19. A novel gene mutation in a family with X-linked retinoschisis.

    Science.gov (United States)

    Lai, Yu-Hung; Huang, Shun-Ping; Chen, Shee-Ping; Hu, Pei-Shin; Lin, Shu-Fung; Sheu, Min-Muh; Wang, Hwei-Zu; Tsai, Rong Kung

    2015-09-01

    To describe the clinical characteristics of a Taiwanese family with X-linked retinoschisis (XLRS) and to investigate the molecular genetics of a novel mutation in the retinoschisin 1 (RS1) gene. A total of 15 participants in this XLRS family were analyzed. Complete ophthalmic examinations and fundus photography were performed on 15 family members. These tests identified five affected males and two female carriers. Blood samples were collected, and genomic DNA was extracted. Best-corrected visual acuity, optical coherence tomography (OCT), electroretinogram (ERG), and direct DNA sequence analysis of the RS1 gene were performed on 15 family members. Five affected males, with visual acuity ranging from 0.2 to 0.7, had macular schisis and abnormal retinal pigment epithelium pigmentation. The mixed scotopic ERG "b" wave was more reduced than the "a" wave. OCT revealed typical microcystic schisis cavities within the macula area. Direct DNA sequence analysis revealed a single base pair deletion, 97delT, in all the affected individuals. This deletion resulted in a frameshift mutation of the RS1 gene, causing protein truncation. The affected males in this family showed moderately decreased visual acuity and dysfunction in both cone cells and phototransduction. We identified a novel RS1 (97delT) mutation in a Taiwanese family with XLRS. This finding expands the RS1 mutation spectrum and may help to further understand the molecular pathogenesis of XLRS. Copyright © 2014. Published by Elsevier B.V.

  20. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  1. CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

    Science.gov (United States)

    Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

    2015-10-01

    A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

  2. UV Signature Mutations

    Science.gov (United States)

    2014-01-01

    Sequencing complete tumor genomes and exomes has sparked the cancer field's interest in mutation signatures for identifying the tumor's carcinogen. This review and meta-analysis discusses signatures and their proper use. We first distinguish between a mutagen's canonical mutations – deviations from a random distribution of base changes to create a pattern typical of that mutagen – and the subset of signature mutations, which are unique to that mutagen and permit inference backward from mutations to mutagen. To verify UV signature mutations, we assembled literature datasets on cells exposed to UVC, UVB, UVA, or solar simulator light (SSL) and tested canonical UV mutation features as criteria for clustering datasets. A confirmed UV signature was: ≥60% of mutations are C→T at a dipyrimidine site, with ≥5% CC→TT. Other canonical features such as a bias for mutations on the non-transcribed strand or at the 3' pyrimidine had limited application. The most robust classifier combined these features with criteria for the rarity of non-UV canonical mutations. In addition, several signatures proposed for specific UV wavelengths were limited to specific genes or species; non-signature mutations induced by UV may cause melanoma BRAF mutations; and the mutagen for sunlight-related skin neoplasms may vary between continents. PMID:25354245

  3. WDR62 is associated with the spindle pole and is mutated in human microcephaly.

    Science.gov (United States)

    Nicholas, Adeline K; Khurshid, Maryam; Désir, Julie; Carvalho, Ofélia P; Cox, James J; Thornton, Gemma; Kausar, Rizwana; Ansar, Muhammad; Ahmad, Wasim; Verloes, Alain; Passemard, Sandrine; Misson, Jean-Paul; Lindsay, Susan; Gergely, Fanni; Dobyns, William B; Roberts, Emma; Abramowicz, Marc; Woods, C Geoffrey

    2010-11-01

    Autosomal recessive primary microcephaly (MCPH) is a disorder of neurodevelopment resulting in a small brain. We identified WDR62 as the second most common cause of MCPH after finding homozygous missense and frame-shifting mutations in seven MCPH families. In human cell lines, we found that WDR62 is a spindle pole protein, as are ASPM and STIL, the MCPH7 and MCHP7 proteins. Mutant WDR62 proteins failed to localize to the mitotic spindle pole. In human and mouse embryonic brain, we found that WDR62 expression was restricted to neural precursors undergoing mitosis. These data lend support to the hypothesis that the exquisite control of the cleavage furrow orientation in mammalian neural precursor cell mitosis, controlled in great part by the centrosomes and spindle poles, is critical both in causing MCPH when perturbed and, when modulated, generating the evolutionarily enlarged human brain.

  4. A Turkish family with Nance-Horan Syndrome due to a novel mutation.

    Science.gov (United States)

    Tug, Esra; Dilek, Nihal F; Javadiyan, Shahrbanou; Burdon, Kathryn P; Percin, Ferda E

    2013-08-01

    Nance-Horan Syndrome (NHS) is a rare X-linked syndrome characterized by congenital cataract which leads to profound vision loss, characteristic dysmorphic features and specific dental anomalies. Microcornea, microphthalmia and mild or moderate mental retardation may accompany these features. Heterozygous females often manifest similarly but with less severe features than affected males. We describe two brothers who have the NHS phenotype and their carrier mother who had microcornea but not cataract. We identified a previously unreported frameshift mutation (c.558insA) in exon 1 of the NHS gene in these patients and their mother which is predicted to result in the incorporation of 11 aberrant amino acids prior to a stop codon (p.E186Efs11X). We also discussed genotype-phenotype correlation according to relevant literature. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. High frequency of the recurrent c.1310_1313delAAGA BRCA2 mutation in the North-East of Morocco and implication for hereditary breast-ovarian cancer prevention and control.

    Science.gov (United States)

    Laarabi, Fatima-Zahra; Ratbi, Ilham; Elalaoui, Siham Chafai; Mezzouar, Loubna; Doubaj, Yassamine; Bouguenouch, Laila; Ouldim, Karim; Benjaafar, Noureddine; Sefiani, Abdelaziz

    2017-06-02

    To date, a limited number of BRCA1/2 germline mutations have been reported in hereditary breast and/or ovarian cancer in the Moroccan population. Less than 20 different mutations of these two genes have been identified in Moroccan patients, and recently we reported a further BRCA2 mutation (c.1310_1313delAAGA; p.Lys437IlefsX22) in three unrelated patients, all from the North-East of the country. We aimed in this study to evaluate the frequency and geographic distribution of this BRCA2 frameshift mutation, in order to access its use as the first-line BRCA genetic testing strategy for Moroccan patients. We enrolled in this study 122 patients from different regions of Morocco, with suggestive inherited predisposition to breast and ovarian cancers. All subjects gave written informed consent to BRCA1/2 genetic testing. According to available resources of our lab and enrolled families, 51 patients were analyzed by the conventional individual exon-by-exon Sanger sequencing, 23 patients were able to benefit from a BRCA next generation sequencing and a target screening for exon 10 of BRCA2 gene was performed in 48 patients. Overall, and among the 122 patients analyzed for at least the exon 10 of the BRCA2 gene, the c.1310_1313delAAGA frameshift mutation was found in 14 patients. Genealogic investigation revealed that all carriers of this mutation shared the same geographic origin and were descendants of the North-East of Morocco. In this study, we highlighted that c.1310_1313delAAGA mutation of BRCA2 gene is recurrent with high frequency in patients from the North-East region of Morocco. Therefore, we propose to use, in public health strategies, the detection of this mutation as the first-line screening tests in patients with breast and ovarian cancer originated from this region.

  6. Characterization of a splicing mutation in group A xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki; Miyamoto, Iwai; Okada, Yoshio; Satoh, Yoshiaki; Kondo, Seiji

    1990-01-01

    The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G → C substitution at the 3' splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3' splice site, thus creating two abnormally spliced mRNA forms. The larger form is identical with normal mRNA except for a dinucleotide deletion at the 5' end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5' end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers

  7. Identification of Two Novel Amalgaviruses in the Common Eelgrass (Zostera marina and in Silico Analysis of the Amalgavirus +1 Programmed Ribosomal Frameshifting Sites

    Directory of Open Access Journals (Sweden)

    2018-04-01

    Full Text Available The genome sequences of two novel monopartite RNA viruses were identified in a common eelgrass (Zostera marina transcriptome dataset. Sequence comparison and phylogenetic analyses revealed that these two novel viruses belong to the genus Amalgavirus in the family Amalgaviridae. They were named Zostera marina amalgavirus 1 (ZmAV1 and Zostera marina amalgavirus 2 (ZmAV2. Genomes of both ZmAV1 and ZmAV2 contain two overlapping open reading frames (ORFs. ORF1 encodes a putative replication factory matrix-like protein, while ORF2 encodes a RNA-dependent RNA polymerase (RdRp domain. The fusion protein (ORF1+2 of ORF1 and ORF2, which mediates RNA replication, was produced using the +1 programmed ribosomal frameshifting (PRF mechanism. The +1 PRF motif sequence, UUU_CGN, which is highly conserved among known amalgaviruses, was also found in ZmAV1 and ZmAV2. Multiple sequence alignment of the ORF1+2 fusion proteins from 24 amalgaviruses revealed that +1 PRF occurred only at three different positions within the 13-amino acid-long segment, which was surrounded by highly conserved regions on both sides. This suggested that the +1 PRF may be constrained by the structure of fusion proteins. Genome sequences of ZmAV1 and ZmAV2, which are the first viruses to be identified in common eelgrass, will serve as useful resources for studying evolution and diversity of amalgaviruses.

  8. Identification of Nine New RAI1-Truncating Mutations in Smith-Magenis Syndrome Patients without 17p11.2 Deletions.

    Science.gov (United States)

    Dubourg, C; Bonnet-Brilhault, F; Toutain, A; Mignot, C; Jacquette, A; Dieux, A; Gérard, M; Beaumont-Epinette, M-P; Julia, S; Isidor, B; Rossi, M; Odent, S; Bendavid, C; Barthélémy, C; Verloes, A; David, V

    2014-02-01

    Smith-Magenis syndrome (SMS) is an intellectual disability syndrome with sleep disturbance, self-injurious behaviors and dysmorphic features. It is estimated to occur in 1/25,000 births, and in 90% of cases it is associated with interstitial deletions of chromosome 17p11.2. RAI1 (retinoic acid induced 1; OMIM 607642) mutations are the second most frequent molecular etiology, with this gene being located in the SMS locus at 17p11.2. Here, we report 9 new RAI1-truncating mutations in nonrelated individuals referred for molecular analysis due to a possible SMS diagnosis. None of these patients carried a 17p11.2 deletion. The 9 mutations include 2 nonsense mutations and 7 heterozygous frameshift mutations leading to protein truncation. All mutations map in exon 3 of RAI1 which codes for more than 98% of the protein. RAI1 regulates gene transcription, and its targets are themselves involved in transcriptional regulation, cell growth and cell cycle regulation, bone and skeletal development, lipid and glucide metabolisms, neurological development, behavioral functions, and circadian activity. We report the clinical features of the patients carrying these deleterious mutations in comparison with those of patients carrying 17p11.2 deletions.

  9. Congenital muscular dystrophy with fatty liver and infantile-onset cataract caused by TRAPPC11 mutations: broadening of the phenotype.

    Science.gov (United States)

    Liang, Wen-Chen; Zhu, Wenhua; Mitsuhashi, Satomi; Noguchi, Satoru; Sacher, Michael; Ogawa, Megumu; Shih, Hsiang-Hung; Jong, Yuh-Jyh; Nishino, Ichizo

    2015-01-01

    Transport protein particle (TRAPP) is a multiprotein complex involved in endoplasmic reticulum-to-Golgi trafficking. Zebrafish with a mutation in the TRAPPC11 orthologue showed hepatomegaly with steatosis and defects in visual system development. In humans, TRAPPC11 mutations have been reported in only three families showing limb-girdle muscular dystrophy (LGMD) or myopathy with movement disorders and intellectual disability. We screened muscular dystrophy genes using next-generation sequencing and performed associated molecular and biochemical analyses in a patient with fatty liver and cataract in addition to infantile-onset muscle weakness. We identified the first Asian patient with TRAPPC11 mutations. Muscle pathology demonstrated typical dystrophic changes and liver biopsy revealed steatosis. The patient carried compound heterozygous mutations of a previously reported missense and a novel splice-site mutation. The splice-site change produced two aberrantly-spliced transcripts that were both predicted to result in translational frameshift and truncated proteins. Full-length TRAPPC11 protein was undetectable on immunoblotting. This report widens the phenotype of TRAPPC11-opathy as the patient showed the following: (1) congenital muscular dystrophy phenotype rather than LGMD; (2) steatosis and infantile-onset cataract, both not observed in previously reported patients; but (3) no ataxia or abnormal movement, clearly indicating that TRAPPC11 plays a physiological role in multiple tissues in human.

  10. An elastin gene mutation producing abnormal tropoelastin and abnormal elastic fibres in a patient with autosomal dominant cutis laxa.

    Science.gov (United States)

    Tassabehji, M; Metcalfe, K; Hurst, J; Ashcroft, G S; Kielty, C; Wilmot, C; Donnai, D; Read, A P; Jones, C J

    1998-06-01

    Elastin is the protein responsible for the characteristic elastic properties of many tissues including the skin, lungs and large blood vessels. Loss-of-function mutations in the elastin gene are known to cause the heart defect supravalvular aortic stenosis (SVAS). We and others have identified deletions, nonsense mutations and splice site mutations in SVAS patients that abolish the function of one elastin gene. We have now identified an elastin mutation in a patient with a completely different phenotype, the rare autosomal dominant condition cutis laxa. A frameshift mutation in exon 32 of the elastin gene is predicted to replace 37 amino acids at the C-terminus of elastin by a novel sequence of 62 amino acids. mRNA and immunoprecipitation studies show that the mutant allele is expressed. Electron microscopy of skin sections shows abnormal branching and fragmentation in the amorphous elastin component, and immunocytochemistry shows reduced elastin deposition in the elastic fibres and fewer microfibrils in the dermis. These findings suggest that the mutant tropoelastin protein is synthesized, secreted and incorporated into the elastic matrix, where it alters the architecture of elastic fibres. Interference with cross-linking would reduce elastic recoil in affected tissues and explain the cutis laxa phenotype.

  11. Identification of a novel mutation in the CLCN5 gene in a Chinese family with Dent-1 disease.

    Science.gov (United States)

    Zhang, Hao; Wang, Chun; Yue, Hua; Hu, Wei-Wei; Gu, Jie-Mei; He, Jin-Wei; Fu, Wen-Zhen; Liu, Yu-Juan; Zhang, Zeng; Zhang, Zhen-Lin

    2014-02-01

    Dent disease comprises a group of X-linked recessive inherited renal tubular disorders, the symptoms of which include low-molecular-weight proteinuria (LMWP), hypercalciuria, nephrocalcinosis, and progressive renal failure. We sought to characterize the clinical manifestations and to identify the mutations associated with this disease in Chinese patients. In total, 155 DNA samples were collected from one affected individual, four of his family members, and 150 healthy donors. All 12 exons and the exon-intron boundaries of the CLCN5 gene were amplified and directly sequenced in this Chinese family. The proband demonstrated osteomalacia, which had resulted in more than 10 fractures, LMWP, and renal failure. A single base 'G' deletion at nucleotide 246 (c. 246delG) was identified in exon 5 of the CLCN5 gene in this patient, resulting in a frame shift mutation (fsX) that changed the Threonine (Thr) residue in position 83 to Proline (Pro). The proband's mother was found to be a carrier of this mutation. The present study suggests that a novel frameshift mutation (c. 246delG) in exon 5 of the CLCN5 gene is responsible for Dent disease in this case. Our findings also expand the known spectrum of CLCN5 mutations. © 2014 Asian Pacific Society of Nephrology.

  12. A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

    Directory of Open Access Journals (Sweden)

    Garuti Rita

    2010-10-01

    Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

  13. Coffin-Siris Syndrome with obesity, macrocephaly, hepatomegaly and hyperinsulinism caused by a mutation in the ARID1B gene.

    Science.gov (United States)

    Vals, Mari-Anne; Õiglane-Shlik, Eve; Nõukas, Margit; Shor, Riina; Peet, Aleksandr; Kals, Mart; Kivistik, Paula Ann; Metspalu, Andres; Õunap, Katrin

    2014-11-01

    Coffin-Siris Syndrome (CSS, MIM 135900) is a rare genetic disorder, and mutations in ARID1B were recently shown to cause CSS. In this study, we report a novel ARID1B mutation identified by whole-exome sequencing in a patient with clinical features of CSS. We identified a novel heterozygous frameshift mutation c.1584delG in exon 2 of ARID1B (NM_020732.3) predicting a premature stop codon p.(Leu528Phefs*65). Sanger sequencing confirmed the c.1584delG mutation as a de novo in the proband and that it was not present either in her parents, half-sister or half-brother. Clinically, the patient presented with extreme obesity, macrocephaly, hepatomegaly, hyperinsulinism and polycystic ovarian syndrome (PCOS), which have previously not been described in CSS patients. We suggest that obesity, macrocephaly, hepatomegaly and/or PCOS may be added to the list of clinical features of ARID1B mutations, but further clinical reports are required to make a definite conclusion.

  14. Coffin–Siris Syndrome with obesity, macrocephaly, hepatomegaly and hyperinsulinism caused by a mutation in the ARID1B gene

    Science.gov (United States)

    Vals, Mari-Anne; Õiglane-Shlik, Eve; Nõukas, Margit; Shor, Riina; Peet, Aleksandr; Kals, Mart; Kivistik, Paula Ann; Metspalu, Andres; Õunap, Katrin

    2014-01-01

    Coffin–Siris Syndrome (CSS, MIM 135900) is a rare genetic disorder, and mutations in ARID1B were recently shown to cause CSS. In this study, we report a novel ARID1B mutation identified by whole-exome sequencing in a patient with clinical features of CSS. We identified a novel heterozygous frameshift mutation c.1584delG in exon 2 of ARID1B (NM_020732.3) predicting a premature stop codon p.(Leu528Phefs*65). Sanger sequencing confirmed the c.1584delG mutation as a de novo in the proband and that it was not present either in her parents, half-sister or half-brother. Clinically, the patient presented with extreme obesity, macrocephaly, hepatomegaly, hyperinsulinism and polycystic ovarian syndrome (PCOS), which have previously not been described in CSS patients. We suggest that obesity, macrocephaly, hepatomegaly and/or PCOS may be added to the list of clinical features of ARID1B mutations, but further clinical reports are required to make a definite conclusion. PMID:24569609

  15. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0

    Science.gov (United States)

    2010-01-01

    Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X) and a novel frameshift mutation (966_967delGA/insC) which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions. PMID:20051115

  16. Identification of a de novo mutation of SOX10 in a Chinese patient with Waardenburg syndrome type IV.

    Science.gov (United States)

    Liang, Fenghe; Zhao, Min; Fan, Lynn; Zhang, Hongyan; Shi, Yang; Han, Rui; Qu, Chunyan

    2016-12-01

    Waardenburg syndrome is a rare genetic disorder, characterized by the association of sensorineural hearing loss and pigmentation abnormalities. Four subtypes have been classified. The present study aimed to analyze the clinical feature and investigate the genetic cause for a Chinese case of Waardenburg type IV (WS4). The patient and his family members were subjected to mutation detection in the candidate gene SOX10 by Sanger sequencing. The patient has the clinical features of WS4, including sensorineural hearing loss, bright blue irides, premature graying of the hair and Hirschsprung disease. A novel heterozygous frameshift mutation, c.752_753ins7 (p.Gly252Alafs*31) in the exon 5 of SOX10 was detected in the patient, but not found in the unaffected family members and 100 normal controls. This mutation results in a premature stop codon 31 amino acid downstream. The novel mutation c.752_753ins7 (p.Gly252Alafs*31) arose de novo and was considered as the cause of WS4 in the proband. This study further characterized the molecular complexity of WS4 and provided a clinical case for genotype-phenotype correlation studies of different phenotypes caused by SOX10 mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Better plants through mutations

    International Nuclear Information System (INIS)

    1988-01-01

    This is a public relations film describing problems associated with the genetic improvement of crop plants through induced mutations. Mutations are the ultimate source of genetic variation in plants. Mutation induction is now established as a practical tool in plant breeding. The Joint FAO/IAEA Division and the IAEA's laboratory at Seibersdorf have supported research and practical implementation of mutation breeding of both seed propagated and vegetatively propagated plants. Plant biotechnology based on in vitro culture and recombinant DNA technology will make a further significant contribution to plant breeding

  18. Analysis of clinical symptoms and ABCC6 mutations in 76 Japanese patients with pseudoxanthoma elasticum.

    Science.gov (United States)

    Iwanaga, Akira; Okubo, Yumi; Yozaki, Mariko; Koike, Yuta; Kuwatsuka, Yutaka; Tomimura, Saori; Yamamoto, Yosuke; Tamura, Hiroshi; Ikeda, Satoshi; Maemura, Koji; Tsuiki, Eiko; Kitaoka, Takashi; Endo, Yuichiro; Mishima, Hiroyuki; Yoshiura, Koh-Ichiro; Ogi, Tomoo; Tanizaki, Hideaki; Wataya-Kaneda, Mari; Hattori, Tomoyasu; Utani, Atsushi

    2017-06-01

    Pseudoxanthoma elasticum (PXE) is a hereditary disease, causing calcification and degeneration of elastic fibers, which affects the skin, eye, cardiovascular systems and gastrointestinal tract. PXE is caused by mutations in the ABCC6 gene. Neither detailed nor large-scale analyses have been accomplished in Japanese patients with PXE. We, therefore, investigated clinical symptoms and ABCC6 gene mutations in 76 Japanese patients. Japanese PXE patients (n = 76) had a significantly lower incidence of vascular lesions than 505 PXE patients in the Leiden Open Variation Database (LOVD) (38.7% vs 65.1%, respectively; P = 1.34E-06); however, the incidences of the skin, eye, cardiac and gastrointestinal lesion symptoms were not significantly different. Symptom severity scores for skin, eye and vascular lesions, calculated using the Phenodex™ system, were significantly lower in Japanese PXE patients than in LOVD PXE patients. Genetic analysis revealed three nonsense, four frame-shift, one exon deletion and 13 missense mutations in ABCC6 in 73 patients; however, we were unable to detect pathogenic mutations in three patients. Frequent mutations differed between Japanese and LOVD PXE patients. In Japanese PXE patients, the top five mutations accounted for more than 60% of all pathogenic changes, suggesting the presence of founder effects. Consistent with previous reports, no obvious correlations between genotypes and phenotypes were identified in this study. In conclusion, we consider that the milder clinical phenotypes, observed even in older Japanese PXE patients, could be attributed to environmental factors such as dietary habits and lifestyle, as well as genetic background. © 2017 Japanese Dermatological Association.

  19. The mutator pathway is a feature of immunodeficiency-related lymphomas

    Science.gov (United States)

    Duval, Alex; Raphael, Martine; Brennetot, Caroline; Poirel, Helene; Buhard, Olivier; Aubry, Alban; Martin, Antoine; Krimi, Amor; Leblond, Veronique; Gabarre, Jean; Davi, Frederic; Charlotte, Frederic; Berger, Francoise; Gaidano, Gianluca; Capello, Daniela; Canioni, Danielle; Bordessoule, Dominique; Feuillard, Jean; Gaulard, Philippe; Delfau, Marie Helene; Ferlicot, Sophie; Eclache, Virginie; Prevot, Sophie; Guettier, Catherine; Lefevre, Pascale Cornillet; Adotti, Francoise; Hamelin, Richard

    2004-01-01

    The mutator phenotype caused by defects in the mismatch repair system is observed in a subset of solid neoplasms characterized by widespread microsatellite instability-high (MSI-H). It is known to be very rare in non-Hodgkin lymphomas (NHL), whereas mutator NHL is the most frequent tumor subtype in mismatch repair-deficient mice. By screening a series of 603 human NHL with specific markers of the mutator phenotype, we found here 12 MSI-H cases (12/603, 2%). Of interest, we demonstrated that this phenotype was specifically associated with immunodeficiency-related lymphomas (ID-RL), because it was observed in both posttransplant lymphoproliferative disorders (9/111, 8.1%) and HIV infection-related lymphomas (3/128, 2.3%) but not in a large series of NHL arising in the general population (0/364) (P < 0.0001). The MSI pathway is known to lead to the production of hundreds of abnormal protein neoantigens that are generated in MSI-H neoplasms by frameshift mutations of a number of genes containing coding microsatellite sequences. As expected, MSI-H ID-RL were found to harbor such genetic alterations in 12 target genes with a putative role in lymphomagenesis. The observation that the MSI-H phenotype was restricted to HIV infection-related lymphomas and posttransplant lymphoproliferative disorders suggests the existence of the highly immunogenic mutator pathway as a novel oncogenic process in lymphomagenesis whose role is favored when host immunosurveillance is reduced. Because MSI-H-positive cases were found to be either Epstein-Barr virus-positive or -negative, the mutator pathway should act synergistically or not with this other oncogenic factor, playing an important role in ID-RL. PMID:15047891

  20. Convergent Evolution of Slick Coat in Cattle through Truncation Mutations in the Prolactin Receptor

    Directory of Open Access Journals (Sweden)

    Laercio R. Porto-Neto

    2018-02-01

    Full Text Available Evolutionary adaptations are occasionally convergent solutions to the same problem. A mutation contributing to a heat tolerance adaptation in Senepol cattle, a New World breed of mostly European descent, results in the distinct phenotype known as slick, where an animal has shorter hair and lower follicle density across its coat than wild type animals. The causal variant, located in the 11th exon of prolactin receptor, produces a frameshift that results in a truncated protein. However, this mutation does not explain all cases of slick coats found in criollo breeds. Here, we obtained genome sequences from slick cattle of a geographically distinct criollo breed, namely Limonero, whose ancestors were originally brought to the Americas by the Spanish. These data were used to identify new causal alleles in the 11th exon of the prolactin receptor, two of which also encode shortened proteins that remove a highly conserved tyrosine residue. These new mutations explained almost 90% of investigated cases of animals that had slick coats, but which also did not carry the Senepol slick allele. These results demonstrate convergent evolution at the molecular level in a trait important to the adaptation of an animal to its environment.

  1. Hirschsprung disease as a yet undescribed phenotype in a patient with ARID1B mutation.

    Science.gov (United States)

    Takenouchi, Toshiki; Yoshihashi, Hiroshi; Sakaguchi, Yuri; Uehara, Tomoko; Honda, Masataka; Takahashi, Takao; Kosaki, Kenjiro; Miyama, Sahoko

    2016-12-01

    Mutations in the BAF complex (mammalian SWI/SNF complex) are responsible for Coffin-Siris syndrome, which is characterized by developmental delay, distinctive facial features, hirsutism, and hypoplasia/aplasia of the fifth finger/fingernails. Hirschsprung disease is characterized by defective stem cells in the enteric neural system, and the involvement of multiple signaling cascades has been implicated. So far, the roles of the BAF complex in the genesis of Hirschsprung disease have remained unknown. Here, we document a patient with coarse facial features, postnatal growth failure, developmental delay, epilepsy, and hypoplasia of the corpus callosum and cerebellum but without a hypoplastic fifth finger/fingernail. In addition, he had Hirschsprung disease. Exome sequencing with a gene set representing a total of 4,813 genes with known relationships to human diseases revealed a heterozygous frameshift mutation in ARID1B (c.5789delC p.Pro1930Leufs*44). The presence of a congenital cataract and Hirschsprung disease in the presently reported patient further expands the phenotypic spectrum of patients with ARID1B mutations and may suggest the potential role of the BAF complex in the pathogenesis of the enteric neural system. The present observation is in agreement with a recent study of Drosophila neuroblasts showing that the dysregulated BAF complex leads to an abnormal lineage progression of neural stem cell lineages and that Hirschsprung disease is caused by abnormal stem cell lineages in the peripheral neural tissues. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. Germline mutation in NLRP2 (NALP2 in a familial imprinting disorder (Beckwith-Wiedemann Syndrome.

    Directory of Open Access Journals (Sweden)

    Esther Meyer

    2009-03-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a fetal overgrowth and human imprinting disorder resulting from the deregulation of a number of genes, including IGF2 and CDKN1C, in the imprinted gene cluster on chromosome 11p15.5. Most cases are sporadic and result from epimutations at either of the two 11p15.5 imprinting centres (IC1 and IC2. However, rare familial cases may be associated with germline 11p15.5 deletions causing abnormal imprinting in cis. We report a family with BWS and an IC2 epimutation in which affected siblings had inherited different parental 11p15.5 alleles excluding an in cis mechanism. Using a positional-candidate gene approach, we found that the mother was homozygous for a frameshift mutation in exon 6 of NLRP2. While germline mutations in NLRP7 have previously been associated with familial hydatidiform mole, this is the first description of NLRP2 mutation in human disease and the first report of a trans mechanism for disordered imprinting in BWS. These observations are consistent with the hypothesis that NLRP2 has a previously unrecognised role in establishing or maintaining genomic imprinting in humans.

  3. Progressive retinal atrophy in Shetland sheepdog is associated with a mutation in the CNGA1 gene.

    Science.gov (United States)

    Wiik, A C; Ropstad, E O; Ekesten, B; Karlstam, L; Wade, C M; Lingaas, F

    2015-10-01

    Progressive retinal atrophy (PRA) is the collective name of a class of hereditary retinal dystrophies in the dog and is often described as the equivalent of retinitis pigmentosa in humans. PRA is characterized by visual impairment due to degeneration of the photoreceptors in the retina, usually leading to blindness. PRA has been reported in dogs from more than 100 breeds and can be genetically heterogeneous both between and within breeds. The disease can be subdivided by age at onset and rate of progression. Using genome-wide association with 15 Shetland Sheepdog (Sheltie) cases and 14 controls, we identified a novel PRA locus on CFA13 (Praw  = 8.55 × 10(-7) , Pgenome  = 1.7 × 10(-4) ). CNGA1, which is known to be involved in human cases of retinitis pigmentosa, was located within the associated region and was considered a likely candidate gene. Sequencing of this gene identified a 4-bp deletion in exon 9 (c.1752_1755delAACT), leading to a frameshift and a premature stop codon. The study indicated genetic heterogeneity as the mutation was present in all PRA-affected individuals in one large family of Shelties, whereas some other cases in the studied Sheltie population were not associated with this CNGA1 mutation. To our knowledge, this is the first report of a mutation in CNGA1 causing PRA in dogs. © 2015 Stichting International Foundation for Animal Genetics.

  4. Homozygous ARHGEF2 mutation causes intellectual disability and midbrain-hindbrain malformation.

    Directory of Open Access Journals (Sweden)

    Ethiraj Ravindran

    2017-04-01

    Full Text Available Mid-hindbrain malformations can occur during embryogenesis through a disturbance of transient and localized gene expression patterns within these distinct brain structures. Rho guanine nucleotide exchange factor (ARHGEF family members are key for controlling the spatiotemporal activation of Rho GTPase, to modulate cytoskeleton dynamics, cell division, and cell migration. We identified, by means of whole exome sequencing, a homozygous frameshift mutation in the ARHGEF2 as a cause of intellectual disability, a midbrain-hindbrain malformation, and mild microcephaly in a consanguineous pedigree of Kurdish-Turkish descent. We show that loss of ARHGEF2 perturbs progenitor cell differentiation and that this is associated with a shift of mitotic spindle plane orientation, putatively favoring more symmetric divisions. The ARHGEF2 mutation leads to reduction in the activation of the RhoA/ROCK/MLC pathway crucial for cell migration. We demonstrate that the human brain malformation is recapitulated in Arhgef2 mutant mice and identify an aberrant migration of distinct components of the precerebellar system as a pathomechanism underlying the midbrain-hindbrain phenotype. Our results highlight the crucial function of ARHGEF2 in human brain development and identify a mutation in ARHGEF2 as novel cause of a neurodevelopmental disorder.

  5. De novo mutations of KIAA2022 in females cause intellectual disability and intractable epilepsy

    Science.gov (United States)

    de Lange, Iris M; Helbig, Katherine L; Weckhuysen, Sarah; Møller, Rikke S; Velinov, Milen; Dolzhanskaya, Natalia; Marsh, Eric; Helbig, Ingo; Devinsky, Orrin; Tang, Sha; Mefford, Heather C; Myers, Candace T; van Paesschen, Wim; Striano, Pasquale; van Gassen, Koen; van Kempen, Marjan; de Kovel, Carolien G F; Piard, Juliette; Minassian, Berge A; Nezarati, Marjan M; Pessoa, André; Jacquette, Aurelia; Maher, Bridget; Balestrini, Simona; Sisodiya, Sanjay; Warde, Marie Therese Abi; De St Martin, Anne; Chelly, Jamel; van ‘t Slot, Ruben; Van Maldergem, Lionel; Brilstra, Eva H; Koeleman, Bobby P C

    2016-01-01

    Background Mutations in the KIAA2022 gene have been reported in male patients with X-linked intellectual disability, and related female carriers were unaffected. Here, we report 14 female patients who carry a heterozygous de novo KIAA2022 mutation and share a phenotype characterised by intellectual disability and epilepsy. Methods Reported females were selected for genetic testing because of substantial developmental problems and/or epilepsy. X-inactivation and expression studies were performed when possible. Results All mutations were predicted to result in a frameshift or premature stop. 12 out of 14 patients had intractable epilepsy with myoclonic and/or absence seizures, and generalised in 11. Thirteen patients had mild to severe intellectual disability. This female phenotype partially overlaps with the reported male phenotype which consists of more severe intellectual disability, microcephaly, growth retardation, facial dysmorphisms and, less frequently, epilepsy. One female patient showed completely skewed X-inactivation, complete absence of RNA expression in blood and a phenotype similar to male patients. In the six other tested patients, X-inactivation was random, confirmed by a non-significant twofold to threefold decrease of RNA expression in blood, consistent with the expected mosaicism between cells expressing mutant or normal KIAA2022 alleles. Conclusions Heterozygous loss of KIAA2022 expression is a cause of intellectual disability in females. Compared with its hemizygous male counterpart, the heterozygous female disease has less severe intellectual disability, but is more often associated with a severe and intractable myoclonic epilepsy. PMID:27358180

  6. Novel mutations in the connexin 32 gene associated with X-linked Charcot-Marie-Tooth disease

    Energy Technology Data Exchange (ETDEWEB)

    Tan, C.; Ainsworth, P. [Victoria Hospital, Ontario (Canada)]|[Childrens Hospital of Western Ontario (Canada)

    1994-09-01

    Charcot-Marie-Tooth disease is a pathologically and genetically hetergenous group of disorders that cause a progressive neuropathy, defined pathologically by degeneration of the myelin (CMT 1) of the axon (CMT 2) of the peripheral nerves. An X-linked type of the demyelinating form of this disorder (CMT X) has recently been linked to mutations in the connexin 32 (Cx32) gene, which codes for a 284 amino acid gap junction protein found in myelinated peripheral nerve. To date some 7 different mutations in this gene have been identified as being responsible for CMT X. The majority of these predict nonconservative amino acid substitutions, while one is a frameshift mutation which predicts a premature stop at codon 21. We report the results of molecular studies on three further local CMT X kindreds. The Cx32 gene was amplified by PCR in three overlapping fragments 300-450 bp in length using leukocyte-derived DNA as template. These were either sequenced directly using a deaza dGTP sequencing protocol, or were cloned and sequenced using a TA vector. In two of the kindreds the affected members carried a point mutation which was predicted to effect a non-conservative amino acid change within the first transmembrane domain. Both of these mutations caused a restriction site alteration (the loss of an Nla III and the creation of a Pvu II, respectively), and the former mutation was observed to segregate with the clinicial phenotype in affected family members. Affected members of the third kindred, which was a very large multigenerational family that had been extensively studied previously, were shown to carry a point mutation predicted to cause a premature truncation of the Cx32 gene product in the intracellular carboxy terminus. This mutation obliterated an Rsa I site which allowed a rapid screen of several other family members.

  7. Reduced lentivirus susceptibility in sheep with TMEM154 mutations.

    Science.gov (United States)

    Heaton, Michael P; Clawson, Michael L; Chitko-Mckown, Carol G; Leymaster, Kreg A; Smith, Timothy P L; Harhay, Gregory P; White, Stephen N; Herrmann-Hoesing, Lynn M; Mousel, Michelle R; Lewis, Gregory S; Kalbfleisch, Theodore S; Keen, James E; Laegreid, William W

    2012-01-01

    Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10(-9)). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection.

  8. A frameshift in the coding region of a novel tomato class I basic chitinase gene makes it a pseudogene with a functional wound-responsive promoter.

    Science.gov (United States)

    Baykal, Ulku; Moyne, Anne-Laure; Tuzun, Sadik

    2006-07-05

    A putative class I basic chitinase gene, assigned as psiBCH, was cloned from a tomato breeding line NC 24E. The gene contains a coding region with two introns. The predicted psiBCH open reading frame (ORF) is 971 bp and exhibits 81-88% identity at the nucleotide level with known class I basic chitinase genes from the Solanaceae family. However, the presence of a stop codon caused by a frameshift in the ORF of psiBCH makes it unusual among the other class I plant basic chitinases. This stop codon might be involved in the lower accumulation of fully spliced psiBCH RNA caused by nonsense-mediated decay (NMD), which is an RNA surveillance system universally found in eukaryotes. Sequence analysis of the 1883-bp 5'-flanking region of the psiBCH gene revealed the presence of potential wound-response promoter elements. To study the transcriptional regulation of the psiBCH gene, its 5'-flanking region containing the putative promoter was fused to the gus reporter gene and introduced into the tobacco genome via Agrobacterium tumefaciens-mediated transformation. Transgenic plants were functionally assayed for beta-glucuronidase activity. The psiBCH promoter drives the reporter gene expression in response to wounding stimuli. psiBCH promoter-GUS analysis indicates that wound-response of the tobacco transgene was rapid and localized in the wounded area following mechanical wounding. Therefore, our results suggest that the psiBCH promoter can provide targeted expression of genes, such as protease inhibitors in response to pest attack.

  9. Whole Exome Sequencing Identified a Novel Heterozygous Mutation in HMBS Gene in a Chinese Patient With Acute Intermittent Porphyria With Rare Type of Mild Anemia

    Directory of Open Access Journals (Sweden)

    Yongjiang Zheng

    2018-04-01

    Full Text Available Acute intermittent porphyria (AIP is a rare hereditary metabolic disease with an autosomal dominant mode of inheritance. Germline mutations of HMBS gene causes AIP. Mutation of HMBS gene results into the partial deficiency of the heme biosynthetic enzyme hydroxymethylbilane synthase. AIP is clinically manifested with abdominal pain, vomiting, and neurological complaints. Additionally, an extreme phenotypic heterogeneity has been reported in AIP patients with mutations in HMBS gene. Here, we investigated a Chinese patient with AIP. The proband is a 28-year-old Chinese male manifested with severe stomach ache, constipation, nausea and depression. Proband’s father and mother is normal. Proband’s blood sample was collected and genomic DNA was extracted. Whole exome sequencing and Sanger sequencing identified a heterozygous novel single nucleotide deletion (c.809delC in exon 12 of HMBS gene in the proband. This mutation leads to frameshift followed by formation of a truncated (p.Ala270Valfs∗2 HMBS protein with 272 amino acids comparing with the wild type HMBS protein of 361 amino acids. This mutation has not been found in proband’s unaffected parents as well as in 100 healthy normal control. According to the variant interpretation guidelines of American College of Medical Genetics and Genomics (ACMG, this variant is classified as “likely pathogenic” variant. Our findings expand the mutational spectra of HMBS gene related AIP which are significant for screening and genetic diagnosis for AIP.

  10. Differential regulation of hepatitis B virus core protein expression and genome replication by a small upstream open reading frame and naturally occurring mutations in the precore region.

    Science.gov (United States)

    Zong, Li; Qin, Yanli; Jia, Haodi; Ye, Lei; Wang, Yongxiang; Zhang, Jiming; Wands, Jack R; Tong, Shuping; Li, Jisu

    2017-05-01

    Hepatitis B virus (HBV) transcribes two subsets of 3.5-kb RNAs: precore RNA for hepatitis B e antigen (HBeAg) expression, and pregenomic RNA for core and P protein translation as well as genome replication. HBeAg expression could be prevented by mutations in the precore region, while an upstream open reading frame (uORF) has been proposed as a negative regulator of core protein translation. We employed replication competent HBV DNA constructs and transient transfection experiments in Huh7 cells to verify the uORF effect and to explore the alternative function of precore RNA. Optimized Kozak sequence for the uORF or extra ATG codons as present in some HBV genotypes reduced core protein expression. G1896A nonsense mutation promoted more efficient core protein expression than mutated precore ATG, while a +1 frameshift mutation was ineffective. In conclusion, various HBeAg-negative precore mutations and mutations affecting uORF differentially regulate core protein expression and genome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Coffin-Siris syndrome with café-au-lait spots, obesity and hyperinsulinism caused by a mutation in the ARID1B gene.

    Science.gov (United States)

    Sonmez, Fatma Mujgan; Uctepe, Eyyup; Gunduz, Mehmet; Gormez, Zeliha; Erpolat, Seval; Oznur, Murat; Sagiroglu, Mahmut Samil; Demirci, Huseyin; Gunduz, Esra

    2016-08-01

    Coffin-Siris syndrome (CSS) (MIM 135900) is characterized by developmental delay, severe speech impairment, distinctive facial features, hypertrichosis, aplasia or hypoplasia of the distal phalanx or nail of the fifth digit and agenesis of the corpus callosum. Recently, it was shown that mutations in the ARID1B gene are the main cause of CSS, accounting for 76% of identified mutations. Here, we report a 15 year-old female patient who was admitted to our clinic with seizures, speech problems, dysmorphic features, bilaterally big, large thumb, café-au-lait (CAL) spots, obesity and hyperinsulinism. First, the patient was thought to have an association of neurofibromatosis and Rubinstein Taybi syndrome. Because of the large size of the NF1 gene for neurofibromatosis and CREBBP gene for Rubinstein Taybi syndrome, whole exome sequence analysis (WES) was conducted and a novel ARID1B mutation was identified. The proband WES test identified a novel heterozygous frameshift mutation c.3394_3395insTA in exon 13 of ARID1B (NM_017519.2) predicting a premature stop codon p.(Tyr1132Leufs*67). Sanger sequencing confirmed the heterozygous c.3394_3395insTA mutation in the proband and that it was not present in her parents indicating de novo mutation. Further investigation and new cases will help to understand this phenomenon better.

  12. Mutations in fetal genes involved in innate immunity and host defense against microbes increase risk of preterm premature rupture of membranes (PPROM).

    Science.gov (United States)

    Modi, Bhavi P; Teves, Maria E; Pearson, Laurel N; Parikh, Hardik I; Haymond-Thornburg, Hannah; Tucker, John L; Chaemsaithong, Piya; Gomez-Lopez, Nardhy; York, Timothy P; Romero, Roberto; Strauss, Jerome F

    2017-11-01

    Twin studies have revealed a significant contribution of the fetal genome to risk of preterm birth. Preterm premature rupture of membranes (PPROM) is the leading identifiable cause of preterm delivery. Infection and inflammation of the fetal membranes is commonly found associated with PPROM. We carried out whole exome sequencing (WES) of genomic DNA from neonates born of African-American mothers whose pregnancies were complicated by PPROM (76) or were normal term pregnancies (N = 43) to identify mutations in 35 candidate genes involved in innate immunity and host defenses against microbes. Targeted genotyping of mutations in the candidates discovered by WES was conducted on an additional 188 PPROM cases and 175 controls. We identified rare heterozygous nonsense and frameshift mutations in several of the candidate genes, including CARD6, CARD8, DEFB1, FUT2, MBL2, NLP10, NLRP12, and NOD2. We discovered that some mutations (CARD6, DEFB1, FUT2, MBL2, NLRP10, NOD2) were present only in PPROM cases. We conclude that rare damaging mutations in innate immunity and host defense genes, the majority being heterozygous, are more frequent in neonates born of pregnancies complicated by PPROM. These findings suggest that the risk of preterm birth in African-Americans may be conferred by mutations in multiple genes encoding proteins involved in dampening the innate immune response or protecting the host against microbial infection and microbial products. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  13. Inherited germline TP53 mutation encodes a protein with an aberrant C-terminal motif in a case of pediatric adrenocortical tumor.

    Science.gov (United States)

    Pinto, Emilia M; Ribeiro, Raul C; Kletter, Gad B; Lawrence, John P; Jenkins, Jesse J; Wang, Jinling; Shurtleff, Sheila; McGregor, Lisa; Kriwacki, Richard W; Zambetti, Gerard P

    2011-03-01

    Childhood adrenocortical tumor (ACT), a very rare malignancy, has an annual worldwide incidence of about 0.3 per million children younger than 15 years. The association between inherited germline mutations of the TP53 gene and an increased predisposition to ACT was described in the context of the Li-Fraumeni syndrome. In fact, about two-thirds of children with ACT have a TP53 mutation. However, less than 10% of pediatric ACT cases occur in Li-Fraumeni syndrome, suggesting that inherited low-penetrance TP53 mutations play an important role in pediatric adrenal cortex tumorigenesis. We identified a novel inherited germline TP53 mutation affecting the acceptor splice site at intron 10 in a child with an ACT and no family history of cancer. The lack of family history of cancer and previous information about the carcinogenic potential of the mutation led us to further characterize it. Bioinformatics analysis showed that the non-natural and highly hydrophobic C-terminal segment of the frame-shifted mutant p53 protein may disrupt its tumor suppressor function by causing misfolding and aggregation. Our findings highlight the clinical and genetic counseling dilemmas that arise when an inherited TP53 mutation is found in a child with ACT without relatives with Li-Fraumeni-component tumors.

  14. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  15. CDKL5 gene status in female patients with epilepsy and Rett-like features: two new mutations in the catalytic domain

    Directory of Open Access Journals (Sweden)

    Maortua Hiart

    2012-08-01

    Full Text Available Abstract Background Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5 located in the Xp22 region have been shown to cause a subset of atypical Rett syndrome with infantile spasms or early seizures starting in the first postnatal months. Methods We performed mutation screening of CDKL5 in 60 female patients who had been identified as negative for the methyl CpG-binding protein 2 gene (MECP2 mutations, but who had current or past epilepsy, regardless of the age of onset, type, and severity. All the exons in the CDKL5 gene and their neighbouring sequences were examined, and CDKL5 rearrangements were studied by multiplex ligation-dependent probe amplification (MLPA. Results Six previously unidentified DNA changes were detected, two of which were disease-causing mutations in the catalytic domain: a frameshift mutation (c.509_510insGT; p.Glu170GlyfsX36 and a complete deletion of exon 10. Both were found in patients with seizures that started in the first month of life. Conclusions This study demonstrated the importance of CDKL5 mutations as etiological factors in neurodevelopmental disorders, and indicated that a thorough analysis of the CDKL5 gene sequence and its rearrangements should be considered in females with Rett syndrome-like phenotypes, severe encephalopathy and epilepsy with onset before 5 months of age. This study also confirmed the usefulness of MLPA as a diagnostic screening method for use in clinical practice.

  16. Phenotypic characterization of an older adult male with late-onset epilepsy and a novel mutation in ASXL3 shows overlap with the associated Bainbridge-Ropers syndrome

    Directory of Open Access Journals (Sweden)

    Verhoeven W

    2018-03-01

    Full Text Available Willem Verhoeven,1,2 Jos Egger,1,3 Emmy Räkers,4 Arjen van Erkelens,5 Rolph Pfundt,5 Marjolein H Willemsen5 1Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Department of Psychiatry, Erasmus University Medical Centre, Rotterdam, the Netherlands; 3Donders Institute for Brain, Cognition and Behaviour, Radboud University, Nijmegen, the Netherlands; 4ASVZ, Centre for People with Intellectual Disabilities, Sliedrecht, the Netherlands; 5Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the Netherlands Abstract: The additional sex combs like 3 gene is considered to be causative for the rare Bainbridge-Ropers syndrome (BRPS, which is characterized by severe intellectual disability, neonatal hypotonia, nearly absent development of speech and language as well as several facial dysmorphisms. Apart from disruptive autistiform behaviors, sleep disturbances and epileptic phenomena may be present. Here, a 47-year-old severely intellectually disabled male is described in whom exome sequencing disclosed a novel heterozygous frameshift mutation in the ASXL3 gene leading to a premature stopcodon in the last part of the last exon. Mutations in this very end 3' of the gene have not been reported before in BRPS. The phenotypical presentation of the patient including partially therapy-resistant epilepsy starting in later adulthood shows overlap with BRPS, and it was therefore concluded that the phenotype is likely explained by the identified mutation in ASXL3. Keywords: Bainbridge-Ropers syndrome, ASLX3, frameshift mutation, epilepsy, intellectual disability, array analysis, whole exome sequencing, autism spectrum disorder

  17. Spontaneous mutations of the UDP-glucose:flavonoid 3-O-glucosyltransferase gene confers pale- and dull-colored flowers in the Japanese and common morning glories.

    Science.gov (United States)

    Morita, Yasumasa; Ishiguro, Kanako; Tanaka, Yoshikazu; Iida, Shigeru; Hoshino, Atsushi

    2015-09-01

    UDP-glucose:flavonoid 3- O -glucosyltransferase is essential for maintaining proper production quantity, acylation, and glucosylation of anthocyanin, and defects cause pale and dull flower pigmentation in morning glories. The Japanese (Ipomoea nil) and the common (I. purpurea) morning glory display bright blue and dark purple flowers, respectively. These flowers contain acylated and glucosylated anthocyanin pigments, and a number of flower color mutants have been isolated in I. nil. Of these, the duskish mutants of I. nil produce pale- and dull-colored flowers. We found that the Duskish gene encodes UDP-glucose:flavonoid 3-O-glucosyltransferase (3GT). The duskish-1 mutation is a frameshift mutation caused by a 4-bp insertion, and duskish-2 is an insertion of a DNA transposon, Tpn10, at 1.3 kb upstream of the 3GT start codon. In the duskish-2 mutant, excision of Tpn10 is responsible for restoration of the expression of the 3GT gene. The recombinant 3GT protein displays expected 3GT enzymatic activities to catalyze 3-O-glucosylation of anthocyanidins in vitro. Anthocyanin analysis of a duskish-2 mutant and its germinal revertant showing pale and normal pigmented flowers, respectively, revealed that the mutation caused around 80 % reduction of anthocyanin accumulation. We further characterized two I. purpurea mutants showing pale brownish-red flowers, and found that they carry the same frameshift mutation in the 3GT gene. Most of the flower anthocyanins in the mutants were previously found to be anthocyanidin 3-O-glucosides lacking several caffeic acid and glucose moieties that are attached to the anthocyanins in the wild-type plants. These results indicated that 3GT is essential not only for production, but also for proper acylation and glucosylation, of anthocyanin in the morning glories.

  18. Capsule loss or death: the position of mutations among capsule genes sways the destiny of Streptococcus suis.

    Science.gov (United States)

    Lakkitjaroen, Nattakan; Takamatsu, Daisuke; Okura, Masatoshi; Sato, Masumi; Osaki, Makoto; Sekizaki, Tsutomu

    2014-05-01

    Streptococcus suis, an emerging zoonotic pathogen, is responsible for various diseases in swine and humans. Most S. suis strains from clinical cases possess a group of capsular polysaccharide synthesis (cps) genes and phenotypically express capsular polysaccharides (CPs). Although CPs are considered to be an important virulence factor, our previous study showed that many S. suis isolates from porcine endocarditis lost their CPs, and some of these unencapsulated isolates had large insertions or deletions in the cps gene clusters. We further investigated 25 endocarditis isolates with no obvious genetic alterations to elucidate the unencapsulation mechanisms and found that a single-nucleotide substitution and frameshift mutation in two glycosyltransferase genes (cps2E and cps2F) were the main causes of the capsule loss. Moreover, mutations in the genes involved in side-chain formation (cps2J and cps2N), polymerase (cps2I), and flippase (cps2O) appeared to be lethal; however, these lethal effects were relieved by mutations in the cps2EF region. As unencapsulation and even the death of individual cells have recently been suggested to be beneficial to the pathogenesis of infections, the results of the present study provide a further insight into understanding the biological significance of cps mutations during the course of S. suis infections. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  19. Whole Exome Sequencing for a Patient with Rubinstein-Taybi Syndrome Reveals de Novo Variants besides an Overt CREBBP Mutation

    Directory of Open Access Journals (Sweden)

    Hee Jeong Yoo

    2015-03-01

    Full Text Available Rubinstein-Taybi syndrome (RSTS is a rare condition with a prevalence of 1 in 125,000–720,000 births and characterized by clinical features that include facial, dental, and limb dysmorphology and growth retardation. Most cases of RSTS occur sporadically and are caused by de novo mutations. Cytogenetic or molecular abnormalities are detected in only 55% of RSTS cases. Previous genetic studies have yielded inconsistent results due to the variety of methods used for genetic analysis. The purpose of this study was to use whole exome sequencing (WES to evaluate the genetic causes of RSTS in a young girl presenting with an Autism phenotype. We used the Autism diagnostic observation schedule (ADOS and Autism diagnostic interview revised (ADI-R to confirm her diagnosis of Autism. In addition, various questionnaires were used to evaluate other psychiatric features. We used WES to analyze the DNA sequences of the patient and her parents and to search for de novo variants. The patient showed all the typical features of Autism, WES revealed a de novo frameshift mutation in CREBBP and de novo sequence variants in TNC and IGFALS genes. Mutations in the CREBBP gene have been extensively reported in RSTS patients, while potential missense mutations in TNC and IGFALS genes have not previously been associated with RSTS. The TNC and IGFALS genes are involved in central nervous system development and growth. It is possible for patients with RSTS to have additional de novo variants that could account for previously unexplained phenotypes.

  20. Structure-based analysis of five novel disease-causing mutations in 21-hydroxylase-deficient patients.

    Directory of Open Access Journals (Sweden)

    Carolina Minutolo

    2011-01-01

    Full Text Available Congenital adrenal hyperplasia (CAH due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism, and accounts for 90-95% of CAH cases. The affected enzyme, P450C21, is encoded by the CYP21A2 gene, located together with a 98% nucleotide sequence identity CYP21A1P pseudogene, on chromosome 6p21.3. Even though most patients carry CYP21A1P-derived mutations, an increasing number of novel and rare mutations in disease causing alleles were found in the last years. In the present work, we describe five CYP21A2 novel mutations, p.R132C, p.149C, p.M283V, p.E431K and a frameshift g.2511_2512delGG, in four non-classical and one salt wasting patients from Argentina. All novel point mutations are located in CYP21 protein residues that are conserved throughout mammalian species, and none of them were found in control individuals. The putative pathogenic mechanisms of the novel variants were analyzed in silico. A three-dimensional CYP21 structure was generated by homology modeling and the protein design algorithm FoldX was used to calculate changes in stability of CYP21A2 protein. Our analysis revealed changes in protein stability or in the surface charge of the mutant enzymes, which could be related to the clinical manifestation found in patients.

  1. A novel 5' ATRX mutation with splicing consequences in acquired alpha thalassemia-myelodysplastic syndrome.

    Science.gov (United States)

    Nelson, Maria E; Thurmes, Paul J; Hoyer, James D; Steensma, David P

    2005-11-01

    Acquired alpha thalassemia (hemoglobin H (HbH) disease) is a rare complication of neoplastic chronic myeloid disorders, especially myelodysplastic syndrome. Acquired HbH has recently been associated with mutations in an X-linked gene, ATRX, previously linked to inherited ATR-X syndrome (alpha thalassemia-retardation-X linked). A Swiss man with chronic myelomonocytic leukemia complicated by various autoimmune disorders and by strikingly microcytic, hypochromic anemia was analyzed for the presence of acquired HbH. After HbH detection, we sought an underlying genetic cause. We used denaturing high-performance liquid chromatography to screen for an ATRX mutation, and measured ATRX expression by reverse transcriptase polymerase chain reaction. The patient had 50% HbH-containing cells on supravital staining. Marrow karyotype and the alpha globin cluster were normal. A clonally-restricted ATRX point mutation was detected in the conserved splice donor motif in intron 4 (IVS 4 +2 T-->C). Plasmid vector cloning of patient ATRX cDNA demonstrated both exon 4 skipping and partial intron retention with activation of a cryptic splice site, both outcomes resulting in frameshifts with premature stop codon generation in exon 5 and near-decimation of ATRX expression in myeloid cells. Normal exon 6 alternative splicing was retained. Intronic ATRX mutations with splicing consequences, uncommon in inherited ATR-X syndrome because of their devastating effect on expression of functional protein, should be routinely sought when undertaking molecular analysis of acquired HbH disease. Detection of an acquired ATRX mutation can help support clonality in karyotypically normal ambiguous myeloid disorders with HbH.

  2. A mutational comparison of adult and adolescent and young adult (AYA) colon cancer.

    Science.gov (United States)

    Tricoli, James V; Boardman, Lisa A; Patidar, Rajesh; Sindiri, Sivasish; Jang, Jin S; Walsh, William D; McGregor, Paul M; Camalier, Corinne E; Mehaffey, Michele G; Furman, Wayne L; Bahrami, Armita; Williams, P Mickey; Lih, Chih-Jian; Conley, Barbara A; Khan, Javed

    2018-03-01

    It is possible that the relative lack of progress in treatment outcomes among adolescent and young adult (AYA) patients with cancer is caused by a difference in disease biology compared with the corresponding diseases in younger and older individuals. There is evidence that colon cancer is more aggressive and has a poorer prognosis in AYA patients than in older adult patients. To further understand the molecular basis for this difference, whole-exome sequencing was conducted on a cohort of 30 adult, 30 AYA, and 2 pediatric colon cancers. A statistically significant difference in mutational frequency was observed between AYA and adult samples in 43 genes, including ROBO1, MYC binding protein 2 (MYCBP2), breast cancer 2 (early onset) (BRCA2), MAP3K3, MCPH1, RASGRP3, PTCH1, RAD9B, CTNND1, ATM, NF1; KIT, PTEN, and FBXW7. Many of these mutations were nonsynonymous, missense, stop-gain, or frameshift mutations that were damaging. Next, RNA sequencing was performed on a subset of the samples to confirm the mutations identified by exome sequencing. This confirmation study verified the presence of a significantly greater frequency of damaging mutations in AYA compared with adult colon cancers for 5 of the 43 genes (MYCBP2, BRCA2, PHLPP1, TOPORS, and ATR). The current results provide the rationale for a more comprehensive study with a larger sample set and experimental validation of the functional impact of the identified variants along with their contribution to the biologic and clinical characteristics of AYA colon cancer. Cancer 2018;124:1070-82. © 2017 American Cancer Society. © 2017 American Cancer Society.

  3. Mutational analyses on X-linked adrenoleukodystrophy reveal a novel cryptic splicing and three missense mutations in the ABCD1 gene.

    Science.gov (United States)

    Hung, Kun-Long; Wang, Jinn-Shyan; Keng, Wee Teik; Chen, Hui-Ju; Liang, Jao-Shwann; Ngu, Lock Hock; Lu, Jyh-Feng

    2013-09-01

    X-linked adrenoleukodystrophy is caused by a defective peroxisomal membrane transporter, ABCD1, responsible for transporting very-long-chain fatty acid substrate into peroxisomes for degradation. The main biochemical defect, which is also one of the major diagnostic hallmarks, of X-linked adrenoleukodystrophy is the accumulation of saturated very-long-chain fatty acids in all tissues and body fluids. Direct and reverse-transcribed polymerase chain reactions followed by DNA sequencing-based mutational analyses were performed on one Taiwanese and three Malaysian X-linked adrenoleukodystrophy families. A novel splicing donor site mutation (c.1272+1g>a) was identified in a Taiwanese X-linked adrenoleukodystrophy patient, resulting in a deletion of 121 bp and a premature stop codon (p.Val425fs*92) in messenger-RNA transcript. This deletion is caused by the activation of a cryptic splicing donor site in exon 4 of the ABCD1 gene, which is consistent with the prediction by several online algorithms. In addition, three previously described missense mutations (c.965T>C, c.1978C>T, and c.2006A>G), leading to aberrant ABCD1 of p.Leu322Pro, p.Arg660Trp, and p.His669Arg, were also identified in Malaysian probands. This is the first report to unveil unequivocally that cryptic splicing-induced aberrant messenger-RNA carrying an internal frameshift deletion results from an intronic mutation in the ABCD1 gene. Furthermore, a polymorphism in intron 9 (c.1992-32c/t; refSNP: rs4898368) of the ABCD1 gene was commonly observed in both Taiwanese and Malaysian populations. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Induced mutation of soy by ionization mutation

    Energy Technology Data Exchange (ETDEWEB)

    Li, C.L.; Hsu, H.L.

    1975-09-01

    This article presents the results of experiments dealing with how 14 different doses of three types of ionization irradiation-roentgen rays, /sup 60/Co gamma rays, and thermal neutrons affect mutation of 14 types of soy beans and their hybrids. It was learned that with an increased dose the coefficient of seed germination decreases, the cotyledon becomes increasingly thicker, shoots develop more and more slowly, various deformities arise in the stalk, and fertility decreases. As far as M/sub 2/ mutation is concerned, a great variety has been discovered with regard to the height of the stem, the leaf formation, the color of the bloom, the color of the edge, the characteristics of the pod, the size of the seed and the color of the cicatrix. At the same time some specific characteristics having an important economic significance are being revealed, as for example, dwarf stems, the ability to withstand lodging, great pod density, increased inflorescence and short sprouts.

  5. AICA-ribosiduria: a novel, neurologically devastating inborn error of purine biosynthesis caused by mutation of ATIC.

    Science.gov (United States)

    Marie, Sandrine; Heron, Benedicte; Bitoun, Pierre; Timmerman, Therese; Van Den Berghe, Georges; Vincent, Marie-Francoise

    2004-06-01

    In a female infant with dysmorphic features, severe neurological defects, and congenital blindness, a positive urinary Bratton-Marshall test led to identification of a massive excretion of 5-amino-4-imidazolecarboxamide (AICA)-riboside, the dephosphorylated counterpart of AICAR (also termed "ZMP"), an intermediate of de novo purine biosynthesis. ZMP and its di- and triphosphate accumulated in the patient's erythrocytes. Incubation of her fibroblasts with AICA-riboside led to accumulation of AICAR, not observed in control cells, suggesting impairment of the final steps of purine biosynthesis, catalyzed by the bifunctional enzyme AICAR transformylase/IMP cyclohydrolase (ATIC). AICAR transformylase was profoundly deficient, whereas the IMP cyclohydrolase level was 40% of normal. Sequencing of ATIC showed a K426R change in the transformylase region in one allele and a frameshift in the other. Recombinant protein carrying mutation K426R completely lacks AICAR transformylase activity.

  6. Mutations in GABRB3

    DEFF Research Database (Denmark)

    Møller, Rikke S; Wuttke, Thomas V; Helbig, Ingo

    2017-01-01

    OBJECTIVE: To examine the role of mutations in GABRB3 encoding the β3 subunit of the GABAA receptor in individual patients with epilepsy with regard to causality, the spectrum of genetic variants, their pathophysiology, and associated phenotypes. METHODS: We performed massive parallel sequencing...... of GABRB3 in 416 patients with a range of epileptic encephalopathies and childhood-onset epilepsies and recruited additional patients with epilepsy with GABRB3 mutations from other research and diagnostic programs. RESULTS: We identified 22 patients with heterozygous mutations in GABRB3, including 3...... probands from multiplex families. The phenotypic spectrum of the mutation carriers ranged from simple febrile seizures, genetic epilepsies with febrile seizures plus, and epilepsy with myoclonic-atonic seizures to West syndrome and other types of severe, early-onset epileptic encephalopathies...

  7. Loss-of-Function Mutations in SERPINB8 Linked to Exfoliative Ichthyosis with Impaired Mechanical Stability of Intercellular Adhesions.

    Science.gov (United States)

    Pigors, Manuela; Sarig, Ofer; Heinz, Lisa; Plagnol, Vincent; Fischer, Judith; Mohamad, Janan; Malchin, Natalia; Rajpopat, Shefali; Kharfi, Monia; Lestringant, Giles G; Sprecher, Eli; Kelsell, David P; Blaydon, Diana C

    2016-08-04

    SERPINS comprise a large and functionally diverse family of serine protease inhibitors. Here, we report three unrelated families with loss-of-function mutations in SERPINB8 in association with an autosomal-recessive form of exfoliative ichthyosis. Whole-exome sequencing of affected individuals from a consanguineous Tunisian family and a large Israeli family revealed a homozygous frameshift mutation, c.947delA (p.Lys316Serfs(∗)90), and a nonsense mutation, c.850C>T (p.Arg284(∗)), respectively. These two mutations are located in the last exon of SERPINB8 and, hence, would not be expected to lead to nonsense-mediated decay of the mRNA; nonetheless, both mutations are predicted to lead to loss of the reactive site loop of SERPINB8, which is crucial for forming the SERPINB8-protease complex. Using Sanger sequencing, a homozygous missense mutation, c.2T>C (p.Met1?), predicted to result in an N-terminal truncated protein, was identified in an additional family from UAE. Histological analysis of a skin biopsy from an individual homozygous for the variant p.Arg284(∗) showed disadhesion of keratinocytes in the lower epidermal layers plus decreased SERPINB8 levels compared to control. In vitro studies utilizing siRNA-mediated knockdown of SERPINB8 in keratinocytes demonstrated that in the absence of the protein, there is a cell-cell adhesion defect, particularly when cells are subjected to mechanical stress. In addition, immunoblotting and immunostaining revealed an upregulation of desmosomal proteins. In conclusion, we report mutations in SERPINB8 that are associated with exfoliative ichthyosis and provide evidence that SERPINB8 contributes to the mechanical stability of intercellular adhesions in the epidermis. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  8. Novel mutations in the BRCA1 and BRCA2 genes in Iranian women with early-onset breast cancer

    International Nuclear Information System (INIS)

    Yassaee, Vahid R; Zeinali, Sirous; Harirchi, Iraj; Jarvandi, Soghra; Mohagheghi, Mohammad A; Hornby, David P; Dalton, Ann

    2002-01-01

    Breast cancer is the most common female malignancy and a major cause of death in middle-aged women. So far, germline mutations in the BRCA1 and BRCA2 genes in patients with early-onset breast and/or ovarian cancer have not been identified within the Iranian population. With the collaboration of two main centres for cancer in Iran, we obtained clinical information, family history and peripheral blood from 83 women under the age of 45 with early-onset breast cancer for scanning of germline mutations in the BRCA1 and BRCA2 genes. We analysed BRCA1 exons 11 and BRCA2 exons 10 and 11 by the protein truncation test, and BRCA1 exons 2, 3, 5, 13 and 20 and BRCA2 exons 9, 17, 18 and 23 with the single-strand conformation polymorphism assay on genomic DNA amplified by polymerase chain reaction. Ten sequence variants were identified: five frameshifts (putative mutations – four novel); three missense changes of unknown significance and two polymorphisms, one seen commonly in both Iranian and British populations. Identification of these novel mutations suggests that any given population should develop a mutation database for its programme of breast cancer screening. The pattern of mutations seen in the BRCA genes seems not to differ from other populations studied. Early-onset breast cancer (less than 45 years) and a limited family history is sufficient to justify mutation screening with a detection rate of over 25% in this group, whereas sporadic early-onset breast cancer (detection rate less than 5%) is unlikely to be cost-effective

  9. Homozygosity Mapping Reveals Mutations of GRXCR1 as a Cause of Autosomal-Recessive Nonsyndromic Hearing Impairment

    Science.gov (United States)

    Schraders, Margit; Lee, Kwanghyuk; Oostrik, Jaap; Huygen, Patrick L.M.; Ali, Ghazanfar; Hoefsloot, Lies H.; Veltman, Joris A.; Cremers, Frans P.M.; Basit, Sulman; Ansar, Muhammad; Cremers, Cor W.R.J.; Kunst, Henricus P.M.; Ahmad, Wasim; Admiraal, Ronald J.C.; Leal, Suzanne M.; Kremer, Hannie

    2010-01-01

    We identified overlapping homozygous regions within the DFNB25 locus in two Dutch and ten Pakistani families with sensorineural autosomal-recessive nonsyndromic hearing impairment (arNSHI). Only one of the families, W98-053, was not consanguineous, and its sibship pointed toward a reduced critical region of 0.9 Mb. This region contained the GRXCR1 gene, and the orthologous mouse gene was described to be mutated in the pirouette (pi) mutant with resulting hearing loss and circling behavior. Sequence analysis of the GRXCR1 gene in hearing-impaired family members revealed splice-site mutations in two Dutch families and a missense and nonsense mutation, respectively, in two Pakistani families. The splice-site mutations are predicted to cause frameshifts and premature stop codons. In family W98-053, this could be confirmed by cDNA analysis. GRXCR1 is predicted to contain a GRX-like domain. GRX domains are involved in reversible S-glutathionylation of proteins and thereby in the modulation of activity and/or localization of these proteins. The missense mutation is located in this domain, whereas the nonsense and splice-site mutations may result in complete or partial absence of the GRX-like domain or of the complete protein. Hearing loss in patients with GRXCR1 mutations is congenital and is moderate to profound. Progression of the hearing loss was observed in family W98-053. Vestibular dysfunction was observed in some but not all affected individuals. Quantitative analysis of GRXCR1 transcripts in fetal and adult human tissues revealed a preferential expression of the gene in fetal cochlea, which may explain the nonsyndromic nature of the hearing impairment. PMID:20137778

  10. Mutation breeding in peas

    International Nuclear Information System (INIS)

    Jaranowski, J.; Micke, A.

    1985-01-01

    The pea as an ancient crop plant still today has wide uses and is an import source of food protein. It is also an important object for genetic studies and as such has been widely used in mutation induction experiments. However, in comparison with cereals this ancient crop plant (like several other grain legumes) has gained relatively little from advances in breeding. The review focuses on the prospects of genetic improvement of pea by induced mutations, discusses principles and gives methodological information. (author)

  11. Ultraviolet light protection, enhancement of ultraviolet light mutagenesis, and mutator effect of plasmid R46 in Salmonella typhimurium

    International Nuclear Information System (INIS)

    Mortelmans, K.E.; Stocker, B.A.D.

    1976-01-01

    Plasmid R46 partially protected Salmonella typhimurium, wild type or uvrB or polA, against the lethal effect of ultraviolet (uv) irradiation, but did not protect recA mutants. The plasmid also increased frequency of uv-induced reversion to His + in all tested his point mutants (wild type for uv sensitivity), including amber, ochre, UGA, missense, and frame-shift mutants. Plasmid R46 also increased uv-induced reversion to His + in uvrB and polA strains, but no uv mutagenic effect was detected in R - or R46-carrying recA derivatives of a his(amber) mutant. The spontaneous reversion frequency of his nonsense mutants of all classes, and of some his missense mutants, was increased about 10-fold when the strains carried R46, but the plasmid had no effect on the spontaneous reversion frequency of some other his missense mutations or of reversion rate of his frame-shift mutants (except for two uvrB derivatives of one single-base insertion mutant). The plasmid increased the ability of wild type, polA, and uvrB hosts to support plaque production by uv-irradiated phage, and made strain LT2 his G46 less sensitive to methyl methane sulfonate and to x rays and more responsive to the mutagenic effect of visible-light irradiation. R46 increased spontaneous reversion frequency of a his(amber) rec + strain, but had no such effect in its recA sublines. Since the plasmid in the absence of host recA function fails to produce its mutator effect, or to confer uv protection or to enhance uv mutagenesis, these three effects may be produced via some mechanism involved in recA-dependent deoxyribonucleic acid repair, perhaps by an increase in activity of the ''error-prone'' component of the inducible repair pathway

  12. Screening for common mutations in BRCA1 and BRCA2 genes: interest in genetic testing of Tunisian families with breast and/or ovarian cancer.

    Science.gov (United States)

    Fourati, Asma; Louchez, Marie-Michèle; Fournier, Joelle; Gamoudi, Amor; Rahal, Khaled; El May, Michèle-Véronique; El May, Ahmed; Revillion, Françoise; Peyrat, Jean-Philippe

    2014-11-01

    In the Tunisian population, as yet a limited number of BRCA1/2 germline mutations have been reported in hereditary breast and/or ovarian cancer. These mutations are located in a few exons of BRCA1/2. The aim of the present study was to search for these mutations in 66 unrelated patients with hereditary breast and/or ovarian cancer in order to assess the interest in such a targeted approach for genetic testing in Tunisia. Blood specimens from the 66 Tunisian patients, with family history of breast and/or ovarian cancer, were collected at the Salah Azaiz Cancer Institute of Tunis. The exons 5, 20 and part of exon 11 of BRCA1 as well as part of exons 10 and 11 of BRCA2 were analyzed by Sanger sequencing. 12 patients had deleterious mutations in the BRCA1 or BRCA2 genes (18%), including a novel frame-shift mutation of BRCA1 (c.3751dup; 3780insT). Four distinct BRCA1 mutations were detected eight patients: c.5266dup (5382insC) and c.211dup (330insA) each in three patients, c.3751dup (3870insT) and c.4041_4042del (4160delAG) each in one patient. The four remaining cases all carried the same BRCA2 mutation, c.1310_1313del (1538delAAGA). Besides these deleterious mutations, eight polymorphisms and unclassified variants were detected, one of them being never reported (BRCA1c.3030T>G, p.Pro1010Pro). In this study, we show that targeting relevant exons in BRCA1 and BRCA2 genes allows detection of a substantial percentage of mutations in the Tunisian population. Therefore such an approach may be of interest in genetic testing of high-risk breast and ovarian cancer families in Tunisia.

  13. Novel FGFR1 mutations in Kallmann syndrome and normosmic idiopathic hypogonadotropic hypogonadism: evidence for the involvement of an alternatively spliced isoform.

    Science.gov (United States)

    Gonçalves, Catarina; Bastos, Margarida; Pignatelli, Duarte; Borges, Teresa; Aragüés, José M; Fonseca, Fernando; Pereira, Bernardo D; Socorro, Sílvia; Lemos, Manuel C

    2015-11-01

    To determine the prevalence of fibroblast growth factor receptor 1 (FGFR1) mutations and their predicted functional consequences in patients with idiopathic hypogonadotropic hypogonadism (IHH). Cross-sectional study. Multicentric. Fifty unrelated patients with IHH (21 with Kallmann syndrome and 29 with normosmic IHH). None. Patients were screened for mutations in FGFR1. The functional consequences of mutations were predicted by in silico structural and conservation analysis. Heterozygous FGFR1 mutations were identified in six (12%) kindreds. These consisted of frameshift mutations (p.Pro33-Alafs*17 and p.Tyr654*) and missense mutations in the signal peptide (p.Trp4Cys), in the D1 extracellular domain (p.Ser96Cys) and in the cytoplasmic tyrosine kinase domain (p.Met719Val). A missense mutation was identified in the alternatively spliced exon 8A (p.Ala353Thr) that exclusively affects the D3 extracellular domain of FGFR1 isoform IIIb. Structure-based and sequence-based prediction methods and the absence of these variants in 200 normal controls were all consistent with a critical role for the mutations in the activity of the receptor. Oligogenic inheritance (FGFR1/CHD7/PROKR2) was found in one patient. Two FGFR1 isoforms, IIIb and IIIc, result from alternative splicing of exons 8A and 8B, respectively. Loss-of-function of isoform IIIc is a cause of IHH, whereas isoform IIIb is thought to be redundant. Ours is the first report of normosmic IHH associated with a mutation in the alternatively spliced exon 8A and suggests that this disorder can be caused by defects in either of the two alternatively spliced FGFR1 isoforms. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Mutational spectrum drives the rise of mutator bacteria.

    Science.gov (United States)

    Couce, Alejandro; Guelfo, Javier R; Blázquez, Jesús

    2013-01-01

    Understanding how mutator strains emerge in bacterial populations is relevant both to evolutionary theory and to reduce the threat they pose in clinical settings. The rise of mutator alleles is understood as a result of their hitchhiking with linked beneficial mutations, although the factors that govern this process remain unclear. A prominent but underappreciated fact is that each mutator allele increases only a specific spectrum of mutational changes. This spectrum has been speculated to alter the distribution of fitness effects of beneficial mutations, potentially affecting hitchhiking. To study this possibility, we analyzed the fitness distribution of beneficial mutations generated from different mutator and wild-type Escherichia coli strains. Using antibiotic resistance as a model system, we show that mutational spectra can alter these distributions substantially, ultimately determining the competitive ability of each strain across environments. Computer simulation showed that the effect of mutational spectrum on hitchhiking dynamics follows a non-linear function, implying that even slight spectrum-dependent fitness differences are sufficient to alter mutator success frequency by several orders of magnitude. These results indicate an unanticipated central role for the mutational spectrum in the evolution of bacterial mutation rates. At a practical level, this study indicates that knowledge of the molecular details of resistance determinants is crucial for minimizing mutator evolution during antibiotic therapy.

  15. Mutational spectrum drives the rise of mutator bacteria.

    Directory of Open Access Journals (Sweden)

    Alejandro Couce

    Full Text Available Understanding how mutator strains emerge in bacterial populations is relevant both to evolutionary theory and to reduce the threat they pose in clinical settings. The rise of mutator alleles is understood as a result of their hitchhiking with linked beneficial mutations, although the factors that govern this process remain unclear. A prominent but underappreciated fact is that each mutator allele increases only a specific spectrum of mutational changes. This spectrum has been speculated to alter the distribution of fitness effects of beneficial mutations, potentially affecting hitchhiking. To study this possibility, we analyzed the fitness distribution of beneficial mutations generated from different mutator and wild-type Escherichia coli strains. Using antibiotic resistance as a model system, we show that mutational spectra can alter these distributions substantially, ultimately determining the competitive ability of each strain across environments. Computer simulation showed that the effect of mutational spectrum on hitchhiking dynamics follows a non-linear function, implying that even slight spectrum-dependent fitness differences are sufficient to alter mutator success frequency by several orders of magnitude. These results indicate an unanticipated central role for the mutational spectrum in the evolution of bacterial mutation rates. At a practical level, this study indicates that knowledge of the molecular details of resistance determinants is crucial for minimizing mutator evolution during antibiotic therapy.

  16. Compound Heterozygosity of Low-Frequency Promoter Deletions and Rare Loss-of-Function Mutations in TXNL4A Causes Burn-McKeown Syndrome

    Science.gov (United States)

    Wieczorek, Dagmar; Newman, William G.; Wieland, Thomas; Berulava, Tea; Kaffe, Maria; Falkenstein, Daniela; Beetz, Christian; Graf, Elisabeth; Schwarzmayr, Thomas; Douzgou, Sofia; Clayton-Smith, Jill; Daly, Sarah B.; Williams, Simon G.; Bhaskar, Sanjeev S.; Urquhart, Jill E.; Anderson, Beverley; O’Sullivan, James; Boute, Odile; Gundlach, Jasmin; Czeschik, Johanna Christina; van Essen, Anthonie J.; Hazan, Filiz; Park, Sarah; Hing, Anne; Kuechler, Alma; Lohmann, Dietmar R.; Ludwig, Kerstin U.; Mangold, Elisabeth; Steenpaß, Laura; Zeschnigk, Michael; Lemke, Johannes R.; Lourenco, Charles Marques; Hehr, Ute; Prott, Eva-Christina; Waldenberger, Melanie; Böhmer, Anne C.; Horsthemke, Bernhard; O’Keefe, Raymond T.; Meitinger, Thomas; Burn, John; Lüdecke, Hermann-Josef; Strom, Tim M.

    2014-01-01

    Mutations in components of the major spliceosome have been described in disorders with craniofacial anomalies, e.g., Nager syndrome and mandibulofacial dysostosis type Guion-Almeida. The U5 spliceosomal complex of eight highly conserved proteins is critical for pre-mRNA splicing. We identified biallelic mutations in TXNL4A, a member of this complex, in individuals with Burn-McKeown syndrome (BMKS). This rare condition is characterized by bilateral choanal atresia, hearing loss, cleft lip and/or palate, and other craniofacial dysmorphisms. Mutations were found in 9 of 11 affected families. In 8 families, affected individuals carried a rare loss-of-function mutation (nonsense, frameshift, or microdeletion) on one allele and a low-frequency 34 bp deletion (allele frequency 0.76%) in the core promoter region on the other allele. In a single highly consanguineous family, formerly diagnosed as oculo-oto-facial dysplasia, the four affected individuals were homozygous for a 34 bp promoter deletion, which differed from the promoter deletion in the other families. Reporter gene and in vivo assays showed that the promoter deletions led to reduced expression of TXNL4A. Depletion of TXNL4A (Dib1) in yeast demonstrated reduced assembly of the tri-snRNP complex. Our results indicate that BMKS is an autosomal-recessive condition, which is frequently caused by compound heterozygosity of low-frequency promoter deletions in combination with very rare loss-of-function mutations. PMID:25434003

  17. Detecting clusters of mutations.

    Directory of Open Access Journals (Sweden)

    Tong Zhou

    Full Text Available Positive selection for protein function can lead to multiple mutations within a small stretch of DNA, i.e., to a cluster of mutations. Recently, Wagner proposed a method to detect such mutation clusters. His method, however, did not take into account that residues with high solvent accessibility are inherently more variable than residues with low solvent accessibility. Here, we propose a new algorithm to detect clustered evolution. Our algorithm controls for different substitution probabilities at buried and exposed sites in the tertiary protein structure, and uses random permutations to calculate accurate P values for inferred clusters. We apply the algorithm to genomes of bacteria, fly, and mammals, and find several clusters of mutations in functionally important regions of proteins. Surprisingly, clustered evolution is a relatively rare phenomenon. Only between 2% and 10% of the genes we analyze contain a statistically significant mutation cluster. We also find that not controlling for solvent accessibility leads to an excess of clusters in terminal and solvent-exposed regions of proteins. Our algorithm provides a novel method to identify functionally relevant divergence between groups of species. Moreover, it could also be useful to detect artifacts in automatically assembled genomes.

  18. Mutational and acquired carbapenem resistance mechanisms in multidrug resistant Pseudomonas aeruginosa clinical isolates from Recife, Brazil.

    Science.gov (United States)

    Cavalcanti, Felipe Lira de Sá; Mirones, Cristina Rodríguez; Paucar, Elena Román; Montes, Laura Álvarez; Leal-Balbino, Tereza Cristina; Morais, Marcia Maria Camargo de; Martínez-Martínez, Luis; Ocampo-Sosa, Alain Antonio

    2015-12-01

    An investigation was carried out into the genetic mechanisms responsible for multidrug resistance in nine carbapenem-resistant Pseudomonas aeruginosa isolates from different hospitals in Recife, Brazil. Susceptibility to antimicrobial agents was determined by broth microdilution. Polymerase chain reaction (PCR) was employed to detect the presence of genes encoding β-lactamases, aminoglycoside-modifying enzymes (AMEs), 16S rRNA methylases, integron-related genes and OprD. Expression of genes coding for efflux pumps and AmpC cephalosporinase were assessed by quantitative PCR. The outer membrane proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The blaSPM-1, blaKPC-2 and blaGES-1 genes were detected in P. aeruginosa isolates in addition to different AME genes. The loss of OprD in nine isolates was mainly due to frameshift mutations, premature stop codons and point mutations. An association of loss of OprD with the overexpression of MexAB-OprM and MexXY-OprM was observed in most isolates. Hyper-production of AmpC was also observed in three isolates. Clonal relationship of the isolates was determined by repetitive element palindromic-PCR and multilocus sequence typing. Our results show that the loss of OprD along with overexpression of efflux pumps and β-lactamase production were responsible for the multidrug resistance in the isolates analysed.

  19. Dysferlinopathy in the Jews of the Caucasus: a frequent mutation in the dysferlin gene.

    Science.gov (United States)

    Leshinsky-Silver, E; Argov, Z; Rozenboim, L; Cohen, S; Tzofi, Z; Cohen, Y; Wirguin, Y; Dabby, R; Lev, D; Sadeh, M

    2007-12-01

    Dysferlin encoding gene (DYS) is mutated in the autosomal recessive disorders Miyoshi myopathy, Limb Girdle Muscular Dystrophy type 2B (LGMD2B) and distal anterior compartment myopathy, causing dysferlin deficiency in muscle biopsy. Three ethnic clusters have previously been described in Dysferlinopathy: the Libyan Jewish population originating in the area of Tripoli, Italian and Spanish populations. We report another cluster of this muscular dystrophy in Israel among Jews of the Caucasus region. A genomic analysis of the dysferlin coding sequence performed in patients from this ethnic group, who demonstrated an absence of dysferlin expression in muscle biopsy, revealed a homozygous frameshift mutation of G deletion at codon 927 (2779delG) predicting a truncated protein and a complete loss of functional protein. The possible existence of a founder effect is strengthened by our finding of a 4% carrier frequency in this community. These findings are important for genetic counseling and also enable a molecular diagnosis of LGMD2B in Jews of the Caucasus region.

  20. Novel mutations in Darier disease and association to self-reported disease severity.

    Directory of Open Access Journals (Sweden)

    Ivone U S Leong

    Full Text Available Darier disease is a rare and severe autosomal dominant skin disease characterised by malodorous keratotic papules in seborrheic areas of the skin. Darier disease affects up to 1 in 30 000 people and is caused by mutations in the ATP2A2 gene, which encodes to the sarco/endoplasmic reticulum calcium-ATPase isoform 2 that pumps calcium into the endoplasmic reticulum. Although many ATP2A2 variants have been described, it is not known if genotype correlates with phenotype, which could be important for prognosis and treatment. This is the first study to use whole exome sequencing to screen the ATP2A2 gene in a cohort of 28 clinically diagnosed Darier disease patients. Twenty-one different disease causing variants were identified and 15 of these were novel. Sixteen of the 21 variants were predicted to be pathogenic using in silico prediction programs. There were seven missense, four intronic/splice-sites, three frameshifts, two in-frame deletions, four nonsense and one synonymous mutations. This study also found ten patients who harbour more than one ATP2A2 variant. The phenotype of the patient cohort was assessed by photography and by patient questionnaires. The genotype-phenotype association was examined for all variants in relation to the patient's disease severity score, and no correlation could be established.

  1. Molecular characterization of a double-flower mutation in Matthiola incana.

    Science.gov (United States)

    Nakatsuka, Takashi; Koishi, Kanae

    2018-03-01

    The double flower is one of the most important traits in the floricultural plant Matthiola incana. Although a "doubleness" locus (S/s) was defined by genetic analysis a century ago, the gene responsible for double flowers has not been identified in M. incana. We isolated MiAG from M. incana cultivars, and its sequence and genomic structure were found to be highly similar to the AGAMOUS gene in Arabidopsis. Two independent mutated alleles miag1 and miag2 were identified from the double-flowered individuals of M. incana cultivars. Deletions of 135 bp (from the 2nd exon to the 2nd intron) and 89 bp (from the 7th intron to the 8th exon) were detected in miag1 and miag2, respectively. No transcript was detected in flower buds from miag1 alleles in corresponding cultivars, whereas three mRNA variants with frameshifts were transcribed from the miag2 allele in other cultivars. Thus, two mutated alleles corresponding to the s locus contributed to the 'eversporting' type double-flower cultivars in M. incana. Moreover, we also developed co-dominant molecular markers to describe the genotypes of the three alleles of MiAG. Using these DNA markers allows for selection of single- or double-flowered individuals among seedlings that do not display phenotypic differences. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Cornelia de Lange syndrome with NIPBL mutation and mosaic Turner syndrome in the same individual

    Directory of Open Access Journals (Sweden)

    Wierzba Jolanta

    2012-06-01

    Full Text Available Abstract Background Cornelia de Lange syndrome (CdLS is a dominantly inherited disorder characterized by facial dysmorphism, growth and cognitive impairment, limb malformations and multiple organ involvement. Mutations in NIPBL gene account for about 60% of patients with CdLS. This gene encodes a key regulator of the Cohesin complex, which controls sister chromatid segregation during both mitosis and meiosis. Turner syndrome (TS results from the partial or complete absence of one of the X chromosomes, usually associated with congenital lymphedema, short stature, and gonadal dysgenesis. Case presentation Here we report a four-year-old female with CdLS due to a frameshift mutation in the NIPBL gene (c.1445_1448delGAGA, who also had a tissue-specific mosaic 45,X/46,XX karyotype. The patient showed a severe form of CdLS with craniofacial dysmorphism, pre- and post-natal growth delay, cardiovascular abnormalities, hirsutism and severe psychomotor retardation with behavioural problems. She also presented with minor clinical features consistent with TS, including peripheral lymphedema and webbed neck. The NIPBL mutation was present in the two tissues analysed from different embryonic origins (peripheral blood lymphocytes and oral mucosa epithelial cells. However, the percentage of cells with monosomy X was low and variable in tissues. These findings indicate that, ontogenically, the NIPBL mutation may have appeared before the mosaic monosomy X. Conclusions The coexistence in several patients of these two rare disorders raises the issue of whether there is indeed a cause-effect association. The detailed clinical descriptions indicate predominant CdLS phenotype, although additional TS manifestations may appear in adolescence.

  3. Homozygous Mutations in WEE2 Cause Fertilization Failure and Female Infertility.

    Science.gov (United States)

    Sang, Qing; Li, Bin; Kuang, Yanping; Wang, Xueqian; Zhang, Zhihua; Chen, Biaobang; Wu, Ling; Lyu, Qifeng; Fu, Yonglun; Yan, Zheng; Mao, Xiaoyan; Xu, Yao; Mu, Jian; Li, Qiaoli; Jin, Li; He, Lin; Wang, Lei

    2018-04-05

    Fertilization is a fundamental process of development and is a prerequisite for successful human reproduction. In mice, although several receptor proteins have been shown to play important roles in the process of fertilization, only three genes have been shown to cause fertilization failure and infertility when deleted in vivo. In clinical practice, some infertility case subjects suffer from recurrent failure of in vitro fertilization and intracytoplasmic sperm injection attempts due to fertilization failure, but the genetic basis of fertilization failure in humans remains largely unknown. Wee2 is a key oocyte-specific kinase involved in the control of meiotic arrest in mice, but WEE2 has not been associated with any diseases in humans. In this study, we identified homozygous mutations in WEE2 that are responsible for fertilization failure in humans. All four independent affected individuals had homozygous loss-of-function missense mutations or homozygous frameshift protein-truncating mutations, and the phenotype of fertilization failure was shown to follow a Mendelian recessive inheritance pattern. All four mutations significantly decreased the amount of WEE2 protein in vitro and in affected individuals' oocytes in vivo, and they all led to abnormal serine phosphorylation of WEE2 and reduced tyrosine 15 phosphorylation of Cdc2 in vitro. In addition, injection of WEE2 cRNA into affected individuals' oocytes rescued the fertilization failure phenotype and led to the formation of blastocysts in vitro. This work presents a novel gene responsible for human fertilization failure and has implications for future therapeutic treatments for infertility cases. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  4. Neurological findings and genetic alterations in patients with Kostmann syndrome and HAX1 mutations.

    Science.gov (United States)

    Roques, Gaëlle; Munzer, Martine; Barthez, Marie-Anne Carpentier; Beaufils, Sandrine; Beaupain, Blandine; Flood, Terry; Keren, Boris; Bellanné-Chantelot, Christine; Donadieu, Jean

    2014-06-01

    To describe the clinical profile and the prevalence of severe congenital neutropenia (SCN) and HAX1 mutations, so-called Kostmann syndrome, in France. Two pedigrees were identified from the French registry. The study included five subjects (three males), which represent 0.7% of the 759 SCN cases registered in France. The age at diagnosis was 0.3 years (range: 0.1-1.2 years) and the median age at the last follow-up was 7.3 years (range: 1.2-17.8 years). A novel large homozygous deletion of the HAX1 gene (exons 2-5) was found in one pedigree; while, a homozygous frameshift mutation was identified in exon 3 (c.430dupG, p.Val144fs) in the second pedigree. Severe bacterial infections were observed in four patients, including two cases of sepsis, one case of pancolitis, a lung abscess, and recurrent cellulitis and stomatitis. During routine follow-up, the median neutrophil value was 0.16 × 10(9)/L, associated with monocytosis (2 × 10(9)/L). Bone marrow (BM) smears revealed a decrease of the granulocytic lineage with no mature myeloid cells above the myelocytes. One patient died at age 2 from neurological complications, while two other patients, including one who underwent a hematopoietic stem cell transplantation (HSCT) at age 5, are living with very severe neurological retardation. SCN with HAX1 mutations, is a rare sub type of congenital neutropenia, mostly observed in population from Sweden and Asia minor, associating frequently neurological retardation, when the mutations involved the B isoform of the protein. © 2014 Wiley Periodicals, Inc.

  5. Two novel connexin32 mutations cause early onset X-linked Charcot-Marie-Tooth disease

    Directory of Open Access Journals (Sweden)

    Sand Jette C

    2007-07-01

    Full Text Available Abstract Background X-linked Charcot-Marie Tooth (CMT is caused by mutations in the connexin32 gene that encodes a polypeptide which is arranged in hexameric array and form gap junctions. Methods We describe two novel mutations in the connexin32 gene in two Norwegian families. Results Family 1 had a c.225delG (R75fsX83 which causes a frameshift and premature stop codon at position 247. This probably results in a shorter non-functional protein structure. Affected individuals had an early age at onset usually in the first decade. The symptoms were more severe in men than women. All had severe muscle weakness in the legs. Several abortions were observed in this family. Family 2 had a c.536 G>A (C179Y transition which causes a change of the highly conserved cysteine residue, i.e. disruption of at least one of three disulfide bridges. The mean age at onset was in the first decade. Muscle wasting was severe and correlated with muscle weakness in legs. The men and one woman also had symptom from their hands. The neuropathy is demyelinating and the nerve conduction velocities were in the intermediate range (25–49 m/s. Affected individuals had symmetrical clinical findings, while the neurophysiology revealed minor asymmetrical findings in nerve conduction velocity in 6 of 10 affected individuals. Conclusion The two novel mutations in the connexin32 gene are more severe than the majority of previously described mutations possibly due to the severe structural change of the gap junction they encode.

  6. A novel splice site mutation in the dentin sialophosphoprotein gene in a Chinese family with dentinogenesis imperfecta type II

    International Nuclear Information System (INIS)

    Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun

    2009-01-01

    Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II

  7. A novel heterozygous mutation of the AIRE gene in a patient with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED).

    Science.gov (United States)

    Fierabracci, Alessandra; Bizzarri, Carla; Palma, Alessia; Milillo, Annamaria; Bellacchio, Emanuele; Cappa, Marco

    2012-12-10

    Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED) is an autosomal recessive disease due to mutations of the autoimmune regulator (AIRE) gene. Typical manifestations include candidiasis, Addison's disease, and hypoparathyroidism. Type 1 diabetes, alopecia, vitiligo, ectodermal dystrophy, celiac disease and other intestinal dysfunctions, chronic atrophic gastritis, chronic active hepatitis, autoimmune thyroid disorders, pernicious anemia and premature ovarian failure are other rare associated diseases although other conditions have been associated with APECED. What follows is the clinical, endocrinological and molecular data of a female APECED patient coming from Lithuania. The patient was affected by chronic mucocutaneous candidiasis, hypoparathyroidism and pre-clinical Addison's disease. Using direct sequencing of all the 14 exons of the AIRE gene in the patient's DNA, we identified in exon 6 the known mutation c.769 C>T (p.Arg257X) in compound heterozygosity with the newly discovered mutation c.1214delC (p.Pro405fs) in exon 10. The novel mutation results in a frameshift that is predicted to alter the sequence of the protein starting from amino acid 405 as well as to cause its premature truncation, therefore a non-functional Aire protein. A novel mutation has been described in a patient with APECED with classical clinical components, found in compound heterozygosity with the c.769 C>T variation. Expanded epidemiological investigations based on AIRE gene sequencing are necessary to verify the relevancy of the novel mutation to APECED etiopathogenesis in the Lithuanian population and to prove its diagnostic efficacy in association with clinical and immunological findings. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Are There Mutator Polymerases?

    Directory of Open Access Journals (Sweden)

    Miguel Garcia-Diaz

    2003-01-01

    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  9. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  10. Mutations in linker for activation of T cells (LAT) lead to a novel form of severe combined immunodeficiency.

    Science.gov (United States)

    Bacchelli, Chiara; Moretti, Federico A; Carmo, Marlene; Adams, Stuart; Stanescu, Horia C; Pearce, Kerra; Madkaikar, Manisha; Gilmour, Kimberly C; Nicholas, Adeline K; Woods, C Geoffrey; Kleta, Robert; Beales, Phil L; Qasim, Waseem; Gaspar, H Bobby

    2017-02-01

    Signaling through the T-cell receptor (TCR) is critical for T-cell development and function. Linker for activation of T cells (LAT) is a transmembrane adaptor signaling molecule that is part of the TCR complex and essential for T-cell development, as demonstrated by LAT-deficient mice, which show a complete lack of peripheral T cells. We describe a pedigree affected by a severe combined immunodeficiency phenotype with absent T cells and normal B-cell and natural killer cell numbers. A novel homozygous frameshift mutation in the gene encoding for LAT was identified in this kindred. Genetic, molecular, and functional analyses were used to identify and characterize the LAT defect. Clinical and immunologic analysis of patients was also performed and reported. Homozygosity mapping was used to identify potential defective genes. Sanger sequencing of the LAT gene showed a mutation that resulted in a premature stop codon and protein truncation leading to complete loss of function and loss of expression of LAT in the affected family members. We also demonstrate loss of LAT expression and lack of TCR signaling restoration in LAT-deficient cell lines reconstituted with a synthetic LAT gene bearing this severe combined immunodeficiency mutation. For the first time, the results of this study show that inherited LAT deficiency should be considered in patients with combined immunodeficiency with T-cell abnormalities. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  11. The prevalence of ABCB1:c.227_230delATAG mutation in affected dog breeds from European countries.

    Science.gov (United States)

    Firdova, Zuzana; Turnova, Evelina; Bielikova, Marcela; Turna, Jan; Dudas, Andrej

    2016-06-01

    Deletion of 4-base pairs in the canine ABCB1 (MDR1) gene, responsible for encoding P-glycoprotein, leads to nonsense frame-shift mutation, which causes hypersensitivity to macrocyclic lactones drugs (e.g. ivermectin). To date, at least 12 purebred dog breeds have been found to be affected by this mutation. The aim of this study was to update information about the prevalence of ABCB1 mutation (c.227_230delATAG) in predisposed breeds in multiple European countries. This large scale survey also includes countries which were not involved in previous studies. The samples were collected in the period from 2012 to 2014. The overview is based on genotyping data of 4729 individuals. The observed mutant allele frequencies were 58.5% (Smooth Collie), 48.3% (Rough Collie), 35% (Australian Shepherd), 30.3% (Shetland Sheepdog), 28.1% (Silken Windhound), 26.1% (Miniature Australian Shepherd), 24.3% (Longhaired Whippet), 16.2% (White Swiss Shepherd) and 0% (Border Collie). The possible presence of an ABCB1 mutant allele in Akita-Inu breed has been investigated with negative results. This information could be helpful for breeders in optimization of their breeding strategy and for veterinarians when prescribing drug therapy for dogs of predisposed breeds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. The first missense mutation of NHS gene in a Tunisian family with clinical features of NHS syndrome including cardiac anomaly.

    Science.gov (United States)

    Chograni, Manèl; Rejeb, Imen; Jemaa, Lamia Ben; Châabouni, Myriam; Bouhamed, Habiba Chaabouni

    2011-08-01

    Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome is a disease of unknown gene action mechanism, characterized by congenital cataract, dental anomalies, dysmorphic features and, in some cases, mental retardation. We performed linkage analysis in a Tunisian family with NHS in which affected males and obligate carrier female share a common haplotype in the Xp22.32-p11.21 region that contains the NHS gene. Direct sequencing of NHS coding exons and flanking intronic sequences allowed us to identify the first missense mutation (P551S) and a reported SNP-polymorphism (L1319F) in exon 6, a reported UTR-SNP (c.7422 C>T) and a novel one (c.8239 T>A) in exon 8. Both variations P551S and c.8239 T>A segregate with NHS phenotype in this family. Although truncations, frame-shift and copy number variants have been reported in this gene, no missense mutations have been found to segregate previously. This is the first report of a missense NHS mutation causing NHS phenotype (including cardiac defects). We hypothesize also that the non-reported UTR-SNP of the exon 8 (3'-UTR) is specific to the Tunisian population.

  13. [Portal-splenic-mesenteric venous thrombosis in a patients with protein S deficiency due to novel PROS1 gene mutation].

    Science.gov (United States)

    Hwang, Eui Tae; Kang, Won Sik; Park, Jin Woo; Lee, Ji Hyun; Han, Hyun Jeong; Shin, Sang Yong; Kim, Hee Jin; Choi, Ja Sung

    2014-08-01

    Protein S (PS), a vitamin K-dependent glycoprotein, performs an important role in the anticoagulation cascade as a cofactor of protein C. Because of the presence of a pseudogene and two different forms of PS in the plasma, protein S deficiency (PSD) is one of the most difficult thrombophilias to study and a rare blood disorder associated with an increased risk of thrombosis. We describe a unusual case of previously healthy 37-year-old man diagnosed with portal-splenic-mesenteric vein thrombosis secondary to PSD. The patient was admitted to the hospital due to continuous nonspecific abdominal pain and nausea. Abdominal computed tomography revealed acute venous thrombosis from inferior mesenteric vein to left portal vein via splenic vein, and laboratory test revealed decreased PS antigen level and PS functional activity. Conventional polymerase chain reaction and direct DNA sequencing analysis of the PROS1 gene demonstrated duplication of the 166th base in exon 2 resulting in frame-shift mutation (p.Arg56Lysfs*10) which is the first description of the new PROS1 gene mutation to our knowledge. Results from other studies suggest that the inherited PSD due to a PROS1 gene mutation may cause venous thrombosis in a healthy young man without any known predisposing factor.

  14. Fluoroquinolone Resistance Mechanisms in an Escherichia coli Isolate, HUE1, Without Quinolone Resistance-Determining Region Mutations

    Directory of Open Access Journals (Sweden)

    Toyotaka eSato

    2013-05-01

    Full Text Available Fluoroquinolone resistance can cause major clinical problems. Here, we investigated fluoroquinolone resistance mechanisms in a clinical Escherichia coli isolate, HUE1, which had no mutations quinolone resistance-determining regions (QRDRs of DNA gyrase and topoisomerase IV. HUE1 demonstrated MICs that exceeded the breakpoints for ciprofloxacin, levofloxacin, and norfloxacin. HUE1 harbored oqxAB and qnrS1 on distinct plasmids. In addition, it exhibited lower intracellular ciprofloxacin concentrations and higher mRNA expression levels of efflux pumps and their global activators than did reference strains. The genes encoding AcrR (local AcrAB repressor and MarR (MarA repressor were disrupted by insertion of the transposon IS3-IS629 and a frameshift mutation, respectively. A series of mutants derived from HUE1 were obtained by plasmid curing and gene knockout using homologous recombination. Compared to the MICs of the parent strain HUE1, the fluoroquinolone MICs of these mutants indicated that qnrS1, oqxAB, acrAB, acrF, acrD, mdtK, mdfA, and tolC contributed to the reduced susceptibility to fluoroquinolone in HUE1. Therefore, fluoroquinolone resistance in HUE1 is caused by concomitant acquisition of QnrS1 and OqxAB and overexpression of AcrAB−TolC and other chromosome-encoded efflux pumps. Thus, we have demonstrated that QRDR mutations are not absolutely necessary for acquiring fluoroquinolone resistance in E. coli.

  15. First evidence of Smith-Magenis syndrome in mother and daughter due to a novel RAI mutation.

    Science.gov (United States)

    Acquaviva, Fabio; Sana, Maria Elena; Della Monica, Matteo; Pinelli, Michele; Postorivo, Diana; Fontana, Paolo; Falco, Maria Teresa; Nardone, Anna Maria; Lonardo, Fortunato; Iascone, Maria; Scarano, Gioacchino

    2017-01-01

    Smith-Magenis syndrome (SMS) is a complex genetic disorder caused by interstitial 17p11.2 deletions encompassing multiple genes, including the retinoic acid induced 1 gene-RAI1-or mutations in RAI1 itself. The clinical spectrum includes developmental delay, cognitive impairment, and behavioral abnormalities, with distinctive physical features that become more evident with age. No patients have been reported to have had offspring. We here describe a girl with developmental delay, mainly compromising the speech area, and her mother with mild intellectual disabilities and minor dysmorphic features. Both had sleep disturbance and attention deficit disorder, but no other atypical behaviors have been reported. In both, CGH-array analysis detected a 15q13.3 interstitial duplication, encompassing CHRNA7. However, the same duplication has been observed in several, apparently healthy, maternal relatives. We, thus, performed a whole exome sequencing analysis, which detected a frameshift mutation in RAI1, de novo in the mother, and transmitted to her daughter. No other family members carried this mutation. This is the first report of an SMS patient having offspring. Our experience confirms the importance of searching for alternative causative genetic mechanisms in case of confounding/inconclusive findings such as a CGH-array result of uncertain significance. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Molecular characterization of minor gene rearrangements in Finnish patients with heterozygous familial hypercholesterolemia: Identification of two common missense mutations (Gly823{r_arrow}Asp and Leu380{r_arrow}His) and eight rare mutations of the LDL receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Koivisto, U.M.; Viikari, J.S.; Kontula, K. [Univ. of Turku, Helsinki (Finland)

    1995-10-01

    Two deletions of the low-density lipoprotein (LDL) receptor gene were previously shown to account for about two thirds of all mutations causing familial hypercholesterolemia (FH) in Finland. We screened the DNA samples from a cohort representing the remaining 30% of Finnish heterozygous FH patients by amplifying all the 18 exons of the receptor gene by PCR and searching for DNA variations with the SSCP technique. Ten novel mutations were identified, comprising two nonsense and seven missense mutations as well as one frameshift mutation caused by a 13-bp deletion. A single nucleotide change, substituting adenine for guanidine at position 2533 and resulting in an amino acid change of glycine to aspartic acid at codon 823, was found in DNA samples from 14 unrelated FH probands. This mutation (FH-Turku) affects the sequence encoding the putative basolateral sorting signal of the LDL receptor protein; however, the exact functional consequences of this mutation are yet to be examined. The FH-Turku gene and another point mutation (Leu380{r_arrow}His or FH-Pori) together account for {approximately}8% of the FH-causing genes in Finland and are particularly common among FH patients from the southwestern part of the country (combined, 30%). Primer-introduced restriction analysis was applied for convenient assay of the FH-Turku and FH-Pori point mutations. In conclusion, this paper demonstrates the unique genetic background of FH in Finland and describes a commonly occurring FH gene with a missense mutation closest to the C terminus thus far reported. 32 refs., 5 figs., 2 tabs.

  17. Mutation, somatic mutation and diseases of man

    International Nuclear Information System (INIS)

    Burnet, F.M.

    1976-01-01

    The relevance of the intrinsic mutagenesis for the evolution process, genetic diseases and the process of aging is exemplified. The fundamental reaction is the function of the DNA and the DNA-enzymes like the DNA-polymerases in replication, repair, and transcription. These defects are responsible for the mutation frequency and the genetic drift in the evolution process. They cause genetic diseases like Xeroderma pigmentosum which is described here in detail. The accumulation of structural and functional mistakes leads to diseases of old age, for example to autoimmune diseases and immune suppression. There is a proportionality between the duration of life and the frequency of mistakes in the enzymatic repair system. No possibility of prophylaxis or therapy is seen. Methods for prognosis could be developed. (AJ) [de

  18. Dural ectasia and FBN1 mutation screening of 40 patients with Marfan syndrome and related disorders: role of dural ectasia for the diagnosis.

    Science.gov (United States)

    Attanasio, Monica; Pratelli, Elisa; Porciani, Maria Cristina; Evangelisti, Lucia; Torricelli, Elena; Pellicanò, Giannantonio; Abbate, Rosanna; Gensini, Gian Franco; Pepe, Guglielmina

    2013-07-01

    Marfan syndrome is an autosomal dominant disorder of connective tissue caused by mutations in the gene encoding fibrillin-1 (FBN1), a matrix component of microfibrils. Dural ectasia, i.e. enlargement of the neural canal mainly located in the lower lumbar and sacral region, frequently occurs in Marfan patients. The aim of our study was to investigate the role of dural ectasia in raising the diagnosis of Marfan syndrome and its association with FBN1 mutations. We studied 40 unrelated patients suspected for MFS, who underwent magnetic resonance imaging searching for dural ectasia. In all of them FBN1 gene analysis was also performed. Thirty-seven patients resulted affected by Marfan syndrome according to the '96 Ghent criteria; in 30 of them the diagnosis was confirmed when revaluated by the recently revised criteria (2010). Thirty-six patients resulted positive for dural ectasia. The degree of dural ectasia was grade 1 in 19 patients, grade 2 in 11 patients, and grade 3 in 6 patients. In 7 (24%) patients, the presence of dural ectasia allowed to reach a positive score for systemic feature criterion. Twenty-four patients carried an FBN1 mutation, that were represented by 13 missense (54%), and 11 (46%) mutations generating a premature termination codon (PTC, frameshifts and stop codons). No mutation was detected in the remaining 16 (6 patients with MFS and 10 with related disorders according to revised Ghent criteria). The prevalence of severe (grade 2 and grade 3) involvement of dura mater was higher in patients harbouring premature termination codon (PTC) mutations than those carrying missense-mutations (8/11 vs 2/13, P = 0.0111). Our data emphasizes the importance of dural ectasia screening to reach the diagnosis of Marfan syndrome especially when it is uncertain and indicates an association between PTC mutations and severe dural ectasia in Marfan patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  19. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  20. Mutation breeding newsletter. No. 33

    International Nuclear Information System (INIS)

    1989-01-01

    This issue of the newsletter reports a number of research news and research abstracts on application of radiation induced mutation techniques to increase mutagenesis and mutation frequency in plant breeding projects

  1. Mutation breeding newsletter. No. 45

    International Nuclear Information System (INIS)

    2001-07-01

    This issue of the Mutation Breeding newsletter contains 39 articles dealing with radiation induced mutations and chemical mutagenesis techniques in plant breeding programs with the aims of improving crop productivity and disease resistance as well as exploring genetic variabilities

  2. Breast tumor specific mutation in GATA3 affects physiological mechanisms regulating transcription factor turnover

    Science.gov (United States)

    2014-01-01

    Background The transcription factor GATA3 is a favorable prognostic indicator in estrogen receptor-α (ERα)-positive breast tumors in which it participates with ERα and FOXA1 in a complex transcriptional regulatory program driving tumor growth. GATA3 mutations are frequent in breast cancer and have been classified as driver mutations. To elucidate the contribution(s) of GATA3 alterations to cancer, we studied two breast cancer cell lines, MCF7, which carries a heterozygous frameshift mutation in the second zinc finger of GATA3, and T47D, wild-type at this locus. Methods Immunofluorescence staining and subcellular fractionation were employed to verify cellular localization of GATA3 in T47D and MCF7 cells. To test protein stability, cells were treated with translation inhibitor, cycloheximide or proteasome inhibitor, MG132, and GATA3 abundance was measured over time using immunoblot. GATA3 turn-over in response to hormone was determined by treating the cells with estradiol or ERα agonist, ICI 182,780. DNA binding ability of recombinant GATA3 was evaluated using electrophoretic mobility shift assay and heparin chromatography. Genomic location of GATA3 in MCF7 and T47D cells was assessed by chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq). Results GATA3 localized in the nucleus in T47D and MCF7 cells, regardless of the mutation status. The truncated protein in MCF7 had impaired interaction with chromatin and was easily released from the nucleus. Recombinant mutant GATA3 was able to bind DNA to a lesser degree than the wild-type protein. Heterozygosity for the truncating mutation conferred protection from regulated turnover of GATA3, ERα and FOXA1 following estrogen stimulation in MCF7 cells. Thus, mutant GATA3 uncoupled protein-level regulation of master regulatory transcription factors from hormone action. Consistent with increased protein stability, ChIP-seq profiling identified greater genome-wide accumulation of GATA3 in MCF7

  3. Prevalence and distribution of Listeria monocytogenes inlA alleles prone to phase variation and inlA alleles with premature stop codon mutations among human, food, animal, and environmental isolates.

    Science.gov (United States)

    Manuel, Clyde S; Van Stelten, Anna; Wiedmann, Martin; Nightingale, Kendra K; Orsi, Renato H

    2015-12-01

    In Listeria monocytogenes, 18 mutations leading to premature stop codons (PMSCs) in the virulence gene inlA have been identified to date. While most of these mutations represent nucleotide substitutions, a frameshift deletion in a 5' seven-adenine homopolymeric tract (HT) in inlA has also been reported. This HT may play a role in phase variation and was first identified among L. monocytogenes lineage II ribotype DUP-1039C isolates. In order to better understand the distribution of different inlA mutations in this ribotype, a newly developed multiplex real-time PCR assay was used to screen 368 DUP-1039C isolates from human, animal, and food-associated sources for three known 5' inlA HT alleles: (i) wild-type (WT) (A7), (ii) frameshift (FS) (A6), and (iii) guanine interruption (A2GA4) alleles. Additionally, 228 DUP-1039C isolates were screened for all inlA PMSCs; data on the presence of all inlA PMSCs for the other 140 isolates were obtained from previous studies. The statistical analysis based on 191 epidemiologically unrelated strains showed that strains with inlA PMSC mutations (n = 41) were overrepresented among food-associated isolates, while strains encoding full-length InlA (n = 150) were overrepresented among isolates from farm animals and their environments. Furthermore, the A6 allele was overrepresented and the A7 allele was underrepresented among food isolates, while the A6 allele was underrepresented among farm and animal isolates. Our results indicate that genetic variation in inlA contributes to niche adaptation within the lineage II subtype DUP-1039C. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Identification of novel X-linked gain-of-function RPGR-ORF15 mutation in Italian family with retinitis pigmentosa and pathologic myopia.

    Science.gov (United States)

    Parmeggiani, Francesco; Barbaro, Vanessa; De Nadai, Katia; Lavezzo, Enrico; Toppo, Stefano; Chizzolini, Marzio; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

    2016-12-20

    The aim of this study was to describe a new pathogenic variant in the mutational hot spot exon ORF15 of retinitis pigmentosa GTPase regulator (RPGR) gene within an Italian family with X-linked retinitis pigmentosa (RP), detailing its distinctive genotype-phenotype correlation with pathologic myopia (PM). All members of this RP-PM family underwent a complete ophthalmic examination. The entire open reading frames of RPGR and retinitis pigmentosa 2 genes were analyzed by Sanger sequencing. A novel frame-shift mutation in exon ORF15 of RPGR gene (c.2091_2092insA; p.A697fs) was identified as hemizygous variant in the male proband with RP, and as heterozygous variant in the females of this pedigree who invariably exhibited symmetrical PM in both eyes. The c.2091_2092insA mutation coherently co-segregated with the observed phenotypes. These findings expand the spectrum of X-linked RP variants. Interestingly, focusing on Caucasian ethnicity, just three RPGR mutations are hitherto reported in RP-PM families: one of these is located in exon ORF15, but none appears to be characterized by a high penetrance of PM trait as observed in the present, relatively small, pedigree. The geno-phenotypic attributes of this heterozygosity suggest that gain-of-function mechanism could give rise to PM via a degenerative cell-cell remodeling of the retinal structures.

  5. Posterior column ataxia with retinitis pigmentosa coexisting with sensory-autonomic neuropathy and leukemia due to the homozygous p.Pro221Ser FLVCR1 mutation.

    Science.gov (United States)

    Castori, Marco; Morlino, Silvia; Ungelenk, Martin; Pareyson, Davide; Salsano, Ettore; Grammatico, Paola; Tolosano, Emanuela; Kurth, Ingo; Chiabrando, Deborah

    2017-10-01

    FLVCR1 encodes for a ubiquitous heme exporter, whose recessive mutations cause posterior column ataxia with retinitis pigmentosa (PCARP). Recently, FLVCR1 recessive mutations were also found in two sporadic children with hereditary sensory-autonomic neuropathy (HSAN). We report the unique case of a 33-year-old Italian woman with a combination of typical PCARP, sensory-autonomic neuropathy with sensory loss to all modalities and multiple autonomic dysfuctions, and acute lymphocytic leukemia. Molecular analysis demonstrated homozygosity for the previously identified FLVCR1 p.Pro221Ser variation. The same variation, in combination with a frameshift mutation, was previously identified in an Italian child with HSAN. Functional studies carried out on patient-derived lymphoblastoid cell lines showed decreased FLVCR1a transcript, increased reactive oxygen species, excessive intracellular heme accumulation, and increased number of Annexin V positive cells. This indicates that the homozygous p.Pro221Ser FLVCR1 variation compromises the ability of FLVCR1a to export heme leading to enhanced susceptibility to programmed cell death. Our study demonstrates the existence of a phenotypic continuum among the discrete disorders previously linked to FLVCR1 mutations, and suggests that the related alteration of heme metabolism may lead to the degeneration of specific neuronal cell populations. © 2017 Wiley Periodicals, Inc.

  6. Clinical, molecular and histopathological features of short stature syndrome with novel CUL7 mutation in Yakuts: new population isolate in Asia.

    Science.gov (United States)

    Maksimova, N; Hara, K; Miyashia, A; Nikolaeva, I; Shiga, A; Nogovicina, A; Sukhomyasova, A; Argunov, V; Shvedova, A; Ikeuchi, T; Nishizawa, M; Kuwano, R; Onodera, O

    2007-12-01

    In total, 43 patients having short stature syndrome in 37 Yakut families with autosomal recessive prenatal and postnatal nonprogressive growth failure and facial dysmorphism but with normal intelligence have been identified. Because Yakuts are considered as a population isolate and the disease is rare in other populations, genomewide homozygosity mapping was performed using 763 microsatellite markers and candidate gene approach in the critical region to identify the causative gene for the short stature syndrome in Yakut. All families shared an identical haplotype in the same region as the identical loci responsible for 3-M and gloomy face syndromes and a novel homozygous 4582insT mutation in Cullin 7 (CUL7) was found, which resulted in a frameshift mutation and the formation of a subsequent premature stop codon at 1553 (Q1553X). Yakut patients with short stature syndrome have unique features such as a high frequency of neonatal respiratory distress and few bone abnormalities, whereas the clinical features of the other Yakut patients were similar to those of 3-M syndrome. Furthermore, abnormal vascularisation was present in the fetal placenta and an abnormal development of cartilage tissue in the bronchus of a fetus with CUL7 mutation. These findings may provide a new understanding of the clinical diversity and pathogenesis of short stature syndrome with CUL7 mutation.

  7. Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

    International Nuclear Information System (INIS)

    Hafeez, M.

    2007-01-01

    To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

  8. Heterozygosity for ARID2 loss-of-function mutations in individuals with a Coffin-Siris syndrome-like phenotype.

    Science.gov (United States)

    Bramswig, Nuria C; Caluseriu, O; Lüdecke, H-J; Bolduc, F V; Noel, N C L; Wieland, T; Surowy, H M; Christen, H-J; Engels, H; Strom, T M; Wieczorek, D

    2017-03-01

    Chromatin remodeling is a complex process shaping the nucleosome landscape, thereby regulating the accessibility of transcription factors to regulatory regions of target genes and ultimately managing gene expression. The SWI/SNF (switch/sucrose nonfermentable) complex remodels the nucleosome landscape in an ATP-dependent manner and is divided into the two major subclasses Brahma-associated factor (BAF) and Polybromo Brahma-associated factor (PBAF) complex. Somatic mutations in subunits of the SWI/SNF complex have been associated with different cancers, while germline mutations have been associated with autism spectrum disorder and the neurodevelopmental disorders Coffin-Siris (CSS) and Nicolaides-Baraitser syndromes (NCBRS). CSS is characterized by intellectual disability (ID), coarsening of the face and hypoplasia or absence of the fifth finger- and/or toenails. So far, variants in five of the SWI/SNF subunit-encoding genes ARID1B, SMARCA4, SMARCB1, ARID1A, and SMARCE1 as well as variants in the transcription factor-encoding gene SOX11 have been identified in CSS-affected individuals. ARID2 is a member of the PBAF subcomplex, which until recently had not been linked to any neurodevelopmental phenotypes. In 2015, mutations in the ARID2 gene were associated with intellectual disability. In this study, we report on two individuals with private de novo ARID2 frameshift mutations. Both individuals present with a CSS-like phenotype including ID, coarsening of facial features, other recognizable facial dysmorphisms and hypoplasia of the fifth toenails. Hence, this study identifies mutations in the ARID2 gene as a novel and rare cause for a CSS-like phenotype and enlarges the list of CSS-like genes.

  9. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0

    Directory of Open Access Journals (Sweden)

    Pereira Maria

    2010-01-01

    Full Text Available Abstract Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X and a novel frameshift mutation (966_967delGA/insC which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions.

  10. Mutation breeding in pepper

    International Nuclear Information System (INIS)

    Daskalov, S.

    1986-01-01

    Pepper (Capsicum sp.) is an important vegetable and spice crop widely grown in tropical as well as in temperate regions. Until recently the improvement programmes were based mainly on using natural sources of germ plasma, crossbreeding and exploiting the heterosis of F 1 hybrids. However, interest in using induced mutations is growing. A great number of agronomically useful mutants as well as mutants valuable for genetic, cytological and physiological studies have been induced and described. In this review information is presented about suitable mutagen treatment procedures with radiation as well as chemicals, M 1 effects, handling the treated material in M 1 , M 2 and subsequent generations, and mutant screening procedures. This is supplemented by a description of reported useful mutants and released cultivars. Finally, general advice is given on when and how to incorporate mutation induction in Capsicum improvement programmes. (author)

  11. Mutations causative of familial hypercholesterolaemia

    DEFF Research Database (Denmark)

    Benn, Marianne; Watts, Gerald F; Tybjærg-Hansen, Anne

    2016-01-01

    causing mutations in 98 098 participants from the general population, the Copenhagen General Population Study. METHODS AND RESULTS: We genotyped for LDLR[W23X;W66G;W556S] and APOB[R3500Q] accounting for 38.7% of pathogenic FH mutations in Copenhagen. Clinical FH assessment excluded mutation information......-cholesterol concentration to discriminate between mutation carriers and non-carriers was 4.4 mmol/L. CONCLUSION: Familial hypercholesterolaemia-causing mutations are estimated to occur in 1:217 in the general population and are best identified by a definite or probable phenotypic diagnosis of FH based on the DLCN criteria...

  12. Mutation selection of strawberries

    International Nuclear Information System (INIS)

    Repka, F.; Tsaganova, I.

    1986-01-01

    A brief account is given of the preliminary results of selection work carried out with the aim of deriving a variety of strawberry suitable for mechanized picking. Mutation selection based on irradiation by gamma rays, fast neutrons and a laser beam has been used. The irradiation was performed on strawberry seedlings grown under field conditions and on in vitro cultures at different stages of development. The studies are continuing. (author)

  13. Septin mutations in human cancers

    Directory of Open Access Journals (Sweden)

    Elias T Spiliotis

    2016-11-01

    Full Text Available Septins are GTP-binding proteins that are evolutionarily and structurally related to the RAS oncogenes. Septin expression levels are altered in many cancers and new advances point to how abnormal septin expression may contribute to the progression of cancer. In contrast to the RAS GTPases, which are frequently mutated and actively promote tumorigenesis, little is known about the occurrence and role of septin mutations in human cancers. Here, we review septin missense mutations that are currently in the Catalog of Somatic Mutations in Cancer (COSMIC database. The majority of septin mutations occur in tumors of the large intestine, skin, endometrium and stomach. Over 25% of the annotated mutations in SEPT2, SEPT4 and SEPT9 belong to large intestine tumors. From all septins, SEPT9 and SEPT14 exhibit the highest mutation frequencies in skin, stomach and large intestine cancers. While septin mutations occur with frequencies lower than 3%, recurring mutations in several invariant and highly conserved amino acids are found across different septin paralogs and tumor types. Interestingly, a significant number of these mutations occur in the GTP-binding pocket and septin dimerization interfaces. Future studies may determine how these somatic mutations affect septin structure and function, whether they contribute to the progression of specific cancers and if they could serve as tumor-specific biomarkers.

  14. Extracellular matrix and nuclear abnormalities in skeletal muscle of a patient with Walker-Warburg syndrome caused by POMT1 mutation.

    Science.gov (United States)

    Sabatelli, Patrizia; Columbaro, Marta; Mura, Isabella; Capanni, Cristina; Lattanzi, Giovanna; Maraldi, Nadir M; Beltràn-Valero de Barnabè, Daniel; van Bokoven, Hans; Squarzoni, Stefano; Merlini, Luciano

    2003-05-20

    Walker-Warburg syndrome (WWS) is an autosomal recessive disorder characterized by congenital muscular dystrophy, structural eye abnormalities and severe brain malformations. We performed an immunohistochemical and electron microscopy study of a muscle biopsy from a patient affected by WWS carrying a homozygous frameshift mutation in O-mannosyltransferase 1 gene (POMT1). alpha-Dystroglycan glycosylated epitope was not detected in muscle fibers and intramuscular peripheral nerves. Laminin alpha2 chain and perlecan were reduced in muscle fibers and well preserved in intramuscular peripheral nerves. The basal lamina in several muscle fibers showed discontinuities and detachment from the plasmalemma. Most nuclei, including myonuclei and satellite cell nuclei, showed detachment or complete absence of peripheral heterochromatin from the nuclear envelope. Apoptotic changes were detected in 3% of muscle fibers. The particular combination of basal lamina and nuclear changes may suggest that a complex pathogenetic mechanism, affecting several subcellular compartments, underlies the degenerative process in WWS muscle.

  15. A novel SLC25A20 splicing mutation in patients of different ethnic origin with neonatally lethal carnitine-acylcarnitine translocase (CACT) deficiency.

    Science.gov (United States)

    Korman, Stanley H; Pitt, James J; Boneh, Avihu; Dweikat, Imad; Zater, Mokhtar; Meiner, Vardiella; Gutman, Alisa; Brivet, Michèle

    2006-12-01

    Carnitine-acylcarnitine translocase (CACT) deficiency is a rare disorder of fatty acid oxidation associated with high mortality. Two female newborns of different ethnic origin (the first Anglo-Celtic and the second Palestinian Arab) both died after sudden collapse on day 2 of life. Both had elevated bloodspot long-chain acylcarnitines consistent with either CACT or carnitine palmitoyltransferase II (CPT2) deficiency; the latter was excluded by demonstrating normal CPT2 activity in fibroblasts. Direct sequencing of all SLC25A20 (CACT) gene exons and exon-intron boundaries revealed that Patient 1 was compound heterozygous for a novel c.609-3c>g (IVS6-3c>g) mutation on the paternal allele and a previously described c.326delG mutation on the maternal allele. Patient 2 was homozygous for the same, novel c.609-3c>g mutation. Previously reported SLC25A20 mutations have been almost exclusively confined to a single family or ethnic group. Analysis of fibroblast cDNA by RT-PCR, agarose gel electrophoresis and sequencing of extracted bands showed that both mutations produce aberrant splicing. c.609-3C>G results in exon 7 skipping leading to a frameshift with premature termination seven amino acids downstream. c.326delG was confirmed to produce skipping of exons 3 or 3 plus 4. CACT activity in both patients' fibroblasts was near-zero. For both families, prenatal diagnosis of an unaffected fetus was performed by mutation analysis on CVS tissue in a subsequent pregnancy. Due to the urgency of prenatal diagnosis in the second family, molecular diagnosis was performed prior to demonstration of CACT enzyme deficiency, illustrating that mutation analysis is a rapid and reliable approach to first-line diagnosis of CACT deficiency.

  16. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Tsutomu Ogata

    Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.

  17. Four mutations in SH2 and SH3 domains of Bruton`s tyrosine kinase (BTK) resulting in classic X-linked agammaglobulinemia (XLA)

    Energy Technology Data Exchange (ETDEWEB)

    Chen, S.H.; Zhang, M.; Zhu, Q.; Scott, C.R.; Och, H.D. [Univ. of Washington, Seattle, WA (United States)

    1994-09-01

    XLA is an X-linked immunodeficient disease in man resulted from mutations in the BTK gene. BTK contains a unique amino-region of unknown function, SH2 and SH3 (src homology) domains, and a carboxyl-terminal kinase (SH1) domain. We have studied the normal genomic organizations of the SH2 and SH3 domains and found the regions containing 6 exons are about 3000 bp in length. We also carried out sequence analyses of cDNA and genomic DNA of XLA patients to identify mutations. Four of fourteen families with XLA were found to have mutations within the regions. (1) A point mutation G to T in codon 240 resulted in a stop codon. (2) A transition mutation (g to a) at first nucleotide of intron 8 resulted in exon 8 skipping, missing 21 codons and shorter polypeptide but with normal kinase activity and ATP binding ability. (3) An a to t transversion at one of the invariant dinucleotides (ag) of the 3{prime} end of intron 11 resulted in alternative splicing at a position 13 nucleotides downstream from the normal one. The mutation produced mRNA with 13 nucleotide deletion and presumably resulted in a frameshift at codon 372 leading to a stop codon at 398. (4) A 16 nucleotide duplication (1248 to 1263 of the cDNA sequence) consistently present in mRNA of three brothers with XLA. However, genomic sequence of patient DNA of the regions did not reveal the anormaly. The observation that mutations within SH2 and SH3 causing severe B-cell defects typical for XLA suggests that these two domains are crucial for the function of BTK, possibly by regulating the interaction of cytoplasmic proteins involved in signal transduction.

  18. A splice acceptor mutation in C. elegans daf-19/Rfx disrupts functional specialization of male-specific ciliated neurons but does not affect ciliogenesis.

    Science.gov (United States)

    Wells, Kristen L; Rowneki, Mazhgan; Killian, Darrell J

    2015-04-01

    RFX transcription factors are master regulators of ciliogenesis in diverse animal species. The sole Caenorhabditis elegans RFX homolog, DAF-19, plays at least two roles in the formation of functional cilia. The DAF-19(C) isoform is required for ciliogenesis and the DAF-19(M) isoform is required for the functional specialization of a subset of male-specific ciliated neurons called PKD neurons. Here we report the identification of a novel mutation, daf-19(sm129), which disrupts the functional specification of PKD neurons and thus suggests that daf-19m activity is compromised. However, ciliogenesis is not disrupted in daf-19(sm129) mutants suggesting that daf-19c activity is retained. The sm129 mutation disrupts a splice acceptor site adjacent to an exon common to the daf-19c and daf-19m isoforms resulting in aberrant splicing in a proportion of transcripts. While aberrant splicing of daf-19c to upstream cryptic sites results in in-frame and functional products, a large proportion of daf-19m mRNAs include the entire upstream intron, which introduces a frameshift and stop codons. At least 15% of disease-causing mutations affect splicing of the gene bearing the mutation, thus it is important to understand the consequences of splice site mutations on gene function. However, predicting the effects of a splice site mutation remains difficult and experimental determination is still required. Using daf-19(sm129) as a model, our results suggest that this problem is exacerbated when a splice acceptor mutation is used by multiple isoforms of the same gene because the effects on each isoform can be dramatically different. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. p53 mutation is infrequent in clear cell carcinoma of the ovary.

    Science.gov (United States)

    Ho, E S; Lai, C R; Hsieh, Y T; Chen, J T; Lin, A J; Hung, M H; Liu, F S

    2001-02-01

    p53 gene alteration has been extensively studied in epithelial ovarian cancer. However, its occurrence in clear cell carcinoma, an infrequent histologic subtype of epithelial ovarian cancer, is rarely reported. The aim of this study is to determine the status of p53 gene alteration in this distinct type of ovarian carcinoma. Paraffin blocks of tumors from 38 patients with primary or recurrent ovarian clear cell carcinoma were studied for p53 alteration. All these tumors were subjected to immunohistochemical and molecular analysis. Two monoclonal antibodies (DO-7 and PAb 1801) were used for immunohistochemical staining. Genomic DNAs extracted from paraffin blocks of the 38 tumors were subscribed for a nested polymerase chain reaction/single-strand conformation polymorphism (PCR/SSCP) analysis. Tumors showing band shift on SSCP were further prepared for DNA sequencing to determine the site of mutation. Overexpression of p53 was observed in only one stage III clear cell carcinoma. However, focal positive p53 staining was noted in another five tumors. Of the six tumors showing positive immunohistochemistry, p53 alterations were noted in four tumors. Three tumors revealed a missense point mutation: two were in exon 7 (TCT(227) --> TTT and GGC(245) --> AGC) and one was in exon 5 (CGC(156) --> CAC). Another tumor revealed a 12-bp deletion in two possible ways: it might involve the last four codons at the 3' end of exon 4 (nucleotides 12,288-12,299) or it might cross over the splice junction between exon 4 and intron 4 (nucleotides 12,290-12,301). The former would result in a predicted protein product of 389 amino acids whereas the latter would cause a frameshift in the gene sequence and would result in a truncated protein. Mutations in p53 appear to be much less frequent in clear cell carcinoma than in other histologic types of epithelial ovarian cancer. We suggest that p53 alterations may not play an important role in the development of clear cell carcinoma.

  20. De novo mutations of KIAA2022 in females cause intellectual disability and intractable epilepsy.

    Science.gov (United States)

    de Lange, Iris M; Helbig, Katherine L; Weckhuysen, Sarah; Møller, Rikke S; Velinov, Milen; Dolzhanskaya, Natalia; Marsh, Eric; Helbig, Ingo; Devinsky, Orrin; Tang, Sha; Mefford, Heather C; Myers, Candace T; van Paesschen, Wim; Striano, Pasquale; van Gassen, Koen; van Kempen, Marjan; de Kovel, Carolien G F; Piard, Juliette; Minassian, Berge A; Nezarati, Marjan M; Pessoa, André; Jacquette, Aurelia; Maher, Bridget; Balestrini, Simona; Sisodiya, Sanjay; Warde, Marie Therese Abi; De St Martin, Anne; Chelly, Jamel; van 't Slot, Ruben; Van Maldergem, Lionel; Brilstra, Eva H; Koeleman, Bobby P C

    2016-12-01

    Mutations in the KIAA2022 gene have been reported in male patients with X-linked intellectual disability, and related female carriers were unaffected. Here, we report 14 female patients who carry a heterozygous de novo KIAA2022 mutation and share a phenotype characterised by intellectual disability and epilepsy. Reported females were selected for genetic testing because of substantial developmental problems and/or epilepsy. X-inactivation and expression studies were performed when possible. All mutations were predicted to result in a frameshift or premature stop. 12 out of 14 patients had intractable epilepsy with myoclonic and/or absence seizures, and generalised in 11. Thirteen patients had mild to severe intellectual disability. This female phenotype partially overlaps with the reported male phenotype which consists of more severe intellectual disability, microcephaly, growth retardation, facial dysmorphisms and, less frequently, epilepsy. One female patient showed completely skewed X-inactivation, complete absence of RNA expression in blood and a phenotype similar to male patients. In the six other tested patients, X-inactivation was random, confirmed by a non-significant twofold to threefold decrease of RNA expression in blood, consistent with the expected mosaicism between cells expressing mutant or normal KIAA2022 alleles. Heterozygous loss of KIAA2022 expression is a cause of intellectual disability in females. Compared with its hemizygous male counterpart, the heterozygous female disease has less severe intellectual disability, but is more often associated with a severe and intractable myoclonic epilepsy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. Reduced lentivirus susceptibility in sheep with TMEM154 mutations.

    Directory of Open Access Journals (Sweden)

    Michael P Heaton

    2012-01-01

    Full Text Available Visna/Maedi, or ovine progressive pneumonia (OPP as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154 that exceeded genome-wide significance (unadjusted p-value 3×10(-9. Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E at position 35 were associated with infection while a third haplotype with lysine (K at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-value<0.0001, 95% CI 5-1,100. In a combined analysis of nine cohorts with 2,705 sheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-value<0.0001, 95% CI 2.36-3.43. Although rare, some sheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection.

  2. Identification of a Novel Heterozygous De Novo 7-bp Frameshift Deletion in PBX1 by Whole-Exome Sequencing Causing a Multi-Organ Syndrome Including Bilateral Dysplastic Kidneys and Hypoplastic Clavicles

    Directory of Open Access Journals (Sweden)

    Korbinian Maria Riedhammer

    2017-11-01

    Full Text Available IntroductionCongenital anomalies of the kidney and urinary tract (CAKUT represent the primary cause of chronic kidney disease in children. Many genes have been attributed to the genesis of this disorder. Recently, haploinsufficiency of PBX1 caused by microdeletions has been shown to result in bilateral renal hypoplasia and other organ malformations.Materials and methodsHere, we report on a 14-year-old male patient with congenital bilateral dysplastic kidneys, cryptorchidism, hypoplastic clavicles, developmental delay, impaired intelligence, and minor dysmorphic features. Presuming a syndromic origin, we performed SNP array analysis to scan for large copy number variations (CNVs followed by whole-exome sequencing (WES. Sanger sequencing was done to confirm the variant’s de novo status.ResultsSNP array analysis did not reveal any microdeletions or -duplications larger than 50 or 100 kb, respectively. WES identified a novel heterozygous 7-bp frameshift deletion in PBX1 (c.413_419del, p.Gly138Valfs*40 resulting in a loss-of-function. The de novo status could be confirmed by Sanger sequencing.DiscussionBy WES, we identified a novel heterozygous de novo 7-bp frameshift deletion in PBX1. Our findings expand the spectrum of causative variants in PBX1-related CAKUT. In this case, WES proved to be the apt technique to detect the variant responsible for the patient’s phenotype, as single gene testing is not feasible given the multitude of genes involved in CAKUT and SNP array analysis misses rare single-nucleotide variants and small Indels.

  3. Association between mutation spectra and stable and unstable DNA adduct profiles in Salmonella for benzo[a]pyrene and dibenzo[a,l]pyrene

    Energy Technology Data Exchange (ETDEWEB)

    DeMarini, David M., E-mail: demarini.david@epa.gov [Integrated Systems Toxicology Division, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States); Hanley, Nancy M.; Warren, Sarah H.; Adams, Linda D.; King, Leon C. [Integrated Systems Toxicology Division, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States)

    2011-09-01

    Highlights: {yields} Benzo[a]pyrene (BP) induces stable DNA adducts and mutations primarily at guanine. {yields} Dibenzo[a,l]pyrene (DBP) induces them primarily at adenine. {yields} BP induces abasic sites, but DBP does not in the Salmonella mutagenicity assay. {yields} Stable DNA adducts alone appear to account for the mutation spectrum of DBP. {yields} Stable DNA adducts and possibly abasic sites account for the mutation spectrum of BP. - Abstract: Benzo[a]pyrene (BP) and dibenzo[a,l]pyrene (DBP) are two polycyclic aromatic hydrocarbons (PAHs) that exhibit distinctly different mutagenicity and carcinogenicity profiles. Although some studies show that these PAHs produce unstable DNA adducts, conflicting data and arguments have been presented regarding the relative roles of these unstable adducts versus stable adducts, as well as oxidative damage, in the mutagenesis and tumor-mutation spectra of these PAHs. However, no study has determined the mutation spectra along with the stable and unstable DNA adducts in the same system with both PAHs. Thus, we determined the mutagenic potencies and mutation spectra of BP and DBP in strains TA98, TA100 and TA104 of Salmonella, and we also measured the levels of abasic sites (aldehydic-site assay) and characterized the stable DNA adducts ({sup 32}P-postlabeling/HPLC) induced by these PAHs in TA104. Our results for the mutation spectra and site specificity of stable adducts were consistent with those from other systems, showing that DBP was more mutagenic than BP in TA98 and TA100. The mutation spectra of DBP and BP were significantly different in TA98 and TA104, with 24% of the mutations induced by BP in TA98 being complex frameshifts, whereas DBP produced hardly any of these mutations. In TA104, BP produced primarily GC to TA transversions, whereas DBP produced primarily AT to TA transversions. The majority (96%) of stable adducts induced by BP were at guanine, whereas the majority (80%) induced by DBP were at adenine

  4. Mutation breeding in chickpea

    International Nuclear Information System (INIS)

    2009-01-01

    Chickpea is an important food legume in Turkey. Turkey is one of the most important gene centers in the world for legumes. The most widely known characteristic of chickpea is that it is an important vegetable protein source used in human and animal nutrition. However, the dry grains of chickpea, has 2-3 times more protein than our traditional food of wheat. In addition, cheakpea is also energy source because of its high carbohydrate content. It is very rich in some vitamin and mineral basis. In the plant breeding, mutation induction has become an effective way of supplementing existing germplasm and improving cultivars. Many successful examples of mutation induction have proved that mutation breeding is an effective and important approach to food legume improvement. The induced mutation technique in chickpea has proved successful and good results have been attained. Realizing the potential of induced mutations, a mutation breeding programme was initiated at the Nuclear Agriculture Section of the Saraykoey Nuclear Research and Training Center in 1994. The purpose of the study was to obtain high yielding chickpea mutants with large seeds, good cooking quality and high protein content. Beside this some characters such as higher adaptation ability, tolerant to cold and drought, increased machinery harvest type, higher yield, resistant to diseases especially to antracnose and pest were investigated too. Parents varieties were ILC-482, AK-7114 and AKCIN-91 (9 % seed moisture content and germination percentage 98 %) in these experiments. The irradiation doses were 0 (control), 50, 100, 150, 200, 250, 300, 350, 400, 500 ve 600 Gy for greenhouse experiments and 0 (control), 50, 100, 150, 200, 250, 300, 350 ve 400 Gy for field experiments, respectively. One thousand seeds for per treatment were sown in the field for the M 1 . At maturity, 3500 single plants were harvested and 20 seeds were taken from each M 1 plant and planted in the following season. During plant growth

  5. Amplification-refractory mutation system (ARMS) analysis of point mutations.

    Science.gov (United States)

    Little, S

    2001-05-01

    The amplification-refractory mutation system (ARMS) is a simple method for detecting any mutation involving single base changes or small deletions. ARMS is based on the use of sequence-specific PCR primers that allow amplification of test DNA only when the target allele is contained within the sample. Following an ARMS reaction the presence or absence of a PCR product is diagnostic for the presence or absence of the target allele. The protocols detailed here outline methods that can be used to analyze human genomic DNA for one or more mutations. The Basic Protocol describes the development and application of an ARMS test for a single mutation; the Alternate Protocol extends this to multiplex ARMS for the analysis of two or more mutations. The Support Protocol describes a rapid DNA extraction method from blood or mouthwash samples that yields DNA compatible with the type of tests described. The amplification-refractory mutation system (ARMS) is a simple method for detecting any mutation involving single base change The amplification-refractory mutation system (ARMS) is a simple method for detecting any mutation involving single base change.

  6. Induced mutations in citrus

    International Nuclear Information System (INIS)

    Spiegel-Roy, P.; Vardi, Aliza

    1990-01-01

    Full text: Parthenocarpic tendency is an important prerequisite for successful induction of seedlessness in breeding and especially in mutation breeding. A gene for asynapsis and accompanying seedless fruit has been found by us in inbred progeny of cv. 'Wilking'. Using budwood irradiation by gamma rays, seedless mutants of 'Eureka' and 'Villafranca' lemon (original clone of the latter has 25 seeds) and 'Minneola' tangelo have been obtained. Ovule sterility of the three mutants is nearly complete, with some pollen fertility still remaining. A semi-compact mutant of Shamouti orange has been obtained by irradiation. A programme for inducing seedlessness in easy peeling citrus varieties and selections has been initiated. (author)

  7. Mutations in TCF8 Cause Posterior Polymorphous Corneal Dystrophy and Ectopic Expression of COL4A3 by Corneal Endothelial Cells

    Science.gov (United States)

    Krafchak, Charles M. ; Pawar, Hemant ; Moroi, Sayoko E. ; Sugar, Alan ; Lichter, Paul R. ; Mackey, David A. ; Mian, Shahzad ; Nairus, Theresa ; Elner, Victor ; Schteingart, Miriam T. ; Downs, Catherine A. ; Kijek, Theresa Guckian ; Johnson, Jenae M. ; Trager, Edward H. ; Rozsa, Frank W. ; Ali Mandal, Md Nawajes ; Epstein, Michael P. ; Vollrath, Douglas ; Ayyagari, Radha ; Boehnke, Michael ; Richards, Julia E. 

    2005-01-01

    Posterior polymorphous corneal dystrophy (PPCD, also known as PPMD) is a rare disease involving metaplasia and overgrowth of corneal endothelial cells. In patients with PPCD, these cells manifest in an epithelial morphology and gene expression pattern, produce an aberrant basement membrane, and, sometimes, spread over the iris and nearby structures in a way that increases the risk for glaucoma. We previously mapped PPCD to a region (PPCD3) on chromosome 10 containing the gene that encodes the two-handed zinc-finger homeodomain transcription factor TCF8. Here, we report a heterozygous frameshift mutation in TCF8 that segregates with PPCD in the family used to map PPCD3 and four different heterozygous nonsense and frameshift mutations in TCF8 in four other PPCD probands. Family reports of inguinal hernia, hydrocele, and possible bone anomalies in affected individuals suggest that individuals with TCF8 mutations should be examined for nonocular anomalies. We detect transcripts of all three identified PPCD genes (VSX1, COL8A2, and TCF8) in the cornea. We show presence of a complex (core plus secondary) binding site for TCF8 in the promoter of Alport syndrome gene COL4A3, which encodes collagen type IV α3, and we present immunohistochemical evidence of ectopic expression of COL4A3 in corneal endothelium of the proband of the original PPCD3 family. Identification of TCF8 as the PPCD3 gene provides a valuable tool for the study of critical gene regulation events in PPCD pathology and suggests a possible role for TCF8 mutations in altered structure and function of cells lining body cavities other than the anterior chamber of the eye. Thus, this study has identified TCF8 as the gene responsible for approximately half of the cases of PPCD, has implicated TCF8 mutations in developmental abnormalities outside the eye, and has presented the TCF8 regulatory target, COL4A3, as a key, shared molecular component of two different diseases, PPCD and Alport syndrome. PMID:16252232

  8. Mutation Breeding Newsletter. No. 39

    International Nuclear Information System (INIS)

    1992-01-01

    This newsletter contains brief articles on the use of radiation to induce mutations in plants; radiation-induced mutants in Chrysanthemum; disrupting the association between oil and protein content in soybean seeds; mutation studies on bougainvillea; a new pepper cultivar; and the use of mutation induction to improve the quality of yam beans. A short review of the seminar on the use of mutation and related biotechnology for crop improvement in the Middle East and Mediterranean regions, and a description of a Co-ordinated Research Programme on the application of DNA-based marker mutations for the improvement of cereals and other sexually reproduced crop species are also included. Two tables are given: these are based on the ''FAO/IAEA Mutant Varieties Database'' and show the number of mutated varieties and the number of officially released mutant varieties in particular crops/species. Refs and tabs

  9. Mutation breeding in mangosteen

    International Nuclear Information System (INIS)

    Mohd Khalid Mohd Zain

    2002-01-01

    Mangosteen the queen of the tropical fruits is apomitic and only a cultivar is reported and it reproduces asexually. Conventional breeding is not possible and the other methods to create variabilities are through genetic engineering and mutation breeding. The former technique is still in the infantry stage in mangosteen research while the latter has been an established tool in breeding to improve cultivars. In this mutation breeding seeds of mangosteen were irradiated using gamma rays and the LD 50 for mangosteen was determined and noted to be very low at 10 Gy. After sowing in the seedbed, the seedlings were transplanted in polybags and observed in the nursery bed for about one year before planted in the field under old oil palm trees in Station MARDI, Kluang. After evaluation and screening, about 120 mutant mangosteen plants were selected and planted in Kluang. The plants were observed and some growth data taken. There were some mutant plants that have good growth vigour and more vigorous that the control plants. The trial are now in the fourth year and the plants are still in the juvenile stage. (Author)

  10. Mutation breeding in chickpea

    International Nuclear Information System (INIS)

    Sagel, Z.; Tutluer, M. I.; Peskircioglu, H.; Kantoglu, Y.; Kunter, B.

    2009-01-01

    Chickpea is an important food legume in Turkey. Turkey is one of the most important gene centers in the world for legumes. Realizing the potential of induced mutations, a mutation breeding programme was initiated at the Nuclear Agriculture Section of the Saraykoy Nuclear Research and Training Center in 1994. The purpose of the study was to obtain high yielding chickpea mutants with large seeds, good cooking quality and high protein content. Beside this some characters such as higher adaptation ability, tolerant to cold and drought, increased machinery harvest type, higher yield, resistant to diseases especially to antracnose and pest were investigated too. Parent varieties were ILC-482, AK-7114 and AKCIN-91 had been used in these experiments. The irradiation doses were 0 (control), 50, 100, 150, 200, 250, 300, 350 and 400 Gy for field experiments, respectively. As a result of these experiments, two promising mutant lines were chosen and given to the Seed Registration and Certification Center for official registration These two promising mutants were tested at five different locations of Turkey, in 2004 and 2005 years. After 2 years of registration experiments one of outstanding mutants was officially released as mutant chickpea variety under the name TAEK-SAGEL, in 2006. Some basic characteristics of this mutant are; earliness (95-100 day), high yield capacity (180-220 kg/da), high seed protein (22-25 %), first pot height (20-25 cm), 100 seeds weight (42-48 g), cooking time (35-40 min) and resistance to Ascochyta blight.

  11. Mutation breeding newsletter. No. 43

    International Nuclear Information System (INIS)

    1997-10-01

    This issue of the Newsletter includes articles dealing with radiation induced mutation based plant breeding research findings aimed at improving productivity, disease resistance and tolerance of stress conditions

  12. Molecular analysis of the APC and MUTYH genes in Galician and Catalonian FAP families: a different spectrum of mutations?

    Science.gov (United States)

    Gómez-Fernández, Nuria; Castellví-Bel, Sergi; Fernández-Rozadilla, Ceres; Balaguer, Francesc; Muñoz, Jenifer; Madrigal, Irene; Milà, Montserrat; Graña, Begoña; Vega, Ana; Castells, Antoni; Carracedo, Angel; Ruiz-Ponte, Clara

    2009-06-16

    Familial adenomatous polyposis (FAP) is an autosomal dominant-inherited colorectal cancer syndrome, caused by germline mutations in the APC gene. Recently, biallelic mutations in MUTYH have also been identified in patients with multiple colorectal adenomas and in APC-negative patients with FAP. The aim of this work is therefore to determine the frequency of APC and MUTYH mutations among FAP families from two Spanish populations. Eighty-two unrelated patients with classical or attenuated FAP were screened for APC germline mutations. MUTYH analysis was then conducted in those APC-negative families and in 9 additional patients from a previous study. Direct sequencing, SSCP analysis and TaqMan genotyping were used to identify point and frameshift mutations, meanwhile large rearrangements in the APC gene were screened by multiplex ligation-dependent probe amplification (MLPA). APC germline mutations were found in 39% of the patients and, despite the great number of genetic variants described so far in this gene, seven new mutations were identified. The two hotspots at codons 1061 and 1309 of the APC gene accounted for 9,4% of the APC-positive families, although they were underrepresented in Galician samples. The deletion at codon 1061 was not found in 19 APC-positive Galician patients but represented 23% of the Catalonian positive families (p = 0,058). The same trend was observed at codon 1309, even though statistical analysis showed no significance between populations. Twenty-four percent of the APC-negative patients carried biallelic MUTYH germline mutations, and showed an attenuated polyposis phenotype generally without extracolonic manifestations. New genetic variants were found, as well as the two hotspots already reported (p.Tyr165Cys and p.Gly382Asp). The results we present indicate that in Galician patients the frequency of the hotspot at codon 1061 in APC differs significantly from the Catalonian and also other Caucasian populations. Similar results had already

  13. Functional and cellular characterization of human Retinoic Acid Induced 1 (RAI1) mutations associated with Smith-Magenis Syndrome.

    Science.gov (United States)

    Carmona-Mora, Paulina; Encina, Carolina A; Canales, Cesar P; Cao, Lei; Molina, Jessica; Kairath, Pamela; Young, Juan I; Walz, Katherina

    2010-08-25

    Smith-Magenis Syndrome is a contiguous gene syndrome in which the dosage sensitive gene has been identified: the Retinoic Acid Induced 1 (RAI1). Little is known about the function of human RAI1. We generated the full-length cDNA of the wild type protein and five mutated forms: RAI1-HA 2687delC, RAI1-HA 3103delC, RAI1 R960X, RAI1-HA Q1562R, and RAI1-HA S1808N. Four of them have been previously associated with SMS clinical phenotype. Molecular weight, subcellular localization and transcription factor activity of the wild type and mutant forms were studied by western blot, immunofluorescence and luciferase assays respectively. The wild type protein and the two missense mutations presented a higher molecular weight than expected, localized to the nucleus and activated transcription of a reporter gene. The frameshift mutations generated a truncated polypeptide with transcription factor activity but abnormal subcellular localization, and the same was true for the 1-960aa N-terminal half of RAI1. Two different C-terminal halves of the RAI1 protein (1038aa-end and 1229aa-end) were able to localize into the nucleus but had no transactivation activity. Our results indicate that transcription factor activity and subcellular localization signals reside in two separate domains of the protein and both are essential for the correct functionality of RAI1. The pathogenic outcome of some of the mutated forms can be explained by the dissociation of these two domains.

  14. Functional and cellular characterization of human Retinoic Acid Induced 1 (RAI1 mutations associated with Smith-Magenis Syndrome

    Directory of Open Access Journals (Sweden)

    Carmona-Mora Paulina

    2010-08-01

    Full Text Available Abstract Background Smith-Magenis Syndrome is a contiguous gene syndrome in which the dosage sensitive gene has been identified: the Retinoic Acid Induced 1 (RAI1. Little is known about the function of human RAI1. Results We generated the full-length cDNA of the wild type protein and five mutated forms: RAI1-HA 2687delC, RAI1-HA 3103delC, RAI1 R960X, RAI1-HA Q1562R, and RAI1-HA S1808N. Four of them have been previously associated with SMS clinical phenotype. Molecular weight, subcellular localization and transcription factor activity of the wild type and mutant forms were studied by western blot, immunofluorescence and luciferase assays respectively. The wild type protein and the two missense mutations presented a higher molecular weight than expected, localized to the nucleus and activated transcription of a reporter gene. The frameshift mutations generated a truncated polypeptide with transcription factor activity but abnormal subcellular localization, and the same was true for the 1-960aa N-terminal half of RAI1. Two different C-terminal halves of the RAI1 protein (1038aa-end and 1229aa-end were able to localize into the nucleus but had no transactivation activity. Conclusion Our results indicate that transcription factor activity and subcellular localization signals reside in two separate domains of the protein and both are essential for the correct functionality of RAI1. The pathogenic outcome of some of the mutated forms can be explained by the dissociation of these two domains.

  15. Targeted Next-Generation Sequencing of a 12.5 Mb Homozygous Region Reveals ANO10 Mutations in Patients with Autosomal-Recessive Cerebellar Ataxia

    Science.gov (United States)

    Vermeer, Sascha; Hoischen, Alexander; Meijer, Rowdy P.P.; Gilissen, Christian; Neveling, Kornelia; Wieskamp, Nienke; de Brouwer, Arjan; Koenig, Michel; Anheim, Mathieu; Assoum, Mirna; Drouot, Nathalie; Todorovic, Slobodanka; Milic-Rasic, Vedrana; Lochmüller, Hanns; Stevanin, Giovanni; Goizet, Cyril; David, Albert; Durr, Alexandra; Brice, Alexis; Kremer, Berry; van de Warrenburg, Bart P.C.; Schijvenaars, Mascha M.V.A.P.; Heister, Angelien; Kwint, Michael; Arts, Peer; van der Wijst, Jenny; Veltman, Joris; Kamsteeg, Erik-Jan; Scheffer, Hans; Knoers, Nine

    2010-01-01

    Autosomal-recessive cerebellar ataxias comprise a clinically and genetically heterogeneous group of neurodegenerative disorders. In contrast to their dominant counterparts, unraveling the molecular background of these ataxias has proven to be more complicated and the currently known mutations provide incomplete coverage for genotyping of patients. By combining SNP array-based linkage analysis and targeted resequencing of relevant sequences in the linkage interval with the use of next-generation sequencing technology, we identified a mutation in a gene and have shown its association with autosomal-recessive cerebellar ataxia. In a Dutch consanguineous family with three affected siblings a homozygous 12.5 Mb region on chromosome 3 was targeted by array-based sequence capture. Prioritization of all detected sequence variants led to four candidate genes, one of which contained a variant with a high base pair conservation score (phyloP score: 5.26). This variant was a leucine-to-arginine substitution in the DUF 590 domain of a 16K transmembrane protein, a putative calcium-activated chloride channel encoded by anoctamin 10 (ANO10). The analysis of ANO10 by Sanger sequencing revealed three additional mutations: a homozygous mutation (c.1150_1151del [p.Leu384fs]) in a Serbian family and a compound-heterozygous splice-site mutation (c.1476+1G>T) and a frameshift mutation (c.1604del [p.Leu535X]) in a French family. This illustrates the power of using initial homozygosity mapping with next-generation sequencing technology to identify genes involved in autosomal-recessive diseases. Moreover, identifying a putative calcium-dependent chloride channel involved in cerebellar ataxia adds another pathway to the list of pathophysiological mechanisms that may cause cerebellar ataxia. PMID:21092923

  16. Two novel exonic point mutations in HEXA identified in a juvenile Tay-Sachs patient: role of alternative splicing and nonsense-mediated mRNA decay.

    Science.gov (United States)

    Levit, A; Nutman, D; Osher, E; Kamhi, E; Navon, R

    2010-06-01

    We have identified three mutations in the beta-hexoseaminidase A (HEXA) gene in a juvenile Tay-Sachs disease (TSD) patient, which exhibited a reduced level of HEXA mRNA. Two mutations are novel, c.814G>A (p.Gly272Arg) and c.1305C>T (p.=), located in exon 8 and in exon 11, respectively. The third mutation, c.1195A>G (p.Asn399Asp) in exon 11, has been previously characterized as a common polymorphism in African-Americans. Hex A activity measured in TSD Glial cells, transfected with HEXA cDNA constructs bearing these mutations, was unaltered from the activity level measured in normal HEXA cDNA. Analysis of RT-PCR products revealed three aberrant transcripts in the patient, one where exon 8 was absent, one where exon 11 was absent and a third lacking both exons 10 and 11. All three novel transcripts contain frameshifts resulting in premature termination codons (PTCs). Transfection of mini-gene constructs carrying the c.814G>A and c.1305C>T mutations proved that the two mutations result in exon skipping. mRNAs that harbor a PTC are detected and degraded by the nonsense-mediated mRNA decay (NMD) pathway to prevent synthesis of abnormal proteins. However, although NMD is functional in the patient's fibroblasts, aberrant transcripts are still present. We suggest that the level of correctly spliced transcripts as well as the efficiency in which NMD degrade the PTC-containing transcripts, apparently plays an important role in the phenotype severity of the unique patient and thus should be considered as a potential target for drug therapy.

  17. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    Science.gov (United States)

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Mutations in the control of virulence sensor gene from Streptococcus pyogenes after infection in mice lead to clonal bacterial variants with altered gene regulatory activity and virulence.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Mayfield

    Full Text Available The cluster of virulence sensor (CovS/responder (CovR two-component operon (CovRS regulates ∼15% of the genes of the Group A Streptococcal pyogenes (GAS genome. Bacterial clones containing inactivating mutations in the covS gene have been isolated from patients with virulent invasive diseases. We report herein an assessment of the nature and types of covS mutations that can occur in both virulent and nonvirulent GAS strains, and assess whether a nonvirulent GAS can attain enhanced virulence through this mechanism. A group of mice were infected with a globally-disseminated clonal M1T1 GAS (isolate 5448, containing wild-type (WT CovRS (5448/CovR+S+, or less virulent engineered GAS strains, AP53/CovR+S+ and Manfredo M5/CovR+S+. SpeB negative GAS clones from wound sites and/or from bacteria disseminated to the spleen were isolated and the covS gene was subjected to DNA sequence analysis. Numerous examples of inactivating mutations were found in CovS in all regions of the gene. The mutations found included frame-shift insertions and deletions, and in-frame small and large deletions in the gene. Many of the mutations found resulted in early translation termination of CovS. Thus, the covS gene is a genomic mutagenic target that gives GAS enhanced virulence. In cases wherein CovS- was discovered, these clonal variants exhibited high lethality, further suggesting that randomly mutated covS genes occur during the course of infection, and lead to the development of a more invasive infection.

  19. WAC loss-of-function mutations cause a recognisable syndrome characterised by dysmorphic features, developmental delay and hypotonia and recapitulate 10p11.23 microdeletion syndrome.

    Science.gov (United States)

    DeSanto, Cori; D'Aco, Kristin; Araujo, Gabriel C; Shannon, Nora; Vernon, Hilary; Rahrig, April; Monaghan, Kristin G; Niu, Zhiyv; Vitazka, Patrik; Dodd, Jonathan; Tang, Sha; Manwaring, Linda; Martir-Negron, Arelis; Schnur, Rhonda E; Juusola, Jane; Schroeder, Audrey; Pan, Vivian; Helbig, Katherine L; Friedman, Bethany; Shinawi, Marwan

    2015-11-01

    Rare de novo mutations have been implicated as a significant cause of idiopathic intellectual disability. Large deletions encompassing 10p11.23 have been implicated in developmental delay, behavioural abnormalities and dysmorphic features, but the genotype-phenotype correlation was not delineated. Mutations in WAC have been recently reported in large screening cohorts of patients with intellectual disability or autism, but no full phenotypic characterisation was described. Clinical and molecular characterisation of six patients with loss-of-function WAC mutations identified by whole exome sequencing was performed. Clinical data were obtained by retrospective chart review, parental interviews, direct patient interaction and formal neuropsychological evaluation. Five heterozygous de novo WAC mutations were identified in six patients. Three of the mutations were nonsense, and two were frameshift; all are predicted to cause loss of function either through nonsense-mediated mRNA decay or protein truncation. Clinical findings included developmental delay (6/6), hypotonia (6/6), behavioural problems (5/6), eye abnormalities (5/6), constipation (5/6), feeding difficulties (4/6), seizures (2/6) and sleep problems (2/6). All patients exhibited common dysmorphic features, including broad/prominent forehead, synophrys and/or bushy eyebrows, depressed nasal bridge and bulbous nasal tip. Posteriorly rotated ears, hirsutism, deep-set eyes, thin upper lip, inverted nipples, hearing loss and branchial cleft anomalies were also noted. Our case series show that loss-of-function mutations in WAC cause a recognisable genetic syndrome characterised by a neurocognitive phenotype and facial dysmorphism. Our data highly suggest that WAC haploinsufficiency is responsible for most of the phenotypic features associated with deletions encompassing 10p11.23. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. Novel genetic linkage of rat Sp6 mutation to Amelogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    Muto Taro

    2012-06-01

    Full Text Available Abstract Background Amelogenesis imperfecta (AI is an inherited disorder characterized by abnormal formation of tooth enamel. Although several genes responsible for AI have been reported, not all causative genes for human AI have been identified to date. AMI rat has been reported as an autosomal recessive mutant with hypoplastic AI isolated from a colony of stroke-prone spontaneously hypertensive rat strain, but the causative gene has not yet been clarified. Through a genetic screen, we identified the causative gene of autosomal recessive AI in AMI and analyzed its role in amelogenesis. Methods cDNA sequencing of possible AI-candidate genes so far identified using total RNA of day 6 AMI rat molars identified a novel responsible mutation in specificity protein 6 (Sp6. Genetic linkage analysis was performed between Sp6 and AI phenotype in AMI. To understand a role of SP6 in AI, we generated the transgenic rats harboring Sp6 transgene in AMI (Ami/Ami + Tg. Histological analyses were performed using the thin sections of control rats, AMI, and Ami/Ami + Tg incisors in maxillae, respectively. Results We found the novel genetic linkage between a 2-bp insertional mutation of Sp6 gene and the AI phenotype in AMI rats. The position of mutation was located in the coding region of Sp6, which caused frameshift mutation and disruption of the third zinc finger domain of SP6 with 11 cryptic amino acid residues and a stop codon. Transfection studies showed that the mutant protein can be translated and localized in the nucleus in the same manner as the wild-type SP6 protein. When we introduced the CMV promoter-driven wild-type Sp6 transgene into AMI rats, the SP6 protein was ectopically expressed in the maturation stage of ameloblasts associated with the extended maturation stage and the shortened reduced stage without any other phenotypical changes. Conclusion We propose the addition of Sp6 mutation as a new molecular diagnostic criterion for the

  1. Recurrent LDL-receptor mutation causes familial ...

    African Journals Online (AJOL)

    1995-05-05

    May 5, 1995 ... mutation detection. Haplotype analysis with polymorphisms on both sides of the FH2 mutation indicated that the identical LDLR gene mutations found in two different South ... amplification refractory mutation system (ARMS)" and single- .... point mutations that cause familial defective apolipoprotein. 8-100 ...

  2. Studies on mutation techniques in rice breeding

    International Nuclear Information System (INIS)

    Wang Cailian; Chen Qiufang; Jin Wei

    2001-01-01

    Synthetical techniques for improving rice mutation breeding efficiency were studied. The techniques consist of corresponding relationship between radiosensitivity and mutation frequency, choosing appropriate materials, combination of physical and chemical mutagens, mutagenic effects of the new mutagenic agents as proton, ions, synchronous irradiation and space mutation. These techniques and methods for inducing mutations are very valuable to increase inducing mutation efficiency and breeding level

  3. Mutation breeding in soybean

    International Nuclear Information System (INIS)

    Baradjanegara, A.A.

    1983-01-01

    In Indonesia, soybean is one of the important crop after rice. It is generally cultivated in the lowlands and rarely in the highlands. Seeds of soybean variety ORBA were treated with various doses of fast neutrons, gamma rays, EMS and NaN 3 with the aims of studying the mutagen effects in M-1 and M-2 generations and also to select mutants adapted to highland conditions. D-50 doses for gamma rays, fast neutrons and EMS were around 23 krad, 2,300 rad, 0.3%, respectively. Much higher chlorophyll mutation frequency was observed in EMS treatment of 0.3%. Seven mutants were shorter and four early mutants matured from 4 to 20 days earlier than the control plants. Two early mutants were quite adaptable in both the low and highlands and produced better yields than the parental material. (author)

  4. Identification of mutations in two major mRNA isoforms of the Chediak–Higashi syndrome gene in human and mouse

    Science.gov (United States)

    Barbosa, Maria D. F. S.; Barrat, Franck J.; Tchernev, Velizar T.; Nguyen, Quan A.; Mishra, Vishnu S.; Colman, Steven D.; Pastural, Elodie; Dufourcq-Lagelouse, Rémi; Fischer, Alain; Holcombe, Randall F.; Wallace, Margaret R.; Brandt, Stephen J.; de Saint Basile, Geneviève; Kingsmore, Stephen F.

    2010-01-01

    Chediak–Higashi syndrome is an autosomal recessive, immune deficiency disorder of human (CHS) and mouse (beige, bg) that is characterized by abnormal intracellular protein transport to, and from, the lysosome. Recent reports have described the identification of homologous genes that are mutated in human CHS and bg mice. Here we report the sequences of two major mRNA isoforms of the CHS gene in human and mouse. These isoforms differ both in size and in sequence at the 3′ end of their coding domains, with the smaller isoform (~5.8 kb) arising from incomplete splicing and reading through an intron. These mRNAs also differ in tissue distribution of transcription and in predicted biological properties. Novel mutations were identified within the region of the coding domain common to both isoforms in three CHS patients: C→T transitions that generated stop codons (R50X and Q1029X) were found in two patients, and a novel frame-shift mutation (deletion of nucleotides 3073 and 3074 of the coding domain) was found in a third. Northern blots of lymphoblastoid mRNA from CHS patients revealed loss of the largest transcript (~13.5 kb) in two of seven CHS patients, while the small mRNA was undiminished in abundance. These results suggest that the small isoform alone cannot complement Chediak–Higashi syndrome. PMID:9215680

  5. A novel ABCD1 mutation detected by next generation sequencing in presumed hereditary spastic paraplegia: A 30-year diagnostic delay caused by misleading biochemical findings.

    Science.gov (United States)

    Koutsis, Georgios; Lynch, David S; Tucci, Arianna; Houlden, Henry; Karadima, Georgia; Panas, Marios

    2015-08-15

    To present a Greek family in which 5 male and 2 female members developed progressive spastic paraplegia. Plasma very long chain fatty acids (VLCFA) were reportedly normal at first testing in an affected male and for over 30 years the presumed diagnosis was hereditary spastic paraplegia (HSP). Targeted next generation sequencing (NGS) was used as a further diagnostic tool. Targeted exome sequencing in the proband, followed by Sanger sequencing confirmation; mutation segregation testing in multiple family members and plasma VLCFA measurement in the proband. NGS of the proband revealed a novel frameshift mutation in ABCD1 (c.1174_1178del, p.Leu392Serfs*7), bringing an end to diagnostic uncertainty by establishing the diagnosis of adrenomyeloneuropathy (AMN), the myelopathic phenotype of X-linked adrenoleukodystrophy (ALD). The mutation segregated in all family members and the diagnosis of AMN/ALD was confirmed by plasma VLCFA measurement. Confounding factors that delayed the diagnosis are presented. This report highlights the diagnostic utility of NGS in patients with undiagnosed spastic paraplegia, establishing a molecular diagnosis of AMN, allowing proper genetic counseling and management, and overcoming the diagnostic delay that can be rarely caused by false negative VLCFA analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. CRISPR/Cas9 DNA cleavage at SNP-derived PAM enables both in vitro and in vivo KRT12 mutation-specific targeting.

    Science.gov (United States)

    Courtney, D G; Moore, J E; Atkinson, S D; Maurizi, E; Allen, E H A; Pedrioli, D M L; McLean, W H I; Nesbit, M A; Moore, C B T

    2016-01-01

    CRISPR/Cas9-based therapeutics hold the possibility for permanent treatment of genetic disease. The potency and specificity of this system has been used to target dominantly inherited conditions caused by heterozygous missense mutations through inclusion of the mutated base in the short-guide RNA (sgRNA) sequence. This research evaluates a novel approach for targeting heterozygous single-nucleotide polymorphisms (SNPs) using CRISPR/Cas9. We determined that a mutation within KRT12, which causes Meesmann's epithelial corneal dystrophy (MECD), leads to the occurrence of a novel protospacer adjacent motif (PAM). We designed an sgRNA complementary to the sequence adjacent to this SNP-derived PAM and evaluated its potency and allele specificity both in vitro and in vivo. This sgRNA was found to be highly effective at reducing the expression of mutant KRT12 mRNA and protein in vitro. To assess its activity in vivo we injected a combined Cas9/sgRNA expression construct into the corneal stroma of a humanized MECD mouse model. Sequence analysis of corneal genomic DNA revealed non-homologous end-joining repair resulting in frame-shifting deletions within the mutant KRT12 allele. This study is the first to demonstrate in vivo gene editing of a heterozygous disease-causing SNP that results in a novel PAM, further highlighting the potential for CRISPR/Cas9-based therapeutics.

  7. Naxos disease in an Arab family is not caused by the Pk2157del2 mutation; evidance for exclusion of the plakoglobin gene

    International Nuclear Information System (INIS)

    Stuhmann, M.; El-Harith, A.; Bukhari, Iqbal A.

    2004-01-01

    Nax os disease is a rare hereditary disorder characterized by palmoplantar keratoderma, woolly hair and cardiomyopathy. This study aims to determine whether Naxos disease in a Saudi Arab family is caused by the Pk2157del2 mutation that was identified in Greek families from Naxos Island where the disease had originally been described. This study was undertaken at King Fahad Hospital of the University, Al-Khobar, and the Medical University of Hannover, in the spring of 2003. Naxos disease has been encountered in a 2-year-old girl and her 30-year-old aunt of a Saudi Arab family. Deoxyribonucleic acid samples of this family were analyzed by polymerase chain-reaction (PCR) amplification of the respective region of the plakoglobin gene, and direct nucleotide sequencing of the PCR-products. Segregation analysis was performed employing the newly detected IVS11+22G/A polymorphism. Molecular genetic analysis of the DNA sample of the child diagnosed with Naxos disease showed absence of the Pk2157del2 mutation. In addition, the segregation analysis revealed heterozygosity for IVS11+22G/A in the affected girl. Absence of the Pk2157del2 frameshift in the affected child proved that Naxos disease in this Saudi Arab family is not caused by the same mutation that was identified in the Greek families. Furthermore, heterozygosity for the IVS11+22G/A polymorphism provided evidence for exclusion of the plakoglobin gene in this consanguineous family. (author)

  8. A heterozygous mutation in RPGR associated with X-linked retinitis pigmentosa in a patient with Turner syndrome mosaicism (45,X/46,XX).

    Science.gov (United States)

    Zhou, Qi; Yao, Fengxia; Wang, Feng; Li, Hui; Chen, Rui; Sui, Ruifang

    2018-01-01

    Turner syndrome with retinitis pigmentosa (RP) is rare, with only three cases reported based on clinical examination alone. We summarized the 4-year follow-up and molecular findings in a 28-year-old patient with Turner syndrome and the typical features of short stature and neck webbing, who also had X-linked RP. Her main complaints were night blindness and progressive loss of vision since the age of 9 years. Ophthalmologic examination, optical coherent tomographic imaging, and visual electrophysiology tests showed classic manifestations of RP. The karyotype of peripheral blood showed mosaicism (45,X [72%]/46,XX[28%]). A novel heterozygous frameshift mutation (c.2403_2406delAGAG, p.T801fsX812) in the RP GTPase regulator (RPGR) gene was detected using next generation sequencing and validated by Sanger sequencing. We believe that this is the first report of X-linked RP in a patient with Turner syndrome associated with mosaicism, and an RPGR heterozygous mutation. We hypothesize that X-linked RP in this woman is not related to Turner syndrome, but may be a manifestation of the lack of a normal paternal X chromosome with intact but mutated RPGR. © 2017 Wiley Periodicals, Inc.

  9. CDKL5 Gene-Related Epileptic Encephalopathy in Estonia: Four Cases, One Novel Mutation Causing Severe Phenotype in a Boy, and Overview of the Literature.

    Science.gov (United States)

    Lilles, Stella; Talvik, Inga; Noormets, Klari; Vaher, Ulvi; Õunap, Katrin; Reimand, Tiia; Sander, Valentin; Ilves, Pilvi; Talvik, Tiina

    2016-12-01

    Cyclin-dependent kinase-like 5 ( CDKL5 ) gene mutations have mainly been found in females with early infantile epileptic encephalopathy (EIEE), severe intellectual disability, and Rett-like features. To date, only 22 boys have been reported, presenting with far more severe phenotypic features. We report the first cases of CDKL5 gene-related EIEE in Estonia diagnosed using panels of epilepsy-associated genes and describe the phenotype-genotype correlations in three male and one female patient. One of the mutations, identified in a male patient, was a novel de novo hemizygous frameshift mutation (NM_003159.2:c.2225_2228del (p.Glu742Afs*41)) in exon 15 of CDKL5. All boys have a more severe phenotype than the female patient. In boys with early onset of seizures and poor development with absent or poor eye contact, CDKL5 gene-related EIEE can be suspected and epilepsy-associated genes should be analyzed for early etiological diagnosis. Early genetic diagnosis would be the cornerstone in personalized treatment in the future. Georg Thieme Verlag KG Stuttgart · New York.

  10. MPL mutations in myeloproliferative disorders

    DEFF Research Database (Denmark)

    Beer, Philip A.; Campbell, Peter J.; Scott, Linda M.

    2008-01-01

    Activating mutations of MPL exon 10 have been described in a minority of patients with idiopathic myelofibrosis (IMF) or essential thrombocythemia (ET), but their prevalence and clinical significance are unclear. Here we demonstrate that MPL mutations outside exon 10 are uncommon in platelet c......DNA and identify 4 different exon 10 mutations in granulocyte DNA from a retrospective cohort of 200 patients with ET or IMF. Allele-specific polymerase chain reaction was then used to genotype 776 samples from patients with ET entered into the PT-1 studies. MPL mutations were identified in 8.5% of JAK2 V617F......(-) patients and a single V617F(+) patient. Patients carrying the W515K allele had a significantly higher allele burden than did those with the W515L allele, suggesting a functional difference between the 2 variants. Compared with V617F(+) ET patients, those with MPL mutations displayed lower hemoglobin...

  11. Mutation breeding in ornamental plants

    International Nuclear Information System (INIS)

    Datta, S.K.

    1990-01-01

    Full text: Mutation induction produced a large number of new promising varieties in ornamental species. 37 new mutants of Chrysanthemum and 14 of rose have been developed by mutations and released for commercialisation. The mutations in flower colour/shape were detected as chimeras in M 1 V 1 , M 1 V 2 , M 1 V 3 generations. The mutation frequency varied with the cultivar and exposure to gamma rays. Comparative analysis of original cultivars and their respective induced mutants on cytomorphological, anatomical and biochemical characters are being carried out for better understanding of the mechanism involved in the origin and evolution of somatic flower colour/shape mutations. Cytological analysis with reference to chromosomal aberrations, chromosome number, ICV, INV and DNA content gave no differences between the original and mutant cultivars. Analysis of florets/petal pigments by TLC and spectrophotometric methods indicated both qualitative and quantitative changes. (author)

  12. Evolutionary Accessibility of Mutational Pathways

    Science.gov (United States)

    Franke, Jasper; Klözer, Alexander; de Visser, J. Arjan G. M.; Krug, Joachim

    2011-01-01

    Functional effects of different mutations are known to combine to the total effect in highly nontrivial ways. For the trait under evolutionary selection (‘fitness’), measured values over all possible combinations of a set of mutations yield a fitness landscape that determines which mutational states can be reached from a given initial genotype. Understanding the accessibility properties of fitness landscapes is conceptually important in answering questions about the predictability and repeatability of evolutionary adaptation. Here we theoretically investigate accessibility of the globally optimal state on a wide variety of model landscapes, including landscapes with tunable ruggedness as well as neutral ‘holey’ landscapes. We define a mutational pathway to be accessible if it contains the minimal number of mutations required to reach the target genotype, and if fitness increases in each mutational step. Under this definition accessibility is high, in the sense that at least one accessible pathway exists with a substantial probability that approaches unity as the dimensionality of the fitness landscape (set by the number of mutational loci) becomes large. At the same time the number of alternative accessible pathways grows without bounds. We test the model predictions against an empirical 8-locus fitness landscape obtained for the filamentous fungus Aspergillus niger. By analyzing subgraphs of the full landscape containing different subsets of mutations, we are able to probe the mutational distance scale in the empirical data. The predicted effect of high accessibility is supported by the empirical data and is very robust, which we argue reflects the generic topology of sequence spaces. Together with the restrictive assumptions that lie in our definition of accessibility, this implies that the globally optimal configuration should be accessible to genome wide evolution, but the repeatability of evolutionary trajectories is limited owing to the presence of a

  13. Monoallelic mutation analysis (MAMA) for identifying germline mutations.

    Science.gov (United States)

    Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

    1995-09-01

    Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

  14. Case report: maternal mosaicism resulting in inheritance of a novel GATA6 mutation causing pancreatic agenesis and neonatal diabetes mellitus.

    Science.gov (United States)

    Yau, Daphne; De Franco, Elisa; Flanagan, Sarah E; Ellard, Sian; Blumenkrantz, Miriam; Mitchell, John J

    2017-01-03

    Haploinsufficiency of the GATA6 transcription factor gene was recently found to be the most common cause of pancreatic agenesis, a rare cause of neonatal diabetes mellitus. Although most cases are de novo, we describe three siblings with inherited GATA6 haploinsufficiency and the rare finding of parental mosaicism. The proband was born at term with severe intrauterine growth restriction, the first child of non-consanguineous parents. Diabetes occurred on day of life 1 with pancreatic exocrine insufficiency noted at several months of age. Pancreatic agenesis with absent gallbladder was confirmed when he underwent congenital diaphragmatic hernia and intestinal malrotation repair. A patent ductus arteriosus and pulmonary stenosis were repaired in infancy. Neurocognitive development has been normal. A second pregnancy was terminated due to tetralogy of Fallot and pulmonary hypoplasia secondary to congenital diaphragmatic hernia. The fetus also demonstrated severe pancreatic hypoplasia, gallbladder agenesis and intestinal rotation abnormalities. Despite severe hypoplasia, the pancreas demonstrated normal islet histology. Another sibling was found to have multiple cardiac abnormalities, requiring procedural intervention. Given the proband's spectrum of congenital anomalies, Sanger sequencing of the GATA6 gene was performed, revealing a novel heterozygous c.635_660del frameshift mutation (p.Pro212fs). The mutation is predicted to be pathogenic, resulting in inclusion of a premature stop codon and likely degradation of the gene transcript by nonsense-mediated decay. The abortus and the sibling with the cardiac defect were both found to have the mutation, while the father and remaining sibling were negative. The mother, who is healthy with no evidence of diabetes or cardiac disease, is mosaic for the mutation at a level of 11% in her peripheral leukocytes by next-generation sequencing. We highlight a rare mechanism of pancreatic agenesis, this being only the second report

  15. Two different BRCA2 mutations found in a multigenerational family with a history of breast, prostate, and lung cancers

    Directory of Open Access Journals (Sweden)

    Caporale DA

    2014-06-01

    Full Text Available Diane A Caporale, Erica E SwensonDepartment of Biology, University of Wisconsin – Stevens Point, Stevens Point, WI, USAAbstract: Breast and lung cancer are two of the most common malignancies in the United States, causing approximately 40,000 and 160,000 deaths each year, respectively. Over 80% of hereditary breast cancer cases are due to mutations in two breast cancer predisposition genes, BRCA1 and BRCA2. These are tumor-suppressor genes associated with DNA repair. Since the discovery of these two genes in the mid-1990s, several other breast cancer predisposition genes have been identified, such as the CHEK2 gene encoding a regulator of BRCA1. Recently, studies have begun investigating the roles of BRCA1 and BRCA2 gene expression in lung cancer. We conducted a family-based case study that included a bloodline of Italian heritage with several cases of breast cancer and associated cancers (prostate and stomach through multiple generations and on a nonblood relative of Scottish/Irish descent who was consecutively diagnosed with breast and lung cancer. Cancer history and environmental risk factors were recorded for each family member. To investigate possible genetic risks, we screened for mutations in specific hypervariable regions of the BRCA1, BRCA2, and CHEK2 genes. DNA was extracted and isolated from the individuals' hair follicles and cheek cells. Polymerase chain reaction (PCR, allele-specific PCR, and DNA sequencing were performed to identify and verify the presence or absence of mutations in these regions. Genotypes of several family members were determined and carriers of mutations were identified. Here we report for the first time the occurrence of two different BRCA2 frameshift mutations within the same family. Specifically, three Italian family members were found to be carriers of the BRCA2-c.2808_2811delACAA (3036delACAA mutation, a 4-nucleotide deletion in exon 11, which is a truncated mutation that causes deleterious function of

  16. Minisequencing mitochondrial DNA pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Carracedo Ángel

    2008-04-01

    Full Text Available Abstract Background There are a number of well-known mutations responsible of common mitochondrial DNA (mtDNA diseases. In order to overcome technical problems related to the analysis of complete mtDNA genomes, a variety of different techniques have been proposed that allow the screening of coding region pathogenic mutations. Methods We here propose a minisequencing assay for the analysis of mtDNA mutations. In a single reaction, we interrogate a total of 25 pathogenic mutations distributed all around the whole mtDNA genome in a sample of patients suspected for mtDNA disease. Results We have detected 11 causal homoplasmic mutations in patients suspected for Leber disease, which were further confirmed by standard automatic sequencing. Mutations m.11778G>A and m.14484T>C occur at higher frequency than expected by change in the Galician (northwest Spain patients carrying haplogroup J lineages (Fisher's Exact test, P-value Conclusion We here developed a minisequencing genotyping method for the screening of the most common pathogenic mtDNA mutations which is simple, fast, and low-cost. The technique is robust and reproducible and can easily be implemented in standard clinical laboratories.

  17. Radiation mutation breeding

    Energy Technology Data Exchange (ETDEWEB)

    Song, Hi Sup; Kim, Jae Sung; Kim, Jin Kyu; Shin, In Chul; Lim, Young Taek

    1998-04-01

    In order to develop an advanced technical knowledge for the selection of better mutants, some of the crops were irradiated and the mutation rate, the survival rate and the method for selction of a mutant were studied. Furthermore, this study aimed to obtain basic data applicable to the development of genetic resources by evaluation and analysis the specific character for selection of the superior mutant and its plant breeding. 1. selection of the mutant with a superior resistance against environment in the principal crops 1) New varieties of mutant rices such as Wonpyeongbyeo, Wongwangbyeo, Winmibyeo, and heogseon chalbeyeo (sticky forma) were registered in the national variety list and made an application to crop variety protection right. They are under review now. 2) We also keep on studying on the number of a grain of 8 lines of excellent mutant rice for the purpose of improvement of breeding . 3) We selected 3 lines which have a resistance to pod and stem blight in large soybean, 31 lines with small grain size and higher yield, 112 lines of soybean of cooking, 7 lines of low lipoxygenase content, and 12 lines with decreased phytic acid content by 20 % compared to the previous level. 2. Selection of advanced Mugunwha (Rose of Sharon) mutant 1) Bagseul, a new variety of mutant, was developed and 30 plantlets of it are being proliferated. 2) Fifty-three lines of a mutant having a various morphologies were selected.

  18. Induced mutations in castor

    International Nuclear Information System (INIS)

    Ganesan, K.; Javad Hussain, H.S.; Vindhiyavarman, P.

    2001-01-01

    Castor (Ricinus communis L.) is an important oilseed crop in India. To create variability mutations were induced in two cultivars 'TMV5' (maturing in 130-140 days) and 'CO1' (perennial type). Gamma rays and diethyl sulphate and ethidium bromide were used for seed treatment. Ten doses, from 100 to 1000 Gy were employed. For chemical mutagenesis five concentrations of mutagenes from 10 to 50 mM were tried. No economic mutants could be isolated after treatment with the chemical mutagens. The following economic mutants were identified in the dose 300 Gy of gamma rays. Annual types from perennial CO 1 castor CO 1 is a perennial variety (8-10 years) with bold seeds (100 seed weight 90 g) and high oil content (57%). Twenty-one lines were isolated with annual types (160-180 days) with high yield potential as well as bold seeds and high oil content. These mutants, identified in M 3 generation were bred true in subsequent generations up to M 8 generation. Critical evaluation of the mutants in yield evaluation trials is in progress

  19. A novel mutation in the putative DNA helicase XH2 is responsible for male-to-female sex reversal associated with an atypical form of the ATR-X syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Ion, A.; Telvi, L.; Galacteros, F.; McElreavey, K. [Institut Pasteur, Paris (France)] [and others

    1996-06-01

    We describe a pedigree presenting X-linked severe mental retardation associated with multiple congenital abnormalities and 46,XY gonadal dysgenesis, leading in one family member to female gender assignment. Female carriers are unaffected. The dysmorphic features are similar to those described in the {alpha}-thalassemia and mental retardation (ATR-X) syndrome, although there is no clinical evidence of {alpha}-thalassemia in this family. In addition, the family had other clinical features not previously observed in the ATR-X syndrome, including partial optic-nerve atrophy and partial ocular albinism. Mutations in a putative DNA helicase, termed XH2, have been reported to give rise to the ATR-X syndrome. We screened the YCH2 gene for mutations in affected members of the family and identified a 4-bp deletion at an intron/exon boundary that removes an invariant 3{prime} splice-acceptor site. The mutation cosegregates with the syndrome. The genomic deletion causes missplicing of the pre-mRNA, which results in the loss of 8 bp of coding sequence, thereby generating a frameshift and a downstream premature stop codon. Our finding increases the range of clinical features associated with mutations in the XH2 gene. 17 refs., 4 figs., 2 tabs.

  20. Clinical characteristics and mutation spectrum of GLA in Korean patients with Fabry disease by a nationwide survey: Underdiagnosis of late-onset phenotype.

    Science.gov (United States)

    Choi, Jin-Ho; Lee, Beom Hee; Heo, Sun Hee; Kim, Gu-Hwan; Kim, Yoo-Mi; Kim, Dae-Seong; Ko, Jung Min; Sohn, Young Bae; Hong, Yong Hee; Lee, Dong-Hwan; Kook, Hoon; Lim, Han Hyuk; Kim, Kyung Hee; Kim, Woo-Shik; Hong, Geu-Ru; Kim, Su-Hyun; Park, Sang Hyun; Kim, Chan-Duck; Kim, So Mi; Seo, Jeong-Sook; Yoo, Han-Wook

    2017-07-01

    Fabry disease is a rare X-linked lysosomal storage disorder caused by an α-galactosidase A deficiency. The progressive accumulation of globotriaosylceramide (GL-3) results in life-threatening complications, including renal, cardiac, and cerebrovascular diseases. This study investigated the phenotypic and molecular spectra of GLA mutations in Korean patients with Fabry disease using a nationwide survey.This study included 94 patients from 46 independent pedigrees: 38 adult males, 46 symptomatic females, and 10 pediatric males. Each diagnosis was based on an enzyme assay and GLA gene mutation analysis.The mean age at presentation was 24 years (range, 5-65 years); however, the diagnoses were delayed by 21 ± 19 years after the onset of symptoms. Those patients with late-onset Fabry disease were diagnosed by family screening or milder symptoms at a later age. Forty different mutations were identified: 20 missense (50%), 10 nonsense (25%), 8 frameshift (20%), and 2 splice site (5%) mutations. Five of them were novel. IVS4+919G>A (c.936+919 G>A) was not detected among the 6505 alleles via newborn screening using dried blood spots. Enzyme replacement therapy (ERT) was performed in all the males and pediatric patients, whereas 75% of the symptomatic females underwent ERT for 4.2 ± 3.6 years.This study described the demographic data, wide clinical spectrum of phenotypes, and GLA mutation spectrum of Fabry disease in Korea. Most of the patients had classical Fabry disease, with a 4 times higher incidence than that of late-onset Fabry disease, indicating an underdiagnosis of mild, late-onset Fabry disease.

  1. Longitudinal evaluation of the hypothalamic-pituitary-testicular function in 8 boys with adrenal hypoplasia congenita (AHC due to NR0B1 mutations.

    Directory of Open Access Journals (Sweden)

    Caroline Galeotti

    Full Text Available BACKGROUND: Boys carrying mutations in the NR0B1 gene develop adrenal hypoplasia congenita (AHC and impaired sexual development due to the combination of hypogonadotropic hypogonadism (HH and primary defects in spermatogenesis. METHODS: We analysed the evolution of hypothalamic-pituitary-testicular function of 8 boys with AHC due to NR0B1 mutations. Our objective was to characterize and monitor the progressive deterioration of this function. RESULTS: The first symptoms appeared in the neonatal period (n = 5 or between 6 months and 8.7 years (n = 3. Basal plasma adrenocorticotrophic hormone (ACTH concentrations increased in all boys, whilst cortisol levels decreased in one case. The natremia was equal or below 134 mmol/L and kaliemia was over 5 mmol/L. All had increased plasma renin. In 3 of 4 patients diagnosed in the neonatal period and evaluated during the first year, the basal plasma gonadotropins concentrations, and their response to gonadotropin releasing hormone (GnRH test (n = 2, and those of testosterone were normal. The plasma inhibin B levels were normal in the first year of life. With the exception of two cases these concentrations decreased to below the normal for age. Anti-Müllerian hormone concentrations were normal for age in all except one case, which had low concentrations before the initiation of testosterone treatment. In 3 of the 8 cases the gene was deleted and the remaining 5 cases carried frameshift mutations that are predicted to introduce a downstream nonsense mutation resulting in a truncated protein. CONCLUSIONS: The decreases in testosterone and inhibin B levels indicated a progressive loss of testicular function in boys carrying NR0B1 mutations. These non-invasive examinations can help to estimate the age of the testicular degradation and cryopreservation of semen may be considered in these cases as investigational procedure with the aim of restoring fertility.

  2. Exome sequencing identifies DYNC2H1 mutations as a common cause of asphyxiating thoracic dystrophy (Jeune syndrome) without major polydactyly, renal or retinal involvement

    Science.gov (United States)

    Schmidts, Miriam; Arts, Heleen H; Bongers, Ernie M H F; Yap, Zhimin; Oud, Machteld M; Antony, Dinu; Duijkers, Lonneke; Emes, Richard D; Stalker, Jim; Yntema, Jan-Bart L; Plagnol, Vincent; Hoischen, Alexander; Gilissen, Christian; Forsythe, Elisabeth; Lausch, Ekkehart; Veltman, Joris A; Roeleveld, Nel; Superti-Furga, Andrea; Kutkowska-Kazmierczak, Anna; Kamsteeg, Erik-Jan; Elçioğlu, Nursel; van Maarle, Merel C; Graul-Neumann, Luitgard M; Devriendt, Koenraad; Smithson, Sarah F; Wellesley, Diana; Verbeek, Nienke E; Hennekam, Raoul C M; Kayserili, Hulya; Scambler, Peter J; Beales, Philip L; Knoers, Nine VAM; Roepman, Ronald; Mitchison, Hannah M

    2013-01-01

    Background Jeune asphyxiating thoracic dystrophy (JATD) is a rare, often lethal, recessively inherited chondrodysplasia characterised by shortened ribs and long bones, sometimes accompanied by polydactyly, and renal, liver and retinal disease. Mutations in intraflagellar transport (IFT) genes cause JATD, including the IFT dynein-2 motor subunit gene DYNC2H1. Genetic heterogeneity and the large DYNC2H1 gene size have hindered JATD genetic diagnosis. Aims and methods To determine the contribution to JATD we screened DYNC2H1 in 71 JATD patients JATD patients combining SNP mapping, Sanger sequencing and exome sequencing. Results and conclusions We detected 34 DYNC2H1 mutations in 29/71 (41%) patients from 19/57 families (33%), showing it as a major cause of JATD especially in Northern European patients. This included 13 early protein termination mutations (nonsense/frameshift, deletion, splice site) but no patients carried these in combination, suggesting the human phenotype is at least partly hypomorphic. In addition, 21 missense mutations were distributed across DYNC2H1 and these showed some clustering to functional domains, especially the ATP motor domain. DYNC2H1 patients largely lacked significant extra-skeletal involvement, demonstrating an important genotype–phenotype correlation in JATD. Significant variability exists in the course and severity of the thoracic phenotype, both between affected siblings with identical DYNC2H1 alleles and among individuals with different alleles, which suggests the DYNC2H1 phenotype might be subject to modifier alleles, non-genetic or epigenetic factors. Assessment of fibroblasts from patients showed accumulation of anterograde IFT proteins in the ciliary tips, confirming defects similar to patients with other retrograde IFT machinery mutations, which may be of undervalued potential for diagnostic purposes. PMID:23456818

  3. Whole-exome analysis of a Li-Fraumeni family trio with a novel TP53 PRD mutation and anticipation profile.

    Science.gov (United States)

    Franceschi, Sara; Spugnesi, Laura; Aretini, Paolo; Lessi, Francesca; Scarpitta, Rosa; Galli, Alvaro; Congregati, Caterina; Caligo, Maria Adelaide; Mazzanti, Chiara Maria

    2017-09-01

    Li-Fraumeni syndrome is a clinically heterogeneous familial cancer predisposition syndrome with autosomal-dominant inheritance caused by heterozygous germline mutations in the TP53 gene. We here analyze the genetic background of a family with a 4-year-proband presented with a Li-Fraumeni tumor. The mother developed breast cancer at age 37 and the proband died at age 8. We performed Sanger sequencing and whole-exome sequencing on peripheral blood DNA from proband and relatives. Data analysis selected only high-quality score and depth reads, rare variants and protein impact involving missense, non-sense, frameshift and splice disrupt mutations. Disease implicated variants and predicted deleterious alterations were also chosen. TP53 genetic testing revealed a never reported TP53 deletion arose as de novo mutation in the mother and inherited by the proband. We then performed whole-exome analysis of the trio to uncover inherited variants from the father that potentially worsen the already altered genetic background in the proband. No pathogenic variants were inherited in autosomal recessive, de novo dominant or X-linked recessive manner. Comparing proband and father exome we detected 25 predicted deleterious variants including a nonsense mutation in ERCC3. Those inherited mutations are possible candidate modifiers linked to TP53, explaining the proband accelerated tumor onset compared to the mother and providing a possible explanation of the genetic anticipation event in this Li-Fraumeni family. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. The role of PHD2 mutations in the pathogenesis of erythrocytosis

    Directory of Open Access Journals (Sweden)

    Gardie B

    2014-07-01

    of EPO transcription. The α subunits of the hypoxia-inducible transcription factor are hydroxylated by three prolyl hydroxylase domain (PHD enzymes, which belong to the iron and 2-oxoglutarate-dependent oxygenase superfamily. Sequence analysis of the genes encoding the PHDs in patients with erythrocytosis has revealed heterozygous germline mutations only occurring in Egl nine homolog 1 (EGLN1, also known as PHD2, the gene that encodes PHD2. To date, 24 different EGLN1 mutations comprising missense, frameshift, and nonsense mutations have been described. The phenotypes associated with the patients carrying these mutations are fairly homogeneous and typically limited to erythrocytosis with normal to elevated EPO. However, exceptions exist; for example, there is one case with development of concurrent paraganglioma (PHD2-H374R. Analysis of the erythrocytosis-associated PHD2 missense mutations has shown heterogeneous results. Structural studies reveal that mutations can affect different domains of PHD2. Some are close to the hypoxia-inducible transcription factor α/2-oxoglutarate or the iron binding sites for PHD2. In silico studies demonstrate that the mutations do not always affect fully conserved residues. In vitro and in cellulo studies showed varying effects of the mutations, ranging from mild effects to severe loss of function. The exact mechanism of a potential tumor-suppressor role for PHD2 still needs to be elucidated. A knockin mouse model expressing the first reported PHD2-P317R mutation recapitulates the phenotype observed in humans (erythrocytosis with inappropriately normal serum EPO levels and demonstrates that haploinsufficiency and partial deregulation of PHD2 is sufficient to cause erythrocytosis. Keywords: PHD2, EGLN1, HIF, hypoxia, erythropoietin, erythrocytosis

  5. Mutational profiling reveals PIK3CA mutations in gallbladder carcinoma

    Directory of Open Access Journals (Sweden)

    Bardeesy Nabeel

    2011-02-01

    Full Text Available Abstract Background The genetics of advanced biliary tract cancers (BTC, which encompass intra- and extra-hepatic cholangiocarcinomas as well as gallbladder carcinomas, are heterogeneous and remain to be fully defined. Methods To better characterize mutations in established known oncogenes and tumor suppressor genes we tested a mass spectrometric based platform to interrogate common cancer associated mutations across a panel of 77 formalin fixed paraffin embedded archived BTC cases. Results Mutations among three genes, KRAS, NRAS and PIK3CA were confirmed in this cohort. Activating mutations in PIK3CA were identified exclusively in GBC (4/32, 12.5%. KRAS mutations were identified in 3 (13% intra-hepatic cholangiocarcinomas and 1 (33% perihillar cholangiocarcinoma but were not identified in gallbladder carcinomas and extra-hepatic cholangiocarcinoma. Conclusions The presence of activating mutations in PIK3CA specifically in GBC has clinical implications in both the diagnosis of this cancer type, as well as the potential utility of targeted therapies such as PI3 kinase inhibitors.

  6. Mutation breeding newsletter. No. 44

    International Nuclear Information System (INIS)

    1999-04-01

    This issue of the Newsletter presents research reports on the role of radiation induced mutation and chemical mutagens in improving productivity, disease resistance; cold and salinity tolerance of various crops and ornamental plants

  7. Mutation breeding newsletter. No. 18

    International Nuclear Information System (INIS)

    1981-07-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  8. Mutation breeding newsletter. No. 6

    International Nuclear Information System (INIS)

    1975-08-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  9. Mutation breeding newsletter. No. 2

    International Nuclear Information System (INIS)

    1973-02-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  10. Mutation breeding newsletter. No. 5

    International Nuclear Information System (INIS)

    1975-02-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  11. Mutation breeding newsletter. No. 32

    International Nuclear Information System (INIS)

    1988-07-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  12. Mutation breeding newsletter. No. 9

    International Nuclear Information System (INIS)

    1977-01-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  13. Mutation breeding newsletter. No. 8

    International Nuclear Information System (INIS)

    1976-09-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  14. Mutation breeding newsletter. No. 10

    International Nuclear Information System (INIS)

    1977-07-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  15. Mutation breeding newsletter. No. 7

    International Nuclear Information System (INIS)

    1976-01-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  16. Mutation breeding newsletter. No. 36

    International Nuclear Information System (INIS)

    1990-07-01

    This issue of the Newsletter presents abstracts and short communications of research results on radiation and chemical induced mutation breeding projects. Positive traits such as disease resistance and increased productivity are highlighted

  17. Mutation breeding newsletter. No. 16

    International Nuclear Information System (INIS)

    1980-07-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  18. Mutation Breeding Newsletter. No. 37

    International Nuclear Information System (INIS)

    1991-01-01

    This newsletter contains a brief account of FAO/IAEA meetings held in 1990 on plant breeding involving the use of induced mutations. It also features a list of commercially available plant cultivars produced by such techniques. Refs and tabs

  19. Mutation breeding newsletter. No. 3

    International Nuclear Information System (INIS)

    1974-01-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  20. Mutation breeding newsletter. No. 4

    International Nuclear Information System (INIS)

    1974-08-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  1. Mutation breeding newsletter. No. 19

    International Nuclear Information System (INIS)

    1982-01-01

    This issue of the Newsletter presents new reports on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  2. BRAF mutations in conjunctival melanoma

    DEFF Research Database (Denmark)

    Larsen, Ann-Cathrine; Dahl, Christina; Dahmcke, Christina M.

    2016-01-01

    with atypia. BRAF mutations were identified in 39 of 111 (35%) cases. The rate ratio of BRAF-mutated versus BRAF-wild-type melanoma did not change over time. BRAF mutations were associated with T1 stage (p = 0.007), young age (p = 0.001), male gender (p = 0.02), sun-exposed location (p = 0.01), mixed....../non-pigmented tumour colour (p = 0.02) and nevus origin (p = 0.005), but did not associate with prognosis. BRAF status in conjunctival melanoma and paired premalignant lesions corresponded in 19 of 20 cases. Immunohistochemistry detected BRAF V600E mutations with a sensitivity of 0.94 and a specificity of 1...

  3. Mutation breeding newsletter. No. 1

    International Nuclear Information System (INIS)

    1972-05-01

    This issue of the Newsletter presents reports and rea search abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  4. Mutation breeding newsletter. No. 24

    International Nuclear Information System (INIS)

    1984-07-01

    This issue of the Newsletter presents reports and research abstracts on mutation breeding programs using radiation or chemical mutagenesis to improve productivity, introduce disease resistance or induce morphological changes in crop plants

  5. Mutation breeding newsletter. No. 31

    International