A Frameshift Mutation in the Cubilin Gene (CUBN) in Border Collies with Imerslund-Gräsbeck Syndrome (Selective Cobalamin Malabsorption)

Science.gov (United States)

Owczarek-Lipska, Marta; Jagannathan, Vidhya; Drögemüller, Cord; Lutz, Sabina; Glanemann, Barbara

2013-01-01

Imerslund-Gräsbeck syndrome (IGS) or selective cobalamin malabsorption has been described in humans and dogs. IGS occurs in Border Collies and is inherited as a monogenic autosomal recessive trait in this breed. Using 7 IGS cases and 7 non-affected controls we mapped the causative mutation by genome-wide association and homozygosity mapping to a 3.53 Mb interval on chromosome 2. We re-sequenced the genome of one affected dog at ∼10× coverage and detected 17 non-synonymous variants in the critical interval. Two of these non-synonymous variants were in the cubilin gene (CUBN), which is known to play an essential role in cobalamin uptake from the ileum. We tested these two CUBN variants for association with IGS in larger cohorts of dogs and found that only one of them was perfectly associated with the phenotype. This variant, a single base pair deletion (c.8392delC), is predicted to cause a frameshift and premature stop codon in the CUBN gene. The resulting mutant open reading frame is 821 codons shorter than the wildtype open reading frame (p.Q2798Rfs*3). Interestingly, we observed an additional nonsense mutation in the MRC1 gene encoding the mannose receptor, C type 1, which was in perfect linkage disequilibrium with the CUBN frameshift mutation. Based on our genetic data and the known role of CUBN for cobalamin uptake we conclude that the identified CUBN frameshift mutation is most likely causative for IGS in Border Collies. PMID:23613799

A CNGB1 frameshift mutation in Papillon and Phalene dogs with progressive retinal atrophy.

Directory of Open Access Journals (Sweden)

Saija J Ahonen

Full Text Available Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA or degeneration resembles human retinitis pigmentosa (RP and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10(-8 with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes.

The sequence spectrum of frameshift reversions obtained with a novel adaptive mutation assay in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Erich Heidenreich

2016-12-01

Full Text Available Research on the mechanisms of adaptive mutagenesis in resting, i.e. non-replicating cells relies on appropriate mutation assays. Here we provide a novel procedure for the detection of frameshift-reverting mutations in yeast. Proliferation of non-reverted cells in this assay is suppressed by the lack of a fermentable carbon source. The test allele was constructed in a way that the reversions mimic microsatellite instability, a condition often found in cancer cells. We show the cell numbers during these starvation conditions and provide a DNA sequence spectrum of a representative set of revertants. The data in this article support the publication "Glucose starvation as a selective tool for the study of adaptive mutations in Saccharomyces cerevisiae" (Heidenreich and Steinboeck, 2016 [1].

Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

Science.gov (United States)

Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

2015-01-01

Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

Identification of a novel frameshift mutation in the ILDR1 gene in a UAE family, mutations review and phenotype genotype correlation.

Directory of Open Access Journals (Sweden)

Abdelaziz Tlili

Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.

A novel frameshift mutation of SMPX causes a rare form of X-linked nonsyndromic hearing loss in a Chinese family.

Directory of Open Access Journals (Sweden)

Zhijie Niu

Full Text Available X-linked hearing impairment is the rarest form of genetic hearing loss (HL and represents only a minor fraction of all cases. The aim of this study was to investigate the cause of X-linked inherited sensorineural HL in a four-generation Chinese family. A novel duplication variant (c.217dupA, p.Ile73Asnfs*5 in SMPX was identified by whole-exome sequencing. The frameshift mutation predicted to result in the premature truncation of the SMPX protein was co-segregated with the HL phenotype and was absent in 295 normal controls. Subpopulation screening of the coding exons and flanking introns of SMPX was further performed for 338 Chinese patients with nonsydromic HL by Sanger sequencing, and another two potential causative substitutions (c.238C>A and c.55A>G in SMPX were identified in additional sporadic cases of congenital deafness. Collectively, this study is the first to report the role of SMPX in Chinese population and identify a novel frameshift mutation in SMPX that causes not only nonsyndromic late-onset progressive HL, but also congenital hearing impairment. Our findings extend the mutation and phenotypic spectrum of the SMPX gene.

Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutations in mammalian cells

International Nuclear Information System (INIS)

Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.

1988-01-01

The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage

A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

Science.gov (United States)

Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

2013-03-01

Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome.

Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

Science.gov (United States)

Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

2017-07-01

Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

Postmortem diagnosis of Marfan syndrome in a case of sudden death due to aortic rupture: Detection of a novel FBN1 frameshift mutation.

Science.gov (United States)

Wang, Yunyun; Chen, Shu; Wang, Rongshuai; Huang, Sizhe; Yang, Mingzhen; Liu, Liang; Liu, Qian

2016-04-01

To investigate the sudden death of a 36-year-old Chinese man, a medicolegal autopsy was performed, combining forensic pathological examinations and genetic sequencing analysis to diagnose the cause of death. Genomic DNA samples were extracted from blood and subjected to high-throughput sequencing. Major findings included a dilated aortic root with a ruptured and dissected aorta and consequent tamponade of the pericardial sac. Moreover, arachnodactyly and other skeletal deformities were noted. By sequencing the fibrillin-1 gene (FBN1), five genetic variations were found, including four previously known single nucleotide polymorphisms (SNPs) and a novel frameshift mutation, leading to the diagnosis of Marfan syndrome. The frameshift mutation (c.4921delG, p.glu1641llysFsX9) detected in exon 40 led to a stop codon after the next 8 amino acids. The four SNPs included a splice site mutation (c.3464-5 G>A, rs11853943), a synonymous mutation (p.Asn625Asn, rs25458), and two missense mutations (p.Pro1148Ala, rs140598; p.Cys472Tyr, rs4775765). Genetic screening was recommended for the relatives as it was reported that the father and brother of the deceased had died at the ages of 40 and 25, respectively, from sudden cardiac failure. The son of the deceased lacked the relevant mutations. This report emphasizes the important contribution of medicolegal postmortem analysis on the molecular pathogenesis study of Marfan syndrome and early diagnosis of at-risk relatives. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1

DEFF Research Database (Denmark)

Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars

2016-01-01

-threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based...

Ghrelin gene: identification of missense variants and a frameshift mutation in extremely obese children and adolescents and healthy normal weight students.

Science.gov (United States)

Hinney, Anke; Hoch, Anne; Geller, Frank; Schäfer, Helmut; Siegfried, Wolfgang; Goldschmidt, Hanspeter; Remschmidt, Helmut; Hebebrand, Johannes

2002-06-01

Ghrelin induces obesity via central and peripheral mechanisms. Administration of ghrelin leads to increased food intake and decreased fat utilisation in rodents. Ghrelin levels are decreased in obese individuals. Recently, a polymorphism (Arg-51-Gln) within the ghrelin gene (GHRL) was described to be associated with obesity. We screened the GHRL coding region in 215 extremely obese German Children and adolescents (study group 1) and 93 normal weight students (study group 2) by single strand conformation polymorphism analysis (SSCP). We found the two previously described single nucleotide polymorphisms (SNP: Arg-51-Gln and Leu-72-Met) in similar frequencies in study groups 1 and 2 (allele frequencies were: 0.019 and 0.016 for the 51-Gln allele and 0.091 and 0.086 for the 72-Met allele, respectively). Hence, we could not confirm the previous finding. Additionally, two novel variants were identified within the coding region: (1) We detected one healthy normal weight individual with a frameshift mutation (2bp deletion at codon 34). This frameshift mutation affects the coding region of the mature ghrelin. Hence, it is highly likely that the normal weight student is haplo-insufficient for ghrelin. (2) An A to T transversion leads to an amino acid exchange from Gln to Leu at amino acid position 90. The frequency of the 90-Leu allele was significantly higher in the extremely obese children and adolescents (0.063) than in the normal weight students (0.016; nominal p = 0.011). Additionally, we genotyped 134 underweight students and 44 normal weight adults for this SNP. Genotype frequencies were similar in extremely obese children and adolescents, underweight students and normal weight adults (p > 0.8). In conclusion, we identified four sequence variants in the coding region of the ghrelin gene in individuals belonging to different weight extremes. A frameshift mutation was detected in a normal weight individual. None of the variants seem to influence weight regulation.

Epistatic participation of REV1 and REV3 in the formation of UV-induced frameshift mutations in cell cycle-arrested yeast cells

Energy Technology Data Exchange (ETDEWEB)

Heidenreich, Erich [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)]. E-mail: erich.heidenreich@meduniwien.ac.at; Eisler, Herfried [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria); Steinboeck, Ferdinand [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)

2006-01-29

Mutations arising in times of cell cycle arrest may provide a selective advantage for unicellular organisms adapting to environmental changes. For multicellular organisms, however, they may pose a serious threat, in that such mutations in somatic cells contribute to carcinogenesis and ageing. The budding yeast Saccharomyces cerevisiae presents a convenient model system for studying the incidence and the mechanisms of stationary-phase mutation in a eukaryotic organism. Having studied the emergence of frameshift mutants after several days of starvation-induced cell cycle arrest, we previously reported that all (potentially error-prone) translesion synthesis (TLS) enzymes identified in S. cerevisiae did not contribute to the basal level of spontaneous stationary-phase mutations. However, we observed that an increased frequency of stationary-phase frameshift mutations, brought about by a defective nucleotide excision repair (NER) pathway or by UV irradiation, was dependent on Rev3p, the catalytic subunit of the TLS polymerase zeta (Pol {zeta}). Employing the same two conditions, we now examined the effect of deletions of the genes coding for polymerase eta (Pol {eta}) (RAD30) and Rev1p (REV1). In a NER-deficient strain background, the increased incidence of stationary-phase mutations was only moderately influenced by a lack of Pol {eta} but completely reduced to wild type level by a knockout of the REV1 gene. UV-induced stationary-phase mutations were abundant in wild type and rad30{delta} strains, but substantially reduced in a rev1{delta} as well as a rev3{delta} strain. The similarity of the rev1{delta} and the rev3{delta} phenotype and an epistatic relationship evident from experiments with a double-deficient strain suggests a participation of Rev1p and Rev3p in the same mutagenic pathway. Based on these results, we propose that the response of cell cycle-arrested cells to an excess of exo- or endogenously induced DNA damage includes a novel replication

Selective translational repression of truncated proteins from frameshift mutation-derived mRNAs in tumors.

Directory of Open Access Journals (Sweden)

Kwon Tae You

2007-05-01

Full Text Available Frameshift and nonsense mutations are common in tumors with microsatellite instability, and mRNAs from these mutated genes have premature termination codons (PTCs. Abnormal mRNAs containing PTCs are normally degraded by the nonsense-mediated mRNA decay (NMD system. However, PTCs located within 50-55 nucleotides of the last exon-exon junction are not recognized by NMD (NMD-irrelevant, and some PTC-containing mRNAs can escape from the NMD system (NMD-escape. We investigated protein expression from NMD-irrelevant and NMD-escape PTC-containing mRNAs by Western blotting and transfection assays. We demonstrated that transfection of NMD-irrelevant PTC-containing genomic DNA of MARCKS generates truncated protein. In contrast, NMD-escape PTC-containing versions of hMSH3 and TGFBR2 generate normal levels of mRNA, but do not generate detectable levels of protein. Transfection of NMD-escape mutant TGFBR2 genomic DNA failed to generate expression of truncated proteins, whereas transfection of wild-type TGFBR2 genomic DNA or mutant PTC-containing TGFBR2 cDNA generated expression of wild-type protein and truncated protein, respectively. Our findings suggest a novel mechanism of gene expression regulation for PTC-containing mRNAs in which the deleterious transcripts are regulated either by NMD or translational repression.

A disease-associated frameshift mutation in caveolin-1 disrupts caveolae formation and function through introduction of a de novo ER retention signal.

Science.gov (United States)

Copeland, Courtney A; Han, Bing; Tiwari, Ajit; Austin, Eric D; Loyd, James E; West, James D; Kenworthy, Anne K

2017-11-01

Caveolin-1 (CAV1) is an essential component of caveolae and is implicated in numerous physiological processes. Recent studies have identified heterozygous mutations in the CAV1 gene in patients with pulmonary arterial hypertension (PAH), but the mechanisms by which these mutations impact caveolae assembly and contribute to disease remain unclear. To address this question, we examined the consequences of a familial PAH-associated frameshift mutation in CAV1 , P158PfsX22, on caveolae assembly and function. We show that C-terminus of the CAV1 P158 protein contains a functional ER-retention signal that inhibits ER exit and caveolae formation and accelerates CAV1 turnover in Cav1 -/- MEFs. Moreover, when coexpressed with wild-type (WT) CAV1 in Cav1 -/- MEFs, CAV1-P158 functions as a dominant negative by partially disrupting WT CAV1 trafficking. In patient skin fibroblasts, CAV1 and caveolar accessory protein levels are reduced, fewer caveolae are observed, and CAV1 complexes exhibit biochemical abnormalities. Patient fibroblasts also exhibit decreased resistance to a hypo-osmotic challenge, suggesting the function of caveolae as membrane reservoir is compromised. We conclude that the P158PfsX22 frameshift introduces a gain of function that gives rise to a dominant negative form of CAV1, defining a new mechanism by which disease-associated mutations in CAV1 impair caveolae assembly. © 2017 Copeland, Han, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Naturally Occurring Frameshift Mutations in the tvb Receptor Gene Are Responsible for Decreased Susceptibility of Chicken to Infection with Avian Leukosis Virus Subgroups B, D, and E.

Science.gov (United States)

Li, Xinjian; Chen, Weiguo; Zhang, Huanmin; Li, Aijun; Shu, Dingming; Li, Hongxing; Dai, Zhenkai; Yan, Yiming; Zhang, Xinheng; Lin, Wencheng; Ma, Jingyun; Xie, Qingmei

2018-04-15

The group of highly related avian leukosis viruses (ALVs) in chickens are thought to have evolved from a common retroviral ancestor into six subgroups, A to E and J. These ALV subgroups use diverse cellular proteins encoded by four genetic loci in chickens as receptors to gain entry into host cells. Hosts exposed to ALVs might be under selective pressure to develop resistance to ALV infection. Indeed, resistance alleles have previously been identified in all four receptor loci in chickens. The tvb gene encodes a receptor, which determines the susceptibility of host cells to ALV subgroup B (ALV-B), ALV-D, and ALV-E. Here we describe the identification of two novel alleles of the tvb receptor gene, which possess independent insertions each within exon 4. The insertions resulted in frameshift mutations that reveal a premature stop codon that causes nonsense-mediated decay of the mutant mRNA and the production of truncated Tvb protein. As a result, we observed that the frameshift mutations in the tvb gene significantly lower the binding affinity of the truncated Tvb receptors for the ALV-B, ALV-D, and ALV-E envelope glycoproteins and significantly reduce susceptibility to infection by ALV-B, ALV-D and ALV-E in vitro and in vivo Taken together, these findings suggest that frameshift mutation can be a molecular mechanism of reducing susceptibility to ALV and enhance our understanding of virus-host coevolution. IMPORTANCE Avian leukosis virus (ALV) once caused devastating economic loss to the U.S. poultry industry prior the current eradication schemes in place, and it continues to cause severe calamity to the poultry industry in China and Southeast Asia, where deployment of a complete eradication scheme remains a challenge. The tvb gene encodes the cellular receptor necessary for subgroup B, D, and E ALV infection. Two tvb allelic variants that resulted from frameshift mutations have been identified in this study, which have been shown to have significantly reduced

A novel frameshift mutation in CX46 associated with hereditary dominant cataracts in a Chinese family

Directory of Open Access Journals (Sweden)

Xiu-Kun Cui

2017-05-01

Full Text Available AIM: To investigate the genetic mutations that are associated the hereditary autosomal dominant cataract in a Chinese family. METHODS: A Chinese family consisting of 20 cataract patients (including 9 male and 11 female and 2 unaffected individuals from 5 generations were diagnosed to be a typical autosomal dominant cataract pedigree. Genomic DNA samples were extracted from the peripheral blood cells of the participants in this pedigree. Exon sequence was used for genetic mutation screening. In silico analysis was used to study the structure characteristics of connexin 46 (CX46 mutant. Immunoblotting was conduceted for testing the expression of CX46. RESULTS: To determine the involved genetic mutations, 11 well-known cataract-associated genes (cryaa, cryab, crybb1, crybb2, crygc, crygd, Gja3, Gja8, Hsf4, Mip and Pitx3 were chosen for genetic mutation test by using exon sequencing. A novel cytosine insertion at position 1195 of CX46 cDNA (c.1194_1195ins C was found in the samples of 5 tested cataract patients but not in the unaffected 2 individuals nor in normal controls, which resulted in 30 amino acids more extension in CX46C-terminus (cx46fs400 compared with the wild-type CX46. In silico protein structure analysis indicated that the mutant showed distinctive hydrophobicity and protein secondary structure compared with the wild-type CX46. The immunoblot results revealed that CX46 protein, which expressed in the aging cataract lens tissues, was absence in the proband lens. In contrast, CX50, alpha A-crystallin and alphaB-crystallin expressed equally in both proband and aging cataract tissues. Those results revealed that the cx46fs400 mutation could impair CX46 protein expression. CONCLUSION: The insertion of cytosine at position 1195 of CX46 cDNA is a novel mutation site that is associated with the autosomal dominant cataracts in this Chinese family. The C-terminal frameshift mutation is involved in regulating CX46 protein expression.

Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

Science.gov (United States)

Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

2016-01-01

We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Clinical Characteristics of Wolfram Syndrome in Chinese Population and a Novel Frameshift Mutation in WFS1.

Science.gov (United States)

Duan, Lian; Li, Qian; Tong, An-Li; Mao, Jiang-Feng; Yu, Miao; Yuan, Tao; Chai, Xiao-Feng; Gu, Feng

2018-01-01

Wolfram syndrome (WS) is a rare, degenerative, and hereditary disorder characterized by ear diabetes mellitus (DM) and optic atrophy (OA). We aim to characterize clinical features in Chinese patients who had been poorly studied until now. We performed a retrospective review of patients with WS seen in the Peking Union Medical College Hospital from 2002 to 2017. Data including demographic data, clinical presentations, examination results, family history, and genetic analysis were described. Six patients with WS were identified, meeting the diagnostic criteria of the coincidence of DM and OA before 15 years old or the existence of two WFS1 mutations. All were male, with the median age of 14.5 years (range 10-19 years). Blood glucose impairment, OA, and diabetes insipidus were present in all (100%), hearing impairment in four (66.7%), urological abnormalities in four (66.7%), neurological abnormalities in one (16.7%), and endocrine disorder in one (16.7%). Rare presentation includes cataract, glaucoma, and spina bifida occulta. Diabetes was insulin-dependent and not ketosis onset, with antibody to glutamic acid decarboxylase and islet cell negative. Genetic analysis revealed mutations in WFS1 in three patients. A novel frameshift mutation (p.Asp151Glufs*93) was identified in exon 4 of WFS1 . Our series of WS patients indicated that WS is a degenerative disease with a wide and variable spectrum, characterized by ear non-autoimmune DM and bilateral OA. Genetic analysis is recommended when suspected of WS.

A Frameshift Mutation in KIT is Associated with  White Spotting in the Arabian Camel

Directory of Open Access Journals (Sweden)

Heather Holl

2017-03-01

Full Text Available While the typical Arabian camel is characterized by a single colored coat, there are rare populations with white spotting patterns. White spotting coat patterns are found in virtually all domesticated species, but are rare in wild species. Theories suggest that white spotting is linked to the domestication process, and is occasionally associated with health disorders. Though mutations have been found in a diverse array of species, fewer than 30 genes have been associated with spotting patterns, thus providing a key set of candidate genes for the Arabian camel. We obtained 26 spotted camels and 24 solid controls for candidate gene analysis. One spotted and eight solid camels were whole genome sequenced as part of a separate project. The spotted camel was heterozygous for a frameshift deletion in KIT (c.1842delG, named KITW1 for White spotting 1, whereas all other camels were wild‐type (KIT+/KIT+. No additional mutations unique to the spotted camel were detected in the EDNRB, EDN3, SOX10, KITLG, PDGFRA, MITF, and PAX3 candidate white spotting genes. Sanger sequencing of the study population identified an additional five kITW1/KIT+ spotted camels. The frameshift results in a premature stop codon five amino acids downstream, thus terminating KIT at the tyrosine kinase domain. An additional 13 spotted camels tested KIT+/KIT+, but due to phenotypic differences when compared to the KITW1/KIT+ camels, they likely represent an independent mutation. Our study suggests that there are at least two causes of white spotting in the Arabian camel, the newly described KITW1 allele and an uncharacterized mutation.

Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

Science.gov (United States)

Nikolaitchik, Olga A; Hu, Wei-Shau

2014-04-01

A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

Clinical Characteristics of Wolfram Syndrome in Chinese Population and a Novel Frameshift Mutation in WFS1

Directory of Open Access Journals (Sweden)

Lian Duan

2018-02-01

Full Text Available ObjectiveWolfram syndrome (WS is a rare, degenerative, and hereditary disorder characterized by ear diabetes mellitus (DM and optic atrophy (OA. We aim to characterize clinical features in Chinese patients who had been poorly studied until now.MethodsWe performed a retrospective review of patients with WS seen in the Peking Union Medical College Hospital from 2002 to 2017. Data including demographic data, clinical presentations, examination results, family history, and genetic analysis were described.ResultsSix patients with WS were identified, meeting the diagnostic criteria of the coincidence of DM and OA before 15 years old or the existence of two WFS1 mutations. All were male, with the median age of 14.5 years (range 10–19 years. Blood glucose impairment, OA, and diabetes insipidus were present in all (100%, hearing impairment in four (66.7%, urological abnormalities in four (66.7%, neurological abnormalities in one (16.7%, and endocrine disorder in one (16.7%. Rare presentation includes cataract, glaucoma, and spina bifida occulta. Diabetes was insulin-dependent and not ketosis onset, with antibody to glutamic acid decarboxylase and islet cell negative. Genetic analysis revealed mutations in WFS1 in three patients. A novel frameshift mutation (p.Asp151Glufs*93 was identified in exon 4 of WFS1.ConclusionOur series of WS patients indicated that WS is a degenerative disease with a wide and variable spectrum, characterized by ear non-autoimmune DM and bilateral OA. Genetic analysis is recommended when suspected of WS.

Molecular characterization of WFS1 in an Iranian family with Wolfram syndrome reveals a novel frameshift mutation associated with early symptoms.

Science.gov (United States)

Sobhani, Maryam; Tabatabaiefar, Mohammad Amin; Rajab, Asadollah; Kajbafzadeh, Abdol-Mohammad; Noori-Daloii, Mohammad Reza

2013-10-10

Wolfram syndrome (WS) is a rare autosomal recessive neurodegenerative disorder that represents a likely source of childhood diabetes especially among countries in the consanguinity belt. The main responsible gene is WFS1 for which over one hundred mutations have been reported from different ethnic groups. The aim of this study was to identify the molecular etiology of WS and to perform a possible genotype-phenotype correlation in Iranian kindred. An Iranian family with two patients was clinically studied and WS was suspected. Genetic linkage analysis via 5 STR markers was carried out. For identification of mutations, DNA sequencing of WFS1 including all the exons, exon-intron boundaries and the promoter was performed. Linkage analysis indicated linkage to the WFS1 region. After DNA sequencing of WFS1, one novel pathogenic mutation, which causes frameshift alteration c.2177_2178insTCTTC (or c.2173_2177dupTCTTC) in exon eight, was found. The genotype-phenotype correlation analysis suggests that the presence of the homozygous mutation may be associated with early onset of disease symptoms. This study stresses the necessity of considering the molecular analysis of WFS1 in childhood diabetes with some symptoms of WS. © 2013 Elsevier B.V. All rights reserved.

The rad2 mutation affects the molecular nature of UV and acridine-mustard-induced mutations in the ADE2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Ivanov, E.L.; Kovaltzova, S.V.; Kassinova, G.V.; Gracheva, L.M.; Korolev, V.G.; Zakharov, I.A.

1986-01-01

The authors have studied the molecular nature of ade2 mutations induced by UV light and bifunctional acridine-mustard (BAM) in wild-type (RAD) and in excision-deficient (rad2) strains of the yeast, Saccharomyces cerevisiae. In the RAD strain, UV causes 45% GC → AT transitions among all mutations; in the rad2 strain this value is 77%. BAM was shown to be highly specific for frameshift mutagenesis: 60% frameshifts in the RAD strain, and as many as 84% frameshifts in the rad2 strain were induced. Therefore, the rad2 mutation affects the specificity of UV- and BAM-induced mutagenesis in yeast. Experimental data agree with the view that the majority of mutations in the RAD strain are induced by a prereplicative mechanism, whereas mutations in the rad2 strain are predominantly postreplicative events. (Auth.)

Mutation induction in Haemophilus influenzae by ICR-191. Pt. 1

International Nuclear Information System (INIS)

Perdue, S.W.; Kimball, R.F.; McGray, P.C.; Tennessee Univ., Oak Ridge

1981-01-01

The investigation of mutagenic mechanisms in Haemophilus influenzae has been confined until now to mutagens that normally produce mainly base pair substitutions. This paper describes the development of a system suitable for detecting frameshift mutations induced by ICR-191. The system involves reversions from thymidine dependence to thymidine independence. Evidence is presented from a comparison of the responses to ICR-191 and to N-methyl-N'-nitro-N-nitrosoguanidine that the system is specific for frameshift mutations. The genetic recombination involved in transformation leads to a marked increase in spontaneous reversion of the frameshift mutations but not of the base substitution mutations. Presumably, this is a consequence of mispairing, with consequent change in the number of bases, during the recombination. (orig.)

A novel frameshift GRN mutation results in frontotemporal lobar degeneration with a distinct clinical phenotype in two siblings: case report and literature review.

Science.gov (United States)

Hosaka, Takashi; Ishii, Kazuhiro; Miura, Takeshi; Mezaki, Naomi; Kasuga, Kensaku; Ikeuchi, Takeshi; Tamaoka, Akira

2017-09-15

Progranulin gene (GRN) mutations are major causes of frontotemporal lobar degeneration. To date, 68 pathogenic GRN mutations have been identified. However, very few of these mutations have been reported in Asians. Moreover, some GRN mutations manifest with familial phenotypic heterogeneity. Here, we present a novel GRN mutation resulting in frontotemporal lobar degeneration with a distinct clinical phenotype, and we review reports of GRN mutations associated with familial phenotypic heterogeneity. We describe the case of a 74-year-old woman with left frontotemporal lobe atrophy who presented with progressive anarthria and non-fluent aphasia. Her brother had been diagnosed with corticobasal syndrome (CBS) with right-hand limb-kinetic apraxia, aphasia, and a similar pattern of brain atrophy. Laboratory blood examinations did not reveal abnormalities that could have caused cognitive dysfunction. In the cerebrospinal fluid, cell counts and protein concentrations were within normal ranges, and concentrations of tau protein and phosphorylated tau protein were also normal. Since similar familial cases due to mutation of GRN and microtubule-associated protein tau gene (MAPT) were reported, we performed genetic analysis. No pathological mutations of MAPT were identified, but we identified a novel GRN frameshift mutation (c.1118_1119delCCinsG: p.Pro373ArgX37) that resulted in progranulin haploinsufficiency. This is the first report of a GRN mutation associated with familial phenotypic heterogeneity in Japan. Literature review of GRN mutations associated with familial phenotypic heterogeneity revealed no tendency of mutation sites. The role of progranulin has been reported in this and other neurodegenerative diseases, and the analysis of GRN mutations may lead to the discovery of a new therapeutic target.

Early-progressive dilated cardiomyopathy in a family with Becker muscular dystrophy related to a novel frameshift mutation in the dystrophin gene exon 27.

Science.gov (United States)

Tsuda, Takeshi; Fitzgerald, Kristi; Scavena, Mena; Gidding, Samuel; Cox, Mary O; Marks, Harold; Flanigan, Kevin M; Moore, Steven A

2015-03-01

We report a family in which two male siblings with Becker muscular dystrophy (BMD) developed severe dilated cardiomyopathy (DCM) and progressive heart failure (HF) at age 11 years; one died at age 14 years while awaiting heart transplant and the other underwent left ventricular assist device implantation at the same age. Genetic analysis of one sibling showed a novel frameshift mutation in exon 27 of Duchenne muscular dystrophy (DMD) gene (c.3779_3785delCTTTGGAinsGG), in which seven base pairs are deleted and two are inserted. Although this predicts an amino-acid substitution and premature termination (p.Thr1260Argfs*8), muscle biopsy dystrophin immunostaining instead indicates that the mutation is more likely to alter splicing. Despite relatively preserved skeletal muscular performance, both the siblings developed progressive HF secondary to early-onset DCM. In addition, their 7-year-old nephew with delayed gross motor development, mild proximal muscle weakness and markedly elevated serum creatine kinase level (>13 000 IU l(-1)) at 16 months was recently demonstrated to have the familial DMD mutation. Here, we report a novel genotype of BMD with early-onset DCM and progressive lethal HF during early adolescence.

The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

Directory of Open Access Journals (Sweden)

Suneeth F Mathew

Full Text Available HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon' contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1.

Common Β- Thalassaemia Mutations in

Directory of Open Access Journals (Sweden)

P Azarfam

2005-01-01

Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.

Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

Science.gov (United States)

Liphardt, J; Napthine, S; Kontos, H; Brierley, I

1999-05-07

RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

Genetic Mutations in Cancer

Science.gov (United States)

Many different types of genetic mutations are found in cancer cells. This infographic outlines certain types of alterations that are present in cancer, such as missense, nonsense, frameshift, and chromosome rearrangements.

Uma Síntese Das Instâncias Narrativas Em Charaudeau E Peytard

Directory of Open Access Journals (Sweden)

Lucas Piter Alves Costa

2016-07-01

Full Text Available O discurso narrativo ficcional engendra níveis de produção de sentido, nos quais o sujeito autor se desdobra em entidades equivocadamente tomadas como as mesmas. Charaudeau (1992, 2008, por meio do Modo de Organização do Discurso Narrativo, e Peytard (2007 [1983], com sua Topografia das Instâncias do Campo Literário, buscaram elucidar esse equívoco. Os dois modelos compartilham a concepção de que um sujeito ocupante de uma instância situacional, sócio-histórica, é diferente do sujeito ocupante de uma instância discursiva e que assume a função de escritor. Diante desses pressupostos, os objetivos deste trabalho são: (a apresentar como Charaudeau e Peytard trabalham as instâncias de sujeito que compõem o discurso narrativo, (b distinguir conceitualmente essas instâncias, e, a partir daí, (c propor uma síntese delas, e, ao fim, (d diferenciar as instâncias de autor-indivíduo, autor-escritor e narrador.

Position-dependent termination and widespread obligatory frameshifting in Euplotes translation

Energy Technology Data Exchange (ETDEWEB)

Lobanov, Alexei V.; Heaphy, Stephen M.; Turanov, Anton A.; Gerashchenko, Maxim V.; Pucciarelli, Sandra; Devaraj, Raghul R.; Xie, Fang; Petyuk, Vladislav A.; Smith, Richard D.; Klobutcher, Lawrence A.; Atkins, John F.; Miceli, Cristina; Hatfield, Dolph L.; Baranov, Pavel V.; Gladyshev, Vadim N.

2016-11-21

The ribosome can change its reading frame during translation in a process known as programmed ribosomal frameshifting. These rare events are supported by complex mRNA signals. However, we found that the ciliates Euplotes crassus and Euplotes focardii exhibit widespread frameshifting at stop codons. 47 different codons preceding stop signals resulted in either +1 or +2 frameshifts, and +1 frameshifting at AAA was the most frequent. The frameshifts showed unusual plasticity and rapid evolution, and had little influence on translation rates. The proximity of a stop codon to the 3' mRNA end, rather than its occurrence or sequence context, appeared to designate termination. Thus, a ‘stop codon’ is not a sufficient signal for translation termination, and the default function of stop codons in Euplotes is frameshifting, whereas termination is specific to certain mRNA positions and probably requires additional factors.

Evidence for a Rad18-independent frameshift mutagenesis pathway in human cell-free extracts.

Directory of Open Access Journals (Sweden)

Régine Janel-Bintz

Full Text Available Bypass of replication blocks by specialized DNA polymerases is crucial for cell survival but may promote mutagenesis and genome instability. To gain insight into mutagenic sub-pathways that coexist in mammalian cells, we examined N-2-acetylaminofluorene (AAF-induced frameshift mutagenesis by means of SV40-based shuttle vectors containing a single adduct. We found that in mammalian cells, as previously observed in E. coli, modification of the third guanine of two target sequences, 5'-GGG-3' (3G and 5'-GGCGCC-3' (NarI site, induces -1 and -2 frameshift mutations, respectively. Using an in vitro assay for translesion synthesis, we investigated the biochemical control of these events. We showed that Pol eta, but neither Pol iota nor Pol zeta, plays a major role in the frameshift bypass of the AAF adduct located in the 3G sequence. By complementing PCNA-depleted extracts with either a wild-type or a non-ubiquitinatable form of PCNA, we found that this Pol eta-mediated pathway requires Rad18 and ubiquitination of PCNA. In contrast, when the AAF adduct is located within the NarI site, TLS is only partially dependent upon Pol eta and Rad18, unravelling the existence of alternative pathways that concurrently bypass this lesion.

An exon 53 frameshift mutation in CUBN abrogates cubam function and causes Imerslund-Gräsbeck syndrome in dogs.

Science.gov (United States)

Fyfe, John C; Hemker, Shelby L; Venta, Patrick J; Fitzgerald, Caitlin A; Outerbridge, Catherine A; Myers, Sherry L; Giger, Urs

2013-08-01

Cobalamin malabsorption accompanied by selective proteinuria is an autosomal recessive disorder known as Imerslund-Gräsbeck syndrome in humans and was previously described in dogs due to amnionless (AMN) mutations. The resultant vitamin B12 deficiency causes dyshematopoiesis, lethargy, failure to thrive, and life-threatening metabolic disruption in the juvenile period. We studied 3 kindreds of border collies with cobalamin malabsorption and mapped the disease locus in affected dogs to a 2.9Mb region of homozygosity on canine chromosome 2. The region included CUBN, the locus encoding cubilin, a peripheral membrane protein that in concert with AMN forms the functional intrinsic factor-cobalamin receptor expressed in ileum and a multi-ligand receptor in renal proximal tubules. Cobalamin malabsorption and proteinuria comprising CUBN ligands were demonstrated by radiolabeled cobalamin uptake studies and SDS-PAGE, respectively. CUBN mRNA and protein expression were reduced ~10 fold and ~20 fold, respectively, in both ileum and kidney of affected dogs. DNA sequencing demonstrated a single base deletion in exon 53 predicting a translational frameshift and early termination codon likely triggering nonsense mediated mRNA decay. The mutant allele segregated with the disease in the border collie kindred. The border collie disorder indicates that a CUBN mutation far C-terminal from the intrinsic factor-cobalamin binding site can abrogate receptor expression and cause Imerslund-Gräsbeck syndrome. Copyright © 2013 Elsevier Inc. All rights reserved.

A frameshift mutation in GON4L is associated with proportionate dwarfism in Fleckvieh cattle.

Science.gov (United States)

Schwarzenbacher, Hermann; Wurmser, Christine; Flisikowski, Krzysztof; Misurova, Lubica; Jung, Simone; Langenmayer, Martin C; Schnieke, Angelika; Knubben-Schweizer, Gabriela; Fries, Ruedi; Pausch, Hubert

2016-03-31

Low birth weight and postnatal growth restriction are the most evident symptoms of dwarfism. Accompanying skeletal aberrations may compromise the general condition and locomotion of affected individuals. Several paternal half-sibs with a low birth weight and a small size were born in 2013 in the Fleckvieh cattle population. Affected calves were strikingly underweight at birth in spite of a normal gestation length and had craniofacial abnormalities such as elongated narrow heads and brachygnathia inferior. In spite of a normal general condition, their growth remained restricted during rearing. We genotyped 27 affected and 10,454 unaffected animals at 44,672 single nucleotide polymorphisms and performed association tests followed by homozygosity mapping, which allowed us to map the locus responsible for growth failure to a 1.85-Mb segment on bovine chromosome 3. Analysis of whole-genome re-sequencing data from one affected and 289 unaffected animals revealed a 1-bp deletion (g.15079217delC, rs723240647) in the coding region of the GON4L gene that segregated with the dwarfism-associated haplotype. We showed that the deletion induces intron retention and premature termination of translation, which can lead to a severely truncated protein that lacks domains that are likely essential to normal protein function. The widespread use of an undetected carrier bull for artificial insemination has resulted in a tenfold increase in the frequency of the deleterious allele in the female population. A frameshift mutation in GON4L is associated with autosomal recessive proportionate dwarfism in Fleckvieh cattle. The mutation has segregated in the population for more than 50 years without being recognized as a genetic disorder. However, the widespread use of an undetected carrier bull for artificial insemination caused a sudden accumulation of homozygous calves with dwarfism. Our findings provide the basis for genome-based mating strategies to avoid the inadvertent mating of carrier

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

Science.gov (United States)

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

Model of the pathway of −1 frameshifting: Long pausing

Directory of Open Access Journals (Sweden)

Ping Xie

2016-03-01

Full Text Available It has been characterized that the programmed ribosomal −1 frameshifting often occurs at the slippery sequence on the presence of a downstream mRNA pseudoknot. In some prokaryotic cases such as the dnaX gene of Escherichia coli, an additional stimulatory signal—an upstream, internal Shine–Dalgarno (SD sequence—is also necessary to stimulate the efficient −1 frameshifting. However, the molecular and physical mechanism of the −1 frameshifting is poorly understood. Here, we propose a model of the pathway of the −1 translational frameshifting during ribosome translation of the dnaX −1 frameshift mRNA. With the model, the single-molecule fluorescence data (Chen et al. (2014 [29] on the dynamics of the shunt either to long pausing or to normal translation, the tRNA transit and sampling dynamics in the long-paused rotated state, the EF-G sampling dynamics, the mean rotated-state lifetimes, etc., are explained quantitatively. Moreover, the model is also consistent with the experimental data (Yan et al. (2015 [30] on translocation excursions and broad branching of frameshifting pathways. In addition, we present some predicted results, which can be easily tested by future optical trapping experiments.

Molecular mechanisms of induced-mutations

International Nuclear Information System (INIS)

Kato, Takeshi

1985-01-01

The outcome of recent studies on mechanisms of induced-mutations is outlined with particular emphasis on the dependence of recA gene function in Escherichia coli. Genes involved in spontaneous mutation and x-ray- and chemical-induced mutation and genes involved in adaptive response are presented. As for SOS mutagenesis, SOS-induced regulation mechanisms and mutagenic routes are described. Furthermore, specificity of mutagens themselves are discussed in relation to mechanisms of base substitution, frameshift, and deletion mutagenesis. (Namekawa, K.)

Mutations in TGFbeta-RII and BAX mediate tumor progression in the later stages of colorectal cancer with microsatellite instability

International Nuclear Information System (INIS)

Yashiro, Masakazu; Hirakawa, Kosei; Boland, C Richard

2010-01-01

Microsatellite instability (MSI) occurs in 15% of colorectal cancers (CRC). The genetic targets for mutation in the MSI phenotype include somatic mutations in the transforming growth factor beta receptor typeII (TGFbetaRII), BAX, hMSH3 and hMSH6. It is not clear how mutations of these genes mediate tumor progression in the MSI pathway, and the temporal sequence of these mutations remains uncertain. In this study, early stage CRCs were examined for frameshift mutations in these target genes, and compared with late stage tumors and CRC cell lines. We investigated 6 CRC cell lines and 71 sporadic CRCs, including 61 early stage cancers and 10 late stage cancers. Mutations of repetitive mononucleotide tracts in the coding regions of TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR and Fas antigen were identified by direct sequencing. Thirteen (18.3%) of 71 CRC, including 9/61 (14.7%) early stage cancers and 4/10 (40%) late stage cancers, were identified as MSI and analyzed for frameshift mutations. No mutation in the target genes was observed in any of the 9 early stage MSI CRCs. In contrast, frameshift mutations of TGFbetaRII, BAX, hMSH3 and hMSH6 were present in 3/4 late stage MSI tumors. There is a statistical association (p = 0.014) between mutation in any one gene and tumor stage. TGFbetaRII, BAX, hMSH3 and hMSH6 mutations are relatively late events in the genesis of MSI CRCs. The frameshift mutations in these target genes might mediate progression from early to late stage cancer, rather than mediating the adenoma to carcinoma transition

Unusual long survival despite severe lung disease of a child with biallelic loss of function mutations in ABCA-3

Directory of Open Access Journals (Sweden)

P. El Boustany

Full Text Available Homozygous or compound heterozygous for frameshift or nonsense mutations in the ATP–binding cassette transporter A3 (ABCA3 is associated with neonatal respiratory failure and death within the first year of life without lung transplantation. We report the case of a newborn baby girl who developed severe respiratory distress soon after birth. She was diagnosed with compound heterozygous frameshift mutation of the ABCA3 gene. Despite extensive treatment (intravenous corticosteroids pulse therapy, oral corticosteroids, azithromycin, and hydroxychloroquine, she developed chronic respiratory failure. As the parents refused cardio-pulmonary transplantation and couldn't resolve to an accompaniment of end of life, a tracheostomy was performed resulting in continuous mechanical ventilation. A neurodevelopmental delay and an overall muscular dystrophy were noted. At the age of 5 years, after 2 episodes of pneumothorax, the patient died from severe respiratory failure. To our knowledge, this was the first case of a child with compound heterozygous frameshift mutation who posed such an ethical dilemma with a patient surviving till the age of five years. Keywords: ABCA3 deficiency, Compound heterozygous frameshift mutation, Neonatal respiratory failure, Tracheostomy, Mechanical ventilation, Ethical dilemma

Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa [version 2; referees: 2 approved, 1 approved with reservations

Directory of Open Access Journals (Sweden)

Shamsudheen Karuthedath Vellarikkal

2016-07-01

Full Text Available Dystrophic epidermolysis bullosa simplex (DEB is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES. Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India.

Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa [version 1; referees: 2 approved, 1 approved with reservations

Directory of Open Access Journals (Sweden)

Shamsudheen Karuthedath Vellarikkal

2016-05-01

Full Text Available Dystrophic epidermolysis bullosa simplex (DEB is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES. Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India.

SHIFT: server for hidden stops analysis in frame-shifted translation.

Science.gov (United States)

Gupta, Arun; Singh, Tiratha Raj

2013-02-23

Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

Screening for calreticulin mutations in a cohort of patients suspected ...

African Journals Online (AJOL)

Of the 36 types of insertions and deletions identified, type 1 (a. 52-base pair deletion) and type 2 (a 5-base pair insertion) mutations account for >80% of CALR mutations.[7] Phenotypic differences between type 1 and type 2 carriers have been implicated. [3] All recurrent mutations cause a frameshift in the region encoding.

UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.

Science.gov (United States)

Lawrence, C W; O'Brien, T; Bond, J

1984-01-01

The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.

Effect of endogenous carotenoids on “adaptive” mutation in Escherichia coli FC40

Science.gov (United States)

Bridges, Bryn A.; Foster, Patricia L.; Timms, Andrew R.

2010-01-01

The appearance over many days of Lac+ frameshift mutations in Escherichia coli strain FC40 incubated on lactose selection plates is a classic example of apparent “adaptive” mutation in an episomal gene. We show that endogenously overproduced carotenoids reduce adaptive mutation under selective conditions by a factor of around two. Carotenoids are known to scavenge singlet oxygen suggesting that the accumulation of oxidative base damage may be an integral part of the adaptive mutation phenomenon. If so, the lesion cannot be 7,8-dihydro-8-oxoguanine since adaptive mutation in FC40 is unaffected by mutM and mutY mutations. If active oxygen species such as singlet oxygen are involved in adaptive mutation then they should also induce frameshift mutations in FC40 under non-selective conditions. We show that such mutations can be induced under non-selective conditions by protoporphyrin photosensitisation and that this photodynamic induction is reduced by a factor of just over two when endogenous carotenoids are present. We argue that the involvement of oxidative damage would in no way be inconsistent with current understanding of the mechanism of adaptive mutation and the role of DNA polymerases. PMID:11166030

A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

Directory of Open Access Journals (Sweden)

Alexandre Bolze

Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

Directory of Open Access Journals (Sweden)

Marcelo Paschoalete Carlin

2013-01-01

Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

[Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

Science.gov (United States)

Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

2008-06-01

To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

A novel FLNC frameshift and an OBSCN variant in a family with distal muscular dystrophy

Energy Technology Data Exchange (ETDEWEB)

Rossi, Daniela; Palmio, Johanna; EvilaÈ, Anni; Galli, Lucia; Barone, Virginia; Caldwell, Tracy A.; Policke, Rachel A.; Aldkheil, Esraa; Berndsen, Christopher E.; Wright, Nathan T.; Malfatti, Edoardo; Brochier, Guy; Pierantozzi, Enrico; Jordanova, Albena; Guergueltcheva, Velina; Romero, Norma Beatriz; Hackman, Peter; Eymard, Bruno; Udd, Bjarne; Sorrentino, Vincenzo (Antwerp); (U. Sofia); (Siena); (Tampere); (J Madison); (Helsinki)

2017-10-26

A novel FLNC c.5161delG (p.Gly1722ValfsTer61) mutation was identified in two members of a French family affected by distal myopathy and in one healthy relative. This FLNC c.5161delG mutation is one nucleotide away from a previously reported FLNC mutation (c.5160delC) that was identified in patients and in asymptomatic carriers of three Bulgarian families with distal muscular dystrophy, indicating a low penetrance of the FLNC frameshift mutations. Given these similarities, we believe that the two FLNC mutations alone can be causative of distal myopathy without full penetrance. Moreover, comparative analysis of the clinical manifestations indicates that patients of the French family show an earlier onset and a complete segregation of the disease. As a possible explanation of this, the two French patients also carry a OBSCN c.13330C>T (p.Arg4444Trp) mutation. The p.Arg4444Trp variant is localized within the OBSCN Ig59 domain that, together with Ig58, binds to the ZIg9/ZIg10 domains of titin at Z-disks. Structural and functional studies indicate that this OBSCN p.Arg4444Trp mutation decreases titin binding by ~15-fold. On this line, we suggest that the combination of the OBSCN p.Arg4444Trp variant and of the FLNC c.5161delG mutation, can cooperatively affect myofibril stability and increase the penetrance of muscular dystrophy in the French family.

Identification of novel FBN1 and TGFBR2 mutations in 65 probands with Marfan syndrome or Marfan-like phenotypes.

Science.gov (United States)

Chung, Brian Hon-Yin; Lam, Stephen Tak-Sum; Tong, Tony Ming-For; Li, Susanna Yuk-Han; Lun, Kin-Shing; Chan, Daniel Hon-Chuen; Fok, Susanna Fung-Shan; Or, June Siu-Fong; Smith, David Keith; Yang, Wanling; Lau, Yu-Lung

2009-07-01

Marfan syndrome is an autosomal dominant connective tissue disorder, and mutations in the FBN1 and TGFBR2 genes have been identified in probands with MFS and related phenotypes. Using DHPLC and sequencing, we studied the mutation spectrum in 65 probands with Marfan syndrome and related phenotypes. A total of 24 mutations in FBN1 were identified, of which 19 (nine missense, six frameshift, two nonsense and two affecting splice junctions) were novel. In the remaining 41 probands, six were identified to have novel TGFBR2 mutations (one frameshift and five missense mutations). All novel mutations found in this study were confirmed to be absent in 50 unrelated normal individuals of the same ethnic background. In probands who fulfilled the Ghent criteria (n = 16), mutations in FBN1 were found in 81% of cases. None of those with TGFBR2 mutations fulfilled the Ghent criteria. Novel missense mutations of unknown significance were classified according to the latest ACMG guidelines and their likelihood to be causative was evaluated.

Embryonal rhabdomyosarcoma in a patient with a heterozygous frameshift variant in the DICER1 gene and additional manifestations of the DICER1 syndrome.

Science.gov (United States)

Fremerey, Julia; Balzer, Stefan; Brozou, Triantafyllia; Schaper, Joerg; Borkhardt, Arndt; Kuhlen, Michaela

2017-07-01

Germline mutations in the DICER1 gene are associated with an inherited cancer predisposition syndrome also known as the DICER1-syndrome, which is implicated in a broad range of tumors including pleuropulmonary blastoma, ovarian Sertoli-Leydig cell tumors, ciliary body medulloepithelioma (CBME), pituitary blastoma, embryonal rhabdomyosarcoma (eRMS), anaplastic renal sarcoma as well as ocular, sinonasal tumors ovarian sex-cord tumors, thyroid neoplasia and cystic nephroma. This study describes a novel, heterozygous frameshift DICER1 mutation in a patient, who is affected by different tumors of the DICER1-syndrome, including eRMS, CBME and suspected pleuropulmonary blastoma type I. By whole-exome sequencing of germline material using peripheral blood-derived DNA, we identified a single base pair duplication within the DICER1 gene (c.3405 dupA) that leads to a frameshift and results in a premature stop in exon 21 (p.Gly1136Arg). The metachronous occurrence of two unrelated tumor entities (eRMS and CBME) in a very young child within a short timeframe should have raised the suspicion of an underlying cancer susceptibility syndrome and should be prompt tested for DICER1.

Four Novel p.N385K, p.V36A, c.1033–1034insT and c.1417–1418delCT Mutations in the Sphingomyelin Phosphodiesterase 1 (SMPD1 Gene in Patients with Types A and B Niemann-Pick Disease (NPD

Directory of Open Access Journals (Sweden)

Masoumeh Dehghan Manshadi

2015-03-01

Full Text Available Background: Types A and B Niemann-Pick disease (NPD are autosomal-recessive lysosomal storage disorders caused by the deficient activity of acid sphingomyelinase due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1 gene. Methods: In order to determine the prevalence and distribution of SMPD1 gene mutations, the genomic DNA of 15 unrelated Iranian patients with types A and B NPD was examined using PCR, DNA sequencing and bioinformatics analysis. Results: Of 8 patients with the p.G508R mutation, 5 patients were homozygous, while the other 3 were heterozygous. One patient was heterozygous for both the p.N385K and p.G508R mutations. Another patient was heterozygous for both the p.A487V and p.G508R mutations. Two patients (one homozygous and one heterozygous showed the p.V36A mutation. One patient was homozygous for the c.1033–1034insT mutation. One patient was homozygous for the c.573delT mutation, and 1 patient was homozygous for the c.1417–1418delCT mutation. Additionally, bioinformatics analysis indicated that two new p.V36A and p.N385K mutations decreased the acid sphingomyelinase (ASM protein stability, which might be evidence to suggest the pathogenicity of these mutations. Conclusion: with detection of these new mutations, the genotypic spectrum of types A and B NPD is extended, facilitating the definition of disease-related mutations. However, more research is essential to confirm the pathogenic effect of these mutations.

Norrie-Warburg syndrome: two novel mutations in patients with classical clinical phenotype.

Science.gov (United States)

Gal, A; Veske, A; Jojart, G; Grammatico, B; Huber, B; Gu, S; del Porto, G; Senyi, K

1996-01-01

Norrie-Warburg syndrome (NWS) is a rare X-linked disorder characterized by blindness, which is invariable, deafness and mental disturbances, which are present occasionally. We describe here two novel mutations, a missense mutation (C126S) and a 1-base pair insertion (insT466/T467), together with a recurrent mutation (M1V), found in patients presenting with the classical clinical phenotype of NWS. All three mutations are likely to result in prominent structural changes of the norrin protein.

Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

Science.gov (United States)

Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

2017-01-01

Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

Science.gov (United States)

Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

2016-09-06

Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients

DEFF Research Database (Denmark)

Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J

2013-01-01

Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomi...

1st International Nuclear Science and Technology Conference 2014 (INST2014)

Science.gov (United States)

2015-04-01

Nuclear technology has played an important role in many aspects of our lives, including agriculture, energy, materials, medicine, environment, forensics, healthcare, and frontier research. The International Nuclear Science and Technology Conference (INST) aims to bring together scientists, engineers, academics, and students to share knowledge and experiences about all aspects of nuclear sciences. INST has evolved from a series of national conferences in Thailand called Nuclear Science and Technology (NST) Conference, which has been held for 11 times, the first being in 1986. INST2014 was held in August 2014 and hosted by Thailand Institute of Nuclear Technology (TINT). The theme was "Driving the future with nuclear technology". The conference working language was English. The proceedings were peer reviewed and considered for publication. The topics covered in the conference were: • Agricultural and food applications [AGR] • Environmental applications [ENV] • Radiation processing and industrial applications [IND] • Medical and nutritional applications [MED] • Nuclear physics and engineering [PHY] • Nuclear and radiation safety [SAF] • Other related topics [OTH] • Device and instrument presentation [DEV] Awards for outstanding oral and poster presentations will be given to qualified students who present their work during the conference.

six novel mutations in the TSC1 and TSC2 genes

Indian Academy of Sciences (India)

M. GLUSHKOVA

2018-04-30

Apr 30, 2018 ... RESEARCH ARTICLE ... nant disorder caused by inactivating TSC1 or TSC2 gene variants (Van ... premature protein truncation, while missense mutations are rare ..... TSC2 variants in our cohort are missense, frame-shift.

X-ray-induced mutations in Escherichia coli K-12 strains with altered DNA polymerase I activities

International Nuclear Information System (INIS)

Nagata, Yuki; Kawata, Masakado; Komura, Jun-ichiro; Ono, Tetsuya; Yamamoto, Kazuo

2003-01-01

Spectra of ionizing radiation mutagenesis were determined by sequencing X-ray-induced endogenous tonB gene mutations in Escherichia coli polA strains. We used two polA alleles, the polA1 mutation, defective for Klenow domain, and the polA107 mutation, defective for flap domain. We demonstrated that irradiation of 75 and 50 Gy X-rays could induce 3.8- and 2.6-fold more of tonB mutation in polA1 and polA107 strains, respectively, than spontaneous level. The radiation induced spectrum of 51 tonB mutations in polA1 and 51 in polA107 indicated that minus frameshift, A:T→T:A transversion and G:C→T:A transversion were the types of mutations increased. Previously, we have reported essentially the same X-ray-induced tonB mutation spectra in the wild-type strain. These results indicate that (1) X-rays can induce minus frameshift, A:T→T:A transversion and G:C→T:A transversion in E. coli and (2) presence or absence of polymerase I (PolI) of E. coli does not have any effects on the process of X-ray mutagenesis

A novel frameshift deletion in the albumin gene causes analbuminemia in a young Turkish woman.

Science.gov (United States)

Dagnino, Monica; Caridi, Gianluca; Aydin, Zeki; Ozturk, Savas; Karaali, Zeynep; Kazancioglu, Rumeyza; Cefle, Kivanc; Gursu, Meltem; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2010-11-11

Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin. The analbuminemic trait was diagnosed in a young Turkish woman on the basis of her clinical symptoms (bilateral lower limb edema) and biochemical findings (minimal albumin amount and variable increases in other protein fractions). Total DNA from the analbuminemic proband and her parents was PCR-amplified using oligonucleotide primers designed to amplify the 14 exons of the albumin gene (ALB) and the flanking intron regions. The products were screened for mutations by single-strand conformation polymorphism (SSCP) and heteroduplex analyses (HA). HA allowed the identification of the mutation site in exon 12. Direct DNA sequencing of this abnormal fragment revealed that the analbuminemic trait was caused by a homozygous CA deletion at nucleotide positions c. 1614-1615 in the codons for Cys538 and Thr539. The subsequent frameshift should give rise to a putative truncated albumin variant in which the sequence Cys(538)-Thr-Leu-Ser has been changed to Cys(538)-Thr-Phe-Stop. The parents were heterozygous for the same mutation. Gel-based mutation detection and DNA sequencing substantiate the clinical diagnosis of congenital analbuminemia in our patient and show that the condition is caused by a novel mutation within the ALB gene. These results contribute to shed light on the molecular basis of this rare condition. 2010 Elsevier B.V. All rights reserved.

Serum antibodies against frameshift peptides in microsatellite unstable colorectal cancer patients with Lynch syndrome.

Science.gov (United States)

Reuschenbach, Miriam; Kloor, Matthias; Morak, Monika; Wentzensen, Nicolas; Germann, Anja; Garbe, Yvette; Tariverdian, Mirjam; Findeisen, Peter; Neumaier, Michael; Holinski-Feder, Elke; von Knebel Doeberitz, Magnus

2010-06-01

High level microsatellite instability (MSI-H) occurs in about 15% of colorectal cancer (CRCs), either as sporadic cancers or in the context of hereditary non-polyposis cancer or Lynch syndrome. In MSI-H CRC, mismatch repair deficiency leads to insertion/deletion mutations at coding microsatellites and thus to the translation of frameshift peptides (FSPs). FSPs are potent inductors of T cell responses in vitro and in vivo. The present study aims at the identification of FSP-specific humoral immune responses in MSI-H CRC and Lynch syndrome. Sera from patients with history of MSI-H CRC (n = 69), healthy Lynch syndrome mutation carriers (n = 31) and healthy controls (n = 52) were analyzed for antibodies against FSPs using peptide ELISA. Reactivities were measured against FSPs derived from genes frequently mutated in MSI-H CRCs, AIM2, TGFBR2, CASP5, TAF1B, ZNF294, and MARCKS. Antibody reactivity against FSPs was significantly higher in MSI-H CRC patients than in healthy controls (P = 0.036, Mann-Whitney) and highest in patients with shortest interval between tumor resection and serum sampling. Humoral immune responses in patients were most frequently directed against FSPs derived from mutated TAF1B (11.6%, 8/69) and TGFBR2 (10.1%, 7/69). Low level FSP-specific antibodies were also detected in healthy mutation carriers. Our results show that antibody responses against FSPs are detectable in MSI-H CRC patients and healthy Lynch syndrome mutation carriers. Based on the high number of defined FSP antigens, measuring FSP-specific humoral immune responses is a highly promising tool for future diagnostic application in MSI-H cancer patients.

Serum antibodies against frameshift peptides in microsatellite unstable colorectal cancer patients with Lynch syndrome

Science.gov (United States)

Reuschenbach, Miriam; Kloor, Matthias; Morak, Monika; Wentzensen, Nicolas; Germann, Anja; Garbe, Yvette; Tariverdian, Mirjam; Findeisen, Peter; Neumaier, Michael; Holinski-Feder, Elke; Doeberitz, Magnus von Knebel

2014-01-01

High level microsatellite instability (MSI-H) occurs in about 15% of colorectal cancer (CRCs), either as sporadic cancers or in the context of hereditary non-polyposis cancer (HNPCC) or Lynch syndrome. In MSI-H CRC, mismatch repair deficiency leads to insertion/deletion mutations at coding microsatellites (cMS) and thus to the translation of frameshift peptides (FSPs). FSPs are potent inductors of T cell responses in vitro and in vivo. The present study aims at the identification of FSP-specific humoral immune responses in MSI-H CRC and Lynch syndrome. Sera from patients with history of MSI-H CRC (n=69), healthy Lynch syndrome mutation carriers (n=31) and healthy controls (n=52) were analyzed for antibodies against FSPs using peptide ELISA. Reactivities were measured against FSPs derived from genes frequently mutated in MSI-H CRCs, AIM2, TGFBR2, CASP5, TAF1B, ZNF294, and MARCKS. Antibody reactivity against FSPs was significantly higher in MSI-H CRC patients than in healthy controls (p=0.036, Mann-Whitney) and highest in patients with shortest interval between tumor resection and serum sampling. Humoral immune responses in patients were most frequently directed against FSPs derived from mutated TAF1B (11.6%, 8/69) and TGFBR2 (10.1%, 7/69). Low level FSP-specific antibodies were also detected in healthy mutation carriers. Our results show that antibody responses against FSPs are detectable in MSI-H CRC patients and healthy Lynch syndrome mutation carriers. Based on the high number of defined FSP antigens, measuring FSP-specific humoral immune responses is a highly promising tool for future diagnostic application in MSI-H cancer patients. PMID:19957108

Novel TBX22 mutations in Chinese nonsyndromic cleft lip/palate ...

Indian Academy of Sciences (India)

Jiewen Dai

2018-06-06

Jun 6, 2018 ... sense, frame-shift, splice-site, or missense mutation (Pauws et al. 2013). Except for ... 0.4.0, http:// · frodo.wi.mit.edu/) was used for primer design. The poly- ..... Sternberg M. J. 2015 The Phyre2 web portal for protein modeling ...

NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features

DEFF Research Database (Denmark)

Andersen, Morten Tolstrup; Andersen, Mette Klarskov; Christiansen, D.H.

2008-01-01

Frameshift mutations of the nucleophosmin gene (NPM1) were recently reported as a frequently occurring abnormality in patients with de novo acute myeloid leukemia (AML). To evaluate the frequency of NPM1 mutations in patients with therapy-related myelodysplasia (t-MDS) and therapy-related AML (t......-/-7, the most frequent abnormalities of t-MDS/t-AML, were not observed (P=0.002). This raises the question whether some of the cases presenting NPM1 mutations were in fact cases of de novo leukemia. The close association to class I mutations and the inverse association to class II mutations suggest...

TNF Lectin-Like Domain Restores Epithelial Sodium Channel Function in Frameshift Mutants Associated with Pseudohypoaldosteronism Type 1B

Directory of Open Access Journals (Sweden)

Anita Willam

2017-05-01

Full Text Available Previous in vitro studies have indicated that tumor necrosis factor (TNF activates amiloride-sensitive epithelial sodium channel (ENaC current through its lectin-like (TIP domain, since cyclic peptides mimicking the TIP domain (e.g., solnatide, showed ENaC-activating properties. In the current study, the effects of TNF and solnatide on individual ENaC subunits or ENaC carrying mutated glycosylation sites in the α-ENaC subunit were compared, revealing a similar mode of action for TNF and solnatide and corroborating the previous assumption that the lectin-like domain of TNF is the relevant molecular structure for ENaC activation. Accordingly, TNF enhanced ENaC current by increasing open probability of the glycosylated channel, position N511 in the α-ENaC subunit being identified as the most important glycosylation site. TNF significantly increased Na+ current through ENaC comprising only the pore forming subunits α or δ, was less active in ENaC comprising only β-subunits, and showed no effect on ENaC comprising γ-subunits. TNF did not increase the membrane abundance of ENaC subunits to the extent observed with solnatide. Since the α-subunit is believed to play a prominent role in the ENaC current activating effect of TNF and TIP, we investigated whether TNF and solnatide can enhance αβγ-ENaC current in α-ENaC loss-of-function frameshift mutants. The efficacy of solnatide has been already proven in pathological conditions involving ENaC in phase II clinical trials. The frameshift mutations αI68fs, αT169fs, αP197fs, αE272fs, αF435fs, αR438fs, αY447fs, αR448fs, αS452fs, and αT482fs have been reported to cause pseudohypoaldosteronism type 1B (PHA1B, a rare, life-threatening, salt-wasting disease, which hitherto has been treated only symptomatically. In a heterologous expression system, all frameshift mutants showed significantly reduced amiloride-sensitive whole-cell current compared to wild type αβγ-ENaC, whereas membrane

Significance of somatic mutations and content alteration of mitochondrial DNA in esophageal cancer

Directory of Open Access Journals (Sweden)

Wang Yu-Fen

2006-04-01

Full Text Available Abstract Background The roles of mitochondria in energy metabolism, the generation of ROS, aging, and the initiation of apoptosis have implicated their importance in tumorigenesis. In this study we aim to establish the mutation spectrum and to understand the role of somatic mtDNA mutations in esophageal cancer. Methods The entire mitochondrial genome was screened for somatic mutations in 20 pairs (18 esophageal squamous cell carcinomas, one adenosquamous carcinoma and one adenocarcinoma of tumor/surrounding normal tissue of esophageal cancers, using temporal temperature gradient gel electrophoresis (TTGE, followed by direct DNA sequencing to identify the mutations. Results Fourteen somatic mtDNA mutations were identified in 55% (11/20 of tumors analyzed, including 2 novel missense mutations and a frameshift mutation in ND4L, ATP6 subunit, and ND4 genes respectively. Nine mutations (64% were in the D-loop region. Numerous germline variations were found, at least 10 of them were novel and five were missense mutations, some of them occurred in evolutionarily conserved domains. Using real-time quantitative PCR analysis, the mtDNA content was found to increase in some tumors and decrease in others. Analysis of molecular and other clinicopathological findings does not reveal significant correlation between somatic mtDNA mutations and mtDNA content, or between mtDNA content and metastatic status. Conclusion Our results demonstrate that somatic mtDNA mutations in esophageal cancers are frequent. Some missense and frameshift mutations may play an important role in the tumorigenesis of esophageal carcinoma. More extensive biochemical and molecular studies will be necessary to determine the pathological significance of these somatic mutations.

RNF43 is mutated less frequently in Lynch Syndrome compared with sporadic microsatellite unstable colorectal cancers.

Science.gov (United States)

Fennell, Lochlan J; Clendenning, Mark; McKeone, Diane M; Jamieson, Saara H; Balachandran, Samanthy; Borowsky, Jennifer; Liu, John; Kawamata, Futoshi; Bond, Catherine E; Rosty, Christophe; Burge, Matthew E; Buchanan, Daniel D; Leggett, Barbara A; Whitehall, Vicki L J

2018-01-01

The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers

Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

International Nuclear Information System (INIS)

Kimura, Hiroshi; Kato, Takesi.

1992-01-01

X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

Hybridization alters spontaneous mutation rates in a parent-of-origin-dependent fashion in Arabidopsis.

Science.gov (United States)

Bashir, Tufail; Sailer, Christian; Gerber, Florian; Loganathan, Nitin; Bhoopalan, Hemadev; Eichenberger, Christof; Grossniklaus, Ueli; Baskar, Ramamurthy

2014-05-01

Over 70 years ago, increased spontaneous mutation rates were observed in Drosophila spp. hybrids, but the genetic basis of this phenomenon is not well understood. The model plant Arabidopsis (Arabidopsis thaliana) offers unique opportunities to study the types of mutations induced upon hybridization and the frequency of their occurrence. Understanding the mutational effects of hybridization is important, as many crop plants are grown as hybrids. Besides, hybridization is important for speciation and its effects on genome integrity could be critical, as chromosomal rearrangements can lead to reproductive isolation. We examined the rates of hybridization-induced point and frameshift mutations as well as homologous recombination events in intraspecific Arabidopsis hybrids using a set of transgenic mutation detector lines that carry mutated or truncated versions of a reporter gene. We found that hybridization alters the frequency of different kinds of mutations. In general, Columbia (Col)×Cape Verde Islands and Col×C24 hybrid progeny had decreased T→G and T→A transversion rates but an increased C→T transition rate. Significant changes in frameshift mutation rates were also observed in some hybrids. In Col×C24 hybrids, there is a trend for increased homologous recombination rates, except for the hybrids from one line, while in Col×Cape Verde Islands hybrids, this rate is decreased. The overall genetic distance of the parents had no influence on mutation rates in the progeny, as closely related accessions on occasion displayed higher mutation rates than accessions that are separated farther apart. However, reciprocal hybrids had significantly different mutation rates, suggesting parent-of-origin-dependent effects on the mutation frequency.

Structural diversity of frameshifting signals : reprogramming the programmed

NARCIS (Netherlands)

Yu, Chien-Hung

2011-01-01

Programmed ribosomal frameshifting (PRF) is one kind of recoding events that is mostly utilized by RNA viruses to synthesize more proteins with defined ratio from their compact genome and it is known that the stoichiometric is critical to virus infection and propagation. Two cis-acting RNA elements

(TSC) in Bulgaria: six novel mutations in the TSC1 and TSC2 genes

Indian Academy of Sciences (India)

G2-Trombo

Zdrave” str., ... Our data is similar to previous studies with .... The TSC1 and TSC2 protein products, hamartin (TSC1) with 1164 amino acids and tuberin ... cohort are missense, frameshift and nonsense mutations, while in the TSC1 gene most of ...

Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

DEFF Research Database (Denmark)

Christiansen, L; Ged, C; Hombrados, I

1999-01-01

to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

Loss of function JAK1 mutations occur at high frequency in cancers with microsatellite instability and are suggestive of immune evasion.

Science.gov (United States)

Albacker, Lee A; Wu, Jeremy; Smith, Peter; Warmuth, Markus; Stephens, Philip J; Zhu, Ping; Yu, Lihua; Chmielecki, Juliann

2017-01-01

Immune evasion is a well-recognized hallmark of cancer and recent studies with immunotherapy agents have suggested that tumors with increased numbers of neoantigens elicit greater immune responses. We hypothesized that the immune system presents a common selective pressure on high mutation burden tumors and therefore immune evasion mutations would be enriched in high mutation burden tumors. The JAK family of kinases is required for the signaling of a host of immune modulators in tumor, stromal, and immune cells. Therefore, we analyzed alterations in this family for the hypothesized signature of an immune evasion mutation. Here, we searched a database of 61,704 unique solid tumors for alterations in the JAK family kinases (JAK1/2/3, TYK2). We used The Cancer Genome Atlas and Cancer Cell Line Encyclopedia data to confirm and extend our findings by analyzing gene expression patterns. Recurrent frameshift mutations in JAK1 were associated with high mutation burden and microsatellite instability. These mutations occurred in multiple tumor types including endometrial, colorectal, stomach, and prostate carcinomas. Analyzing gene expression signatures in endometrial and stomach adenocarcinomas revealed that tumors with a JAK1 frameshift exhibited reduced expression of interferon response signatures and multiple anti-tumor immune signatures. Importantly, endometrial cancer cell lines exhibited similar gene expression changes that were expected to be tumor cell intrinsic (e.g. interferon response) but not those expected to be tumor cell extrinsic (e.g. NK cells). From these data, we derive two primary conclusions: 1) JAK1 frameshifts are loss of function alterations that represent a potential pan-cancer adaptation to immune responses against tumors with microsatellite instability; 2) The mechanism by which JAK1 loss of function contributes to tumor immune evasion is likely associated with loss of the JAK1-mediated interferon response.

Immunodeficiency associated with FCN3 mutation and ficolin-3 deficiency

DEFF Research Database (Denmark)

Munthe-Fog, Lea; Hummelshøj, Tina; Honoré, Christian

2009-01-01

Ficolin-3, encoded by the FCN3 gene and expressed in the lung and liver, is a recognition molecule in the lectin pathway of the complement system. Heterozygosity for an FCN3 frameshift mutation (rs28357092), leading to a distortion of the C-terminal end of the molecule, occurs in people without...... disease (allele frequency among whites, 0.01). We describe a patient with recurrent infections who was homozygous for this mutation, who had undetectable serum levels of ficolin-3, and who had a deficiency in ficolin-3-dependent complement activation....

Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

International Nuclear Information System (INIS)

Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

2010-01-01

Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

Truncating Mutations of MAGEL2, a Gene within the Prader-Willi Locus, Are Responsible for Severe Arthrogryposis

Science.gov (United States)

Mejlachowicz, Dan; Nolent, Flora; Maluenda, Jérome; Ranjatoelina-Randrianaivo, Hanitra; Giuliano, Fabienne; Gut, Ivo; Sternberg, Damien; Laquerrière, Annie; Melki, Judith

2015-01-01

Arthrogryposis multiplex congenita (AMC) is characterized by the presence of multiple joint contractures resulting from reduced or absent fetal movement. Here, we report two unrelated families affected by lethal AMC. By genetic mapping and whole-exome sequencing in a multiplex family, a heterozygous truncating MAGEL2 mutation leading to frameshift and a premature stop codon (c.1996delC, p.Gln666Serfs∗36) and inherited from the father was identified in the probands. In another family, a distinct heterozygous truncating mutation leading to frameshift (c.2118delT, p.Leu708Trpfs∗7) and occurring de novo on the paternal allele of MAGEL2 was identified in the affected individual. In both families, RNA analysis identified the mutated paternal MAGEL2 transcripts only in affected individuals. MAGEL2 is one of the paternally expressed genes within the Prader-Willi syndrome (PWS) locus. PWS is associated with, to varying extents, reduced fetal mobility, severe infantile hypotonia, childhood-onset obesity, hypogonadism, and intellectual disability. MAGEL2 mutations have been recently reported in affected individuals with features resembling PWS and called Schaaf-Yang syndrome. Here, we show that paternal MAGEL2 mutations are also responsible for lethal AMC, recapitulating the clinical spectrum of PWS and suggesting that MAGEL2 is a PWS-determining gene. PMID:26365340

Compound heterozygous ASPM mutations in Pakistani MCPH families

DEFF Research Database (Denmark)

Muhammad, Farooq; Mahmood Baig, Shahid; Hansen, Lars

2009-01-01

Autosomal recessive primary microcephaly (MCPH) is characterized by reduced head circumference (50% of all reported families. In spite of the high frequency of MCPH in Pakistan only one case of compound heterozygosity for mutations in ASPM has been reported yet. In this large MCPH study we...... confirmed compound heterozygosity in two and homozygous mutations in 20 families, respectively, showing that up to 10% of families with MCPH caused by ASPM are compound heterozygous. In total we identified 16 different nonsense or frameshift mutations of which 12 were novel thereby increasing the number...... of mutations in ASPM significantly from 35 to 47. We found no correlation between the severity of the condition and the site of truncation. We suggest that the high frequency of compound heterozygosity observed in this study is taken into consideration as part of future genetic testing and counseling...

Mutations in REEP6 Cause Autosomal-Recessive Retinitis Pigmentosa.

Science.gov (United States)

Arno, Gavin; Agrawal, Smriti A; Eblimit, Aiden; Bellingham, James; Xu, Mingchu; Wang, Feng; Chakarova, Christina; Parfitt, David A; Lane, Amelia; Burgoyne, Thomas; Hull, Sarah; Carss, Keren J; Fiorentino, Alessia; Hayes, Matthew J; Munro, Peter M; Nicols, Ralph; Pontikos, Nikolas; Holder, Graham E; Asomugha, Chinwe; Raymond, F Lucy; Moore, Anthony T; Plagnol, Vincent; Michaelides, Michel; Hardcastle, Alison J; Li, Yumei; Cukras, Catherine; Webster, Andrew R; Cheetham, Michael E; Chen, Rui

2016-12-01

Retinitis pigmentosa (RP) is the most frequent form of inherited retinal dystrophy. RP is genetically heterogeneous and the genes identified to date encode proteins involved in a wide range of functional pathways, including photoreceptor development, phototransduction, the retinoid cycle, cilia, and outer segment development. Here we report the identification of biallelic mutations in Receptor Expression Enhancer Protein 6 (REEP6) in seven individuals with autosomal-recessive RP from five unrelated families. REEP6 is a member of the REEP/Yop1 family of proteins that influence the structure of the endoplasmic reticulum but is relatively unstudied. The six variants identified include three frameshift variants, two missense variants, and a genomic rearrangement that disrupts exon 1. Human 3D organoid optic cups were used to investigate REEP6 expression and confirmed the expression of a retina-specific isoform REEP6.1, which is specifically affected by one of the frameshift mutations. Expression of the two missense variants (c.383C>T [p.Pro128Leu] and c.404T>C [p.Leu135Pro]) and the REEP6.1 frameshift mutant in cultured cells suggest that these changes destabilize the protein. Furthermore, CRISPR-Cas9-mediated gene editing was used to produce Reep6 knock-in mice with the p.Leu135Pro RP-associated variant identified in one RP-affected individual. The homozygous knock-in mice mimic the clinical phenotypes of RP, including progressive photoreceptor degeneration and dysfunction of the rod photoreceptors. Therefore, our study implicates REEP6 in retinal homeostasis and highlights a pathway previously uncharacterized in retinal dystrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Clinical phenotype of 5 females with a CDKL5 mutation.

Science.gov (United States)

Stalpers, Xenia L; Spruijt, Liesbeth; Yntema, Helger G; Verrips, Aad

2012-01-01

Mutations in the X-linked cyclin dependent kinase like 5 (CDKL5) gene have been reported in approximately 80 patients since the first description in 2003. The clinical presentation partly corresponds with Rett syndrome, considering clinical features as intellectual disability, hypotonia, and poor visual, language, and motor development. However, these patients do not meet the consensus criteria for Rett syndrome since they lack the clear period of regression. Furthermore, in contrast to Rett syndrome, patients with CDKL5 mutations, have seizures or infantile spasms starting in the first weeks of life. We present clinical phenotype of 5 girls having a mutation in the CDKL5 gene. All mutations are novel and are pathogenic since they either lead to a frameshift in the reading frame or affect a consensus splice site. Four of the mutations are detected de novo in the affected girl.

Four Novel Mutations in the ALPL Gene in Chinese patients with Odonto, Childhood and Adult Hypophosphatasia.

Science.gov (United States)

Xu, Lijun; Pang, Qianqian; Jiang, Yan; Wang, Ou; Li, Mei; Xing, Xiaoping; Xia, Weibo

2018-05-03

Background and purpose: Hypophosphatasiais (HPP) is a rare inherited disorder characterized by defective bone and/or dental mineralization, and decreased serum alkaline phosphatase activity. ALPL , the only gene related with HPP, encodes tissue non-specific alkaline phosphatase (TNSALP). Few studies were carried out in ALPL gene mutations in the Chinese population with HPP. The purpose of this study is to elucidate the clinical and genetic characteristics of HPP in 5 unrelated Chinese families and 2 sporadic patients. Methods : 10 clinically diagnosed HPP patients from 5 unrelated Chinese families and 2 sporadic patients and 50 healthy controls were genetic investigated. All 12 exons and exon-intron boundaries of the ALPL gene were amplified by polymerase chain reaction and directly sequenced. The laboratory and radiological investigations were conducted simultaneously in these 10 HPP patients. A three-dimensional model of the TNSALP was used to predict the dominant negative effect of identified missense mutations. Results : 3 odonto, 3 childhood and 4 adult types of HPP were clinically diagnosed. 10 mutations were identified in 5 unrelated Chinese families and 2 sporadic patients, including 8 missense mutations and 2 frameshift mutations. Of which, 4 were novel: 1 frameshift mutation (p.R138Pfsx45); 3 missense mutations (p.C201R, p.V459A, p.C497S). No identical mutations and any other new ALPL mutations were found in unrelated 50 healthy controls. Conclusions : Our study demonstrated that the ALPL  gene mutations are responsible for HPP in these Chinese families. These findings will be useful for clinicians to improve understanding of this heritable bone disorder. ©2018 The Author(s).

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

Science.gov (United States)

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

De novo mutations in the genome organizer CTCF cause intellectual disability

DEFF Research Database (Denmark)

Gregor, Anne; Oti, Martin; Kouwenhoven, Evelyn N

2013-01-01

An increasing number of genes involved in chromatin structure and epigenetic regulation has been implicated in a variety of developmental disorders, often including intellectual disability. By trio exome sequencing and subsequent mutational screening we now identified two de novo frameshift...... mutations and one de novo missense mutation in CTCF in individuals with intellectual disability, microcephaly, and growth retardation. Furthermore, an individual with a larger deletion including CTCF was identified. CTCF (CCCTC-binding factor) is one of the most important chromatin organizers in vertebrates...... and is involved in various chromatin regulation processes such as higher order of chromatin organization, enhancer function, and maintenance of three-dimensional chromatin structure. Transcriptome analyses in all three individuals with point mutations revealed deregulation of genes involved in signal transduction...

Induction of spontaneous and UV-induced mutations during commitment to meiosis in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Machida, I.; Nakai, S.

1980-01-01

Inductions of reversions of nonsense, missense and frameshift-type mutations were investigated in a diploid cell population of Saccharomyces cerevisiae during commitment to meiosis, by using the medium-transfer technique from sporulation medium to vegetative medium. The yields of spontaneous reverse mutations obtained from the cells that were committed to different stages during meiosis were rather constant irrespective of the alleles tested, although the yields of both intergenic and intragenic recombinations markedly increased. The susceptibilities to UV-induced reverse mutations examined during commitment to meiosis were not changed appreciably. It is concluded that induction of base-change-type mutations in meiosis is not essentially different from that in mitosis. (orig.)

Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

Directory of Open Access Journals (Sweden)

Kai-Chun Chang

2012-01-01

Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

Calreticulin Mutations in Myeloproliferative Neoplasms

Directory of Open Access Journals (Sweden)

Noa Lavi

2014-10-01

Full Text Available With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph− myeloproliferative neoplasms (MPNs in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET and primary myelofibrosis (PMF. At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations and recurrent 5-bp insertions (type 2 mutations in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph− MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review.

Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

Directory of Open Access Journals (Sweden)

Udhaya H Kotecha

2014-01-01

Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

DEFF Research Database (Denmark)

Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos

2016-01-01

Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2...... Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large...... deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder...

Gene expression patterns of chicken neuregulin 3 in association with copy number variation and frameshift deletion.

Science.gov (United States)

Abe, Hideaki; Aoya, Daiki; Takeuchi, Hiro-Aki; Inoue-Murayama, Miho

2017-07-21

NRG3 are structural mutations that occurred before the establishment of commercial chicken lines. Our results further suggest that the putative frameshift deletion in exon 2 may potentially affect the expression level of particular isoforms of chicken NRG3.

A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

Science.gov (United States)

Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

2017-06-01

Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

Novel BRCA1 splice-site mutation in ovarian cancer patients of Slavic origin.

Science.gov (United States)

Krivokuca, Ana; Dragos, Vita Setrajcic; Stamatovic, Ljiljana; Blatnik, Ana; Boljevic, Ivana; Stegel, Vida; Rakobradovic, Jelena; Skerl, Petra; Jovandic, Stevo; Krajc, Mateja; Magic, Mirjana Brankovic; Novakovic, Srdjan

2018-04-01

Mutations in breast cancer susceptibility gene 1 (BRCA1) lead to defects in a number of cellular pathways including DNA damage repair and transcriptional regulation, resulting in the elevated genome instability and predisposing to breast and ovarian cancers. We report a novel mutation LRG_292t1:c.4356delA,p.(Ala1453Glnfs*3) in the 12th exon of BRCA1, in the splice site region near the donor site of intron 12. It is a frameshift mutation with the termination codon generated on the third amino acid position from the site of deletion. Human Splice Finder 3.0 and MutationTaster have assessed this variation as disease causing, based on the alteration of splicing, creation of premature stop codon and other potential alterations initiated by nucleotide deletion. Among the most important alterations are frameshift and splice site changes (score of the newly created donor splice site: 0.82). c.4356delA was associated with two ovarian cancer cases in two families of Slavic origin. It was detected by next generation sequencing, and confirmed with Sanger sequencing in both cases. Because of the fact that it changes the reading frame of the protein, novel mutation c.4356delA p.(Ala1453Glnfs*3) in BRCA1 gene might be of clinical significance for hereditary ovarian cancer. Further functional as well as segregation analyses within the families are necessary for appropriate clinical classification of this variant. Since it has been detected in two ovarian cancer patients of Slavic origin, it is worth investigating founder effect of this mutation in Slavic populations.

Isotopically nonstationary metabolic flux analysis (INST-MFA) of photosynthesis and photorespiration in plants

Science.gov (United States)

Photorespiration is a central component of photosynthesis; however to better understand its role it should be viewed in the context of an integrated metabolic network rather than a series of individual reactions that operate independently. Isotopically nonstationary 13C metabolic flux analysis (INST...

Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient

Energy Technology Data Exchange (ETDEWEB)

Choy, F.Y.M.; Humphries, M.L. [Univ. of Victoria, British Columbia (Canada); Ferreira, P. [Univ. of Alberta, Edmonton (Canada)

1997-01-20

Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed while the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.

Dystrophin in frameshift deletion patients with Becker Muscular Dystrophy

Energy Technology Data Exchange (ETDEWEB)

Gangopadhyay, S.B.; Ray, P.N.; Worton, R.G.; Sherratt, T.G.; Heckmatt, J.Z.; Dubowitz, V.; Strong, P.N.; Miller, G. (Penn State College of Medicine, Hershey, PA (United States)); Shokeir, M. (Univ. Hospital, Saskatchewan (Canada))

1992-09-01

In a previous study the authors identified 14 cases with Duchenne muscular dystrophy (DMD) or its milder variant, Becker muscular dystrophy (BMD), with a deletion of exons 3-7, a deletion that would be expected to shift the translational reading frame of the mRNA and give a severe phenotype. They have examined dystrophin and its mRNA from muscle biopsies of seven cases with either mild or intermediate phenotypes. In all cases they detected slightly lower-molecular-weight dystrophin in 12%-15% abundance relative to the normal. By sequencing amplified mRNA they have found that exon 2 is spliced to exon 8, a splice that produces a frameshifted mRNA, and have found no evidence for alternate splicing that might be involved in restoration of dystrophin mRNA reading frame in the patients with a mild phenotype. Other transcriptional and posttranscriptional mechanisms such as cryptic promoter, ribosomal frameshifting, and reinitiation are suggested that might play some role in restoring the reading frame. 34 refs., 5 figs. 1 tab.

Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

Science.gov (United States)

Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

2014-03-15

Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel DNMT1 mutation associated with early onset hereditary sensory and autonomic neuropathy, cataplexy, cerebellar atrophy, scleroderma, endocrinopathy, and common variable immune deficiency.

Science.gov (United States)

Fox, Robin; Ealing, John; Murphy, Helen; Gow, David P; Gosal, David

2016-09-01

DNA methyltransferase 1 (DNMT1) is an enzyme which has a role in methylation of DNA, gene regulation, and chromatin stability. Missense mutations in the DNMT1 gene have been previously associated with two neurological syndromes: hereditary sensory and autonomic neuropathy type 1 with dementia and deafness (HSAN1E) and autosomal dominant cerebellar ataxia, deafness, and narcolepsy (ADCA-DN). We report a case showing overlap of both of these syndromes plus associated clinical features of common variable immune deficiency, scleroderma, and endocrinopathy that could also be mutation associated. Our patient was found to be heterozygous for a previously unreported frameshift mutation, c.1635_1637delCAA p.(Asn545del) in the DNMT1 gene exon 20. This case displays both the first frameshift mutation described in the literature which is associated with a phenotype with a high degree of overlap between HSAN1E and ADCA-DN and early age of onset (c. 8 years). Our case is also of interest as the patient displays a number of new non-neurological features, which could also be DNMT1 mutation related. © 2016 Peripheral Nerve Society.

Two recessive mutations in FGF5 are associated with the long-hair phenotype in donkeys.

Science.gov (United States)

Legrand, Romain; Tiret, Laurent; Abitbol, Marie

2014-09-25

Seven donkey breeds are recognized by the French studbook. Individuals from the Pyrenean, Provence, Berry Black, Normand, Cotentin and Bourbonnais breeds are characterized by a short coat, while those from the Poitou breed (Baudet du Poitou) are characterized by a long-hair phenotype. We hypothesized that loss-of-function mutations in the FGF5 (fibroblast growth factor 5) gene, which are associated with a long-hair phenotype in several mammalian species, may account for the special coat feature of Poitou donkeys. To the best of our knowledge, mutations in FGF5 have never been described in Equidae. We sequenced the FGF5 gene from 35 long-haired Poitou donkeys, as well as from a panel of 67 short-haired donkeys from the six other French breeds and 131 short-haired ponies and horses. We identified a recessive c.433_434delAT frameshift deletion in FGF5, present in Poitou and three other donkey breeds and a recessive nonsense c.245G > A substitution, present in Poitou and four other donkey breeds. The frameshift deletion was associated with the long-hair phenotype in Poitou donkeys when present in two copies (n = 31) or combined with the nonsense mutation (n = 4). The frameshift deletion led to a stop codon at position 159 whereas the nonsense mutation led to a stop codon at position 82 in the FGF5 protein. In silico, the two truncated FGF5 proteins were predicted to lack the critical β strands involved in the interaction between FGF5 and its receptor, a mandatory step to inhibit hair growth. Our results highlight the allelic heterogeneity of the long-hair phenotype in donkeys and enlarge the panel of recessive FGF5 loss-of-function alleles described in mammals. Thanks to the DNA test developed in this study, breeders of non-Poitou breeds will have the opportunity to identify long-hair carriers in their breeding stocks.

Juvenil polypose-syndrom og hereditær hæmoragisk telangiektasi hos en patient med SMAD4-mutation

DEFF Research Database (Denmark)

Jelsig, Anne Marie; Tørring, Pernille Mathiesen; Wikman, Friedrik

2014-01-01

Germ line mutations in SMAD4 can cause both juvenile polyposis syndrome and hereditary haemorrhagic telangiectasia syndrome. In this case we present a 37-year-old man with a frameshift mutation in SMAD4. The patient had multiple polyps in the gastrointestinal tract and was diagnosed with colon ca...... cancer at the age of 21 and gastro-oesophageal junction cancer at the age of 37. Furthermore the patient had telangiectasias and recurrent epistaxis....

Rab-GDI complex dissociation factor expressed through translational frameshifting in filamentous ascomycetes.

Directory of Open Access Journals (Sweden)

Fabienne Malagnac

Full Text Available In the model fungus Podospora anserina, the PaYIP3 gene encoding the orthologue of the Saccharomyces cerevisiae YIP3 Rab-GDI complex dissociation factor expresses two polypeptides, one of which, the long form, is produced through a programmed translation frameshift. Inactivation of PaYIP3 results in slightly delayed growth associated with modification in repartition of fruiting body on the thallus, along with reduced ascospore production on wood. Long and short forms of PaYIP3 are expressed in the mycelium, while only the short form appears expressed in the maturing fruiting body (perithecium. The frameshift has been conserved over the evolution of the Pezizomycotina, lasting for over 400 million years, suggesting that it has an important role in the wild.

Rab-GDI complex dissociation factor expressed through translational frameshifting in filamentous ascomycetes.

Science.gov (United States)

Malagnac, Fabienne; Fabret, Céline; Prigent, Magali; Rousset, Jean-Pierre; Namy, Olivier; Silar, Philippe

2013-01-01

In the model fungus Podospora anserina, the PaYIP3 gene encoding the orthologue of the Saccharomyces cerevisiae YIP3 Rab-GDI complex dissociation factor expresses two polypeptides, one of which, the long form, is produced through a programmed translation frameshift. Inactivation of PaYIP3 results in slightly delayed growth associated with modification in repartition of fruiting body on the thallus, along with reduced ascospore production on wood. Long and short forms of PaYIP3 are expressed in the mycelium, while only the short form appears expressed in the maturing fruiting body (perithecium). The frameshift has been conserved over the evolution of the Pezizomycotina, lasting for over 400 million years, suggesting that it has an important role in the wild.

New mutations affecting induced mutagenesis in yeast.

Science.gov (United States)

Lawrence, C W; Krauss, B R; Christensen, R B

1985-01-01

Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.

TBC1D24 Mutations in a Sibship with Multifocal Polymyoclonus

Directory of Open Access Journals (Sweden)

Adeline Ngoh

2017-04-01

Full Text Available Background: Advances in molecular genetic technologies have improved our understanding of genetic causes of rare neurological disorders with features of myoclonus.Case Report: A family with two affected siblings, presenting with multifocal polymyoclonus and neurodevelopmental delay, was recruited for whole-exome sequencing following unyielding diagnostic neurometabolic investigations. Compound heterozygous mutations in TBC1D24, a gene previously associated with various epilepsy phenotypes and hearing loss, were identified in both siblings. The mutations included a missense change c.457G>A (p.Glu157Lys, and a novel frameshift mutation c.545del (p.Thr182Serfs*6.Discussion: We propose that TBC1D24-related diseases should be in the differential diagnosis for children with polymyoclonus. 

KIT Mutation and Loss of 14q May Be Sufficient for the Development of Clinically Symptomatic Very Low-Risk GIST.

Directory of Open Access Journals (Sweden)

Olaf Karl Klinke

Full Text Available The aim of this study was to determine the minimal set of genetic alterations required for the development of a very low risk clinically symptomatic gastro-intestinal stromal tumour within the stomach wall. We studied the genome of a very low-risk gastric gastro-intestinal stromal tumour by whole-genome sequencing, comparative genomic hybridisation and methylation profiling. The studied tumour harboured two typical genomic lesions: loss of the long arm of chromosome 14 and an activating mutation in exon 11 of KIT. Besides these genetic lesions, only two point mutations that may affect tumour progression were identified: A frame-shift deletion in RNF146 and a missense mutation in a zinc finger of ZNF407. Whilst the frameshift deletion in RNF146 seemed to be restricted to this particular tumour, a similar yet germline mutation in ZNF407 was found in a panel of 52 gastro-intestinal stromal tumours from different anatomical sites and different categories. Germline polymorphisms in the mitotic checkpoint proteins Aurora kinase A and BUB1 kinase B may have furthered tumour growth. The epigenetic profile of the tumour matches that of other KIT-mutant tumours. We have identified mutations in three genes and loss of the long arm of chromosome 14 as the so far minimal set of genetic abnormalities sufficient for the development of a very low risk clinically symptomatic gastric stromal tumour.

Whole-exome sequencing revealed two novel mutations in Usher syndrome.

Science.gov (United States)

Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

2015-06-01

Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel GABRG2 mutations cause familial febrile seizures

Science.gov (United States)

Boillot, Morgane; Morin-Brureau, Mélanie; Picard, Fabienne; Weckhuysen, Sarah; Lambrecq, Virginie; Minetti, Carlo; Striano, Pasquale; Zara, Federico; Iacomino, Michele; Ishida, Saeko; An-Gourfinkel, Isabelle; Daniau, Mailys; Hardies, Katia; Baulac, Michel; Dulac, Olivier; Leguern, Eric; Nabbout, Rima

2015-01-01

Objective: To identify the genetic cause in a large family with febrile seizures (FS) and temporal lobe epilepsy (TLE) and subsequently search for additional mutations in a cohort of 107 families with FS, with or without epilepsy. Methods: The cohort consisted of 1 large family with FS and TLE, 64 smaller French families recruited through a national French campaign, and 43 Italian families. Molecular analyses consisted of whole-exome sequencing and mutational screening. Results: Exome sequencing revealed a p.Glu402fs*3 mutation in the γ2 subunit of the GABAA receptor gene (GABRG2) in the large family with FS and TLE. Three additional nonsense and frameshift GABRG2 mutations (p.Arg136*, p.Val462fs*33, and p.Pro59fs*12), 1 missense mutation (p.Met199Val), and 1 exonic deletion were subsequently identified in 5 families of the follow-up cohort. Conclusions: We report GABRG2 mutations in 5.6% (6/108) of families with FS, with or without associated epilepsy. This study provides evidence that GABRG2 mutations are linked to the FS phenotype, rather than epilepsy, and that loss-of-function of GABAA receptor γ2 subunit is the probable underlying pathogenic mechanism. PMID:27066572

De novo MECP2 frameshift mutation in a boy with moderate mental retardation, obesity and gynaecomastia.

NARCIS (Netherlands)

Kleefstra, T.; Yntema, H.G.; Oudakker, A.R.; Romein, T.; Sistermans, E.A.; Nillessen, W.; Bokhoven, J.H.L.M. van; Vries, L.B.A. de; Hamel, B.C.J.

2002-01-01

Rett syndrome (RTT) is an X-linked neurodevelopmental disorder caused by mutations in the MECP2 gene, with apparent lethality in male embryos. However, recent studies indicate that mutations in the MECP2 gene can cause congenital encephalopathy, an Angelman-like phenotype and even nonspecific mental

Mutational spectrum analysis of umuC-independent and umuC-dependent γ-radiation mutagenesis in Escherichia coli

International Nuclear Information System (INIS)

Sargentini, N.J.; Smith, K.C.

1989-01-01

γ-radiation mutagenesis Escherichia coli K-12. Mutagenesis (argE3(OC) A rg + ) was blocked in a δ(recA-srlR)306 strain at the same doses that induced mutations in umuC122::Tn5 and wild-type strains, indicating that both umuC-independent and umuC-dependent mechanisms function within recA-dependent misrepair. Analyses of various suppressor and back mutations that result in argE3 and hisG4 ochre reversion and an analysis of trpE9777 reversion were performed on umuC and wild-type cells irradiated in the presence and absence of oxygen. While the umuC strain showed the γ-radiation induction of base substitution and frameshifts when irradiated in the absence of oxygen, the umuC mutation blocked all oxygen-dependent base-substitution mutagenesis, but non all oxygen-dependent frameshift mutagenesis. For anoxically irradiated cells, the yields of GC T and AT GC transitions were essentially umuC independent, while the yields of (AT or GC) TA transversions were heavily umuC dependent. These data suggest new concepts about the nature of the DNA lesions and the mutagenic mechanisms that lead to γ-radiation mutagenesis. (author). 48 refs.; 1 tab.; 6 refs

HNPCC: Six new pathogenic mutations

Directory of Open Access Journals (Sweden)

Epplen Joerg T

2004-06-01

Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.

Missense Mutation in the USH2A Gene: Association with Recessive Retinitis Pigmentosa without Hearing Loss

OpenAIRE

Rivolta, Carlo; Sweklo, Elizabeth A.; Berson, Eliot L.; Dryja, Thaddeus P.

2000-01-01

Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an...

Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

Energy Technology Data Exchange (ETDEWEB)

Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

1996-07-26

Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

Interplay between DMD point mutations and splicing signals in Dystrophinopathy phenotypes.

Directory of Open Access Journals (Sweden)

Jonàs Juan-Mateu

Full Text Available DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements.

[Suspected pathogenic mutation identified in two cases with oculocutaneous albinism].

Science.gov (United States)

He, Jiangmei; Zheng, Meiling; Zhang, Guilin; Hua, Ailing

2015-08-01

To detect potential mutations in genes related with non-syndromic oculocutaneous albinism I-IV and ocular albinism type I in two couples who had given births to children with albinism. All exons of the non-syndromic albinism related genes TYR, OCA2, TYRP-1, MITF, SLC45A2 and GPR143 were subjected to deep sequencing. The results were verified with Sanger sequencing. For the two female carriers, the coding region of the TYR gene was found to harbor a frameshift mutation c.925_926insC, which was also suspected to have been pathogenic. In one of the male partners, a nonsense mutations c.832C>T was found, which was also known to be pathogenic. Another male partner was found to harbor a TYR gene mutation c.346C>T, which was also known to be a pathogenic nonsense mutation. The coding region of the TYR gene c.925_926insC (p.Thr309ThrfsX9) probably underlies the OCA1 disease phenotype.

Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

Science.gov (United States)

Al-sbou, Mohammed

2012-06-01

This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

A novel mutation in the EDAR gene causes severe autosomal recessive hypohidrotic ectodermal dysplasia.

Science.gov (United States)

Henningsen, Emil; Svendsen, Mathias Tiedemann; Lildballe, Dorte Launholt; Jensen, Peter Kjestrup Axel

2014-08-01

We report on a 2-year-old girl presenting with a severe form of hypohidrotic ectodermal dysplasia (HED). The patient presented with hypotrichosis, anodontia, hypohidrosis, frontal bossing, prominent lips and ears, dry, pale skin, and dermatitis. The patient had chronic rhinitis with malodorous nasal discharge. The girl was the second born child of first-cousin immigrants from Northern Iraq. A novel homozygous mutation (c.84delC) in the EDAR gene was identified. This mutation most likely causes a frameshift in the protein product (p.S29fs*74). This results in abolition of all ectodysplasin-mediated NF-kB signalling. This complete loss-of-function mutation likely accounts for the severe clinical abnormalities in ectodermal structures in the described patient. © 2014 Wiley Periodicals, Inc.

A novel STXBP1 mutation causes typical Rett syndrome in a Japanese girl.

Science.gov (United States)

Yuge, Kotaro; Iwama, Kazuhiro; Yonee, Chihiro; Matsufuji, Mayumi; Sano, Nozomi; Saikusa, Tomoko; Yae, Yukako; Yamashita, Yushiro; Mizuguchi, Takeshi; Matsumoto, Naomichi; Matsuishi, Toyojiro

2018-06-01

Rett syndrome (RTT) is a neurodevelopmental disorder mostly caused by mutations in Methyl-CpG-binding protein 2 (MECP2); however, mutations in various other genes may lead to RTT-like phenotypes. Here, we report the first case of a Japanese girl with RTT caused by a novel syntaxin-binding protein 1 (STXBP1) frameshift mutation (c.60delG, p.Lys21Argfs*16). She showed epilepsy at one year of age, regression of acquired psychomotor abilities thereafter, and exhibited stereotypic hand and limb movements at 3 years of age. Her epilepsy onset was earlier than is typical for RTT patients. However, she fully met the 2010 diagnostic criteria of typical RTT. STXBP1 mutations cause early infantile epileptic encephalopathy (EIEE), various intractable epilepsies, and neurodevelopmental disorders. However, the case described here presented a unique clinical presentation of typical RTT without EIEE and a novel STXBP1 mutation. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Screening of 1331 Danish breast and/or ovarian cancer families identified 40 novel BRCA1 and BRCA2 mutations

DEFF Research Database (Denmark)

Hansen, Thomas V O; Jønson, Lars; Steffensen, Ane Y

2011-01-01

Germ-line mutations in the tumour suppressor genes BRCA1 and BRCA2 predispose to breast and ovarian cancer. Since 1999 we have performed mutational screening of breast and/or ovarian cancer patients in East Denmark. During this period we have identified 40 novel sequence variations in BRCA1...... and BRCA2 in high risk breast and/or ovarian cancer families. The mutations were detected via pre-screening using dHPLC or high-resolution melting and direct sequencing. We identified 16 variants in BRCA1, including 9 deleterious frame-shift mutations, 2 intronic variants, 4 missense mutations, and 1......, the presumed significance of the missense mutations was predicted in silico using the align GVGD algorithm. In conclusion, the mutation screening identified 40 novel variants in the BRCA1 and BRCA2 genes and thereby extends the knowledge of the BRCA1/BRCA2 mutation spectrum. Nineteen of the mutations were...

Somatic loss of function mutations in neurofibromin 1 and MYC associated factor X genes identified by exome-wide sequencing in a wild-type GIST case

International Nuclear Information System (INIS)

Belinsky, Martin G.; Rink, Lori; Cai, Kathy Q.; Capuzzi, Stephen J.; Hoang, Yen; Chien, Jeremy; Godwin, Andrew K.; Mehren, Margaret von

2015-01-01

Approximately 10–15 % of gastrointestinal stromal tumors (GISTs) lack gain of function mutations in the KIT and platelet-derived growth factor receptor alpha (PDGFRA) genes. An alternate mechanism of oncogenesis through loss of function of the succinate-dehydrogenase (SDH) enzyme complex has been identified for a subset of these “wild type” GISTs. Paired tumor and normal DNA from an SDH-intact wild-type GIST case was subjected to whole exome sequencing to identify the pathogenic mechanism(s) in this tumor. Selected findings were further investigated in panels of GIST tumors through Sanger DNA sequencing, quantitative real-time PCR, and immunohistochemical approaches. A hemizygous frameshift mutation (p.His2261Leufs*4), in the neurofibromin 1 (NF1) gene was identified in the patient’s GIST; however, no germline NF1 mutation was found. A somatic frameshift mutation (p.Lys54Argfs*31) in the MYC associated factor X (MAX) gene was also identified. Immunohistochemical analysis for MAX on a large panel of GISTs identified loss of MAX expression in the MAX-mutated GIST and in a subset of mainly KIT-mutated tumors. This study suggests that inactivating NF1 mutations outside the context of neurofibromatosis may be the oncogenic mechanism for a subset of sporadic GIST. In addition, loss of function mutation of the MAX gene was identified for the first time in GIST, and a broader role for MAX in GIST progression was suggested. The online version of this article (doi:10.1186/s12885-015-1872-y) contains supplementary material, which is available to authorized users

Mutations in the Norrie disease gene.

Science.gov (United States)

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

Genome duplication and mutations in ACE2 cause multicellular, fast-sedimenting phenotypes in evolved Saccharomyces cerevisiae.

Science.gov (United States)

Oud, Bart; Guadalupe-Medina, Victor; Nijkamp, Jurgen F; de Ridder, Dick; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc

2013-11-05

Laboratory evolution of the yeast Saccharomyces cerevisiae in bioreactor batch cultures yielded variants that grow as multicellular, fast-sedimenting clusters. Knowledge of the molecular basis of this phenomenon may contribute to the understanding of natural evolution of multicellularity and to manipulating cell sedimentation in laboratory and industrial applications of S. cerevisiae. Multicellular, fast-sedimenting lineages obtained from a haploid S. cerevisiae strain in two independent evolution experiments were analyzed by whole genome resequencing. The two evolved cell lines showed different frameshift mutations in a stretch of eight adenosines in ACE2, which encodes a transcriptional regulator involved in cell cycle control and mother-daughter cell separation. Introduction of the two ace2 mutant alleles into the haploid parental strain led to slow-sedimenting cell clusters that consisted of just a few cells, thus representing only a partial reconstruction of the evolved phenotype. In addition to single-nucleotide mutations, a whole-genome duplication event had occurred in both evolved multicellular strains. Construction of a diploid reference strain with two mutant ace2 alleles led to complete reconstruction of the multicellular-fast sedimenting phenotype. This study shows that whole-genome duplication and a frameshift mutation in ACE2 are sufficient to generate a fast-sedimenting, multicellular phenotype in S. cerevisiae. The nature of the ace2 mutations and their occurrence in two independent evolution experiments encompassing fewer than 500 generations of selective growth suggest that switching between unicellular and multicellular phenotypes may be relevant for competitiveness of S. cerevisiae in natural environments.

New truncation mutation of the NR2E3 gene in a Japanese patient with enhanced S-cone syndrome.

Science.gov (United States)

Kuniyoshi, Kazuki; Hayashi, Takaaki; Sakuramoto, Hiroyuki; Mishima, Hiroshi; Tsuneoka, Hiroshi; Tsunoda, Kazushige; Iwata, Takeshi; Shimomura, Yoshikazu

2016-11-01

The enhanced S-cone syndrome (ESCS) is a rare hereditary retinal degeneration that has enhanced short wavelength-sensitive cone (S-cone) functions. The longitudinal clinical course of this disease has been rarely reported, and the genetic aspects of ESCS have not been well investigated in the Japanese population. In this report, we present our clinical and genetic findings for 2 patients with ESCS. The patients were 2 unrelated Japanese men. Standard ophthalmic examinations and mutation screening for the NR2E3 gene were performed. Patient 1 was a 36-year-old man, and his clinical findings were typical of ESCS. His decimal best-corrected visual acuity (BCVA) was 1.0 OD and 0.5 OS after removal of cataracts. Genetic investigations revealed a homozygous truncation frameshift, the p.I307LfsX33 mutation. Patient 2 was an 11-year-old boy when he was first examined by us. His clinical findings were typical of ESCS except for uveitis in the left eye. His decimal BCVA at the age of 39 years was maintained at 1.5 in each eye, although the retinal degeneration and visual field impairments had progressed during the follow-up period. The genetic investigations revealed homozygous mutations of p.R104Q in the NR2E3 gene. The frameshift mutation, p.I307LfsX33, in the NR2E3 gene is a new causative mutation for ESCS. The clinical observations for patient 2 are the longest ever reported. The retinal degeneration caused by this mutation is slowly progressive, and these patients maintained good vision with maintenance of the foveal structure until their late thirties.

A novel heterozygous SOX2 mutation causing congenital bilateral anophthalmia, hypogonadotropic hypogonadism and growth hormone deficiency.

Science.gov (United States)

Macchiaroli, Annamaria; Kelberman, Daniel; Auriemma, Renata Simona; Drury, Suzanne; Islam, Lily; Giangiobbe, Sara; Ironi, Gabriele; Lench, Nicholas; Sowden, Jane C; Colao, Annamaria; Pivonello, Rosario; Cavallo, Luciano; Gasperi, Maurizio; Faienza, Maria Felicia

2014-01-25

Heterozygous de novo mutations in SOX2 have been reported in approximately 10-20% of patients with unilateral or bilateral anophthalmia or microphthalmia. An additional phenotype of hypopituitarism, with anterior pituitary hypoplasia and hypogonadotropic hypogonadism, has been reported in patients carrying SOX2 alterations. We report a novel heterozygous mutation in the SOX2 gene in a male affected with congenital bilateral anophthalmia, hypogonadotrophic hypogonadism and growth hormone deficiency. The mutation we describe is a cytosine deletion in position 905 (c905delC) which causes frameshift and an aberrant C-terminal domain. Our report highlights the fact that subjects affected with eye anomalies and harboring SOX2 mutations are at high risk for gonadotropin deficiency, which has important implications for their clinical management. Copyright © 2013 Elsevier B.V. All rights reserved.

Abandono Afetivo: Afeto e Paternidade em Instâncias Jurídicas

Directory of Open Access Journals (Sweden)

Lisandra Espíndula Moreira

Full Text Available Resumo O objetivo deste artigo é discutir arqueologicamente a articulação entre paternidade e criminalidade, tomando como base um documento jurídico que aciona um pai por abandono afetivo. Em especial, analisamos a produção de sujeitos nos jogos enunciativos que responsabilizam o pai por sua ausência na vida da prole. Para que se construa essa responsabilização em relação ao(a filho(a é necessário que os enunciados se movimentem e estabeleçam diferenciações entre a responsabilidade familiar x de outras instâncias (comunidade e Estado. No interior da instância familiar, os enunciados explicitam a matriz heterossexista, construindo lugares específicos para homens e mulheres, recheados de prescrições, funções e características. Para que se transforme numa demanda jurídica legítima, o afeto será entendido como cuidado e convívio. Mesmo nesta operação enunciativa, o cuidado paterno não se produz de forma semelhante ao cuidado materno. Ao referir-se à paternidade, o afeto (cuidado se transformará na demanda por limite e autoridade, que se sustenta na associação entre a ausência paterna e a criminalidade.

Identification of a novel BRCA1 nucleotide 4803delCC/c.4684delCC mutation and a nucleotide 249T>A/c.130T>A (p.Cys44Ser) mutation in two Greenlandic Inuit families

DEFF Research Database (Denmark)

Hansen, Thomas van Overeem; Jønson, Lars; Albrechtsen, Anders

2010-01-01

Germ-line mutations in the tumour suppressor proteins BRCA1 and BRCA2 predispose to breast and ovarian cancer. We have recently identified a Greenlandic Inuit BRCA1 nucleotide 234T>G/c.115T>G (p.Cys39Gly) founder mutation, which at that time was the only disease-causing BRCA1/BRCA2 mutation...... identified in this population. Here, we describe the identification of a novel disease-causing BRCA1 nucleotide 4803delCC/c.4684delCC mutation in a Greenlandic Inuit with ovarian cancer. The mutation introduces a frameshift and a premature stop at codon 1572. We have also identified a BRCA1 nucleotide 249T......>A/c.130T>A (p.Cys44Ser) mutation in another Greenlandic individual with ovarian cancer. This patient share a 1-2 Mb genomic fragment, containing the BRCA1 gene, with four Danish families harbouring the same mutation, suggesting that the 249T>A/c.130T>A (p.Cys44Ser) mutation originates from a Danish...

A novel SERPINA1 mutation causing serum alpha(1-antitrypsin deficiency.

Directory of Open Access Journals (Sweden)

Darren N Saunders

Full Text Available Mutations in the SERPINA1 gene can cause deficiency in the circulating serine protease inhibitor α(1-Antitrypsin (α(1AT. α(1AT deficiency is the major contributor to pulmonary emphysema and liver disease in persons of European ancestry, with a prevalence of 1 in 2500 in the USA. We present the discovery and characterization of a novel SERPINA1 mutant from an asymptomatic Middle Eastern male with circulating α(1AT deficiency. This 49 base pair deletion mutation (T379Δ, originally mistyped by IEF, causes a frame-shift replacement of the last sixteen α(1AT residues and adds an extra twenty-four residues. Functional analysis showed that the mutant protein is not secreted and prone to intracellular aggregation.

Characterization of variegate porphyria mutations using a minigene approach.

Science.gov (United States)

Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

2015-01-01

Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

Growth Hormone Receptor Mutations Related to Individual Dwarfism

Science.gov (United States)

Li, Charles; Zhang, Xiquan

2018-01-01

Growth hormone (GH) promotes body growth by binding with two GH receptors (GHRs) at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin-like growth factor (IGF) synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature), including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development. PMID:29748515

Growth Hormone Receptor Mutations Related to Individual Dwarfism

Directory of Open Access Journals (Sweden)

Shudai Lin

2018-05-01

Full Text Available Growth hormone (GH promotes body growth by binding with two GH receptors (GHRs at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin‐like growth factor (IGF synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature, including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development.

Technological solution for the protection of the environment (in the Central Research Inst. of Electric Power Industry, Tokyo, Japan)

International Nuclear Information System (INIS)

Glamochanin, Vlastimir

1997-01-01

As we approach the 21 century, the world finds itself confronting challenges regarding global-scale issues: economic development, the use of energy and natural resources, and environmental preservation. Moreover, these issues do not exist in a vacuum; they are all interrelated. They exert delicate effects on each other and can not be considered separately. If we continue as we have in the past, the earth will face an unprecedented crisis in the middle of coming century, in conjunction with the population explosion. (Susumu Yoda, President of the Central Research Inst. of Electric Power Industry, Tokyo, Japan). This paper presents a brief review of the research policy of the Japan Central Research Inst. of Electric Power Industry, regarding environmental preservation

Diverse growth hormone receptor gene mutations in Laron syndrome.

Science.gov (United States)

Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

1993-01-01

To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

Assessment of the structural and functional impact of in-frame mutations of the DMD gene, using the tools included in the eDystrophin online database

Directory of Open Access Journals (Sweden)

Nicolas Aurélie

2012-07-01

Full Text Available Abstract Background Dystrophin is a large essential protein of skeletal and heart muscle. It is a filamentous scaffolding protein with numerous binding domains. Mutations in the DMD gene, which encodes dystrophin, mostly result in the deletion of one or several exons and cause Duchenne (DMD and Becker (BMD muscular dystrophies. The most common DMD mutations are frameshift mutations resulting in an absence of dystrophin from tissues. In-frame DMD mutations are less frequent and result in a protein with partial wild-type dystrophin function. The aim of this study was to highlight structural and functional modifications of dystrophin caused by in-frame mutations. Methods and results We developed a dedicated database for dystrophin, the eDystrophin database. It contains 209 different non frame-shifting mutations found in 945 patients from a French cohort and previous studies. Bioinformatics tools provide models of the three-dimensional structure of the protein at deletion sites, making it possible to determine whether the mutated protein retains the typical filamentous structure of dystrophin. An analysis of the structure of mutated dystrophin molecules showed that hybrid repeats were reconstituted at the deletion site in some cases. These hybrid repeats harbored the typical triple coiled-coil structure of native repeats, which may be correlated with better function in muscle cells. Conclusion This new database focuses on the dystrophin protein and its modification due to in-frame deletions in BMD patients. The observation of hybrid repeat reconstitution in some cases provides insight into phenotype-genotype correlations in dystrophin diseases and possible strategies for gene therapy. The eDystrophin database is freely available: http://edystrophin.genouest.org/.

Mitochondrial Mutation Rate, Spectrum and Heteroplasmy in Caenorhabditis elegans Spontaneous Mutation Accumulation Lines of Differing Population Size.

Science.gov (United States)

Konrad, Anke; Thompson, Owen; Waterston, Robert H; Moerman, Donald G; Keightley, Peter D; Bergthorsson, Ulfar; Katju, Vaishali

2017-06-01

Mitochondrial genomes of metazoans, given their elevated rates of evolution, have served as pivotal markers for phylogeographic studies and recent phylogenetic events. In order to determine the dynamics of spontaneous mitochondrial mutations in small populations in the absence and presence of selection, we evolved mutation accumulation (MA) lines of Caenorhabditis elegans in parallel over 409 consecutive generations at three varying population sizes of N = 1, 10, and 100 hermaphrodites. The N =1 populations should have a minimal influence of natural selection to provide the spontaneous mutation rate and the expected rate of neutral evolution, whereas larger population sizes should experience increasing intensity of selection. New mutations were identified by Illumina paired-end sequencing of 86 mtDNA genomes across 35 experimental lines and compared with published genomes of natural isolates. The spontaneous mitochondrial mutation rate was estimated at 1.05 × 10-7/site/generation. A strong G/C→A/T mutational bias was observed in both the MA lines and the natural isolates. This suggests that the low G + C content at synonymous sites is the product of mutation bias rather than selection as previously proposed. The mitochondrial effective population size per worm generation was estimated to be 62. Although it was previously concluded that heteroplasmy was rare in C. elegans, the vast majority of mutations in this study were heteroplasmic despite an experimental regime exceeding 400 generations. The frequencies of frameshift and nonsynonymous mutations were negatively correlated with population size, which suggests their deleterious effects on fitness and a potent role for selection in their eradication. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Novel mutations in MYO7A and USH2A in Usher syndrome.

Science.gov (United States)

Maubaret, Cécilia; Griffoin, Jean-Michel; Arnaud, Bernard; Hamel, Christian

2005-03-01

Usher syndrome is an autosomal recessive disease associating retinitis pigmentosa and neurosensory deafness. Three clinical types (USH1, USH2, USH3) and 11 mutated genes or loci have been described. Mutations in MYO7A and USH2A are responsible for about 40% and 60% of Usher syndromes type 1 and 2, respectively. These genes were screened in a series of patients suffering from Usher syndrome. We performed SSCP screening of MYO7A in 12 unrelated patients suffering from Usher syndrome type 1 (USH1) and USH2A in 28 unrelated patients affected by Usher syndrome type 2 (USH2). Six mutations in MYO7A were found in five patients, including two novel mutations c.397C > G (His133Asp) and 1244-2A > G (Glu459Stop), accounting for 42% of our USH1 patients. Twelve mutations in USH2A were found in 11 patients, including four new mutations c.850delGA, c.1841-2A > G, c.3129insT, and c.3920C > G (Ser1307Stop), accounting for 39% of our USH2 patients

Replacement of Murine Leukemia Virus Readthrough Mechanism by Human Immunodeficiency Virus Frameshift Allows Synthesis of Viral Proteins and Virus Replication

Science.gov (United States)

Brunelle, Marie-Noëlle; Brakier-Gingras, Léa; Lemay, Guy

2003-01-01

Retroviruses use unusual recoding strategies to synthesize the Gag-Pol polyprotein precursor of viral enzymes. In human immunodeficiency virus, ribosomes translating full-length viral RNA can shift back by 1 nucleotide at a specific site defined by the presence of both a slippery sequence and a downstream stimulatory element made of an extensive secondary structure. This so-called frameshift mechanism could become a target for the development of novel antiviral strategies. A different recoding strategy is used by other retroviruses, such as murine leukemia viruses, to synthesize the Gag-Pol precursor; in this case, a stop codon is suppressed in a readthrough process, again due to the presence of a specific structure adopted by the mRNA. Development of antiframeshift agents will greatly benefit from the availability of a simple animal and virus model. For this purpose, the murine leukemia virus readthrough region was rendered inactive by mutagenesis and the frameshift region of human immunodeficiency virus was inserted to generate a chimeric provirus. This substitution of readthrough by frameshift allows the synthesis of viral proteins, and the chimeric provirus sequence was found to generate infectious viruses. This system could be a most interesting alternative to study ribosomal frameshift in the context of a virus amenable to the use of a simple animal model. PMID:12584361

Isolated hypogonadotropic hypogonadism with SOX2 mutation and anophthalmia/microphthalmia in offspring.

Science.gov (United States)

Stark, Zornitza; Storen, Rebecca; Bennetts, Bruce; Savarirayan, Ravi; Jamieson, Robyn V

2011-07-01

Isolated hypogonadotropic hypogonadism (IHH) is a genetically heterogeneous condition in which patients frequently require assisted reproduction to achieve fertility. In patients with IHH who are otherwise well, no particular increased risk of congenital anomalies in the resultant offspring has been highlighted. Heterozygous mutations in SOX2 are the commonest single-gene cause of anophthalmia/microphthalmia (A/M) and sometimes result in pituitary abnormalities. We report a family with a novel frameshift mutation in the SOX2 transactivation domain, p.Gly280AlafsX91, resulting in bilateral anophthalmia and subtle endocrinological abnormalities in a male sibling, and unilateral microphthalmia in a female sibling. The mutation is present in their mother who has IHH, but has no eye disorders or other anomalies. She underwent assisted reproduction to achieve fertility. This report has important implications for the evaluation of patients with IHH, particularly in the setting of planned infertility treatment.

Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

Science.gov (United States)

Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

2007-07-01

Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

Evaluation of point mutations in dystrophin gene in Iranian Duchenne and Becker muscular dystrophy patients: introducing three novel variants.

Science.gov (United States)

Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar

2016-06-01

Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.

Normosmic congenital hypogonadotropic hypogonadism due to TAC3/TACR3 mutations: characterization of neuroendocrine phenotypes and novel mutations.

Directory of Open Access Journals (Sweden)

Bruno Francou

Full Text Available CONTEXT: TAC3/TACR3 mutations have been reported in normosmic congenital hypogonadotropic hypogonadism (nCHH (OMIM #146110. In the absence of animal models, studies of human neuroendocrine phenotypes associated with neurokinin B and NK3R receptor dysfunction can help to decipher the pathophysiology of this signaling pathway. OBJECTIVE: To evaluate the prevalence of TAC3/TACR3 mutations, characterize novel TACR3 mutations and to analyze neuroendocrine profiles in nCHH caused by deleterious TAC3/TACR3 biallelic mutations. RESULTS: From a cohort of 352 CHH, we selected 173 nCHH patients and identified nine patients carrying TAC3 or TACR3 variants (5.2%. We describe here 7 of these TACR3 variants (1 frameshift and 2 nonsense deleterious mutations and 4 missense variants found in 5 subjects. Modeling and functional studies of the latter demonstrated the deleterious consequence of one missense mutation (Tyr267Asn probably caused by the misfolding of the mutated NK3R protein. We found a statistically significant (p<0.0001 higher mean FSH/LH ratio in 11 nCHH patients with TAC3/TACR3 biallelic mutations than in 47 nCHH patients with either biallelic mutations in KISS1R, GNRHR, or with no identified mutations and than in 50 Kallmann patients with mutations in KAL1, FGFR1 or PROK2/PROKR2. Three patients with TAC3/TACR3 biallelic mutations had an apulsatile LH profile but low-frequency alpha-subunit pulses. Pulsatile GnRH administration increased alpha-subunit pulsatile frequency and reduced the FSH/LH ratio. CONCLUSION: The gonadotropin axis dysfunction associated with nCHH due to TAC3/TACR3 mutations is related to a low GnRH pulsatile frequency leading to a low frequency of alpha-subunit pulses and to an elevated FSH/LH ratio. This ratio might be useful for pre-screening nCHH patients for TAC3/TACR3 mutations.

Using CRISPR/Cas9-mediated gene editing to further explore growth and trade-off effects in myostatin-mutated F4 medaka (Oryzias latipes).

Science.gov (United States)

Yeh, Ying-Chun; Kinoshita, Masato; Ng, Tze Hann; Chang, Yu-Hsuan; Maekawa, Shun; Chiang, Yi-An; Aoki, Takashi; Wang, Han-Ching

2017-09-12

Myostatin (MSTN) suppresses skeletal muscle development and growth in mammals, but its role in fish is less well understood. Here we used CRISPR/Cas9 to mutate the MSTN gene in medaka (Oryzias latipes) and evaluate subsequent growth performance. We produced mutant F0 fish that carried different frameshifts in the OlMSTN coding sequence and confirmed the heritability of the mutant genotypes to the F1 generation. Two F1 fish with the same heterozygous frame-shifted genomic mutations (a 22 bp insertion in one allele; a 32 bp insertion in the other) were then crossbred to produce subsequent generations (F2~F5). Body length and weight of the MSTN -/- F4 medaka were significantly higher than in the wild type fish, and muscle fiber density in the inner and outer compartments of the epaxial muscles was decreased, suggesting that MSTN null mutation induces muscle hypertrophy. From 3~4 weeks post hatching (wph), the expression of three major myogenic related factors (MRFs), MyoD, Myf5 and Myogenin, was also significantly upregulated. Some medaka had a spinal deformity, and we also observed a trade-off between growth and immunity in MSTN -/- F4 medaka. Reproduction was unimpaired in the fast-growth phenotypes.

Methylation state of the EDA gene promoter in Chinese X-linked hypohidrotic ectodermal dysplasia carriers.

Directory of Open Access Journals (Sweden)

Wei Yin

Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.

Genotype-phenotype correlation in a large population of muscular dystrophy patients with LAMA2 mutations.

LENUS (Irish Health Repository)

Geranmayeh, Fatemeh

2010-04-01

Merosin deficient congenital muscular dystrophy 1A (MDC1A) results from mutations in the LAMA2 gene. We report 51 patients with MDC1A and examine the relationship between degree of merosin expression, genotype and clinical features. Thirty-three patients had absence of merosin and 13 showed some residual merosin. Compared to the residual merosin group, patients with absent merosin had an earlier presentation (<7days) (P=0.0073), were more likely to lack independent ambulation (P=0.0215), or require enteral feeding (P=0.0099) and ventilatory support (P=0.0354). We identified 33 novel LAMA2 mutations; these were distributed throughout the gene in patients with absent merosin, with minor clusters in exon 27, 14, 25 and 26 (55% of mutations). Patients with residual merosin often carried at least one splice site mutation and less frequently frameshift mutations. This large study identified novel LAMA2 mutations and highlights the role of immunohistochemical studies for merosin status in predicting clinical severity of MDC1A.

Kinetics of gene and chromosome mutations induced by UV-C in yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Koltovaya, N.; Kokoreva, A.; Senchenko, D.; Shvaneva, N.; Zhuchkina, N.

2017-01-01

The systematic study of the kinetics of UV-induced gene and structural mutations in eukaryotic cells was carried out on the basis of model yeast S. cerevisiae. A variety of genetic assays (all types of base pair substitutions, frameshifts, forward mutations canl, chromosomal and plasmid rearrangements) in haploid strains were used. Yeast cells were treated by UV-C light of fluence of energy up to 200 J/m"2. The kinetics of the induced gene and structural mutations is represented by a linear-quadratic and exponential functions. The slope of curves in log-log plots was not constant, had the value 2-4 and depended on the interval of doses. It was suggested that it is the superposition and dynamics of different pathways form the mutagenic responses of eukaryotic cells to UV-C light that cause the high-order curves. [ru

Autosomal-dominant Leber Congenital Amaurosis Caused by a Heterozygous CRX Mutation in a Father and Son.

Science.gov (United States)

Arcot Sadagopan, Karthikeyan; Battista, Robert; Keep, Rosanne B; Capasso, Jenina E; Levin, Alex V

2015-06-01

Leber congenital amaurosis (LCA) is most often an autosomal recessive disorder. We report a father and son with autosomal dominant LCA due to a mutation in the CRX gene. DNA screening using an allele specific assay of 90 of the most common LCA-causing variations in the coding sequences of AIPL1, CEP290, CRB1, CRX, GUCY2D, RDH12 and RPE65 was performed on the father. Automated DNA sequencing of his son examining exon 3 of the CRX gene was subsequently performed. Both father and son have a heterozygous single base pair deletion of an adenine at codon 153 in the coding sequence of the CRX gene resulting in a frameshift mutation. Mutations involving the CRX gene may demonstrate an autosomal dominant inheritance pattern for LCA.

TP53 mutation spectrum in smokers and never smoking lung cancer patients

Directory of Open Access Journals (Sweden)

Ann Rita Halvorsen

2016-05-01

Full Text Available AbstractBackground: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer.Methods: We analysed tumour tissue from 394 non-small cell carcinomas including adenocarcinomas (n=229, squamous cell carcinomas (n=112, large cell carcinomas (n=30 and others (n=23 for mutations in TP53 by the use of Sanger sequencing (n=394 and next generation sequencing (n=100. Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65% of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3% compared to adenocarcinomas (9.1%.Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, as also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers.

The identification of point mutations in Duchenne muscular dystrophy patients by using reverse-transcription PCR and the protein truncation test

Energy Technology Data Exchange (ETDEWEB)

Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)

1995-08-01

The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.

Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

Science.gov (United States)

Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

2012-10-01

The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

Wilson's disease in Southern Brazil: genotype-phenotype correlation and description of two novel mutations in ATP7B gene

Directory of Open Access Journals (Sweden)

Ricardo Schmitt de Bem

2013-08-01

Full Text Available OBJECTIVE: Wilson's disease (WD is an inborn error of metabolism caused by abnormalities of the copper-transporting protein encoding gene ATP7B. In this study, we examined ATP7B for mutations in a group of patients living in southern Brazil. METHODS: 36 WD subjects were studied and classified according to their clinical and epidemiological data. In 23 subjects the ATP7B gene was analyzed. RESULTS: Fourteen distinct mutations were detected in at least one of the alleles. The c.3207C>A substitution at exon 14 was the most common mutation (allelic frequency=37.1% followed by the c.3402delC at exon 15 (allelic frequency=11.4%. The mutations c.2018-2030del13 at exon 7 and c.4093InsT at exon 20 are being reported for the first time. CONCLUSION: The c.3207C>A substitution at exon 14, was the most common mutation, with an allelic frequency of 37.1%. This mutation is the most common mutation described in Europe.

Osteogenesis imperfecta type 3 in South Africa: Causative mutations in FKBP10

Directory of Open Access Journals (Sweden)

Alvera Vorster

2017-05-01

Full Text Available Background. A relatively high frequency of autosomal recessively inherited osteogenesis imperfecta (OI type 3 (OI-3 is present in the indigenous black southern African population. Affected persons may be severely handicapped as a result of frequent fractures, progressive deformity of the tubular bones and spinal malalignment. Objective. To delineate the molecular basis for the condition. Methods. Molecular investigations were performed on 91 affected persons from seven diverse ethnolinguistic groups in this population. Results. Following polymerase chain reaction amplification and direct cycle sequencing, FKBP10 mutations were identified in 45.1% (41/91 OI-3-affected persons. The homozygous FKBP10 c.831dupC frameshift mutation was confirmed in 35 affected individuals in the study cohort. Haplotype analysis suggests that this mutation is identical among these OI-3-affected persons by descent, thereby confirming that they had a common ancestor. Compound heterozygosity of this founder mutation was observed, in combination with three different deleterious FKBP10 mutations, in six additional persons in the cohort. Four of these individuals had the c.831delC mutation. Conclusion. The burden of the disorder, both in frequency and severity, warrants the establishment of a dedicated service for molecular diagnostic confirmation and genetic management of persons and families with OI in southern Africa.

Endometrial cancer and somatic G>T KRAS transversion in patients with constitutional MUTYH biallelic mutations.

Science.gov (United States)

Tricarico, Rossella; Bet, Paola; Ciambotti, Benedetta; Di Gregorio, Carmela; Gatteschi, Beatrice; Gismondi, Viviana; Toschi, Benedetta; Tonelli, Francesco; Varesco, Liliana; Genuardi, Maurizio

2009-02-18

MUTYH-associated polyposis (MAP) is an autosomal recessive condition predisposing to colorectal cancer, caused by constitutional biallelic mutations in the base excision repair (BER) gene MUTYH. Colorectal tumours from MAP patients display an excess of somatic G>T mutations in the APC and KRAS genes due to defective BER function. To date, few extracolonic manifestations have been observed in MAP patients, and the clinical spectrum of this condition is not yet fully established. Recently, one patient with a diagnosis of endometrial cancer and biallelic MUTYH mutations has been described. We here report on two additional unrelated MAP patients with biallelic MUTYH germline mutations who developed endometrioid endometrial carcinoma. The endometrial tumours were evaluated for PTEN, PIK3CA, KRAS, BRAF and CTNNB1 mutations. A G>T transversion at codon 12 of the KRAS gene was observed in one tumour. A single 1bp frameshift deletion of PTEN was observed in the same sample. Overall, these findings suggest that endometrial carcinoma is a phenotypic manifestations of MAP and that inefficient repair of oxidative damage can be involved in its pathogenesis.

Prenatal diagnosis of autosomal dominant hereditary spastic paraplegia (SPG4) using direct mutation detection

DEFF Research Database (Denmark)

Nielsen, Jørgen E; Koefoed, Pernille; Kjaergaard, Susanne

2004-01-01

OBJECTIVE: To present a report on prenatal diagnosis using direct SPG4 gene analysis in a family with autosomal dominant hereditary spastic paraplegia (AD-HSP). METHODS: Genetic linkage and haplotype analysis were previously carried out with chromosome 2p markers. DNA was obtained from affected...... individuals, the affected father, the mother, and fetal DNA from an ongoing pregnancy by chorionic villus sampling (CVS) in the first trimester. The spastin gene (SPG4) was completely sequenced. RESULTS: A novel 832insGdelAA frameshift mutation, predicted to cause loss of functional protein, was identified...... in the affected father and in the fetal DNA. CONCLUSIONS: This is the first report on direct prenatal diagnosis of chromosome 2p-linked AD-HSP (SPG4). In addition, we report a novel SPG4-combined small insertion/deletion mutation in exon 5, which may be the first SPG4 mutational hot spot....

Mutation spectrum of homogentisic acid oxidase (HGD) in alkaptonuria.

Science.gov (United States)

Vilboux, Thierry; Kayser, Michael; Introne, Wendy; Suwannarat, Pim; Bernardini, Isa; Fischer, Roxanne; O'Brien, Kevin; Kleta, Robert; Huizing, Marjan; Gahl, William A

2009-12-01

Alkaptonuria (AKU) is a rare autosomal recessive metabolic disorder, characterized by accumulation of homogentisic acid, leading to darkened urine, pigmentation of connective tissue (ochronosis), joint and spine arthritis, and destruction of cardiac valves. AKU is due to mutations in the homogentisate dioxygenase gene (HGD) that converts homogentisic acid to maleylacetoacetic acid in the tyrosine catabolic pathway. Here we report a comprehensive mutation analysis of 93 patients enrolled in our study, as well as an extensive update of all previously published HGD mutations associated with AKU. Within our patient cohort, we identified 52 HGD variants, of which 22 were novel. This yields a total of 91 identified HGD variations associated with AKU to date, including 62 missense, 13 splice site, 10 frameshift, 5 nonsense, and 1 no-stop mutation. Most HGD variants reside in exons 3, 6, 8, and 13. We assessed the potential effect of all missense variations on protein function, using five bioinformatic tools specifically designed for interpretation of missense variants (SIFT, POLYPHEN, PANTHER, PMUT, and SNAP). We also analyzed the potential effect of splice-site variants using two different tools (BDGP and NetGene2). This study provides valuable resources for molecular analysis of alkaptonuria and expands our knowledge of the molecular basis of this disease.

Clinical study of DMD gene point mutation causing Becker muscular dystrophy

Directory of Open Access Journals (Sweden)

Ji-qing CAO

2015-07-01

Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

Birt-Hogg-Dubé syndrome: novel FLCN frameshift deletion in daughter and father with renal cell carcinomas.

Science.gov (United States)

Näf, Ernst; Laubscher, Dominik; Hopfer, Helmut; Streit, Markus; Matyas, Gabor

2016-01-01

Germline mutation of the FLCN gene causes Birt-Hogg-Dubé syndrome (BHD), a rare autosomal dominant condition characterized by skin fibrofolliculomas, lung cysts, spontaneous pneumothorax and renal tumours. We identified a hitherto unreported pathogenic FLCN frameshift deletion c.563delT (p.Phe188Serfs*35) in a family of a 46-year-old woman presented with macrohematuria due to bilateral chromophobe renal carcinomas. A heritable renal cancer was suspected due to the bilaterality of the tumour and as the father of this woman had suffered from renal cancer. Initially, however, BHD was overlooked by the medical team despite the highly suggestive clinical presentation. We assume that BHD is underdiagnosed, at least partially, due to low awareness of this variable condition and to insufficient use of appropriate genetic testing. Our study indicates that BHD and FLCN testing should be routinely considered in patients with positive family or personal history of renal tumours. In addition, we demonstrate how patients and their families can play a driving role in initiating genetic diagnosis, presymptomatic testing of at-risk relatives, targeted disease management, and genetic counselling of rare diseases such as BHD.

Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

Science.gov (United States)

Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

2014-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

Recurrent mutations in the CDKL5 gene: genotype-phenotype relationships.

Science.gov (United States)

Bahi-Buisson, Nadia; Villeneuve, Nathalie; Caietta, Emilie; Jacquette, Aurélia; Maurey, Helene; Matthijs, Gert; Van Esch, Hilde; Delahaye, Andrée; Moncla, Anne; Milh, Mathieu; Zufferey, Flore; Diebold, Bertrand; Bienvenu, Thierry

2012-07-01

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been described in epileptic encephalopathies in females with infantile spasms with features that overlap with Rett syndrome. With more than 80 reported patients, the phenotype of CDKL5-related encephalopathy is well-defined. The main features consist of seizures starting before 6 months of age, severe intellectual disability with absent speech and hand stereotypies and deceleration of head growth, which resembles Rett syndrome. However, some clinical discrepancies suggested the influence of genetics and/or environmental factors. No genotype-phenotype correlation has been defined and thus there is a need to examine individual mutations. In this study, we analyzed eight recurrent CDKL5 mutations to test whether the clinical phenotype of patients with the same mutation is similar and whether patients with specific CDKL5 mutations have a milder phenotype than those with other CDKL5 mutations. Patients bearing missense mutations in the ATP binding site such as the p.Ala40Val mutation typically walked unaided, had normocephaly, better hand use ability, and less frequent refractory epilepsy when compared to girls with other CDKL5 mutations. In contrast, patients with mutations in the kinase domain (such as p.Arg59X, p.Arg134X, p.Arg178Trp/Pro/Gln, or c.145 + 2T > C) and frameshift mutations in the C-terminal region (such as c.2635_2636delCT) had a more severe phenotype with infantile spasms, refractory epileptic encephalopathy, absolute microcephaly, and inability to walk. It is important for clinicians to have this information when such patients are diagnosed. Copyright © 2012 Wiley Periodicals, Inc.

Novel SCARB2 mutation in action myoclonus-renal failure syndrome and evaluation of SCARB2 mutations in isolated AMRF features

Directory of Open Access Journals (Sweden)

Hopfner Franziska

2011-10-01

Full Text Available Abstract Background Action myoclonus-renal failure syndrome is a hereditary form of progressive myoclonus epilepsy associated with renal failure. It is considered to be an autosomal-recessive disease related to loss-of-function mutations in SCARB2. We studied a German AMRF family, additionally showing signs of demyelinating polyneuropathy and dilated cardiomyopathy. To test the hypothesis whether isolated appearance of individual AMRF syndrome features could be related to heterozygote SCARB2 mutations, we screened for SCARB2 mutations in unrelated patients showing isolated AMRF features. Methods In the AMRF family all exons of SCARB2 were analyzed by Sanger sequencing. The mutation screening of unrelated patients with isolated AMRF features affected by either epilepsy (n = 103, progressive myoclonus epilepsy or generalized epilepsy, demyelinating polyneuropathy (n = 103, renal failure (n = 192 or dilated cardiomyopathy (n = 85 was performed as high resolution melting curve analysis of the SCARB2 exons. Results A novel homozygous 1 bp deletion (c.111delC in SCARB2 was found by sequencing three affected homozygous siblings of the affected family. A heterozygous sister showed generalized seizures and reduction of nerve conduction velocity in her legs. No mutations were found in the epilepsy, renal failure or dilated cardiomyopathy samples. In the polyneuropathy sample two individuals with demyelinating disease were found to be carriers of a SCARB2 frameshift mutation (c.666delCCTTA. Conclusions Our findings indicate that demyelinating polyneuropathy and dilated cardiomyopathy are part of the action myoclonus-renal failure syndrome. Moreover, they raise the possibility that in rare cases heterozygous SCARB2 mutations may be associated with PNP features.

Mutations in HPSE2 cause urofacial syndrome.

Science.gov (United States)

Daly, Sarah B; Urquhart, Jill E; Hilton, Emma; McKenzie, Edward A; Kammerer, Richard A; Lewis, Malcolm; Kerr, Bronwyn; Stuart, Helen; Donnai, Dian; Long, David A; Burgu, Berk; Aydogdu, Ozgu; Derbent, Murat; Garcia-Minaur, Sixto; Reardon, Willie; Gener, Blanca; Shalev, Stavit; Smith, Rupert; Woolf, Adrian S; Black, Graeme C; Newman, William G

2010-06-11

Urinary voiding dysfunction in childhood, manifesting as incontinence, dysuria, and urinary frequency, is a common condition. Urofacial syndrome (UFS) is a rare autosomal recessive disease characterized by facial grimacing when attempting to smile and failure of the urinary bladder to void completely despite a lack of anatomical bladder outflow obstruction or overt neurological damage. UFS individuals often have reflux of infected urine from the bladder to the upper renal tract, with a risk of kidney damage and renal failure. Whole-genome SNP mapping in one affected individual defined an autozygous region of 16 Mb on chromosome 10q23-q24, within which a 10 kb deletion encompassing exons 8 and 9 of HPSE2 was identified. Homozygous exonic deletions, nonsense mutations, and frameshift mutations in five further unrelated families confirmed HPSE2 as the causative gene for UFS. Mutations were not identified in four additional UFS patients, indicating genetic heterogeneity. We show that HPSE2 is expressed in the fetal and adult central nervous system, where it might be implicated in controlling facial expression and urinary voiding, and also in bladder smooth muscle, consistent with a role in renal tract morphology and function. Our findings have broader implications for understanding the genetic basis of lower renal tract malformations and voiding dysfunction.

Mutations in HPSE2 Cause Urofacial Syndrome

Science.gov (United States)

Daly, Sarah B.; Urquhart, Jill E.; Hilton, Emma; McKenzie, Edward A.; Kammerer, Richard A.; Lewis, Malcolm; Kerr, Bronwyn; Stuart, Helen; Donnai, Dian; Long, David A.; Burgu, Berk; Aydogdu, Ozgu; Derbent, Murat; Garcia-Minaur, Sixto; Reardon, Willie; Gener, Blanca; Shalev, Stavit; Smith, Rupert; Woolf, Adrian S.; Black, Graeme C.; Newman, William G.

2010-01-01

Urinary voiding dysfunction in childhood, manifesting as incontinence, dysuria, and urinary frequency, is a common condition. Urofacial syndrome (UFS) is a rare autosomal recessive disease characterized by facial grimacing when attempting to smile and failure of the urinary bladder to void completely despite a lack of anatomical bladder outflow obstruction or overt neurological damage. UFS individuals often have reflux of infected urine from the bladder to the upper renal tract, with a risk of kidney damage and renal failure. Whole-genome SNP mapping in one affected individual defined an autozygous region of 16 Mb on chromosome 10q23-q24, within which a 10 kb deletion encompassing exons 8 and 9 of HPSE2 was identified. Homozygous exonic deletions, nonsense mutations, and frameshift mutations in five further unrelated families confirmed HPSE2 as the causative gene for UFS. Mutations were not identified in four additional UFS patients, indicating genetic heterogeneity. We show that HPSE2 is expressed in the fetal and adult central nervous system, where it might be implicated in controlling facial expression and urinary voiding, and also in bladder smooth muscle, consistent with a role in renal tract morphology and function. Our findings have broader implications for understanding the genetic basis of lower renal tract malformations and voiding dysfunction. PMID:20560210

ATM (ataxia-telangiectasia mutated) abnormality and diseases

International Nuclear Information System (INIS)

Takagi, Masatoshi; Nakata, Shinichiro; Mizutani, Shuki

2007-01-01

Ataxia-Telangiectasia (A-T) is an autosomal recessive inherited disease due to mutation of ATM gene on chromosome 11q22.3, with major symptoms of ataxia, telangiectasia, immunodeficiency and frequent complication of cancer, and the cells have characters of chromosomal break, high sensitivity to radiation and inappropriate continuation of DNA synthesis after radiation. This review describes past and present studies of ATM functions with clinical features in the following order: Clinical symptoms and epidemiology; ATM gene mutation in A-T patients, mainly by frame-shift (80-90%); ATM, whose gene consisted from 66 exons (150 kb), functions in phosphoinositide-3-kinase related kinase family which protecting cells from stress and integrating their system, at response to DNA double strand break, and in the cell cycle checkpoints at G1/S, S and G2/M phases; ATM nonsense/missense mutations in embryonic cells leading to carcinogenesis and role of ATM in the suppression of carcinogenesis in somatic cells; Chromosomal translocation which relating to carcinogenesis, by functional defect of ATM; and Other functions of ATM in neuronal growth, immunodeficiency, carbohydrate and lipid metabolism, early senescence, and virus infection. ATM is thus an essential molecule to maintain growth and homeostasis. (T.I.)

Two novel mutations in the homogentisate-1,2-dioxygenase gene identified in Chinese Han Child with Alkaptonuria.

Science.gov (United States)

Li, Hongying; Zhang, Kaihui; Xu, Qun; Ma, Lixia; Lv, Xin; Sun, Ruopeng

2015-03-01

Alkaptonuria (AKU) is an autosomal recessive disorder of tyrosine metabolism, which is caused by a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) with subsequent accumulation of homogentisic acid. Presently, more than 100 HGD mutations have been identified as the cause of the inborn error of metabolism across different populations worldwide. However, the HGD mutation is very rarely reported in Asia, especially China. In this study, we present mutational analyses of HGD gene in one Chinese Han child with AKU, which had been identified by gas chromatography-mass spectrometry detection of organic acids in urine samples. PCR and DNA sequencing of the entire coding region as well as exon-intron boundaries of HGD have been performed. Two novel mutations were identified in the HGD gene in this AKU case, a frameshift mutation of c.115delG in exon 3 and the splicing mutation of IVS5+3 A>C, a donor splice site of the exon 5 and exon-intron junction. The identification of these mutations in this study further expands the spectrum of known HGD gene mutations and contributes to prenatal molecular diagnosis of AKU.

Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

Directory of Open Access Journals (Sweden)

Rocio Toro

Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

The NOD2 3020insC Mutation in Women with Breast Cancer from the Bydgoszcz Region in Poland. First Results

Directory of Open Access Journals (Sweden)

Janiszewska Hanna

2006-01-01

Full Text Available Abstract The frameshift NOD2 gene mutation 3020insC is predominantly associated with Crohn's disease, but predisposes to many types of common cancers as well. We studied the frequency of this mutant NOD2 allele in 148 breast cancer women from the Bydgoszcz region in Poland. The NOD2 mutation was present in 8.8% of the patients. The mean age at breast cancer diagnosis of the mutation carriers was 43 years. We did not find any mutation in patients diagnosed with breast cancer after the age of 50 years. There was no association of the NOD2 mutation with a strong family history of breast cancer. On the contrary, the mutation frequency (11.4% was two times higher in women from families with a single case of breast cancer and with aggregation of other common types of cancer, especially digestive tract cancers. Low risk of breast cancer in the mutation carriers seems to be confirmed by finding the 3020insC mutation in three healthy parents of probands aged 73, 74 and 83 years, from three separate families.

Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

Science.gov (United States)

Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

2013-02-15

Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Environmental protection: Researches in National Inst. of Radiological Sciences

International Nuclear Information System (INIS)

Fuma, S.; Ban-nai, T.; Doi, M.; Fujimori, A.; Ishii, N.; Ishikawa, Y.; Kawaguchi, I.; Kubota, Y.; Maruyama, K.; Miyamoto, K.; Nakamori, T.; Takeda, H.; Watanabe, Y.; Yanagisawa, K.; Yasuda, T.; Yoshida, S.

2011-01-01

Some studies for radiological protection of the environment have been made at the National Inst. of Radiological Sciences (NIRS). Transfer of radionuclides and related elements has been investigated for dose estimation of non-human biota. A parameter database and radionuclide transfer models have been also developed for the Japanese environments. Dose (rate)-effect relationships for survival, growth and reproduction have been investigated in conifers, Arabidopsis, fungi, earthworms, springtails, algae, duckweeds, daphnia and medaka. Also genome-wide gene expression analysis has been carried out by high coverage expression profiling (HiCEP). Effects on aquatic microbial communities have been studied in experimental ecosystem models, i.e., microcosms. Some effects were detected at a dose rate of 1 Gy day -1 and were likely to arise from inter-species interactions. The results obtained at NIRS have been used in development of frameworks for environmental protection by some international bodies, and will contribute to environmental protection in Japan and other Asian countries. (authors)

Coffin-Siris Syndrome with obesity, macrocephaly, hepatomegaly and hyperinsulinism caused by a mutation in the ARID1B gene.

Science.gov (United States)

Vals, Mari-Anne; Õiglane-Shlik, Eve; Nõukas, Margit; Shor, Riina; Peet, Aleksandr; Kals, Mart; Kivistik, Paula Ann; Metspalu, Andres; Õunap, Katrin

2014-11-01

Coffin-Siris Syndrome (CSS, MIM 135900) is a rare genetic disorder, and mutations in ARID1B were recently shown to cause CSS. In this study, we report a novel ARID1B mutation identified by whole-exome sequencing in a patient with clinical features of CSS. We identified a novel heterozygous frameshift mutation c.1584delG in exon 2 of ARID1B (NM_020732.3) predicting a premature stop codon p.(Leu528Phefs*65). Sanger sequencing confirmed the c.1584delG mutation as a de novo in the proband and that it was not present either in her parents, half-sister or half-brother. Clinically, the patient presented with extreme obesity, macrocephaly, hepatomegaly, hyperinsulinism and polycystic ovarian syndrome (PCOS), which have previously not been described in CSS patients. We suggest that obesity, macrocephaly, hepatomegaly and/or PCOS may be added to the list of clinical features of ARID1B mutations, but further clinical reports are required to make a definite conclusion.

Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies.

Science.gov (United States)

Salter, Claire G; Beijer, Danique; Hardy, Holly; Barwick, Katy E S; Bower, Matthew; Mademan, Ines; De Jonghe, Peter; Deconinck, Tine; Russell, Mark A; McEntagart, Meriel M; Chioza, Barry A; Blakely, Randy D; Chilton, John K; De Bleecker, Jan; Baets, Jonathan; Baple, Emma L; Walk, David; Crosby, Andrew H

2018-04-01

To identify the genetic cause of disease in 2 previously unreported families with forms of distal hereditary motor neuropathies (dHMNs). The first family comprises individuals affected by dHMN type V, which lacks the cardinal clinical feature of vocal cord paralysis characteristic of dHMN-VII observed in the second family. Next-generation sequencing was performed on the proband of each family. Variants were annotated and filtered, initially focusing on genes associated with neuropathy. Candidate variants were further investigated and confirmed by dideoxy sequence analysis and cosegregation studies. Thorough patient phenotyping was completed, comprising clinical history, examination, and neurologic investigation. dHMNs are a heterogeneous group of peripheral motor neuron disorders characterized by length-dependent neuropathy and progressive distal limb muscle weakness and wasting. We previously reported a dominant-negative frameshift mutation located in the concluding exon of the SLC5A7 gene encoding the choline transporter (CHT), leading to protein truncation, as the likely cause of dominantly-inherited dHMN-VII in an extended UK family. In this study, our genetic studies identified distinct heterozygous frameshift mutations located in the last coding exon of SLC5A7 , predicted to result in the truncation of the CHT C-terminus, as the likely cause of the condition in each family. This study corroborates C-terminal CHT truncation as a cause of autosomal dominant dHMN, confirming upper limb predominating over lower limb involvement, and broadening the clinical spectrum arising from CHT malfunction.

Analysis of mutations in the human HPRT gene induced by accelerated heavy-ion irradiation

International Nuclear Information System (INIS)

Kagawa, Yasuhiro; Yatagai, Fumio; Hanaoka, Fumio; Suzuki, Masao; Kase, Youko; Kobayashi, Akiko; Hirano, Masahiko; Kato, Takesi; Watanabe, Masami.

1995-01-01

Multiplex PCR analysis of HPRT(-) mutations in human embryo (HE) cells induced by 230 keV/μm carbon-ion irradiation showed no large deletion around the exon regions of the locus gene in contrast to the irradiations at different LETs. To identify these mutations, the sequence alterations in a cDNA of hprt gene were determined for 18 mutant clones in this study. Missing of exon 6 was the most frequent mutational event (10 clones), and missing of both exons 6 and 8 was next most frequent event (6 clones), then base substitutions (2 clones). These characteristics were not seen in a similar analysis of spontaneous mutations, which showed base substitution (5 clones), frameshift (2 clones), missing of both exons 2 and 3 (2 clones), and a single unidentified clone. Direct sequencing and restriction enzyme digestion of the genomic DNA of the mutants which showed missing of exons 6 and 8 in the cDNA, supports the possibility that they were induced by aberrant mRNA splicing. (author)

High frequency of the recurrent c.1310_1313delAAGA BRCA2 mutation in the North-East of Morocco and implication for hereditary breast-ovarian cancer prevention and control.

Science.gov (United States)

Laarabi, Fatima-Zahra; Ratbi, Ilham; Elalaoui, Siham Chafai; Mezzouar, Loubna; Doubaj, Yassamine; Bouguenouch, Laila; Ouldim, Karim; Benjaafar, Noureddine; Sefiani, Abdelaziz

2017-06-02

To date, a limited number of BRCA1/2 germline mutations have been reported in hereditary breast and/or ovarian cancer in the Moroccan population. Less than 20 different mutations of these two genes have been identified in Moroccan patients, and recently we reported a further BRCA2 mutation (c.1310_1313delAAGA; p.Lys437IlefsX22) in three unrelated patients, all from the North-East of the country. We aimed in this study to evaluate the frequency and geographic distribution of this BRCA2 frameshift mutation, in order to access its use as the first-line BRCA genetic testing strategy for Moroccan patients. We enrolled in this study 122 patients from different regions of Morocco, with suggestive inherited predisposition to breast and ovarian cancers. All subjects gave written informed consent to BRCA1/2 genetic testing. According to available resources of our lab and enrolled families, 51 patients were analyzed by the conventional individual exon-by-exon Sanger sequencing, 23 patients were able to benefit from a BRCA next generation sequencing and a target screening for exon 10 of BRCA2 gene was performed in 48 patients. Overall, and among the 122 patients analyzed for at least the exon 10 of the BRCA2 gene, the c.1310_1313delAAGA frameshift mutation was found in 14 patients. Genealogic investigation revealed that all carriers of this mutation shared the same geographic origin and were descendants of the North-East of Morocco. In this study, we highlighted that c.1310_1313delAAGA mutation of BRCA2 gene is recurrent with high frequency in patients from the North-East region of Morocco. Therefore, we propose to use, in public health strategies, the detection of this mutation as the first-line screening tests in patients with breast and ovarian cancer originated from this region.

A novel c.240_241insGG mutation in NDP gene in a family with Norrie disease.

Science.gov (United States)

Andarva, Monavvar; Jamshidi, Javad; Ghaedi, Hamid; Daftarian, Narsis; Emamalizadeh, Babak; Alehabib, Elham; Taghavi, Shaghyegh; Pouriran, Ramin; Darvish, Hossein

2018-03-01

Norrie disease (ND) is a rare, X-linked recessive disorder with the main characteristic of early childhood blindness. The aim of the present study was to identify the genetic cause of the disease and the phenotypic characteristics of the patients in an Iranian family with four affected males with ND. Norrie disease pseudoglioma (NDP) gene was sequenced and clinical examination was performed on patients. A GG dinucleotide insertion in exon 3 (c.240_241insGG) of NDP was detected in all patients. The mutation caused a frameshift and an early stop codon (p.Phe81Glyfs*23). A novel mutation was found in the NDP gene in the affected males of the family. As the mutation was absent in the normal male members of the family, it should be the genetic cause of the disease. © 2017 Optometry Australia.

Effects of near-ultraviolet light on mutations, intragenic and intergenic recombinations in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Machida, Isamu; Saeki, Tetsuya; Nakai, Sayaka

1986-01-01

The effects of far and near ultraviolet light on mutations, intragenic and intergenic recombinations were compared in diploid strains of Saccharomyces cerevisiae. At equivalent survival levels there was not much difference in the induction of nonsense and missense mutations between far- and near-UV radiations. However, frameshift mutations were induced more frequently by near-UV than by far-UV radiation. Near-UV radiation induced intragenic recombination as efficiently as far-UV radiation. A strikingly higher frequency was observed for the intergenic recombination induced by near-UV radiation than by far-UV radiation when compared at equivalent survival levels. Photoreactivation reduced the frequency only slightly in far-UV induced intergenic recombination and not at all in near-UV induction. These results indicate that near-UV damage involves strand breakage in addition to pyrimidine dimers and other lesions induced, whereas far-UV damage consists largely of photoreactivable lesions, pyrimidine dimers, and near-UV induced damage is more efficient for the induction of crossing-over. (Auth.)

GFI1B mutation causes a bleeding disorder with abnormal platelet function.

Science.gov (United States)

Stevenson, W S; Morel-Kopp, M-C; Chen, Q; Liang, H P; Bromhead, C J; Wright, S; Turakulov, R; Ng, A P; Roberts, A W; Bahlo, M; Ward, C M

2013-11-01

GFI1B is a transcription factor important for erythropoiesis and megakaryocyte development but previously unknown to be associated with human disease. A family with a novel bleeding disorder was identified and characterized. Genetic linkage analysis and massively parallel sequencing were used to localize the mutation causing the disease phenotype on chromosome 9. Functional studies were then performed in megakaryocytic cell lines to determine the biological effects of the mutant transcript. We have identified a family with an autosomal dominant bleeding disorder associated with macrothrombocytopenia, red cell anisopoikilocytosis, and platelet dysfunction. The severity of bleeding is variable with some affected individuals experiencing spontaneous bleeding while other family members exhibit only abnormal bleeding with surgery. A single nucleotide insertion was identified in GFI1B that predicts a frameshift mutation in the fifth zinc finger DNA-binding domain. This mutation alters the transcriptional activity of the protein, resulting in a reduction in platelet α-granule content and aberrant expression of key platelet proteins. GFI1B mutation represents a novel human bleeding disorder, and the described phenotype identifies GFI1B as a critical regulator of platelet shape, number, and function. © 2013 International Society on Thrombosis and Haemostasis.

Progranulin mutation causes frontotemporal dementia in the Swedish Karolinska family.

Science.gov (United States)

Chiang, Huei-Hsin; Rosvall, Lina; Brohede, Jesper; Axelman, Karin; Björk, Behnosh F; Nennesmo, Inger; Robins, Tiina; Graff, Caroline

2008-11-01

Frontotemporal dementia (FTD) is a neurodegenerative disease characterized by cognitive impairment, language dysfunction, and/or changes in personality. Recently it has been shown that progranulin (GRN) mutations can cause FTD as well as other neurodegenerative phenotypes. DNA from 30 family members, of whom seven were diagnosed with FTD, in the Karolinska family was available for GRN sequencing. Fibroblast cell mRNA from one affected family member and six control individuals was available for relative quantitative real-time polymerase chain reaction to investigate the effect of the mutation. Furthermore, the cDNA of an affected individual was sequenced. Clinical and neuropathologic findings of a previously undescribed family branch are presented. A frameshift mutation in GRN (g.102delC) was detected in all affected family members and absent in four unaffected family members older than 70 years. Real-time polymerase chain reaction data showed an approximately 50% reduction of GRN fibroblast mRNA in an affected individual. The mutated mRNA transcripts were undetectable by cDNA sequencing. Segregation and RNA analyses showed that the g.102delC mutation, previously reported, causes FTD in the Karolinska family. Our findings add further support to the significance of GRN in FTD etiology and the presence of modifying genes, which emphasize the need for further studies into the mechanisms of clinical heterogeneity. However, the results already call for attention to the complexity of predictive genetic testing of GRN mutations.

Mutational effects of γ-rays and carbon ion beams on Arabidopsis seedlings

International Nuclear Information System (INIS)

Yoshihara, Ryohei; Nozawa, Shigeki; Hase, Yoshihiro; Sakamoto, Ayako N.; Narumi, Issay; Hidema, Jun

2013-01-01

To assess the mutational effects of radiation on vigorously proliferating plant tissue, the mutation spectrum was analyzed with Arabidopsis seedlings using the plasmid-rescue method. Transgenic plants containing the Escherichia coli rpsL gene were irradiated with γ-rays and carbon ion beams (320-MeV 12 C 6+ ), and mutations in the rpsL gene were analyzed. Mutant frequency increased significantly following irradiation by γ-rays, but not by 320-MeV 12 C 6+ . Mutation spectra showed that both radiations increased the frequency of frameshifts and other mutations, including deletions and insertions, but only γ-rays increased the frequency of total base substitutions. These results suggest that the type of DNA lesions which cause base substitutions were less often induced by 320-MeV 12 C 6+ than by γ-rays in Arabidopsis seedlings. Furthermore, γ-rays never increased the frequencies of G:C to T:A or A:T to C:G transversions, which are caused by oxidized guanine; 320-MeV 12 C 6+ , however, produced a slight increase in both transversions. Instead, γ-rays produced a significant increase in the frequency of G:C to A:T transitions. These results suggest that 8-oxoguanine has little effect on mutagenesis in Arabidopsis cells. (author)

Genetic progression in microsatellite instability high (MSI-H) colon cancers correlates with clinico-pathological parameters: A study of the TGRbetaRII, BAX, hMSH3, hMSH6, IGFIIR and BLM genes.

Science.gov (United States)

Calin, G A; Gafà, R; Tibiletti, M G; Herlea, V; Becheanu, G; Cavazzini, L; Barbanti-Brodano, G; Nenci, I; Negrini, M; Lanza, G

2000-05-20

Colon carcinomas with microsatellite mutator phenotype exhibit specific genetic and clinico-pathological features. This report describes the analysis of 63 "microsatellite instability-high" (MSI-H) tumors for the presence of mutations in microsatellites located in the coding regions (CDRs) of 6 genes: TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR, and BLM. The following frequencies of mutations were detected: TGFbetaRII (70%), BAX (54%), hMSH3 (36.5%), IGFIIR (22%), hMSH6 (17.5%), and BLM (16%). The overall picture revealed combinations of mutations suggestive of a progressive order of accumulation, with mutations of TGFbetaRII and BAX first, followed by frameshifts in hMSH3, hMSH6, IGFIIR, and BLM. Correlations with 12 clinico-pathological parameters revealed that tumors with frameshifts in 1 or 2 CDRs were significantly better differentiated than tumors with frameshifts in more than 2 CDRs. We also found that mutations in the hMSH3 gene were significantly associated with decreased wall invasiveness and aneuploidy, and frameshifts in the BLM gene were significantly associated with the mucinous histotype. A trend toward an association between hMSH3 and IGFIIR with the medullary and conventional adenocarcinoma histotypes, respectively, was seen. Our results strengthen the concept that mutations in target genes have a role in the tumorigenic process of MSI-H tumors, and indicate that frameshifts in microsatellites located in CDRs occur in a limited number of combinations that could determine distinct clinico-pathological traits. Copyright 2000 Wiley-Liss, Inc.

Wiskott-Aldrich Syndrome With Normal-Sized Platelets in an Eighteen-Month-Old Boy: A Rare Mutation

Directory of Open Access Journals (Sweden)

Jayitri Mazumdar

2015-07-01

Full Text Available Introduction: Wiskott-Aldrich syndrome (WAS is an X-linked recessive disorder characterized by thrombocytopenia, eczema, and recurrent infections. The disease is usually associated with small defective platelets. Case Presentation: We described an 18-month-old boy who presented with lower gastrointestinal bleeding, eczema, and recurrent infections. There was pancytopenia with normal-sized platelets. In addition, the CD4 count was significantly low and serum IgA and IgE levels were increased. The diagnosis of WAS was confirmed by detecting a mutation of WAS gene, which was due to a deletion mutation resulting in frameshift (c.177DelT. Conclusions: Usually microplatelets with mean platelet volume of 4-5 fL are seen in WAS, but in this case, the patient had normal-sized platelets with a rare mutation of WAS gene. Therefore, high index of clinical suspicion is needed to diagnose WAS.

Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

Science.gov (United States)

Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine

2015-01-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

Directory of Open Access Journals (Sweden)

Zied Riahi

Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3 are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys, in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24, and a nonsense mutation, c.52A>T (p.Lys18*. Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

Mutations in noncoding regions of GJB1 are a major cause of X-linked CMT

Science.gov (United States)

Tomaselli, Pedro J.; Rossor, Alexander M.; Horga, Alejandro; Jaunmuktane, Zane; Carr, Aisling; Saveri, Paola; Piscosquito, Giuseppe; Pareyson, Davide; Laura, Matilde; Blake, Julian C.; Poh, Roy; Polke, James; Houlden, Henry

2017-01-01

Objective: To determine the prevalence and clinical and genetic characteristics of patients with X-linked Charcot-Marie-Tooth disease (CMT) due to mutations in noncoding regions of the gap junction β-1 gene (GJB1). Methods: Mutations were identified by bidirectional Sanger sequence analysis of the 595 bases of the upstream promoter region, and 25 bases of the 3′ untranslated region (UTR) sequence in patients in whom mutations in the coding region had been excluded. Clinical and neurophysiologic data were retrospectively collected. Results: Five mutations were detected in 25 individuals from 10 kindreds representing 11.4% of all cases of CMTX1 diagnosed in our neurogenetics laboratory between 1996 and 2016. Four pathogenic mutations, c.-17G>A, c.-17+1G>T, c.-103C>T, and c.-146-90_146-89insT were detected in the 5′UTR. A novel mutation, c.*15C>T, was detected in the 3′ UTR of GJB1 in 2 unrelated families with CMTX1 and is the first pathogenic mutation in the 3′UTR of any myelin-associated CMT gene. Mutations segregated with the phenotype, were at sites predicted to be pathogenic, and were not present in the normal population. Conclusions: Mutations in noncoding DNA are a major cause of CMTX1 and highlight the importance of mutations in noncoding DNA in human disease. Next-generation sequencing platforms for use in inherited neuropathy should therefore include coverage of these regions. PMID:28283593

Atypical Clinical Presentation of Xeroderma Pigmentosum in a Patient Harboring a Novel Missense Mutation in the XPC Gene: The Importance of Clinical Suspicion.

Science.gov (United States)

Meneses, Marina; Chavez-Bourgeois, Marion; Badenas, Celia; Villablanca, Salvador; Aguilera, Paula; Bennàssar, Antoni; Alos, Llucia; Puig, Susana; Malvehy, Josep; Carrera, Cristina

2015-01-01

Xeroderma pigmentosum (XP) is a genodermatosis caused by abnormal DNA repair. XP complementation group C (XPC) is the most frequent type in Mediterranean countries. We describe a case with a novel mutation in the XPC gene. A healthy Caucasian male patient was diagnosed with multiple primary melanomas. Digital follow-up and molecular studies were carried out. During digital follow-up 8 more additional melanomas were diagnosed. Molecular studies did not identify mutations in CDKN2A, CDK4 or MITF genes. Two heterozygous mutations in the XPC gene were detected: c.2287delC (p.Leu763Cysfs*4) frameshift and c.2212A>G (p.Thr738Ala) missense mutations. The p.Thr738Ala missense mutation has not been previously described. Missense mutations in the XPC gene may allow partial functionality that could explain this unusual late onset XP. Atypical clinical presentation of XPC could be misdiagnosed when genetic aberrations allow partial DNA repair capacity. © 2015 S. Karger AG, Basel.

CtIP Mutations Cause Seckel and Jawad Syndromes.

Directory of Open Access Journals (Sweden)

Per Qvist

2011-10-01

Full Text Available Seckel syndrome is a recessively inherited dwarfism disorder characterized by microcephaly and a unique head profile. Genetically, it constitutes a heterogeneous condition, with several loci mapped (SCKL1-5 but only three disease genes identified: the ATR, CENPJ, and CEP152 genes that control cellular responses to DNA damage. We previously mapped a Seckel syndrome locus to chromosome 18p11.31-q11.2 (SCKL2. Here, we report two mutations in the CtIP (RBBP8 gene within this locus that result in expression of C-terminally truncated forms of CtIP. We propose that these mutations are the molecular cause of the disease observed in the previously described SCKL2 family and in an additional unrelated family diagnosed with a similar form of congenital microcephaly termed Jawad syndrome. While an exonic frameshift mutation was found in the Jawad family, the SCKL2 family carries a splicing mutation that yields a dominant-negative form of CtIP. Further characterization of cell lines derived from the SCKL2 family revealed defective DNA damage induced formation of single-stranded DNA, a critical co-factor for ATR activation. Accordingly, SCKL2 cells present a lowered apoptopic threshold and hypersensitivity to DNA damage. Notably, over-expression of a comparable truncated CtIP variant in non-Seckel cells recapitulates SCKL2 cellular phenotypes in a dose-dependent manner. This work thus identifies CtIP as a disease gene for Seckel and Jawad syndromes and defines a new type of genetic disease mechanism in which a dominant negative mutation yields a recessively inherited disorder.

ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

Science.gov (United States)

Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

2016-01-01

Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

Detection of myxoma viruses encoding a defective M135R gene from clinical cases of myxomatosis; possible implications for the role of the M135R protein as a virulence factor

Directory of Open Access Journals (Sweden)

Larsen Lars E

2010-01-01

Full Text Available Abstract Background Myxoma virus is a member of the Poxviridae and causes disease in European rabbits. Laboratory confirmation of the clinical disease, which occurs in the autumn of most years in Denmark, has been achieved previously using antigen ELISA and electron microscopy. Results An unusually large number of clinically suspected cases of myxomatosis were observed in Denmark during 2007. Myxoma virus DNA was detected, using a new real time PCR assay which targets the M029L gene, in over 70% of the clinical samples submitted for laboratory confirmation. Unexpectedly, further analysis revealed that a high proportion of these viral DNA preparations contained a frame-shift mutation within the M135R gene that has previously been identified as a virulence factor. This frame-shift mutation results in expression of a greatly truncated product. The same frame-shift mutation has also been found recently within an avirulent strain of myxoma virus (6918. However, three other frame-shift mutations found in this strain (in the genes M009L, M036L and M148R were not shared with the Danish viruses but a single nucleotide deletion in the M138R/M139R intergenic region was a common feature. Conclusions It appears that expression of the full-length myxoma virus M135R protein is not required for virulence in rabbits. Hence, the frame-shift mutation in the M135R gene in the nonpathogenic 6918 virus strain is not sufficient to explain the attenuation of this myxoma virus but one/some of the other frame-shift mutations alone or in conjunction with one/some of the thirty two amino acid substitutions must also contribute. The real time PCR assay for myxoma virus is a useful diagnostic tool for laboratory confirmation of suspected cases of myxomatosis.

Detection of myxoma viruses encoding a defective M135R gene from clinical cases of myxomatosis; possible implications for the role of the M135R protein as a virulence factor.

Science.gov (United States)

Belsham, Graham J; Polacek, Charlotta; Breum, Solvej Ø; Larsen, Lars E; Bøtner, Anette

2010-01-16

Myxoma virus is a member of the Poxviridae and causes disease in European rabbits. Laboratory confirmation of the clinical disease, which occurs in the autumn of most years in Denmark, has been achieved previously using antigen ELISA and electron microscopy. An unusually large number of clinically suspected cases of myxomatosis were observed in Denmark during 2007. Myxoma virus DNA was detected, using a new real time PCR assay which targets the M029L gene, in over 70% of the clinical samples submitted for laboratory confirmation. Unexpectedly, further analysis revealed that a high proportion of these viral DNA preparations contained a frame-shift mutation within the M135R gene that has previously been identified as a virulence factor. This frame-shift mutation results in expression of a greatly truncated product. The same frame-shift mutation has also been found recently within an avirulent strain of myxoma virus (6918). However, three other frame-shift mutations found in this strain (in the genes M009L, M036L and M148R) were not shared with the Danish viruses but a single nucleotide deletion in the M138R/M139R intergenic region was a common feature. It appears that expression of the full-length myxoma virus M135R protein is not required for virulence in rabbits. Hence, the frame-shift mutation in the M135R gene in the nonpathogenic 6918 virus strain is not sufficient to explain the attenuation of this myxoma virus but one/some of the other frame-shift mutations alone or in conjunction with one/some of the thirty two amino acid substitutions must also contribute. The real time PCR assay for myxoma virus is a useful diagnostic tool for laboratory confirmation of suspected cases of myxomatosis.

Somatic mutation analysis of MYH11 in breast and prostate cancer

International Nuclear Information System (INIS)

Alhopuro, Pia; Karhu, Auli; Winqvist, Robert; Waltering, Kati; Visakorpi, Tapio; Aaltonen, Lauri A

2008-01-01

MYH11 (also known as SMMHC) encodes the smooth-muscle myosin heavy chain, which has a key role in smooth muscle contraction. Inversion at the MYH11 locus is one of the most frequent chromosomal aberrations found in acute myeloid leukemia. We have previously shown that MYH11 mutations occur in human colorectal cancer, and may also be associated with Peutz-Jeghers syndrome. The mutations found in human intestinal neoplasia result in unregulated proteins with constitutive motor activity, similar to the mutant myh11 underlying the zebrafish meltdown phenotype characterized by disrupted intestinal architecture. Recently, MYH1 and MYH9 have been identified as candidate breast cancer genes in a systematic analysis of the breast cancer genome. The aim of this study was to investigate the role of somatic MYH11 mutations in two common tumor types; breast and prostate cancers. A total of 155 breast cancer and 71 prostate cancer samples were analyzed for those regions in MYH11 (altogether 8 exons out of 42 coding exons) that harboured mutations in colorectal cancer in our previous study. In breast cancer samples only germline alterations were observed. One prostate cancer sample harbored a frameshift mutation c.5798delC, which we have previously shown to result in a protein with unregulated motor activity. Little evidence for a role of somatic MYH11 mutations in the formation of breast or prostate cancers was obtained in this study

Clinical and Neurobehavioral Features of Three Novel Kabuki Syndrome Patients with Mosaic KMT2D Mutations and a Review of Literature.

Science.gov (United States)

Lepri, Francesca Romana; Cocciadiferro, Dario; Augello, Bartolomeo; Alfieri, Paolo; Pes, Valentina; Vancini, Alessandra; Caciolo, Cristina; Squeo, Gabriella Maria; Malerba, Natascia; Adipietro, Iolanda; Novelli, Antonio; Sotgiu, Stefano; Gherardi, Renzo; Digilio, Maria Cristina; Dallapiccola, Bruno; Merla, Giuseppe

2017-12-28

Kabuki syndrome (KS) is a rare disorder characterized by multiple congenital anomalies and variable intellectual disability caused by mutations in KMT2D/MLL2 and KDM6A/UTX , two interacting chromatin modifier responsible respectively for 56-75% and 5-8% of the cases. To date, three KS patients with mosaic KMT2D deletions in blood lymphocytes have been described. We report on three additional subjects displaying KMT2D gene mosaics including one in which a single nucleotide change results in a new frameshift mutation (p.L1199HfsX7), and two with already-known nonsense mutations (p.R4484X and p.R5021X). Consistent with previously published cases, mosaic KMT2D mutations may result in mild KS facial dysmorphisms and clinical and neurobehavioral features, suggesting that these characteristics could represent the handles for genetic testing of individuals with slight KS-like traits.

Phenotypic characterization of an older adult male with late-onset epilepsy and a novel mutation in ASXL3 shows overlap with the associated Bainbridge-Ropers syndrome

Directory of Open Access Journals (Sweden)

Verhoeven W

2018-03-01

Full Text Available Willem Verhoeven,1,2 Jos Egger,1,3 Emmy Räkers,4 Arjen van Erkelens,5 Rolph Pfundt,5 Marjolein H Willemsen5 1Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Department of Psychiatry, Erasmus University Medical Centre, Rotterdam, the Netherlands; 3Donders Institute for Brain, Cognition and Behaviour, Radboud University, Nijmegen, the Netherlands; 4ASVZ, Centre for People with Intellectual Disabilities, Sliedrecht, the Netherlands; 5Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the Netherlands Abstract: The additional sex combs like 3 gene is considered to be causative for the rare Bainbridge-Ropers syndrome (BRPS, which is characterized by severe intellectual disability, neonatal hypotonia, nearly absent development of speech and language as well as several facial dysmorphisms. Apart from disruptive autistiform behaviors, sleep disturbances and epileptic phenomena may be present. Here, a 47-year-old severely intellectually disabled male is described in whom exome sequencing disclosed a novel heterozygous frameshift mutation in the ASXL3 gene leading to a premature stopcodon in the last part of the last exon. Mutations in this very end 3' of the gene have not been reported before in BRPS. The phenotypical presentation of the patient including partially therapy-resistant epilepsy starting in later adulthood shows overlap with BRPS, and it was therefore concluded that the phenotype is likely explained by the identified mutation in ASXL3. Keywords: Bainbridge-Ropers syndrome, ASLX3, frameshift mutation, epilepsy, intellectual disability, array analysis, whole exome sequencing, autism spectrum disorder

Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

Science.gov (United States)

Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

Science.gov (United States)

Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

2018-01-01

Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post

Novel mutations in the USH1C gene in Usher syndrome patients.

Science.gov (United States)

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

2010-12-31

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

Eight previously unidentified mutations found in the OA1 ocular albinism gene

Directory of Open Access Journals (Sweden)

Dufier Jean-Louis

2006-04-01

Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

Missense mutation in the USH2A gene: association with recessive retinitis pigmentosa without hearing loss.

Science.gov (United States)

Rivolta, C; Sweklo, E A; Berson, E L; Dryja, T P

2000-06-01

Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an amino-acid residue within the fifth laminin-epidermal growth factor-like domain of the USH2A gene and that is associated with recessive RP without hearing loss. This single mutation was found in 4.5% of 224 patients with recessive RP, suggesting that USH2A could cause more cases of nonsyndromic recessive RP than does any other gene identified to date.

A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

Science.gov (United States)

Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

2018-04-01

In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

Coffin–Siris Syndrome with obesity, macrocephaly, hepatomegaly and hyperinsulinism caused by a mutation in the ARID1B gene

Science.gov (United States)

Vals, Mari-Anne; Õiglane-Shlik, Eve; Nõukas, Margit; Shor, Riina; Peet, Aleksandr; Kals, Mart; Kivistik, Paula Ann; Metspalu, Andres; Õunap, Katrin

2014-01-01

Coffin–Siris Syndrome (CSS, MIM 135900) is a rare genetic disorder, and mutations in ARID1B were recently shown to cause CSS. In this study, we report a novel ARID1B mutation identified by whole-exome sequencing in a patient with clinical features of CSS. We identified a novel heterozygous frameshift mutation c.1584delG in exon 2 of ARID1B (NM_020732.3) predicting a premature stop codon p.(Leu528Phefs*65). Sanger sequencing confirmed the c.1584delG mutation as a de novo in the proband and that it was not present either in her parents, half-sister or half-brother. Clinically, the patient presented with extreme obesity, macrocephaly, hepatomegaly, hyperinsulinism and polycystic ovarian syndrome (PCOS), which have previously not been described in CSS patients. We suggest that obesity, macrocephaly, hepatomegaly and/or PCOS may be added to the list of clinical features of ARID1B mutations, but further clinical reports are required to make a definite conclusion. PMID:24569609

Homozygous ARHGEF2 mutation causes intellectual disability and midbrain-hindbrain malformation.

Science.gov (United States)

Ravindran, Ethiraj; Hu, Hao; Yuzwa, Scott A; Hernandez-Miranda, Luis R; Kraemer, Nadine; Ninnemann, Olaf; Musante, Luciana; Boltshauser, Eugen; Schindler, Detlev; Hübner, Angela; Reinecker, Hans-Christian; Ropers, Hans-Hilger; Birchmeier, Carmen; Miller, Freda D; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M

2017-04-01

Mid-hindbrain malformations can occur during embryogenesis through a disturbance of transient and localized gene expression patterns within these distinct brain structures. Rho guanine nucleotide exchange factor (ARHGEF) family members are key for controlling the spatiotemporal activation of Rho GTPase, to modulate cytoskeleton dynamics, cell division, and cell migration. We identified, by means of whole exome sequencing, a homozygous frameshift mutation in the ARHGEF2 as a cause of intellectual disability, a midbrain-hindbrain malformation, and mild microcephaly in a consanguineous pedigree of Kurdish-Turkish descent. We show that loss of ARHGEF2 perturbs progenitor cell differentiation and that this is associated with a shift of mitotic spindle plane orientation, putatively favoring more symmetric divisions. The ARHGEF2 mutation leads to reduction in the activation of the RhoA/ROCK/MLC pathway crucial for cell migration. We demonstrate that the human brain malformation is recapitulated in Arhgef2 mutant mice and identify an aberrant migration of distinct components of the precerebellar system as a pathomechanism underlying the midbrain-hindbrain phenotype. Our results highlight the crucial function of ARHGEF2 in human brain development and identify a mutation in ARHGEF2 as novel cause of a neurodevelopmental disorder.

Homozygous ARHGEF2 mutation causes intellectual disability and midbrain-hindbrain malformation

Science.gov (United States)

Yuzwa, Scott A.; Hernandez-Miranda, Luis R.; Musante, Luciana; Boltshauser, Eugen; Schindler, Detlev; Hübner, Angela; Reinecker, Hans-Christian; Ropers, Hans-Hilger; Miller, Freda D.; Hübner, Christoph; Kaindl, Angela M.

2017-01-01

Mid-hindbrain malformations can occur during embryogenesis through a disturbance of transient and localized gene expression patterns within these distinct brain structures. Rho guanine nucleotide exchange factor (ARHGEF) family members are key for controlling the spatiotemporal activation of Rho GTPase, to modulate cytoskeleton dynamics, cell division, and cell migration. We identified, by means of whole exome sequencing, a homozygous frameshift mutation in the ARHGEF2 as a cause of intellectual disability, a midbrain-hindbrain malformation, and mild microcephaly in a consanguineous pedigree of Kurdish-Turkish descent. We show that loss of ARHGEF2 perturbs progenitor cell differentiation and that this is associated with a shift of mitotic spindle plane orientation, putatively favoring more symmetric divisions. The ARHGEF2 mutation leads to reduction in the activation of the RhoA/ROCK/MLC pathway crucial for cell migration. We demonstrate that the human brain malformation is recapitulated in Arhgef2 mutant mice and identify an aberrant migration of distinct components of the precerebellar system as a pathomechanism underlying the midbrain-hindbrain phenotype. Our results highlight the crucial function of ARHGEF2 in human brain development and identify a mutation in ARHGEF2 as novel cause of a neurodevelopmental disorder. PMID:28453519

Muscarinic Acetylcholine Receptor M3 Mutation Causes Urinary Bladder Disease and a Prune-Belly-like Syndrome.

Science.gov (United States)

Weber, Stefanie; Thiele, Holger; Mir, Sevgi; Toliat, Mohammad Reza; Sozeri, Betül; Reutter, Heiko; Draaken, Markus; Ludwig, Michael; Altmüller, Janine; Frommolt, Peter; Stuart, Helen M; Ranjzad, Parisa; Hanley, Neil A; Jennings, Rachel; Newman, William G; Wilcox, Duncan T; Thiel, Uwe; Schlingmann, Karl Peter; Beetz, Rolf; Hoyer, Peter F; Konrad, Martin; Schaefer, Franz; Nürnberg, Peter; Woolf, Adrian S

2011-11-11

Urinary bladder malformations associated with bladder outlet obstruction are a frequent cause of progressive renal failure in children. We here describe a muscarinic acetylcholine receptor M3 (CHRM3) (1q41-q44) homozygous frameshift mutation in familial congenital bladder malformation associated with a prune-belly-like syndrome, defining an isolated gene defect underlying this sometimes devastating disease. CHRM3 encodes the M3 muscarinic acetylcholine receptor, which we show is present in developing renal epithelia and bladder muscle. These observations may imply that M3 has a role beyond its known contribution to detrusor contractions. This Mendelian disease caused by a muscarinic acetylcholine receptor mutation strikingly phenocopies Chrm3 null mutant mice. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Molecular analysis of formaldehyde-induced mutations in human lymphoblasts and E. coli

International Nuclear Information System (INIS)

Crosby, R.M.; Richardson, K.K.; Craft, T.R.; Benforado, K.B.; Liber, H.L.; Skopek, T.R.

1988-01-01

The molecular nature of formaldehyde (HCHO)-induced mutations was studied in both human lymphoblasts and E. coli. Thirty HPRT - human lymphoblast colonies induced by eight repetitive 150 μM HCHO treatments were characterized by Southern blot analysis. Fourteen of these mutants (47%) had visible deletions of some or all of the X-linked HPRT bands, indicating that HCHO can induce large losses of DNA in human lymphoblasts. In E. coli., DNA alterations induced by HCHO were characterized with use of the xanthine guanine phosphoribosyl transferase (gpt) gene as the genetic target. Exposure of E. coli to 4 mM HCHO for 1 hr induced large insertions (41%), large deletions (18%), and point mutations (41%). Dideoxy DNA sequencing revealed that most of the point mutations were transversions at GC base pairs. In contrast, exposure of E. coli to 40 mM HCHO for 1 hr produced 92% point mutations, 62% of which were transitions at a single AT base pair in the gene. Therefore, HCHO is capable of producing different genetic alterations in E. coli at different concentrations, suggesting fundamental differences in the mutagenic mechanisms operating at the two concentrations used. Naked pSV2gpt plasmid DNA was exposed to 3.3 or 10 mM HCHO and transformed into E. coli. Most of the resulting mutations were frameshifts, again suggesting a different mutagenic mechanism

Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.

Science.gov (United States)

Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi

2016-12-01

Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

Mutation analysis in the long isoform of USH2A in American patients with Usher Syndrome type II.

Science.gov (United States)

Yan, Denise; Ouyang, Xiaomei; Patterson, D Michael; Du, Li Lin; Jacobson, Samuel G; Liu, Xue-Zhong

2009-12-01

Usher syndrome type II (USH2) is an autosomal recessive disorder characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa (RP). To identify novel mutations and determine the frequency of USH2A mutations as a cause of USH2, we have carried out mutation screening of all 72 coding exons and exon-intron splice sites of the USH2A gene. A total of 20 USH2 American probands of European descent were analyzed using single strand conformational polymorphism (SSCP) and direct sequencing methods. Ten different USH2A mutations were identified in 55% of the probands, five of which were novel mutations. The detected mutations include three missense, three frameshifts and four nonsense mutations, with c.2299delG/p.E767fs mutation, accounting for 38.9% of the pathological alleles. Two cases were homozygotes, two cases were compound heterozygotes and one case had complex allele with three variants. In seven probands, only one USH2A mutation was detected and no pathological mutation was found in the remaining eight individuals. Altogether, our data support the fact that c.2299delG/p.E767fs is indeed the most common USH2A mutation found in USH2 patients of European Caucasian background. Thus, if screening for mutations in USH2A is considered, it is reasonable to screen for the c.2299delG mutation first.

Prevalence of Novel MAGED2 Mutations in Antenatal Bartter Syndrome.

Science.gov (United States)

Legrand, Anne; Treard, Cyrielle; Roncelin, Isabelle; Dreux, Sophie; Bertholet-Thomas, Aurélia; Broux, Françoise; Bruno, Daniele; Decramer, Stéphane; Deschenes, Georges; Djeddi, Djamal; Guigonis, Vincent; Jay, Nadine; Khalifeh, Tackwa; Llanas, Brigitte; Morin, Denis; Morin, Gilles; Nobili, François; Pietrement, Christine; Ryckewaert, Amélie; Salomon, Rémi; Vrillon, Isabelle; Blanchard, Anne; Vargas-Poussou, Rosa

2018-02-07

Mutations in the MAGED2 gene, located on the X chromosome, have been recently detected in males with a transient form of antenatal Bartter syndrome or with idiopathic polyhydramnios. The aim of this study is to analyze the proportion of the population with mutations in this gene in a French cohort of patients with antenatal Bartter syndrome. The French cohort of patients with antenatal Bartter syndrome encompasses 171 families. Mutations in genes responsible for types 1-4 have been detected in 75% of cases. In patients without identified genetic cause ( n =42), transient antenatal Bartter syndrome was reported in 12 cases. We analyzed the MAGED2 gene in the entire cohort of negative cases by Sanger sequencing and retrospectively collected clinical data regarding pregnancy as well as the postnatal outcome for positive cases. We detected mutations in MAGED2 in 17 patients, including the 12 with transient antenatal Bartter syndrome, from 16 families. Fifteen different mutations were detected (one whole deletion, three frameshift, three splicing, three nonsense, two inframe deletions, and three missense); 13 of these mutations had not been previously described. Interestingly, two patients are females; in one of these patients our data are consistent with selective inactivation of chromosome X explaining the severity. The phenotypic presentation in our patients was variable and less severe than that of the originally described cases. MAGED2 mutations explained 9% of cases of antenatal Bartter syndrome in a French cohort, and accounted for 38% of patients without other characterized mutations and for 44% of male probands of negative cases. Our study confirmed previously published data and showed that females can be affected. As a result, this gene must be included in the screening of the most severe clinical form of Bartter syndrome. Copyright © 2018 by the American Society of Nephrology.

Teoria Crítica e democracia deliberativa: diálogos instáveis

Directory of Open Access Journals (Sweden)

Ricardo Fabrino Mendonça

2013-06-01

Full Text Available Este artigo discute a relação entre as abordagens deliberacionistas de democracia e a Teoria Crítica. Para tanto, apresentam-se três argumentos que sugerem uma dissociação entre os dois corpos teóricos: 1 A deliberação reforça quadros de dominação existentes; 2 A deliberação conformou-se às instituições liberais em voga; e 3 A guinada empírica dos estudos deliberativos aproximaram-nos da teoria tradicional. A partir desses argumentos, o texto ressalta a existência de um diálogo instável entre a abordagem deliberativa e o legado frankfurtiano.

Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease.

Science.gov (United States)

Casari, G; De Fusco, M; Ciarmatori, S; Zeviani, M; Mora, M; Fernandez, P; De Michele, G; Filla, A; Cocozza, S; Marconi, R; Dürr, A; Fontaine, B; Ballabio, A

1998-06-12

Hereditary spastic paraplegia (HSP) is characterized by progressive weakness and spasticity of the lower limbs due to degeneration of corticospinal axons. We found that patients from a chromosome 16q24.3-linked HSP family are homozygous for a 9.5 kb deletion involving a gene encoding a novel protein, named Paraplegin. Two additional Paraplegin mutations, both resulting in a frameshift, were found in a complicated and in a pure form of HSP. Paraplegin is highly homologous to the yeast mitochondrial ATPases, AFG3, RCA1, and YME1, which have both proteolytic and chaperon-like activities at the inner mitochondrial membrane. Immunofluorescence analysis and import experiments showed that Paraplegin localizes to mitochondria. Analysis of muscle biopsies from two patients carrying Paraplegin mutations showed typical signs of mitochondrial OXPHOS defects, thus suggesting a mechanism for neurodegeneration in HSP-type disorders.

Clinical and Neurobehavioral Features of Three Novel Kabuki Syndrome Patients with Mosaic KMT2D Mutations and a Review of Literature

Directory of Open Access Journals (Sweden)

Francesca Romana Lepri

2017-12-01

Full Text Available Kabuki syndrome (KS is a rare disorder characterized by multiple congenital anomalies and variable intellectual disability caused by mutations in KMT2D/MLL2 and KDM6A/UTX, two interacting chromatin modifier responsible respectively for 56–75% and 5–8% of the cases. To date, three KS patients with mosaic KMT2D deletions in blood lymphocytes have been described. We report on three additional subjects displaying KMT2D gene mosaics including one in which a single nucleotide change results in a new frameshift mutation (p.L1199HfsX7, and two with already-known nonsense mutations (p.R4484X and p.R5021X. Consistent with previously published cases, mosaic KMT2D mutations may result in mild KS facial dysmorphisms and clinical and neurobehavioral features, suggesting that these characteristics could represent the handles for genetic testing of individuals with slight KS-like traits.

Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

Science.gov (United States)

Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

2017-08-01

Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

Ethnic disparity in 21-hydroxylase gene mutations identified in Pakistani congenital adrenal hyperplasia patients

Directory of Open Access Journals (Sweden)

Jabbar Abdul

2011-02-01

Full Text Available Abstract Background Congenital adrenal hyperplasia (CAH is a group of autosomal recessive disorders caused by defects in the steroid 21 hydroxylase gene (CYP21A2. We studied the spectrum of mutations in CYP21A2 gene in a multi-ethnic population in Pakistan to explore the genetics of CAH. Methods A cross sectional study was conducted for the identification of mutations CYP21A2 and their phenotypic associations in CAH using ARMS-PCR assay. Results Overall, 29 patients were analyzed for nine different mutations. The group consisted of two major forms of CAH including 17 salt wasters and 12 simple virilizers. There were 14 phenotypic males and 15 females representing all the major ethnic groups of Pakistan. Parental consanguinity was reported in 65% cases and was equally distributed in the major ethnic groups. Among 58 chromosomes analyzed, mutations were identified in 45 (78.6% chromosomes. The most frequent mutation was I2 splice (27% followed by Ile173Asn (26%, Arg 357 Trp (19%, Gln319stop, 16% and Leu308InsT (12%, whereas Val282Leu was not observed in this study. Homozygosity was seen in 44% and heterozygosity in 34% cases. I2 splice mutation was found to be associated with SW in the homozygous. The Ile173Asn mutation was identified in both SW and SV forms. Moreover, Arg357Trp manifested SW in compound heterozygous state. Conclusion Our study showed that CAH exists in our population with ethnic difference in the prevalence of mutations examined.

AIP mutations in young patients with acromegaly and the Tampico Giant: the Mexican experience.

Science.gov (United States)

Ramírez-Rentería, Claudia; Hernández-Ramírez, Laura C; Portocarrero-Ortiz, Lesly; Vargas, Guadalupe; Melgar, Virgilio; Espinosa, Etual; Espinosa-de-Los-Monteros, Ana Laura; Sosa, Ernesto; González, Baldomero; Zúñiga, Sergio; Unterländer, Martina; Burger, Joachim; Stals, Karen; Bussell, Anne-Marie; Ellard, Sian; Dang, Mary; Iacovazzo, Donato; Kapur, Sonal; Gabrovska, Plamena; Radian, Serban; Roncaroli, Federico; Korbonits, Márta; Mercado, Moisés

2016-08-01

Although aryl hydrocarbon receptor-interacting protein (AIP) mutations are rare in sporadic acromegaly, their prevalence among young patients is nonnegligible. The objectives of this study were to evaluate the frequency of AIP mutations in a cohort of Mexican patients with acromegaly with disease onset before the age of 30 and to search for molecular abnormalities in the AIP gene in teeth obtained from the "Tampico Giant". Peripheral blood DNA from 71 patients with acromegaly (51 females) with disease onset T (p.Arg304Ter), well-known truncating mutation was identified; in one of these two cases and her identical twin sister, the mutation proved to be a de novo event, since neither of their parents were found to be carriers. In the remaining three patients, new mutations were identified: a frameshift mutation (c.976_977insC, p.Gly326AfsTer), an in-frame deletion (c.872_877del, p.Val291_Leu292del) and a nonsense mutation (c.868A > T, p.Lys290Ter), which are predicted to be pathogenic based on in silico analysis. Patients with AIP mutations tended to have an earlier onset of acromegaly and harboured larger and more invasive tumours. A previously described genetic variant of unknown significance (c.869C > T, p.Ala299Val) was identified in DNA from the Tampico Giant. The prevalence of AIP mutations in young Mexican patients with acromegaly is similar to that of European cohorts. Our results support the need for genetic evaluation of patients with early onset acromegaly.

Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

Energy Technology Data Exchange (ETDEWEB)

Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

2014-02-15

Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

First de novo ANK3 nonsense mutation in a boy with intellectual disability, speech impairment and autistic features.

Science.gov (United States)

Kloth, Katja; Denecke, Jonas; Hempel, Maja; Johannsen, Jessika; Strom, Tim M; Kubisch, Christian; Lessel, Davor

2017-09-01

Ankyrin-G, encoded by ANK3, plays an important role in neurodevelopment and neuronal function. There are multiple isoforms of Ankyrin-G resulting in differential tissue expression and function. Heterozygous missense mutations in ANK3 have been associated with autism spectrum disorder. Further, in three siblings a homozygous frameshift mutation affecting only the longest isoform and a patient with a balanced translocation disrupting all isoforms were documented. The latter four patients were affected by a variable degree of intellectual disability, attention deficit hyperactivity disorder and autism. Here, we report on a boy with speech impairment, intellectual disability, autistic features, macrocephaly, macrosomia, chronic hunger and an altered sleeping pattern. By trio-whole-exome sequencing, we identified the first de novo nonsense mutation affecting all ANK3 transcripts. Thus, our data expand the phenotype of ANK3-associated diseases and suggest an isoform-based, phenotypic continuum between dominant and recessive ANK3-associated pathologies. Copyright © 2017. Published by Elsevier Masson SAS.

Germline PMS2 mutation screened by mismatch repair protein immunohistochemistry of colorectal cancer in Japan.

Science.gov (United States)

Sugano, Kokichi; Nakajima, Takeshi; Sekine, Shigeki; Taniguchi, Hirokazu; Saito, Shinya; Takahashi, Masahiro; Ushiama, Mineko; Sakamoto, Hiromi; Yoshida, Teruhiko

2016-11-01

Germline PMS2 gene mutations were detected by RT-PCR/direct sequencing of total RNA extracted from puromycin-treated peripheral blood lymphocytes (PBL) and multiplex ligation-dependent probe amplification (MLPA) analyses of Japanese patients with colorectal cancer (CRC) fulfilling either the revised Bethesda Guidelines or being an age at disease onset of younger than 70 years, and screened by mismatch repair protein immunohistochemistry of formalin-fixed paraffin embedded sections. Of the 501 subjects examined, 7 (1.40%) showed the downregulated expression of the PMS2 protein alone and were referred to the genetic counseling clinic. Germline PMS2 mutations were detected in 6 (85.7%), including 3 nonsense and 1 frameshift mutations by RT-PCR/direct sequencing and 2 genomic deletions by MLPA. No mutations were identified in the other MMR genes (i.e. MSH2, MLH1 and MSH6). The prevalence of the downregulated expression of the PMS2 protein alone was 1.40% among the subjects examined and IHC results predicted the presence of PMS2 germline mutations. RT-PCR from puromycin-treated PBL and MLPA may be employed as the first screening step to detect PMS2 mutations without pseudogene interference, followed by the long-range PCR/nested PCR validation using genomic DNA. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

The mutator pathway is a feature of immunodeficiency-related lymphomas

Science.gov (United States)

Duval, Alex; Raphael, Martine; Brennetot, Caroline; Poirel, Helene; Buhard, Olivier; Aubry, Alban; Martin, Antoine; Krimi, Amor; Leblond, Veronique; Gabarre, Jean; Davi, Frederic; Charlotte, Frederic; Berger, Francoise; Gaidano, Gianluca; Capello, Daniela; Canioni, Danielle; Bordessoule, Dominique; Feuillard, Jean; Gaulard, Philippe; Delfau, Marie Helene; Ferlicot, Sophie; Eclache, Virginie; Prevot, Sophie; Guettier, Catherine; Lefevre, Pascale Cornillet; Adotti, Francoise; Hamelin, Richard

2004-01-01

The mutator phenotype caused by defects in the mismatch repair system is observed in a subset of solid neoplasms characterized by widespread microsatellite instability-high (MSI-H). It is known to be very rare in non-Hodgkin lymphomas (NHL), whereas mutator NHL is the most frequent tumor subtype in mismatch repair-deficient mice. By screening a series of 603 human NHL with specific markers of the mutator phenotype, we found here 12 MSI-H cases (12/603, 2%). Of interest, we demonstrated that this phenotype was specifically associated with immunodeficiency-related lymphomas (ID-RL), because it was observed in both posttransplant lymphoproliferative disorders (9/111, 8.1%) and HIV infection-related lymphomas (3/128, 2.3%) but not in a large series of NHL arising in the general population (0/364) (P < 0.0001). The MSI pathway is known to lead to the production of hundreds of abnormal protein neoantigens that are generated in MSI-H neoplasms by frameshift mutations of a number of genes containing coding microsatellite sequences. As expected, MSI-H ID-RL were found to harbor such genetic alterations in 12 target genes with a putative role in lymphomagenesis. The observation that the MSI-H phenotype was restricted to HIV infection-related lymphomas and posttransplant lymphoproliferative disorders suggests the existence of the highly immunogenic mutator pathway as a novel oncogenic process in lymphomagenesis whose role is favored when host immunosurveillance is reduced. Because MSI-H-positive cases were found to be either Epstein-Barr virus-positive or -negative, the mutator pathway should act synergistically or not with this other oncogenic factor, playing an important role in ID-RL. PMID:15047891

Köln's unstable hemoglobin: case report and literature review Hemoglobina instável de Köln: relato de caso e revisão de literatura

Directory of Open Access Journals (Sweden)

Sandra Pscheidt

2003-01-01

Full Text Available Unstable hemoglobins are a group of genetic variants of hemoglobins caused by the mutation of amino acids into alpha and beta globins and, depending on the points and types of mutation, the result can vary from no clinical symptomatology to severe hemolytic anemia. On the present report, we study the case of a female patient who showed a very exuberant hematological picture for the red series, which suggests hemoglobinic changes; this was confirmed following the conduction of the protocol established by Laboratório Médico Santa Luzia for the study of hemoglobinopathies and which was then sent for a reference laboratory: C.D.A. Naoun Laboratórios de Análises ClínicasAs hemoglobinas instáveis constituem um grupo de variantes genéticas de hemoglobinas causadas pela mutação de aminoácidos nas globinas alfa e beta e, dependendo dos pontos e dos tipos de mutações ocorridos, o resultado pode ser de nenhuma sintomatologia clínica até anemias hemolíticas graves. No presente relato, estudamos o caso de uma paciente que apresentava um quadro hematológico de série vermelha bastante exuberante, sugestivo de alteração hemoglobínica, o que foi confirmado após realização do protocolo estabelecido pelo Laboratório Médico Santa Luzia para estudo de hemoglobinopatias e posteriormente enviado para o laboratório de referência C.D.A. Naoun Laboratórios de Análises Clínicas.

Novel and recurrent mutations of WISP3 in two Chinese families with progressive pseudorheumatoid dysplasia.

Directory of Open Access Journals (Sweden)

Jing Sun

Full Text Available BACKGROUND: The WNT1-inducible signaling pathway protein 3 (WISP3, which belongs to the CCN (cysteine-rich protein 61, connective tissue growth factor, nephroblastoma overexpressed family, is a secreted cysteine-rich matricellular protein that is involved in chondrogenesis, osteogenesis and tumorigenesis. WISP3 gene mutations are associated with progressive pseudorheumatoid dysplasia (PPD, OMIM208230, an autosomal recessive genetic disease that is characterized by the swelling of multiple joints and disproportionate dwarfism. METHODOLOGY/PRINCIPAL FINDINGS: Four PPD patients from two unrelated Chinese families were recruited for this study. The clinical diagnosis was confirmed by medical history, physical examinations, laboratory results and radiological abnormalities. WISP3 mutations were detected by direct DNA sequence analysis. In total, four different mutations were identified, which consisted of two missense mutations, one deletion and one insertion that spanned exons 3, 5 and 6 of the WISP3 gene. One of the missense mutations (c.342T>G/p.C114W and a seven-base pair frameshift deletion (c.716_722del/p.E239fs*16 were novel. The other missense mutation (c.1000T>C/p. S334P and the insertion mutation (c.866_867insA/p.Q289fs*31 had previously been identified in Chinese patients. All four cases had a compound heterozygous status, and their parents were heterozygous carriers of these mutations. CONCLUSIONS/SIGNIFICANCE: The results of our study expand the spectrum of WISP3 mutations that are associated with PPD and further elucidate the function of WISP3.

A frameshift variant of CYP2C8 was identified in a patient who suffered from rhabdomyolysis after administration of cerivastatin.

Science.gov (United States)

Ishikawa, Chikako; Ozaki, Hiroshi; Nakajima, Toshiaki; Ishii, Toshihiro; Kanai, Saburo; Anjo, Saeko; Shirai, Kohji; Inoue, Ituro

2004-01-01

A hypercholesterolemic patient medicated with cerivastatin for 22 days resulted in acute rhabdomyolysis. CYP2C8 and CYP3A4 are the major enzymes responsible for the metabolism of cerivastatin, and a transporter, OATP2, contributes to uptake of cerivastatin to the liver. In this study, the patient's DNA was sequenced in order to identify a variant that would lead to the adverse effect of cerivastatin. Three nucleotide variants, 475delA, G874C, and T1551C, were found in the exons of CYP2C8. The patient was homozygous for 475delA variant that leads to frameshift and premature termination. Accordingly, the patient is most likely lacking the enzyme activity. The patient's children were both heterozygous for the mutation. The patient had three nucleotide variants in exon 4 (A388G) and exon 5 (C571T and C597T) of OATP2 that were all heterozygous. No nucleotide variation in the exons of CYP3A4 was identified. To our knowledge, this is the first report showing that the adverse effect of cerivastatin might be caused by the genetic variant of CYP2C8.

Case Report: Exome sequencing reveals recurrent RETSAT mutations and a loss-of-function POLDIP2 mutation in a rare undifferentiated tongue sarcoma [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Jason Y. K. Chan

2018-04-01

Full Text Available Soft tissue sarcoma of the tongue represents a very rare head and neck cancer with connective tissue features, and the genetics underlying this rare cancer are largely unknown. There are less than 20 cases reported in the literature thus far. Here, we reported the first whole-exome characterization (>×200 depth of an undifferentiated sarcoma of the tongue in a 31-year-old male. Even with a very good sequencing depth, only 19 nonsynonymous mutations were found, indicating a relatively low mutation rate of this rare cancer (lower than that of human papillomavirus (HPV-positive head and neck cancer. Yet, among the few genes that are somatically mutated in this HPV-negative undifferentiated tongue sarcoma, a noticeable deleterious frameshift mutation (with a very high allele frequency of >93% of a gene for DNA replication and repair, namely POLDIP2 (DNA polymerase delta interacting protein 2, and two recurrent mutations of the adipogenesis and adipocyte differentiation gene RETSAT (retinol saturase, were identified. Thus, somatic events likely affecting adipogenesis and differentiation, as well as potential stem mutations to POLDIP2, may be implicated in the formation of this rare cancer. This identified somatic whole-exome sequencing profile appears to be distinct from that of other reported adult sarcomas from The Cancer Genome Atlas, suggesting a potential unique genetic profile for this rare sarcoma of the tongue. Interestingly, this low somatic mutation rate is unexpectedly found to be accompanied by multiple tumor protein p53 and NOTCH1 germline mutations of the patient’s blood DNA. This may explain the very early age of onset of head and neck cancer, with likely hereditary predisposition. Our findings are, to our knowledge, the first to reveal a unique genetic profile of this very rare undifferentiated sarcoma of the tongue.

Proton nuclear magnetic resonance studies on bulge-containing DNA oligonucleotides from a mutational hot-spot sequence

International Nuclear Information System (INIS)

Woodson, S.A.; Crothers, D.M.

1987-01-01

A series of bulge-containing and normal double-helical synthetic oligodeoxyribonucleotides, of sequence corresponding to a frame-shift mutational hot spot in the λ C/sub I/ gene, are compared by proton magnetic resonance spectroscopy at 500 MHz. The imino proton resonances are assigned by one-dimensional nuclear Overhauser effect spectroscopy. Nonselective T 1 inversion-recovery experiments are used to determine exchangeable proton lifetimes and to compare helix stability and dynamics of the three duplexes. An extra adenosine flanking the internal G-C base pairs has a strongly localized effect on helix stability, but the destabilizing effect of an extra cytidine in a C tract is delocalized over the entire G-C run. These data lead to the conclusion that the position of the bulge migrates along the run in the fast-exchange limit on the NMR time scale. Rapid migration of the bulge defect in homopolymeric sequences may help rationalize both frame-shift mutagenesis and translational frame shifting. The authors estimate that the unfavorable free energy of a localized bulge defect is 2.9-3.2 kcal/mol, in good agreement with earlier estimates for RNA helices

Phenotype/genotype correlation in a case series of Stargardt's patients identifies novel mutations in the ABCA4 gene.

Science.gov (United States)

Gemenetzi, M; Lotery, A J

2013-11-01

To investigate phenotypic variability in terms of best-corrected visual acuity (BCVA) in patients with Stargardt disease (STGD) and confirmed ABCA4 mutations. Entire coding region analysis of the ABCA4 gene by direct sequencing of seven patients with clinical findings of STGD seen in the Retina Clinics of Southampton Eye Unit between 2002 and 2011.Phenotypic variables recorded were BCVA, fluorescein angiographic appearance, electrophysiology, and visual fields. All patients had heterozygous amino acid-changing variants (missense mutations) in the ABCA4 gene. A splice sequence change was found in a 30-year-old patient with severly affected vision. Two novel sequence changes were identified: a missense mutation in a mildly affected 44-year-old patient and a frameshift mutation in a severly affected 34-year-old patient. The identified ABCA4 mutations were compatible with the resulting phenotypes in terms of BCVA. Higher BCVAs were recorded in patients with missense mutations. Sequence changes, predicted to have more deleterious effect on protein function, resulted in a more severe phenotype. This case series of STGD patients demonstrates novel genotype/phenotype correlations, which may be useful to counselling of patients. This information may prove useful in selection of candidates for clinical trials in ABCA4 disease.

MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

Directory of Open Access Journals (Sweden)

D. S. Mikhaylenko

2016-01-01

Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

Homozygous ARHGEF2 mutation causes intellectual disability and midbrain-hindbrain malformation.

Directory of Open Access Journals (Sweden)

Ethiraj Ravindran

2017-04-01

Full Text Available Mid-hindbrain malformations can occur during embryogenesis through a disturbance of transient and localized gene expression patterns within these distinct brain structures. Rho guanine nucleotide exchange factor (ARHGEF family members are key for controlling the spatiotemporal activation of Rho GTPase, to modulate cytoskeleton dynamics, cell division, and cell migration. We identified, by means of whole exome sequencing, a homozygous frameshift mutation in the ARHGEF2 as a cause of intellectual disability, a midbrain-hindbrain malformation, and mild microcephaly in a consanguineous pedigree of Kurdish-Turkish descent. We show that loss of ARHGEF2 perturbs progenitor cell differentiation and that this is associated with a shift of mitotic spindle plane orientation, putatively favoring more symmetric divisions. The ARHGEF2 mutation leads to reduction in the activation of the RhoA/ROCK/MLC pathway crucial for cell migration. We demonstrate that the human brain malformation is recapitulated in Arhgef2 mutant mice and identify an aberrant migration of distinct components of the precerebellar system as a pathomechanism underlying the midbrain-hindbrain phenotype. Our results highlight the crucial function of ARHGEF2 in human brain development and identify a mutation in ARHGEF2 as novel cause of a neurodevelopmental disorder.

DMD Mutations in 576 Dystrophinopathy Families: A Step Forward in Genotype-Phenotype Correlations.

Directory of Open Access Journals (Sweden)

Jonas Juan-Mateu

Full Text Available Recent advances in molecular therapies for Duchenne muscular dystrophy (DMD require precise genetic diagnosis because most therapeutic strategies are mutation-specific. To understand more about the genotype-phenotype correlations of the DMD gene we performed a comprehensive analysis of the DMD mutational spectrum in a large series of families. Here we provide the clinical, pathological and genetic features of 576 dystrophinopathy patients. DMD gene analysis was performed using the MLPA technique and whole gene sequencing in blood DNA and muscle cDNA. The impact of the DNA variants on mRNA splicing and protein functionality was evaluated by in silico analysis using computational algorithms. DMD mutations were detected in 576 unrelated dystrophinopathy families by combining the analysis of exonic copies and the analysis of small mutations. We found that 471 of these mutations were large intragenic rearrangements. Of these, 406 (70.5% were exonic deletions, 64 (11.1% were exonic duplications, and one was a deletion/duplication complex rearrangement (0.2%. Small mutations were identified in 105 cases (18.2%, most being nonsense/frameshift types (75.2%. Mutations in splice sites, however, were relatively frequent (20%. In total, 276 mutations were identified, 85 of which have not been previously described. The diagnostic algorithm used proved to be accurate for the molecular diagnosis of dystrophinopathies. The reading frame rule was fulfilled in 90.4% of DMD patients and in 82.4% of Becker muscular dystrophy patients (BMD, with significant differences between the mutation types. We found that 58% of DMD patients would be included in single exon-exon skipping trials, 63% from strategies directed against multiexon-skipping exons 45 to 55, and 14% from PTC therapy. A detailed analysis of missense mutations provided valuable information about their impact on the protein structure.

Identification of novel mutations in Chinese Hans with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Yu Chaowen

2011-12-01

Full Text Available Abstract Background Autosomal dominant polycystic kidney disease (ADPKD is the most common inherited renal disease with an incidence of 1 in 400 to 1000. The disease is genetically heterogeneous, with two genes identified: PKD1 (16p13.3 and PKD2 (4q21. Molecular diagnosis of the disease in at-risk individuals is complicated due to the structural complexity of PKD1 gene and the high diversity of the mutations. This study is the first systematic ADPKD mutation analysis of both PKD1 and PKD2 genes in Chinese patients using denaturing high-performance liquid chromatography (DHPLC. Methods Both PKD1 and PKD2 genes were mutation screened in each proband from 65 families using DHPLC followed by DNA sequencing. Novel variations found in the probands were checked in their family members available and 100 unrelated normal controls. Then the pathogenic potential of the variations of unknown significance was examined by evolutionary comparison, effects of amino acid substitutions on protein structure, and effects of splice site alterations using online mutation prediction resources. Results A total of 92 variations were identified, including 27 reported previously. Definitely pathogenic mutations (ten frameshift, ten nonsense, two splicing defects and one duplication were identified in 28 families, and probably pathogenic mutations were found in an additional six families, giving a total detection level of 52.3% (34/65. About 69% (20/29 of the mutations are first reported with a recurrent mutation rate of 31%. Conclusions Mutation study of PKD1 and PKD2 genes in Chinese Hans with ADPKD may contribute to a better understanding of the genetic diversity between different ethnic groups and enrich the mutation database. Besides, evaluating the pathogenic potential of novel variations should also facilitate the clinical diagnosis and genetic counseling of the disease.

Functional analysis of the novel TBX5 c.1333delC mutation resulting in an extended TBX5 protein

Directory of Open Access Journals (Sweden)

Ekman-Joelsson Britt-Marie

2008-10-01

Full Text Available Abstract Background Autosomal dominant Holt-Oram syndrome (HOS is caused by mutations in the TBX5 gene and is characterized by congenital heart and preaxial radial ray upper limb defects. Most of the TBX5 mutations found in patients with HOS cause premature truncation of the primary TBX5 transcript. TBX5 missense mutations alter the three-dimensional structure of the protein and result in failed nuclear localization or reduced binding to target DNA. In this study we present our functional analyses of the novel and unusual c.1333delC mutation found in a patient with classical HOS. Methods The functional impact of this novel mutation was assessed by investigating the intracellular localization of the resulting TBX5 protein and its ability to activate the expression of its downstream target ANF. Results The deletion of the cytosine is the first TBX5 frameshift mutation predicted to result in an elongated TBX5 protein with 74 miscoding amino acids and 62 supernumerary C-terminal amino acids. The c.1333delC mutation affects neither the nuclear localization, nor its colocalization with SALL4, but severely affects the activation of the ANF promoter. Conclusion The mutation c.1333delC does not locate within functional domains, but impairs the activation of the downstream target. This suggests that misfolding of the protein prevents its biological function.

CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.

Directory of Open Access Journals (Sweden)

Ewa Ziętkiewicz

Full Text Available Cystic fibrosis (CF is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR. In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone. The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported

A case of early onset rectal cancer of Lynch syndrome with a novel deleterious PMS2 mutation.

Science.gov (United States)

Nomura, Sachio; Fujimoto, Yoshiya; Yamamoto, Noriko; Sato, Yuri; Ashihara, Yuumi; Kita, Mizuho; Yamaguchi, Junya; Ishikawa, Yuichi; Ueno, Masashi; Arai, Masami

2015-10-01

Heterozygous deleterious mutation of the PMS2 gene is a cause of Lynch syndrome, an autosomal dominant cancer disease. However, the frequency of PMS2 mutation is rare compared with that of the other causative genes; MSH2, MLH1 and MSH6. PMS2 mutation has so far only been reported once from a Japanese facility. Detection of PMS2 mutation is relatively complicated due to the existence of 15 highly homologous pseudogenes, and its gene conversion event with the pseudogene PMS2CL. Therefore, for PMS2 mutation analysis, it is crucial to clearly distinguish PMS2 from its pseudogenes. We report here a novel deleterious 11 bp deletion mutation of exon 11 of PMS2 distinguished from PMS2CL in a 34-year-old Japanese female with rectal cancer. PMS2 mutated at c.1492del11 results in a truncated 500 amino acid protein rather than the wild-type protein of 862 amino acids. This is supported by the fact that, although there is usually concordance between MLH1 and PMS2 expression, cells were immunohistochemically positive for MLH1, whereas PMS2 could not be immunohistochemically stained using an anti-C-terminal PMS2 antibody, or effective PMS2 mRNA degradation with NMD caused by the frameshift mutation. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Impact of two myostatin (MSTN mutations on weight gain and lamb carcass classification in Norwegian White Sheep (Ovis aries

Directory of Open Access Journals (Sweden)

Blichfeldt Thor

2010-01-01

Full Text Available Abstract Background Our aim was to estimate the effect of two myostatin (MSTN mutations in Norwegian White Sheep, one of which is close to fixation in the Texel breed. Methods The impact of two known MSTN mutations was examined in a field experiment with Norwegian White Sheep. The joint effect of the two MSTN mutations on live weight gain and weaning weight was studied on 644 lambs. Carcass weight gain from birth to slaughter, carcass weight, carcass conformation and carcass fat classes were calculated in a subset of 508 lambs. All analyses were carried out with a univariate linear animal model. Results The most significant impact of both mutations was on conformation and fat classes. The largest difference between the genotype groups was between the wild type for both mutations and the homozygotes for the c.960delG mutation. Compared to the wild types, these mutants obtained a conformation score 5.1 classes higher and a fat score 3.0 classes lower, both on a 15-point scale. Conclusions Both mutations reduced fatness and increased muscle mass, although the effect of the frameshift mutation (c.960delG was more important as compared to the 3'-UTR mutation (c.2360G>A. Lambs homozygous for the c.960delG mutation grew more slowly than those with other MSTN genotypes, but had the least fat and the largest muscle mass. Only c.960delG showed dominance effects.

Spectrum of SMPD1 mutations in Asian-Indian patients with acid sphingomyelinase (ASM)-deficient Niemann-Pick disease.

Science.gov (United States)

Ranganath, Prajnya; Matta, Divya; Bhavani, Gandham SriLakshmi; Wangnekar, Savita; Jain, Jamal Mohammed Nurul; Verma, Ishwar C; Kabra, Madhulika; Puri, Ratna Dua; Danda, Sumita; Gupta, Neerja; Girisha, Katta M; Sankar, Vaikom H; Patil, Siddaramappa J; Ramadevi, Akella Radha; Bhat, Meenakshi; Gowrishankar, Kalpana; Mandal, Kausik; Aggarwal, Shagun; Tamhankar, Parag Mohan; Tilak, Preetha; Phadke, Shubha R; Dalal, Ashwin

2016-10-01

Acid sphingomyelinase (ASM)-deficient Niemann-Pick disease is an autosomal recessive lysosomal storage disorder caused by biallelic mutations in the SMPD1 gene. To date, around 185 mutations have been reported in patients with ASM-deficient NPD world-wide, but the mutation spectrum of this disease in India has not yet been reported. The aim of this study was to ascertain the mutation profile in Indian patients with ASM-deficient NPD. We sequenced SMPD1 in 60 unrelated families affected with ASM-deficient NPD. A total of 45 distinct pathogenic sequence variants were found, of which 14 were known and 31 were novel. The variants included 30 missense, 4 nonsense, and 9 frameshift (7 single base deletions and 2 single base insertions) mutations, 1 indel, and 1 intronic duplication. The pathogenicity of the novel mutations was inferred with the help of the mutation prediction software MutationTaster, SIFT, Polyphen-2, PROVEAN, and HANSA. The effects of the identified sequence variants on the protein structure were studied using the structure modeled with the help of the SWISS-MODEL workspace program. The p. (Arg542*) (c.1624C>T) mutation was the most commonly identified mutation, found in 22% (26 out of 120) of the alleles tested, but haplotype analysis for this mutation did not identify a founder effect for the Indian population. To the best of our knowledge, this is the largest study on mutation analysis of patients with ASM-deficient Niemann-Pick disease reported in literature and also the first study on the SMPD1 gene mutation spectrum in India. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Convergent Evolution of Slick Coat in Cattle through Truncation Mutations in the Prolactin Receptor

Directory of Open Access Journals (Sweden)

Laercio R. Porto-Neto

2018-02-01

Full Text Available Evolutionary adaptations are occasionally convergent solutions to the same problem. A mutation contributing to a heat tolerance adaptation in Senepol cattle, a New World breed of mostly European descent, results in the distinct phenotype known as slick, where an animal has shorter hair and lower follicle density across its coat than wild type animals. The causal variant, located in the 11th exon of prolactin receptor, produces a frameshift that results in a truncated protein. However, this mutation does not explain all cases of slick coats found in criollo breeds. Here, we obtained genome sequences from slick cattle of a geographically distinct criollo breed, namely Limonero, whose ancestors were originally brought to the Americas by the Spanish. These data were used to identify new causal alleles in the 11th exon of the prolactin receptor, two of which also encode shortened proteins that remove a highly conserved tyrosine residue. These new mutations explained almost 90% of investigated cases of animals that had slick coats, but which also did not carry the Senepol slick allele. These results demonstrate convergent evolution at the molecular level in a trait important to the adaptation of an animal to its environment.

De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II.

Science.gov (United States)

Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan

2014-06-01

Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

Energy Technology Data Exchange (ETDEWEB)

Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

2012-07-13

Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

International Nuclear Information System (INIS)

Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

2012-01-01

Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

Identification of a de novo mutation of SOX10 in a Chinese patient with Waardenburg syndrome type IV.

Science.gov (United States)

Liang, Fenghe; Zhao, Min; Fan, Lynn; Zhang, Hongyan; Shi, Yang; Han, Rui; Qu, Chunyan

2016-12-01

Waardenburg syndrome is a rare genetic disorder, characterized by the association of sensorineural hearing loss and pigmentation abnormalities. Four subtypes have been classified. The present study aimed to analyze the clinical feature and investigate the genetic cause for a Chinese case of Waardenburg type IV (WS4). The patient and his family members were subjected to mutation detection in the candidate gene SOX10 by Sanger sequencing. The patient has the clinical features of WS4, including sensorineural hearing loss, bright blue irides, premature graying of the hair and Hirschsprung disease. A novel heterozygous frameshift mutation, c.752_753ins7 (p.Gly252Alafs*31) in the exon 5 of SOX10 was detected in the patient, but not found in the unaffected family members and 100 normal controls. This mutation results in a premature stop codon 31 amino acid downstream. The novel mutation c.752_753ins7 (p.Gly252Alafs*31) arose de novo and was considered as the cause of WS4 in the proband. This study further characterized the molecular complexity of WS4 and provided a clinical case for genotype-phenotype correlation studies of different phenotypes caused by SOX10 mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A patient with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and severe hypoganglionosis associated with a novel SOX10 mutation.

Science.gov (United States)

Akutsu, Yuko; Shirai, Kentaro; Takei, Akira; Goto, Yudai; Aoyama, Tomohiro; Watanabe, Akimitu; Imamura, Masatoshi; Enokizono, Takashi; Ohto, Tatsuyuki; Hori, Tetsuo; Suzuki, Keiko; Hayashi, Masaharu; Masumoto, Kouji; Inoue, Ken

2018-05-01

In this report, we present the case of a female infant with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease (PCWH) associated with a novel frameshift mutation (c.842dupT) in exon 5, the last exon of SOX10. She had severe hypoganglionosis in the small intestine and entire colon, and suffered from frequent enterocolitis. The persistence of ganglion cells made both the diagnosis and treatment difficult in the neonatal period. She also showed hypopigmentation of the irises, hair and skin, bilateral sensorineural deafness with hypoplastic inner year, severe demyelinating neuropathy with hypotonia, and diffuse brain hypomyelination. The p.Ser282GlnfsTer12 mutation presumably escapes from nonsense-mediated decay and may generate a dominant-negative effect. We suggest that hypoganglionosis can be a variant intestinal manifestation associated with PCWH and that hypoganglionosis and aganglionosis may share the same pathoetiological mechanism mediated by SOX10 mutations. © 2018 Wiley Periodicals, Inc.

A novel del(8)(q23.2q24.11) contributing to disease progression in a case of JAK2/TET2 double mutated chronic myelomonocytic leukemia

DEFF Research Database (Denmark)

Toft-Petersen, Marie; Kjeldsen, Eigil; Nederby, Line

2014-01-01

We have identified a novel 7.7 Mb del(8)(q23.2q24.11) in a patient progressing to acute myeloid leukemia (AML) following a 12-year stable phase of chronic myelomonocytic leukemia (CMML). A surprisingly high JAK2+ allelic burden of 92% at the time of AML led us to delineate the molecular aberrations...... relevant for leukemogenesis. While a frameshift mutation in the TET2 gene was stably present throughout the course of disease the JAK2 mutation was acquired after initial diagnosis of CMML. At progression aCGH revealed del(8q)(q23.2q24.11) encompassing various cancer relevant genes of which RAD21 and CSMD3...

Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations.

Science.gov (United States)

Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela

2011-03-01

Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.

The FH mutation database: an online database of fumarate hydratase mutations involved in the MCUL (HLRCC tumor syndrome and congenital fumarase deficiency

Directory of Open Access Journals (Sweden)

Tomlinson Ian PM

2008-03-01

Full Text Available Abstract Background Fumarate hydratase (HGNC approved gene symbol – FH, also known as fumarase, is an enzyme of the tricarboxylic acid (TCA cycle, involved in fundamental cellular energy production. First described by Zinn et al in 1986, deficiency of FH results in early onset, severe encephalopathy. In 2002, the Multiple Leiomyoma Consortium identified heterozygous germline mutations of FH in patients with multiple cutaneous and uterine leiomyomas, (MCUL: OMIM 150800. In some families renal cell cancer also forms a component of the complex and as such has been described as hereditary leiomyomatosis and renal cell cancer (HLRCC: OMIM 605839. The identification of FH as a tumor suppressor was an unexpected finding and following the identification of subunits of succinate dehydrogenase in 2000 and 2001, was only the second description of the involvement of an enzyme of intermediary metabolism in tumorigenesis. Description The FH mutation database is a part of the TCA cycle gene mutation database (formerly the succinate dehydrogenase gene mutation database and is based on the Leiden Open (source Variation Database (LOVD system. The variants included in the database were derived from the published literature and annotated to conform to current mutation nomenclature. The FH database applies HGVS nomenclature guidelines, and will assist researchers in applying these guidelines when directly submitting new sequence variants online. Since the first molecular characterization of an FH mutation by Bourgeron et al in 1994, a series of reports of both FH deficiency patients and patients with MCUL/HLRRC have described 107 variants, of which 93 are thought to be pathogenic. The most common type of mutation is missense (57%, followed by frameshifts & nonsense (27%, and diverse deletions, insertions and duplications. Here we introduce an online database detailing all reported FH sequence variants. Conclusion The FH mutation database strives to systematically

A deep intronic CLRN1 (USH3A) founder mutation generates an aberrant exon and underlies severe Usher syndrome on the Arabian Peninsula.

Science.gov (United States)

Khan, Arif O; Becirovic, Elvir; Betz, Christian; Neuhaus, Christine; Altmüller, Janine; Maria Riedmayr, Lisa; Motameny, Susanne; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno J

2017-05-03

Deafblindness is mostly due to Usher syndrome caused by recessive mutations in the known genes. Mutation-negative patients therefore either have distinct diseases, mutations in yet unknown Usher genes or in extra-exonic parts of the known genes - to date a largely unexplored possibility. In a consanguineous Saudi family segregating Usher syndrome type 1 (USH1), NGS of genes for Usher syndrome, deafness and retinal dystrophy and subsequent whole-exome sequencing each failed to identify a mutation. Genome-wide linkage analysis revealed two small candidate regions on chromosome 3, one containing the USH3A gene CLRN1, which has never been associated with Usher syndrome in Saudi Arabia. Whole-genome sequencing (WGS) identified a homozygous deep intronic mutation, c.254-649T > G, predicted to generate a novel donor splice site. CLRN1 minigene-based analysis confirmed the splicing of an aberrant exon due to usage of this novel motif, resulting in a frameshift and a premature termination codon. We identified this mutation in an additional two of seven unrelated mutation-negative Saudi USH1 patients. Locus-specific markers indicated that c.254-649T > G CLRN1 represents a founder allele that may significantly contribute to deafblindness in this population. Our finding underlines the potential of WGS to uncover atypically localized, hidden mutations in patients who lack exonic mutations in the known disease genes.

A mutational signature reveals alterations underlying deficient homologous recombination repair in breast cancer.

Science.gov (United States)

Polak, Paz; Kim, Jaegil; Braunstein, Lior Z; Karlic, Rosa; Haradhavala, Nicholas J; Tiao, Grace; Rosebrock, Daniel; Livitz, Dimitri; Kübler, Kirsten; Mouw, Kent W; Kamburov, Atanas; Maruvka, Yosef E; Leshchiner, Ignaty; Lander, Eric S; Golub, Todd R; Zick, Aviad; Orthwein, Alexandre; Lawrence, Michael S; Batra, Rajbir N; Caldas, Carlos; Haber, Daniel A; Laird, Peter W; Shen, Hui; Ellisen, Leif W; D'Andrea, Alan D; Chanock, Stephen J; Foulkes, William D; Getz, Gad

2017-10-01

Biallelic inactivation of BRCA1 or BRCA2 is associated with a pattern of genome-wide mutations known as signature 3. By analyzing ∼1,000 breast cancer samples, we confirmed this association and established that germline nonsense and frameshift variants in PALB2, but not in ATM or CHEK2, can also give rise to the same signature. We were able to accurately classify missense BRCA1 or BRCA2 variants known to impair homologous recombination (HR) on the basis of this signature. Finally, we show that epigenetic silencing of RAD51C and BRCA1 by promoter methylation is strongly associated with signature 3 and, in our data set, was highly enriched in basal-like breast cancers in young individuals of African descent.

Hot-spot KIF5A mutations cause familial ALS

Science.gov (United States)

Yilmaz, Rüstem; Müller, Kathrin; Grehl, Torsten; Petri, Susanne; Meyer, Thomas; Grosskreutz, Julian; Weydt, Patrick; Ruf, Wolfgang; Neuwirth, Christoph; Weber, Markus; Pinto, Susana; Claeys, Kristl G; Schrank, Berthold; Jordan, Berit; Knehr, Antje; Günther, Kornelia; Hübers, Annemarie; Zeller, Daniel; Kubisch, Christian; Jablonka, Sibylle; Klopstock, Thomas; de Carvalho, Mamede; Sperfeld, Anne; Borck, Guntram; Volk, Alexander E; Dorst, Johannes; Weis, Joachim; Otto, Markus; Schuster, Joachim; Del Tredici, Kelly; Braak, Heiko; Danzer, Karin M; Freischmidt, Axel; Meitinger, Thomas; Strom, Tim M; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H; Weyen, Ute; Hermann, Andreas; Hagenacker, Tim; Koch, Jan Christoph; Lingor, Paul; Göricke, Bettina; Zierz, Stephan; Baum, Petra; Wolf, Joachim; Winkler, Andrea; Young, Peter; Bogdahn, Ulrich; Prudlo, Johannes; Kassubek., Jan

2018-01-01

Abstract Heterozygous missense mutations in the N-terminal motor or coiled-coil domains of the kinesin family member 5A (KIF5A) gene cause monogenic spastic paraplegia (HSP10) and Charcot-Marie-Tooth disease type 2 (CMT2). Moreover, heterozygous de novo frame-shift mutations in the C-terminal domain of KIF5A are associated with neonatal intractable myoclonus, a neurodevelopmental syndrome. These findings, together with the observation that many of the disease genes associated with amyotrophic lateral sclerosis disrupt cytoskeletal function and intracellular transport, led us to hypothesize that mutations in KIF5A are also a cause of amyotrophic lateral sclerosis. Using whole exome sequencing followed by rare variant analysis of 426 patients with familial amyotrophic lateral sclerosis and 6137 control subjects, we detected an enrichment of KIF5A splice-site mutations in amyotrophic lateral sclerosis (2/426 compared to 0/6137 in controls; P = 4.2 × 10−3), both located in a hot-spot in the C-terminus of the protein and predicted to affect splicing exon 27. We additionally show co-segregation with amyotrophic lateral sclerosis of two canonical splice-site mutations in two families. Investigation of lymphoblast cell lines from patients with KIF5A splice-site mutations revealed the loss of mutant RNA expression and suggested haploinsufficiency as the most probable underlying molecular mechanism. Furthermore, mRNA sequencing of a rare non-synonymous missense mutation (predicting p.Arg1007Gly) located in the C-terminus of the protein shortly upstream of the splice donor of exon 27 revealed defective KIF5A pre-mRNA splicing in respective patient-derived cell lines owing to abrogation of the donor site. Finally, the non-synonymous single nucleotide variant rs113247976 (minor allele frequency = 1.00% in controls, n = 6137), also located in the C-terminal region [p.(Pro986Leu) in exon 26], was significantly enriched in familial amyotrophic lateral sclerosis patients (minor

Four novel germline mutations in the MLH1 and PMS2 mismatch repair genes in patients with hereditary nonpolyposis colorectal cancer.

Science.gov (United States)

Montazer Haghighi, Mahdi; Radpour, Ramin; Aghajani, Katayoun; Zali, Narges; Molaei, Mahsa; Zali, Mohammad Reza

2009-08-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is the most common cause of early onset hereditary colorectal cancer. In the majority of HNPCC families, microsatellite instability (MSI) and germline mutation in one of the DNA mismatch repair (MMR) genes are found. The entire coding sequence of MMR genes (MLH1, MLH2, MLH6, and PMS2) was analyzed using direct sequencing. Also, tumor tests were done as MSI and immunohistochemistry testing. We were able to find three novel MLH1 and one novel PMS2 germline mutations in three Iranian HNPCC patients. The first was a transversion mutation c.346A>C (T116P) and happened in the highly conserved HATPase-c region of MLH1 protein. The second was a transversion mutation c.736A>T (I246L), which caused an amino acid change of isoleucine to leucine. The third mutation (c.2145,6 delTG) was frameshift and resulted in an immature stop codon in five codons downstream. All of these three mutations were detected in the MLH1 gene. The other mutation was a transition mutation, c.676G>A (G207E), which has been found in exon six of the PMS2 gene and caused an amino acid change of glycine to glutamic acid. MSI assay revealed high instability in microsatellite for two patients and microsatellite stable for one patient. In all patients, an abnormal expression of the MMR proteins in HNPCC was related to the above novel mutations.

Hearing loss in a patient with the myopathic form of mitochondrial DNA depletion syndrome and a novel mutation in the TK2 gene.

Science.gov (United States)

Martí, Ramon; Nascimento, Andrés; Colomer, Jaume; Lara, Mari C; López-Gallardo, Ester; Ruiz-Pesini, Eduardo; Montoya, Julio; Andreu, Antoni L; Briones, Paz; Pineda, Mercè

2010-08-01

Mitochondrial DNA (mtDNA) depletion syndrome (MDS) is a devastating disorder of infancy caused by a significant reduction of the number of copies of mitochondrial DNA in one or more tissues. We report a Spanish patient with the myopathic form of MDS, harboring two mutations in the thymidine kinase 2 gene (TK2): a previously reported deletion (p.K244del) and a novel nucleotide duplication in the exon 2, generating a frameshift and premature stop codon. Sensorineural hearing loss was a predominant symptom in the patient and a novel feature of MDS due to TK2 mutations. The patient survived up to the age of 8.5 y, which confirms that survival above the age of 5 y is not infrequent in patients with MDS due to TK2 deficiency.

Mutations in pseudohypoparathyroidism 1a and pseudopseudohypoparathyroidism in ethnic Chinese.

Directory of Open Access Journals (Sweden)

Yi-Lei Wu

Full Text Available An inactivating mutation in the GNAS gene causes either pseudohypoparathyroidism 1a (PHP1A when it is maternally inherited or pseudopseudohypoparathyroidism (PPHP when it is paternally inherited. We investigated clinical manifestations and mutations of the GNAS gene in ethnic Chinese patients with PHP1A or PPHP. Seven patients from 5 families including 4 girls and 2 boys with PHP1A and 1 girl with PPHP were studied. All PHP1A patients had mental retardation. They were treated with calcitriol and CaCO3 with regular monitoring of serum Ca levels, urinary Ca/Cr ratios, and renal sonography. Among them, 5 patients also had primary hypothyroidism suggesting TSH resistance. One female patient had a renal stone which was treated with extracorporeal shockwave lithotripsy. She had an increased urinary Ca/Cr ratio of 0.481 mg/mg when the stone was detected. We detected mutations using PCR and sequencing as well as analysed a splice acceptor site mutation using RT-PCR, sequencing, and minigene construct. We detected 5 mutations: c.85C>T (Q29*, c.103C>T (Q35*, c.840-2A>G (R280Sfs*21, c.1027_1028delGA (D343*, and c.1174G>A (E392K. Mutations c.840-2A>G and c.1027_1028delGA were novel. The c.840-2A>G mutation at the splice acceptor site of intron 10 caused retention of intron 10 in the minigene construct but skipping of exon 11 in the peripheral blood cells. The latter was the most probable mechanism which caused a frameshift, changing Arg to Ser at residue 280 and invoking a premature termination of translation at codon 300 (R280Sfs*21. Five GNAS mutations in ethnic Chinese with PHP1A and PPHP were reported. Two of them were novel. Mutation c.840-2A>G destroyed a spice acceptor site and caused exon skipping. Regular monitoring and adjustment in therapy are mandatory to achieve optimal therapeutic effects and avoid nephrolithiasis in patients with PHP1A.

TP53 mutation and human papilloma virus status of oral squamous cell carcinomas in young adult patients.

Science.gov (United States)

Braakhuis, B J M; Rietbergen, M M; Buijze, M; Snijders, P J F; Bloemena, E; Brakenhoff, R H; Leemans, C R

2014-09-01

Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. TP53 mutations were determined with direct sequencing on paraffin-embedded carcinoma tissue from 31 young patients and compared with two older age OSCC reference groups: one from the same institute (N = 87) and an independent one (N = 675). Biologically active tumour HPV was detected by p16-immunohistochemistry followed by a HPV-DNA GP5 + /6 + -PCR. HPV16 was present in one OSCC (3%). TP53 mutations were found in 14 (45%) OSCC: five were missense and nine resulted in a truncated protein. Six of these latter were insertions or deletions of one or more nucleotides leading to frameshift, one was at a splice site and two resulted in a stop codon. The percentage of truncating mutations (64% of all mutations) was higher than that observed in the institute's reference group (44%, P = 0.23) and in the independent reference group (24%, P = 0.002). This study shows that TP53 mutations are common in OSCC of young adult patients; infection with biologically active HPV is rare. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Hepatitis C Virus Frameshift/Alternate Reading Frame Protein Suppresses Interferon Responses Mediated by Pattern Recognition Receptor Retinoic-Acid-Inducible Gene-I.

Directory of Open Access Journals (Sweden)

Seung Bum Park

Full Text Available Hepatitis C virus (HCV actively evades host interferon (IFN responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I (RIG-I-mediated IFN induction. Expression of frameshift/alternate reading frame protein (F/ARFP from HCV -2/+1 frame in Huh7 hepatoma cells suppressed type I IFN responses stimulated by HCV RNA pathogen-associated molecular pattern (PAMP and poly(IC. The suppression occurred independently of other HCV factors; and activation of interferon stimulated genes, TNFα, IFN-λ1, and IFN-λ2/3 was likewise suppressed by HCV F/ARFP. Point mutations in the full-length HCV sequence (JFH1 genotype 2a strain were made to introduce premature termination codons in the -2/+1 reading frame coding for F/ARFP while preserving the original reading frame, which enhanced IFNα and IFNβ induction by HCV. The potentiation of IFN response by the F/ARFP mutations was diminished in Huh7.5 cells, which already have a defective RIG-I, and by decreasing RIG-I expression in Huh7 cells. Furthermore, adding F/ARFP back via trans-complementation suppressed IFN induction in the F/ARFP mutant. The F/ARFP mutants, on the other hand, were not resistant to exogenous IFNα. Finally, HCV-infected human liver samples showed significant F/ARFP antibody reactivity, compared to HCV-uninfected control livers. Therefore, HCV F/ARFP likely cooperates with other viral factors to suppress type I and III IFN induction occurring through the RIG-I signaling pathway. This study identifies a novel mechanism of pattern recognition receptor modulation by HCV and suggests a biological function of the HCV alternate reading frame in the modulation of host innate immunity.

instU_3d_asm_Cp: MERRA 3D IAU State, Meteorology Diurnal 1.25 x 1.25 degree V5.2.0 (MAIUCPASM) at GES DISC

Data.gov (United States)

National Aeronautics and Space Administration — The MAIUCPASM or instU_3d_asm_Cp data product is the MERRA Data Assimilation System 3-Dimensional assimilated state on pressure, at a reduced resolution. It is a...

CDH23 mutation and phenotype heterogeneity: a profile of 107 diverse families with Usher syndrome and nonsyndromic deafness.

Science.gov (United States)

Astuto, L M; Bork, J M; Weston, M D; Askew, J W; Fields, R R; Orten, D J; Ohliger, S J; Riazuddin, S; Morell, R J; Khan, S; Riazuddin, S; Kremer, H; van Hauwe, P; Moller, C G; Cremers, C W R J; Ayuso, C; Heckenlively, J R; Rohrschneider, K; Spandau, U; Greenberg, J; Ramesar, R; Reardon, W; Bitoun, P; Millan, J; Legge, R; Friedman, T B; Kimberling, W J

2002-08-01

Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP-like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia.

CDH23 Mutation and Phenotype Heterogeneity: A Profile of 107 Diverse Families with Usher Syndrome and Nonsyndromic Deafness

Science.gov (United States)

Astuto, L. M.; Bork, J. M.; Weston, M. D.; Askew, J. W.; Fields, R. R.; Orten, D. J.; Ohliger, S. J.; Riazuddin, S.; Morell, R. J.; Khan, S.; Riazuddin, S.; Kremer, H.; van Hauwe, P.; Moller, C. G.; Cremers, C. W. R. J.; Ayuso, C.; Heckenlively, J. R.; Rohrschneider, K.; Spandau, U.; Greenberg, J.; Ramesar, R.; Reardon, W.; Bitoun, P.; Millan, J.; Legge, R.; Friedman, T. B.; Kimberling, W. J.

2002-01-01

Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP–like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia. PMID:12075507

Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

Science.gov (United States)

Rong, Weining; Chen, Xue; Zhao, Kanxing; Liu, Yani; Liu, Xiaoxing; Ha, Shaoping; Liu, Wenzhou; Kang, Xiaoli; Sheng, Xunlun; Zhao, Chen

2014-01-01

Usher syndrome (USH) is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS) approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

Directory of Open Access Journals (Sweden)

Weining Rong

Full Text Available Usher syndrome (USH is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

umuC-mediated misrepair mutagenesis in Escherichia coli: Extent and specificity of SOS mutagenesis

International Nuclear Information System (INIS)

Shinoura, Y.; Ise, T.; Kato, T.; Glickman, B.W.

1983-01-01

The role of the error-prone misrepair pathway in mutagenesis was examined for a series of mutagens in umuC + and umuC36 strains of Escherichia coli. Mutagenesis by ENU, MNU, MNNG and EMS was independent of the umuC + gene function, while mutagenesis by MMS, 4NQO, γ-rays and UV was largely umuC + -dependent. Residual mutagenesis following UV-treatment of a umuC - strain showed the same mutational specificity seen in the umuC + strain. In contrast, the umuC mutation altered specificity substantially in an excision-repair-defective strain that showed a UV-spectrum strikingly different from that seen in an excision-repair-proficient strain. Only one of nine trpE frameshift mutations examined was reverted by UV-light and its reversion was umuC-dependent. In comparison, the dependence of frameshift mutagenesis following ICR191 treatment was site-specific, suggesting at least two mechanisms of frameshift mutagenesis, one dependent upon misrepair, the other not. (orig./AJ)

Mismatch repair deficiency commonly precedes adenoma formation in Lynch Syndrome-Associated colorectal tumorigenesis.

Science.gov (United States)

Sekine, Shigeki; Mori, Taisuke; Ogawa, Reiko; Tanaka, Masahiro; Yoshida, Hiroshi; Taniguchi, Hirokazu; Nakajima, Takeshi; Sugano, Kokichi; Yoshida, Teruhiko; Kato, Mamoru; Furukawa, Eisaku; Ochiai, Atsushi; Hiraoka, Nobuyoshi

2017-08-01

Lynch syndrome is a cancer predisposition syndrome caused by germline mutations in mismatch repair (MMR) genes. MMR deficiency is a ubiquitous feature of Lynch syndrome-associated colorectal adenocarcinomas; however, it remains unclear when the MMR-deficient phenotype is acquired during tumorigenesis. To probe this issue, the present study examined genetic alterations and MMR statuses in Lynch syndrome-associated colorectal adenomas and adenocarcinomas, in comparison with sporadic adenomas. Among the Lynch syndrome-associated colorectal tumors, 68 of 86 adenomas (79%) and all adenocarcinomas were MMR-deficient, whereas all the sporadic adenomas were MMR-proficient, as determined by microsatellite instability testing and immunohistochemistry for MMR proteins. Sequencing analyses identified APC or CTNNB1 mutations in the majority of sporadic adenomas (58/84, 69%) and MMR-proficient Lynch syndrome-associated adenomas (13/18, 72%). However, MMR-deficient Lynch syndrome-associated adenomas had less APC or CTNNB1 mutations (25/68, 37%) and frequent frameshift RNF43 mutations involving mononucleotide repeats (45/68, 66%). Furthermore, frameshift mutations affecting repeat sequences constituted 14 of 26 APC mutations (54%) in MMR-deficient adenomas whereas these frameshift mutations were rare in MMR-proficient adenomas in patients with Lynch syndrome (1/12, 8%) and in sporadic adenomas (3/52, 6%). Lynch syndrome-associated adenocarcinomas exhibited mutation profiles similar to those of MMR-deficient adenomas. Considering that WNT pathway activation sufficiently drives colorectal adenoma formation, the distinct mutation profiles of WNT pathway genes in Lynch syndrome-associated adenomas suggest that MMR deficiency commonly precedes adenoma formation.

De novo FBXO11 mutations are associated with intellectual disability and behavioural anomalies.

Science.gov (United States)

Fritzen, Daniel; Kuechler, Alma; Grimmel, Mona; Becker, Jessica; Peters, Sophia; Sturm, Marc; Hundertmark, Hela; Schmidt, Axel; Kreiß, Martina; Strom, Tim M; Wieczorek, Dagmar; Haack, Tobias B; Beck-Wödl, Stefanie; Cremer, Kirsten; Engels, Hartmut

2018-05-01

Intellectual disability (ID) has an estimated prevalence of 1.5-2%. In most affected individuals, its genetic basis remains unclear. Whole exome sequencing (WES) studies have identified a multitude of novel causative gene defects and have shown that a large proportion of sporadic ID cases results from de novo mutations. Here, we present two unrelated individuals with similar clinical features and deleterious de novo variants in FBXO11 detected by WES. Individual 1, a 14-year-old boy, has mild ID as well as mild microcephaly, corrected cleft lip and alveolus, hyperkinetic disorder, mild brain atrophy and minor facial dysmorphism. WES detected a heterozygous de novo 1 bp insertion in the splice donor site of exon 3. Individual 2, a 3-year-old boy, showed ID and pre- and postnatal growth retardation, postnatal mild microcephaly, hyperkinetic and restless behaviour, as well as mild dysmorphism. WES detected a heterozygous de novo frameshift mutation. While ten individuals with ID and de novo variants in FBXO11 have been reported as part of larger studies, only one of the reports has some additional clinical data. Interestingly, the latter individual carries the identical mutation as our individual 2 and also displays ID, intrauterine growth retardation, microcephaly, behavioural anomalies, and dysmorphisms. Thus, we confirm deleterious de novo mutations in FBXO11 as a cause of ID and start the delineation of the associated clinical picture which may also comprise postnatal microcephaly or borderline small head size and behavioural anomalies.

Rediscovery by Whole Genome Sequencing: Classical Mutations and Genome Polymorphisms in Neurospora crassa

Energy Technology Data Exchange (ETDEWEB)

McCluskey, Kevin; Wiest, Aric E.; Grigoriev, Igor V.; Lipzen, Anna; Martin, Joel; Schackwitz, Wendy; Baker, Scott E.

2011-06-02

Classical forward genetics has been foundational to modern biology, and has been the paradigm for characterizing the role of genes in shaping phenotypes for decades. In recent years, reverse genetics has been used to identify the functions of genes, via the intentional introduction of variation and subsequent evaluation in physiological, molecular, and even population contexts. These approaches are complementary and whole genome analysis serves as a bridge between the two. We report in this article the whole genome sequencing of eighteen classical mutant strains of Neurospora crassa and the putative identification of the mutations associated with corresponding mutant phenotypes. Although some strains carry multiple unique nonsynonymous, nonsense, or frameshift mutations, the combined power of limiting the scope of the search based on genetic markers and of using a comparative analysis among the eighteen genomes provides strong support for the association between mutation and phenotype. For ten of the mutants, the mutant phenotype is recapitulated in classical or gene deletion mutants in Neurospora or other filamentous fungi. From thirteen to 137 nonsense mutations are present in each strain and indel sizes are shown to be highly skewed in gene coding sequence. Significant additional genetic variation was found in the eighteen mutant strains, and this variability defines multiple alleles of many genes. These alleles may be useful in further genetic and molecular analysis of known and yet-to-be-discovered functions and they invite new interpretations of molecular and genetic interactions in classical mutant strains.

Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

Science.gov (United States)

Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

1998-01-01

Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

TP53 mutations in serous tubal intraepithelial carcinoma and concurrent pelvic high-grade serous carcinoma—evidence supporting the clonal relationship of the two lesions

Science.gov (United States)

Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming

2016-01-01

Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and ‘primary peritoneal’ (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. PMID:21990067

Whole-exome sequencing, without prior linkage, identifies a mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta.

Science.gov (United States)

Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

2014-01-01

The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.

Exome Capture and Massively Parallel Sequencing Identifies a Novel HPSE2 Mutation in a Saudi Arabian Child with Ochoa (Urofacial) Syndrome

Science.gov (United States)

Al Badr, Wisam; Al Bader, Suha; Otto, Edgar; Hildebrandt, Friedhelm; Ackley, Todd; Peng, Weiping; Xu, Jishu; Li, Jun; Owens, Kailey M.; Bloom, David; Innis, Jeffrey W.

2011-01-01

We describe a child of Middle Eastern descent by first-cousin mating with idiopathic neurogenic bladder and high grade vesicoureteral reflux at 1 year of age, whose characteristic facial grimace led to the diagnosis of Ochoa (Urofacial) syndrome at age 5 years. We used homozygosity mapping, exome capture and paired end sequencing to identify the disease causing mutation in the proband. We reviewed the literature with respect to the urologic manifestations of Ochoa syndrome. A large region of marker homozygosity was observed at 10q24, consistent with known autosomal recessive inheritance, family consanguinity and previous genetic mapping in other families with Ochoa syndrome. A homozygous mutation was identified in the proband in HPSE2: c.1374_1378delTGTGC, a deletion of 5 nucleotides in exon 10 that is predicted to lead to a frameshift followed by replacement of 132 C-terminal amino acids with 153 novel amino acids (p.Ala458Alafsdel132ins153). This mutation is novel relative to very recently published mutations in HPSE2 in other families. Early intervention and recognition of Ochoa syndrome with control of risk factors and close surveillance will decrease complications and renal failure. PMID:21450525

Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome.

Science.gov (United States)

Amiel, Jeanne; Laudier, Béatrice; Attié-Bitach, Tania; Trang, Ha; de Pontual, Loïc; Gener, Blanca; Trochet, Delphine; Etchevers, Heather; Ray, Pierre; Simonneau, Michel; Vekemans, Michel; Munnich, Arnold; Gaultier, Claude; Lyonnet, Stanislas

2003-04-01

Congenital central hypoventilation syndrome (CCHS or Ondine's curse; OMIM 209880) is a life-threatening disorder involving an impaired ventilatory response to hypercarbia and hypoxemia. This core phenotype is associated with lower-penetrance anomalies of the autonomic nervous system (ANS) including Hirschsprung disease and tumors of neural-crest derivatives such as ganglioneuromas and neuroblastomas. In mice, the development of ANS reflex circuits is dependent on the paired-like homeobox gene Phox2b. Thus, we regarded its human ortholog, PHOX2B, as a candidate gene in CCHS. We found heterozygous de novo mutations in PHOX2B in 18 of 29 individuals with CCHS. Most mutations consisted of 5-9 alanine expansions within a 20-residue polyalanine tract probably resulting from non-homologous recombination. We show that PHOX2B is expressed in both the central and the peripheral ANS during human embryonic development. Our data support an essential role of PHOX2B in the normal patterning of the autonomous ventilation system and, more generally, of the ANS in humans.

Kallmann syndrome: 14 novel mutations in KAL1 and FGFR1 (KAL2).

Science.gov (United States)

Albuisson, Juliette; Pêcheux, Chistophe; Carel, Jean-Claude; Lacombe, Didier; Leheup, Bruno; Lapuzina, Pablo; Bouchard, Philippe; Legius, Eric; Matthijs, Gert; Wasniewska, Malgorzata; Delpech, Marc; Young, Jacques; Hardelin, Jean-Pierre; Dodé, Catherine

2005-01-01

Kallmann syndrome (KAL) combines hypogonadotropic hypogonadism and anosmia. Hypogonadism is due to Gonadotropin Releasing Hormone (GnRH) deficiency and anosmia is related to hypoplasia of the olfactory bulbs. Occasional symptoms include renal agenesis, bimanual synkinesia, cleft lip palate, dental agenesis. KAL is genetically heterogeneous and two genes have so far been identified, namely KAL1 (Xp22.3) and FGFR1/KAL2 (8p12), which underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. We studied a cohort of 98 unrelated Caucasian KAL patients. We identified KAL1 mutations in 14 patients, of which 7 (c.3G>A (p.M1?), g.IVS1+1G>T, c.570_571insA (p.R191fsX14), c.784G>C (p.R262P), c.958G>T (p.E320X), c.1651_1654delinsAGCT (p.P551_E552delinsSX), c.1711T>A (p.W571R)) have not been previously reported. In addition, we found FGFR1 mutations in 7 patients, namely c.303G>A (p.V102I), C.385A>C (p.D129A), c.810G>A (p.V273M), c.1093_1094delAG (p.R365fsX41), c.1561G>A (p.A520T), c.1836_1837insT (p.Y613fsX42), c.2190C>G (p.Y730X), all of which were novel mutations. In this study, unilateral renal agenesis and bimanual synkinesia were exclusively found associated with KAL1mutations, cleft palate and dental agenesia with FGFR1mutations. (c) 2004 Wiley-Liss, Inc.

CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

Science.gov (United States)

Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

2015-10-01

A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

Novel Munc13–4 mutations in children and young adult patients with haemophagocytic lymphohistiocytosis

Science.gov (United States)

Santoro, A; Cannella, S; Bossi, G; Gallo, F; Trizzino, A; Pende, D; Dieli, F; Bruno, G; Stinchcombe, J C; Micalizzi, C; De Fusco, C; Danesino, C; Moretta, L; Notarangelo, L D; Griffiths, G M; Aricò, M

2006-01-01

Familial haemophagocytic lymphohistiocytosis (FHL) is a genetically heterogeneous disorder characterised by constitutive defects in cellular cytotoxicity resulting in fever, hepatosplenomegaly and cytopenia, and the outcome is fatal unless treated by chemoimmunotherapy followed by haematopoietic stem‐cell transplantation. Since 1999, mutations in the perforin gene giving rise to this disease have been identified; however, these account only for 40% of cases. Lack of a genetic marker hampers the diagnosis, suitability for transplantation, selection of familial donors, identification of carriers, genetic counselling and prenatal diagnosis. Mutations in the Munc13–4 gene have recently been described in patients with FHL. We sequenced the Munc13–4 gene in all patients with haemophagocytic lymphohistiocytosis not due to PRF1 mutations. In 15 of the 30 families studied, 12 novel and 4 known Munc13–4 mutations were found, spread throughout the gene. Among novel mutations, 2650C→T introduced a stop codon; 441del A, 532del C, 3082del C and 3226ins G caused a frameshift, and seven were mis sense mutations. Median age of diagnosis was 4 months, but six patients developed the disease after 5 years of age and one as a young adult of 18 years. Involvement of central nervous system was present in 9 of 15 patients, activity of natural killer cells was markedly reduced or absent in 13 of 13 tested patients. Chemo‐immunotherapy was effective in all patients. Munc13–4 mutations were found in 15 of 30 patients with FHL without PRF1 mutations. Because these patients may develop the disease during adolescence or even later, haematologists should include FHL2 and FHL3 in the differential diagnosis of young adults with fever, cytopenia, splenomegaly and hypercytokinaemia. PMID:16825436

Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

Science.gov (United States)

Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

2014-01-01

Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

Inherited biallelic CSF3R mutations in severe congenital neutropenia.

Science.gov (United States)

Triot, Alexa; Järvinen, Päivi M; Arostegui, Juan I; Murugan, Dhaarini; Kohistani, Naschla; Dapena Díaz, José Luis; Racek, Tomas; Puchałka, Jacek; Gertz, E Michael; Schäffer, Alejandro A; Kotlarz, Daniel; Pfeifer, Dietmar; Díaz de Heredia Rubio, Cristina; Ozdemir, Mehmet Akif; Patiroglu, Turkan; Karakukcu, Musa; Sánchez de Toledo Codina, José; Yagüe, Jordi; Touw, Ivo P; Unal, Ekrem; Klein, Christoph

2014-06-12

Severe congenital neutropenia (SCN) is characterized by low numbers of peripheral neutrophil granulocytes and a predisposition to life-threatening bacterial infections. We describe a novel genetic SCN type in 2 unrelated families associated with recessively inherited loss-of-function mutations in CSF3R, encoding the granulocyte colony-stimulating factor (G-CSF) receptor. Family A, with 3 affected children, carried a homozygous missense mutation (NM_000760.3:c.922C>T, NP_000751.1:p.Arg308Cys), which resulted in perturbed N-glycosylation and aberrant localization to the cell surface. Family B, with 1 affected infant, carried compound heterozygous deletions provoking frameshifts and premature stop codons (NM_000760.3:c.948_963del, NP_000751.1:p.Gly316fsTer322 and NM_000760.3:c.1245del, NP_000751.1:p.Gly415fsTer432). Despite peripheral SCN, all patients had morphologic evidence of full myeloid cell maturation in bone marrow. None of the patients responded to treatment with recombinant human G-CSF. Our study highlights the genetic and morphologic SCN variability and provides evidence both for functional importance and redundancy of G-CSF receptor-mediated signaling in human granulopoiesis. © 2014 by The American Society of Hematology.

Novel mutations in the BRCA1 and BRCA2 genes in Iranian women with early-onset breast cancer

International Nuclear Information System (INIS)

Yassaee, Vahid R; Zeinali, Sirous; Harirchi, Iraj; Jarvandi, Soghra; Mohagheghi, Mohammad A; Hornby, David P; Dalton, Ann

2002-01-01

Breast cancer is the most common female malignancy and a major cause of death in middle-aged women. So far, germline mutations in the BRCA1 and BRCA2 genes in patients with early-onset breast and/or ovarian cancer have not been identified within the Iranian population. With the collaboration of two main centres for cancer in Iran, we obtained clinical information, family history and peripheral blood from 83 women under the age of 45 with early-onset breast cancer for scanning of germline mutations in the BRCA1 and BRCA2 genes. We analysed BRCA1 exons 11 and BRCA2 exons 10 and 11 by the protein truncation test, and BRCA1 exons 2, 3, 5, 13 and 20 and BRCA2 exons 9, 17, 18 and 23 with the single-strand conformation polymorphism assay on genomic DNA amplified by polymerase chain reaction. Ten sequence variants were identified: five frameshifts (putative mutations – four novel); three missense changes of unknown significance and two polymorphisms, one seen commonly in both Iranian and British populations. Identification of these novel mutations suggests that any given population should develop a mutation database for its programme of breast cancer screening. The pattern of mutations seen in the BRCA genes seems not to differ from other populations studied. Early-onset breast cancer (less than 45 years) and a limited family history is sufficient to justify mutation screening with a detection rate of over 25% in this group, whereas sporadic early-onset breast cancer (detection rate less than 5%) is unlikely to be cost-effective

Common pathological mutations in PQBP1 induce nonsense-mediated mRNA decay and enhance exclusion of the mutant exon.

Science.gov (United States)

Musante, Luciana; Kunde, Stella-Amrei; Sulistio, Tina O; Fischer, Ute; Grimme, Astrid; Frints, Suzanna G M; Schwartz, Charles E; Martínez, Francisco; Romano, Corrado; Ropers, Hans-Hilger; Kalscheuer, Vera M

2010-01-01

The polyglutamine binding protein 1 (PQBP1) gene plays an important role in X-linked mental retardation (XLMR). Nine of the thirteen PQBP1 mutations known to date affect the AG hexamer in exon 4 and cause frameshifts introducing premature termination codons (PTCs). However, the phenotype in this group of patients is variable. To investigate the pathology of these PQBP1 mutations, we evaluated their consequences on mRNA and protein expression. RT-PCRs revealed mutation-specific reduction of PQBP1 mRNAs carrying the PTCs that can be partially restored by blocking translation, thus indicating a role for the nonsense-mediated mRNA decay pathway. In addition, these mutations resulted in altered levels of PQBP1 transcripts that skipped exon 4, probably as a result of altering important splicing motifs via nonsense-associated altered splicing (NAS). This hypothesis is supported by transfection experiments using wild-type and mutant PQBP1 minigenes. Moreover, we show that a truncated PQBP1 protein is indeed present in the patients. Remarkably, patients with insertion/deletion mutations in the AG hexamer express significantly increased levels of a PQBP1 isoform, which is very likely encoded by the transcripts without exon 4, confirming the findings at the mRNA level. Our study provides significant insight into the early events contributing to the pathogenesis of the PQBP1 related XLMR disease.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

Structure-based analysis of five novel disease-causing mutations in 21-hydroxylase-deficient patients.

Directory of Open Access Journals (Sweden)

Carolina Minutolo

2011-01-01

Full Text Available Congenital adrenal hyperplasia (CAH due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism, and accounts for 90-95% of CAH cases. The affected enzyme, P450C21, is encoded by the CYP21A2 gene, located together with a 98% nucleotide sequence identity CYP21A1P pseudogene, on chromosome 6p21.3. Even though most patients carry CYP21A1P-derived mutations, an increasing number of novel and rare mutations in disease causing alleles were found in the last years. In the present work, we describe five CYP21A2 novel mutations, p.R132C, p.149C, p.M283V, p.E431K and a frameshift g.2511_2512delGG, in four non-classical and one salt wasting patients from Argentina. All novel point mutations are located in CYP21 protein residues that are conserved throughout mammalian species, and none of them were found in control individuals. The putative pathogenic mechanisms of the novel variants were analyzed in silico. A three-dimensional CYP21 structure was generated by homology modeling and the protein design algorithm FoldX was used to calculate changes in stability of CYP21A2 protein. Our analysis revealed changes in protein stability or in the surface charge of the mutant enzymes, which could be related to the clinical manifestation found in patients.

Alagille syndrome in a Vietnamese cohort: mutation analysis and assessment of facial features.

Science.gov (United States)

Lin, Henry C; Le Hoang, Phuc; Hutchinson, Anne; Chao, Grace; Gerfen, Jennifer; Loomes, Kathleen M; Krantz, Ian; Kamath, Binita M; Spinner, Nancy B

2012-05-01

Alagille syndrome (ALGS, OMIM #118450) is an autosomal dominant disorder that affects multiple organ systems including the liver, heart, eyes, vertebrae, and face. ALGS is caused by mutations in one of two genes in the Notch Signaling Pathway, Jagged1 (JAG1) or NOTCH2. In this study, analysis of 21 Vietnamese ALGS individuals led to the identification of 19 different mutations (18 JAG1 and 1 NOTCH2), 17 of which are novel, including the third reported NOTCH2 mutation in Alagille Syndrome. The spectrum of JAG1 mutations in the Vietnamese patients is similar to that previously reported, including nine frameshift, three missense, two splice site, one nonsense, two whole gene, and one partial gene deletion. The missense mutations are all likely to be disease causing, as two are loss of cysteines (C22R and C78G) and the third creates a cryptic splice site in exon 9 (G386R). No correlation between genotype and phenotype was observed. Assessment of clinical phenotype revealed that skeletal manifestations occur with a higher frequency than in previously reported Alagille cohorts. Facial features were difficult to assess and a Vietnamese pediatric gastroenterologist was only able to identify the facial phenotype in 61% of the cohort. To assess the agreement among North American dysmorphologists at detecting the presence of ALGS facial features in the Vietnamese patients, 37 clinical dysmorphologists evaluated a photographic panel of 20 Vietnamese children with and without ALGS. The dysmorphologists were unable to identify the individuals with ALGS in the majority of cases, suggesting that evaluation of facial features should not be used in the diagnosis of ALGS in this population. This is the first report of mutations and phenotypic spectrum of ALGS in a Vietnamese population. Copyright © 2012 Wiley Periodicals, Inc.

A mutational comparison of adult and adolescent and young adult (AYA) colon cancer.

Science.gov (United States)

Tricoli, James V; Boardman, Lisa A; Patidar, Rajesh; Sindiri, Sivasish; Jang, Jin S; Walsh, William D; McGregor, Paul M; Camalier, Corinne E; Mehaffey, Michele G; Furman, Wayne L; Bahrami, Armita; Williams, P Mickey; Lih, Chih-Jian; Conley, Barbara A; Khan, Javed

2018-03-01

It is possible that the relative lack of progress in treatment outcomes among adolescent and young adult (AYA) patients with cancer is caused by a difference in disease biology compared with the corresponding diseases in younger and older individuals. There is evidence that colon cancer is more aggressive and has a poorer prognosis in AYA patients than in older adult patients. To further understand the molecular basis for this difference, whole-exome sequencing was conducted on a cohort of 30 adult, 30 AYA, and 2 pediatric colon cancers. A statistically significant difference in mutational frequency was observed between AYA and adult samples in 43 genes, including ROBO1, MYC binding protein 2 (MYCBP2), breast cancer 2 (early onset) (BRCA2), MAP3K3, MCPH1, RASGRP3, PTCH1, RAD9B, CTNND1, ATM, NF1; KIT, PTEN, and FBXW7. Many of these mutations were nonsynonymous, missense, stop-gain, or frameshift mutations that were damaging. Next, RNA sequencing was performed on a subset of the samples to confirm the mutations identified by exome sequencing. This confirmation study verified the presence of a significantly greater frequency of damaging mutations in AYA compared with adult colon cancers for 5 of the 43 genes (MYCBP2, BRCA2, PHLPP1, TOPORS, and ATR). The current results provide the rationale for a more comprehensive study with a larger sample set and experimental validation of the functional impact of the identified variants along with their contribution to the biologic and clinical characteristics of AYA colon cancer. Cancer 2018;124:1070-82. © 2017 American Cancer Society. © 2017 American Cancer Society.

Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients.

Science.gov (United States)

Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J; Gerdes, Anne-Marie; Krogh, Lotte N; Bernstein, Inge; Okkels, Henrik; Wikman, Friedrik; Nielsen, Finn C; Hansen, Thomas V O

2013-10-03

Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic rearrangements. However, a large number of mutations, including missense, silent, and intronic variants, are classified as variants of unknown clinical significance. Intronic MLH1, MSH2, or MSH6 variants were investigated using in silico prediction tools and mini-gene assay to asses the effect on splicing. We describe in silico and in vitro characterization of nine intronic MLH1, MSH2, or MSH6 mutations identified in Danish colorectal cancer patients, of which four mutations are novel. The analysis revealed aberrant splicing of five mutations (MLH1 c.588 + 5G > A, MLH1 c.677 + 3A > T, MLH1 c.1732-2A > T, MSH2 c.1276 + 1G > T, and MSH2 c.1662-2A > C), while four mutations had no effect on splicing compared to wild type (MLH1 c.117-34A > T, MLH1 c.1039-8 T > A, MSH2 c.2459-18delT, and MSH6 c.3439-16C > T). In conclusion, we classify five MLH1/MSH2 mutations as pathogenic, whereas four MLH1/MSH2/MSH6 mutations are classified as neutral. This study supports the notion that in silico prediction tools and mini-gene assays are important for the classification of intronic variants, and thereby crucial for the genetic counseling of patients and their family members.

Functional characterization of two novel splicing mutations in the OCA2 gene associated with oculocutaneous albinism type II.

Science.gov (United States)

Rimoldi, Valeria; Straniero, Letizia; Asselta, Rosanna; Mauri, Lucia; Manfredini, Emanuela; Penco, Silvana; Gesu, Giovanni P; Del Longo, Alessandra; Piozzi, Elena; Soldà, Giulia; Primignani, Paola

2014-03-01

Oculocutaneous albinism (OCA) is characterized by hypopigmentation of the skin, hair and eye, and by ophthalmologic abnormalities caused by a deficiency in melanin biosynthesis. OCA type II (OCA2) is one of the four commonly-recognized forms of albinism, and is determined by mutation in the OCA2 gene. In the present study, we investigated the molecular basis of OCA2 in two siblings and one unrelated patient. The mutational screening of the OCA2 gene identified two hitherto-unknown putative splicing mutations. The first one (c.1503+5G>A), identified in an Italian proband and her affected sibling, lies in the consensus sequence of the donor splice site of OCA2 intron 14 (IVS14+5G>A), in compound heterozygosity with a frameshift mutation, c.1450_1451insCTGCCCTGACA, which is predicted to determine the premature termination of the polypeptide chain (p.I484Tfs*19). In-silico prediction of the effect of the IVS14+5G>A mutation on splicing showed a score reduction for the mutant splice site and indicated the possible activation of a newly-created deep-intronic acceptor splice site. The second mutation is a synonymous transition (c.2139G>A, p.K713K) involving the last nucleotide of exon 20. This mutation was found in a young African albino patient in compound heterozygosity with a previously-reported OCA2 missense mutation (p.T404M). In-silico analysis predicted that the mutant c.2139G>A allele would result in the abolition of the splice donor site. The effects on splicing of these two novel mutations were investigated using an in-vitro hybrid-minigene approach that led to the demonstration of the causal role of the two mutations and to the identification of aberrant transcript variants. Copyright © 2013 Elsevier B.V. All rights reserved.

A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

Directory of Open Access Journals (Sweden)

Garuti Rita

2010-10-01

Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

Holoprosencephaly: ZIC2 mutation in a case with panhypopituitarism.

Science.gov (United States)

Tasdemir, Sener; Sahin, Ibrahim; Cayır, Atilla; Doneray, Hakan; Solomon, Benjamin D; Muenke, Maximilian; Yuce, Ihsan; Tatar, Abdulgani

2014-07-01

Holoprosencephaly (HPE), the most common malformation of the brain, results from failed or incomplete separation of the embryonic forebrain (prosencephalon). HPE occurs in approximately 1 in 250 embryos and in about 1 in 10,000 births. It is etiologically heterogeneous, and may be caused by cytogenetic anomalies and teratogenic influences; it occurs as part of a syndrome, or due to heterozygous mutations in 1 of over 10 HPE-associated genes. ZIC2 mutations are the second-most common cause of non-syndromic non-chromosomal HPE (after sonic hedgehog) and occur de novo in 74% of the affected probands. The objective of the study was to describe the first case of ZIC2-related HPE with both anterior and posterior pituitary insufficiencies. We report about a 2-year-8-month-old boy who was born as a second child in a non-consanguineous healthy Turkish family. He has the characteristic ZIC2 phenotype: bitemporal narrowing, upslanting palpebral fissures, large ears, short nose with anteverted nares and broad and deep philtrum. Magnetic resonance imaging revealed alobar HPE. During laboratory investigation, his blood sodium level was 158 mmol/L and the specific gravity of his urine was 1.002. Serum osmolarity was 336 mOsm/L and urine osmolality was 135 mOsm/kg. His FT4 was 0.8 ng/dL and TSH was 0.79 mLU/mL. Response to vasopressin confirmed the diagnosis of central diabetes insipidus and TRH-stimulating test supported the central hypothyroidism. A frameshift mutation (NM_007129.2:c1091_1092 del, p.Gln364Leufs*2) in the ZIC2 gene was detected. Pituitary insufficiency other than isolated diabetes insipidus is a rare finding of HPE, and occurs most frequently in patients with GLI2 mutations (the phenotype of which typically does not include frank neuroanatomic anomalies such as HPE); ours is the only described patient with a ZIC2 mutation and both anterior and posterior pituitary dysfunction.

Coffin-Siris syndrome with café-au-lait spots, obesity and hyperinsulinism caused by a mutation in the ARID1B gene.

Science.gov (United States)

Sonmez, Fatma Mujgan; Uctepe, Eyyup; Gunduz, Mehmet; Gormez, Zeliha; Erpolat, Seval; Oznur, Murat; Sagiroglu, Mahmut Samil; Demirci, Huseyin; Gunduz, Esra

2016-08-01

Coffin-Siris syndrome (CSS) (MIM 135900) is characterized by developmental delay, severe speech impairment, distinctive facial features, hypertrichosis, aplasia or hypoplasia of the distal phalanx or nail of the fifth digit and agenesis of the corpus callosum. Recently, it was shown that mutations in the ARID1B gene are the main cause of CSS, accounting for 76% of identified mutations. Here, we report a 15 year-old female patient who was admitted to our clinic with seizures, speech problems, dysmorphic features, bilaterally big, large thumb, café-au-lait (CAL) spots, obesity and hyperinsulinism. First, the patient was thought to have an association of neurofibromatosis and Rubinstein Taybi syndrome. Because of the large size of the NF1 gene for neurofibromatosis and CREBBP gene for Rubinstein Taybi syndrome, whole exome sequence analysis (WES) was conducted and a novel ARID1B mutation was identified. The proband WES test identified a novel heterozygous frameshift mutation c.3394_3395insTA in exon 13 of ARID1B (NM_017519.2) predicting a premature stop codon p.(Tyr1132Leufs*67). Sanger sequencing confirmed the heterozygous c.3394_3395insTA mutation in the proband and that it was not present in her parents indicating de novo mutation. Further investigation and new cases will help to understand this phenomenon better.

p.H1069Q mutation in ATP7B and biochemical parameters of copper metabolism and clinical manifestation of Wilson's disease.

Science.gov (United States)

Gromadzka, Graznya; Schmidt, Harmut H J; Genschel, Janine; Bochow, Bettina; Rodo, M; Tarnacka, Beatek; Litwin, Thomas; Chabik, Grzegorz; Członkowska, Anna

2006-02-01

We compared the effect of the p.H1069Q mutation and other non-p.H1069Q mutations in ATP7B on the phenotypic expression of Wilson's disease (WD), and assessed whether the clinical phenotype of WD in compound heterozygotes depends on the type of mutation coexisting with the p.H1069Q. One hundred forty-two patients with clinically, biochemically, and genetically diagnosed WD were studied. The mutational analysis of ATP7B was performed by direct sequencing. A total number of 26 mutations in ATP7B were identified. The p.His1069Gln was the most common mutation (allelic frequency: 72%). Seventy-three patients were homozygous for this mutation. Of compound heterozygotes, 37 had frameshift/nonsense mutation, and 20 had other missense mutation on one of their ATP7B alleles. Twelve patients had two non-p.H1069Q mutations. Patients homozygous for the p.H1069Q mutation had the less severe disturbances of copper metabolism and the latest presentation of first WD symptoms. The most severely disturbed copper metabolism and the earliest age at initial disease manifestation was noticed in non-p.H1069Q patients. In compound heterozygotes, the type of mutation coexisting with the p.H1069Q to a small extent influenced WD phenotype. The phenotype of WD varied considerably among patients with the same genotype. The p.H1069Q mutation is associated with late WD manifestation and with a mild disruption of copper metabolism. In compound heterozygotes, the phenotype of WD to a small extent depends on the type of mutation coexisting with the p.H1069Q. Besides genotype, additional modifying factors seem to determine WD manifestations. Copyright (c) 2005 Movement Disorder Society.

Ultraviolet light protection, enhancement of ultraviolet light mutagenesis, and mutator effect of plasmid R46 in Salmonella typhimurium

International Nuclear Information System (INIS)

Mortelmans, K.E.; Stocker, B.A.D.

1976-01-01

Plasmid R46 partially protected Salmonella typhimurium, wild type or uvrB or polA, against the lethal effect of ultraviolet (uv) irradiation, but did not protect recA mutants. The plasmid also increased frequency of uv-induced reversion to His + in all tested his point mutants (wild type for uv sensitivity), including amber, ochre, UGA, missense, and frame-shift mutants. Plasmid R46 also increased uv-induced reversion to His + in uvrB and polA strains, but no uv mutagenic effect was detected in R - or R46-carrying recA derivatives of a his(amber) mutant. The spontaneous reversion frequency of his nonsense mutants of all classes, and of some his missense mutants, was increased about 10-fold when the strains carried R46, but the plasmid had no effect on the spontaneous reversion frequency of some other his missense mutations or of reversion rate of his frame-shift mutants (except for two uvrB derivatives of one single-base insertion mutant). The plasmid increased the ability of wild type, polA, and uvrB hosts to support plaque production by uv-irradiated phage, and made strain LT2 his G46 less sensitive to methyl methane sulfonate and to x rays and more responsive to the mutagenic effect of visible-light irradiation. R46 increased spontaneous reversion frequency of a his(amber) rec + strain, but had no such effect in its recA sublines. Since the plasmid in the absence of host recA function fails to produce its mutator effect, or to confer uv protection or to enhance uv mutagenesis, these three effects may be produced via some mechanism involved in recA-dependent deoxyribonucleic acid repair, perhaps by an increase in activity of the ''error-prone'' component of the inducible repair pathway

A Turkish family with Nance-Horan Syndrome due to a novel mutation.

Science.gov (United States)

Tug, Esra; Dilek, Nihal F; Javadiyan, Shahrbanou; Burdon, Kathryn P; Percin, Ferda E

2013-08-01

Nance-Horan Syndrome (NHS) is a rare X-linked syndrome characterized by congenital cataract which leads to profound vision loss, characteristic dysmorphic features and specific dental anomalies. Microcornea, microphthalmia and mild or moderate mental retardation may accompany these features. Heterozygous females often manifest similarly but with less severe features than affected males. We describe two brothers who have the NHS phenotype and their carrier mother who had microcornea but not cataract. We identified a previously unreported frameshift mutation (c.558insA) in exon 1 of the NHS gene in these patients and their mother which is predicted to result in the incorporation of 11 aberrant amino acids prior to a stop codon (p.E186Efs11X). We also discussed genotype-phenotype correlation according to relevant literature. Copyright © 2013 Elsevier B.V. All rights reserved.

Choline transporter mutations in severe congenital myasthenic syndrome disrupt transporter localization.

Science.gov (United States)

Wang, Haicui; Salter, Claire G; Refai, Osama; Hardy, Holly; Barwick, Katy E S; Akpulat, Ugur; Kvarnung, Malin; Chioza, Barry A; Harlalka, Gaurav; Taylan, Fulya; Sejersen, Thomas; Wright, Jane; Zimmerman, Holly H; Karakaya, Mert; Stüve, Burkhardt; Weis, Joachim; Schara, Ulrike; Russell, Mark A; Abdul-Rahman, Omar A; Chilton, John; Blakely, Randy D; Baple, Emma L; Cirak, Sebahattin; Crosby, Andrew H

2017-11-01

The presynaptic, high-affinity choline transporter is a critical determinant of signalling by the neurotransmitter acetylcholine at both central and peripheral cholinergic synapses, including the neuromuscular junction. Here we describe an autosomal recessive presynaptic congenital myasthenic syndrome presenting with a broad clinical phenotype due to homozygous choline transporter missense mutations. The clinical phenotype ranges from the classical presentation of a congenital myasthenic syndrome in one patient (p.Pro210Leu), to severe neurodevelopmental delay with brain atrophy (p.Ser94Arg) and extend the clinical outcomes to a more severe spectrum with infantile lethality (p.Val112Glu). Cells transfected with mutant transporter construct revealed a virtually complete loss of transport activity that was paralleled by a reduction in transporter cell surface expression. Consistent with these findings, studies to determine the impact of gene mutations on the trafficking of the Caenorhabditis elegans choline transporter orthologue revealed deficits in transporter export to axons and nerve terminals. These findings contrast with our previous findings in autosomal dominant distal hereditary motor neuropathy of a dominant-negative frameshift mutation at the C-terminus of choline transporter that was associated with significantly reduced, but not completely abrogated choline transporter function. Together our findings define divergent neuropathological outcomes arising from different classes of choline transporter mutation with distinct disease processes and modes of inheritance. These findings underscore the essential role played by the choline transporter in sustaining acetylcholine neurotransmission at both central and neuromuscular synapses, with important implications for treatment and drug selection. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Congenital sucrase-isomaltase deficiency: identification of a common Inuit founder mutation.

Science.gov (United States)

Marcadier, Julien L; Boland, Margaret; Scott, C Ronald; Issa, Kheirie; Wu, Zaining; McIntyre, Adam D; Hegele, Robert A; Geraghty, Michael T; Lines, Matthew A

2015-02-03

Congenital sucrase-isomaltase deficiency is a rare hereditary cause of chronic diarrhea in children. People with this condition lack the intestinal brush-border enzyme required for digestion of di- and oligosaccharides, including sucrose and isomaltose, leading to malabsorption. Although the condition is known to be highly prevalent (about 5%-10%) in several Inuit populations, the genetic basis for this has not been described. We sought to identify a common mutation for congenital sucrase-isomaltase deficiency in the Inuit population. We sequenced the sucrase-isomaltase gene, SI, in a single Inuit proband with congenital sucrase-isomaltase deficiency who had severe fermentative diarrhea and failure to thrive. We then genotyped a further 128 anonymized Inuit controls from a variety of locales in the Canadian Arctic to assess for a possible founder effect. In the proband, we identified a novel, homozygous frameshift mutation, c.273_274delAG (p.Gly92Leufs*8), predicted to result in complete absence of a functional protein product. This change was very common among the Inuit controls, with an observed allele frequency of 17.2% (95% confidence interval [CI] 12.6%-21.8%). The predicted Hardy-Weinberg prevalence of congenital sucrase-isomaltase deficiency in Inuit people, based on this single founder allele, is 3.0% (95% CI 1.4%-4.5%), which is comparable with previous estimates. We found a common mutation, SI c.273_274delAG, to be responsible for the high prevalence of congenital sucrase-isomaltase deficiency among Inuit people. Targeted mutation testing for this allele should afford a simple and minimally invasive means of diagnosing this condition in Inuit patients with chronic diarrhea. © 2015 Canadian Medical Association or its licensors.

TP53 mutations in serous tubal intraepithelial carcinoma and concurrent pelvic high-grade serous carcinoma--evidence supporting the clonal relationship of the two lesions.

Science.gov (United States)

Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming

2012-02-01

Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and 'primary peritoneal' (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Hot-spot KIF5A mutations cause familial ALS.

Science.gov (United States)

Brenner, David; Yilmaz, Rüstem; Müller, Kathrin; Grehl, Torsten; Petri, Susanne; Meyer, Thomas; Grosskreutz, Julian; Weydt, Patrick; Ruf, Wolfgang; Neuwirth, Christoph; Weber, Markus; Pinto, Susana; Claeys, Kristl G; Schrank, Berthold; Jordan, Berit; Knehr, Antje; Günther, Kornelia; Hübers, Annemarie; Zeller, Daniel; Kubisch, Christian; Jablonka, Sibylle; Sendtner, Michael; Klopstock, Thomas; de Carvalho, Mamede; Sperfeld, Anne; Borck, Guntram; Volk, Alexander E; Dorst, Johannes; Weis, Joachim; Otto, Markus; Schuster, Joachim; Del Tredici, Kelly; Braak, Heiko; Danzer, Karin M; Freischmidt, Axel; Meitinger, Thomas; Strom, Tim M; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H

2018-01-12

Heterozygous missense mutations in the N-terminal motor or coiled-coil domains of the kinesin family member 5A (KIF5A) gene cause monogenic spastic paraplegia (HSP10) and Charcot-Marie-Tooth disease type 2 (CMT2). Moreover, heterozygous de novo frame-shift mutations in the C-terminal domain of KIF5A are associated with neonatal intractable myoclonus, a neurodevelopmental syndrome. These findings, together with the observation that many of the disease genes associated with amyotrophic lateral sclerosis disrupt cytoskeletal function and intracellular transport, led us to hypothesize that mutations in KIF5A are also a cause of amyotrophic lateral sclerosis. Using whole exome sequencing followed by rare variant analysis of 426 patients with familial amyotrophic lateral sclerosis and 6137 control subjects, we detected an enrichment of KIF5A splice-site mutations in amyotrophic lateral sclerosis (2/426 compared to 0/6137 in controls; P = 4.2 × 10-3), both located in a hot-spot in the C-terminus of the protein and predicted to affect splicing exon 27. We additionally show co-segregation with amyotrophic lateral sclerosis of two canonical splice-site mutations in two families. Investigation of lymphoblast cell lines from patients with KIF5A splice-site mutations revealed the loss of mutant RNA expression and suggested haploinsufficiency as the most probable underlying molecular mechanism. Furthermore, mRNA sequencing of a rare non-synonymous missense mutation (predicting p.Arg1007Gly) located in the C-terminus of the protein shortly upstream of the splice donor of exon 27 revealed defective KIF5A pre-mRNA splicing in respective patient-derived cell lines owing to abrogation of the donor site. Finally, the non-synonymous single nucleotide variant rs113247976 (minor allele frequency = 1.00% in controls, n = 6137), also located in the C-terminal region [p.(Pro986Leu) in exon 26], was significantly enriched in familial amyotrophic lateral sclerosis patients (minor allele

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

Science.gov (United States)

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

CDKL5 gene status in female patients with epilepsy and Rett-like features: two new mutations in the catalytic domain.

Science.gov (United States)

Maortua, Hiart; Martínez-Bouzas, Cristina; Calvo, María-Teresa; Domingo, Maria-Rosario; Ramos, Feliciano; García-Ribes, Ainhoa; Martínez, María-Jesús; López-Aríztegui, María-Asunción; Puente, Nerea; Rubio, Izaskun; Tejada, María-Isabel

2012-08-06

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) located in the Xp22 region have been shown to cause a subset of atypical Rett syndrome with infantile spasms or early seizures starting in the first postnatal months. We performed mutation screening of CDKL5 in 60 female patients who had been identified as negative for the methyl CpG-binding protein 2 gene (MECP2) mutations, but who had current or past epilepsy, regardless of the age of onset, type, and severity. All the exons in the CDKL5 gene and their neighbouring sequences were examined, and CDKL5 rearrangements were studied by multiplex ligation-dependent probe amplification (MLPA). Six previously unidentified DNA changes were detected, two of which were disease-causing mutations in the catalytic domain: a frameshift mutation (c.509_510insGT; p.Glu170GlyfsX36) and a complete deletion of exon 10. Both were found in patients with seizures that started in the first month of life. This study demonstrated the importance of CDKL5 mutations as etiological factors in neurodevelopmental disorders, and indicated that a thorough analysis of the CDKL5 gene sequence and its rearrangements should be considered in females with Rett syndrome-like phenotypes, severe encephalopathy and epilepsy with onset before 5 months of age. This study also confirmed the usefulness of MLPA as a diagnostic screening method for use in clinical practice.

CDKL5 gene status in female patients with epilepsy and Rett-like features: two new mutations in the catalytic domain

Directory of Open Access Journals (Sweden)

Maortua Hiart

2012-08-01

Full Text Available Abstract Background Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5 located in the Xp22 region have been shown to cause a subset of atypical Rett syndrome with infantile spasms or early seizures starting in the first postnatal months. Methods We performed mutation screening of CDKL5 in 60 female patients who had been identified as negative for the methyl CpG-binding protein 2 gene (MECP2 mutations, but who had current or past epilepsy, regardless of the age of onset, type, and severity. All the exons in the CDKL5 gene and their neighbouring sequences were examined, and CDKL5 rearrangements were studied by multiplex ligation-dependent probe amplification (MLPA. Results Six previously unidentified DNA changes were detected, two of which were disease-causing mutations in the catalytic domain: a frameshift mutation (c.509_510insGT; p.Glu170GlyfsX36 and a complete deletion of exon 10. Both were found in patients with seizures that started in the first month of life. Conclusions This study demonstrated the importance of CDKL5 mutations as etiological factors in neurodevelopmental disorders, and indicated that a thorough analysis of the CDKL5 gene sequence and its rearrangements should be considered in females with Rett syndrome-like phenotypes, severe encephalopathy and epilepsy with onset before 5 months of age. This study also confirmed the usefulness of MLPA as a diagnostic screening method for use in clinical practice.

Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

Science.gov (United States)

Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

2014-01-01

Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are

Comunicação por impressos na saúde do trabalhador: a perspectiva das instâncias públicas

Directory of Open Access Journals (Sweden)

Kelly-Santos Adriana

2005-01-01

Full Text Available O artigo apresenta os resultados de uma pesquisa que investigou os processos comunicativos mediados por impressos (cartazes, fôlderes, cartilhas de instâncias públicas atuantes no binômio saúde-trabalho. Objetivamos oferecer subsídios teórico-metodológicos para que a Saúde do Trabalhador possa aprimorar as práticas comunicativas em curso. Realizamos a análise de 80 impressos produzidos por cinco instâncias e entrevistas com atores centrais de Programas de Saúde do Trabalhador. Verificamos que a segmentação do público é raramente abordada pelo pólo emissor, que discute simultaneamente uma série de temas, privilegiando sua própria perspectiva. As intenções do pólo emissor são as de informar o leitor sobre processo saúde-doença relacionado com o trabalho e orientá-lo quanto à adoção de procedimentos e comportamentos para promoção de saúde. Consideramos que o pólo emissor apresenta uma concepção instrumental de comunicação, fundamentada na transmissão de conhecimentos de forma linear e verticalizada. A saúde é discutida de maneira restrita reproduzindo os discursos dos modelos sanitário e biomédico. Concluímos que há uma tendência a utilizar os impressos como um fim, o que contribui para demarcar a distância entre os interlocutores no processo comunicativo mediado.

Loss of function mutations in EPHB4 are responsible for vein of Galen aneurysmal malformation.

Science.gov (United States)

Vivanti, Alexandre; Ozanne, Augustin; Grondin, Cynthia; Saliou, Guillaume; Quevarec, Loic; Maurey, Helène; Aubourg, Patrick; Benachi, Alexandra; Gut, Marta; Gut, Ivo; Martinovic, Jelena; Sénat, Marie Victoire; Tawk, Marcel; Melki, Judith

2018-04-01

See Meschia (doi:10.1093/brain/awy066) for a scientific commentary on this article.Vein of Galen aneurysmal malformation is a congenital anomaly of the cerebral vasculature representing 30% of all paediatric vascular malformations. We conducted whole exome sequencing in 19 unrelated patients presenting this malformation and subsequently screened candidate genes in a cohort of 32 additional patients using either targeted exome or Sanger sequencing. In a cohort of 51 patients, we found five affected individuals with heterozygous mutations in EPHB4 including de novo frameshift (p.His191Alafs*32) or inherited deleterious splice or missense mutations predicted to be pathogenic by in silico tools. Knockdown of ephb4 in zebrafish embryos leads to specific anomalies of dorsal cranial vessels including the dorsal longitudinal vein, which is the orthologue of the median prosencephalic vein and the embryonic precursor of the vein of Galen. This model allowed us to investigate EPHB4 loss-of-function mutations in this disease by the ability to rescue the brain vascular defect in knockdown zebrafish co-injected with wild-type, but not truncated EPHB4, mimicking the p.His191Alafs mutation. Our data showed that in both species, loss of function mutations of EPHB4 result in specific and similar brain vascular development anomalies. Recently, EPHB4 germline mutations have been reported in non-immune hydrops fetalis and in cutaneous capillary malformation-arteriovenous malformation. Here, we show that EPHB4 mutations are also responsible for vein of Galen aneurysmal malformation, indicating that heterozygous germline mutations of EPHB4 result in a large clinical spectrum. The identification of EPHB4 pathogenic mutations in patients presenting capillary malformation or vein of Galen aneurysmal malformation should lead to careful follow-up of pregnancy of carriers for early detection of anomaly of the cerebral vasculature in order to propose optimal neonatal care. Endovascular

SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.

Science.gov (United States)

Hanchate, Naresh Kumar; Giacobini, Paolo; Lhuillier, Pierre; Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine

2012-08-01

Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema) mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.

Directory of Open Access Journals (Sweden)

Naresh Kumar Hanchate

2012-08-01

Full Text Available Kallmann syndrome (KS associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31 and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H. All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H, which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

Mutation profile of all 49 exons of the human myosin VIIA gene, and haplotype analysis, in Usher 1B families from diverse origins.

Science.gov (United States)

Adato, A; Weil, D; Kalinski, H; Pel-Or, Y; Ayadi, H; Petit, C; Korostishevsky, M; Bonne-Tamir, B

1997-10-01

Usher syndrome types I (USH1A-USH1E) are a group of autosomal recessive diseases characterized by profound congenital hearing loss, vestibular areflexia, and progressive visual loss due to retinitis pigmentosa. The human myosin VIIA gene, located on 11q14, has been shown to be responsible for Usher syndrome type 1B (USH1B). Haplotypes were constructed in 28 USH1 families by use of the following polymorphic markers spanning the USH1B locus: D11S787, D11S527, D11S1789, D11S906, D11S4186, and OMP. Affected individuals and members of their families from 12 different ethnic origins were screened for the presence of mutations in all 49 exons of the myosin VIIA gene. In 15 families myosin VIIA mutations were detected, verifying their classification as USH1B. All these mutations are novel, including three missense mutations, one premature stop codon, two splicing mutations, one frameshift, and one deletion of >2 kb comprising exons 47 and 48, a part of exon 49, and the introns between them. Three mutations were shared by more than one family, consistent with haplotype similarities. Altogether, 16 USH1B haplotypes were observed in the 15 families; most haplotypes were population specific. Several exonic and intronic polymorphisms were also detected. None of the 20 known USH1B mutations reported so far in other world populations were identified in our families.

Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

Science.gov (United States)

Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

2018-03-01

There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

The first missense mutation of NHS gene in a Tunisian family with clinical features of NHS syndrome including cardiac anomaly.

Science.gov (United States)

Chograni, Manèl; Rejeb, Imen; Jemaa, Lamia Ben; Châabouni, Myriam; Bouhamed, Habiba Chaabouni

2011-08-01

Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome is a disease of unknown gene action mechanism, characterized by congenital cataract, dental anomalies, dysmorphic features and, in some cases, mental retardation. We performed linkage analysis in a Tunisian family with NHS in which affected males and obligate carrier female share a common haplotype in the Xp22.32-p11.21 region that contains the NHS gene. Direct sequencing of NHS coding exons and flanking intronic sequences allowed us to identify the first missense mutation (P551S) and a reported SNP-polymorphism (L1319F) in exon 6, a reported UTR-SNP (c.7422 C>T) and a novel one (c.8239 T>A) in exon 8. Both variations P551S and c.8239 T>A segregate with NHS phenotype in this family. Although truncations, frame-shift and copy number variants have been reported in this gene, no missense mutations have been found to segregate previously. This is the first report of a missense NHS mutation causing NHS phenotype (including cardiac defects). We hypothesize also that the non-reported UTR-SNP of the exon 8 (3'-UTR) is specific to the Tunisian population.

CDKL5 Gene-Related Epileptic Encephalopathy in Estonia: Four Cases, One Novel Mutation Causing Severe Phenotype in a Boy, and Overview of the Literature.

Science.gov (United States)

Lilles, Stella; Talvik, Inga; Noormets, Klari; Vaher, Ulvi; Õunap, Katrin; Reimand, Tiia; Sander, Valentin; Ilves, Pilvi; Talvik, Tiina

2016-12-01

Cyclin-dependent kinase-like 5 ( CDKL5 ) gene mutations have mainly been found in females with early infantile epileptic encephalopathy (EIEE), severe intellectual disability, and Rett-like features. To date, only 22 boys have been reported, presenting with far more severe phenotypic features. We report the first cases of CDKL5 gene-related EIEE in Estonia diagnosed using panels of epilepsy-associated genes and describe the phenotype-genotype correlations in three male and one female patient. One of the mutations, identified in a male patient, was a novel de novo hemizygous frameshift mutation (NM_003159.2:c.2225_2228del (p.Glu742Afs*41)) in exon 15 of CDKL5. All boys have a more severe phenotype than the female patient. In boys with early onset of seizures and poor development with absent or poor eye contact, CDKL5 gene-related EIEE can be suspected and epilepsy-associated genes should be analyzed for early etiological diagnosis. Early genetic diagnosis would be the cornerstone in personalized treatment in the future. Georg Thieme Verlag KG Stuttgart · New York.

Identification of Novel Compound Mutations in PLA2G6-Associated Neurodegeneration Patient with Characteristic MRI Imaging.

Science.gov (United States)

Guo, Sen; Yang, Liu; Liu, Huijie; Chen, Wei; Li, Jinchen; Yu, Ping; Sun, Zhong Sheng; Chen, Xiang; Du, Jie; Cai, Tao

2017-08-01

Neurodegeneration with brain iron accumulation comprises a heterogeneous group of disorders characterized clinically by progressive motor dysfunction. Accurate identification of de novo and rare inherited mutations is important for determining causative genes of undiagnosed neurological diseases. In the present study, we report a unique case with cerebellar ataxia symptoms and social communication difficulties in an intermarriage family. MRI showed a marked cerebellar atrophy and the "eye-of-the-tiger"-like sign in the medial globus pallidus. Potential genetic defects were screened by whole-exome sequencing (WES) for the patient and four additional family members. A previously undescribed de novo missense mutation (c.1634A>G, p.K545R) in the exon 12 of the PLA2G6 gene was identified. A second rare variant c.1077G>A at the end of exon 7 was also identified, which was inherited from the mother, and resulted in a frame-shift mutation (c.1074_1077del.GTCG) due to an alternative splicing. In conclusion, the identification of the "eye-of-the-tiger"-like sign in the globus pallidus of the patient expands the phenotypic spectrum of PLA2G6-associated disorders and reveals its value in differential diagnosis of PLA2G6-associated disorders.

Targeted exome sequencing reveals novel USH2A mutations in Chinese patients with simplex Usher syndrome.

Science.gov (United States)

Shu, Hai-Rong; Bi, Huai; Pan, Yang-Chun; Xu, Hang-Yu; Song, Jian-Xin; Hu, Jie

2015-09-16

Usher syndrome (USH) is an autosomal recessive disorder characterized by hearing impairment and vision dysfunction due to retinitis pigmentosa. Phenotypic and genetic heterogeneities of this disease make it impractical to obtain a genetic diagnosis by conventional Sanger sequencing. In this study, we applied a next-generation sequencing approach to detect genetic abnormalities in patients with USH. Two unrelated Chinese families were recruited, consisting of two USH afflicted patients and four unaffected relatives. We selected 199 genes related to inherited retinal diseases as targets for deep exome sequencing. Through systematic data analysis using an established bioinformatics pipeline, all variants that passed filter criteria were validated by Sanger sequencing and co-segregation analysis. A homozygous frameshift mutation (c.4382delA, p.T1462Lfs*2) was revealed in exon20 of gene USH2A in the F1 family. Two compound heterozygous mutations, IVS47 + 1G > A and c.13156A > T (p.I4386F), located in intron 48 and exon 63 respectively, of USH2A, were identified as causative mutations for the F2 family. Of note, the missense mutation c.13156A > T has not been reported so far. In conclusion, targeted exome sequencing precisely and rapidly identified the genetic defects in two Chinese USH families and this technique can be applied as a routine examination for these disorders with significant clinical and genetic heterogeneity.

Phenotypical features of two patients diagnosed with PHARC syndrome and carriers of a new homozygous mutation in the ABHD12 gene.

Science.gov (United States)

Frasquet, Marina; Lupo, Vincenzo; Chumillas, María José; Vázquez-Costa, Juan Francisco; Espinós, Carmen; Sevilla, Teresa

2018-04-15

PHARC (Polyneuropathy, Hearing loss, Ataxia, Retinitis pigmentosa and Cataracts) (MIM# 612674) is an autosomal recessive neurodegenerative disease caused by mutations in the ABHD12 gene. We evaluated two Spanish siblings affected with pes cavus, sensorimotor neuropathy, hearing loss, retinitis pigmentosa and juvenile cataracts in whom the genetic test of ABHD12 revealed a novel homozygous frameshift mutation, c.211_223del (p.Arg71Tyrfs*26). The earliest clinical manifestation in these patients was a demyelinating neuropathy manifested with a Charcot-Marie-Tooth phenotype over three decades. Progressive hearing loss, cataracts and retinitis pigmentosa appeared after the age of 30. We herein describe the complete clinical picture of these two patients, and focus particularly on neuropathy characteristics. This study supports the fact that although PHARC is rare, its phenotype is very characteristic and we should include its study in patients affected with demyelinating polyneuropathy, hearing loss and retinopathy. Copyright © 2018 Elsevier B.V. All rights reserved.

Investigation of mutagenicity of extracts of hydrobionts from lake Drukshiai and water from its streamlets

International Nuclear Information System (INIS)

Lekevichius, R.; Dagyte, B.; Sabaliuniene, I.; Shumyliene, I.; Mishkelevichiute, E.

1995-01-01

Rain-water samples from Ignalina NPP buildings and industry sewerage water samples collected in 1993-1994 induced statistically significant increase in levels of frameshift and and base-substitution mutations in Salmonella typhimurium Ames tester strains. It was found that mutagens originated not by Ignalina NPP get into lake Drukshiai from its streamlets. Extracts from 4 species of molluscs did not induce frameshift and base-substitution mutations in Ames tester-strains. Among extracts of liver, muscles and gonads from 4 fish species tested, the highest mutagenicity levels were induced by extracts of gonads from the largest fish. (author). 4 refs., 4 tabs

Radiation-induced germ-line mutations detected by a direct comparison of parents and children DNA sequences containing SNPs

International Nuclear Information System (INIS)

Morimyo, M.; Hongo, E.; Higashi, T.; Wu, J.; Matsumoto, I.; Okamoto, M.; Kawano, A.; Tsuji, S.

2003-01-01

Full text: Germ-line mutation is detected in mice but not in humans. To estimate genetic risk of humans, a new approach to extrapolate from animal data to humans or to directly detect radiation-induced mutations in man is expected. We have developed a new method to detect germ-line mutations by directly comparing DNA sequences of parents and children. The nucleotide sequences among mouse strains are almost identical except SNP markers that are detected at 1/1000 frequency. When gamma-irradiated male mice are mated with female mice, heterogeneous nucleotide sequences induced in children DNA are a candidate of mutation, whose assignment can be done by SNP analysis. This system can easily detect all types of mutations such as transition, transversion, frameshift and deletion induced by radiation and can be applied to humans having genetically heterogeneous nucleotide sequences and many SNP markers. C3H male mice of 8 weeks of gestation were irradiated with gamma rays of 3 and 1 Gy and after 3 weeks, they were mated with the same aged C57BL female mice. After 3 weeks breeding, DNA was extracted from parents and children mice. The nucleotide sequences of 150 STS markers containing 300-900 bp and SNPs of parents and children DNA were determined by a direct sequencing; amplification of STS markers by Taq DNA polymerase, purification of PCR products, and DNA sequencing with a dye-terminator method. At each radiation dose, a total amount of 5 Mb DNA sequences were examined to detect radiation-induced mutations. We could find 6 deletions in 3 Gy irradiated mice but not in 1 Gy and control mice. The mutation frequency was about 4.0 x 10 -7 /bp/ Gy or 1.6 x 10 -4 /locus/Gy, and suggested the non-linear increase of mutation rate with dose

Identification of new RECQL4 mutations in Caucasian Rothmund-Thomson patients and analysis of sensitivity to a wide range of genotoxic agents

Energy Technology Data Exchange (ETDEWEB)

Caseira Cabral, Rosa Estela [Laboratoire ' Genomes et Cancers' , FRE2939 CNRS, Institut Gustave-Roussy, Universite Paris-Sud, PRII, 39 Rue Camille Desmoulins, 94805 Villejuif (France); Instituto de Biofisica Carlos Chagas Filho, Centro de Ciencias da Saude, Universidade Federal do Rio de Janeiro (Brazil); Queille, Sophie [Laboratoire ' Genomes et Cancers' , FRE2939 CNRS, Institut Gustave-Roussy, Universite Paris-Sud, PRII, 39 Rue Camille Desmoulins, 94805 Villejuif (France); Bodemer, Christine; Prost, Yves de [Service de Dermatologie, Hopital Necker-Enfants Malades, Universite Decartes-Paris V, APHP, Cedex (France); Bispo Cabral Neto, Januario [Instituto de Biofisica Carlos Chagas Filho, Centro de Ciencias da Saude, Universidade Federal do Rio de Janeiro (Brazil); Sarasin, Alain [Laboratoire ' Genomes et Cancers' , FRE2939 CNRS, Institut Gustave-Roussy, Universite Paris-Sud, PRII, 39 Rue Camille Desmoulins, 94805 Villejuif (France); Daya-Grosjean, Leela [Laboratoire ' Genomes et Cancers' , FRE2939 CNRS, Institut Gustave-Roussy, Universite Paris-Sud, PRII, 39 Rue Camille Desmoulins, 94805 Villejuif (France)], E-mail: daya@igr.fr

2008-08-25

Rothmund-Thomson syndrome (RTS), a rare recessive autosomal disorder, presents genome instability and clinical heterogeneity with growth deficiency, skin and bone defects, premature aging symptoms and cancer susceptibility. A subset of RTS patients presents mutations of the RECQL4 gene, member of the RecQ family of DNA helicases, including the RECQL2 (BLM) and RECQL3 (WRN) genes, defective in the cancer prone Bloom and Werner syndromes, respectively. Analysis of the RECQL4 gene in six clinically diagnosed RTS patients shows five patients, including two siblings, with eight mutations mainly located in the helicase domain, three patients presenting two mutations. The alterations include four missense mutations, one nonsense mutation and the same frameshift deletion, g.2881delG in exon 9 found in three patients. Seven RECQL4 polymorphisms, two being new, have also been identified. Primary RTS fibroblasts from these RTS patients show no sensitivity to a wide variety of genotoxic agents including ionizing or ultraviolet irradiation, nitrogen mustard, 4NQO, 8-MOP, Cis-Pt, MMC, H{sub 2}O{sub 2}, HU, or UV plus caffeine which could be related to the RECQL4 alterations identified here. This is in contrast with the DNA damage sensitive Bloom and Werner cells and highlights the complexity of the numerous RecQ protein functions implicated in the different cellular pathways required for maintaining genomic integrity.

Identification of new RECQL4 mutations in Caucasian Rothmund-Thomson patients and analysis of sensitivity to a wide range of genotoxic agents

International Nuclear Information System (INIS)

Caseira Cabral, Rosa Estela; Queille, Sophie; Bodemer, Christine; Prost, Yves de; Bispo Cabral Neto, Januario; Sarasin, Alain; Daya-Grosjean, Leela

2008-01-01

Rothmund-Thomson syndrome (RTS), a rare recessive autosomal disorder, presents genome instability and clinical heterogeneity with growth deficiency, skin and bone defects, premature aging symptoms and cancer susceptibility. A subset of RTS patients presents mutations of the RECQL4 gene, member of the RecQ family of DNA helicases, including the RECQL2 (BLM) and RECQL3 (WRN) genes, defective in the cancer prone Bloom and Werner syndromes, respectively. Analysis of the RECQL4 gene in six clinically diagnosed RTS patients shows five patients, including two siblings, with eight mutations mainly located in the helicase domain, three patients presenting two mutations. The alterations include four missense mutations, one nonsense mutation and the same frameshift deletion, g.2881delG in exon 9 found in three patients. Seven RECQL4 polymorphisms, two being new, have also been identified. Primary RTS fibroblasts from these RTS patients show no sensitivity to a wide variety of genotoxic agents including ionizing or ultraviolet irradiation, nitrogen mustard, 4NQO, 8-MOP, Cis-Pt, MMC, H 2 O 2 , HU, or UV plus caffeine which could be related to the RECQL4 alterations identified here. This is in contrast with the DNA damage sensitive Bloom and Werner cells and highlights the complexity of the numerous RecQ protein functions implicated in the different cellular pathways required for maintaining genomic integrity

In vitro antibacterial activity of rifampicin in combination with imipenem, meropenem and doripenem against multidrug-resistant clinical isolates of Pseudomonas aeruginosa.

Science.gov (United States)

Hu, Yi-Fan; Liu, Chang-Pan; Wang, Nai-Yu; Shih, Shou-Chuan

2016-08-24

Multidrug-resistant Pseudomonas aeruginosa has emerged as one of the most important healthcare-associated pathogens. Colistin is regarded as the last-resort antibiotic for multidrug-resistant Gram-negative bacteria, but is associated with high rates of acute kidney injury. The aim of this in vitro study is to search for an alternative treatment to colistin for multidrug-resistant P. aeruginosa infections. Multidrug and carbapenem-resistant P. aeruginosa isolates were collected between January 2009 and December 2012 at MacKay Memorial Hospital. Minimal inhibitory concentrations (MICs) were determined for various antibiotic combinations. Carbapenemase-producing genes including bla VIM, other β-lactamase genes and porin mutations were screened by PCR and sequencing. The efficacy of carbapenems (imipenem, meropenem, doripenem) with or without rifampicin was correlated with the type of porin mutation (frameshift mutation, premature stop codon mutation) in multidrug-resistant P. aeruginosa isolates without carbapenemase-producing genes. Of the 71 multidrug-resistant clinical P. aeruginosa isolates, only six harboured the bla VIM gene. Imipenem, meropenem and doripenem were significantly more effective (reduced fold-change of MICs) when combined with rifampicin in bla VIM-negative isolates, especially in isolates with porin frameshift mutation. Imipenem + rifampicin combination has a low MIC against multidrug-resistant P. aeruginosa, especially in isolates with porin frameshift mutation. The imipenem + rifampicin combination may provide an alternative treatment to colistin for multidrug -resistant P. aeruginosa infections, especially for patients with renal insufficiency.

Mutations in fetal genes involved in innate immunity and host defense against microbes increase risk of preterm premature rupture of membranes (PPROM).

Science.gov (United States)

Modi, Bhavi P; Teves, Maria E; Pearson, Laurel N; Parikh, Hardik I; Haymond-Thornburg, Hannah; Tucker, John L; Chaemsaithong, Piya; Gomez-Lopez, Nardhy; York, Timothy P; Romero, Roberto; Strauss, Jerome F

2017-11-01

Twin studies have revealed a significant contribution of the fetal genome to risk of preterm birth. Preterm premature rupture of membranes (PPROM) is the leading identifiable cause of preterm delivery. Infection and inflammation of the fetal membranes is commonly found associated with PPROM. We carried out whole exome sequencing (WES) of genomic DNA from neonates born of African-American mothers whose pregnancies were complicated by PPROM (76) or were normal term pregnancies (N = 43) to identify mutations in 35 candidate genes involved in innate immunity and host defenses against microbes. Targeted genotyping of mutations in the candidates discovered by WES was conducted on an additional 188 PPROM cases and 175 controls. We identified rare heterozygous nonsense and frameshift mutations in several of the candidate genes, including CARD6, CARD8, DEFB1, FUT2, MBL2, NLP10, NLRP12, and NOD2. We discovered that some mutations (CARD6, DEFB1, FUT2, MBL2, NLRP10, NOD2) were present only in PPROM cases. We conclude that rare damaging mutations in innate immunity and host defense genes, the majority being heterozygous, are more frequent in neonates born of pregnancies complicated by PPROM. These findings suggest that the risk of preterm birth in African-Americans may be conferred by mutations in multiple genes encoding proteins involved in dampening the innate immune response or protecting the host against microbial infection and microbial products. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Functional Analysis of In-frame Indel ARID1A Mutations Reveals New Regulatory Mechanisms of Its Tumor Suppressor Functions

Directory of Open Access Journals (Sweden)

Bin Guan

2012-10-01

Full Text Available AT-rich interactive domain 1A (ARID1A has emerged as a new tumor suppressor in which frequent somatic mutations have been identified in several types of human cancers. Although most ARID1A somatic mutations are frame-shift or nonsense mutations that contribute to mRNA decay and loss of protein expression, 5% of ARID1A mutations are in-frame insertions or deletions (indels that involve only a small stretch of peptides. Naturally occurring in-frame indel mutations provide unique and useful models to explore the biology and regulatory role of ARID1A. In this study, we analyzed indel mutations identified in gynecological cancers to determine how these mutations affect the tumor suppressor function of ARID1A. Our results demonstrate that all in-frame mutants analyzed lost their ability to inhibit cellular proliferation or activate transcription of CDKN1A, which encodes p21, a downstream effector of ARID1A. We also showed that ARID1A is a nucleocytoplasmic protein whose stability depends on its subcellular localization. Nuclear ARID1A is less stable than cytoplasmic ARID1A because ARID1A is rapidly degraded by the ubiquitin-proteasome system in the nucleus. In-frame deletions affecting the consensus nuclear export signal reduce steady-state protein levels of ARID1A. This defect in nuclear exportation leads to nuclear retention and subsequent degradation. Our findings delineate a mechanism underlying the regulation of ARID1A subcellular distribution and protein stability and suggest that targeting the nuclear ubiquitin-proteasome system can increase the amount of the ARID1A protein in the nucleus and restore its tumor suppressor functions.

Introducing a frameshift mutation to the POL sequence of HIV-1 provirus and evaluation of the immunogenic characteristics of the mutated virions (RINNL4-3).

Science.gov (United States)

Zabihollahi, Rezvan; Sadat, Seyed Mehdi; Vahabpour, Rouhollah; Salehi, Mansoor; Azadmanesh, Kayhan; Siadat, Seyed Davar; Saraji, Ali Reza Azizi; Pouriavali, Mohamamd Hassan; Momen, Seyed Bahman; Aghasadeghi, Mohamad Reza

2012-01-01

Inactivation of the reverse transcriptase (RT) and integrase (IN) enzymes can abolish the replication of the human immunodeficiency virus (HIV) and, thus, its infectivity. Here, inactivated HIV particles convenient for designing virus-like particle (VLP) based vaccines have been produced. Inactivated HIV-provirus was created by introducing a frame shift mutation. HIV provirus DNA was cut in the pol region by Age I restriction enzyme, followed by filling of sticky ends using the Klenow fragment before ligation. The resulting plasmid was named as pRINNL4-3. HEK-293T cells were used as producer, after being transfected with the modified plasmid. Viral particle production and biological activity were assayed by virus capsid protein (p24) quantification and syncytium formation in MT2 cells, respectively. The immunogenicity of the RINNL4-3 virions was investigated in a mouse model. The mutation was expected to inactivate the virus RT and IN enzymes. The results showed that the VLPs were assembled, as measured by the p24 load of the culture supernatant, and contained functional envelope proteins (Env) as monitored by the syncytium formation. However, these VLPs had no ability to infect target MT2 cells, as well as their VSVG (vesicular stomatitis virus-glycoprotein) pseudotyped counterparts infected HEK-293T cells. A high level of antibody response was observed in immunized mice. Since RINNL4-3 virions are replication incompetent, they are convenient for production and use in biomedical studies. Also, RINNL4-3 is a candidate for a vaccine development due to it contains envelope and structural virus proteins which are crucial for triggering neutralizing antibodies and the cellular immune response.

Identification and Functional Testing of ERCC2 Mutations in a Multi-national Cohort of Patients with Familial Breast- and Ovarian Cancer.

Directory of Open Access Journals (Sweden)

Andreas Rump

2016-08-01

Full Text Available The increasing application of gene panels for familial cancer susceptibility disorders will probably lead to an increased proposal of susceptibility gene candidates. Using ERCC2 DNA repair gene as an example, we show that proof of a possible role in cancer susceptibility requires a detailed dissection and characterization of the underlying mutations for genes with diverse cellular functions (in this case mainly DNA repair and basic cellular transcription. In case of ERCC2, panel sequencing of 1345 index cases from 587 German, 405 Lithuanian and 353 Czech families with breast and ovarian cancer (BC/OC predisposition revealed 25 mutations (3 frameshift, 2 splice-affecting, 20 missense, all absent or very rare in the ExAC database. While 16 mutations were unique, 9 mutations showed up repeatedly with population-specific appearance. Ten out of eleven mutations that were tested exemplarily in cell-based functional assays exert diminished excision repair efficiency and/or decreased transcriptional activation capability. In order to provide evidence for BC/OC predisposition, we performed familial segregation analyses and screened ethnically matching controls. However, unlike the recently published RECQL example, none of our recurrent ERCC2 mutations showed convincing co-segregation with BC/OC or significant overrepresentation in the BC/OC cohort. Interestingly, we detected that some deleterious founder mutations had an unexpectedly high frequency of > 1% in the corresponding populations, suggesting that either homozygous carriers are not clinically recognized or homozygosity for these mutations is embryonically lethal. In conclusion, we provide a useful resource on the mutational landscape of ERCC2 mutations in hereditary BC/OC patients and, as our key finding, we demonstrate the complexity of correct interpretation for the discovery of "bonafide" breast cancer susceptibility genes.

The prevalence of ABCB1:c.227_230delATAG mutation in affected dog breeds from European countries.

Science.gov (United States)

Firdova, Zuzana; Turnova, Evelina; Bielikova, Marcela; Turna, Jan; Dudas, Andrej

2016-06-01

Deletion of 4-base pairs in the canine ABCB1 (MDR1) gene, responsible for encoding P-glycoprotein, leads to nonsense frame-shift mutation, which causes hypersensitivity to macrocyclic lactones drugs (e.g. ivermectin). To date, at least 12 purebred dog breeds have been found to be affected by this mutation. The aim of this study was to update information about the prevalence of ABCB1 mutation (c.227_230delATAG) in predisposed breeds in multiple European countries. This large scale survey also includes countries which were not involved in previous studies. The samples were collected in the period from 2012 to 2014. The overview is based on genotyping data of 4729 individuals. The observed mutant allele frequencies were 58.5% (Smooth Collie), 48.3% (Rough Collie), 35% (Australian Shepherd), 30.3% (Shetland Sheepdog), 28.1% (Silken Windhound), 26.1% (Miniature Australian Shepherd), 24.3% (Longhaired Whippet), 16.2% (White Swiss Shepherd) and 0% (Border Collie). The possible presence of an ABCB1 mutant allele in Akita-Inu breed has been investigated with negative results. This information could be helpful for breeders in optimization of their breeding strategy and for veterinarians when prescribing drug therapy for dogs of predisposed breeds. Copyright © 2016 Elsevier Ltd. All rights reserved.

A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

Directory of Open Access Journals (Sweden)

Ali Gargouri

2015-08-01

Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

Characterization of a splicing mutation in group A xeroderma pigmentosum

International Nuclear Information System (INIS)

Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki; Miyamoto, Iwai; Okada, Yoshio; Satoh, Yoshiaki; Kondo, Seiji

1990-01-01

The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G → C substitution at the 3' splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3' splice site, thus creating two abnormally spliced mRNA forms. The larger form is identical with normal mRNA except for a dinucleotide deletion at the 5' end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5' end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers

Heterogeneous Pulmonary Phenotypes Associated With Mutations in the Thyroid Transcription Factor Gene NKX2-1

Science.gov (United States)

Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.

2013-01-01

Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038

Nelson`s syndrome associated with a somatic frame shift mutation in the glucocorticoid recepter gene

Energy Technology Data Exchange (ETDEWEB)

Karl, M.; Stratakis, C.A.; Chrousos, G.P.; Katz, D.A.; Ali, I.U.; Oldfield, E.H. [National Inst. of Neurological Disorders and Stroke, Bethesda, MD (United States)] [and others

1996-01-01

Nelson`s syndrome is the appearance and/or progression of ACTH-secreting pituitary macroadenomas in patients who had previously undergone bilateral adrenalectomy for Cushing`s disease. Extremely high plasma ACTH levels and aggressive neoplastic growth might be explained by the lack of appropriate glucocorticoid negative feedback due to defective glucocorticoid signal transduction. To study the glucocorticoid receptor (GR) gene in Nelson`s syndrome, DNA was extracted from pituitary adenomas and leukocytes of four patients with this condition and amplified by PCR for direct sequence analysis. In one of the tumors, a heterozygous mutation, consisting of an insertion of a thymine between complementary DNA nucleotides 1188 and 1189, was found in exon 2. This frame-shift mutation led to premature termination at amino acid residue 366 of the world-type coding sequence, excluding the expression of a functioning receptor protein from the defective allele. The mutation was not detected in the sequence of the GR gene in the patient`s leukocyte DNA, indicating a somatic origin. By lowering the receptor number in tumorous cells, this defect might have caused local resistance to negative glucocorticoid feedback similar to that caused by the presence of a null allele in a kindred with the generalized glucocorticoid resistance syndrome. P53 protein accumulation, previously reported in 60% of corticotropinomas, could not be detected in any of the four pituitary tumors examined by immunohistochemistry. We suggest that a somatic GR defect might have played a pathophysiological role in the tumorigenesis of the corticotropinoma bearing this mutation. 35 refs., 3 figs., 1 tab.

Generation and characterization of Kctd15 mutations in zebrafish.

Directory of Open Access Journals (Sweden)

Alison Heffer

Full Text Available Potassium channel tetramerization domain containing 15 (Kctd15 was previously found to have a role in early neural crest (NC patterning, specifically delimiting the region where NC markers are expressed via repression of transcription factor AP-2a and inhibition of Wnt signaling. We used transcription activator-like effector nucleases (TALENs to generate null mutations in zebrafish kctd15a and kctd15b paralogs to study the in vivo role of Kctd15. We found that while deletions producing frame-shift mutations in each paralog showed no apparent phenotype, kctd15a/b double mutant zebrafish are smaller in size and show several phenotypes including some affecting the NC, such as expansion of the early NC domain, increased pigmentation, and craniofacial defects. Both melanophore and xanthophore pigment cell numbers and early markers are up-regulated in the double mutants. While we find no embryonic craniofacial defects, adult mutants have a deformed maxillary segment and missing barbels. By confocal imaging of mutant larval brains we found that the torus lateralis (TLa, a region implicated in gustatory networks in other fish, is absent. Ablation of this brain tissue in wild type larvae mimics some aspects of the mutant growth phenotype. Thus kctd15 mutants show deficits in the development of both neural crest derivatives, and specific regions within the central nervous system, leading to a strong reduction in normal growth rates.

A heterozygous mutation in RPGR associated with X-linked retinitis pigmentosa in a patient with Turner syndrome mosaicism (45,X/46,XX).

Science.gov (United States)

Zhou, Qi; Yao, Fengxia; Wang, Feng; Li, Hui; Chen, Rui; Sui, Ruifang

2018-01-01

Turner syndrome with retinitis pigmentosa (RP) is rare, with only three cases reported based on clinical examination alone. We summarized the 4-year follow-up and molecular findings in a 28-year-old patient with Turner syndrome and the typical features of short stature and neck webbing, who also had X-linked RP. Her main complaints were night blindness and progressive loss of vision since the age of 9 years. Ophthalmologic examination, optical coherent tomographic imaging, and visual electrophysiology tests showed classic manifestations of RP. The karyotype of peripheral blood showed mosaicism (45,X [72%]/46,XX[28%]). A novel heterozygous frameshift mutation (c.2403_2406delAGAG, p.T801fsX812) in the RP GTPase regulator (RPGR) gene was detected using next generation sequencing and validated by Sanger sequencing. We believe that this is the first report of X-linked RP in a patient with Turner syndrome associated with mosaicism, and an RPGR heterozygous mutation. We hypothesize that X-linked RP in this woman is not related to Turner syndrome, but may be a manifestation of the lack of a normal paternal X chromosome with intact but mutated RPGR. © 2017 Wiley Periodicals, Inc.

Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

International Nuclear Information System (INIS)

Hafeez, M.

2007-01-01

To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

Achieving a golden mean: mechanisms by which coronaviruses ensure synthesis of the correct stoichiometric ratios of viral proteins.

Science.gov (United States)

Plant, Ewan P; Rakauskaite, Rasa; Taylor, Deborah R; Dinman, Jonathan D

2010-05-01

In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed -1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the -1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a "golden mean" model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins.

De novo mutations of KIAA2022 in females cause intellectual disability and intractable epilepsy

Science.gov (United States)

de Lange, Iris M; Helbig, Katherine L; Weckhuysen, Sarah; Møller, Rikke S; Velinov, Milen; Dolzhanskaya, Natalia; Marsh, Eric; Helbig, Ingo; Devinsky, Orrin; Tang, Sha; Mefford, Heather C; Myers, Candace T; van Paesschen, Wim; Striano, Pasquale; van Gassen, Koen; van Kempen, Marjan; de Kovel, Carolien G F; Piard, Juliette; Minassian, Berge A; Nezarati, Marjan M; Pessoa, André; Jacquette, Aurelia; Maher, Bridget; Balestrini, Simona; Sisodiya, Sanjay; Warde, Marie Therese Abi; De St Martin, Anne; Chelly, Jamel; van ‘t Slot, Ruben; Van Maldergem, Lionel; Brilstra, Eva H; Koeleman, Bobby P C

2016-01-01

Background Mutations in the KIAA2022 gene have been reported in male patients with X-linked intellectual disability, and related female carriers were unaffected. Here, we report 14 female patients who carry a heterozygous de novo KIAA2022 mutation and share a phenotype characterised by intellectual disability and epilepsy. Methods Reported females were selected for genetic testing because of substantial developmental problems and/or epilepsy. X-inactivation and expression studies were performed when possible. Results All mutations were predicted to result in a frameshift or premature stop. 12 out of 14 patients had intractable epilepsy with myoclonic and/or absence seizures, and generalised in 11. Thirteen patients had mild to severe intellectual disability. This female phenotype partially overlaps with the reported male phenotype which consists of more severe intellectual disability, microcephaly, growth retardation, facial dysmorphisms and, less frequently, epilepsy. One female patient showed completely skewed X-inactivation, complete absence of RNA expression in blood and a phenotype similar to male patients. In the six other tested patients, X-inactivation was random, confirmed by a non-significant twofold to threefold decrease of RNA expression in blood, consistent with the expected mosaicism between cells expressing mutant or normal KIAA2022 alleles. Conclusions Heterozygous loss of KIAA2022 expression is a cause of intellectual disability in females. Compared with its hemizygous male counterpart, the heterozygous female disease has less severe intellectual disability, but is more often associated with a severe and intractable myoclonic epilepsy. PMID:27358180

Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

Science.gov (United States)

Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

2012-06-01

Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

Elucidation of the Vibrio anguillarum genetic response to the potential fish probiont Pseudomonas fluorescens AH2, using RNA-arbitrarily primed PCR

DEFF Research Database (Denmark)

Holmstrøm, Kim; Gram, Lone

2003-01-01

or another V. anguillarum siderophore. On the pJM1 plasmid of V anguillarum serotype O1, a pseudogene designated open reading frame E (ORF E) that contains a frameshift mutation was previously identified. The gene homologous to vibE identified in this study, interestingly, also has significant homology...... to ORF E on the amino acid level and does not possess the frameshift mutation. Thus, the chromosomally encoded vibE homologue could fulfil the role of the inactive plasmid-encoded ORF E pseudogene. Addition of Fe3+ to the system eliminated the growth arrest, and the genes homologous to rpoS and vibE were...

Identification of novel X-linked gain-of-function RPGR-ORF15 mutation in Italian family with retinitis pigmentosa and pathologic myopia

Science.gov (United States)

Parmeggiani, Francesco; Barbaro, Vanessa; De Nadai, Katia; Lavezzo, Enrico; Toppo, Stefano; Chizzolini, Marzio; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

2016-01-01

The aim of this study was to describe a new pathogenic variant in the mutational hot spot exon ORF15 of retinitis pigmentosa GTPase regulator (RPGR) gene within an Italian family with X-linked retinitis pigmentosa (RP), detailing its distinctive genotype-phenotype correlation with pathologic myopia (PM). All members of this RP-PM family underwent a complete ophthalmic examination. The entire open reading frames of RPGR and retinitis pigmentosa 2 genes were analyzed by Sanger sequencing. A novel frame-shift mutation in exon ORF15 of RPGR gene (c.2091_2092insA; p.A697fs) was identified as hemizygous variant in the male proband with RP, and as heterozygous variant in the females of this pedigree who invariably exhibited symmetrical PM in both eyes. The c.2091_2092insA mutation coherently co-segregated with the observed phenotypes. These findings expand the spectrum of X-linked RP variants. Interestingly, focusing on Caucasian ethnicity, just three RPGR mutations are hitherto reported in RP-PM families: one of these is located in exon ORF15, but none appears to be characterized by a high penetrance of PM trait as observed in the present, relatively small, pedigree. The geno-phenotypic attributes of this heterozygosity suggest that gain-of-function mechanism could give rise to PM via a degenerative cell-cell remodeling of the retinal structures. PMID:27995965

Novel mutations in the long isoform of the USH2A gene in patients with Usher syndrome type II or non-syndromic retinitis pigmentosa.

Science.gov (United States)

McGee, Terri L; Seyedahmadi, Babak Jian; Sweeney, Meredith O; Dryja, Thaddeus P; Berson, Eliot L

2010-07-01

Usher syndrome type II (USH2) is an autosomal recessive disorder characterised by retinitis pigmentosa (RP) and mild to moderate sensorineural hearing loss. Mutations in the USH2A gene are the most common cause of USH2 and are also a cause of some forms of RP without hearing loss (ie, non-syndromic RP). The USH2A gene was initially identified as a transcript comprised of 21 exons but subsequently a longer isoform containing 72 exons was identified. The 51 exons unique to the long isoform of USH2A were screened for mutations among a core set of 108 patients diagnosed with USH2 and 80 patients with non-syndromic RP who were all included in a previously reported screen of the short isoform of USH2A. For several exons, additional patients were screened. In total, 35 deleterious mutations were identified including 17 nonsense mutations, 9 frameshift mutations, 5 splice-site mutations, and 4 small in-frame deletions or insertions. Twenty-seven mutations were novel. In addition, 65 rare missense changes were identified. A method of classifying the deleterious effect of the missense changes was developed using the summed results of four different mutation assessment algorithms, SIFT, pMUT, PolyPhen, and AGVGD. This system classified 8 of the 65 changes as 'likely deleterious' and 9 as 'possibly deleterious'. At least one mutation was identified in 57-63% of USH2 cases and 19-23% of cases of non-syndromic recessive RP (calculated without and including probable/possible deleterious changes) thus supporting that USH2A is the most common known cause of RP in the USA.

A novel splice site mutation in the dentin sialophosphoprotein gene in a Chinese family with dentinogenesis imperfecta type II

International Nuclear Information System (INIS)

Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun

2009-01-01

Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II

Heterozygosity for ARID2 loss-of-function mutations in individuals with a Coffin-Siris syndrome-like phenotype.

Science.gov (United States)

Bramswig, Nuria C; Caluseriu, O; Lüdecke, H-J; Bolduc, F V; Noel, N C L; Wieland, T; Surowy, H M; Christen, H-J; Engels, H; Strom, T M; Wieczorek, D

2017-03-01

Chromatin remodeling is a complex process shaping the nucleosome landscape, thereby regulating the accessibility of transcription factors to regulatory regions of target genes and ultimately managing gene expression. The SWI/SNF (switch/sucrose nonfermentable) complex remodels the nucleosome landscape in an ATP-dependent manner and is divided into the two major subclasses Brahma-associated factor (BAF) and Polybromo Brahma-associated factor (PBAF) complex. Somatic mutations in subunits of the SWI/SNF complex have been associated with different cancers, while germline mutations have been associated with autism spectrum disorder and the neurodevelopmental disorders Coffin-Siris (CSS) and Nicolaides-Baraitser syndromes (NCBRS). CSS is characterized by intellectual disability (ID), coarsening of the face and hypoplasia or absence of the fifth finger- and/or toenails. So far, variants in five of the SWI/SNF subunit-encoding genes ARID1B, SMARCA4, SMARCB1, ARID1A, and SMARCE1 as well as variants in the transcription factor-encoding gene SOX11 have been identified in CSS-affected individuals. ARID2 is a member of the PBAF subcomplex, which until recently had not been linked to any neurodevelopmental phenotypes. In 2015, mutations in the ARID2 gene were associated with intellectual disability. In this study, we report on two individuals with private de novo ARID2 frameshift mutations. Both individuals present with a CSS-like phenotype including ID, coarsening of facial features, other recognizable facial dysmorphisms and hypoplasia of the fifth toenails. Hence, this study identifies mutations in the ARID2 gene as a novel and rare cause for a CSS-like phenotype and enlarges the list of CSS-like genes.

Mutation Analysis of Consanguineous Moroccan Patients with Parkinson’s Disease Combining Microarray and Gene Panel

Directory of Open Access Journals (Sweden)

Ahmed Bouhouche

2017-10-01

Full Text Available During the last two decades, 15 different genes have been reported to be responsible for the monogenic form of Parkinson’s disease (PD, representing a worldwide frequency of 5–10%. Among them, 10 genes have been associated with autosomal recessive PD, with PRKN and PINK1 being the most frequent. In a cohort of 145 unrelated Moroccan PD patients enrolled since 2013, 19 patients were born from a consanguineous marriage, of which 15 were isolated cases and 4 familial. One patient was homozygous for the common LRRK2 G2019S mutation and the 18 others who did not carry this mutation were screened for exon rearrangements in the PRKN gene using Affymetrix Cytoscan HD microarray. Two patients were determined homozygous for PRKN exon-deletions, while another patient presented with compound heterozygous inheritance (3/18, 17%. Two other patients showed a region of homozygosity covering the 1p36.12 locus and were sequenced for the candidate PINK1 gene, which revealed two homozygous point mutations: the known Q456X mutation in exon 7 and a novel L539F variation in exon 8. The 13 remaining patients were subjected to next-generation sequencing (NGS that targeted a panel of 22 PD-causing genes and overlapping phenotypes. NGS data showed that two unrelated consanguineous patients with juvenile-onset PD (12 and 13 years carried the same homozygous stop mutation W258X in the ATP13A2 gene, possibly resulting from a founder effect; and one patient with late onset (76 years carried a novel heterozygous frameshift mutation in SYNJ1. Clinical analysis showed that patients with the ATP13A2 mutation developed juvenile-onset PD with a severe phenotype, whereas patients having either PRKN or PINK1 mutations displayed early-onset PD with a relatively mild phenotype. By identifying pathogenic mutations in 45% (8/18 of our consanguineous Moroccan PD series, we demonstrate that the combination of chromosomal microarray analysis and NGS is a powerful approach to

Whole Exome Sequencing Identified a Novel Heterozygous Mutation in HMBS Gene in a Chinese Patient With Acute Intermittent Porphyria With Rare Type of Mild Anemia

Directory of Open Access Journals (Sweden)

Yongjiang Zheng

2018-04-01

Full Text Available Acute intermittent porphyria (AIP is a rare hereditary metabolic disease with an autosomal dominant mode of inheritance. Germline mutations of HMBS gene causes AIP. Mutation of HMBS gene results into the partial deficiency of the heme biosynthetic enzyme hydroxymethylbilane synthase. AIP is clinically manifested with abdominal pain, vomiting, and neurological complaints. Additionally, an extreme phenotypic heterogeneity has been reported in AIP patients with mutations in HMBS gene. Here, we investigated a Chinese patient with AIP. The proband is a 28-year-old Chinese male manifested with severe stomach ache, constipation, nausea and depression. Proband’s father and mother is normal. Proband’s blood sample was collected and genomic DNA was extracted. Whole exome sequencing and Sanger sequencing identified a heterozygous novel single nucleotide deletion (c.809delC in exon 12 of HMBS gene in the proband. This mutation leads to frameshift followed by formation of a truncated (p.Ala270Valfs∗2 HMBS protein with 272 amino acids comparing with the wild type HMBS protein of 361 amino acids. This mutation has not been found in proband’s unaffected parents as well as in 100 healthy normal control. According to the variant interpretation guidelines of American College of Medical Genetics and Genomics (ACMG, this variant is classified as “likely pathogenic” variant. Our findings expand the mutational spectra of HMBS gene related AIP which are significant for screening and genetic diagnosis for AIP.

Newly identified CHO ERCC3/XPB mutations and phenotype characterization

Science.gov (United States)

Rybanská, Ivana; Gurský, Ján; Fašková, Miriam; Salazar, Edmund P.; Kimlíčková-Polakovičová, Erika; Kleibl, Karol; Thompson, Larry H.; Piršel, Miroslav

2010-01-01

Nucleotide excision repair (NER) is a complex multistage process involving many interacting gene products to repair a wide range of DNA lesions. Genetic defects in NER cause human hereditary diseases including xeroderma pigmentosum (XP), Cockayne syndrome (CS), trichothiodystrophy and a combined XP/CS overlapping symptom. One key gene product associated with all these disorders is the excision repair cross-complementing 3/xeroderma pigmentosum B (ERCC3/XPB) DNA helicase, a subunit of the transcription factor IIH complex. ERCC3 is involved in initiation of basal transcription and global genome repair as well as in transcription-coupled repair (TCR). The hamster ERCC3 gene shows high degree of homology with the human ERCC3/XPB gene. We identified new mutations in the Chinese hamster ovary cell ERCC3 gene and characterized the role of hamster ERCC3 protein in DNA repair of ultraviolet (UV)-induced and oxidative DNA damage. All but one newly described mutations are located in the protein C-terminal region around the last intron–exon boundary. Due to protein truncations or frameshifts, they lack amino acid Ser751, phosphorylation of which prevents the 5′ incision of the UV-induced lesion during NER. Thus, despite the various locations of the mutations, their phenotypes are similar. All ercc3 mutants are extremely sensitive to UV-C light and lack recovery of RNA synthesis (RRS), confirming a defect in TCR of UV-induced damage. Their limited global genome NER capacity averages ∼8%. We detected modest sensitivity of ercc3 mutants to the photosensitizer Ro19-8022, which primarily introduces 8-oxoguanine lesions into DNA. Ro19-8022-induced damage interfered with RRS, and some of the ercc3 mutants had delayed kinetics. All ercc3 mutants showed efficient base excision repair (BER). Thus, the positions of the mutations have no effect on the sensitivity to, and repair of, Ro19-8022-induced DNA damage, suggesting that the ERCC3 protein is not involved in BER. PMID:19942596

Hirschsprung disease as a yet undescribed phenotype in a patient with ARID1B mutation.

Science.gov (United States)

Takenouchi, Toshiki; Yoshihashi, Hiroshi; Sakaguchi, Yuri; Uehara, Tomoko; Honda, Masataka; Takahashi, Takao; Kosaki, Kenjiro; Miyama, Sahoko

2016-12-01

Mutations in the BAF complex (mammalian SWI/SNF complex) are responsible for Coffin-Siris syndrome, which is characterized by developmental delay, distinctive facial features, hirsutism, and hypoplasia/aplasia of the fifth finger/fingernails. Hirschsprung disease is characterized by defective stem cells in the enteric neural system, and the involvement of multiple signaling cascades has been implicated. So far, the roles of the BAF complex in the genesis of Hirschsprung disease have remained unknown. Here, we document a patient with coarse facial features, postnatal growth failure, developmental delay, epilepsy, and hypoplasia of the corpus callosum and cerebellum but without a hypoplastic fifth finger/fingernail. In addition, he had Hirschsprung disease. Exome sequencing with a gene set representing a total of 4,813 genes with known relationships to human diseases revealed a heterozygous frameshift mutation in ARID1B (c.5789delC p.Pro1930Leufs*44). The presence of a congenital cataract and Hirschsprung disease in the presently reported patient further expands the phenotypic spectrum of patients with ARID1B mutations and may suggest the potential role of the BAF complex in the pathogenesis of the enteric neural system. The present observation is in agreement with a recent study of Drosophila neuroblasts showing that the dysregulated BAF complex leads to an abnormal lineage progression of neural stem cell lineages and that Hirschsprung disease is caused by abnormal stem cell lineages in the peripheral neural tissues. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Mutation of the PAX6 gene in a sporadic patient with atypical aniridia

Energy Technology Data Exchange (ETDEWEB)

Zhu, D.; Li, Y.; Traboulsi, E.I. [Wilmer Eye Institute, Baltimore, MD (United States)] [and others

1994-09-01

A 28 year-old man presented with poor vision since childhood and gradual further decline of several years duration. His visual acuity measures 20/200 OD with -11.50 + 0.50 x 150 and 20/100 OS with -12.25 + 0.25 x 35. He had a fine nystagmus. His visual fields were full. There was a circumferential pannus with areas of corneal stromal opacification. The iris was hypoplastic with atypical colobomatous defects. The lenses had scattered cortical opacities. The intraocular pressures were normal. The optic nerves had cup disk ratios of 0.6 OU. The family history was negative for similar defects. A diagnosis of aniridia was made and blood was drawn for analysis of the PAX6 gene. PCR amplification of exon 5 showed heterozygous fragments with one allele being larger than normal. Direct DNA sequencing of the individual heterozygous allele showed a 41 base pair insertion at nucleotide 483 in exon 5 of the paired domain. This frameshift mutation changed codon 71 to a stop codon. The diagnosis of aniridia was confirmed in this atypical patient, who will need to be monitored for his high risk of glaucoma. The risk of developing Wilms` tumor in patients with mutations within the aniridia gene is presumably negligible since the neighboring Wilms` tumor gene is unaffected. The identification of intragenic mutations of the PAX6 gene in patients with sporadic aniridia modifies the management of such patients because of recognition of the increased risk of glaucoma and by reducing the necessity for frequent monitoring for the presence of Wilms` tumor.

A role for MLH3 in hereditary nonpolyposis colorectal cancer

NARCIS (Netherlands)

Wu, Y; Berends, MJW; Sijmons, RH; Mensink, RGJ; Verlind, E; Kooi, KA; van der Sluis, T; Kempinga, C; van der Zee, AGJ; Hollema, H; Buys, CHCM; Kleibeuker, JH; Hofstra, RMW

2001-01-01

We investigated a possible role of the mismatch-repair gene MLH3 in hereditary nonpolyposis colorectal cancer by scanning for mutations in 39 HNPCC families and in 288 patients suspected of having HNPCC. We identified ten different germline MLH3 variants, one frameshift and nine missense mutations,

A Novel Heterozygous Intronic Mutation in the FBN1 Gene Contributes to FBN1 RNA Missplicing Events in the Marfan Syndrome

Directory of Open Access Journals (Sweden)

Mario Torrado

2018-01-01

Full Text Available Marfan syndrome (MFS is an autosomal dominantly inherited connective tissue disorder, mostly caused by mutations in the fibrillin-1 (FBN1 gene. We, by using targeted next-generation sequence analysis, identified a novel intronic FBN1 mutation (the c.2678-15C>A variant in a MFS patient with aortic dilatation. The computational predictions showed that the heterozygous c.2678-15C>A intronic variant might influence the splicing process by differentially affecting canonical versus cryptic splice site utilization within intron 22 of the FBN1 gene. RT-PCR and Western blot analyses, using FBN1 minigenes transfected into HeLa and COS-7 cells, revealed that the c.2678-15C>A variant disrupts normal splicing of intron 22 leading to aberrant 13-nt intron 22 inclusion, frameshift, and premature termination codon. Collectively, the results strongly suggest that the c.2678-15C>A variant could lead to haploinsufficiency of the FBN1 functional protein and structural connective tissue fragility in MFS complicated by aorta dilation, a finding that further expands on the genetic basis of aortic pathology.

A 3-day-old neonate with severe hypertriglyceridemia from novel mutations of the GPIHBP1 gene.

Science.gov (United States)

Buonuomo, Paola Sabrina; Bartuli, Andrea; Rabacchi, Claudio; Bertolini, Stefano; Calandra, Sebastiano

2015-01-01

Familial chylomicronemia is a genetic defect of the intravascular lipolysis of triglyceride (TG)-rich lipoproteins. Intravascular lipolysis involves the TG-hydrolase lipoprotein lipase (LPL) as well as other factors such as apolipoprotein CII and apolipoprotein AV (activators of LPL), GPIHBP1 (the molecular platform required for LPL activity on endothelial surface), and LMF1 (a factor required for intracellular formation of active LPL). We sequenced the familial chylomicronemia candidate genes in a neonate with chylomicronemia. A 3-day-old newborn was found to have chylomicronemia (plasma TG 18.8 mmol/L, 1.667 mg/dL). The discontinuation of breastfeeding for 24 hours reduced plasma TG to 2.3 mmol/L (201 mg/dL), whereas its resumption induced a sharp TG increase (7.9 mmol/L, 690 mg/dL). The child was switched to a low-fat diet, which was effective in maintaining TG level below 3.5 mmol/L (294 mg/dL) during the first months of life. The child was found to be a compound heterozygous for 2 novel mutations in GPIHBP1 gene. The first mutation was a 9-bp deletion and 4-bp insertion in exon 2, causing a frameshift that abolished the canonical termination codon TGA. The predicted translation product of the mutant messenger RNA is a peptide that contains 51 amino acids of the N-terminal end of the wild-type protein followed by 252 novel amino acids. The second mutation was a nucleotide change (c.319T>C), causing an amino acid substitution p.(Ser107Pro) predicted in silico to be damaging. GPIHBP1 mutations should be considered in neonates with chylomicronemia negative for mutations in LPL gene. Copyright © 2015 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Juvenile-onset Sporadic Amyotrophic Lateral Sclerosis with a Frameshift FUS Gene Mutation Presenting Unique Neuroradiological Findings and Cognitive Impairment.

Science.gov (United States)

Hirayanagi, Kimitoshi; Sato, Masayuki; Furuta, Natsumi; Makioka, Kouki; Ikeda, Yoshio

2016-01-01

A 24-year-old Japanese woman developed anterocollis, weakness of the proximal arms, and subsequent cognitive impairment. A neurological examination revealed amyotrophic lateral sclerosis (ALS) without a family history. Systemic muscle atrophy progressed rapidly. Cerebral MRI clearly exhibited high signal intensities along the bilateral pyramidal tracts. An analysis of the FUS gene revealed a heterozygous two-base pair deletion, c.1507-1508delAG (p.G504WfsX515). A subset of juvenile-onset familial/sporadic ALS cases with FUS gene mutations reportedly demonstrates mental retardation or learning difficulty. Our study emphasizes the importance of conducting a FUS gene analysis in juvenile-onset ALS cases, even when no family occurrence is confirmed.

Suppression of different classes of somatic mutations in Arabidopsis by vir gene-expressing Agrobacterium strains.

Science.gov (United States)

Shah, Jasmine M; Ramakrishnan, Anantha Maharasi; Singh, Amit Kumar; Ramachandran, Subalakshmi; Unniyampurath, Unnikrishnan; Jayshankar, Ajitha; Balasundaram, Nithya; Dhanapal, Shanmuhapreya; Hyde, Geoff; Baskar, Ramamurthy

2015-08-26

Agrobacterium infection, which is widely used to generate transgenic plants, is often accompanied by T-DNA-linked mutations and transpositions in flowering plants. It is not known if Agrobacterium infection also affects the rates of point mutations, somatic homologous recombinations (SHR) and frame-shift mutations (FSM). We examined the effects of Agrobacterium infection on five types of somatic mutations using a set of mutation detector lines of Arabidopsis thaliana. To verify the effect of secreted factors, we exposed the plants to different Agrobacterium strains, including wild type (Ach5), its derivatives lacking vir genes, oncogenes or T-DNA, and the heat-killed form for 48 h post-infection; also, for a smaller set of strains, we examined the rates of three types of mutations at multiple time-points. The mutation detector lines carried a non-functional β-glucuronidase gene (GUS) and a reversion of mutated GUS to its functional form resulted in blue spots. Based on the number of blue spots visible in plants grown for a further two weeks, we estimated the mutation frequencies. For plants co-cultivated for 48 h with Agrobacterium, if the strain contained vir genes, then the rates of transversions, SHRs and FSMs (measured 2 weeks later) were lower than those of uninfected controls. In contrast, co-cultivation for 48 h with any of the Agrobacterium strains raised the transposition rates above control levels. The multiple time-point study showed that in seedlings co-cultivated with wild type Ach5, the reduced rates of transversions and SHRs after 48 h co-cultivation represent an apparent suppression of an earlier short-lived increase in mutation rates (peaking for plants co-cultivated for 3 h). An increase after 3 h co-cultivation was also seen for rates of transversions (but not SHR) in seedlings exposed to the strain lacking vir genes, oncogenes and T-DNA. However, the mutation rates in plants co-cultivated for longer times with this strain subsequently

Alternative Splicing and Tissue-specific Elastin Misassembly Act as Biological Modifiers of Human Elastin Gene Frameshift Mutations Associated with Dominant Cutis Laxa*

Science.gov (United States)

Sugitani, Hideki; Hirano, Eiichi; Knutsen, Russell H.; Shifren, Adrian; Wagenseil, Jessica E.; Ciliberto, Christopher; Kozel, Beth A.; Urban, Zsolt; Davis, Elaine C.; Broekelmann, Thomas J.; Mecham, Robert P.

2012-01-01

Elastin is the extracellular matrix protein in vertebrates that provides elastic recoil to blood vessels, the lung, and skin. Because the elastin gene has undergone significant changes in the primate lineage, modeling elastin diseases in non-human animals can be problematic. To investigate the pathophysiology underlying a class of elastin gene mutations leading to autosomal dominant cutis laxa, we engineered a cutis laxa mutation (single base deletion) into the human elastin gene contained in a bacterial artificial chromosome. When expressed as a transgene in mice, mutant elastin was incorporated into elastic fibers in the skin and lung with adverse effects on tissue function. In contrast, only low levels of mutant protein incorporated into aortic elastin, which explains why the vasculature is relatively unaffected in this disease. RNA stability studies found that alternative exon splicing acts as a modifier of disease severity by influencing the spectrum of mutant transcripts that survive nonsense-mediated decay. Our results confirm the critical role of the C-terminal region of tropoelastin in elastic fiber assembly and suggest tissue-specific differences in the elastin assembly pathway. PMID:22573328

In silico characterization of a novel pathogenic deletion mutation identified in XPA gene in a Pakistani family with severe xeroderma pigmentosum.

Science.gov (United States)

Nasir, Muhammad; Ahmad, Nafees; Sieber, Christian M K; Latif, Amir; Malik, Salman Akbar; Hameed, Abdul

2013-09-24

Xeroderma Pigmentosum (XP) is a rare skin disorder characterized by skin hypersensitivity to sunlight and abnormal pigmentation. The aim of this study was to investigate the genetic cause of a severe XP phenotype in a consanguineous Pakistani family and in silico characterization of any identified disease-associated mutation. The XP complementation group was assigned by genotyping of family for known XP loci. Genotyping data mapped the family to complementation group A locus, involving XPA gene. Mutation analysis of the candidate XP gene by DNA sequencing revealed a novel deletion mutation (c.654del A) in exon 5 of XPA gene. The c.654del A, causes frameshift, which pre-maturely terminates protein and result into a truncated product of 222 amino acid (aa) residues instead of 273 (p.Lys218AsnfsX5). In silico tools were applied to study the likelihood of changes in structural motifs and thus interaction of mutated protein with binding partners. In silico analysis of mutant protein sequence, predicted to affect the aa residue which attains coiled coil structure. The coiled coil structure has an important role in key cellular interactions, especially with DNA damage-binding protein 2 (DDB2), which has important role in DDB-mediated nucleotide excision repair (NER) system. Our findings support the fact of genetic and clinical heterogeneity in XP. The study also predicts the critical role of DDB2 binding region of XPA protein in NER pathway and opens an avenue for further research to study the functional role of the mutated protein domain.

Fluoroquinolone Resistance Mechanisms in an Escherichia coli Isolate, HUE1, Without Quinolone Resistance-Determining Region Mutations

Directory of Open Access Journals (Sweden)

Toyotaka eSato

2013-05-01

Full Text Available Fluoroquinolone resistance can cause major clinical problems. Here, we investigated fluoroquinolone resistance mechanisms in a clinical Escherichia coli isolate, HUE1, which had no mutations quinolone resistance-determining regions (QRDRs of DNA gyrase and topoisomerase IV. HUE1 demonstrated MICs that exceeded the breakpoints for ciprofloxacin, levofloxacin, and norfloxacin. HUE1 harbored oqxAB and qnrS1 on distinct plasmids. In addition, it exhibited lower intracellular ciprofloxacin concentrations and higher mRNA expression levels of efflux pumps and their global activators than did reference strains. The genes encoding AcrR (local AcrAB repressor and MarR (MarA repressor were disrupted by insertion of the transposon IS3-IS629 and a frameshift mutation, respectively. A series of mutants derived from HUE1 were obtained by plasmid curing and gene knockout using homologous recombination. Compared to the MICs of the parent strain HUE1, the fluoroquinolone MICs of these mutants indicated that qnrS1, oqxAB, acrAB, acrF, acrD, mdtK, mdfA, and tolC contributed to the reduced susceptibility to fluoroquinolone in HUE1. Therefore, fluoroquinolone resistance in HUE1 is caused by concomitant acquisition of QnrS1 and OqxAB and overexpression of AcrAB−TolC and other chromosome-encoded efflux pumps. Thus, we have demonstrated that QRDR mutations are not absolutely necessary for acquiring fluoroquinolone resistance in E. coli.

Progressive retinal atrophy in Shetland sheepdog is associated with a mutation in the CNGA1 gene.

Science.gov (United States)

Wiik, A C; Ropstad, E O; Ekesten, B; Karlstam, L; Wade, C M; Lingaas, F

2015-10-01

Progressive retinal atrophy (PRA) is the collective name of a class of hereditary retinal dystrophies in the dog and is often described as the equivalent of retinitis pigmentosa in humans. PRA is characterized by visual impairment due to degeneration of the photoreceptors in the retina, usually leading to blindness. PRA has been reported in dogs from more than 100 breeds and can be genetically heterogeneous both between and within breeds. The disease can be subdivided by age at onset and rate of progression. Using genome-wide association with 15 Shetland Sheepdog (Sheltie) cases and 14 controls, we identified a novel PRA locus on CFA13 (Praw  = 8.55 × 10(-7) , Pgenome  = 1.7 × 10(-4) ). CNGA1, which is known to be involved in human cases of retinitis pigmentosa, was located within the associated region and was considered a likely candidate gene. Sequencing of this gene identified a 4-bp deletion in exon 9 (c.1752_1755delAACT), leading to a frameshift and a premature stop codon. The study indicated genetic heterogeneity as the mutation was present in all PRA-affected individuals in one large family of Shelties, whereas some other cases in the studied Sheltie population were not associated with this CNGA1 mutation. To our knowledge, this is the first report of a mutation in CNGA1 causing PRA in dogs. © 2015 Stichting International Foundation for Animal Genetics.

Work-life balance utifrån ett arbetsgivarperspektiv : Om arbetsgivares arbete och inställning mot work-life balance

OpenAIRE

Eriksson, Johan

2014-01-01

I och med att tid spenderad på arbetsplatsen verkar fortsätta öka blir allt mindre och mindre tid kvar till familj och fritid, eller det som i denna uppsats benämns som övrigt liv. Den vanligaste orsaken till att en individ upplever obalans är att arbetssfären är för dominerande och lämnar kvar för lite tid till övriga sfärer. Därför har syftet i denna uppsats varit att öka förståelsen för hur och varför olika arbetsgivare arbetar med work-life balance samt att ta reda på vad de har för instä...

Paediatric intestinal cancer and polyposis due to bi-allelic PMS2 mutations: case series, review and follow-up guidelines.

Science.gov (United States)

Herkert, Johanna C; Niessen, Renée C; Olderode-Berends, Maria J W; Veenstra-Knol, Hermine E; Vos, Yvonne J; van der Klift, Heleen M; Scheenstra, Rene; Tops, Carli M J; Karrenbeld, Arend; Peters, Frans T M; Hofstra, Robert M W; Kleibeuker, Jan H; Sijmons, Rolf H

2011-05-01

Bi-allelic germline mutations of one of the DNA mismatch repair genes, so far predominantly found in PMS2, cause constitutional MMR-deficiency syndrome. This rare disorder is characterised by paediatric intestinal cancer and other malignancies. We report the clinical, immunohistochemical and genetic characterisation of four families with bi-allelic germline PMS2 mutations. We present an overview of the published gastrointestinal manifestations of CMMR-D syndrome and propose recommendations for gastro-intestinal screening. The first proband developed a cerebral angiosarcoma at age 2 and two colorectal adenomas at age 7. Genetic testing identified a complete PMS2 gene deletion and a frameshift c.736_741delinsTGTGTGTGAAG (p.Pro246CysfsX3) mutation. In the second family, both the proband and her brother had multiple intestinal adenomas, initially wrongly diagnosed as familial adenomatous polyposis. A splice site c.2174+1G>A, and a missense c.137G>T (p.Ser46Ile) mutation in PMS2 were identified. The third patient was diagnosed with multiple colorectal adenomas at age 11; he developed a high-grade dysplastic colorectal adenocarcinoma at age 21. Two intragenic PMS2 deletions were found. The fourth proband developed a cerebral anaplastic ganglioma at age 9 and a high-grade colerectal dysplastic adenoma at age 10 and carries a homozygous c.2174+1G>A mutation. Tumours of all patients showed microsatellite instability and/or loss of PMS2 expression. Our findings show the association between bi-allelic germline PMS2 mutations and severe childhood-onset gastrointestinal manifestations, and support the notion that patients with early-onset gastrointestinal adenomas and cancer should be investigated for CMMR-D syndrome. We recommend yearly follow-up with colonoscopy from age 6 and simultaneous video-capsule small bowel enteroscopy from age 8. Copyright © 2011 Elsevier Ltd. All rights reserved.

A novel two-nucleotide deletion in the ATP7A gene associated with delayed infantile onset of Menkes disease.

Science.gov (United States)

Wada, Takahito; Haddad, Marie Reine; Yi, Ling; Murakami, Tomomi; Sasaki, Akiko; Shimbo, Hiroko; Kodama, Hiroko; Osaka, Hitoshi; Kaler, Stephen G

2014-04-01

Determining the relationship between clinical phenotype and genotype in genetic diseases is important in clinical practice. In general, frameshift mutations are expected to produce premature termination codons, leading to production of mutant transcripts destined for degradation by nonsense-mediated decay. In X-linked recessive diseases, male patients with frameshift mutations typically have a severe or even lethal phenotype. We report a case of a 17-month-old boy with Menkes disease (NIM #309400), an X-linked recessive copper metabolism disorder caused by mutations in the ATP7A copper transporter gene. He exhibited an unexpectedly late onset and experienced milder symptoms. His genomic DNA showed a de novo two-nucleotide deletion in exon 4 of ATP7A, predicting a translational frameshift and premature stop codon, and a classic severe phenotype. Characterization of his ATP7A mRNA showed no abnormal splicing. We speculate that translation reinitiation could occur downstream to the premature termination codon and produce a partially functional ATP7A protein. Study of the child's fibroblasts found no evidence of translation reinitiation; however, the possibility remains that this phenomenon occurred in neural tissues and influenced the clinical phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

Biallelic mutation of UNC50, encoding a protein involved in AChR trafficking, is responsible for arthrogryposis.

Science.gov (United States)

Abiusi, Emanuela; D'Alessandro, Manuela; Dieterich, Klaus; Quevarec, Loic; Turczynski, Sandrina; Valfort, Aurore-Cecile; Mezin, Paulette; Jouk, Pierre Simon; Gut, Marta; Gut, Ivo; Bessereau, Jean Louis; Melki, Judith

2017-10-15

Arthrogryposis multiplex congenita (AMC) is a developmental condition characterized by multiple joint contractures resulting from reduced or absent fetal movements. Homozygosity mapping of disease loci combined with whole exome sequencing in a consanguineous family presenting with lethal AMC allowed the identification of a homozygous frameshift deletion in UNC50 gene (c.750_751del:p.Cys251Phefs*4) in the index case. To assess the effect of the mutation, an equivalent mutation in the Caenorhabditis elegans orthologous gene was created using CRISPR/Cas9. We demonstrated that unc-50(kr331) modification caused the loss of acetylcholine receptor (AChR) expression in C. elegans muscle. unc-50(kr331) animals were as resistant to the cholinergic agonist levamisole as unc-50 null mutants suggesting that AChRs were no longer expressed in this animal model. This was confirmed by using a knock-in strain in which a red fluorescent protein was inserted into the AChR locus: no signal was detected in unc-50(kr331) background, suggesting that UNC-50, a protein known to be involved in AChR trafficking, was no longer functional. These data indicate that biallelic mutation in the UNC50 gene underlies AMC through a probable loss of AChR expression at the neuromuscular junction which is essential for the cholinergic transmission during human muscle development. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mutations in PTRH2 cause novel infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, and muscle weakness.

Science.gov (United States)

Hu, Hao; Matter, Michelle L; Issa-Jahns, Lina; Jijiwa, Mayumi; Kraemer, Nadine; Musante, Luciana; de la Vega, Michelle; Ninnemann, Olaf; Schindler, Detlev; Damatova, Natalia; Eirich, Katharina; Sifringer, Marco; Schrötter, Sandra; Eickholt, Britta J; van den Heuvel, Lambert; Casamina, Chanel; Stoltenburg-Didinger, Gisela; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M

2014-12-01

To identify the cause of a so-far unreported phenotype of infantile-onset multisystem neurologic, endocrine, and pancreatic disease (IMNEPD). We characterized a consanguineous family of Yazidian-Turkish descent with IMNEPD. The two affected children suffer from intellectual disability, postnatal microcephaly, growth retardation, progressive ataxia, distal muscle weakness, peripheral demyelinating sensorimotor neuropathy, sensorineural deafness, exocrine pancreas insufficiency, hypothyroidism, and show signs of liver fibrosis. We performed whole-exome sequencing followed by bioinformatic analysis and Sanger sequencing on affected and unaffected family members. The effect of mutations in the candidate gene was studied in wild-type and mutant mice and in patient and control fibroblasts. In a consanguineous family with two individuals with IMNEPD, we identified a homozygous frameshift mutation in the previously not disease-associated peptidyl-tRNA hydrolase 2 (PTRH2) gene. PTRH2 encodes a primarily mitochondrial protein involved in integrin-mediated cell survival and apoptosis signaling. We show that PTRH2 is highly expressed in the developing brain and is a key determinant in maintaining cell survival during human tissue development. Moreover, we link PTRH2 to the mTOR pathway and thus the control of cell size. The pathology suggested by the human phenotype and neuroimaging studies is supported by analysis of mutant mice and patient fibroblasts. We report a novel disease phenotype, show that the genetic cause is a homozygous mutation in the PTRH2 gene, and demonstrate functional effects in mouse and human tissues. Mutations in PTRH2 should be considered in patients with undiagnosed multisystem neurologic, endocrine, and pancreatic disease.

Mutations in PTRH2 cause novel infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, and muscle weakness

Science.gov (United States)

Hu, Hao; Matter, Michelle L; Issa-Jahns, Lina; Jijiwa, Mayumi; Kraemer, Nadine; Musante, Luciana; de la Vega, Michelle; Ninnemann, Olaf; Schindler, Detlev; Damatova, Natalia; Eirich, Katharina; Sifringer, Marco; Schrötter, Sandra; Eickholt, Britta J; van den Heuvel, Lambert; Casamina, Chanel; Stoltenburg-Didinger, Gisela; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M

2014-01-01

Objective To identify the cause of a so-far unreported phenotype of infantile-onset multisystem neurologic, endocrine, and pancreatic disease (IMNEPD). Methods We characterized a consanguineous family of Yazidian-Turkish descent with IMNEPD. The two affected children suffer from intellectual disability, postnatal microcephaly, growth retardation, progressive ataxia, distal muscle weakness, peripheral demyelinating sensorimotor neuropathy, sensorineural deafness, exocrine pancreas insufficiency, hypothyroidism, and show signs of liver fibrosis. We performed whole-exome sequencing followed by bioinformatic analysis and Sanger sequencing on affected and unaffected family members. The effect of mutations in the candidate gene was studied in wild-type and mutant mice and in patient and control fibroblasts. Results In a consanguineous family with two individuals with IMNEPD, we identified a homozygous frameshift mutation in the previously not disease-associated peptidyl-tRNA hydrolase 2 (PTRH2) gene. PTRH2 encodes a primarily mitochondrial protein involved in integrin-mediated cell survival and apoptosis signaling. We show that PTRH2 is highly expressed in the developing brain and is a key determinant in maintaining cell survival during human tissue development. Moreover, we link PTRH2 to the mTOR pathway and thus the control of cell size. The pathology suggested by the human phenotype and neuroimaging studies is supported by analysis of mutant mice and patient fibroblasts. Interpretation We report a novel disease phenotype, show that the genetic cause is a homozygous mutation in the PTRH2 gene, and demonstrate functional effects in mouse and human tissues. Mutations in PTRH2 should be considered in patients with undiagnosed multisystem neurologic, endocrine, and pancreatic disease. PMID:25574476

Whole Exome Sequencing for a Patient with Rubinstein-Taybi Syndrome Reveals de Novo Variants besides an Overt CREBBP Mutation

Directory of Open Access Journals (Sweden)

Hee Jeong Yoo

2015-03-01

Full Text Available Rubinstein-Taybi syndrome (RSTS is a rare condition with a prevalence of 1 in 125,000–720,000 births and characterized by clinical features that include facial, dental, and limb dysmorphology and growth retardation. Most cases of RSTS occur sporadically and are caused by de novo mutations. Cytogenetic or molecular abnormalities are detected in only 55% of RSTS cases. Previous genetic studies have yielded inconsistent results due to the variety of methods used for genetic analysis. The purpose of this study was to use whole exome sequencing (WES to evaluate the genetic causes of RSTS in a young girl presenting with an Autism phenotype. We used the Autism diagnostic observation schedule (ADOS and Autism diagnostic interview revised (ADI-R to confirm her diagnosis of Autism. In addition, various questionnaires were used to evaluate other psychiatric features. We used WES to analyze the DNA sequences of the patient and her parents and to search for de novo variants. The patient showed all the typical features of Autism, WES revealed a de novo frameshift mutation in CREBBP and de novo sequence variants in TNC and IGFALS genes. Mutations in the CREBBP gene have been extensively reported in RSTS patients, while potential missense mutations in TNC and IGFALS genes have not previously been associated with RSTS. The TNC and IGFALS genes are involved in central nervous system development and growth. It is possible for patients with RSTS to have additional de novo variants that could account for previously unexplained phenotypes.

An XPA gene splicing mutation resulting in trace protein expression in an elderly patient with xeroderma pigmentosum group A without neurological abnormalities.

Science.gov (United States)

Takahashi, Y; Endo, Y; Kusaka-Kikushima, A; Nakamaura, S; Nakazawa, Y; Ogi, T; Uryu, M; Tsuji, G; Furue, M; Moriwaki, S

2017-07-01

A certain relationship between XPA gene mutations and the severity of symptoms has been observed in patients with xeroderma pigmentosum group A (XP-A). Patients with mutations within the DNA-binding domain usually exhibit severe symptoms, whereas splicing mutations in the same domain sometimes cause very mild symptoms. This inconsistency can be explained by a small amount of functional XPA protein produced from normally spliced transcripts. We herein report the case of an adult Japanese patient with XP-A with unusually mild symptoms. We identified a homozygous c.529G>A mutation in exon 4 of the XPA gene, which resulted in aberrant splicing with a 29-bp deletion in exon 4 causing a frameshift. Intact mRNA was observable, but a Western blot analysis failed to detect any normal XPA protein. We therefore evaluated the DNA repair capacity in normal cells in which the XPA expression was artificially diminished. The repair capacity was still present in cells with trace levels of the XPA protein. The repair capacity of the cells derived from our patient with mild symptoms was poor by comparison, but still significant compared with that of the cells derived from a patient with XP-A with severe symptoms. These results provide strong evidence that a trace level of XPA protein can still exert a relatively strong repair capacity, resulting in only a mild phenotype. © 2016 British Association of Dermatologists.

High Efficiency Gene Correction in Hematopoietic Cells by Donor-Template-Free CRISPR/Cas9 Genome Editing

Directory of Open Access Journals (Sweden)

Duran Sürün

2018-03-01

Full Text Available The CRISPR/Cas9 prokaryotic adaptive immune system and its swift repurposing for genome editing enables modification of any prespecified genomic sequence with unprecedented accuracy and efficiency, including targeted gene repair. We used the CRISPR/Cas9 system for targeted repair of patient-specific point mutations in the Cytochrome b-245 heavy chain gene (CYBB, whose inactivation causes chronic granulomatous disease (XCGD—a life-threatening immunodeficiency disorder characterized by the inability of neutrophils and macrophages to produce microbicidal reactive oxygen species (ROS. We show that frameshift mutations can be effectively repaired in hematopoietic cells by non-integrating lentiviral vectors carrying RNA-guided Cas9 endonucleases (RGNs. Because about 25% of most inherited blood disorders are caused by frameshift mutations, our results suggest that up to a quarter of all patients suffering from monogenic blood disorders could benefit from gene therapy employing personalized, donor template-free RGNs.

Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

Science.gov (United States)

Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

2014-04-01

Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia.

Directory of Open Access Journals (Sweden)

Tsutomu Ogata

Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.

A splice acceptor mutation in C. elegans daf-19/Rfx disrupts functional specialization of male-specific ciliated neurons but does not affect ciliogenesis.

Science.gov (United States)

Wells, Kristen L; Rowneki, Mazhgan; Killian, Darrell J

2015-04-01

RFX transcription factors are master regulators of ciliogenesis in diverse animal species. The sole Caenorhabditis elegans RFX homolog, DAF-19, plays at least two roles in the formation of functional cilia. The DAF-19(C) isoform is required for ciliogenesis and the DAF-19(M) isoform is required for the functional specialization of a subset of male-specific ciliated neurons called PKD neurons. Here we report the identification of a novel mutation, daf-19(sm129), which disrupts the functional specification of PKD neurons and thus suggests that daf-19m activity is compromised. However, ciliogenesis is not disrupted in daf-19(sm129) mutants suggesting that daf-19c activity is retained. The sm129 mutation disrupts a splice acceptor site adjacent to an exon common to the daf-19c and daf-19m isoforms resulting in aberrant splicing in a proportion of transcripts. While aberrant splicing of daf-19c to upstream cryptic sites results in in-frame and functional products, a large proportion of daf-19m mRNAs include the entire upstream intron, which introduces a frameshift and stop codons. At least 15% of disease-causing mutations affect splicing of the gene bearing the mutation, thus it is important to understand the consequences of splice site mutations on gene function. However, predicting the effects of a splice site mutation remains difficult and experimental determination is still required. Using daf-19(sm129) as a model, our results suggest that this problem is exacerbated when a splice acceptor mutation is used by multiple isoforms of the same gene because the effects on each isoform can be dramatically different. Copyright © 2015 Elsevier B.V. All rights reserved.

The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

Directory of Open Access Journals (Sweden)

Gregory N. Thyssen

2016-06-01

Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

SMARCA4 inactivating mutations cause concomitant Coffin–Siris syndrome, microphthalmia and small‐cell carcinoma of the ovary hypercalcaemic type

Science.gov (United States)

Mustafa, Noor; Vetro, Annalisa; Notarangelo, Lucia Dora; de Jonge, Hugo; Rinaldi, Berardo; Vergani, Debora; Giglio, Sabrina Rita; Morbini, Patrizia; Zuffardi, Orsetta

2017-01-01

Abstract SMARCA4 chromatin remodelling factor is mutated in 11% of Coffin–Siris syndrome (CSS) patients and in almost all small‐cell carcinoma of the ovary hypercalcaemic type (SCCOHT) tumours. Missense mutations with gain‐of‐function or dominant‐negative effects are associated with CSS, whereas inactivating mutations, leading to loss of SMARCA4 expression, have been exclusively found in SCCOHT. We applied whole‐exome sequencing to study a 15‐year‐old patient with mild CSS who concomitantly developed SCCOHT at age 13 years. Interestingly, our patient also showed congenital microphthalmia, which has never previously been reported in CSS patients. We detected a de novo germline heterozygous nonsense mutation in exon 19 of SMARCA4 (c.2935C > T;p.Arg979*), and a somatic frameshift mutation in exon 6 (c.1236_1236delC;p.Gln413Argfs*88), causing complete loss of SMARCA4 immunostaining in the tumour. The immunohistochemical findings are supported by the observation that the c.2935C > T mutant transcript was detected by reverse transcription polymerase chain reaction at a much lower level than the wild‐type allele in whole blood and the lymphoblastoid cell line of the proband, confirming nonsense‐mediated mRNA decay. Accordingly, immunoblotting demonstrated that there was approximately half the amount of SMARCA4 protein in the proband's cells as in controls. This study suggests that SMARCA4 constitutional mutations associated with CSS are not necessarily non‐truncating, and that haploinsufficiency may explain milder CSS phenotypes, as previously reported for haploinsufficient ARID1B. In addition, our case supports the dual role of chromatin remodellers in developmental disorders and cancer, as well as the involvement of SMARCA4 in microphthalmia, confirming previous findings in mouse models and the DECIPHER database. Finally, we speculate that mild CSS might be under‐recognized in a proportion of SCCOHT patients harbouring SMARCA4 mutations

CRISPR/Cas9 DNA cleavage at SNP-derived PAM enables both in vitro and in vivo KRT12 mutation-specific targeting.

Science.gov (United States)

Courtney, D G; Moore, J E; Atkinson, S D; Maurizi, E; Allen, E H A; Pedrioli, D M L; McLean, W H I; Nesbit, M A; Moore, C B T

2016-01-01

CRISPR/Cas9-based therapeutics hold the possibility for permanent treatment of genetic disease. The potency and specificity of this system has been used to target dominantly inherited conditions caused by heterozygous missense mutations through inclusion of the mutated base in the short-guide RNA (sgRNA) sequence. This research evaluates a novel approach for targeting heterozygous single-nucleotide polymorphisms (SNPs) using CRISPR/Cas9. We determined that a mutation within KRT12, which causes Meesmann's epithelial corneal dystrophy (MECD), leads to the occurrence of a novel protospacer adjacent motif (PAM). We designed an sgRNA complementary to the sequence adjacent to this SNP-derived PAM and evaluated its potency and allele specificity both in vitro and in vivo. This sgRNA was found to be highly effective at reducing the expression of mutant KRT12 mRNA and protein in vitro. To assess its activity in vivo we injected a combined Cas9/sgRNA expression construct into the corneal stroma of a humanized MECD mouse model. Sequence analysis of corneal genomic DNA revealed non-homologous end-joining repair resulting in frame-shifting deletions within the mutant KRT12 allele. This study is the first to demonstrate in vivo gene editing of a heterozygous disease-causing SNP that results in a novel PAM, further highlighting the potential for CRISPR/Cas9-based therapeutics.

Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

Energy Technology Data Exchange (ETDEWEB)

Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. (Royal Postgraduate Medical School, London (United Kingdom)); Vulliamy, T. (Hammersmith Hospital, London (United Kingdom))

1993-11-01

Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

Two novel exonic point mutations in HEXA identified in a juvenile Tay-Sachs patient: role of alternative splicing and nonsense-mediated mRNA decay.

Science.gov (United States)

Levit, A; Nutman, D; Osher, E; Kamhi, E; Navon, R

2010-06-01

We have identified three mutations in the beta-hexoseaminidase A (HEXA) gene in a juvenile Tay-Sachs disease (TSD) patient, which exhibited a reduced level of HEXA mRNA. Two mutations are novel, c.814G>A (p.Gly272Arg) and c.1305C>T (p.=), located in exon 8 and in exon 11, respectively. The third mutation, c.1195A>G (p.Asn399Asp) in exon 11, has been previously characterized as a common polymorphism in African-Americans. Hex A activity measured in TSD Glial cells, transfected with HEXA cDNA constructs bearing these mutations, was unaltered from the activity level measured in normal HEXA cDNA. Analysis of RT-PCR products revealed three aberrant transcripts in the patient, one where exon 8 was absent, one where exon 11 was absent and a third lacking both exons 10 and 11. All three novel transcripts contain frameshifts resulting in premature termination codons (PTCs). Transfection of mini-gene constructs carrying the c.814G>A and c.1305C>T mutations proved that the two mutations result in exon skipping. mRNAs that harbor a PTC are detected and degraded by the nonsense-mediated mRNA decay (NMD) pathway to prevent synthesis of abnormal proteins. However, although NMD is functional in the patient's fibroblasts, aberrant transcripts are still present. We suggest that the level of correctly spliced transcripts as well as the efficiency in which NMD degrade the PTC-containing transcripts, apparently plays an important role in the phenotype severity of the unique patient and thus should be considered as a potential target for drug therapy.

A novel ABCD1 mutation detected by next generation sequencing in presumed hereditary spastic paraplegia: A 30-year diagnostic delay caused by misleading biochemical findings.

Science.gov (United States)

Koutsis, Georgios; Lynch, David S; Tucci, Arianna; Houlden, Henry; Karadima, Georgia; Panas, Marios

2015-08-15

To present a Greek family in which 5 male and 2 female members developed progressive spastic paraplegia. Plasma very long chain fatty acids (VLCFA) were reportedly normal at first testing in an affected male and for over 30 years the presumed diagnosis was hereditary spastic paraplegia (HSP). Targeted next generation sequencing (NGS) was used as a further diagnostic tool. Targeted exome sequencing in the proband, followed by Sanger sequencing confirmation; mutation segregation testing in multiple family members and plasma VLCFA measurement in the proband. NGS of the proband revealed a novel frameshift mutation in ABCD1 (c.1174_1178del, p.Leu392Serfs*7), bringing an end to diagnostic uncertainty by establishing the diagnosis of adrenomyeloneuropathy (AMN), the myelopathic phenotype of X-linked adrenoleukodystrophy (ALD). The mutation segregated in all family members and the diagnosis of AMN/ALD was confirmed by plasma VLCFA measurement. Confounding factors that delayed the diagnosis are presented. This report highlights the diagnostic utility of NGS in patients with undiagnosed spastic paraplegia, establishing a molecular diagnosis of AMN, allowing proper genetic counseling and management, and overcoming the diagnostic delay that can be rarely caused by false negative VLCFA analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

Advanced cell-based modeling of the royal disease: characterization of the mutated F9 mRNA.

Science.gov (United States)

Martorell, L; Luce, E; Vazquez, J L; Richaud-Patin, Y; Jimenez-Delgado, S; Corrales, I; Borras, N; Casacuberta-Serra, S; Weber, A; Parra, R; Altisent, C; Follenzi, A; Dubart-Kupperschmitt, A; Raya, A; Vidal, F; Barquinero, J

2017-11-01

Essentials The Royal disease (RD) is a form of hemophilia B predicted to be caused by a splicing mutation. We generated an iPSC-based model of the disease allowing mechanistic studies at the RNA level. F9 mRNA analysis in iPSC-derived hepatocyte-like cells showed the predicted abnormal splicing. Mutated F9 mRNA level was very low but we also found traces of wild type transcripts. Background The royal disease is a form of hemophilia B (HB) that affected many descendants of Queen Victoria in the 19th and 20th centuries. It was found to be caused by the mutation F9 c.278-3A>G. Objective To generate a physiological cell model of the disease and to study F9 expression at the RNA level. Methods Using fibroblasts from skin biopsies of a previously identified hemophilic patient bearing the F9 c.278-3A>G mutation and his mother, we generated induced pluripotent stem cells (iPSCs). Both the patient's and mother's iPSCs were differentiated into hepatocyte-like cells (HLCs) and their F9 mRNA was analyzed using next-generation sequencing (NGS). Results and Conclusion We demonstrated the previously predicted aberrant splicing of the F9 transcript as a result of an intronic nucleotide substitution leading to a frameshift and the generation of a premature termination codon (PTC). The F9 mRNA level in the patient's HLCs was significantly reduced compared with that of his mother, suggesting that mutated transcripts undergo nonsense-mediated decay (NMD), a cellular mechanism that degrades PTC-containing mRNAs. We also detected small proportions of correctly spliced transcripts in the patient's HLCs, which, combined with genetic variability in splicing and NMD machineries, could partially explain some clinical variability among affected members of the European royal families who had lifespans above the average. This work allowed the demonstration of the pathologic consequences of an intronic mutation in the F9 gene and represents the first bona fide cellular model of HB allowing the

Sonic Hedgehog mutations are not a common cause of congenital hypopituitarism in the absence of complex midline cerebral defects.

Science.gov (United States)

Paulo, Sabrina Soares; Fernandes-Rosa, Fábio L; Turatti, Wendy; Coeli-Lacchini, Fernanda Borchers; Martinelli, Carlos E; Nakiri, Guilherme S; Moreira, Ayrton C; Santos, Antônio C; de Castro, Margaret; Antonini, Sonir R

2015-04-01

Sonic Hedgehog (SHH) and GLI2, an obligatory mediator of SHH signal transduction, are holoprosencephaly (HPE)-associated genes essential in pituitary formation. GLI2 variants have been found in patients with congenital hypopituitarism without complex midline cerebral defects (MCD). However, data on the occurrence of SHH mutations in these patients are limited. We screened for SHH and GLI2 mutations or copy number variations (CNV) in patients with congenital hypopituitarism without MCD or with variable degrees of MCD. Detailed data on clinical, laboratory and neuroimaging findings of 115 patients presenting with congenital hypopituitarism without MCD, septo-optic dysplasia or HPE were analysed. The SHH and GLI2 genes were directly sequenced, and the presence of gene CNV was analysed by multiplex ligation-dependent probe amplification (MLPA). Anterior pituitary deficiency was found in 74% and 53% of patients with SOD or HPE, respectively. Diabetes insipidus was common in patients with HPE (47%) but infrequent in patients with congenital hypopituitarism or SOD (7% and 8%, respectively). A single heterozygous nonsense SHH mutation (p.Tyr175Ter) was found in a patient presenting with hypopituitarism and alobar HPE. No other SHH mutations or CNV were found. Nine GLI2 variations (8 missense and 1 frameshift) including a homozygous and a compound heterozygous variation were found in patients with congenital hypopituitarism or SOD, but not in HPE patients. No GLI2 CNV were found. SHH mutations or copy number variations are not a common cause of congenital hypopituitarism in patients without complex midline cerebral defects. GLI2 variants are found in some patients with congenital hypopituitarism without complex midline cerebral defects or septo-optic dysplasia. However, functional analyses of these variants are needed to strengthen genotype-phenotype relationship. © 2014 John Wiley & Sons Ltd.

F8 and F9 mutations in US haemophilia patients: correlation with history of inhibitor and race/ethnicity.

Science.gov (United States)

Miller, C H; Benson, J; Ellingsen, D; Driggers, J; Payne, A; Kelly, F M; Soucie, J M; Craig Hooper, W

2012-05-01

Both genetic and treatment-related risk factors contribute to the development of inhibitors in haemophilia. An inhibitor surveillance system piloted at 12 US sites has the goal of assessing risk factors through prospective data collection. This report examines the relationship of genotype and race/ethnicity to history of inhibitor in a large cohort of US haemophilia patients. Mutation analysis was performed on 676 haemophilia A (HA) and 153 haemophilia B (HB) patients by sequencing, Multiplex Ligation-dependent Probe Amplification, and PCR for inversions in F8 introns 22 (inv22) and 1 (inv1). Two HB patients with deletions had history of inhibitor. In severe HA, frequency of history of inhibitor was: large deletion 57.1%, splice site 35.7%, inv22 26.8%, nonsense 24.5%, frameshift 12.9%, inv1 11.1% and missense 9.5%. In HA, 19.6% of 321 White non-Hispanics (Whites), 37.1% of 35 Black non-Hispanics (Blacks) and 46.9% of 32 Hispanics had history of inhibitor (P = 0.0003). Mutation types and novel mutation rates were similar across ethnicities. When F8 haplotypes were constructed, Whites and Hispanics showed only H1 and H2. Within H1, history of inhibitor was 12.4% in Whites, 40.0% in Blacks (P = 0.009) and 32.4% in Hispanics (P = 0.002). Inhibitor frequency is confirmed to vary by mutation type and race in a large US population. White patients with history of inhibitor did not exhibit rare F8 haplotypes. F8 gene analysis did not reveal a cause for the higher inhibitor frequencies in Black and Hispanic patients. © 2011 Blackwell Publishing Ltd.

De novo mutations of KIAA2022 in females cause intellectual disability and intractable epilepsy.

Science.gov (United States)

de Lange, Iris M; Helbig, Katherine L; Weckhuysen, Sarah; Møller, Rikke S; Velinov, Milen; Dolzhanskaya, Natalia; Marsh, Eric; Helbig, Ingo; Devinsky, Orrin; Tang, Sha; Mefford, Heather C; Myers, Candace T; van Paesschen, Wim; Striano, Pasquale; van Gassen, Koen; van Kempen, Marjan; de Kovel, Carolien G F; Piard, Juliette; Minassian, Berge A; Nezarati, Marjan M; Pessoa, André; Jacquette, Aurelia; Maher, Bridget; Balestrini, Simona; Sisodiya, Sanjay; Warde, Marie Therese Abi; De St Martin, Anne; Chelly, Jamel; van 't Slot, Ruben; Van Maldergem, Lionel; Brilstra, Eva H; Koeleman, Bobby P C

2016-12-01

Mutations in the KIAA2022 gene have been reported in male patients with X-linked intellectual disability, and related female carriers were unaffected. Here, we report 14 female patients who carry a heterozygous de novo KIAA2022 mutation and share a phenotype characterised by intellectual disability and epilepsy. Reported females were selected for genetic testing because of substantial developmental problems and/or epilepsy. X-inactivation and expression studies were performed when possible. All mutations were predicted to result in a frameshift or premature stop. 12 out of 14 patients had intractable epilepsy with myoclonic and/or absence seizures, and generalised in 11. Thirteen patients had mild to severe intellectual disability. This female phenotype partially overlaps with the reported male phenotype which consists of more severe intellectual disability, microcephaly, growth retardation, facial dysmorphisms and, less frequently, epilepsy. One female patient showed completely skewed X-inactivation, complete absence of RNA expression in blood and a phenotype similar to male patients. In the six other tested patients, X-inactivation was random, confirmed by a non-significant twofold to threefold decrease of RNA expression in blood, consistent with the expected mosaicism between cells expressing mutant or normal KIAA2022 alleles. Heterozygous loss of KIAA2022 expression is a cause of intellectual disability in females. Compared with its hemizygous male counterpart, the heterozygous female disease has less severe intellectual disability, but is more often associated with a severe and intractable myoclonic epilepsy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Non-targeted mutagenesis of unirradiated lambda phage in Escherichia coli

International Nuclear Information System (INIS)

Wood, R.D.; Hutchinson, F.

1984-01-01

Non-targeted mutagenesis of lambda phage by ultraviolet light is the increase over background mutagenesis when non-irradiated phage are grown in irradiated Escherichia coli host cells. Such mutagenesis is caused by different processes from targeted mutagenesis, in which mutations in irradiated phage are correlated with photoproducts in the phage DNA. Non-irradiated phage grown in heavily irradiated uvr + host cells showed non-targeted mutations, which were 3/4 frameshifts, whereas targeted mutations were 2/3 transitions. For non-targeted mutagenesis in heavily irradiated host cells, there were one or two mutant phage per mutant burst. From the results of a series of experiments with various mutant host cells, a major pathway of non-targeted mutagenesis by ultraviolet light was proposed which acts in addition to ''SOS induction''. This pathway involves binding of the enzyme DNA polymerase I to damaged genomic DNA, and low polymerase activity leads to frameshift mutations during semiconservative DNA replication. The data suggest that this process will play a much smaller role in ultraviolet mutagenesis of the bacterial genome than it does in the mutagenesis of lambda phage. (author)

Mutación fundadora en una familia argentina con cáncer colorrectal hereditario Detection of a founder mutation in an Argentine family with hereditary non polyposis colorectal cancer

Directory of Open Access Journals (Sweden)

Laura Gómez

2010-02-01

Full Text Available El cáncer colorrectal hereditario no poliposo (CCHNP se relaciona con mutaciones en los genes reparadores de ADN (MLH1, MSH2 y MSH6. La mayoría de estas alteraciones son familia-específicas y su detección suele requerir la secuenciación completa de los genes relacionados. Se detectó una mutación puntual (2269-2270insT en el último codón del gen MLH1 en familias de un área del norte de Italia (Reggio Emilia y su origen se considera debido a un efecto fundador. En este trabajo presentamos una familia mendocina con CCHNP portadora de la misma mutación, cuyos ancestros eran oriundos de Reggio Emilia. Para la detección de la mutación se diseñó una estrategia basada en PCR y posterior corte enzimático. La mutación fue hallada en tres integrantes de la familia estudiada, dos de los cuales no presentaban sintomatología clínica. Estos pacientes fueron seguidos preventivamente mediante colonoscopias. La metodología utilizada en nuestro laboratorio fue específica y sensible para la detección de una mutación previamente registrada y permitió realizar el diagnóstico genético molecular en el país, evitando el envío de muestras al extranjero. Es de importancia destacar que el diagnóstico genético pre-sintomático de cáncer hereditario, enfocado desde un grupo multidisciplinario de profesionales, permite un mejor seguimiento y apoyo a las familias afectadas.Hereditary non polyposis colorectal cancer (HNPCC has been related to mutations in the DNA mismatch repair genes (MLH1, MSH2 y MSH6. Mutation detection analysis requires the complete sequencing of these genes, given the high frequency of family-specific alterations. A point mutation (2269- 2270insT in the last codon of the MLH1 gene has been detected in families from a northern region of Italy (Reggio Emilia.Given that this alteration was registered only in people from this region, it has been considered a founder mutation. In this work, we present an Argentine HNPCC family

Mutations in CEP78 Cause Cone-Rod Dystrophy and Hearing Loss Associated with Primary-Cilia Defects.

Science.gov (United States)

Nikopoulos, Konstantinos; Farinelli, Pietro; Giangreco, Basilio; Tsika, Chrysanthi; Royer-Bertrand, Beryl; Mbefo, Martial K; Bedoni, Nicola; Kjellström, Ulrika; El Zaoui, Ikram; Di Gioia, Silvio Alessandro; Balzano, Sara; Cisarova, Katarina; Messina, Andrea; Decembrini, Sarah; Plainis, Sotiris; Blazaki, Styliani V; Khan, Muhammad Imran; Micheal, Shazia; Boldt, Karsten; Ueffing, Marius; Moulin, Alexandre P; Cremers, Frans P M; Roepman, Ronald; Arsenijevic, Yvan; Tsilimbaris, Miltiadis K; Andréasson, Sten; Rivolta, Carlo

2016-09-01

Cone-rod degeneration (CRD) belongs to the disease spectrum of retinal degenerations, a group of hereditary disorders characterized by an extreme clinical and genetic heterogeneity. It mainly differentiates from other retinal dystrophies, and in particular from the more frequent disease retinitis pigmentosa, because cone photoreceptors degenerate at a higher rate than rod photoreceptors, causing severe deficiency of central vision. After exome analysis of a cohort of individuals with CRD, we identified biallelic mutations in the orphan gene CEP78 in three subjects from two families: one from Greece and another from Sweden. The Greek subject, from the island of Crete, was homozygous for the c.499+1G>T (IVS3+1G>T) mutation in intron 3. The Swedish subjects, two siblings, were compound heterozygotes for the nearby mutation c.499+5G>A (IVS3+5G>A) and for the frameshift-causing variant c.633delC (p.Trp212Glyfs(∗)18). In addition to CRD, these three individuals had hearing loss or hearing deficit. Immunostaining highlighted the presence of CEP78 in the inner segments of retinal photoreceptors, predominantly of cones, and at the base of the primary cilium of fibroblasts. Interaction studies also showed that CEP78 binds to FAM161A, another ciliary protein associated with retinal degeneration. Finally, analysis of skin fibroblasts derived from affected individuals revealed abnormal ciliary morphology, as compared to that of control cells. Altogether, our data strongly suggest that mutations in CEP78 cause a previously undescribed clinical entity of a ciliary nature characterized by blindness and deafness but clearly distinct from Usher syndrome, a condition for which visual impairment is due to retinitis pigmentosa. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

RUNX2 analysis of Danish cleidocranial dysplasia families

DEFF Research Database (Denmark)

Hansen, L; Riis, A K; Silahtaroglu, A

2011-01-01

Cleidocranial dysplasia (CCD) is an autosomal dominant inherited disease caused by mutations in the Runt gene RUNX2. Screening of 19 Danish CCD families revealed 16 pathogenic mutations (84%) representing 8 missense mutations, 2 nonsense mutations, 4 frame-shift mutations and 2 large deletions...... in the RUNX2 locus. Eight mutations were novel, two were found twice, and polymorphisms were found in the promoter region and in the conserved polyglutamine/polyalanine repeat. A large duplication downstream of RUNX2 found in one patient suggests a possible regulatory RUNX2 element. The CCD phenotypes...

Identification and verification of a pathogenic MLH1 mutation c.1145dupA in a Lynch syndrome family

Directory of Open Access Journals (Sweden)

Huang Feifei

2017-06-01

Full Text Available Lynch syndrome (LS, an autosomal-dominant disorder with an increased risk of predominantly colorectal and endometrial cancers, is caused by germ-line mutations in mismatch repair genes. The identification of germ-line mutations that predispose to cancer is important to further our understanding of tumorigenesis, guide patient management and inform the best practice for healthcare. A 45-year-old woman with atypical endometrial hyperplasia who suffered colon cancer at the age of 30 years underwent hysterectomy and genetic counseling. Pedigree analysis revealed her family fulfilling the Amsterdam I criteria. Next-generation sequencing was offered to the patient. A mutation in the MLH1 gene, c.1145dupA, was identified and verified by Sanger sequencing. In addition, her nine family members were tested for the mutation. Two were affected (colon cancer at the age of 43 years and 45 years and one healthy relative carried the same mutation in the MLH1 gene. The mutation resulted in a frame-shift (p.Met383Aspfs*12 located in exon12, as well as a polypeptide truncation of 393 amino acids by the formation of a premature stop codon. An immunohistochemistry analysis of endometrial hyperplasia tissues revealed defects in MLH1 and PMS2 protein expression in the patient. Based on the 2015 American College of Medical Genetics and Genomics (ACMG guideline, we report this MLH1 c.1145dupA variation to be a pathogenic mutation that contributes to a strongly increased cancer risk in this LS family. Proper screening suggestions were offered to the three affected patients and the healthy carrier. To the best of our knowledge, this germ-line mutation of MLH1 was previously submitted to the Leiden Open Variation Database (LOVD database, but no comprehensive evidence or supporting observations were reported previously in the literature. The present report found a single nucleotide insertion in exon12 of the MLH1 gene, which can be considered causative of Lynch phenotype

Secondary mutation in a coding mononucleotide tract in MSH6 causes loss of immunoexpression of MSH6 in colorectal carcinomas with MLH1/PMS2 deficiency.

Science.gov (United States)

Shia, Jinru; Zhang, Liying; Shike, Moshe; Guo, Min; Stadler, Zsofia; Xiong, Xiaoling; Tang, Laura H; Vakiani, Efsevia; Katabi, Nora; Wang, Hangjun; Bacares, Ruben; Ruggeri, Jeanine; Boland, C Richard; Ladanyi, Marc; Klimstra, David S

2013-01-01

Immunohistochemical staining for DNA mismatch repair proteins may be affected by various biological and technical factors. Staining variations that could potentially lead to erroneous interpretations have been recognized. A recently recognized staining variation is the significant reduction of staining for MSH6 in some colorectal carcinomas. The frequency and specific characteristics of this aberrant MSH6 staining pattern, however, have not been well analyzed. In this study of 420 colorectal carcinoma samples obtained from patients fulfilling the Revised Bethesda Guidelines, we detected 9 tumors (2%) showing extremely limited staining for MSH6 with positive staining present in PMS2 protein-deficient carcinomas (n=5, including 1 with a pathogenic mutation in PMS2); and (2) MLH1, PMS2 and MSH2 normal but with chemotherapy or chemoradiation therapy before surgery (n=4). To test our hypothesis that somatic mutation in the coding region microsatellite of the MSH6 gene might be a potential underlying mechanism for such limited MSH6 staining, we evaluated frameshift mutation in a (C)(8) tract in exon 5 of the MSH6 gene in seven tumors that had sufficient DNA for analysis, and detected mutation in four; all four tumors belonged to the MLH1/PMS2-deficient group. In conclusion, our data outline the main scenarios where significant reduction of MSH6 staining is more likely to occur in colorectal carcinoma, and suggest that somatic mutations of the coding region microsatellites of the MSH6 gene is an underlying mechanism for this staining phenomenon in MLH1/PMS2-deficient carcinomas.

Widely Used Herpes Simplex Virus 1 ICP0 Deletion Mutant Strain dl1403 and Its Derivative Viruses Do Not Express Glycoprotein C Due to a Secondary Mutation in the gC Gene.

Directory of Open Access Journals (Sweden)

Cristina W Cunha

Full Text Available Herpes simplex virus 1 (HSV-1 ICP0 is a multi-functional phosphoprotein expressed with immediate early kinetics. An ICP0 deletion mutant, HSV-1 dl1403, has been widely used to study the roles of ICP0 in the HSV-1 replication cycle including gene expression, latency, entry and assembly. We show that HSV-1 dl1403 virions lack detectable levels of envelope protein gC, and that gC is not synthesized in infected cells. Sequencing of the gC gene from HSV-1 dl1403 revealed a single amino acid deletion that results in a frameshift mutation. The HSV-1 dl1403 gC gene is predicted to encode a polypeptide consisting of the original 62 N-terminal amino acids of the gC protein followed by 112 irrelevant, non-gC residues. The mutation was also present in a rescuant virus and in two dl1403-derived viruses, D8 and FXE, but absent from the parental 17+, suggesting that the mutation was introduced during the construction of the dl1403 virus, and not as a result of passage in culture.

Novel genetic linkage of rat Sp6 mutation to Amelogenesis imperfecta

Directory of Open Access Journals (Sweden)

Muto Taro

2012-06-01

Full Text Available Abstract Background Amelogenesis imperfecta (AI is an inherited disorder characterized by abnormal formation of tooth enamel. Although several genes responsible for AI have been reported, not all causative genes for human AI have been identified to date. AMI rat has been reported as an autosomal recessive mutant with hypoplastic AI isolated from a colony of stroke-prone spontaneously hypertensive rat strain, but the causative gene has not yet been clarified. Through a genetic screen, we identified the causative gene of autosomal recessive AI in AMI and analyzed its role in amelogenesis. Methods cDNA sequencing of possible AI-candidate genes so far identified using total RNA of day 6 AMI rat molars identified a novel responsible mutation in specificity protein 6 (Sp6. Genetic linkage analysis was performed between Sp6 and AI phenotype in AMI. To understand a role of SP6 in AI, we generated the transgenic rats harboring Sp6 transgene in AMI (Ami/Ami + Tg. Histological analyses were performed using the thin sections of control rats, AMI, and Ami/Ami + Tg incisors in maxillae, respectively. Results We found the novel genetic linkage between a 2-bp insertional mutation of Sp6 gene and the AI phenotype in AMI rats. The position of mutation was located in the coding region of Sp6, which caused frameshift mutation and disruption of the third zinc finger domain of SP6 with 11 cryptic amino acid residues and a stop codon. Transfection studies showed that the mutant protein can be translated and localized in the nucleus in the same manner as the wild-type SP6 protein. When we introduced the CMV promoter-driven wild-type Sp6 transgene into AMI rats, the SP6 protein was ectopically expressed in the maturation stage of ameloblasts associated with the extended maturation stage and the shortened reduced stage without any other phenotypical changes. Conclusion We propose the addition of Sp6 mutation as a new molecular diagnostic criterion for the

Novel genetic linkage of rat Sp6 mutation to Amelogenesis imperfecta

Science.gov (United States)

2012-01-01

Background Amelogenesis imperfecta (AI) is an inherited disorder characterized by abnormal formation of tooth enamel. Although several genes responsible for AI have been reported, not all causative genes for human AI have been identified to date. AMI rat has been reported as an autosomal recessive mutant with hypoplastic AI isolated from a colony of stroke-prone spontaneously hypertensive rat strain, but the causative gene has not yet been clarified. Through a genetic screen, we identified the causative gene of autosomal recessive AI in AMI and analyzed its role in amelogenesis. Methods cDNA sequencing of possible AI-candidate genes so far identified using total RNA of day 6 AMI rat molars identified a novel responsible mutation in specificity protein 6 (Sp6). Genetic linkage analysis was performed between Sp6 and AI phenotype in AMI. To understand a role of SP6 in AI, we generated the transgenic rats harboring Sp6 transgene in AMI (Ami/Ami + Tg). Histological analyses were performed using the thin sections of control rats, AMI, and Ami/Ami + Tg incisors in maxillae, respectively. Results We found the novel genetic linkage between a 2-bp insertional mutation of Sp6 gene and the AI phenotype in AMI rats. The position of mutation was located in the coding region of Sp6, which caused frameshift mutation and disruption of the third zinc finger domain of SP6 with 11 cryptic amino acid residues and a stop codon. Transfection studies showed that the mutant protein can be translated and localized in the nucleus in the same manner as the wild-type SP6 protein. When we introduced the CMV promoter-driven wild-type Sp6 transgene into AMI rats, the SP6 protein was ectopically expressed in the maturation stage of ameloblasts associated with the extended maturation stage and the shortened reduced stage without any other phenotypical changes. Conclusion We propose the addition of Sp6 mutation as a new molecular diagnostic criterion for the autosomal recessive AI patients

Dural ectasia and FBN1 mutation screening of 40 patients with Marfan syndrome and related disorders: role of dural ectasia for the diagnosis.

Science.gov (United States)

Attanasio, Monica; Pratelli, Elisa; Porciani, Maria Cristina; Evangelisti, Lucia; Torricelli, Elena; Pellicanò, Giannantonio; Abbate, Rosanna; Gensini, Gian Franco; Pepe, Guglielmina

2013-07-01

Marfan syndrome is an autosomal dominant disorder of connective tissue caused by mutations in the gene encoding fibrillin-1 (FBN1), a matrix component of microfibrils. Dural ectasia, i.e. enlargement of the neural canal mainly located in the lower lumbar and sacral region, frequently occurs in Marfan patients. The aim of our study was to investigate the role of dural ectasia in raising the diagnosis of Marfan syndrome and its association with FBN1 mutations. We studied 40 unrelated patients suspected for MFS, who underwent magnetic resonance imaging searching for dural ectasia. In all of them FBN1 gene analysis was also performed. Thirty-seven patients resulted affected by Marfan syndrome according to the '96 Ghent criteria; in 30 of them the diagnosis was confirmed when revaluated by the recently revised criteria (2010). Thirty-six patients resulted positive for dural ectasia. The degree of dural ectasia was grade 1 in 19 patients, grade 2 in 11 patients, and grade 3 in 6 patients. In 7 (24%) patients, the presence of dural ectasia allowed to reach a positive score for systemic feature criterion. Twenty-four patients carried an FBN1 mutation, that were represented by 13 missense (54%), and 11 (46%) mutations generating a premature termination codon (PTC, frameshifts and stop codons). No mutation was detected in the remaining 16 (6 patients with MFS and 10 with related disorders according to revised Ghent criteria). The prevalence of severe (grade 2 and grade 3) involvement of dura mater was higher in patients harbouring premature termination codon (PTC) mutations than those carrying missense-mutations (8/11 vs 2/13, P = 0.0111). Our data emphasizes the importance of dural ectasia screening to reach the diagnosis of Marfan syndrome especially when it is uncertain and indicates an association between PTC mutations and severe dural ectasia in Marfan patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

Science.gov (United States)

Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

2013-01-01

Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Reduced lentivirus susceptibility in sheep with TMEM154 mutations.

Science.gov (United States)

Heaton, Michael P; Clawson, Michael L; Chitko-Mckown, Carol G; Leymaster, Kreg A; Smith, Timothy P L; Harhay, Gregory P; White, Stephen N; Herrmann-Hoesing, Lynn M; Mousel, Michelle R; Lewis, Gregory S; Kalbfleisch, Theodore S; Keen, James E; Laegreid, William W

2012-01-01

Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10(-9)). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection.

Disease: H01897 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available utosomal recessive mode of inheritance, characterized by abnormal eggs that lack a zona pellucida has been report...ed. ... A homozygous frameshift mutation in ZP1 has been identified. Recently, it has been report

The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

Science.gov (United States)

Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

2017-06-01

The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Biological effects of dyes on bacteria. VI. Mutation induction by acridine orange and methylene blue in the dark with special reference to Escherichia coli WP6 (polA1)

Energy Technology Data Exchange (ETDEWEB)

Webb, R.B.; Hass, B.S.

1984-01-01

Acridine orange (AO) and methylene blue (MB) in the dark were shown to be weak to moderate mutagens (induction of resistance to T5 phage) in repair-deficient strains of Escherichia coli B/r. However, strain WP2, (wild-type) was not mutated by AO in the dark, in confirmation of earlier data. The presence of 2 ..mu..M AO reduced by 41% the spontaneous mutation rate in strain WP2, from 4.1 to 2.4 mutants/10/sup 8/ cells/generation. In the polymerase I-deficient strain WP6 (polA1), 2 ..mu..M AO increased the mutation rate in the dark 14-fold. It is proposed that both spontaneous and AO-induced mutagenesis in the absence of light occur at the site of semiconservative DNA replication. If the intercalation mechanism for the effects in the absence of light is valid, the wild-type strain (WP2) may be resistant to frameshift mutagenesis induced by intercalated compounds, while the polymerase I-deficient strain (WP6) may be highly susceptible to the presence of an intercalated dye such as AO at the DNA-replication fork. MB and AO likely act through different mechanisms since MB is only a moderate mutagen in strain WP6 and the other repair-deficient strains tested.

Novel human mutation and CRISPR/Cas genome-edited mice reveal the importance of C-terminal domain of MSX1 in tooth and palate development.

Science.gov (United States)

Mitsui, Silvia Naomi; Yasue, Akihiro; Masuda, Kiyoshi; Naruto, Takuya; Minegishi, Yoshiyuki; Oyadomari, Seiichi; Noji, Sumihare; Imoto, Issei; Tanaka, Eiji

2016-12-05

Several mutations, located mainly in the MSX1 homeodomain, have been identified in non-syndromic tooth agenesis predominantly affecting premolars and third molars. We identified a novel frameshift mutation of the highly conserved C-terminal domain of MSX1, known as Msx homology domain 6 (MH6), in a Japanese family with non-syndromic tooth agenesis. To investigate the importance of MH6 in tooth development, Msx1 was targeted in mice with CRISPR/Cas system. Although heterozygous MH6 disruption did not alter craniofacial development, homozygous mice exhibited agenesis of lower incisors with or without cleft palate at E16.5. In addition, agenesis of the upper third molars and the lower second and third molars were observed in 4-week-old mutant mice. Although the upper second molars were present, they were abnormally small. These results suggest that the C-terminal domain of MSX1 is important for tooth and palate development, and demonstrate that that CRISPR/Cas system can be used as a tool to assess causality of human disorders in vivo and to study the importance of conserved domains in genes.

Association between mutation spectra and stable and unstable DNA adduct profiles in Salmonella for benzo[a]pyrene and dibenzo[a,l]pyrene

Energy Technology Data Exchange (ETDEWEB)

DeMarini, David M., E-mail: demarini.david@epa.gov [Integrated Systems Toxicology Division, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States); Hanley, Nancy M.; Warren, Sarah H.; Adams, Linda D.; King, Leon C. [Integrated Systems Toxicology Division, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States)

2011-09-01

Highlights: {yields} Benzo[a]pyrene (BP) induces stable DNA adducts and mutations primarily at guanine. {yields} Dibenzo[a,l]pyrene (DBP) induces them primarily at adenine. {yields} BP induces abasic sites, but DBP does not in the Salmonella mutagenicity assay. {yields} Stable DNA adducts alone appear to account for the mutation spectrum of DBP. {yields} Stable DNA adducts and possibly abasic sites account for the mutation spectrum of BP. - Abstract: Benzo[a]pyrene (BP) and dibenzo[a,l]pyrene (DBP) are two polycyclic aromatic hydrocarbons (PAHs) that exhibit distinctly different mutagenicity and carcinogenicity profiles. Although some studies show that these PAHs produce unstable DNA adducts, conflicting data and arguments have been presented regarding the relative roles of these unstable adducts versus stable adducts, as well as oxidative damage, in the mutagenesis and tumor-mutation spectra of these PAHs. However, no study has determined the mutation spectra along with the stable and unstable DNA adducts in the same system with both PAHs. Thus, we determined the mutagenic potencies and mutation spectra of BP and DBP in strains TA98, TA100 and TA104 of Salmonella, and we also measured the levels of abasic sites (aldehydic-site assay) and characterized the stable DNA adducts ({sup 32}P-postlabeling/HPLC) induced by these PAHs in TA104. Our results for the mutation spectra and site specificity of stable adducts were consistent with those from other systems, showing that DBP was more mutagenic than BP in TA98 and TA100. The mutation spectra of DBP and BP were significantly different in TA98 and TA104, with 24% of the mutations induced by BP in TA98 being complex frameshifts, whereas DBP produced hardly any of these mutations. In TA104, BP produced primarily GC to TA transversions, whereas DBP produced primarily AT to TA transversions. The majority (96%) of stable adducts induced by BP were at guanine, whereas the majority (80%) induced by DBP were at adenine

Acquired multi-azole resistance in Candida tropicalis during persistent urinary tract infection in a dog

Directory of Open Access Journals (Sweden)

Sergio Álvarez-Pérez

2016-03-01

Full Text Available Multi-azole resistance acquisition by Candida tropicalis after prolonged antifungal therapy in a dog with urinary candidiasis is reported. Pre- and post-azole treatment isolates were clonally related and had identical silent mutations in the ERG11 gene, but the latter displayed increased azole minimum inhibitory concentrations. A novel frameshift mutation in ERG3 was found in some isolates recovered after resistance development, so it appears unlikely that this mutation is responsible for multi-azole resistance.

SMARCA4 inactivating mutations cause concomitant Coffin-Siris syndrome, microphthalmia and small-cell carcinoma of the ovary hypercalcaemic type.

Science.gov (United States)

Errichiello, Edoardo; Mustafa, Noor; Vetro, Annalisa; Notarangelo, Lucia Dora; de Jonge, Hugo; Rinaldi, Berardo; Vergani, Debora; Giglio, Sabrina Rita; Morbini, Patrizia; Zuffardi, Orsetta

2017-09-01

SMARCA4 chromatin remodelling factor is mutated in 11% of Coffin-Siris syndrome (CSS) patients and in almost all small-cell carcinoma of the ovary hypercalcaemic type (SCCOHT) tumours. Missense mutations with gain-of-function or dominant-negative effects are associated with CSS, whereas inactivating mutations, leading to loss of SMARCA4 expression, have been exclusively found in SCCOHT. We applied whole-exome sequencing to study a 15-year-old patient with mild CSS who concomitantly developed SCCOHT at age 13 years. Interestingly, our patient also showed congenital microphthalmia, which has never previously been reported in CSS patients. We detected a de novo germline heterozygous nonsense mutation in exon 19 of SMARCA4 (c.2935C > T;p.Arg979*), and a somatic frameshift mutation in exon 6 (c.1236_1236delC;p.Gln413Argfs*88), causing complete loss of SMARCA4 immunostaining in the tumour. The immunohistochemical findings are supported by the observation that the c.2935C > T mutant transcript was detected by reverse transcription polymerase chain reaction at a much lower level than the wild-type allele in whole blood and the lymphoblastoid cell line of the proband, confirming nonsense-mediated mRNA decay. Accordingly, immunoblotting demonstrated that there was approximately half the amount of SMARCA4 protein in the proband's cells as in controls. This study suggests that SMARCA4 constitutional mutations associated with CSS are not necessarily non-truncating, and that haploinsufficiency may explain milder CSS phenotypes, as previously reported for haploinsufficient ARID1B. In addition, our case supports the dual role of chromatin remodellers in developmental disorders and cancer, as well as the involvement of SMARCA4 in microphthalmia, confirming previous findings in mouse models and the DECIPHER database. Finally, we speculate that mild CSS might be under-recognized in a proportion of SCCOHT patients harbouring SMARCA4 mutations. © 2017 The Authors. The

Non-targeted mutagenesis of unirradiated lambda phage in Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Wood, R.D.; Hutchinson, F. (Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry)

1984-03-05

Non-targeted mutagenesis of lambda phage by ultraviolet light is the increase over background mutagenesis when non-irradiated phage are grown in irradiated Escherichia coli host cells. Such mutagenesis is caused by different processes from targeted mutagenesis, in which mutations in irradiated phage are correlated with photoproducts in the phage DNA. Non-irradiated phage grown in heavily irradiated uvr/sup +/ host cells showed non-targeted mutations, which were 3/4 frameshifts, whereas targeted mutations were 2/3 transitions. For non-targeted mutagenesis in heavily irradiated host cells, there were one or two mutant phage per mutant burst. From the results of a series of experiments with various mutant host cells, a major pathway of non-targeted mutagenesis by ultraviolet light was proposed which acts in addition to ''SOS induction''. This pathway involves binding of the enzyme DNA polymerase I to damaged genomic DNA, and low polymerase activity leads to frameshift mutations during semiconservative DNA replication. The data suggest that this process will play a much smaller role in ultraviolet mutagenesis of the bacterial genome than it does in the mutagenesis of lambda phage.

Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations

NARCIS (Netherlands)

Stam, Anine H; Kothari, Parul H; Shaikh, Aisha; Gschwendter, Andreas; Jen, Joanna C; Hodgkinson, Suzanne; Hardy, Todd A; Hayes, Michael; Kempster, Peter A; Kotschet, Katya E; Bajema, Ingeborg M; van Duinen, Sjoerd G; Maat-Schieman, Marion L C; de Jong, Paulus T V M; de Smet, Marc D; de Wolff-Rouendaal, Didi; Dijkman, Greet; Pelzer, Nadine; Kolar, Grant R; Schmidt, Robert E; Lacey, JoAnne; Joseph, Daniel; Fintak, David R; Grand, M Gilbert; Brunt, Elizabeth M; Liapis, Helen; Hajj-Ali, Rula A; Kruit, Mark C; van Buchem, Mark A; Dichgans, Martin; Frants, Rune R; van den Maagdenberg, Arn M J M; Haan, Joost; Baloh, Robert W; Atkinson, John P; Terwindt, Gisela M; Ferrari, Michel D

2016-01-01

Cerebroretinal vasculopathy, hereditary vascular retinopathy, and hereditary endotheliopathy, retinopathy, nephropathy and stroke are neurovascular syndromes initially described as distinct entities. Recently they were shown to be one disease caused by C-terminal frame-shift mutations in TREX1,

Novel mutations in PANK2 and PLA2G6 genes in patients with neurodegenerative disorders: two case reports.

Science.gov (United States)

Dastsooz, Hassan; Nemati, Hamid; Fard, Mohammad Ali Farazi; Fardaei, Majid; Faghihi, Mohammad Ali

2017-08-18

Neurodegeneration with brain iron accumulation (NBIA) is a genetically heterogeneous group of disorders associated with progressive impairment of movement, vision, and cognition. The disease is initially diagnosed on the basis of changes in brain magnetic resonance imaging which indicate an abnormal brain iron accumulation in the basal ganglia. However, the diagnosis of specific types should be based on both clinical findings and molecular genetic testing for genes associated with different types of NBIA, including PANK2, PLA2G6, C19orf12, FA2H, ATP13A2, WDR45, COASY, FTL, CP, and DCAF17. The purpose of this study was to investigate disease-causing mutations in two patients with distinct NBIA disorders. Whole Exome sequencing using Next Generation Illumina Sequencing was used to enrich all exons of protein-coding genes as well as some other important genomic regions in these two affected patients. A deleterious homozygous four-nucleotide deletion causing frameshift deletion in PANK2 gene (c.1426_1429delATGA, p.M476 fs) was identified in an 8 years old girl with dystonia, bone fracture, muscle rigidity, abnormal movement, lack of coordination and chorea. In addition, our study revealed a novel missense mutation in PLA2G6 gene (c.3G > T:p.M1I) in one and half-year-old boy with muscle weakness and neurodevelopmental regression (speech, motor and cognition). The novel mutations were also confirmed by Sanger sequencing in the proband and their parents. Current study uncovered two rare novel mutations in PANK2 and PLA2G6 genes in patients with NBIA disorder and such studies may help to conduct genetic counseling and prenatal diagnosis more accurately for individuals at the high risk of these types of disorders.

Heterozygous Null Bone Morphogenetic Protein Receptor Type 2 Mutations Promote SRC Kinase-dependent Caveolar Trafficking Defects and Endothelial Dysfunction in Pulmonary Arterial Hypertension*

Science.gov (United States)

Prewitt, Allison R.; Ghose, Sampa; Frump, Andrea L.; Datta, Arumima; Austin, Eric D.; Kenworthy, Anne K.; de Caestecker, Mark P.

2015-01-01

Hereditary pulmonary arterial hypertension (HPAH) is a rare, fatal disease of the pulmonary vasculature. The majority of HPAH patients inherit mutations in the bone morphogenetic protein type 2 receptor gene (BMPR2), but how these promote pulmonary vascular disease is unclear. HPAH patients have features of pulmonary endothelial cell (PEC) dysfunction including increased vascular permeability and perivascular inflammation associated with decreased PEC barrier function. Recently, frameshift mutations in the caveolar structural protein gene Caveolin-1 (CAV-1) were identified in two patients with non-BMPR2-associated HPAH. Because caveolae regulate endothelial function and vascular permeability, we hypothesized that defects in caveolar function might be a common mechanism by which BMPR2 mutations promote pulmonary vascular disease. To explore this, we isolated PECs from mice carrying heterozygous null Bmpr2 mutations (Bmpr2+/−) similar to those found in the majority of HPAH patients. We show that Bmpr2+/− PECs have increased numbers and intracellular localization of caveolae and caveolar structural proteins CAV-1 and Cavin-1 and that these defects are reversed after blocking endocytosis with dynasore. SRC kinase is also constitutively activated in Bmpr2+/− PECs, and localization of CAV-1 to the plasma membrane is restored after treating Bmpr2+/− PECs with the SRC kinase inhibitor 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (PP2). Late outgrowth endothelial progenitor cells isolated from HPAH patients show similar increased activation of SRC kinase. Moreover, Bmpr2+/− PECs have impaired endothelial barrier function, and barrier function is restored after treatment with PP2. These data suggest that heterozygous null BMPR2 mutations promote SRC-dependent caveolar trafficking defects in PECs and that this may contribute to pulmonary endothelial barrier dysfunction in HPAH patients. PMID:25411245

Adrenocorticotropin-dependent precocious puberty of testicular origin in a boy with X-linked adrenal hypoplasia congenita due to a novel mutation in the DAX1 gene.

Science.gov (United States)

Domenice, S; Latronico, A C; Brito, V N; Arnhold, I J; Kok, F; Mendonca, B B

2001-09-01

Primary adrenal insufficiency is a rare condition in pediatric age, and its association with precocious sexual development is very uncommon. We report a 2-yr-old Brazilian boy with DAX1 gene mutation whose first clinical manifestation was isosexual gonadotropin-independent precocious puberty. He presented with pubic hair, enlarged penis and testes, and advanced bone age. T levels were elevated, whereas basal and GnRH-stimulated LH levels were compatible with a prepubertal pattern. Chronic GnRH agonist therapy did not reduce T levels, supporting the diagnosis of gonadotropin-independent precocious puberty. Testotoxicosis was ruled out after normal sequencing of exon 11 of the LH receptor gene. At age 3 yr he developed clinical and hormonal features of severe primary adrenal insufficiency. The entire coding region of the DAX1 gene was analyzed through direct sequencing. A nucleotide G insertion between nucleotides 430 and 431 in exon 1, resulting in a novel frameshift mutation and a premature stop codon at position 71 of DAX-1, was identified. Surprisingly, steroid replacement therapy induced a clear decrease in testicular size and T levels to the prepubertal range. These findings suggest that chronic excessive ACTH levels resulting from adrenal insufficiency may stimulate Leydig cells and lead to gonadotropin-independent precocious puberty in some boys with DAX1 gene mutations.

C-terminal truncations in human 3'-5' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

NARCIS (Netherlands)

Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schäfer, Ruth; Stam, Anine H.; Haan, Joost; de Jong, Paulus T. V. M.; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

2007-01-01

Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle-age onset. In nine families, we identified heterozygous C-terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

C-terminal truncations in human 3 '-5 ' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

NARCIS (Netherlands)

Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schaefer, Ruth; Stam, Anine H.; Haan, Joost; Paulus, T. V. M. de Jong; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle- age onset. In nine families, we identified heterozygous C- terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

Infrequent widespread microsatellite instability in hepatocellular carcinomas.

Science.gov (United States)

Yamamoto, H; Itoh, F; Fukushima, H; Kaneto, H; Sasaki, S; Ohmura, T; Satoh, T; Karino, Y; Endo, T; Toyota, J; Imai, K

2000-03-01

Widespread or high-frequency microsatellite instability (MSI) due to the defective DNA mismatch repair (MMR) occurs in the majority of hereditary non-polyposis colorectal cancer and a subset of sporadic malignant tumors. The incidence of MSI and underlying DNA MMR defects have been well characterized in gastrointestinal carcinogenesis, but not in hepatocarcinogenesis. To address the issue, we analyzed 55 Japanese hepatocellular carcinomas using several indicators of DNA MMR defects, such as microsatellite analysis, loss of heterozygosity (LOH) and mutation analysis of MMR genes, methylation of hMLH1 promoter, and frameshift mutations of mononucleotide repeat sequences within possible target genes. Mutation of beta2-microglobulin gene, which is presumably involved in MSI-positive tumor cell escape from immune surveillance was also examined. Some of these analyses were also carried out in 9 human liver cancer cell lines. None of the 3 quasi-monomorphic mononucleotide markers sensitive for MSI, BAT26, BAT25, and BAT34C4 presented shortened unstable alleles in any of the carcinoma, cirrhosis, chronic hepatitis tissues, or cell lines. LOH at MMR genes was infrequent (4.4 approximately 7.1%), and no mutations were detected. Neither hMLH1 hypermethylation nor frameshift mutation in the target genes was detected. No mutations were found in beta2-microglobulin. Widespread MSI due to the defective DNA MMR appears to play little if any part in Japanese hepatocarcinogenesis.

Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and Kelp fly virus.

Directory of Open Access Journals (Sweden)

Steven M Valles

Full Text Available Solenopsis invicta virus 3 (SINV-3 is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV, an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order.

Novel phenotypes of pyridox(am)ine-5'-phosphate oxidase deficiency and high prevalence of c.445_448del mutation in Chinese patients.

Science.gov (United States)

Xue, Jiao; Chang, Xingzhi; Zhang, Yuehua; Yang, Zhixian

2017-08-01

To analyze the clinical and genetic characteristics of Chinese patients with pyridox(am)ine-5'-phosphate oxidase (PNPO) deficiency. The clinical presentations and the responses to treatments were analyzed in 4 patients. Blood and urinary metabolic screenings, electroencephalogram (EEG), brain magnetic resonance imaging (MRI) and epilepsy-related genes detection were performed in all patients. Patient 1 and 2 were identical twin brothers, who were born at 35 +5 w gestation with a sign of encephalopathy. Their seizures started within the first day and could not be controlled by pyridoxine or pyridoxal-5'-phosphate (PLP) completely. Patient 3 presented seizures at 5 months, responding well to pyridoxine. Seizures in patient 4 began at 40 days after birth and were controlled by valproic acid and topiramate. EEG showed atypical hypsarrhythmia or multifocal epileptiform discharges in 3 patients, and showed normality in patient 4. MRI showed nonspecific abnormality or normality. Blood metabolic screening showed multiple amino acids level abnormalities in all cases. Urinary metabolic screening showed vanillactic acid prominently elevated in 3 patients. Genetic analysis revealed 5 mutations of PNPO, three of which were novel. The mutation c.445_448del was carried by the twins and patient 3. Assessment of psychomotor development indicated severe delay in 3 patients and borderline to mild delay in patient 3. This is the first time to report patients with PNPO deficiency diagnosed by gene analysis in China. The novel clinical characteristics and novel mutations found here expanded the phenotypes and genotypes of this disease. Further, the frameshift mutation c.445_448del might be high prevalence in PNPO deficiency in Chinese patients.

A negative feedback modulator of antigen processing evolved from a frameshift in the cowpox virus genome.

Directory of Open Access Journals (Sweden)

Jiacheng Lin

2014-12-01

Full Text Available Coevolution of viruses and their hosts represents a dynamic molecular battle between the immune system and viral factors that mediate immune evasion. After the abandonment of smallpox vaccination, cowpox virus infections are an emerging zoonotic health threat, especially for immunocompromised patients. Here we delineate the mechanistic basis of how cowpox viral CPXV012 interferes with MHC class I antigen processing. This type II membrane protein inhibits the coreTAP complex at the step after peptide binding and peptide-induced conformational change, in blocking ATP binding and hydrolysis. Distinct from other immune evasion mechanisms, TAP inhibition is mediated by a short ER-lumenal fragment of CPXV012, which results from a frameshift in the cowpox virus genome. Tethered to the ER membrane, this fragment mimics a high ER-lumenal peptide concentration, thus provoking a trans-inhibition of antigen translocation as supply for MHC I loading. These findings illuminate the evolution of viral immune modulators and the basis of a fine-balanced regulation of antigen processing.

Tratamento das lesões traumáticas instáveis da coluna torácica e lombar com retângulo de Hartshill Treatment of unstable thotacic spine traumatic injuries using Hartshill rectangle

Directory of Open Access Journals (Sweden)

Júlio César Pereira da Cunha

2002-03-01

Full Text Available Foram avaliados 14 pacientes com lesão instável da coluna torácica e lombar, tratados com instrumentação de Hartshill. De uma forma geral, obtivemos bons resultados com a técnica proposta.Fourteen patients with unstable thoracolumbar spine injuries treated with Hartshill's instrumentation have been evaluated. Good results were generally achieved using this technique.

An Exon-Based Comparative Variant Analysis Pipeline to Study the Scale and Role of Frameshift and Nonsense Mutation in the Human-Chimpanzee Divergence

Directory of Open Access Journals (Sweden)

GongXin Yu

2009-01-01

important biological processes such as T cell lineage development, the pathogenesis of inflammatory diseases, and antigen induced cell death. A “less-is-more” model was previously established to illustrate the role of the gene inactivation and disruptions during human evolution. Here this analysis suggested a different model where the chimpanzee-specific exon-disrupting mutations may act as additional evolutionary force that drove the human-chimpanzee divergence. Finally, the analysis revealed a number of sequencing errors in the chimpanzee and human genome sequences and further illustrated that they could be corrected without resequencing.

Identification of an MSI-H Tumor-Specific Cytotoxic T Cell Epitope Generated by the (−1 Frame of U79260(FTO

Directory of Open Access Journals (Sweden)

Michael Linnebacher

2010-01-01

Full Text Available Microsatellite instability (MSI-H induced by defects of the DNA mismatch repair system results in insertion or deletion of single nucleotides at short repetitive DNA sequences. About 15% of sporadic and approximately 90% of hereditary nonpolyposis colorectal cancers display MSI-H. When affecting coding regions, MSI-H results in frameshift mutations and expression of corresponding frameshift peptides (FSPs. Functional tumor promoting relevance has been demonstrated for a growing number of genes frequently hit by MSI-H. Contrary, immune reactions against FSPs are involved in the immune surveillance of MSI-H cancers. Here, we provide conclusive data that the (−1 frame of U79260(FTO encodes an HLA-A0201-restricted cytotoxic T cell epitope (FSP11; TLSPGWSAV. T cells specific for FSP11 efficiently recognized HLA-A0201(pos tumor cells harboring the mutated reading frame. Considering the exceptionally high mutation rate of U79260(FTO in MSI-H colorectal carcinoma (81.8%, this recommends that FSP11 be a component of future vaccines.

Naxos disease in an Arab family is not caused by the Pk2157del2 mutation; evidance for exclusion of the plakoglobin gene

International Nuclear Information System (INIS)

Stuhmann, M.; El-Harith, A.; Bukhari, Iqbal A.

2004-01-01

Nax os disease is a rare hereditary disorder characterized by palmoplantar keratoderma, woolly hair and cardiomyopathy. This study aims to determine whether Naxos disease in a Saudi Arab family is caused by the Pk2157del2 mutation that was identified in Greek families from Naxos Island where the disease had originally been described. This study was undertaken at King Fahad Hospital of the University, Al-Khobar, and the Medical University of Hannover, in the spring of 2003. Naxos disease has been encountered in a 2-year-old girl and her 30-year-old aunt of a Saudi Arab family. Deoxyribonucleic acid samples of this family were analyzed by polymerase chain-reaction (PCR) amplification of the respective region of the plakoglobin gene, and direct nucleotide sequencing of the PCR-products. Segregation analysis was performed employing the newly detected IVS11+22G/A polymorphism. Molecular genetic analysis of the DNA sample of the child diagnosed with Naxos disease showed absence of the Pk2157del2 mutation. In addition, the segregation analysis revealed heterozygosity for IVS11+22G/A in the affected girl. Absence of the Pk2157del2 frameshift in the affected child proved that Naxos disease in this Saudi Arab family is not caused by the same mutation that was identified in the Greek families. Furthermore, heterozygosity for the IVS11+22G/A polymorphism provided evidence for exclusion of the plakoglobin gene in this consanguineous family. (author)

Ubiquitin ligases of the N-end rule pathway: assessment of mutations in UBR1 that cause the Johanson-Blizzard syndrome.

Directory of Open Access Journals (Sweden)

Cheol-Sang Hwang

Full Text Available Johanson-Blizzard syndrome (JBS; OMIM 243800 is an autosomal recessive disorder that includes congenital exocrine pancreatic insufficiency, facial dysmorphism with the characteristic nasal wing hypoplasia, multiple malformations, and frequent mental retardation. Our previous work has shown that JBS is caused by mutations in human UBR1, which encodes one of the E3 ubiquitin ligases of the N-end rule pathway. The N-end rule relates the regulation of the in vivo half-life of a protein to the identity of its N-terminal residue. One class of degradation signals (degrons recognized by UBR1 are destabilizing N-terminal residues of protein substrates.Most JBS-causing alterations of UBR1 are nonsense, frameshift or splice-site mutations that abolish UBR1 activity. We report here missense mutations of human UBR1 in patients with milder variants of JBS. These single-residue changes, including a previously reported missense mutation, involve positions in the RING-H2 and UBR domains of UBR1 that are conserved among eukaryotes. Taking advantage of this conservation, we constructed alleles of the yeast Saccharomyces cerevisiae UBR1 that were counterparts of missense JBS-UBR1 alleles. Among these yeast Ubr1 mutants, one of them (H160R was inactive in yeast-based activity assays, the other one (Q1224E had a detectable but weak activity, and the third one (V146L exhibited a decreased but significant activity, in agreement with manifestations of JBS in the corresponding JBS patients.These results, made possible by modeling defects of a human ubiquitin ligase in its yeast counterpart, verified and confirmed the relevance of specific missense UBR1 alleles to JBS, and suggested that a residual activity of a missense allele is causally associated with milder variants of JBS.

A Homozygous Frameshift Mutation in LRAT Causes Retinitis Punctata Albescens

NARCIS (Netherlands)

Littink, Karin W.; van Genderen, Maria M.; van Schooneveld, Mary J.; Visser, Linda; Riemslag, Frans C. C.; Keunen, Jan E. E.; Bakker, Bjorn; Zonneveld, Marijke N.; den Hollander, Anneke I.; Cremers, Frans P. M.; van den Born, L. Ingeborgh

2012-01-01

Purpose: To determine the genetic defect and to describe the clinical characteristics in patients with retinitis punctata albescens (RPA) and fundus albipunctatus (FAP). Design: Case series/observational study. Participants: We included 13 patients affected by RPA or FAP. Methods: Thirteen patients

A Homozygous Frameshift Mutation in LRAT Causes Retinitis Punctata Albescens.

NARCIS (Netherlands)

Littink, K.W.; Genderen, M.M. van; Schooneveld, M.J. van; Visser, L.; Riemslag, F.C.; Keunen, J.E.E.; Bakker, B.; Zonneveld, M.N.; Hollander, A.I. den; Cremers, F.P.M.; Born, L.I. van den

2012-01-01

PURPOSE: To determine the genetic defect and to describe the clinical characteristics in patients with retinitis punctata albescens (RPA) and fundus albipunctatus (FAP). DESIGN: Case series/observational study. PARTICIPANTS: We included 13 patients affected by RPA or FAP. METHODS: Thirteen patients

A loss-of-function mutation in the PAS kinase Rim15p is related to defective quiescence entry and high fermentation rates of Saccharomyces cerevisiae sake yeast strains.

Science.gov (United States)

Watanabe, Daisuke; Araki, Yuya; Zhou, Yan; Maeya, Naoki; Akao, Takeshi; Shimoi, Hitoshi

2012-06-01

Sake yeast cells have defective entry into the quiescent state, allowing them to sustain high fermentation rates. To reveal the underlying mechanism, we investigated the PAS kinase Rim15p, which orchestrates initiation of the quiescence program in Saccharomyces cerevisiae. We found that Rim15p is truncated at the carboxyl terminus in modern sake yeast strains as a result of a frameshift mutation. Introduction of this mutation or deletion of the full-length RIM15 gene in a laboratory strain led to a defective stress response, decreased synthesis of the storage carbohydrates trehalose and glycogen, and impaired G(1) arrest, which together closely resemble the characteristic phenotypes of sake yeast. Notably, expression of a functional RIM15 gene in a modern sake strain suppressed all of these phenotypes, demonstrating that dysfunction of Rim15p prevents sake yeast cells from entering quiescence. Moreover, loss of Rim15p or its downstream targets Igo1p and Igo2p remarkably improved the fermentation rate in a laboratory strain. This finding verified that Rim15p-mediated entry into quiescence plays pivotal roles in the inhibition of ethanol fermentation. Taken together, our results suggest that the loss-of-function mutation in the RIM15 gene may be the key genetic determinant of the increased ethanol production rates in modern sake yeast strains.

Disease: H01496 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available TITLE ... Homozygosity for frameshift mutations in XYLT2 result in a spondylo-ocular syndrome with bone fragility, cataracts, and hea...ring defects. ... JOURNAL ... Am J Hum Genet 96:971-8 (2015) DOI:10.1016/j.ajhg.2015.04.017

Exome sequencing identifies DYNC2H1 mutations as a common cause of asphyxiating thoracic dystrophy (Jeune syndrome) without major polydactyly, renal or retinal involvement

Science.gov (United States)

Schmidts, Miriam; Arts, Heleen H; Bongers, Ernie M H F; Yap, Zhimin; Oud, Machteld M; Antony, Dinu; Duijkers, Lonneke; Emes, Richard D; Stalker, Jim; Yntema, Jan-Bart L; Plagnol, Vincent; Hoischen, Alexander; Gilissen, Christian; Forsythe, Elisabeth; Lausch, Ekkehart; Veltman, Joris A; Roeleveld, Nel; Superti-Furga, Andrea; Kutkowska-Kazmierczak, Anna; Kamsteeg, Erik-Jan; Elçioğlu, Nursel; van Maarle, Merel C; Graul-Neumann, Luitgard M; Devriendt, Koenraad; Smithson, Sarah F; Wellesley, Diana; Verbeek, Nienke E; Hennekam, Raoul C M; Kayserili, Hulya; Scambler, Peter J; Beales, Philip L; Knoers, Nine VAM; Roepman, Ronald; Mitchison, Hannah M

2013-01-01

Background Jeune asphyxiating thoracic dystrophy (JATD) is a rare, often lethal, recessively inherited chondrodysplasia characterised by shortened ribs and long bones, sometimes accompanied by polydactyly, and renal, liver and retinal disease. Mutations in intraflagellar transport (IFT) genes cause JATD, including the IFT dynein-2 motor subunit gene DYNC2H1. Genetic heterogeneity and the large DYNC2H1 gene size have hindered JATD genetic diagnosis. Aims and methods To determine the contribution to JATD we screened DYNC2H1 in 71 JATD patients JATD patients combining SNP mapping, Sanger sequencing and exome sequencing. Results and conclusions We detected 34 DYNC2H1 mutations in 29/71 (41%) patients from 19/57 families (33%), showing it as a major cause of JATD especially in Northern European patients. This included 13 early protein termination mutations (nonsense/frameshift, deletion, splice site) but no patients carried these in combination, suggesting the human phenotype is at least partly hypomorphic. In addition, 21 missense mutations were distributed across DYNC2H1 and these showed some clustering to functional domains, especially the ATP motor domain. DYNC2H1 patients largely lacked significant extra-skeletal involvement, demonstrating an important genotype–phenotype correlation in JATD. Significant variability exists in the course and severity of the thoracic phenotype, both between affected siblings with identical DYNC2H1 alleles and among individuals with different alleles, which suggests the DYNC2H1 phenotype might be subject to modifier alleles, non-genetic or epigenetic factors. Assessment of fibroblasts from patients showed accumulation of anterograde IFT proteins in the ciliary tips, confirming defects similar to patients with other retrograde IFT machinery mutations, which may be of undervalued potential for diagnostic purposes. PMID:23456818

Successful every-other-day liothyronine therapy for severe resistance to thyroid hormone beta with a novel THRB mutation; case report.

Science.gov (United States)

Maruo, Yoshihiro; Mori, Asami; Morioka, Yoriko; Sawai, Chihiro; Mimura, Yu; Matui, Katsuyuki; Takeuchi, Yoshihiro

2016-01-12

Resistance to thyroid hormone beta (RTHβ) is a rare and usually dominantly inherited syndrome caused by mutations of the thyroid hormone receptor β gene (THRB). In severe cases, it is rarely challenging to control manifestations using daily therapeutic replacement of thyroid hormone. The present case study concerns an 8-year-old Japanese girl with a severe phenotype of RTH (TSH, fT3, and fT4 were 34.0 mU/L, >25.0 pg/mL and, >8.0 ng/dL, respectively), caused by a novel heterozygous frameshift mutation in exon 10 of the thyroid hormone receptor beta gene (THRB), c.1347-1357 del actcttccccc : p.E449DfsX11. RTH was detected at the neonatal screening program. At 4 years of age, the patient continued to suffer from mental retardation, hyperactivity, insomnia, and reduced resting energy expenditure (REE), despite daily thyroxine (L-T4) therapy. Every-other-day high-dose liothyronine (L-T3) therapy improved her symptoms and increased her REE, without thyrotoxicosis. In a case of severe RTH, every-other-day L-T3 administration enhanced REE and psychomotor development, without promoting symptoms of thyrotoxicosis. Every-other-day L-T3 administration may be an effective strategy for the treatment of severe RTH.

Sequence-Based Mapping and Genome Editing Reveal Mutations in Stickleback Hps5 Cause Oculocutaneous Albinism and the casper Phenotype

Directory of Open Access Journals (Sweden)

James C. Hart

2017-09-01

Full Text Available Here, we present and characterize the spontaneous X-linked recessive mutation casper, which causes oculocutaneous albinism in threespine sticklebacks (Gasterosteus aculeatus. In humans, Hermansky-Pudlak syndrome results in pigmentation defects due to disrupted formation of the melanin-containing lysosomal-related organelle (LRO, the melanosome. casper mutants display not only reduced pigmentation of melanosomes in melanophores, but also reductions in the iridescent silver color from iridophores, while the yellow pigmentation from xanthophores appears unaffected. We mapped casper using high-throughput sequencing of genomic DNA from bulked casper mutants to a region of the stickleback X chromosome (chromosome 19 near the stickleback ortholog of Hermansky-Pudlak syndrome 5 (Hps5. casper mutants have an insertion of a single nucleotide in the sixth exon of Hps5, predicted to generate an early frameshift. Genome editing using CRISPR/Cas9 induced lesions in Hps5 and phenocopied the casper mutation. Injecting single or paired Hps5 guide RNAs revealed higher incidences of genomic deletions from paired guide RNAs compared to single gRNAs. Stickleback Hps5 provides a genetic system where a hemizygous locus in XY males and a diploid locus in XX females can be used to generate an easily scored visible phenotype, facilitating quantitative studies of different genome editing approaches. Lastly, we show the ability to better visualize patterns of fluorescent transgenic reporters in Hps5 mutant fish. Thus, Hps5 mutations present an opportunity to study pigmented LROs in the emerging stickleback model system, as well as a tool to aid in assaying genome editing and visualizing enhancer activity in transgenic fish.

Diaphanous gene mutation affects spiral cleavage and chirality in snails

Science.gov (United States)

Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

2016-01-01

L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

Stemcell Information: SKIP001117 [SKIP Stemcell Database[Archive

Lifescience Database Archive (English)

Full Text Available SKIP001117 ... Diseased D3-1 D3-1 ... 大うつ病 F33.3 major depression 605210 ... ...-- Male ... Yes No iPS cells derived from fibroblasts of a patient in which a frameshift mutation of disrupted in major depression

Stemcell Information: SKIP001118 [SKIP Stemcell Database[Archive

Lifescience Database Archive (English)

Full Text Available SKIP001118 ... Diseased D3-2 D3-2 ... 大うつ病 F33.3 major depression 605210 ... ...-- Male ... Yes No iPS cells derived from fibroblasts of a patient in which a frameshift mutation of disrupted in major depression

Senior-Loken syndrome: A novel NPHP5 gene mutation in a family ...

African Journals Online (AJOL)

Makia J Marafie

2014-01-08

Jan 8, 2014 ... Case report: Here, we are reporting two children from an Arab family with a novel frameshift ... Senior-Loken (S-L) is an autosomal recessive syndrome and a ..... diseases, which are scattered in the Arab world and Middle.

A source of artifact in the lacZ reversion assay in Escherichia coli.

Science.gov (United States)

Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I

2015-06-01

The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its

Reduced lentivirus susceptibility in sheep with TMEM154 mutations.

Directory of Open Access Journals (Sweden)

Michael P Heaton

2012-01-01

Full Text Available Visna/Maedi, or ovine progressive pneumonia (OPP as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154 that exceeded genome-wide significance (unadjusted p-value 3×10(-9. Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E at position 35 were associated with infection while a third haplotype with lysine (K at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-value<0.0001, 95% CI 5-1,100. In a combined analysis of nine cohorts with 2,705 sheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-value<0.0001, 95% CI 2.36-3.43. Although rare, some sheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection.

Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

Directory of Open Access Journals (Sweden)

Yuichiro Iida

Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome previously diagnosed as Seckel syndrome: report of a novel mutation of the PCNT gene.

Science.gov (United States)

Piane, Maria; Della Monica, Matteo; Piatelli, Gianluca; Lulli, Patrizia; Lonardo, Fortunato; Chessa, Luciana; Scarano, Gioacchino

2009-11-01

We report on a 3-year-old boy with prenatal onset of proportionate dwarfism, postnatal severe microcephaly, high forehead with receded hairline, sparse scalp hair, beaked nose, mild retrognathia and hypotonia diagnosed at birth as Seckel syndrome. At age 3 years, he became paralyzed due to a cerebrovascular malformation. Based on the clinical and radiological features showing evidence of skeletal dysplasia, the diagnosis was revised to Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome. Western blot analysis of the patient's lymphoblastoid cell line lysate showed the absence of the protein pericentrin. Subsequent molecular analysis identified a novel homozygous single base insertion (c.1527_1528insA) in exon 10 of the PCNT gene, which leads to a frameshift (Treo510fs) and to premature protein truncation. PCNT mutations must be considered diagnostic of MOPD II syndrome. A possible role of pericentrin in the development of cerebral vessels is suggested. Copyright 2009 Wiley-Liss, Inc.

[The significance of pedigree genetic screening and rapid immunological parameters in the diagnosis of primary hemophagocytic lymphohistiocytosis].

Science.gov (United States)

Zhang, J; Wang, Y N; Wang, J S; Wu, L; Wei, N; Fu, L; Gao, Z; Chen, J H; Pei, R J; Wang, Z

2016-07-01

To investigate the significance of pedigree genetic screening and rapid immunological parameters in the diagnosis of primary hemophagocytic lymphohistiocytosis (HLH). Four cases of primary HLH patients with PRF1, UNC13D and SH2D1A gene mutations were conducted pedigree investigation, including family genetic screening and detections of immunological parameters (NK cell activity, CD107a degranulation and expression of HLH related defective protein), to evaluate the significance of these different indicators in the diagnosis of primary HLH and explore their correlations. The DNA mutations of the four families included missense mutation c.T172C (p.S58P) and non- frameshift deletions c.1083_1094del (p.361_365del), missense mutation c.C1349T (p.T450M) and frameshift mutation c.1090_1091delCT (p.T364fsX93) in PRF1 gene, missense mutation c.G2588A (p.G863D) in UNC13D gene and hemizygous mutation c.32T>G (p.I11S) in SH2D1A gene. The patients and their family members presented decreased NK cell activities. Individuals who carried mutations of PRF1 gene and SH2D1A gene showed low expression of perforin (PRF1) and signaling lymphocytic activation molecule associated protein (SAP). And the patient with UNC13D gene mutation and his family member with identical mutation showed significant reducing cytotoxic degranulation function (expression of CD107a). Pedigree genetic screening and rapid detection of immunological parameters might play an important role in the diagnosis of primary HLH, and both of them had good consistency. As an efficient detection means, the rapid immunological detection indicators would provide reliable basis for the early diagnosis of the primary HLH.

A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

Directory of Open Access Journals (Sweden)

Bertram Brenig

Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

The UGG Isoacceptor of tRNAPro Is Naturally Prone to Frameshifts

Directory of Open Access Journals (Sweden)

Howard B. Gamper

2015-07-01

Full Text Available Native tRNAs often contain post-transcriptional modifications to the wobble position to expand the capacity of reading the genetic code. Some of these modifications, due to the ability to confer imperfect codon-anticodon pairing at the wobble position, can induce a high propensity for tRNA to shift into alternative reading frames. An example is the native UGG isoacceptor of E. coli tRNAPro whose wobble nucleotide U34 is post-transcriptionally modified to cmo5U34 to read all four proline codons (5ʹ-CCA, 5ʹ-CCC, 5ʹ-CCG, and 5ʹ-CCU. Because the pairing of the modified anticodon to CCC codon is particularly weak relative to CCA and CCG codons, this tRNA can readily shift into both the +1 and +2-frame on the slippery mRNA sequence CCC-CG. We show that the shift to the +2-frame is more dominant, driven by the higher stability of the codon-anticodon pairing at the wobble position. Kinetic analysis suggests that both types of shifts can occur during stalling of the tRNA in a post-translocation complex or during translocation from the A to the P-site. Importantly, while the +1-frame post complex is active for peptidyl transfer, the +2-frame complex is a poor peptidyl donor. Together with our recent work, we draw a mechanistic distinction between +1 and +2-frameshifts, showing that while the +1-shifts are suppressed by the additional post-transcriptionally modified m1G37 nucleotide in the anticodon loop, the +2-shifts are suppressed by the ribosome, supporting a role of the ribosome in the overall quality control of reading-frame maintenance.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Enhanced genome editing tools for multi-gene deletion knock-out approaches using paired CRISPR sgRNAs in CHO cells

DEFF Research Database (Denmark)

Schmieder, Valerie; Bydlinski, Nina; Strasser, Richard

2017-01-01

(sgRNAs) for full gene deletions. This strategy also enables the targeting of regulatory regions, which would not respond to the conventional frameshift mutations, as shown by deleting the α-1,6-Fucosyltransferase 8 (FUT8) promoter resulting in a functional knock-out. Fut8 also served as model...

Peeling skin syndrome: genetic defects in late terminal differentiation of the epidermis.

Science.gov (United States)

Bowden, Paul E

2011-03-01

In this issue, Israeli and colleagues confirm that homozygous mutations in corneodesmosin (CDSN) cause type B peeling skin syndrome (PSS), an autosomal recessive skin disorder. The deletion mutation described resulted in a frameshift, producing a downstream premature stop codon and early truncation of the protein. The recently described CDSN nonsense mutation in another PSS family also resulted in protein truncation and nonsense-mediated mRNA decay. Type B generalized PSS can now be clearly distinguished from acral PSS, caused by mutations in transglutaminase 5. This directly affects cornified envelope cross-linking rather than corneodesmosome adherence. These observations provide new insight into the molecular defects underlying two closely related forms of PSS.

Two females with mutations in USP9X highlight the variable expressivity of the intellectual disability syndrome.

Science.gov (United States)

Au, P Y B; Huang, L; Broley, S; Gallagher, L; Creede, E; Lahey, D; Ordorica, S; Mina, K; Boycott, K M; Baynam, G; Dyment, D A

2017-07-01

The genetic causes of intellectual disability (ID) are heterogeneous and include both chromosomal and monogenic etiologies. The X-chromosome is known to contain many ID-related genes and males show a marked predominance for intellectual disability. Here we report two females with syndromic intellectual disability. The first individual was relatively mild in her presentation with mild-moderate intellectual disability, hydronephrosis and altered pigmentation along the lines of Blaschko without additional congenital anomalies. A second female presented shortly after birth with dysmorphic facial features, post-axial polydactyly and, on follow-up assessment, demonstrated moderate intellectual disability. Chromosomal studies for Individual 1 identified an X-chromosome deletion due to a de novo pericentric inversion; the inversion breakpoint was associated with deletion of the 5'UTR of the USP9X, a gene which has been implicated in a syndromic intellectual disability affecting females. The second individual had a de novo frameshift mutation detected by whole-exome sequencing that was predicted to be deleterious, NM_001039590.2 (USP9X): c.4104_4105del (p.(Arg1368Serfs*2)). Haploinsufficiency of USP9X in females has been associated with ID and congenital malformations that include heart defects, scoliosis, dental abnormalities, anal atresia, polydactyly, Dandy Walker malformation and hypoplastic corpus callosum. The extent of the congenital malformations observed in Individual 1 was less striking than Individual 2 and other individuals previously reported in the literature, and suggests that USP9X mutations in females can have a wider spectrum of presentation than previously appreciated. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Clinical and genetic characterization of chanarin-dorfman syndrome patients: first report of large deletions in the ABHD5 gene

Directory of Open Access Journals (Sweden)

Prati Daniele

2010-12-01

Full Text Available Abstract Background Chanarin-Dorfman syndrome (CDS is a rare autosomal recessive disorder characterized by nonbullous congenital ichthyosiform erythroderma (NCIE and an intracellular accumulation of triacylglycerol (TG droplets in most tissues. The clinical phenotype involves multiple organs and systems, including liver, eyes, ears, skeletal muscle and central nervous system (CNS. Mutations in ABHD5/CGI58 gene are associated with CDS. Methods Eight CDS patients belonging to six different families from Mediterranean countries were enrolled for genetic study. Molecular analysis of the ABHD5 gene included the sequencing of the 7 coding exons and of the putative 5' regulatory regions, as well as reverse transcript-polymerase chain reaction analysis and sequencing of normal and aberrant ABHD5 cDNAs. Results Five different mutations were identified, four of which were novel, including two splice-site mutations (c.47+1G>A and c.960+5G>A and two large deletions (c.898_*320del and c.662-1330_773+46del. All the reported mutations are predicted to be pathogenic because they lead to an early stop codon or a frameshift producing a premature termination of translation. While nonsense, missense, frameshift and splice-site mutations have been identified in CDS patients, large genomic deletions have not previously been described. Conclusions These results emphasize the need for an efficient approach for genomic deletion screening to ensure an accurate molecular diagnosis of CDS. Moreover, in spite of intensive molecular screening, no mutations were identified in one patient with a confirmed clinical diagnosis of CDS, appointing to genetic heterogeneity of the syndrome.

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Articles written in Journal of Genetics. Volume 92 Issue 1 April 2013 pp 81-83 Research Note. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic fibrosis patient · Sondess Hadj Fredj Monia Boudaya Sabrine Oueslati Safa Sahnoun Chaima Sahli Hajer Siala Khedija Boussetta Amina Bibi Taieb Messaoud.

Phenotypes and genotypes in individuals with SMC1A variants

DEFF Research Database (Denmark)

Huisman, Sylvia; Mulder, Paul A; Redeker, Egbert

2017-01-01

, stereotypic movements, and (in some) regression. Their missense, nonsense, and frameshift mutations are evenly spread over the gene. We conclude that SMC1A variants can result in a phenotype resembling CdLS and a phenotype resembling Rett syndrome. Resemblances between the SMC1A group and the NIPBL group...

Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses

DEFF Research Database (Denmark)

Hamming, Ole Jensen; Terczynska-Dyla, Ewa; Vieyres, Gabrielle

2013-01-01

The IFNL4 gene is a recently discovered type III interferon, which in a significant fraction of the human population harbours a frameshift mutation abolishing the IFNλ4 ORF. The expression of IFNλ4 is correlated with both poor spontaneous clearance of hepatitis C virus (HCV) and poor response to ...