Olefin copolymerization via reversible addition-fragmentation chain transfer
Venkatesh, R.; Staal, B.B.P.; Klumperman, B.
2004-01-01
Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished
Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.
2009-01-01
Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a
Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene
Pullan, Nikki; Liu, Max; Topham, Paul D.
2013-01-01
Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...
Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.
2000-01-01
The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio
Energy Technology Data Exchange (ETDEWEB)
Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)
2012-01-15
Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.
International Nuclear Information System (INIS)
Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.
2012-01-01
Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.
Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng
2013-10-01
To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.
Directory of Open Access Journals (Sweden)
Hossein Roghani-Mamaqani
2017-09-01
Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.
Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.
2000-01-01
Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.
RAFT Miniemulsion Polymerization of MMA with Cumyl Dithiobenzoate as Chain Transfer Agent
Institute of Scientific and Technical Information of China (English)
Tian Ying GUO; Dong Lin TANG; Jing Wei ZHU; Mou Dao SONG; Bang Hua ZHANG
2006-01-01
Reversible addition-fragmentation transfer (RAFT) miniemulsion polymerizations for PMMA with cumyl dithiobenzoate (CDB) as a chain transfer agent (CTA) has been carried out.Higher temperature made the polymerization much faster and the PDI remained below 1.20, when the temperature was upon 70 ℃.
Energy Technology Data Exchange (ETDEWEB)
Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)
2017-03-23
Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.
Directory of Open Access Journals (Sweden)
Nenad Micic
2014-01-01
Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.
Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin
2010-07-22
Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.
Production of a phage-displayed single chain variable fragment ...
African Journals Online (AJOL)
Abstract. Purpose: To develop specific single chain variable fragments (scFv) against ... libraries. The binding ability of the selected scFv antibody fragments against the IBDV particles was ..... Hermelink H, Koscielniak E. A human recombinant.
Production of a phage-displayed single chain variable fragment ...
African Journals Online (AJOL)
Purpose: To develop specific single chain variable fragments (scFv) against infectious bursal disease virus (IBDV) via phage display technology. Methods: Purified viruses were initially applied for iterative panning rounds of scFv phage display libraries. The binding ability of the selected scFv antibody fragments against the ...
Keddie, Daniel J
2014-01-21
The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.
Automated main-chain model building by template matching and iterative fragment extension
International Nuclear Information System (INIS)
Terwilliger, Thomas C.
2003-01-01
A method for automated macromolecular main-chain model building is described. An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and β-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and β-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C α positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 Å. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition
Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki
2011-08-02
Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.
Directory of Open Access Journals (Sweden)
Li An
2015-09-01
Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.
Automated main-chain model building by template matching and iterative fragment extension.
Terwilliger, Thomas C
2003-01-01
An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.
DEFF Research Database (Denmark)
Olsen, K E; Sletten, K; Westermark, Per
1998-01-01
Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin l...... light chain are a constituent of the AL-amyloid proteins of kappa type. A specific antiserum has identified these fragments in gel filtration fractions where the absorbance approached the base line after the main retarded peak. The fragments are small and have been overlooked previously......Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin...... in the purification process. The significance of the constant part in AL-proteins is unclear, but adds new aspects to the discussion of pre- or post-fibrillogenic cleavage of the immunoglobulin light chains....
International Nuclear Information System (INIS)
Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi
2015-01-01
Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)
Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.
2005-01-01
We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA
Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin
2011-01-01
In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic
Improved production and function of llama heavy chain antibody fragments by molecular evolution
Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.
2000-01-01
The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In
Quantum communication and state transfer in spin chains
International Nuclear Information System (INIS)
Van der Jeugt, Joris
2011-01-01
We investigate the time evolution of a single spin excitation state in certain linear spin chains, as a model for quantum communication. We consider first the simplest possible spin chain, where the spin chain data (the nearest neighbour interaction strengths and the magnetic field strengths) are constant throughout the chain. The time evolution of a single spin state is determined, and this time evolution is illustrated by means of an animation. Some years ago it was discovered that when the spin chain data are of a special form so-called perfect state transfer takes place. These special spin chain data can be linked to the Jacobi matrix entries of Krawtchouk polynomials or dual Hahn polynomials. We discuss here the case related to Krawtchouk polynomials, and illustrate the possibility of perfect state transfer by an animation showing the time evolution of the spin chain from an initial single spin state. Very recently, these ideas were extended to discrete orthogonal polynomials of q-hypergeometric type. Here, a remarkable result is a new analytic model where perfect state transfer is achieved: this is when the spin chain data are related to the Jacobi matrix of q-Krawtchouk polynomials. This case is discussed here, and again illustrated by means of an animation.
Optimization of the crystallizability of a single-chain antibody fragment
Czech Academy of Sciences Publication Activity Database
Škerlová, Jana; Král, Vlastimil; Fábry, Milan; Sedláček, Juraj; Veverka, Václav; Řezáčová, Pavlína
2014-01-01
Roč. 70, č. 12 (2014), s. 1701-1706 ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : single-chain antibody fragment * Thermofluor assay * differential scanning fluorimetry * crystallizability optimization * oligomerization * crystallization Subject RIV: CE - Biochemistry Impact factor: 0.527, year: 2014
Chain-end modification of living anionic polybutadiene with diphenylethylenes and styrenes
Donkers, E.H.D.; Willemse, R.X.E.; Klumperman, B.
2005-01-01
The first step in the transformation of poly(butadienyl)lithium into a macromolecular atom transfer radical polymerization initiator or reversible addition-fragmentation chain transfer agent is the modification of the anionic chain end into a suitable leaving/reinitiating group. We have investigated
Isegawa, Miho; Gao, Jiali; Truhlar, Donald G
2011-08-28
Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics
Polyurea with luminophor fragments in polymer chain: synthesis and spectral properties
Novikova, Tamara S.; Barashkov, Nikolay N.; Sakhno, Tamara V.
2003-12-01
A series of aliphatic polyureas with chromophore moieties in the polymer chain, such as 7-amino-2(4"-aminophenyl)benzoxazole, have been prepared. The absorption and fluorescence spectra of these polymers as well as corresponding chromophore-containing model urea (product of condensation of 7-amino-2(4"-amino-2"-hydroxyphenyl)benzoxazole and phenylisocyanate) were studied and compared. It was found that the special feature of the model compound and polyureas is the large value of Stokes shift due to the presence of a hydroxy group in the ortho-position to the nitrogen atom of the benzoxazole ring. The model of the excited-state proton transfer in molecules containing fragments of 2-(2"-hydroxyphenyl)benzoxazole has been used for the description of bathochromic shift in emission spectra of polymer solutions and films. According to this model, the proton remains predominantly on the phenol oxygen while in the ground state (enol form). Upon UV excitation, in the first excited singlet state, the phenol is a considerably stronger acid and the nitrogen is a stronger base. Thus, the proton is transferred from the oxygen site to the nitrogen site, and the isomer formed (S"1*) is more stable than the isomer before proton transfer (S1*) S"1* can be then regarded as a vibrationally excited form of S1*. Then the molecule de-excites to the ground state, emitting a photon. In the ground state the enol form is again the more stable form and the proton will then transfer back to the oxygen. S"o is also a vibrationally excited state of So. Because of this process the absorption and fluorescence spectra of model urea and polyureas do not intersect and the value of Stokes shift is about 6000 cm-1.
Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji
2018-01-01
Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
Kumar, Sonu; Acharya, Rituparna; Chatterji, Urmi; De, Priyadarsi
2013-12-10
Developing safe and effective nanocarriers for multitype of delivery system is advantageous for several kinds of successful biomedicinal therapy with the same carrier. In the present study, we have designed amino acid biomolecules derived hybrid block copolymers which can act as a promising vehicle for both drug delivery and gene transfer. Two representative natural chiral amino acid-containing (l-phenylalanine and l-alanine) vinyl monomers were polymerized via reversible addition-fragmentation chain transfer (RAFT) process in the presence of monomethoxy poly(ethylene glycol) based macro-chain transfer agents (mPEGn-CTA) for the synthesis of well-defined side-chain amino-acid-based amphiphilic block copolymers, monomethoxy poly(ethylene glycol)-b-poly(Boc-amino acid methacryloyloxyethyl ester) (mPEGn-b-P(Boc-AA-EMA)). The self-assembled micellar aggregation of these amphiphilic block copolymers were studied by fluorescence spectroscopy, atomic force microscopy (AFM) and scanning electron microscopy (SEM). Potential applications of these hybrid polymers as drug carrier have been demonstrated in vitro by encapsulation of nile red dye or doxorubicin drug into the core of the micellar nanoaggregates. Deprotection of side-chain Boc- groups in the amphiphilic block copolymers subsequently transformed them into double hydrophilic pH-responsive cationic block copolymers having primary amino groups in the side-chain terminal. The DNA binding ability of these cationic block copolymers were further investigated by using agarose gel retardation assay and AFM. The in vitro cytotoxicity assay demonstrated their biocompatible nature and these polymers can serve as "smart" materials for promising bioapplications.
Efficient quantum state transfer in an engineered chain of quantum bits
Sandberg, Martin; Knill, Emanuel; Kapit, Eliot; Vissers, Michael R.; Pappas, David P.
2016-03-01
We present a method of performing quantum state transfer in a chain of superconducting quantum bits. Our protocol is based on engineering the energy levels of the qubits in the chain and tuning them all simultaneously with an external flux bias. The system is designed to allow sequential adiabatic state transfers, resulting in on-demand quantum state transfer from one end of the chain to the other. Numerical simulations of the master equation using realistic parameters for capacitive nearest-neighbor coupling, energy relaxation, and dephasing show that fast, high-fidelity state transfer should be feasible using this method.
International Nuclear Information System (INIS)
Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun
2009-01-01
An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1
Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo
2004-05-25
Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the
Variable fragments of heavy chain antibodies (VHHs: a new magic bullet molecule of medicine?
Directory of Open Access Journals (Sweden)
Dorota Smolarek
2012-06-01
Full Text Available Serum of animals belonging to the Camelidae family (camels and llamas contains fully active antibodies that are naturally devoid of light chains. Variable domains derived from heavy chain antibodies (hcAb called VHHs or nanobodies™ can bind antigens as effectively as full-length antibodies and are easy to clone and express. Because of their potential, VHHs are being intensively studied as potential therapeutic, diagnostic and imaging tools. The paper reviews the molecular background of heavy chain antibodies and describes methods of obtaining recombinant fragments of heavy chain antibodies as well as their therapeutic, diagnostic and other applications.
Shapley value based transfer pricing in supply chains with stochastic demand
Directory of Open Access Journals (Sweden)
Lihua Chen
2015-01-01
Full Text Available We study the question of how to ideally divide total profits among supply chain members, especially in a stochastic demand market. The Shapley value is used as the methodology solution to divide profits in a supply chain. To illustrate the Shapley value solution and procedures, a two-echelon supply chain consisting of one supplier and two heterogeneous retailers is examined. The goal is to figure out ideal transfer prices for products delivered among supply chain members. These transfer prices will achieve the suggested profit allocations among three companies.
Constant region of a kappa III immunoglobulin light chain as a major AL-amyloid protein
DEFF Research Database (Denmark)
Engvig, J P; Olsen, K E; Gislefoss, R E
1998-01-01
AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein and the correspond......AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein...... and the corresponding AL protein as a kappa III immunoglobulin light chain from material of a patient with systemic AL-amyloidosis presenting as a local inguinal tumour. The two proteins showed some unique features. The major part of the AL amyloid fibril protein consisted of C-terminal fragments of the Bence......-Jones protein. Furthermore, both the Bence-Jones protein and the AL protein were glycosylated, with possibly a glycosylation in the constant part of the light chain....
Fragmentation and direct transfer reactions for 40Ar incident beam on 27Al target at 1760 MeV
International Nuclear Information System (INIS)
Cisse, Ousmane
1985-01-01
Peripheral collision studies performed with 40 Ar projectiles at 44 MeV/A and 27 Al target show that both fragmentation and transfer reactions can be discerned in this type of interaction. The experimental observation of fragments with masses charges and velocities close to those of the incident beam are the signature of transfer reactions and a detailed analysis of the energy spectra of such fragments has been carried out and interpreted in terms of a direct diffraction transfer model. On the other hand, for large mass transfer reactions, abrasion is the suitable mechanism. Inclusive fragment measurement together with the appropriate residual nuclei-fragment coincidence results then provides experimental data in good agreement with the theoretical predictions obtained from a participant spectator model. These investigations also indicate that the separation energies of the participant from the spectator nucleus, at least within the framework of the above model, can be interpreted in terms of a friction force which becomes more efficient as the projectile energy decreases. (author) [fr
Isotopic resolution of fission fragments from 238U + 12C transfer and fusion reactions
International Nuclear Information System (INIS)
Caamano, M.; Rejmund, F.; Derkx, X.; Schmidt, K. H.; Andouin, L.; Bacri, C. O.; Barreau, G.; Benlliure, J.; Casarejos, E.; Fernandez-Dominguez, B.; Gaudefroy, L.; Golabek, C.; Jurado, B.; Lemasson, A.; Navin, A.; Rejmund, M.; Roger, T.; Shrivastava, A.; Schmitt, C.; Taieb, J.
2010-01-01
Recent results from an experiment at GANIL, performed to investigate the main properties of fission-fragment yields and energy distributions in different fissioning nuclei as a function of the excitation energy, in a neutron-rich region of actinides, are presented. Transfer reactions in inverse kinematics between a 238 U beam and a 12 C target produced different actinides, within a range of excitation energy below 30 MeV. These fissioning nuclei are identified by detecting the target-like recoil, and their kinetic and excitation energy are determined from the reconstruction of the transfer reaction. The large-acceptance spectrometer VAMOS was used to identify the mass, atomic number and charge state of the fission fragments in flight. As a result, the characteristics of the fission-fragment isotopic distributions of a variety of neutron-rich actinides are observed for the first time over the complete range of fission fragments. (authors)
Transfer of long-lived radionuclides through marine food chains: a review of transfer data
International Nuclear Information System (INIS)
Belot, Y.
1986-01-01
Experimental data on the transfer of long-lived radionuclides through food chains have been summarized from the available literature. The transfer to a given organism is characterized by a transfer factor (TF), defined as the activity in the organism relative to that in the ingested food or sediment. The TFs of Pu, Am and Tc from sediment to benthic species have been directly measured and generally do not exceed a value of 0.1. The TFs from prey to predator are related to uptake and retention parameters whose values can be derived from experimental data. It was estimated that these TFs do not generally exceed unity and that an increase of concentration through a food chain is very unlikely. (author)
Diverse responses of species to landscape fragmentation in a simple food chain.
Liao, Jinbao; Bearup, Daniel; Blasius, Bernd
2017-09-01
Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.
Subwavelength dielectric nanorod chains for energy transfer in the visible range.
Li, Dongdong; Zhang, Jingjing; Yan, Changchun; Xu, Zhengji; Zhang, Dao Hua
2017-10-15
We report a new type of energy transfer device, formed by a dielectric nanorod array embedded in a silver slab. Such dielectric chain structures allow surface plasmon wave guiding with large propagation length and highly suppressed crosstalk between adjacent transmission channels. The simulation results show that our proposed design can be used to enhance the energy transfer along the waveguide-like dielectric nanorod chains via coupled plasmons, where the energy spreading is effectively suppressed, and superior imaging properties in terms of resolution and energy transfer distance can be achieved.
Transfer of d-level quantum states through spin chains by random swapping
International Nuclear Information System (INIS)
Bayat, A.; Karimipour, V.
2007-01-01
We generalize an already proposed protocol for quantum state transfer to spin chains of arbitrary spin. An arbitrary unknown d-level state is transferred through a chain with rather good fidelity by the natural dynamics of the chain. We compare the performance of this protocol for various values of d. A by-product of our study is a much simpler method for picking up the state at the destination as compared with the one proposed previously. We also discuss entanglement distribution through such chains and show that the quality of entanglement transition increases with the number of levels d
International Nuclear Information System (INIS)
Guo, Jinxin; Gleeson, Michael R; Liu, Shui; Sheridan, John T
2011-01-01
The non-local photopolymerization driven diffusion (NPDD) model predicts that a reduction in the non-local response length within a photopolymer material will improve its high spatial frequency response. The introduction of a chain transfer agent reduces the average molecular weight of polymer chains formed during free radical polymerization. Therefore a chain transfer agent (CTA) provides a practical method to reduce the non-local response length. An extended NPDD model is presented, which includes the chain transfer reaction and most major photochemical processes. The addition of a chain transfer agent into an acrylamide/polyvinyl alcohol photopolymer material is simulated and the predictions of the model are examined. The predictions of the model are experimentally examined in part II of this paper
A model for the chain-to-plane charge transfer in YBa2Cu3O6+x
International Nuclear Information System (INIS)
Matic, V. M.; Lazarov, N. Dj.; Milic, M.
2012-01-01
A model for the chain-to-plane charge transfer is proposed to account for the two plateaus, at 60 K and at 90 K, of the T c (x) characteristics of the YBa 2 Cu 3 O 6+x high-T c superconductor. It is assumed that the number of holes transferred from a CuO chain of length l to two nearby CuO 2 sheets is proportional to l (that is, to the number of oxygen atoms in the chain), if the chain length is greater than, or equal to, a certain critical chain length, l cr , that is required to trigger the charge transfer process. No holes are assumed to have been transferred from chains of length l cr . The calculated T c (x) dependence is found to be in excellent agreement with the experimentally reported T c (x). The critical chain length parameter is estimated to be equal to l cr = 11 (eleven oxygen atoms in a chain), which is a greater value than that obtained in the previously proposed model for the chain-to-plane charge transfer (l cr = 4). The results obtained out of the proposed model are briefly discussed
Khandelwal, Govind S.; Khan, Ferdous
1989-01-01
An optical model description of energy and momentum transfer in relativistic heavy-ion collisions, based upon composite particle multiple scattering theory, is presented. Transverse and longitudinal momentum transfers to the projectile are shown to arise from the real and absorptive part of the optical potential, respectively. Comparisons of fragment momentum distribution observables with experiments are made and trends outlined based on our knowledge of the underlying nucleon-nucleon interaction. Corrections to the above calculations are discussed. Finally, use of the model as a tool for estimating collision impact parameters is indicated.
Quantum state transfer in spin chains with q-deformed interaction terms
International Nuclear Information System (INIS)
Jafarov, E I; Van der Jeugt, J
2010-01-01
We study the time evolution of a single spin excitation state in certain linear spin chains, as a model for quantum communication. Some years ago it was discovered that when the spin chain data (the nearest-neighbour interaction strengths and the magnetic field strengths) are related to the Jacobi matrix entries of Krawtchouk polynomials or dual Hahn polynomials the so-called perfect state transfer takes place. The extension of these ideas to other types of discrete orthogonal polynomials did not lead to new models with perfect state transfer, but did allow more insight in the general computation of the correlation function. In this paper, we extend the study to discrete orthogonal polynomials of q-hypergeometric type. A remarkable result is a new analytic model where perfect state transfer is achieved: this is when the spin chain data are related to the Jacobi matrix of q-Krawtchouk polynomials. The other cases studied here (affine q-Krawtchouk polynomials, quantum q-Krawtchouk polynomials, dual q-Krawtchouk polynomials, q-Hahn polynomials, dual q-Hahn polynomials and q-Racah polynomials) do not give rise to models with perfect state transfer. However, the computation of the correlation function itself is quite interesting, leading to advanced q-series manipulations.
Multinational firms, global value chains and the organization of technology transfer
Federica Saliola; Antonello Zanfei
2007-01-01
This paper combines insights from different streams of literature to develop a more comprehensive framework for the analysis of technology transfer via value chain relationships. We integrate the existing literature in three ways. First, we consider value chain relationships as a multi-facet process of interaction between buyers and suppliers, involving different degrees of knowledge transmission and development. Second, we assess whether and to what extent value chain relationships are assoc...
Multinational Firms, Global Value Chains and the Organization of Knowledge Transfer
Saliola, Federica; Zanfei, Antonello
2009-01-01
This paper combines insights from different streams of literature to develop a more comprehensive framework for the analysis of knowledge transfer via value chain relationships. We integrate the existing literature in three ways. First, we consider value chain relationships as a multi-facet process of interaction between buyers and suppliers, involving different modes of knowledge transmission and development. Second, we assess whether and to what extent value chain relationships are associat...
Innovation and technology transfer through global value chains: Evidence from China's PV industry
International Nuclear Information System (INIS)
Zhang, Fang; Gallagher, Kelly Sims
2016-01-01
China's success as a rapid innovation follower in the infant Photovoltaic (PV) industry surprised many observers. This paper explores how China inserted itself into global clean energy innovation systems by examining the case of the solar PV industry. The paper decomposes the global PV industrial value chain, and determines the main factors shaping PV technology transfer and diffusion. Chinese firms first entered PV module manufacturing through technology acquisition, and then gradually built their global competitiveness by utilizing a vertical integration strategy within segments of the industry as well as the broader PV value chain. The main drivers for PV technology transfer from the global innovation system to China are global market formation policy, international mobilization of talent, the flexibility of manufacturing in China, and belated policy incentives from China's government. The development trajectory of the PV industry in China indicates that innovation in cleaner energy technologies can occur through both global and national innovation processes, and knowledge exchange along the global PV value chain. - Highlights: •The value chain analytical approach is synergized with the theories of technology transfer and innovation systems. •A detailed review of how China integrated itself into the global solar PV innovation system is provided. •Four main factors shape PV technology transfer to China across various value chain segments. •Innovation in cleaner energy technologies is a combination of global and national innovation processes.
Bioaccumulation and food chain transfer of corrosion products from radioactive stainless steel
International Nuclear Information System (INIS)
Young, J.S.
1986-07-01
Two sets of experiments were conducted to determine if corrosion products from radioactive Type 347 stainless steel could be biologically transferred from sediment through a marine food chain, and whether corrosion products dissolved in seawater could be bioaccumulated and then eliminated. Corrosion products containing 60 Co and 63 Ni from the radioactive stainless steel were introduced into marine sediments. Infaunal polychaete worms exposed to these sediments bioaccumulated the radionuclides. The feeding of these worms to shrimp and fish resulted in a trophic transfer of the radioactive products across a one-step food chain. The magnitude of the transfers are described in terms of transfer factors. Dissolved corrosion products as measured by the radionuclides were also bioaccumulated by shrimp and fish concentrating more than fish. Concentration factors were calculated
Simulation of radionuclide transfer in agricultural food chains
International Nuclear Information System (INIS)
Matthies, M.; Eisfeld, K.; Mueller, H.; Paretzke, H.G.; Proehl, G.; Wirth, E.
1982-12-01
Radioactive releases from nuclear facilities could pose longterm potential hazards to man if radionuclides enter food chains leading to man. The aim of the study was to develop radioecological and dosimetric models for the assessments of the activity intake by man via ingestion and the resulting radiation exposure for members of the population, in particular after accidental releases from fuel reprocessing plants and related installations. A dynamic compartment model for the transfer of radionuclides through agricultural food chains has been developed. Special emphasis is given to the time dependence and the biological and site specific variability of the various transfer and accumulation processes. Agricultural practices representative for Western Europe have been taken into consideration for food production (grain, potatoes, vegetables, beef and pork, milk). For the most relevant long-lived radionuclides a short-term initial deposition of 1 Ci/km 2 on agricultural areas at different months has been assumed and the time dependent transport through various food chains has been assessed. As a main result great differences have been calculated for the various months of releases because of plant foliar uptake and translocation into edible parts of the plants during the vegetation cycle. The potential activity intake over 50 years for the various nuclides and the resulting radiation exposure is dominated by the first two years after the release if no food restrictions are assumed. (orig./MG) [de
Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran
2014-01-01
Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404
Directory of Open Access Journals (Sweden)
Oliinyk O. S.
2014-02-01
Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.
Calculation of energy transfer by fission fragments from plane uranium layer to thin wire
International Nuclear Information System (INIS)
Pikulev, A.A.
2006-01-01
Energy transfer from a flat fissile uranium slab to a fine wire via fission fragments is calculated. The rate of energy transfer versus the thicknesses of the slab and protecting aluminum film, as well as the wire-slab gap, is found. An expression for the absorption coefficient of the wire is derived, and the effect the thickness of the wire has on the energy transfer process is studied. The amount of the edge effect for a finite-size uranium slab is demonstrated with calculations for vacuum conditions and for argon under a pressure of 0.25 atm [ru
Hwang, Sang-Yeon; Kim, Jaewook; Kim, Woo Youn
2018-04-04
In theoretical charge-transfer research, calculation of the electronic coupling element is crucial for examining the degree of the electronic donor-acceptor interaction. The tunneling current (TC), representing the magnitudes and directions of electron flow, provides a way of evaluating electronic couplings, along with the ability of visualizing how electrons flow in systems. Here, we applied the TC theory to π-conjugated organic dimer systems, in the form of our fragment-orbital tunneling current (FOTC) method, which uses the frontier molecular-orbitals of system fragments as diabatic states. For a comprehensive test of FOTC, we assessed how reasonable the computed electronic couplings and the corresponding TC densities are for the hole- and electron-transfer databases HAB11 and HAB7. FOTC gave 12.5% mean relative unsigned error with regard to the high-level ab initio reference. The shown performance is comparable with that of fragment-orbital density functional theory, which gave the same error by 20.6% or 13.9% depending on the formulation. In the test of a set of nucleobase π stacks, we showed that the original TC expression is also applicable to nondegenerate cases under the condition that the overlap between the charge distributions of diabatic states is small enough to offset the energy difference. Lastly, we carried out visual analysis on the FOTC densities of thiophene dimers with different intermolecular alignments. The result depicts an intimate topological connection between the system geometry and electron flow. Our work provides quantitative and qualitative grounds for FOTC, showing it to be a versatile tool in characterization of molecular charge-transfer systems.
Dynamic modeling system for the transfer of radioactivity in terrestrial food chains
International Nuclear Information System (INIS)
Simmonds, J.R.; Linsley, G.S.
1981-01-01
A dynamic modeling system is described for the transfer of radionuclides in terrestrial food chains. The main features of the system are its ability to predict the time dependence of the major transfer processes and its flexibility and applicability to a range of contamination scenarios. The modeling system is regarded as a basic framework on which more realistic models can be based, given the availability of reliable environmental transfer data. An example of such a development is included for 90 Sr in the pasture-cow-milk pathway. The model predicts annual average concentrations of 90 Sr in milk caused by fallout in the United Kingdom to within 15% of measured values for over most of the 20-y period for which data exist. It makes possible the evaluation of the time dependence of the contributions of various transfer processes. Following acute releases to the atmosphere or releases in any other contamination scenario where direct deposition is absent, certain pathways often not considered in food-chain models, such as the external contamination of plants caused by resuspension processes or the ingestion of contaminants together with soil by grazing animals, are shown to be potentially important in the transfer of activity to man. The main application of dynamic food-chain models is the prediction of the consequences of accidental releases to the terrestrial environment. The predictions can be used in planning countermeasures and in assessing the health, economic, and social impacts of accidental release
A general model for the transfer of radioactive materials in terrestrial food chains
International Nuclear Information System (INIS)
Simmonds, J.R.; Linsley, G.S.; Jones, J.A.
1979-09-01
A general methodology for modelling the transfer of radionuclides in the food chains to man is described. The models are dynamic in nature so that the long-term time dependence of processes in environmental materials can be represented, for example, the build-up of activity concentrations in soils during continuous deposition from atmosphere. Modules for radionuclide migration are described in well-mixed (cultivated) soil and undisturbed soil (pasture). The methods by which the transfer coefficients used in plant and animal modules are derived are also given. The foodstuffs considered are those derived from green vegetables, grain, and root vegetables together with meat and liver products from the cow and sheep and cow dairy products. The dynamic model permits the time dependence of food chain transfer processes to be represented for different land contamination scenarios; in particular, the model can be adapted to represent behaviour following a single deposit. Using the sensitivity of results to the variation of transfer parameters the model can be used to determine the parts of the food chain where improved data would be most effective in increasing the reliability of radiological assessments; a worked example is given. (author)
Theoretical study of chain transfer to solvent reactions of alkyl acrylates.
Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud
2014-07-24
This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.
International Nuclear Information System (INIS)
Karlish, S.J.D.; Goldshleger, R.; Stein, W.D.
1990-01-01
Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the α chain, a largely intact β chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the α chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein
Energy Technology Data Exchange (ETDEWEB)
Karlish, S.J.D.; Goldshleger, R. (Weizmann Institute of Science, Rehovot (Israel)); Stein, W.D. (Hebrew Univ. Jerusalem (Israel))
1990-06-01
Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the {alpha} chain, a largely intact {beta} chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the {alpha} chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein.
Optimization of excitation transfer in a spin chain
International Nuclear Information System (INIS)
Gurman, Vladimir I.; Guseva, Irina S.; Fesko, Oles V.
2016-01-01
A revised formulation of the problem of fastest transfer of the excitation in a spin chain is considered on the base of Shrödinger equation which Hamiltonian depends linearly on control. It is taken into account that the excitation of the first or last spin means that it has greatest amplitude equal to the chain invariant whereas its phase is undefined and can be considered as an additional control variable. The role of this additional control is analyzed via transformation of the original problem with unbounded linear control to the regular derived problem known from the theory of degenerate problems [1, 2], in the same way as in [2]. The overall procedure is demonstrated in computational experiments with the use of visual examples.
Polonium (210Po) and lead (210Pb) in marine organisms and their transfer in marine food chains
International Nuclear Information System (INIS)
Carvalho, Fernando P.
2011-01-01
The determination of 210 Po and 210 Pb was performed in marine organisms from the seashore to abyssal depths, encompassing a plethora of species from the microscopic plankton to the sperm whale. Concentrations of those radionuclides ranged from low values of about 5 x 10 -1 Bq kg -1 (wet wt.) in jellyfish, to very high values of about of 3 x 10 4 Bq kg -1 (wet wt.) in the gut walls of sardines, with a common pattern of 210 Po > 210 Pb.These radionuclides are primarily absorbed from water and concentrated by phyto- and microzooplankton, and then are transferred to the next trophic level along marine food chains. Investigation in epipelagic, mesopelagic, bathypelagic and abyssobenthic organisms revealed that 210 Po is transferred in the marine food webs with transfer factors ranging from 0.1 to 0.7, and numerically similar to those of the energy transfer in the marine food chains. As 210 Po preferentially binds to amino acids and proteins, its transfer in food chains likely traces protein transfer and, thus, 210 Po transfer factors are similar to ecotrophic coefficients. 210 Pb is transferred less efficiently in marine food chains and this contributes to increased 210 Po: 210 Pb activity ratios in some trophic levels.
Polonium (210Po) and lead (210Pb) in marine organisms and their transfer in marine food chains.
Carvalho, Fernando P
2011-05-01
The determination of (210)Po and (210)Pb was performed in marine organisms from the seashore to abyssal depths, encompassing a plethora of species from the microscopic plankton to the sperm whale. Concentrations of those radionuclides ranged from low values of about 5 × 10(-1) Bq kg(-1) (wet wt.) in jellyfish, to very high values of about of 3 × 10(4) Bq kg(-1) (wet wt.) in the gut walls of sardines, with a common pattern of (210)Po > (210)Pb.These radionuclides are primarily absorbed from water and concentrated by phyto- and microzooplankton, and then are transferred to the next trophic level along marine food chains. Investigation in epipelagic, mesopelagic, bathypelagic and abyssobenthic organisms revealed that (210)Po is transferred in the marine food webs with transfer factors ranging from 0.1 to 0.7, and numerically similar to those of the energy transfer in the marine food chains. As (210)Po preferentially binds to amino acids and proteins, its transfer in food chains likely traces protein transfer and, thus, (210)Po transfer factors are similar to ecotrophic coefficients. (210)Pb is transferred less efficiently in marine food chains and this contributes to increased (210)Po:(210)Pb activity ratios in some trophic levels. Copyright © 2010 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Loft, N. J. S.; Marchukov, O. V.; Petrosyan, D.
2016-01-01
We have developed an efficient computational method to treat long, one-dimensional systems of strongly-interacting atoms forming self-assembled spin chains. Such systems can be used to realize many spin chain model Hamiltonians tunable by the external confining potential. As a concrete...... demonstration, we consider quantum state transfer in a Heisenberg spin chain and we show how to determine the confining potential in order to obtain nearly-perfect state transfer....
Absolute Charge Transfer and Fragmentation Cross Sections in He2+-C60 Collisions
International Nuclear Information System (INIS)
Rentenier, A.; Moretto-Capelle, P.; Bordenave-Montesquieu, D.; Bordenave-Montesquieu, A.; Ruiz, L. F.; Diaz-Tendero, S.; Alcami, M.; Martin, F.; Zarour, B.; Hanssen, J.; Hervieux, P.-A.; Politis, M. F.
2008-01-01
We have determined absolute charge transfer and fragmentation cross sections in He 2+ +C 60 collisions in the impact-energy range 0.1-250 keV by using a combined experimental and theoretical approach. We have found that the cross sections for the formation of He + and He 0 are comparable in magnitude, which cannot be explained by the sole contribution of pure single and double electron capture but also by contribution of transfer-ionization processes that are important even at low impact energies. The results show that multifragmentation is important only at impact energies larger than 40 keV; at lower energies, sequential C 2 evaporation is the dominant process
Influence of dispersants on trophic transfer of petroleum hydrocarbons in a marine food chain
International Nuclear Information System (INIS)
Wolfe, M. F.; Schwartz, G. J. B.; Singaram, S.; Tjeerdema, R. S.
1997-01-01
Experiments were conducted to determine the impact of dispersing agents on petroleum hydrocarbons (PH) bioavailability and trophic transfer in primary levels of a marine food chain. Uptake, bioaccumulation and metabolic transformation of a model PH, ( 1 4C)naphthalene, were measured and compared with Prudhoe Bay Crude Oil (PBCO) dispersed with Corexit 9527, and undispersed preparations of PBCO. The model food chain consisted of a primary algae producer and a primary rotifer consumer. Results showed that uptake of naphthalene increased significantly in the presence of a dispersant in algae. A significant increase in uptake was also recorded in rotifers via trophic transfer. Trophic transfer played a significant, sometimes even dominant, role in uptake and bioaccumulation. 27 refs., 6 figs
Screening models to predict food-chain transfer of environmental toxicants
International Nuclear Information System (INIS)
Johnson, J.E.; Ward, G.M.; Colorado State Univ., Fort Collins, CO
1989-01-01
The objectives of the research effort were to determine transfer coefficients to milk, beef, eggs, and poultry meat of six radionuclides for which transfer coefficients were either undetermined or based upon secondary data. The radionuclides were isotopes of Tc, Mo, Te, Ba, Zr, and Nb. In addition, 131 I was used in experiments with hens to determine egg and poultry meat transfer coefficients. The new information on transfer coefficients obtained during this project indicates that, in some cases, lower values are appropriate and that those currently in use may provide an overestimate of the risks to man from the animal food chain. The objective of the second phase of this research was to provide information to clarify the physiological parameters that control transfer of radionuclides to animal food products. The data from the first phase has been published but this data has not appeared in the literature and thus is presented here in some detail. 10 refs., 4 figs., 6 tabs
Dong, Shipeng; Xia, Tian; Yang, Yu; Lin, Sijie; Mao, Liang
2018-01-16
The growing applications of graphene materials warrant a careful evaluation of their environmental fate in aquatic food webs. Escherichia coli (Bacteria), Tetrahymena thermophila (protozoa), Daphnia magna (zooplankton), and Danio rerio (vertebrate) were used to build aquatic food chains to investigate the waterborne uptake and trophic transfer of 14 C-labeled graphene. Body burden factor (BBF) and trophic transfer factor (TTF) were analyzed for each organism and food chain to assess the bioaccumulation and biomagnification of graphene. The test organisms have high potential of accumulating graphene via direct uptake from culture medium with log-transformed BBF (log BBF) values of 3.66, 5.1, 3.9, and 1.62 for each organism, respectively. In the food chain from E. coli to T. thermophila, the calculated TTFs of 0.2 to 8.6 indicate the high trophic transfer potential in this aquatic food chain. However, the TTFs calculated for the food chain from T. thermophila to D. magna and from D. magna to D. rerio are much lower than 1, indicating that biomagnification was unlikely to occur in these food chains. Body burden measured for dietary uptake by T. thermophila, D. magna, and D. rerio are higher than that via waterborne exposure in a similar nominal concentration, respectively, indicating that trophic transfer is a nonnegligible route for the bioaccumulation of graphene in organisms.
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Carrier transfer in vertically stacked quantum ring-quantum dot chains
Energy Technology Data Exchange (ETDEWEB)
Mazur, Yu. I., E-mail: ymazur@uark.edu; Dorogan, V. G.; Benamara, M.; Salamo, G. J. [Arkansas Institute for Nanoscale Materials Science and Engineering, University of Arkansas, Fayetteville, Arkansas 72701 (United States); Lopes-Oliveira, V.; Lopez-Richard, V.; Teodoro, M. D.; Marques, G. E. [Departamento de Fisica, Universidade Federal de São Carlos, 13565-905 São Carlos, São Paulo (Brazil); Souza, L. D. de [Departamento de Fisica, Universidade Federal de São Carlos, 13565-905 São Carlos, São Paulo (Brazil); Arkansas Institute for Nanoscale Materials Science and Engineering, University of Arkansas, Fayetteville, Arkansas 72701 (United States); Wu, J.; Wang, Z. M. [State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China, Chengdu (China); Tarasov, G. G. [Institute of Semiconductor Physics, National Academy of Sciences, pr. Nauki 45, Kiev 03028 (Ukraine); Marega, E. [Instituto de Fisica de São Carlos, Universidade de São Paulo, 13.566-590 São Carlos, São Paulo (Brazil)
2015-04-21
The interplay between structural properties and charge transfer in self-assembled quantum ring (QR) chains grown by molecular beam epitaxy on top of an InGaAs/GaAs quantum dot (QD) superlattice template is analyzed and characterized. The QDs and QRs are vertically stacked and laterally coupled as well as aligned within each layer due to the strain field distributions that governs the ordering. The strong interdot coupling influences the carrier transfer both along as well as between chains in the ring layer and dot template structures. A qualitative contrast between different dynamic models has been developed. By combining temperature and excitation intensity effects, the tuning of the photoluminescence gain for either the QR or the QD mode is attained. The information obtained here about relaxation parameters, energy scheme, interlayer and interdot coupling resulting in creation of 1D structures is very important for the usage of such specific QR–QD systems for applied purposes such as lasing, detection, and energy-harvesting technology of future solar panels.
Controlled quantum-state transfer in a spin chain
International Nuclear Information System (INIS)
Gong, Jiangbin; Brumer, Paul
2007-01-01
Control of the transfer of quantum information encoded in quantum wave packets moving along a spin chain is demonstrated. Specifically, based on a relationship with control in a paradigm of quantum chaos, it is shown that wave packets with slow dispersion can automatically emerge from a class of initial superposition states involving only a few spins, and that arbitrary unspecified traveling wave packets can be nondestructively stopped and later relaunched with perfection. The results establish an interesting application of quantum chaos studies in quantum information science
ANGULAR MOMENTUM TRANSFER AND LACK OF FRAGMENTATION IN SELF-GRAVITATING ACCRETION FLOWS
International Nuclear Information System (INIS)
Begelman, Mitchell C.; Shlosman, Isaac
2009-01-01
Rapid inflows associated with early galaxy formation lead to the accumulation of self-gravitating gas in the centers of proto-galaxies. Such gas accumulations are prone to nonaxisymmetric instabilities, as in the well known Maclaurin sequence of rotating ellipsoids, which are accompanied by a catastrophic loss of angular momentum (J). Self-gravitating gas is also intuitively associated with star formation. However, recent simulations of the infall process display highly turbulent continuous flows. We propose that J-transfer, which enables the inflow, also suppresses fragmentation. Inefficient J loss by the gas leads to decay of turbulence, triggering global instabilities and renewed turbulence driving. Flow regulated in this way is stable against fragmentation, while staying close to the instability threshold for bar formation-thick self-gravitating disks are prone to global instabilities before they become unstable locally. On smaller scales, the fraction of gravitationally unstable matter swept up by shocks in such a flow is a small and decreasing function of the Mach number. We conclude counterintuitively that gas able to cool down to a small fraction of its virial temperature will not fragment as it collapses. This provides a venue for supermassive black holes to form via direct infall, without the intermediary stage of forming a star cluster. Some black holes could have formed or grown in massive halos at low redshifts. Thus the fragmentation is intimately related to J redistribution within the system: it is less dependent on the molecular/metal cooling but is conditioned by the ability of the flow to develop virial, supersonic turbulence.
Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko
2012-10-01
We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.
Transfer map approach to and optical effects of energy degraders in fragment separators
Directory of Open Access Journals (Sweden)
B. Erdelyi
2009-01-01
Full Text Available A second order analytical and an arbitrary order numerical procedure is developed for the computation of transfer maps of energy degraders. The incorporation of the wedges into the optics of fragment separators for next-generation exotic beam facilities, their optical effects, and the optimization of their performance is studied in detail. It is shown how to place and shape the degraders in the system such that aberrations are minimized and resolving powers are maximized.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Energy Technology Data Exchange (ETDEWEB)
Carvalho, Fernando P., E-mail: carvalho@itn.p [Instituto Tecnologico e Nuclear, Departamento de Proteccao Radiologica e Seguranca Nuclear, E.N. 10, 2686-953 Sacavem (Portugal)
2011-05-15
The determination of {sup 210}Po and {sup 210}Pb was performed in marine organisms from the seashore to abyssal depths, encompassing a plethora of species from the microscopic plankton to the sperm whale. Concentrations of those radionuclides ranged from low values of about 5 x 10{sup -1} Bq kg{sup -1} (wet wt.) in jellyfish, to very high values of about of 3 x 10{sup 4} Bq kg{sup -1} (wet wt.) in the gut walls of sardines, with a common pattern of {sup 210}Po > {sup 210}Pb.These radionuclides are primarily absorbed from water and concentrated by phyto- and microzooplankton, and then are transferred to the next trophic level along marine food chains. Investigation in epipelagic, mesopelagic, bathypelagic and abyssobenthic organisms revealed that {sup 210}Po is transferred in the marine food webs with transfer factors ranging from 0.1 to 0.7, and numerically similar to those of the energy transfer in the marine food chains. As {sup 210}Po preferentially binds to amino acids and proteins, its transfer in food chains likely traces protein transfer and, thus, {sup 210}Po transfer factors are similar to ecotrophic coefficients. {sup 210}Pb is transferred less efficiently in marine food chains and this contributes to increased {sup 210}Po:{sup 210}Pb activity ratios in some trophic levels.
Free radical transfer in polymers
International Nuclear Information System (INIS)
Sonntag, C. von; Bothe, E.; Ulanski, P.
1998-01-01
For the present study of free-radical transfer in polymers pulse radiolysis and product studies have been carried out in aqueous solutions using thus far only the water-soluble polymers polyacrylic acid, polymethacrylic acid and polyvinyl alcohol. When OH radicals, generated in the radiolysis of N 2 O-saturated aqueous solutions, react with polymers the lifetime of the polymer radical thus created very much depends on the number of radicals per polymer chain. When there are a large number of radicals per chain their bimolecular decay may be faster than the corresponding (diffusion controlled) decay of monomeric radicals, but when the macromolecule contains only few or even just one radical their lifetime is considerably prolonged. Highly charged polymers such as polyacrylic acid at high pH attain a rod-like conformation which again favors a long lifetime of the radicals. Under such conditions, radical transfer reactions can occur. For example, in polyacrylic acid OH radicals generate two kinds of radicals side by side. The radical in β-position to the carboxylate group converts into the thermodynamically more stable α-radicals by an H-transfer reaction as can be followed by spectrophotometry. Besides radical transfer reactions β-fragmentation reactions occur causing chain scission. Such reactions can be followed in a pulse radiolysis experiment by conductometry, because counter ions are released upon chain scission. Such a process is especially effective in the case of polymethacrylic acid, where it results in a chain depolymerization. An intramolecular H-abstraction is also observed in the γ-radiolysis of polyacrylic acid with the corresponding peroxyl radicals. This causes a chain reaction to occur. The resulting hydroperoxides are unstable and decarboxylate given rise to acetylacetone-like products. In polyvinyl alcohol the peroxyl radicals in α-position to the alcohol function undergo HO 2 -elimination. This prevents a scission of the polymer chain in the
International Nuclear Information System (INIS)
Rogival, Damien; Scheirs, Jan; Blust, Ronny
2007-01-01
We studied the accumulation and transfer of As, Cd, Cu, Pb and Zn in the compartments of a soil-diet-wood mouse (Apodemus sylvaticus) food chain at five sites located along a metal pollution gradient. We observed a clear gradient in metal exposure at increasing distance from the smelter in all compartments of the food chain for the non-essential metals. The gradient was less clear or absent for the essential metals in acorn and mice target tissues. Regression analysis showed overall strong relationships within the soil-diet and diet-wood mouse compartments for the non-essential metals, while relationships for the essential metals were weak or absent. Total metal in soil appeared as a better predictor for the diet metal content than the available metal fraction. Our results suggest a more important transfer of non-essential elements through the food chain than essential elements, which is probably a consequence of homeostatic control of the latter group. - Non-essential metal transfer through a soil-diet-wood mouse food chain is more important than essential metal transfer
Inferring properties of disordered chains from FRET transfer efficiencies
Zheng, Wenwei; Zerze, Gül H.; Borgia, Alessandro; Mittal, Jeetain; Schuler, Benjamin; Best, Robert B.
2018-03-01
Förster resonance energy transfer (FRET) is a powerful tool for elucidating both structural and dynamic properties of unfolded or disordered biomolecules, especially in single-molecule experiments. However, the key observables, namely, the mean transfer efficiency and fluorescence lifetimes of the donor and acceptor chromophores, are averaged over a broad distribution of donor-acceptor distances. The inferred average properties of the ensemble therefore depend on the form of the model distribution chosen to describe the distance, as has been widely recognized. In addition, while the distribution for one type of polymer model may be appropriate for a chain under a given set of physico-chemical conditions, it may not be suitable for the same chain in a different environment so that even an apparently consistent application of the same model over all conditions may distort the apparent changes in chain dimensions with variation of temperature or solution composition. Here, we present an alternative and straightforward approach to determining ensemble properties from FRET data, in which the polymer scaling exponent is allowed to vary with solution conditions. In its simplest form, it requires either the mean FRET efficiency or fluorescence lifetime information. In order to test the accuracy of the method, we have utilized both synthetic FRET data from implicit and explicit solvent simulations for 30 different protein sequences, and experimental single-molecule FRET data for an intrinsically disordered and a denatured protein. In all cases, we find that the inferred radii of gyration are within 10% of the true values, thus providing higher accuracy than simpler polymer models. In addition, the scaling exponents obtained by our procedure are in good agreement with those determined directly from the molecular ensemble. Our approach can in principle be generalized to treating other ensemble-averaged functions of intramolecular distances from experimental data.
Çetinkaya, Onur; Demirci, Gökhan; Mergo, Paweł
2017-08-01
Investigation of molecular weight and optical properties of poly(methyl metacrylate) (PMMA) polymerized in house with different chain transfer agents was studied. Isopropyl alcohol (IPA), n-butyl mercaptan (nBMC) and pentamethyl disilane (PMDS) were used as chain transfer agents. The molecular weight (Mw) of PMMA samples were measured by Ostwald viscometer. Mw of bulk polymer samples were decreased with increase the concentration of chain transfer agents (CTA). Since reactivity of used CTAs is not same, molecular weights of samples which were produced with different type of CTA but same concentration of CTA was varied. Higher concentration of n-BMC showed higher scattering. Transmission of samples could not be correlated with different concentration of CTA. Refractive index of samples was not affected by concentration of CTA nevertheless higher molecular weight of CTA showed higher refractive index.
Zhang, Can; Wang, Xingmin; Ashraf, Umair; Qiu, Baoli; Ali, Shaukat
2017-09-01
Contamination of soil with heavy metals has become an issue of concern on global scale. This study investigates the translocation of lead (Pb) along the soil - plant (eggplant and tomato) - mealybug (Dysmicoccus neobrevipes) - ladybird beetle (Cryptolaemus montrouzieri) food chain. Soil amendments used for this study were adjusted to 0, 25, 50 and 100mg/kg of Pb (w/w). The results revealed significantly higher transfer of Pb in tomato when compared to eggplant. Bio-magnification of Pb (2-4 times) was observed for soil - root transfer whereas Pb was bio-minimized in later part of food chain (shoot - mealybug - ladybird transfer). A dose dependent increase in transfer of Pb across the multi-trophic food chain was observed for both host plants. A decrease in coefficients of Pb transfer (from root - shoot and shoot - mealybug) was observed with increase in Pb concentrations. Our results also showed removal of Pb from the bodies of ladybird beetle during metamorphosis. Further studies are required to explain the mechanisms or physiological pathways involved in the bio-minimization of Pb across the food chain. Copyright © 2017 Elsevier Inc. All rights reserved.
Completion of autobuilt protein models using a database of protein fragments
International Nuclear Information System (INIS)
Cowtan, Kevin
2012-01-01
Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature
International Nuclear Information System (INIS)
Denschlag, H.O.; Braun, H.; Wolfsberg, K.
1979-01-01
The fission product yields of the members of the decay chains 132 to 137, 99, and 102 in 235 U(n/sub th/,f) were measured at various kinetic energies and ionic charge states of the fragments using the mass separator for unslowed fission products LOHENGRIN. The results are discussed with respect to four aspects: A preferential formation of neutron rich chain members found at high kinetic energy of the fragments is predominantly due to decreasing prompt neutron evaporation. A particularly large effect in chain 132 is attributed to the double shell closure in Sn-132. The persistence of an even-odd pairing effect in the yields throughout the range of kinetic energies studied leads to the conclusion that the high internal excitation energy of the fragments is tied up mainly in the form of collective energy (e.g., deformation energy) rather than single particle excitation. Generally, the yield distribution at constant kinetic energy is invariant with respect to the ionic charge state of the isotopes separated. Deviations from this behavior found in chains 99, 102, 133, and 136 are interpreted as being due to Auger events following a converted transition in the decay of ns-isomers taking place in the vacuum of the separator. A pronounced variation of the independent formation ratio of single isomeric states with the kinetic energy of the fragments is providing direct information on the controversial topic of the change of angular momentum of fission fragments as a function of deformation (scission distance). 34 references
Directory of Open Access Journals (Sweden)
R. Léguillon
2016-10-01
Full Text Available It is shown that the multinucleon transfer reactions is a powerful tool to study fission of exotic neutron-rich actinide nuclei, which cannot be accessed by particle-capture or heavy-ion fusion reactions. In this work, multinucleon transfer channels of the 18O+232Th reaction are used to study fission of fourteen nuclei 231,232,233,234Th, 232,233,234,235,236Pa, and 234,235,236,237,238U. Identification of fissioning nuclei and of their excitation energy is performed on an event-by-event basis, through the measurement of outgoing ejectile particle in coincidence with fission fragments. Fission fragment mass distributions are measured for each transfer channel, in selected bins of excitation energy. In particular, the mass distributions of 231,234Th and 234,235,236Pa are measured for the first time. Predominantly asymmetric fission is observed at low excitation energies for all studied cases, with a gradual increase of the symmetric mode towards higher excitation energy. The experimental distributions are found to be in general agreement with predictions of the fluctuation–dissipation model.
Revealing the Supramolecular Nature of Side-Chain Terpyridine-Functionalized Polymer Networks
Directory of Open Access Journals (Sweden)
Jérémy Brassinne
2015-01-01
Full Text Available Nowadays, finely controlling the mechanical properties of polymeric materials is possible by incorporating supramolecular motifs into their architecture. In this context, the synthesis of a side-chain terpyridine-functionalized poly(2-(dimethylaminoethyl methacrylate is reported via reversible addition-fragmentation chain transfer polymerization. By addition of transition metal ions, concentrated aqueous solutions of this polymer turn into metallo-supramolecular hydrogels whose dynamic mechanical properties are investigated by rotational rheometry. Hence, the possibility for the material to relax mechanical constrains via dissociation of transient cross-links is brought into light. In addition, the complex phenomena occurring under large oscillatory shear are interpreted in the context of transient networks.
Bozovic, J.S.; Tello Manon, H.M; Meuldijk, J.; Koning, C.E.; Klumperman, B.
2007-01-01
Reversible addition fragmentation chain transfer (RAFT)-mediated polymerization was successfully applied for the synthesis of poly(4-vinylpyridine) (P4VP) polymers of predetermined molar mass and of low polydispersity index. These RAFT end-functionalized polymers were then used as macro-RAFT agents
Bu, Dawei; Zhou, Yuwei; Tang, Jian; Jing, Fang; Zhang, Wei
2013-12-01
Abnormal brain natriuretic peptide (BNP) secretion is regarded as the dominating mechanism of cerebral salt wasting syndrome (CSW), which results from a renal loss of sodium and water during intracranial disease leading to hyponatremia. Scale preparation of therapeutic single-chain variable fragment (scFv) that can neutralize elevated circulating BNP may have potential value for clinical use. In this report, we used a recently isolated humanized anti-BNP scFv fragment (3C1) as model antibody (Ab) to evaluate the potential of scale production of this therapeutic protein. The truncated gene encoding for scFv fragment cloned in pET22b (+) was mainly overexpressed as inclusion bodies in Escherichia coli (E. coli) Rosetta (DE3) pLysS cells. The insoluble fragment was solubilized and purified by Ni-NTA agarose resin under denaturation conditions, and recovered via an effective refolding buffer containing 50 mM Tris-HCl, pH 8.0, 0.15 M NaCl, 1 mM EDTA, 0.5 M arginine, 2 mM GSH, 1 mM GSSG, and 5% glycerol. The refolded scFv fragment was concentrated by PEG20000, and dialyzed in PBS (containing 5% glycerol, pH 7.4). The final yield was approximately 10.2 mg active scFv fragment per liter of culture (3.4 g wet weight cells). The scFv fragment was more than 95% pure assessed by SDS-PAGE assay. Recombinant scFv fragment with His tag displayed its immunoreactivity with anti-His tag Ab by western blotting. ELISA showed the scFv fragment specifically bound to BNP, and it displayed similar activity as the traditional anti-BNP monoclonal Ab (mAb). Thus, the current strategy allows convenient small-scale production of this therapeutic protein. Copyright © 2013 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Abbasi, Maisam; Sternberg, Henrik; Nilsson, Fredrik
2014-01-01
that impact the cost and time requirements from customers of logistics services are not yet a reality. Research limitations/implications (if applicable) This paper implies that LSP sustainability cannot be investigated in isolation if a company does not manage proprietary resources. Practical implications (if......Purpose The purpose of this article is to explore the environmental impact of Logistics Service Provider (LSP) activities in the light of increased customer attention and fragmentation of the industry. It also explores to what extent the LSPs can actually monitor the environmental impact...... of logistics activities in the supply chain? Design/methodology/approach The methodology of this paper is a literature review, a qualitative interview survey, and three case studies. A framework on sustainability challenges in supply chains derived from the literature is used to structure and analyze...
Joosten, V.; Roelofs, M.S.; Dries, N. van den; Goosen, T.; Verrips, C.T.; Hondel, C.A.M.J.J. van den; Lokman, B.C.
2005-01-01
The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5′- or 3′-terminal ends of the gene encoding llama variable heavy chain antibody fragment VHH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which
Spin-state transfer in laterally coupled quantum-dot chains with disorders
International Nuclear Information System (INIS)
Yang Song; Bayat, Abolfazl; Bose, Sougato
2010-01-01
Quantum dot arrays are a promising medium for transferring quantum information between two distant points without resorting to mobile qubits. Here we study the two most common disorders, namely hyperfine interaction and exchange coupling fluctuations, in quantum dot arrays and their effects on quantum communication through these chains. Our results show that the hyperfine interaction is more destructive than the exchange coupling fluctuations. The average optimal time for communication is not affected by any disorder in the system and our simulations show that antiferromagnetic chains are much more resistive than the ferromagnetic ones against both kind of disorders. Even when time modulation of a coupling and optimal control is employed to improve the transmission, the antiferromagnetic chain performs much better. We have assumed the quasistatic approximation for hyperfine interaction and time-dependent fluctuations in the exchange couplings. Particularly for studying exchange coupling fluctuations we have considered the static disorder, white noise, and 1/f noise.
Supramolecular Nanoparticles via Single-Chain Folding Driven by Ferrous Ions.
Wang, Fei; Pu, Hongting; Jin, Ming; Wan, Decheng
2016-02-01
Single-chain nanoparticles can be obtained via single-chain folding assisted by intramolecular crosslinking reversibly or irreversibly. Single-chain folding is also an efficient route to simulate biomacromolecules. In present study, poly(N-hydroxyethylacrylamide-co-4'-(propoxy urethane ethyl acrylate)-2,2':6',2''-terpyridine) (P(HEAm-co-EMA-Tpy)) is synthesized via reversible addition fragmentation chain transfer polymerization. Single-chain folding and intramolecular crosslinking of P(HEAm-co-EMA-Tpy) are achieved via metal coordination chemistry. The intramolecular interaction is characterized on ultraviolet/visible spectrophotometer (UV-vis spectroscopy), proton nuclear magnetic resonance ((1)H NMR), and differential scanning calorimetry (DSC). The supramolecular crosslinking mediated by Fe(2+) plays an important role in the intramolecular collapsing of the single-chain and the formation of the nanoparticles. The size and morphology of the nanoparticles can be controlled reversibly via metal coordination chemistry, which can be characterized by dynamic light scattering (DLS), transmission electron microscope (TEM), and atomic force microscope (AFM). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.
Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas
2014-12-01
The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Transfer coefficient study of Sr-90 in the soil-grass-milk chain for Cuba
International Nuclear Information System (INIS)
Zerquera, J. T.; Sarria P, R.
1996-01-01
One of the most important problems in modern radioecology is the lack of able information about the features of radionuclide migration in tropical and subtropical environment. The development of nuclear energy and the enhancing in the applications of nuclear techniques in those latitudes indicate that studies in this area are necessary. Cuba is carrying out studies on radioecological characterization of the principal food chains in the country. One of the objectives of these studies is to define the values of the transfer coefficients to be used in the evaluation programs for the assessment of the radiological impact of practices which involve ionizing radiation. This paper shows the results obtained in the determination of Sr-90 transfer coefficients in soil-grass-milk food chain in 'La Quebrada', a place near the Havana City where an important part of the milk that the citizens consume is produced. Transfer coefficients for Sr-90 were calculated on the basis of data collected during 5 years in the region. Soil-grass transfer coefficients are in the range 0.18-5 while grass-milk coefficients are in the range of 1.2x10 -4 - 6x10 -3 day/L. These values are in accordance with values reported by other authors in the literature. (authors). 4 refs., 2 tabs
Energy Technology Data Exchange (ETDEWEB)
Zhao Jing [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Graduate School of Chinese Academy of Sciences, Beijing 100039 (China); Chen Miao [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)], E-mail: miaochen99@yahoo.com; An Yanqing [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Graduate School of Chinese Academy of Sciences, Beijing 100039 (China); Liu Jianxi [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Yan Fengyuan [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)], E-mail: fyyan@lzb.ac.cn
2008-12-30
A radical chain-transfer polymerization technique has been applied to graft-polymerize brushes of polystyrene (PSt) on single-crystal silicon substrates. 3-Mercapto-propyltrimethoxysilane (MPTMS), as a chain-transfer agent for grafting, was immobilized on the silicon surface by a self-assembling process. The structure and morphology of the graft-functionalized silicon surfaces were characterized by the means of contact-angle measurement, ellipsometric thickness measurement, Fourier transformation infrared (FTIR) spectroscopy, and atomic force microscopy (AFM). The nanotribological and micromechanical properties of the as-prepared polymer brush films were investigated by frictional force microscopy (FFM), force-volume analysis and scratch test. The results indicate that the friction properties of the grafted polymer films can be improved significantly by the treatment of toluene, and the chemically bonded polystyrene film exhibits superior scratch resistance behavior compared with the spin-coated polystyrene film. The resultant polystyrene brush film is expected to develop as a potential lubrication coating for microelectromechanical systems (MEMS)
Geometrical scaling of jet fragmentation photons
Energy Technology Data Exchange (ETDEWEB)
Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)
2016-12-15
We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.
McDonald, Sarah K; Fleming, Karen G
2016-06-29
Quantitating and understanding the physical forces responsible for the interactions of biomolecules are fundamental to the biological sciences. This is especially challenging for membrane proteins because they are embedded within cellular bilayers that provide a unique medium in which hydrophobic sequences must fold. Knowledge of the energetics of protein-lipid interactions is thus vital to understand cellular processes involving membrane proteins. Here we used a host-guest mutational strategy to calculate the Gibbs free energy changes of water-to-lipid transfer for the aromatic side chains Trp, Tyr, and Phe as a function of depth in the membrane. This work reveals an energetic gradient in the transfer free energies for Trp and Tyr, where transfer was most favorable to the membrane interfacial region and comparatively less favorable into the bilayer center. The transfer energetics follows the concentration gradient of polar atoms across the bilayer normal that naturally occurs in biological membranes. Additional measurements revealed nearest-neighbor coupling in the data set are influenced by a network of aromatic side chains in the host protein. Taken together, these results show that aromatic side chains contribute significantly to membrane protein stability through either aromatic-aromatic interactions or placement at the membrane interface.
Zeng, Xiancheng; Hu, Xiangqian; Yang, Weitao
2012-12-11
A fragment-based fractional number of electron (FNE) approach, is developed to study entire electron transfer (ET) processes from the electron donor region to the acceptor region in condensed phase. Both regions are described by the density-fragment interaction (DFI) method while FNE as an efficient ET order parameter is applied to simulate the electron transfer process. In association with the QM/MM energy expression, the DFI-FNE method is demonstrated to describe ET processes robustly with the Ru 2+ -Ru 3+ self-exchange ET as a proof-of-concept example. This method allows for systematic calculations of redox free energies, reorganization energies, and electronic couplings, and the absolute ET rate constants within the Marcus regime.
Directory of Open Access Journals (Sweden)
Barth Stefan
2005-01-01
Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.
International Nuclear Information System (INIS)
Teoule, R.; Duplaa, A.M.
1987-01-01
Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)
Joosten, V.; Roelofs, M.S.; Dries, van den N.; Goosen, T.; Verrips, C.T.; Hondel, van den C.A.M.J.J.; Lokman, B.C.
2005-01-01
The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5'- or 3'-terminal ends of the gene encoding llama variable heavy chain antibody fragment V-HH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which
Energy Technology Data Exchange (ETDEWEB)
Wan, Qing; Tian, Jianwen; Liu, Meiying; Zeng, Guangjian; Huang, Qiang [Department of Chemistry, Nanchang University, 999 Xuefu Avenue, Nanchang, 330031 (China); Wang, Ke; Zhang, Qingsong [Department of Chemistry and the Tsinghua Center for Frontier Polymer Research, Tsinghua University, Beijing, 100084 (China); Deng, Fengjie, E-mail: fengjiedeng@aliyun.com [Department of Chemistry, Nanchang University, 999 Xuefu Avenue, Nanchang, 330031 (China); Zhang, Xiaoyong, E-mail: xiaoyongzhang1980@gmail.com [Department of Chemistry, Nanchang University, 999 Xuefu Avenue, Nanchang, 330031 (China); Wei, Yen, E-mail: weiyen@tsinghua.edu.cn [Department of Chemistry and the Tsinghua Center for Frontier Polymer Research, Tsinghua University, Beijing, 100084 (China)
2015-08-15
Graphical abstract: A novel strategy combination of mussel inspired chemistry and chain transfer free radical polymerization has been developed for surface modification of carbon nanotubes with polymers for the first time. - Highlights: • Surface modification of CNTs via mussel inspired chemistry. • Preparation of aminated polymers through free radical polymerization. • Functionalized CNTs with aminated polymers via Michael addition reaction. • Highly dispersed CNTs in organic and aqueous solution. - Abstract: In this work, a novel strategy for surface modification of carbon nanotubes (CNTs) was developed via combination of mussel inspired chemistry and chain transfer free radical polymerization. First, pristine CNTs were functionalized with polydopamine (PDA), which is formed via self-polymerization of dopamine in alkaline conditions. These PDA functionalized CNTs can be further reacted with amino-terminated polymers (named as PDMC), which was synthesized through chain transfer free radical polymerization using cysteamine hydrochloride as chain transfer agent and methacryloxyethyltrimethyl ammonium chloride as the monomer. PDMC perfectly conjugated with CNT-PDA was ascertained by a series of characterization techniques including transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), thermal gravimetric analysis (TGA) and X-ray photoelectron spectroscopy (XPS). The dispersibility of obtained CNT nanocomposites (named as CNT-PDA-PDMC) was further examined. Results showed that the dispersibility of CNT-PDA-PDMC in aqueous and organic solutions was obviously enhanced. Apart from PDMC, many other amino-terminated polymers can also be used to functionalization of CNTs via similar strategy. Therefore, the method described in this work should be a general strategy for fabrication various polymer nanocomposites.
RADAL: a dynamic model for the transfer of radionuclides through agricultural food chains
International Nuclear Information System (INIS)
Jerez Vegueria, S.F.; Frometa Suarez, I.; Jerez Vegueria, P.F.
1996-01-01
The contamination of agricultural products by radionuclides is a mechanism which results in radiation dose commitment to the population, following fallout deposits from the atmosphere to the landscape. This paper describes the structure of the dynamic food chain model RADAL. This model simulates an acute environmental transport of fallout radionuclides through agricultural food chains to man and estimates the levels of radiation doses resulting from consumption of contaminated food. The development of RADAL was based on different existing models. For mathematical representation the transport of radionuclides was modeled through compartments representing environmental elements and/or food products. The model solves a set of linear, first-order, differential equations to estimate the concentrations of radionuclides in soil, vegetation, animal tissues and animal products as a function of time following their deposition. Dynamic physico-chemical processes of the model include the following: deposition and foliar interception, weathering, foliar absorption, soil resuspension, transfer from soil surface to the root zone, absorption by plant roots, transfer to deep soil, transfer to animal products, and human consumption of agricultural products. A parameter sensitivity analyses, performed for the main parameters of the model, showed that the foliar interception constant and resuspension factor are the most influential parameters over the radiation doses / model output. (author)
Smeets, N.M.B.; Meda, U.S.; Heuts, J.P.A.; Keurentjes, J.T.F.; Herk, van A.M.; Meuldijk, J.
2007-01-01
For the application of catalytic chain transfer in (mini)emulsion polymerization, catalyst partitioning and deactivation are key parameters that govern the actual catalyst concentration at the locus of polymerization and consequently the final molecular weight distribution. A global model, based on
Directory of Open Access Journals (Sweden)
Desiderio García-Almeida
2018-01-01
Full Text Available Knowledge is a valuable resource that can provide a firm competitive advantages. Food and beverage practices require the existence of knowledge to effectively perform the activities in this key department for many hotels. When hotel firms grow by integrating new hotels in the organizational structure, managers usually want to transfer the knowledge underlying the key practices. However, the transfer is affected by the level of knowledge tacitness, since this characteristic is considered to render the transfer more difficult. With data from 93 new chain hotels where F&B knowledge has been transferred, the results shed some light about the tacitness of F&B knowledge and its transfer. Thus, customer service knowledge is the knowledge with the lowest degree of tacitness, and food planning, production and preparation is the most tacit. The most frequent mechanism to transfer the knowledge on food planning, production and preparation and the knowledge on management and control of purchases and consumption is the use of staff from the headquarters or other chain hotels in long-term assignments; the preferred method for F&B customer service is training courses, lectures and seminars. Moreover, the tacitness of knowledge about F&B customer service negatively affects the knowledge transfer process in several success dimensions.
DEFF Research Database (Denmark)
Tholstrup, T.; Ehnholm, C.; Jauhiainen, M.
2004-01-01
Background: Dietary medium-chain fatty acids (MCFAs) are of nutritional interest because they are more easily absorbed from dietary medium-chain triacylglycerols (MCTs) than are long-chain fatty acids from, for example, vegetable oils. It has generally been claimed that MCFAs do not increase plasma...... cholesterol, although this claim is poorly documented. Objective: We compared the effects of a diet rich in either MCFAs or oleic acid on fasting blood lipids, lipoproteins, glucose, insulin, and lipid transfer protein activities in healthy men. Design: In a study with a double-blind, randomized, crossover...... plasma total triacylglycerol (P = 0.0361), and higher plasma glucose (P = 0.033). Plasma HDL-cholesterol and insulin concentrations and activities of cholesterol ester transfer protein and phospholipid transfer protein did not differ significantly between the diets. Conclusions: Compared with fat high...
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Parameters on the radionuclide transfer in crop plants for Korean food chain dose assessment
International Nuclear Information System (INIS)
Choi, Yong Ho; Lim, K. M.; Cho, Y. H.
2001-12-01
For more realistic assessment of Korean food chain radiation doses due to the operation of nuclear facilities, it is required to use domestically produced data for radionuclide transfer parameters in crop plants. In this report, results of last about 15 years' studies on radionuclide transfer parameters in major crop plants by the Korea Atomic Energy Research Institute, were summarized and put together. Soil-to-plant transfer factors, parameters quantifying the root uptake of radionuclides, were measured through greenhouse experiments and field studies. In addition to traditional transfer factors, which are based on the activity in unit weight of soil, those based on the activity applied to unit area of soil surface were also investigated. Interception factors, translocation factors and weathering half lives, parameters in relation to direct plant contamination, were investigated through greenhouse experiments. The levels of initial plant contamination with HTO and I2 vapor were described with absorption factors. Especially for HTO vapor, 3H levels in crop plants at harvest were expressed with TFWT (tissue free water tritium) reduction factors and OBT (organically bound tritium) production factors. The above-mentioned parameters generally showed great variations with soils, crops and radionuclide species and application times. On the basis of summarized results, the points to be amended or improved in food chain dose assessment models were discussed both for normal operation and for accidental release
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain
DEFF Research Database (Denmark)
Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey
2006-01-01
The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...
International Nuclear Information System (INIS)
Erdelyi, B.; Bandura, L.; Nolen, J.
2009-01-01
A second order analytical and an arbitrary order numerical procedure is developed for the computation of transfer maps of energy degraders. The incorporation of the wedges into the optics of fragment separators for next-generation exotic beam facilities, their optical effects, and the optimization of their performance is studied in detail. It is shown how to place and shape the degraders in the system such that aberrations are minimized and resolving powers are maximized
''adding'' algorithm for the Markov chain formalism for radiation transfer
International Nuclear Information System (INIS)
Esposito, L.W.
1979-01-01
The Markov chain radiative transfer method of Esposito and House has been shown to be both efficient and accurate for calculation of the diffuse reflection from a homogeneous scattering planetary atmosphere. The use of a new algorithm similar to the ''adding'' formula of Hansen and Travis extends the application of this formalism to an arbitrarily deep atmosphere. The basic idea for this algorithm is to consider a preceding calculation as a single state of a new Markov chain. Successive application of this procedure makes calculation possible for any optical depth without increasing the size of the linear system used. The time required for the algorithm is comparable to that for a doubling calculation for a homogeneous atmosphere, but for a non-homogeneous atmosphere the new method is considerably faster than the standard ''adding'' routine. As with he standard ''adding'' method, the information on the internal radiation field is lost during the calculation. This method retains the advantage of the earlier Markov chain method that the time required is relatively insensitive to the number of illumination angles or observation angles for which the diffuse reflection is calculated. A technical write-up giving fuller details of the algorithm and a sample code are available from the author
Modelling of radiocesium transfer in the lichen-reindeer/caribou-wolf food chain
Directory of Open Access Journals (Sweden)
D. F. Holleman
1990-09-01
Full Text Available The environmental contaminate radiocesium (cesium-137 has been shown to be of value as a marker in food selection and intake studies. Its greatest potential value as a food marker is in the subarctic/arctic regions, particularly in the lichen to reindeer/caribou to wolf food chain. A kinetic model describing the movement of radiocesium through the food chain has been developed using the SAAM computer program and is presented here. The program has been written so that the various paramenters affecting the transfer of radiocesium in the food chain can be altered more realistically to describe the system being modeled. The values of the parameters as given in this example are realistic for interior Alaska, however caution should be exercised in the application of the present results to regions that may be vastly different from the Alaskan interior without first evaluating the parameters and assumptions of the model.
International Nuclear Information System (INIS)
Fourmond, V.
2007-04-01
The aim of this work is to find an efficient process to convert solar energy into hydrogen. The electrons transfers in reconstituted photosynthetic chains have been particularly studied with the aims 1)in one hand, to better understand the interactions of the different molecules of the photosynthetic chain in order to optimize the changes of the entire organisms for hydrogen production 2)in another hand, to insert the hydrogenases in a photosynthetic chain and then to photo reduce them in order to obtain kinetic data to better understand how it works. (O.M.)
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
International Nuclear Information System (INIS)
Chen Yiwang; Chen Lie; Nie Huarong; Kang, E.T.; Vora, R.H.
2005-01-01
Graft polymerization of poly(ethylene glycol) methyl ether methacrylate (PEGMA) from fluorinated polyimide (FPI) was carried out by the reversible addition-fragmentation chain transfer (RAFT)-mediated process. The peroxides generated by the ozone treatment on FPI facilitated the thermally-initiated graft copolymerization from FPI backbone. The 'living' character of the graft chain growing was ascertained in the subsequent chain extension of PEGMA. Nuclear magnetic resonance (NMR) and molecular weight measurements were used to characterize the chemical composition and structure of the copolymers. Microfiltration (MF) membranes were fabricated from the FPI-g-PEGMA comb copolymers by phase inversion in aqueous media. Surface composition analysis of the membranes scanned by X-ray photoelectron spectroscopy (XPS) revealed a substantial surface enrichment of the hydrophilic components. The pore size distribution of the resulting membranes was found to be much more uniform than that of the corresponding membranes cast from FPI-g-PEGMA prepared by the conventional radical polymerization process in the absence of the chain transfer agent. The morphology of the membranes was characterized by scanning electron microscopy (SEM)
Thomaz, Joseph E; Lawler, Christian M; Fayer, Michael D
2017-05-04
Proton transfer in the nanoscopic water channels of polyelectrolyte fuel cell membranes was studied using a photoacid, 8-hydroxypyrene-1,3,6-trisulfonic acid sodium salt (HPTS), in the channels. The local environment of the probe was determined using 8-methoxypyrene-1,3,6-trisulfonic acid sodium salt (MPTS), which is not a photoacid. Three fully hydrated membranes, Nafion (DuPont) and two 3M membranes, were studied to determine the impact of different pendant chains and equivalent weights on proton transfer. Fluorescence anisotropy and excited state population decay data that characterize the local environment of the fluorescent probes and proton transfer dynamics were measured. The MPTS lifetime and anisotropy results show that most of the fluorescent probes have a bulk-like water environment with a relatively small fraction interacting with the channel wall. Measurements of the HPTS protonated and deprotonated fluorescent bands' population decays provided information on the proton transport dynamics. The decay of the protonated band from ∼0.5 ns to tens of nanoseconds is in part determined by dissociation and recombination with the HPTS, providing information on the ability of protons to move in the channels. The dissociation and recombination is manifested as a power law component in the protonated band fluorescence decay. The results show that equivalent weight differences between two 3M membranes resulted in a small difference in proton transfer. However, differences in pendant chain structure did significantly influence the proton transfer ability, with the 3M membranes displaying more facile transfer than Nafion.
International Nuclear Information System (INIS)
Hussain, M.Sakhawat; Khan, M.A.; Ahmad, Shafique
2005-01-01
The present paper focuses on the use of a Co (II) complex, [Co(afdo-H)] as a catalytic chain transfer agent (CCTA) for controlling molecular weight in copolymerization of styrene (STY) with butyl methacrylate (BMA) and methylmethacrylate (MMA). The catalyst is structurally similar to [co(dmg-H) (BF)] patented by Du Pont as a CCTA. Average catalytic chain transfer constant, C8 of [co(afdo-H) (BF)] for coplymerization of STY with BMA and MMA determined from Maya plot, was found to be in the range of 10-10.This value is lower than the value reported for the [Co(dmg-H)(BF)). In the case of STY-BMA or STY-MMA copolymerization, a considerable reduction in the viscosity average molecular weights (Mv) was observed in the copolymers. The average molecular weight of poly (MMA-BMA) was reduced by a factor of ten compared to the reduction in poly (STY-MMA) and poly (STY-BMA) for the same concentration of the CCTA. (author)
International Nuclear Information System (INIS)
Letourneau, C.
1987-04-01
This report examines the transfer of radionuclides from the uranium and thorium decay chains (U-238, Ra-226, Th-232, Th-230, Po-210 and Pb-210) through the aquatic and terrestrial environment. This transfer is characterized by a transfer coefficient; environmental and experimental factors which cause this coefficient to vary are presented and discussed in this report. Furthermore, based on a literature survey, the report indicates the range of coefficients found for the aquatic sector (that is, sediment and freshwater and marine organisms) and for the terrestrial sector (that is, plants and domestic and wild animals). Afterwards, generalisations are formulated on the transfer of the different radionuclides through the multiple environmental compartments. 75 refs
Energy Technology Data Exchange (ETDEWEB)
Heinen, Jennifer M. (O' Donnell) [Iowa State Univ., Ames, IA (United States)
2014-12-31
This research has shown that the microstructure of self-assembled copolymers can be decoupled from the polymer chemistry. The simplest polymer architecture, linear block copolymers, is valuable for a broad range of applications, including adhesives and coatings, medical devices, electronics and energy storage, because these block copolymers reproducibly self-assemble into microphase separated nanoscale domains. Unfortunately, the self-assembled microstructure is tuned by polymer composition, thus limiting the potential to simultaneously optimize chemical, mechanical, and transport properties for desired applications. To this end, much work was been put into manipulating block copolymer self-assembly independently of polymer composition. These efforts have included the use of additives or solvents to alter polymer chain conformation, the addition of a third monomer to produce ABC triblock terpolymers, architectures with mixed blocks, such as tapered/gradient polymers, and the synthesis of other nonlinear molecular architectures. This work has shown that the microstructures formed by linear ABC terpolymers can be altered by controlling the architecture of the polymer molecules at a constant monomer composition, so that the microstructure is tuned independently from the chemical properties.
Directory of Open Access Journals (Sweden)
Evandro Prieto
2013-08-01
Full Text Available The automotive value chain has more and more been making room to a strategy of which activities of product design and production have been transferred to the module suppliers. The transfer of value-added activities occurs from assembler to the module suppliers. The former assume the role of integrators within the supply chain. The supply chain participants have started to strengths their competencies in order to obtain advantages in the economy of scale and scope. In this context, the present work aims at investigating the valued-added transfer between first and second tiers of automotive supply chain in new product development and production. The work was carried out from an evaluation of a supplier with regard to modularization. The theoretical background considers the concepts of integrated and modular architecture as well as the progressiveness of competencies among suppliers. It adopts single cased as the research methodological approach. The literature points out that the process of modularization either in product development or in production offer benefits for both sides: assemblers and suppliers. The results from the investigated supplier shows inherent benefits due to the acquisition of new technologies that enable an increase of technical and management learning in projects of new products. Therefore, it demonstrates that in this modularity environment, the potential of value-added transfer is associated to the level of progressiveness of competencies that are incorporated to deliver module solutions to assemblers; the investigated supplier can be categorized in an “embrionary” stage.
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
Ohara, Taku; Yuan, Tan Chia; Torii, Daichi; Kikugawa, Gota; Kosugi, Naohiro
2011-07-21
In this paper, the molecular mechanisms which determine the thermal conductivity of long chain polymer liquids are discussed, based on the results observed in molecular dynamics simulations. Linear n-alkanes, which are typical polymer molecules, were chosen as the target of our studies. Non-equilibrium molecular dynamics simulations of bulk liquid n-alkanes under a constant temperature gradient were performed. Saturated liquids of n-alkanes with six different chain lengths were examined at the same reduced temperature (0.7T(c)), and the contributions of inter- and intramolecular energy transfer to heat conduction flux, which were identified as components of heat flux by the authors' previous study [J. Chem. Phys. 128, 044504 (2008)], were observed. The present study compared n-alkane liquids with various molecular lengths at the same reduced temperature and corresponding saturated densities, and found that the contribution of intramolecular energy transfer to the total heat flux, relative to that of intermolecular energy transfer, increased with the molecular length. The study revealed that in long chain polymer liquids, thermal energy is mainly transferred in the space along the stiff intramolecular bonds. This finding implies a connection between anisotropic thermal conductivity and the orientation of molecules in various organized structures with long polymer molecules aligned in a certain direction, which includes confined polymer liquids and self-organized structures such as membranes of amphiphilic molecules in water.
Study on transfer coefficients of 90Sr, 137Cs, natural U, 226Ra and 239Pu in terrestrial food chains
International Nuclear Information System (INIS)
Qin Suyun; Qi Yong; Li Shuqin; Zhou Caiyun; Zhang Jingjuan; Li Jikai; Li Xuequn
1995-01-01
The aim of study was to provide values of transfer parameter of 90 Sr, 137 Cs, Natural U, 226 Ra and 239 Pu in terrestrial food chains, more applicable for Chinese socio-natural conditions. Data of radionuclides contents in agricultural crops and in associated soils, in sheep tissues and in associated grasses were collected in couples. The transfer coefficients in terrestrial food chains (soil-crops, grasses-sheep tissues) were calculated. On basis of statistical analysis, the representative values and 95% ranges of transfer coefficient for 5 radionuclides in 7 kind of agricultural products for southern moist areas and north dry areas were given. Regression analysis showed that relation between the transfer coefficients and the radionuclide contents in their associated soils present a negative correlation, it could be described with a equation: Y = aX -b
Atiqullah, Muhammad
2015-04-01
Polymerization chain termination reactions and unsaturation of the polymer backbone end are related. Therefore, in this study, the parameters resulting from the modelling of the active centre distribution of the supported catalyst - silica/MAO/(nBuCp)2ZrCl2 - were applied to evaluate the active-centre-dependent ethylene homo- and copolymerization rates, as well as the corresponding chain termination rates. This approach, from a microkinetic mechanistic viewpoint, elucidates better the 1-hexene-induced positive comonomer effect and chain transfer phenomenon. The kinetic expressions, developed on the basis of the proposed polymerization mechanisms, illustrate how the active site type-dependent chain transfer phenomenon is influenced by the different apparent termination rate constants and momoner concentrations. The active centre-specific molecular weight M ni (for the above homo- and copolymer), as a function of chain transfer probability, p CTi, varied as follows: log (p C Ti) = log (mwru) - log (Mn i), where mw ru is the molecular weight of the repeat unit. The physical significance of this finding has been explained. The homo- and copolymer backbones showed all the three chain end unsaturations (vinyl, vinylidene, and trans-vinylene). The postulated polymerization mechanisms reveal the underlying polymer chemistry. The results of the present study will contribute to develop in future supported metallocene catalysts that will be useful to synthesize polyethylene precursors having varying chain end unsaturations, which can be eventually used to prepare functional polyethylenes. [Figure not available: see fulltext.] © 2015 Indian Academy of Sciences.
Fragmentation kinetics of a Morse oscillator chain under tension
International Nuclear Information System (INIS)
Stember, Joseph N.; Ezra, Gregory S.
2007-01-01
The bond dissociation kinetics of tethered atomic (Morse potential) chains under tensile stress is studied. Both RRKM (fully anharmonic, Monte Carlo) and RRK (harmonic appproximation) theory are applied to predict bond dissociation rate constants as a function of energy and tensile force. For chains with N ≥ 3 atoms a hybrid statistical theory is used involving a harmonic approximation for motion in the transition state for bond dissociation. For chains with N = 2-5 atoms, while the RRK approximation significantly overestimates the dissociation rate constant, the fully anharmonic RRKM rate is quite close to simulation results. For the N = 2 chain, a novel approach to the extraction of decay rate constants based on the classical spectral theorem is implemented. Good agreement between the RRKM and dynamical rate constants is obtained for N = 2 despite the fact that the reactant phase space contains a significant fraction of relatively short-lived trajectories
Studies of complex fragment emission in heavy ion reactions
International Nuclear Information System (INIS)
Sobotka, L.G.
1989-01-01
The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report
International Nuclear Information System (INIS)
Plenio, Martin B; Semiao, Fernando L
2005-01-01
We demonstrate that a translation-invariant chain of interacting quantum systems can be used for high efficiency transfer of quantum entanglement and the generation of multiparticle entanglement over large distances and between arbitrary sites without the requirement of precise spatial or temporal control. The scheme is largely insensitive to disorder and random coupling strengths in the chain. We discuss harmonic oscillator systems both in the case of arbitrary Gaussian states and in situations when at most one excitation is in the system. The latter case, which we prove to be equivalent to an xy-spin chain, may be used to generate genuine multiparticle entanglement. Such a 'quantum data bus' may prove useful in future solid state architectures for quantum information processing
Optimal control of fast and high-fidelity quantum state transfer in spin-1/2 chains
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xiong-Peng [School of Physics, Beijing Institute of Technology, Beijing 100081 (China); Shao, Bin, E-mail: sbin610@bit.edu.cn [School of Physics, Beijing Institute of Technology, Beijing 100081 (China); Hu, Shuai; Zou, Jian [School of Physics, Beijing Institute of Technology, Beijing 100081 (China); Wu, Lian-Ao [Department of Theoretical Physics and History of Science, The Basque Country University (EHU/UPV), PO Box 644, 48080 Bilbao (Spain); Ikerbasque, Basque Foundation for Science, 48011 Bilbao (Spain)
2016-12-15
Spin chains are promising candidates for quantum communication and computation. Using quantum optimal control (OC) theory based on the Krotov method, we present a protocol to perform quantum state transfer with fast and high fidelity by only manipulating the boundary spins in a quantum spin-1/2 chain. The achieved speed is about one order of magnitude faster than that is possible in the Lyapunov control case for comparable fidelities. Additionally, it has a fundamental limit for OC beyond which optimization is not possible. The controls are exerted only on the couplings between the boundary spins and their neighbors, so that the scheme has good scalability. We also demonstrate that the resulting OC scheme is robust against disorder in the chain.
International Nuclear Information System (INIS)
Sun Hechao; Godoy-Ruiz, Raquel; Tugarinov, Vitali
2012-01-01
Relaxation violated coherence transfer NMR spectroscopy (Tugarinov et al. in J Am Chem Soc 129:1743–1750, 2007) is an established experimental tool for quantitative estimation of the amplitudes of side-chain motions in methyl-protonated, highly deuterated proteins. Relaxation violated coherence transfer experiments monitor the build-up of methyl proton multiple-quantum coherences that can be created in magnetically equivalent spin-systems as long as their transverse magnetization components relax with substantially different rates. The rate of this build-up is a reporter of the methyl-bearing side-chain mobility. Although the build-up of multiple-quantum 1 H coherences is monitored in these experiments, the decay of the methyl signal during relaxation delays occurs when methyl proton magnetization is in a single-quantum state. We describe a relaxation violated coherence transfer approach where the relaxation of multiple-quantum 1 H– 13 C methyl coherences during the relaxation delay period is quantified. The NMR experiment and the associated fitting procedure that models the time-dependence of the signal build-up, are applicable to the characterization of side-chain order in [ 13 CH 3 ]-methyl-labeled, highly deuterated protein systems up to ∼100 kDa in molecular weight. The feasibility of extracting reliable measures of side-chain order is experimentally verified on methyl-protonated, perdeuterated samples of an 8.5-kDa ubiquitin at 10°C and an 82-kDa Malate Synthase G at 37°C.
Fast local fragment chaining using sum-of-pair gap costs
DEFF Research Database (Denmark)
Otto, Christian; Hoffmann, Steve; Gorodkin, Jan
2011-01-01
, and rank the fragments to improve the specificity. Results: Here we present a fast and flexible fragment chainer that for the first time also supports a sum-of-pair gap cost model. This model has proven to achieve a higher accuracy and sensitivity in its own field of application. Due to a highly time...... alignment heuristics alone. By providing both the linear and the sum-of-pair gap cost model, a wider range of application can be covered. The software clasp is available at http://www.bioinf.uni-leipzig.de/Software/clasp/....
International Nuclear Information System (INIS)
Wang Sufan; Smith, Sean C.
2006-01-01
The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information
Roy, Sudeshna; Spilling, Christopher D
2010-11-19
A convergent synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization, and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with l-selectride to give the fragments of amphidinolide C and F.
Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.
Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B
2016-11-25
Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
Casas, Eduardo; Cai, Guohong; Kuehn, Larry A; Register, Karen B; McDaneld, Tara G; Neill, John D
2018-03-13
High throughput sequencing allows identification of small non-coding RNAs. Transfer RNA Fragments are a class of small non-coding RNAs, and have been identified as being involved in inhibition of gene expression. Given their role, it is possible they may be involved in mediating the infection-induced defense response in the host. Therefore, the objective of this study was to identify 5' transfer RNA fragments (tRF5s) associated with a serum antibody response to M. bovis in beef cattle. The tRF5s encoding alanine, glutamic acid, glycine, lysine, proline, selenocysteine, threonine, and valine were associated (P < 0.05) with antibody response against M. bovis. tRF5s encoding alanine, glutamine, glutamic acid, glycine, histidine, lysine, proline, selenocysteine, threonine, and valine were associated (P < 0.05) with season, which could be attributed to calf growth. There were interactions (P < 0.05) between antibody response to M. bovis and season for tRF5 encoding selenocysteine (anticodon UGA), proline (anticodon CGG), and glutamine (anticodon TTG). Selenocysteine is a rarely used amino acid that is incorporated into proteins by the opal stop codon (UGA), and its function is not well understood. Differential expression of tRF5s was identified between ELISA-positive and negative animals. Production of tRF5s may be associated with a host defense mechanism triggered by bacterial infection, or it may provide some advantage to a pathogen during infection of a host. Further studies are needed to establish if tRF5s could be used as a diagnostic marker of chronic exposure.
Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An
2015-01-01
Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665
The Buccaneer software for automated model building. 1. Tracing protein chains.
Cowtan, Kevin
2006-09-01
A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.
Evaluation of food chain transfer data for use in accident consequence assessment
International Nuclear Information System (INIS)
Coughtrey, P.J.; Kirton, J.A.; Mitchell, N.G.
1991-01-01
Input data for the food chain transport component of radiological assessment models are summarised in the context of the sources of information available prior to the Chernobyl accident and those derived after the accident. Particular attention is devoted to interception and retention soil-to-plant, and plant-to-animal transfer, and to the applicability of environmental data to both equilibrium and time-dependent models. It is argued that much of the current uncertainty in parameter values for use in radiological assessment models reflects lack of understanding of processes involved in the various stages of transfer of radionuclides to man. The Chernobyl accident highlighted this lack of fundamental knowledge and illustrated a number of areas where further research and model development is justified. These areas are identified and suggestions given for appropriate research to support model development
Plasmon assisted control of photo-induced excitation energy transfer in a molecular chain
Wang, Luxia; May, Volkhard
2017-08-01
The strong and ultrafast laser pulse excitation of a molecular chain in close vicinity to a spherical metal nano-particle (MNP) is studied theoretically. Due to local-field enhancement around the MNP, pronounced excited-state formation has to be expected for the part of the chain which is in proximity to the MNP. Here, the description of this phenomenon will be based on a uniform quantum theory of the MNP-molecule system. It accounts for local-field effects due to direct consideration of the strong excitation energy transfer coupling between the MNP and the various molecules. The molecule-MNP distances are chosen in such a way as to achieve a correct description of the MNP via dipole-plasmon excitations. Short plasmon life-times are incorporated in the framework of a density matrix approach. By extending earlier work the present description allows for multi-exciton formation and multiple dipole-plasmon excitation. The region of less intense and not-too-short optical excitation is identified as being best suited for excitation energy localization in the chain.
Resistance of a 1D random chain: Hamiltonian version of the transfer matrix approach
Dossetti-Romero, V.; Izrailev, F. M.; Krokhin, A. A.
2004-01-01
We study some mesoscopic properties of electron transport by employing one-dimensional chains and Anderson tight-binding model. Principal attention is paid to the resistance of finite-length chains with disordered white-noise potential. We develop a new version of the transfer matrix approach based on the equivalency of a discrete Schrödinger equation and a two-dimensional Hamiltonian map describing a parametric kicked oscillator. In the two limiting cases of ballistic and localized regime we demonstrate how analytical results for the mean resistance and its second moment can be derived directly from the averaging over classical trajectories of the Hamiltonian map. We also discuss the implication of the single parameter scaling hypothesis to the resistance.
Resistance of a 1D random chain: Hamiltonian version of the transfer matrix approach
International Nuclear Information System (INIS)
Dossetti-Romero, V.; Izrailev, F.M.; Krokhin, A.A.
2004-01-01
We study some mesoscopic properties of electron transport by employing one-dimensional chains and Anderson tight-binding model. Principal attention is paid to the resistance of finite-length chains with disordered white-noise potential. We develop a new version of the transfer matrix approach based on the equivalency of a discrete Schroedinger equation and a two-dimensional Hamiltonian map describing a parametric kicked oscillator. In the two limiting cases of ballistic and localized regime we demonstrate how analytical results for the mean resistance and its second moment can be derived directly from the averaging over classical trajectories of the Hamiltonian map. We also discuss the implication of the single parameter scaling hypothesis to the resistance
International Nuclear Information System (INIS)
Van Dorpe, F.; Jourdain, F.
2006-01-01
Full text: The numerical code M.I.R.A.G.E. (Module of Radiological impact calculations on the Environment due to accidental or chronic nuclear releases through Aqueous and Gas media) has been developed to simulate the radionuclides transfer in the biosphere and food chains, as well as the dosimetric impact on man, after accidental or chronic releases in the environment by nuclear installations. The originality of M.I.R.A.G.E. is to propose a single tool chained downstream with various atmospheric and liquid dispersion codes. The code M.I.R.A.G.E. is a series of modules which makes it possible to carry out evaluations on the transfers in food chains and human dose impact. Currently, M.I.R.A.G.E. is chained with a Gaussian atmospheric dispersion code H.A.R.M.A.T.T.A.N. (Cea), a 3 D atmospheric dispersion code with Lagrangian model named M.I.N.E.R.V.E.-S.P.R.A.Y. (Aria Technology) and a 3 D groundwater transfer code named M.A.R.T.H.E. (B.R.G.M.). M.I.R.A.G.E. uses concentration or activity result files as initial data input for its calculations. The application initially calculates the concentrations in the various compartments of the environment (soils, plants, animals). The results are given in the shape of concentration and dose maps and also on a particular place called a reference group for dosimetric impact (like a village or a specific population group located around a nuclear installation). The input and output data of M.I.R.A.G.E. can have geographic coordinates and thus readable by a G.I.S. M.I.R.A.G. E.is an opened system with which it is easy to chain other codes of dispersion that those currently used. The calculations uncoupled with dispersion calculations are also possible by manual seizure of the dispersion data (contamination of a tablecloth, particular value in a point, etc.). M.I.R.A.G.E. takes into account soil deposits and resuspension phenomenon, transfers in plants and animals (choice of agricultural parameters, types of plants and animals, etc
International Nuclear Information System (INIS)
Bittel, R.
1986-06-01
Although many data have been accumulated concerning the distribution of Pu in waters, soils, and foodchains, recent studies have raised the question of the Pu physico-chemical species and their differential availability. Accordingly, we reviewed published data on the transfer of Pu in foodchains and in the gastrointestinal tracts. Dietetic, physico-chemical, biochemical and microbiological parameters have been studied and their incidence on the intestinal transfer factor f 1 of Pu in man briefly discussed: the transfer in the trophic chains often increases Pu mobility and perhaps f 1 . Experimental research is needed to obtain quantitative data [fr
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Complex fragment emission from hot compound nuclei
International Nuclear Information System (INIS)
Moretto, L.G.
1986-03-01
The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs
Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis
Directory of Open Access Journals (Sweden)
Chi-Hsin Lee
2017-10-01
Full Text Available Russell’s vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs containing 3.4 × 107 and 5.5 × 107 transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.
Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis.
Lee, Chi-Hsin; Lee, Yu-Ching; Lee, Yueh-Lun; Leu, Sy-Jye; Lin, Liang-Tzung; Chen, Chi-Ching; Chiang, Jen-Ron; Mwale, Pharaoh Fellow; Tsai, Bor-Yu; Hung, Ching-Sheng; Yang, Yi-Yuan
2017-10-27
Russell's vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF) venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY) antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs) containing 3.4 × 10⁷ and 5.5 × 10⁷ transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.
Directory of Open Access Journals (Sweden)
Zhisong Chen
2018-04-01
Full Text Available The inter-basin water transfer (IBWT projects have quasi-public-welfare characteristics, whose operations should take into account the water green level (WGL and social welfare maximization (SWM. This paper explores the interactions between multiple stakeholders of an IBWT green supply chain through the game-theoretic and coordination research approaches considering the government’s subsidy to the WGL improvement under the SWM. The study and its findings complement the IBWT literature in the area of the green supply chain and social welfare maximization modeling. The analytical modeling results with and without considering the SWM are compared. A numerical analysis for a hypothetical IBWT green supply chain is conducted to draw strategic insights from this study. The research results indicate that (1 If the SWM is not considered, coordination strategy could effectively improve the operations performances of the IBWT supply chain and its members, the consumers’ surplus, and the social welfare when compared with the equilibrium strategy; (2 If the SWM is considered, the IBWT green supply chain and its members have a strong intention to adopt the equilibrium strategy to gain more profits, while the government has a strong intention to encourage the IBWT green supply chain and its members to adopt the coordination strategy to maximize social welfare with a smaller public subsidy; (3 The government’s subsidy policy should be designed and provided to encourage the IBWT green supply chain and its members to improve WGL and pursue the SWM, and a subsidy threshold policy can be designed to maximize social welfare with a lower subsidy budget: only when the IBWT green supply chain and its members adopt the coordination strategy can they get a subsidy from the government.
Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.
2000-01-01
DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.
Directory of Open Access Journals (Sweden)
Christiane Y Ozaki
Full Text Available Diarrhea is a prevalent pathological condition frequently associated to the colonization of the small intestine by enterotoxigenic Escherichia coli (ETEC strains, known to be endemic in developing countries. These strains can produce two enterotoxins associated with the manifestation of clinical symptoms that can be used to detect these pathogens. Although several detection tests have been developed, minimally equipped laboratories are still in need of simple and cost-effective methods. With the aim to contribute to the development of such diagnostic approaches, we describe here two mouse hybridoma-derived single chain fragment variable (scFv that were produced in E. coli against enterotoxins of ETEC strains.Recombinant scFv were developed against ETEC heat-labile toxin (LT and heat-stable toxin (ST, from previously isolated hybridoma clones. This work reports their design, construction, molecular and functional characterization against LT and ST toxins. Both antibody fragments were able to recognize the cell-interacting toxins by immunofluorescence, the purified toxins by ELISA and also LT-, ST- and LT/ST-producing ETEC strains.The developed recombinant scFvs against LT and ST constitute promising starting point for simple and cost-effective ETEC diagnosis.
Stability of llama heavy chain antibody fragments under extreme conditions
Dolk, E.
2004-01-01
Camelids have next to their normal antibodies, a unique subset of antibodies lacking light chains. The resulting single binding domain, VHH, of these heavy chain antibodies consequently have unique properties. A high stability is one of these properties, which was investigated in this thesis. The
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
Ji, Xiaonan; Shen, Yanli; Sun, Hao; Gao, Xiangdong
2016-08-01
Human hepatocellular carcinoma (HCC) has a high rate of tumor recurrence and metastasis, resulting in shortened survival time. The function of alpha-fetoprotein (AFP) as a regulatory factor in the growth of HCC cells has been well defined. The aim of this study was to investigate the use of a novel AFP-specific single-chain variable fragment that blocked AFP and inhibited HCC cell growth. The results indicated that the anti-AFP single-chain variable fragment (scFv) induced growth inhibition of AFP-expressing HCC cell lines in vitro through induction of G1 cell cycle arrest and apoptosis. The mechanism of apoptosis probably involved with blocking AFP internalization and regulation of the PTEN/PI3K/Akt signaling network. Moreover, the anti-AFP-scFv also effectively sensitized the HepG2 cells to paclitaxel (PTX) at a lower concentration. The combination effect of PTX and anti-AFP-scFv displayed a synergistic effect on HepG2 cells both in vitro and in vivo. Our results demonstrated that targeting AFP by specific antibodies has potential immunotherapeutic efficacy in human HCC.
Directory of Open Access Journals (Sweden)
Santiago Marfà
Full Text Available Early detection of fibrosis progression is of major relevance for the diagnosis and management of patients with liver disease. This study was designed to find non-invasive biomarkers for fibrosis in a clinical context where this process occurs rapidly, HCV-positive patients who underwent liver transplantation (LT. We analyzed 93 LT patients with HCV recurrence, 41 non-LT patients with liver disease showing a fibrosis stage F≥1 and 9 patients without HCV recurrence who received antiviral treatment before LT, as control group. Blood obtained from 16 healthy subjects was also analyzed. Serum samples were fractionated by ion exchange chromatography and their proteomic profile was analyzed by SELDI-TOF-MS. Characterization of the peptide of interest was performed by ion chromatography and electrophoresis, followed by tandem mass spectrometry identification. Marked differences were observed between the serum proteome profile of LT patients with early fibrosis recurrence and non-recurrent LT patients. A robust peak intensity located at 5905 m/z was the distinguishing feature of non-recurrent LT patients. However, the same peak was barely detected in recurrent LT patients. Similar results were found when comparing samples of healthy subjects with those of non-LT fibrotic patients, indicating that our findings were not related to either LT or HCV infection. Using tandem mass-spectrometry, we identified the protein peak as a C-terminal fragment of the fibrinogen α chain. Cell culture experiments demonstrated that TGF-β reduces α-fibrinogen mRNA expression and 5905 m/z peak intensity in HepG2 cells, suggesting that TGF-β activity regulates the circulating levels of this protein fragment. In conclusion, we identified a 5.9 kDa C-terminal fragment of the fibrinogen α chain as an early serum biomarker of fibrogenic processes in patients with liver disease.
Cloning and expression of cell wall acid invertase gene fragment ...
African Journals Online (AJOL)
A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...
Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek
2018-01-01
Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.
Li, Zhuang; Cheng, Yue; Xi, Hualong; Gu, Tiejun; Yuan, Ruosen; Chen, Xiaoxu; Jiang, Chunlai; Kong, Wei; Wu, Yongge
2015-12-01
Fatal rabies can be prevented effectively by post-exposure prophylactic (PEP) with rabies immunoglobulin (RIG). Single-chain variable fragments (scFv), which are composed of a variable heavy chain (VH) and a variable light chain (VL) connected by a peptide linker, can potentially be used to replace RIG. However, in our previous study, a scFv (scFV57S) specific for the rabies virus (RV) G protein showed a lower neutralizing potency than that of its parent IgG due to lower stability and altered peptide assembly pattern. In monoclonal antibodies, the VH and VL interact non-covalently, while in scFvs the VH is connected covalently with the VL by the artificial linker. In this study, we constructed and expressed two peptides 57VL-JUN-HIS and 57VH-FOS-HA in Escherichia coli. The well-known Fos and Jun leucine zippers were utilized to dimerize VH and VL similarly to the IgG counterpart. The two peptides assembled to form zipFv57S in vitro. Due to the greater similarity in structure with IgG, the zipFv57S protein showed a higher binding ability and affinity resulting in notable improvement of in vitro neutralizing activity over its corresponding scFv. The zipFv57S protein was also found to be more stable and showed similar protective rate as RIG in mice challenged with a lethal dose of RV. Our results not only indicated zipFv57S as an ideal alternative for RIG in PEP but also offered a novel and efficient hetero-dimerization pattern of VH and VL leading to enhanced neutralizing potency. Copyright © 2015. Published by Elsevier Ltd.
Roy, Sudeshna; Spilling, Christopher D.
2010-01-01
A convergent synthesis of the C(18)–C(34) fragment of amphidinolide C and the C(18)–C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with L-selectride to give the fragments of amphidinolide C and F. PMID:21028791
Lv, Kai; Qin, Long; Wang, Xiufeng; Zhang, Li; Liu, Minghua
2013-12-14
Chirality transfer is an interesting phenomenon in Nature, which represents an important step to understand the evolution of chiral bias and the amplification of the chirality. In this paper, we report the chirality transfer via the entanglement of the alkyl chains between chiral gelator molecules and achiral amphiphilic Schiff base. We have found that although an achiral Schiff base amphiphile could not form organogels in any kind of organic solvents, it formed co-organogels when mixed with a chiral gelator molecule. Interestingly, the chirality of the gelator molecules was transferred to the Schiff base chromophore in the mixed co-gels and there was a maximum mixing ratio for the chirality transfer. Furthermore, the supramolecular chirality was also produced based on a dynamic covalent chemistry of an imine formed by the reaction between an aldehyde and an amine. Such a covalent bond of imine was formed reversibly depending on the pH variation. When the covalent bond was formed the chirality transfer occurred, when it was destroyed, the transfer stopped. Thus, a supramolecular chiroptical switch is obtained based on supramolecular chirality transfer and dynamic covalent chemistry.
Wong, Chun Wa; Yasui, Kosuke
2005-01-01
The one-dimensional fall of a folded chain with one end suspended from a rigid support and a chain falling from a resting heap on a table is studied. Because their Lagrangians contain no explicit time dependence, the falling chains are conservative systems. Their equations of motion are shown to contain a term that enforces energy conservation when masses are transferred between subchains. We show that Cayley's 1857 energy nonconserving solution for a chain falling from a resting heap is inco...
Directory of Open Access Journals (Sweden)
Mike Burmester
2017-07-01
Full Text Available The National Strategy for Global Supply Chain Security published in 2012 by the White House identifies two primary goals for strengthening global supply chains: first, to promote the efficient and secure movement of goods, and second to foster a resilient supply chain. The Internet of Things (IoT, and in particular Radio Frequency Identification (RFID technology, can be used to realize these goals. For product identification, tracking and real-time awareness, RFID tags are attached to goods. As tagged goods move along the supply chain from the suppliers to the manufacturers, and then on to the retailers until eventually they reach the customers, two major security challenges can be identified: (I to protect the shipment of goods that are controlled by potentially untrusted carriers; and (II to secure the transfer of ownership at each stage of the chain. For the former, grouping proofs in which the tags of the scanned goods generate a proof of “simulatenous” presence can be employed, while for the latter, ownership transfer protocols (OTP are used. This paper describes enhanced security solutions for both challenges. We first extend earlier work on grouping proofs and group codes to capture resilient group scanning with untrusted readers; then, we describe a modified version of a recently published OTP based on channels with positive secrecy capacity adapted to be implemented on common RFID systems in the supply chain. The proposed solutions take into account the limitations of low cost tags employed in the supply chain, which are only required to generate pseudorandom numbers and compute one-way hash functions.
Burmester, Mike; Munilla, Jorge; Ortiz, Andrés; Caballero-Gil, Pino
2017-07-04
The National Strategy for Global Supply Chain Security published in 2012 by the White House identifies two primary goals for strengthening global supply chains: first, to promote the efficient and secure movement of goods, and second to foster a resilient supply chain. The Internet of Things (IoT), and in particular Radio Frequency Identification (RFID) technology, can be used to realize these goals. For product identification, tracking and real-time awareness, RFID tags are attached to goods. As tagged goods move along the supply chain from the suppliers to the manufacturers, and then on to the retailers until eventually they reach the customers, two major security challenges can be identified: (I) to protect the shipment of goods that are controlled by potentially untrusted carriers; and (II) to secure the transfer of ownership at each stage of the chain. For the former, grouping proofs in which the tags of the scanned goods generate a proof of "simulatenous" presence can be employed, while for the latter, ownership transfer protocols (OTP) are used. This paper describes enhanced security solutions for both challenges. We first extend earlier work on grouping proofs and group codes to capture resilient group scanning with untrusted readers; then, we describe a modified version of a recently published OTP based on channels with positive secrecy capacity adapted to be implemented on common RFID systems in the supply chain. The proposed solutions take into account the limitations of low cost tags employed in the supply chain, which are only required to generate pseudorandom numbers and compute one-way hash functions.
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
Shigemori, Suguru; Ihara, Masaki; Sato, Takashi; Yamamoto, Yoshinari; Nigar, Shireen; Ogita, Tasuku; Shimosato, Takeshi
2017-01-01
Interleukin 6 (IL-6) is an important pathogenic factor in development of various inflammatory and autoimmune diseases and cancer. Blocking antibodies against molecules associated with IL-6/IL-6 receptor signaling are an attractive candidate for the prevention or therapy of these diseases. In this study, we developed a genetically modified strain of Lactococcus lactis secreting a single-chain variable fragment antibody against mouse IL-6 (IL6scFv). An IL6scFv-secretion vector was constructed by cloning an IL6scFv gene fragment into a lactococcal secretion plasmid and was electroporated into L. lactis NZ9000 (NZ-IL6scFv). Secretion of recombinant IL6scFv (rIL6scFv) by nisin-induced NZ-IL6scFv was confirmed by western blotting and was optimized by tuning culture conditions. We found that rIL6scFv could bind to commercial recombinant mouse IL-6. This result clearly demonstrated the immunoreactivity of rIL6scFv. This is the first study to engineer a genetically modified strain of lactic acid bacteria (gmLAB) that produces a functional anti-cytokine scFv. Numerous previous studies suggested that mucosal delivery of biomedical proteins using gmLAB is an effective and low-cost way to treat various disorders. Therefore, NZ-IL6scFv may be an attractive tool for the research and development of new IL-6 targeting agents for various inflammatory and autoimmune diseases as well as for cancer.
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
Dynamic model for tritium transfer in an aquatic food chain.
Melintescu, A; Galeriu, D
2011-08-01
Tritium ((3)H) is released from some nuclear facilities in relatively large quantities. It is a ubiquitous isotope because it enters straight into organisms, behaving essentially identically to its stable analogue (hydrogen). Tritium is a key radionuclide in the aquatic environment, in some cases, contributing significantly to the doses received by aquatic, non-human biota and by humans. The updated model presented here is based on more standardized, comprehensive assessments than previously used for the aquatic food chain, including the benthic flora and fauna, with an explicit application to the Danube ecosystem, as well as an extension to the special case of dissolved organic tritium (DOT). The model predicts the organically bound tritium (OBT) in the primary producers (the autotrophs, such as phytoplankton and algae) and in the consumers (the heterotrophs) using their bioenergetics, which involves the investigation of energy expenditure, losses, gains and efficiencies of transformations in the body. The model described in the present study intends to be more specific than a screening-level model, by including a metabolic approach and a description of the direct uptake of DOT in marine phytoplankton and invertebrates. For a better control of tritium transfer into the environment, not only tritiated water must be monitored, but also the other chemical forms and most importantly OBT, in the food chain.
Cross sections and kinematics of proton induced fragmentation of carbon
International Nuclear Information System (INIS)
Streibel, T.; Roecher, H.; Huentrup, G.; Heinrich, W.
1997-01-01
Charge changing fragmentation cross sections for C at a proton energy of about 70 MeV were measured. The discrepancies between measurement and model predictions indicate the necessity of further investigations. We have also measured distributions of fragment emission angles which can be described using a model with a momentum transfer to the fragmenting nucleus. The developed model leads to predictions for momentum distributions of proton induced target fragments of C at small energies. (orig.)
Cross sections and kinematics of proton induced fragmentation of carbon
Energy Technology Data Exchange (ETDEWEB)
Streibel, T; Roecher, H; Huentrup, G; Heinrich, W [Siegen Univ. (Germany). Dept. of Physics
1997-09-01
Charge changing fragmentation cross sections for C at a proton energy of about 70 MeV were measured. The discrepancies between measurement and model predictions indicate the necessity of further investigations. We have also measured distributions of fragment emission angles which can be described using a model with a momentum transfer to the fragmenting nucleus. The developed model leads to predictions for momentum distributions of proton induced target fragments of C at small energies. (orig.)
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2000-01-01
Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.
Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin
2018-04-01
Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7 CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.
International Nuclear Information System (INIS)
Tateda, Yutaka; Tsumune, Daisuke; Tsubono, Takaki
2013-01-01
The Fukushima Dai-ichi Nuclear Power Plant (1F NPP) accident occurred on 11 March 2011. The accident introduced 137 Cs into the coastal waters which was subsequently transferred to the local coastal biota thereby elevating the concentration of this radionuclide in coastal organisms. In this study, the radioactive cesium levels in coastal biota from the southern Fukushima area were simulated using a dynamic biological compartment model. The simulation derived the possible maximum radioactive cesium levels in organisms, indicating that the maximum 137 Cs concentrations in invertebrates, benthic fish and predator fish occurred during late April, late May and late July, respectively in the studied area where the source was mainly the direct leakage of 137 Cs effluent from the 1F NPP. The delay of a 137 Cs increase in fish was explained by the gradual food chain transfer of 137 Cs introduced to the ecosystem from the initial contamination of the seawater. The model also provided the degree of radionuclide depuration in organisms, and it demonstrated the latest start of the decontamination phase in benthic fish. The ecological half-lives, derived both from model simulation and observation, were 1–4 months in invertebrates, and 2–9 months in plankton feeding fish and coastal predator fish from the studied area. In contrast, it was not possible to similarly calculate these parameters in benthic fish because of an unidentified additional radionuclide source which was deduced from the biological compartment model. To adequately reconstruct the in-situ depuration of radiocesium in benthic fish in the natural ecosystem, a contamination source associated with the bottom sediments is necessary. -- Highlights: • Cs-137 in the southern Fukushima coastal biota were simulated using a dynamic biological compartment model. • Simulation derived contamination phase of marine biota was completed until late April to July 2011. • The delay of Cs-137 concentration increase in fish
Diseno macromolecular par transferencia de cadena
Heuts, J.P.A.; Munoz Bonilla, A.
2010-01-01
In this overview article, a brief description and discussion is given about the controlled radical techniques which are based on chain transfer, i.e., Catalytic Chain Transfer (CCT) and Reversible Addition-Fragmentation chain Transfer (RAFT). The CCT is an incredibly efficient method for making
Shih, I-hung; Been, Michael D.
2001-01-01
Ribozymes of hepatitis delta virus have been proposed to use an active-site cytosine as an acid-base catalyst in the self-cleavage reaction. In this study, we have examined the role of cytosine in more detail with the antigenomic ribozyme. Evidence that proton transfer in the rate-determining step involved cytosine 76 (C76) was obtained from examining cleavage activity of the wild-type and imidazole buffer-rescued C76-deleted (C76Δ) ribozymes in D2O and H2O. In both reactions, a similar kinetic isotope effect and shift in the apparent pKa indicate that the buffer is functionally substituting for the side chain in proton transfer. Proton inventory of the wild-type reaction supported a mechanism of a single proton transfer at the transition state. This proton transfer step was further characterized by exogenous base rescue of a C76Δ mutant with cytosine and imidazole analogues. For the imidazole analogues that rescued activity, the apparent pKa of the rescue reaction, measured under kcat/KM conditions, correlated with the pKa of the base. From these data a Brønsted coefficient (β) of 0.51 was determined for the base-rescued reaction of C76Δ. This value is consistent with that expected for proton transfer in the transition state. Together, these data provide strong support for a mechanism where an RNA side chain participates directly in general acid or general base catalysis of the wild-type ribozyme to facilitate RNA cleavage. PMID:11171978
Ortiz, Andrés
2017-01-01
The National Strategy for Global Supply Chain Security published in 2012 by the White House identifies two primary goals for strengthening global supply chains: first, to promote the efficient and secure movement of goods, and second to foster a resilient supply chain. The Internet of Things (IoT), and in particular Radio Frequency Identification (RFID) technology, can be used to realize these goals. For product identification, tracking and real-time awareness, RFID tags are attached to goods. As tagged goods move along the supply chain from the suppliers to the manufacturers, and then on to the retailers until eventually they reach the customers, two major security challenges can be identified: (I) to protect the shipment of goods that are controlled by potentially untrusted carriers; and (II) to secure the transfer of ownership at each stage of the chain. For the former, grouping proofs in which the tags of the scanned goods generate a proof of “simulatenous” presence can be employed, while for the latter, ownership transfer protocols (OTP) are used. This paper describes enhanced security solutions for both challenges. We first extend earlier work on grouping proofs and group codes to capture resilient group scanning with untrusted readers; then, we describe a modified version of a recently published OTP based on channels with positive secrecy capacity adapted to be implemented on common RFID systems in the supply chain. The proposed solutions take into account the limitations of low cost tags employed in the supply chain, which are only required to generate pseudorandom numbers and compute one-way hash functions. PMID:28677637
Zhang, Zhenbin; Peuchen, Elizabeth H; Dovichi, Norman J
2017-06-20
A surface-confined aqueous reversible addition-fragmentation chain transfer (SCARAFT) polymerization method was developed to coat capillaries for use in capillary zone electrophoresis (CZE). SCARAFT polymerization primarily takes place on the inner surface of the capillary instead of in solution, which greatly improves the homogeneity of the coating. Capillaries treated with this coating produced an electroosmotic mobility of 2.8 ± 0.2 × 10 -6 cm 2 ·V -1 ·s -1 (N = 3), which is roughly an order of magnitude lower than that of commercial linear polyacrylamide (LPA)-coated capillaries. Coated capillaries were evaluated for bottom-up proteomic analysis using CZE. The very low electroosmotic mobility results in a 200 min separation and improved single-shot analysis. An average of 977 protein groups and 5605 unique peptides were identified from 50 ng of an E. coli digest, and 2158 protein groups and 10 005 peptides were identified from 25 ng of a HeLa digest using single-shot analysis with a SCARAFT-acrylamide capillary coupled to a Q Exactive HF mass spectrometer. The coating is stable. A single capillary was used for over 200 h (8.4 days) of continuous operation. RSD in migration time was between 2 and 3% for selected ion electropherograms (SIEs) generated for six ions; median theoretical plate counts ranged from 240 000 to 600 000 for these SIEs. Various types of coatings could be prepared by simply changing the functional vinyl monomers in the polymerization mixture. Positively charged coatings using direct attachment and formation of a block copolymer were prepared and demonstrated for the separation of mixtures of intact proteins.
Neutralisation and binding of VHS virus by monovalent antibody fragments
DEFF Research Database (Denmark)
Cupit, P.M.; Lorenzen, Niels; Strachan, G.
2001-01-01
We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...
Dolle, Ashwini B; Jagadeesh, Narasimhappagari; Bhaumik, Suman; Prakash, Sunita; Biswal, Himansu S; Gowd, Konkallu Hanumae
2018-06-15
The modes of cleavage of lanthionine/methyllanthionine bridges under electron transfer dissociation (ETD) were investigated using synthetic and natural lantipeptides. Knowledge of the mass spectrometric fragmentation of lanthionine/methyllanthionine bridges may assist in the development of analytical methods for the rapid discovery of new lantibiotics. The present study strengthens the advantage of ETD in the characterization of posttranslational modifications of peptides and proteins. Synthetic and natural lantipeptides were obtained by desulfurization of peptide disulfides and cyanogen bromide digestion of the lantibiotic nisin, respectively. These peptides were subjected to electrospray ionization collision-induced dissociation tandem mass spectrometry (CID-MS/MS) and ETD-MS/MS using an HCT ultra ETDII ion trap mass spectrometer. MS 3 CID was performed on the desired product ions to prove cleavage of the lanthionine/methyllanthionine bridge during ETD-MS/MS. ETD has advantages over CID in the cleavage of the side chain of lanthionine/methyllanthionine bridges. The cleavage of the N-Cα backbone peptide bond followed by C-terminal side chain of the lanthionine bridge results in formation of c •+ and z + ions. Cleavage at the preceding peptide bond to the C-terminal side chain of lanthionine/methyllanthionine bridges yields specific fragments with the cysteine/methylcysteine thiyl radical and dehydroalanine. ETD successfully cleaves the lanthionine/methyllanthionine bridges of synthetic and natural lantipeptides. Diagnostic fragment ions of ETD cleavage of lanthionine/methyllanthionine bridges are the N-terminal cysteine/methylcysteine thiyl radical and C-terminal dehydroalanine. Detection of the cysteine/methylcysteine thiyl radical and dehydroalanine in combined ETD-CID-MS may be used for the rapid identification of lantipeptide natural products. Copyright © 2018 John Wiley & Sons, Ltd.
Culture impact in construction supply chain management
Tzortzatou, E. P.
2008-01-01
Awareness of cultural differences in construction supply chains is of fundamental importance because only through a thorough understanding of the manifestations of culture can fragmented supply chains be appropriately integrated into cohesive and collaborating teams which enhance project performance Hence the concept of cultural alignment with the project supply chain is introduced in order for long-term collaborative relationships based on trust, co ordination and mutual benefit to be establ...
Projectile rapidity dependence in target fragmentation
International Nuclear Information System (INIS)
Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.
1979-01-01
The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references
Selective disulfide reduction for labeling and enhancement of Fab antibody fragments
International Nuclear Information System (INIS)
Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.
2016-01-01
Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying
Dar, Mudasir Irfan; Khan, Fareed Ahmad; Green, Iain D; Naikoo, Mohd Irfan
2015-10-01
The contamination of agroecosystems due to the presence of trace elements in commonly used agricultural materials is a serious issue. The most contaminated material is usually sewage sludge, and the sustainable use of this material within agriculture is a major concern. This study addresses a key issue in this respect, the fate of trace metals applied to soil in food chains. The work particularly addresses the transfer of Pb, which is an understudied element in this respect, and compares the transfer of Pb with two of the most labile metals, Cd and Zn. The transfer of these elements was determined from sludge-amended soils in a food chain consisting of Indian mustard (Brassica juncea), the mustard aphid (Lipaphis erysimi) and a predatory beetle (Coccinella septempunctata). The soil was amended with sludge at rates of 0, 5, 10 and 20 % (w/w). Results showed that Cd was readily transferred through the food chain until the predator trophic level. Zn was the most readily transferred element in the lower trophic levels, but transfer to aphids was effectively restricted by the plant regulating shoot concentration. Pb had the lowest level of transfer from soil to shoot and exhibited particular retention in the roots. Nevertheless, Pb concentrations were significantly increased by sludge amendment in aphids, and Pb was increasingly transferred to ladybirds as levels increased. The potential for Pb to cause secondary toxicity to organisms in higher trophic levels may have therefore been underestimated.
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
International Nuclear Information System (INIS)
Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.
1990-01-01
The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome
Chained function filters - theory and applications.
Chrisostomidis, Christos E.
2003-01-01
For the first time, the new class of filter transfer functions, called Chained Functions is described, in detail. With Chained functions, one may define a new polynomial generating function that is given by the product of a combination of low order functions, called seed functions. The chained function concept provides with a variety of transfer functions, having the same order but different frequency-domain, time-domain and implementation characteristics. When compared to the conventional Ch...
International Nuclear Information System (INIS)
Lee, Kok Foong; Patterson, Robert I.A.; Wagner, Wolfgang; Kraft, Markus
2015-01-01
Graphical abstract: -- Highlights: •Problems concerning multi-compartment population balance equations are studied. •A class of fragmentation weight transfer functions is presented. •Three stochastic weighted algorithms are compared against the direct simulation algorithm. •The numerical errors of the stochastic solutions are assessed as a function of fragmentation rate. •The algorithms are applied to a multi-dimensional granulation model. -- Abstract: This paper introduces stochastic weighted particle algorithms for the solution of multi-compartment population balance equations. In particular, it presents a class of fragmentation weight transfer functions which are constructed such that the number of computational particles stays constant during fragmentation events. The weight transfer functions are constructed based on systems of weighted computational particles and each of it leads to a stochastic particle algorithm for the numerical treatment of population balance equations. Besides fragmentation, the algorithms also consider physical processes such as coagulation and the exchange of mass with the surroundings. The numerical properties of the algorithms are compared to the direct simulation algorithm and an existing method for the fragmentation of weighted particles. It is found that the new algorithms show better numerical performance over the two existing methods especially for systems with significant amount of large particles and high fragmentation rates.
Energy Technology Data Exchange (ETDEWEB)
Lee, Kok Foong [Department of Chemical Engineering and Biotechnology, University of Cambridge, New Museums Site, Pembroke Street, Cambridge CB2 3RA (United Kingdom); Patterson, Robert I.A.; Wagner, Wolfgang [Weierstrass Institute for Applied Analysis and Stochastics, Mohrenstraße 39, 10117 Berlin (Germany); Kraft, Markus, E-mail: mk306@cam.ac.uk [Department of Chemical Engineering and Biotechnology, University of Cambridge, New Museums Site, Pembroke Street, Cambridge CB2 3RA (United Kingdom); School of Chemical and Biomedical Engineering, Nanyang Technological University, 62 Nanyang Drive, Singapore, 637459 (Singapore)
2015-12-15
Graphical abstract: -- Highlights: •Problems concerning multi-compartment population balance equations are studied. •A class of fragmentation weight transfer functions is presented. •Three stochastic weighted algorithms are compared against the direct simulation algorithm. •The numerical errors of the stochastic solutions are assessed as a function of fragmentation rate. •The algorithms are applied to a multi-dimensional granulation model. -- Abstract: This paper introduces stochastic weighted particle algorithms for the solution of multi-compartment population balance equations. In particular, it presents a class of fragmentation weight transfer functions which are constructed such that the number of computational particles stays constant during fragmentation events. The weight transfer functions are constructed based on systems of weighted computational particles and each of it leads to a stochastic particle algorithm for the numerical treatment of population balance equations. Besides fragmentation, the algorithms also consider physical processes such as coagulation and the exchange of mass with the surroundings. The numerical properties of the algorithms are compared to the direct simulation algorithm and an existing method for the fragmentation of weighted particles. It is found that the new algorithms show better numerical performance over the two existing methods especially for systems with significant amount of large particles and high fragmentation rates.
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Transfer of selenium from prey to predators in a simulated terrestrial food chain
International Nuclear Information System (INIS)
Hopkins, William A.; Staub, Brandon P.; Baionno, Jennifer A.; Jackson, Brian P.; Talent, Larry G.
2005-01-01
Little is known about the accumulation and effects of selenium in reptiles. We developed a simplified laboratory food chain where we fed commercial feed laden with seleno-D,L-methionine (30 μg/g dry mass) to crickets (Acheta domestica) for 5-7 d. Se-enriched crickets (∼15 μg/g Se [dry mass]) were fed to juvenile male and female lizards (Sceloporus occidentalis) for 98 d while conspecifics were fed uncontaminated crickets. Lizards fed contaminated prey accumulated Se concentrations ranging from 9.3 (in female carcass) to 14.1 (in female gonad) μg/g compared to <1.5 μg/g in tissues of controls. Female gonad concentrations approached the highest of thresholds for reproductive toxicity in oviparous vertebrates. However, we observed no consistent effect of dietary treatment on sublethal parameters or survival. Our simplified food chain proved to be an ecologically relevant method of exposing lizards to Se, and forms the foundation for future studies on maternal transfer and teratogenicity of Se. - Partitioning of selenium among tissues differs between male and female lizards
Transfer of selenium from prey to predators in a simulated terrestrial food chain
Energy Technology Data Exchange (ETDEWEB)
Hopkins, William A. [Wildlife Ecotoxicology and Physiological Ecology Program, Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29801 (United States)]. E-mail: hopkins@srel.edu; Staub, Brandon P. [Wildlife Ecotoxicology and Physiological Ecology Program, Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29801 (United States); Baionno, Jennifer A. [Wildlife Ecotoxicology and Physiological Ecology Program, Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29801 (United States); Jackson, Brian P. [Wildlife Ecotoxicology and Physiological Ecology Program, Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29801 (United States); Talent, Larry G. [Department of Zoology, Oklahoma State University, Stillwater, OK 74078 (United States)
2005-04-01
Little is known about the accumulation and effects of selenium in reptiles. We developed a simplified laboratory food chain where we fed commercial feed laden with seleno-D,L-methionine (30 {mu}g/g dry mass) to crickets (Acheta domestica) for 5-7 d. Se-enriched crickets ({approx}15 {mu}g/g Se [dry mass]) were fed to juvenile male and female lizards (Sceloporus occidentalis) for 98 d while conspecifics were fed uncontaminated crickets. Lizards fed contaminated prey accumulated Se concentrations ranging from 9.3 (in female carcass) to 14.1 (in female gonad) {mu}g/g compared to <1.5 {mu}g/g in tissues of controls. Female gonad concentrations approached the highest of thresholds for reproductive toxicity in oviparous vertebrates. However, we observed no consistent effect of dietary treatment on sublethal parameters or survival. Our simplified food chain proved to be an ecologically relevant method of exposing lizards to Se, and forms the foundation for future studies on maternal transfer and teratogenicity of Se. - Partitioning of selenium among tissues differs between male and female lizards.
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
Energy Technology Data Exchange (ETDEWEB)
Fourmond, V
2007-04-15
The aim of this work is to find an efficient process to convert solar energy into hydrogen. The electrons transfers in reconstituted photosynthetic chains have been particularly studied with the aims 1)in one hand, to better understand the interactions of the different molecules of the photosynthetic chain in order to optimize the changes of the entire organisms for hydrogen production 2)in another hand, to insert the hydrogenases in a photosynthetic chain and then to photo reduce them in order to obtain kinetic data to better understand how it works. (O.M.)
Transfer of 226Ra, 228Ra, 210Pb and 210Po in aquatic organisms and food chain
International Nuclear Information System (INIS)
Yang Xiaotong; Weng Detong; Chen Wenyin; Chen Xiuyun; Chen Jixi; Zhao Shimin
1998-01-01
Objective: To find out the transfer regularities of 226 Ra, 228 Ra, 210 Pb and 210 Po, which are natural radionuclides in the aquatic organisms and food chain. Methods: Large amount of breed of representative aquatic products and their living waters and sediments were collected and treated according to routine experimental procedures. The contents of 226 Ra, 228 Ra, 210 Pb and 210 Po were detected in each sample. Measured data were analyzed statistically and pairwise comparisons were made to determine the differences between groups. Results: 226 Ra, 228 Ra and 210 Pb were mainly deposited in the bones (or shells), their concentration factors (CF) ranged from 10 2 to 10 3 ; the CF ranged only from 10 0 to 10 2 in the flesh. 210 Po was mainly deposited in the soft tissues, CF ranged from 10 2 to 10 4 ; especially in the stomachs and intestines of fishes, the value reached 10 4 . The cooking process did not impinge significantly on the transfer of 226 Ra, 228 Ra and 210 Pb in the food chain (P>0.05), but did significantly influence the transfer of 210 Po, especially in the freshwater fishes and shrimps. Paired comparison test of the activities between raw flesh and cooked flesh showed very significant difference (P 226 Ra, 228 Ra, 210 Pb and 210 Po. Even though the bones (or shells) of aquatic organisms contained relatively higher levels of 226 Ra, 228 Ra and 210 Pb, the cooking process does not significantly increase the radioactive contents in the foodstuffs. However, the cooking process does significantly influence the transfer of 210 Po. It does significantly increase the content of 210 Po in foodstuffs
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
DEFF Research Database (Denmark)
Headlam, Henrietta A; Davies, Michael Jonathan
2002-01-01
Exposure of proteins to radicals in the presence of O(2) results in side-chain oxidation and backbone fragmentation; the interrelationship between these processes is not fully understood. Recently, initial attack on Ala side-chains was shown to give alpha-carbon radicals (and hence backbone cleav...
Recombinant Kinase Production and Fragment Screening by NMR Spectroscopy.
Han, Byeonggu; Ahn, Hee-Chul
2016-01-01
During the past decade fragment-based drug discovery (FBDD) has rapidly evolved and several drugs or drug candidates developed by FBDD approach are clinically in use or in clinical trials. For example, vemurafenib, a V600E mutated BRAF inhibitor, was developed by utilizing FBDD approach and approved by FDA in 2011. In FBDD, screening of fragments is the starting step for identification of hits and lead generation. Fragment screening usually relies on biophysical techniques by which the protein-bound small molecules can be detected. NMR spectroscopy has been extensively used to study the molecular interaction between the protein and the ligand, and has many advantages in fragment screening over other biophysical techniques. This chapter describes the practical aspects of fragment screening by saturation transfer difference NMR.
Energy Technology Data Exchange (ETDEWEB)
Chae, Yooeun; An, Youn-Joo, E-mail: anyjoo@konkuk.ac.kr
2016-04-15
Highlights: • Trophic transfer of silver nanowires (AgNWs) was studied in an aquatic food chain. • The transfer of AgNWs from algae to fish via water fleas was observed. • Toxicity of long AgNWs on aquatic organisms is higher than that of short ones. • AgNWs damage the gut of water fleas and may cause undernourishment. • Quantity of lipid droplets increased with increasing exposure concentration. - Abstract: Nanomaterials of various shapes and dimensions are widely used in the medical, chemical, and electronic industries. Multiple studies have reported the ecotoxicological effects of nanaoparticles when released in aquatic and terrestrial ecosystems; however, information on the toxicity of silver nanowires (AgNWs) to freshwater organisms and their transfer through the food webs is limited. In the present study, we aimed to evaluate the toxicity of 10- and 20-μm-long AgNWs to the alga Chlamydomonas reinhardtii, the water flea Daphnia magna, and the zebrafish and study their movement through this three-species food chain using a variety of qualitative and quantitative methods as well as optical techniques. We found that AgNWs directly inhibited the growth of algae and destroyed the digestive organs of water fleas. The results showed that longer AgNWs (20 μm) were more toxic than shorter ones (10 μm) to both algae and water fleas, but shorter AgNWs were accumulated more than longer ones in the body of the fish. Overall, this study suggests that AgNWs are transferred through food chains, and that they affect organisms at higher trophic levels, potentially including humans. Therefore, further studies that take into account environmental factors, food web complexity, and differences between nanomaterials are required to gain better understanding of the impact of nanomaterials on natural communities and human health.
International Nuclear Information System (INIS)
Chae, Yooeun; An, Youn-Joo
2016-01-01
Highlights: • Trophic transfer of silver nanowires (AgNWs) was studied in an aquatic food chain. • The transfer of AgNWs from algae to fish via water fleas was observed. • Toxicity of long AgNWs on aquatic organisms is higher than that of short ones. • AgNWs damage the gut of water fleas and may cause undernourishment. • Quantity of lipid droplets increased with increasing exposure concentration. - Abstract: Nanomaterials of various shapes and dimensions are widely used in the medical, chemical, and electronic industries. Multiple studies have reported the ecotoxicological effects of nanaoparticles when released in aquatic and terrestrial ecosystems; however, information on the toxicity of silver nanowires (AgNWs) to freshwater organisms and their transfer through the food webs is limited. In the present study, we aimed to evaluate the toxicity of 10- and 20-μm-long AgNWs to the alga Chlamydomonas reinhardtii, the water flea Daphnia magna, and the zebrafish and study their movement through this three-species food chain using a variety of qualitative and quantitative methods as well as optical techniques. We found that AgNWs directly inhibited the growth of algae and destroyed the digestive organs of water fleas. The results showed that longer AgNWs (20 μm) were more toxic than shorter ones (10 μm) to both algae and water fleas, but shorter AgNWs were accumulated more than longer ones in the body of the fish. Overall, this study suggests that AgNWs are transferred through food chains, and that they affect organisms at higher trophic levels, potentially including humans. Therefore, further studies that take into account environmental factors, food web complexity, and differences between nanomaterials are required to gain better understanding of the impact of nanomaterials on natural communities and human health.
Packing motifs as predictors of the propensity of antibody fragments to crystallize
Edmundson, Allen B.; DeWitt, Christina R.; Goldsteen, Benjamin Z.; Ramsland, Paul A.
1999-01-01
A recurring theme in the crystallization of antibody fragments in our laboratory has been a packing pattern involving formation of intermolecular, antiparallel β-pleated sheets across two-fold axes. The most common motif is the antiparallel stacking of constant (C) domains of light (L) chain dimers or Fab molecules. Here, cross-molecule six-stranded sheets are produced by hydrogen-bonding interactions of three-residue polypeptide segments (triads), in the i, i+2 and i+4 positions of the final strands (designated 3-3) of the three-chain layers from two adjacent molecules. In the variable (V) domains the triads are supplied by the first strands (4-1) of the four-chain layers and the resulting cross-molecule sheets contain eight strands. The latter type of packing is more likely to be seen in crystals of Fv fragments (V domains only) than in those of L chain dimers or Fabs. Amongst the triads from either the V or C domains, there are on average four sets of backbone carbonyl and amide groups within hydrogen bonding distance (chain dimers, Fab and Fvs are likely to crystallize in these packing patterns.
International Nuclear Information System (INIS)
Perez, G.; Guzman, F.; Garcia, F.; Rodriguez, O.; Arruda-Neto, J.D.T.; Manso, M.V.; Mesa, J.; Deppman, A.; Likhachev, V.P.; Pereira, J.W.; Helene, O.M.; Araujo, G.W.; Camargo, S.P.; Cestari, A.C.
2000-01-01
During years, scientific assessments had considered plants, animal and other living organism as part of the environment in which radionuclides become dispersed. They were further seen as resources which, when contaminated, may contribute to human radiation exposure since some plants and animals are elements of food chains and represent pathways for the transfer of radionuclides to humans. Today, the assessments are development reflected the generally accepted position that priority should be given to evaluating the potential consequences for humans, which are among the most radiosensitive mammalian species. The transfer of radioisotopes from food to humans is still a well debated issue, because experimental results are even scarce. As a contribution to this issue, the Linear Accelerator Laboratory of the Physics Institute at the Sao Paulo University jointed to other institute of Brazil and Cuba development a project for study of uranium in the food-chain: food-animal/vegetables-human. This project involves experimentation with mammalians (wistar rats and beagles dogs), fishes and vegetables, plus extrapolation to humans by means of the General Multiple-Compartments Model. The pilot experiments in animal and vegetables are well described in the paper. As first results were obtained the transfer coefficients of uranium to the organs of animals as a function of the uranium concentration present in the administered food and the transfer coefficients of uranium for each part of the plant, as function of both growing time and uranium concentration in the nutrients solution. With this data it would be possible to evaluate the uranium ingestion by humans from animal products and plants, given their dietary habits, to infer human absorption of uranium associated with prolonged intake of uranium contained in food and estimates the content of uranium transferred to humans organs, thus allowing the evaluation of internally localized doses and the radiobiological damage and
Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John
2015-10-01
Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. Published by Elsevier B.V.
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
Biological effectiveness of high-energy protons - Target fragmentation
International Nuclear Information System (INIS)
Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.
1991-01-01
High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Huang, Long; Liu, Meiying; Mao, Liucheng; Huang, Qiang; Huang, Hongye; Wan, Qing; Tian, Jianwen; Wen, Yuanqing; Zhang, Xiaoyong; Wei, Yen
2017-12-01
As a new type of mesoporous silica materials with large pore diameter (pore size between 2 and 50nm) and high specific surface areas, SBA-15 has been widely explored for different applications especially in the biomedical fields. The surface modification of SBA-15 with functional polymers has demonstrated to be an effective way for improving its properties and performance. In this work, we reported the preparation of PEGylated SBA-15 polymer composites through surface-initiated chain transfer free radical polymerization for the first time. The thiol group was first introduced on SBA-15 via co-condensation with γ-mercaptopropyltrimethoxysilane (MPTS), that were utilized to initiate the chain transfer free radical polymerization using poly(ethylene glycol) methyl ether methacrylate (PEGMA) and itaconic acid (IA) as the monomers. The successful modification of SBA-15 with poly(PEGMA-co-IA) copolymers was evidenced by a series of characterization techniques, including 1 H NMR, FT-IR, TGA and XPS. The final SBA-15-SH- poly(PEGMA-co-IA) composites display well water dispersity and high loading capability towards cisplatin (CDDP) owing to the introduction of hydrophilic PEGMA and carboxyl groups. Furthermore, the CDDP could be released from SBA-15-SH-poly(PEGMA-co-IA)-CDDP complexes in a pH dependent behavior, suggesting the potential controlled drug delivery of SBA-15-SH-poly(PEGMA-co-IA). More importantly, the strategy should be also useful for fabrication of many other functional materials for biomedical applications owing to the advantages of SBA-15 and well monomer adoptability of chain transfer free radical polymerization. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Miyata, Kenichi; Takagi, Satoshi; Sato, Shigeo; Morioka, Hiroshi; Shiba, Kiyotaka; Minamisawa, Tamiko; Takami, Miho; Fujita, Naoya
2014-01-01
Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies
The production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi
Joosten, V.; Lokman, C.; Hondel, C.A.M.J.J. van den; Punt, P.J.
2003-01-01
In this review we will focus on the current status and views concerning the production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi. We will focus on single-chain antibody fragment production (scFv and VHH) by these lower eukaryotes and the possible applications
Hisada, Hiromoto; Tsutsumi, Hiroko; Ishida, Hiroki; Hata, Yoji
2013-01-01
Llama variable heavy-chain antibody fragment (VHH) fused to four different reader proteins was produced and secreted in culture medium by Aspergillus oryzae. These fusion proteins consisted of N-terminal reader proteins, VHH, and a C-terminal his-tag sequence which facilitated purification using one-step his-tag affinity chromatography. SDS-PAGE analysis of the deglycosylated purified fusion proteins confirmed that the molecular weight of each corresponded to the expected sum of VHH and the respective reader proteins. The apparent high molecular weight reader protein glucoamylase (GlaB) was found to be suitable for efficient VHH production. The GlaB-VHH-His protein bound its antigen, human chorionic gonadotropin, and was detectable by a new ELISA-based method using a coupled assay with glucoamylase, glucose oxidase, peroxidase, maltose, and 3,3',5,5'-tetramethylbenzidine as substrates. Addition of potassium phosphate to the culture medium induced secretion of 0.61 mg GlaB-VHH-His protein/ml culture medium in 5 days.
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Gogoleva, S. D.; Stsiapura, V. I.
2018-05-01
It was found that the spectral and fluorescent properties of BTA-1C cation in protic and aprotic solvents differ. It was shown that for solutions in long-chain alcohols viscosity is the main factor that determines the dynamics of intramolecular charge transfer in the excited state of the BTA-1C molecule. In the case of aprotic solvents a correlation was found between the rate constant of twisted intramolecular charge transfer (TICT) during rotation of fragments of the molecule in relation to each other in the excited state and the solvent relaxation rate: k TICT 1/τ S .
International Nuclear Information System (INIS)
Thomas, P.A.
1991-05-01
The main purpose of this study is to investigate the accumulation and transfer of polonium-210 and lead-210 in the arctic food chain, lichen-caribou-wolf, in the Northwest Territories. Polonium-210 arises from lead-210 decay and is a widespread alpha-emitting radionuclide. It seeks soft tissue and has the potential to accumulate in the food chain. Caribou, wolves and other wildlife may become exposed to enhanced levels of these two uranium-series radionuclides if the proposed uranium mine near Baker Lake, Northwest Territories, proceeds. Baker Lake lies at the crossroads of the ranges of the Beverly, the Kaminuriak and the Wager Bay caribou herds. Therefore, it is important to establish baseline concentrations and natural food chain transfer of uranium series radionuclides, in this study. This information can be used for baseline data before any further mining development takes place. This study will also provide data regarding the statistical uncertainty attached to transfer coefficients. This can help ensure reliable and appropriate future monitoring of environmental change. With the participation of the hunters of Baker Lake, caribou and wolf samples were collected and analyzed for polonium. Results indicate that polonium-210 activity in caribou tissues were somewhat higher than previous data reported from Alaska. Transfer coefficients for polonium-210 from caribou to wolf were near unity for many tissues. However, polonium-210 does not appear to cross the placenta in caribou. Further study includes lichen collections and collection of further caribou samples from the beverly herd in order to determine transfer from lichens to caribou in both the Baker Lake and Snowdrift areas in the Northwest Territories. (author). 26 refs., 3 tabs
Energy Technology Data Exchange (ETDEWEB)
Thomas, P A [Sasatchewan Univ., Saskatoon (Canada). Biology Dept.
1991-05-01
The main purpose of this study is to investigate the accumulation and transfer of polonium-210 and lead-210 in the arctic food chain, lichen-caribou-wolf, in the Northwest Territories. Polonium-210 arises from lead-210 decay and is a widespread alpha-emitting radionuclide. It seeks soft tissue and has the potential to accumulate in the food chain. Caribou, wolves and other wildlife may become exposed to enhanced levels of these two uranium-series radionuclides if the proposed uranium mine near Baker Lake, Northwest Territories, proceeds. Baker Lake lies at the crossroads of the ranges of the Beverly, the Kaminuriak and the Wager Bay caribou herds. Therefore, it is important to establish baseline concentrations and natural food chain transfer of uranium series radionuclides, in this study. This information can be used for baseline data before any further mining development takes place. This study will also provide data regarding the statistical uncertainty attached to transfer coefficients. This can help ensure reliable and appropriate future monitoring of environmental change. With the participation of the hunters of Baker Lake, caribou and wolf samples were collected and analyzed for polonium. Results indicate that polonium-210 activity in caribou tissues were somewhat higher than previous data reported from Alaska. Transfer coefficients for polonium-210 from caribou to wolf were near unity for many tissues. However, polonium-210 does not appear to cross the placenta in caribou. Further study includes lichen collections and collection of further caribou samples from the beverly herd in order to determine transfer from lichens to caribou in both the Baker Lake and Snowdrift areas in the Northwest Territories. (author). 26 refs., 3 tabs.
Bezhenar, Roman; Jung, Kyung Tae; Maderich, Vladimir; Willemsen, Stefan; de With, Govert; Qiao, Fangli
2016-05-01
After the earthquake and tsunami on 11 March 2011 damaged the Fukushima Dai-ichi Nuclear Power Plant (FDNPP), an accidental release of a large amount of radioactive isotopes into both the air and the ocean occurred. Measurements provided by the Japanese agencies over the past 5 years show that elevated concentrations of 137Cs still remain in sediments, benthic organisms, and demersal fishes in the coastal zone around the FDNPP. These observations indicate that there are 137Cs transfer pathways from bottom sediments to the marine organisms. To describe the transfer quantitatively, the dynamic food chain biological uptake model of radionuclides (BURN) has been extended to include benthic marine organisms. The extended model takes into account both pelagic and benthic marine organisms grouped into several classes based on their trophic level and type of species: phytoplankton, zooplankton, and fishes (two types: piscivorous and non-piscivorous) for the pelagic food chain; deposit-feeding invertebrates, demersal fishes fed by benthic invertebrates, and bottom omnivorous predators for the benthic food chain; crustaceans, mollusks, and coastal predators feeding on both pelagic and benthic organisms. Bottom invertebrates ingest organic parts of bottom sediments with adsorbed radionuclides which then migrate up through the food chain. All organisms take radionuclides directly from water as well as food. The model was implemented into the compartment model POSEIDON-R and applied to the north-western Pacific for the period of 1945-2010, and then for the period of 2011-2020 to assess the radiological consequences of 137Cs released due to the FDNPP accident. The model simulations for activity concentrations of 137Cs in both pelagic and benthic organisms in the coastal area around the FDNPP agree well with measurements for the period of 2011-2015. The decrease constant in the fitted exponential function of simulated concentration for the deposit-feeding invertebrates (0.45 yr-1
Energy Technology Data Exchange (ETDEWEB)
Bezhenar, Roman; Maderich, Vladimir [Institute of Mathematical Machine and System Problems, Kiev (Ukraine); Jung, Kyung Tae [Korea Institute of Ocean Science and Technology, Ansan (Korea, Republic of); Willemsen, Stefan; With, Govert de [NRG, Arnhem (Netherlands); Qiao, Fangli [First Institute of Oceanography, Qingdao (China)
2016-07-01
After the earthquake and tsunami on 11 March 2011 damaged the Fukushima Dai-ichi Nuclear Power Plant (FDNPP), an accidental release of a large amount of radioactive isotopes into both the air and the ocean occurred. Measurements provided by the Japanese agencies over the past 5 years show that elevated concentrations of {sup 137}Cs still remain in sediments, benthic organisms, and demersal fishes in the coastal zone around the FDNPP. These observations indicate that there are {sup 137}Cs transfer pathways from bottom sediments to the marine organisms. To describe the transfer quantitatively, the dynamic food chain biological uptake model of radionuclides (BURN) has been extended to include benthic marine organisms. The extended model takes into account both pelagic and benthic marine organisms grouped into several classes based on their trophic level and type of species: phytoplankton, zooplankton, and fishes (two types: piscivorous and non-piscivorous) for the pelagic food chain; deposit-feeding invertebrates, demersal fishes fed by benthic invertebrates, and bottom omnivorous predators for the benthic food chain; crustaceans, mollusks, and coastal predators feeding on both pelagic and benthic organisms. Bottom invertebrates ingest organic parts of bottom sediments with adsorbed radionuclides which then migrate up through the food chain. All organisms take radionuclides directly from water as well as food. The model was implemented into the compartment model POSEIDON-R and applied to the north-western Pacific for the period of 1945-2010, and then for the period of 2011-2020 to assess the radiological consequences of {sup 137}Cs released due to the FDNPP accident. The model simulations for activity concentrations of {sup 137}Cs in both pelagic and benthic organisms in the coastal area around the FDNPP agree well with measurements for the period of 2011-2015. The decrease constant in the fitted exponential function of simulated concentration for the deposit
International Nuclear Information System (INIS)
Bezhenar, Roman; Maderich, Vladimir; Jung, Kyung Tae; Willemsen, Stefan; With, Govert de; Qiao, Fangli
2016-01-01
After the earthquake and tsunami on 11 March 2011 damaged the Fukushima Dai-ichi Nuclear Power Plant (FDNPP), an accidental release of a large amount of radioactive isotopes into both the air and the ocean occurred. Measurements provided by the Japanese agencies over the past 5 years show that elevated concentrations of "1"3"7Cs still remain in sediments, benthic organisms, and demersal fishes in the coastal zone around the FDNPP. These observations indicate that there are "1"3"7Cs transfer pathways from bottom sediments to the marine organisms. To describe the transfer quantitatively, the dynamic food chain biological uptake model of radionuclides (BURN) has been extended to include benthic marine organisms. The extended model takes into account both pelagic and benthic marine organisms grouped into several classes based on their trophic level and type of species: phytoplankton, zooplankton, and fishes (two types: piscivorous and non-piscivorous) for the pelagic food chain; deposit-feeding invertebrates, demersal fishes fed by benthic invertebrates, and bottom omnivorous predators for the benthic food chain; crustaceans, mollusks, and coastal predators feeding on both pelagic and benthic organisms. Bottom invertebrates ingest organic parts of bottom sediments with adsorbed radionuclides which then migrate up through the food chain. All organisms take radionuclides directly from water as well as food. The model was implemented into the compartment model POSEIDON-R and applied to the north-western Pacific for the period of 1945-2010, and then for the period of 2011-2020 to assess the radiological consequences of "1"3"7Cs released due to the FDNPP accident. The model simulations for activity concentrations of "1"3"7Cs in both pelagic and benthic organisms in the coastal area around the FDNPP agree well with measurements for the period of 2011-2015. The decrease constant in the fitted exponential function of simulated concentration for the deposit
Directory of Open Access Journals (Sweden)
Azzedine Bounamous
2014-07-01
Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.
Directory of Open Access Journals (Sweden)
Marcelo Awade
Full Text Available Dispersal is a biological process performed in three stages: emigration, transfer and immigration. Intra-specific variation on dispersal behavior, such as sex-bias, is very common in nature, particularly in birds and mammals. However, dispersal is difficult to measure in the field and many hypotheses concerning the causes of sex-biased dispersal remain without empirical confirmation. An important limitation of most empirical studies is that inferences about sex-biased dispersal are based only on emigration proneness or immigration success data. Thus, we still do not know whether sex-biased immigration in fragmented landscapes occurs during emigration, transfer or in both stages. We conducted translocation and radiotracking experiments to assess i whether inter-patch dispersal movements of a rainforest bird (Pyriglena leucoptera is sex-biased and ii how dispersal stages and the perceptual range of the individuals are integrated to generate dispersal patterns. Our results showed that inter-patch dispersal is sex-biased at all stages for P. leucoptera, as females not only exhibit a higher emigration propensity but are subjected to a lower risk of predation when moving through the matrix. Moreover, our data support a perceptual range of 80 m and our results showed that dispersal success decreases considerably when inter-patch distances exceeds this perceptual range. In this case, birds have a higher probability of travelling over longer routes and, as a consequence, the risk of predation increases, specially for males. Overall, results supported that assuming dispersal as a single-stage process to describe dispersal behavior may be misleading. In this way, our study advanced our understanding of processes and patterns related to inter-patch dispersal of neotropical forest birds, shedding light on potential implications for population dynamics and for the management of fragmented landscapes.
Fragment separator momentum compression schemes
Energy Technology Data Exchange (ETDEWEB)
Bandura, Laura, E-mail: bandura@anl.gov [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Erdelyi, Bela [Argonne National Laboratory, Argonne, IL 60439 (United States); Northern Illinois University, DeKalb, IL 60115 (United States); Hausmann, Marc [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Kubo, Toshiyuki [RIKEN Nishina Center, RIKEN, Wako (Japan); Nolen, Jerry [Argonne National Laboratory, Argonne, IL 60439 (United States); Portillo, Mauricio [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Sherrill, Bradley M. [National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States)
2011-07-21
We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.
Fragment separator momentum compression schemes
International Nuclear Information System (INIS)
Bandura, Laura; Erdelyi, Bela; Hausmann, Marc; Kubo, Toshiyuki; Nolen, Jerry; Portillo, Mauricio; Sherrill, Bradley M.
2011-01-01
We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.
International Nuclear Information System (INIS)
He, Jia; Qin, Weichao; Zhang, Xujia; Wen, Yang; Su, Limin; Zhao, Yuanhui
2013-01-01
Prediction of the biodegradability of organic pollutants is an ecologically desirable and economically feasible tool for estimating the environmental fate of chemicals. In this paper, linear and nonlinear relationships between biological oxygen demand (BOD) and molecular descriptors/fragments have been investigated for 1130 organic chemicals. Significant relationships have been observed between the simple molecular descriptors and %BOD for some homologous compounds, but not for the whole set of compounds. Electronic parameters, such as E HOMO and E LUMO , are the dominant factors affecting the biodegradability for some homologous chemicals. However, other descriptors, such as molecular weight, acid dissociation constant and polarity still have a significant impact on the biodegradation. The best global model for %BOD prediction is that developed from a chain-based fragmentation scheme. At the same time, the theoretical relationship between %BOD and molecular descriptors/fragments has been investigated, based on a first-order kinetic process. The %BOD is nonlinearly, rather than linearly, related to the descriptors. The coefficients of determination can be significantly improved by using nonlinear models for the homologous compounds and the whole data set. After analysing 1130 ready and not ready biodegradable compounds using 23 simple descriptors and various fragmentation schemes, it was revealed that biodegradation could be well predicted from a chain-based fragmentation scheme, a decision tree and a %BOD model. The models were capable of separating NRB and RB with an overall accuracy of 87.2%, 83.0% and 82.5%, respectively. The best classification model developed was a chain-based model but it used 155 fragments. The simplest model was a decision tree which only used 10 structural fragments. The effect of structures on the biodegradation has been analysed and the biodegradation pathway and mechanisms have been discussed based on activating and inactivating
Effects of RAFT Agent on the Selective Approach of Molecularly Imprinted Polymers
Asman, Saliza; Mohamad, Sharifah; Sarih, Norazilawati
2015-01-01
Two types of reversible addition-fragmentation chain transfer molecularly imprinted polymers (RAFT-MIPs) were synthesized using different monomers, which were methacrylic acid functionalized β-cyclodextrin (MAA-β-CD) and 2-hydroxyethyl methacrylate functionalized β-cyclodextrin (HEMA-β-CD), via reversible addition-fragmentation chain transfer (RAFT) polymerization, and were represented as RAFT-MIP(MAA-β-CD) and RAFT-MIP(HEMA-β-CD), respectively. Both RAFT-MIPs were systematically characterize...
International Nuclear Information System (INIS)
Xu, Peng; Gordon, Mark S.
2013-01-01
The charge transfer (CT) interaction, the most time-consuming term in the general effective fragment potential method, is made much more computationally efficient. This is accomplished by the projection of the quasiatomic minimal-basis-set orbitals (QUAMBOs) as the atomic basis onto the self-consistent field virtual molecular orbital (MO) space to select a subspace of the full virtual space called the valence virtual space. The diagonalization of the Fock matrix in terms of QUAMBOs recovers the canonical occupied orbitals and, more importantly, gives rise to the valence virtual orbitals (VVOs). The CT energies obtained using VVOs are generally as accurate as those obtained with the full virtual space canonical MOs because the QUAMBOs span the valence part of the virtual space, which can generally be regarded as “chemically important.” The number of QUAMBOs is the same as the number of minimal-basis MOs of a molecule. Therefore, the number of VVOs is significantly smaller than the number of canonical virtual MOs, especially for large atomic basis sets. This leads to a dramatic decrease in the computational cost
Shavers, M. R.; Poston, J. W.; Cucinotta, F. A.; Wilson, J. W.
1996-01-01
During manned space missions, high-energy nucleons of cosmic and solar origin collide with atomic nuclei of the human body and produce a broad linear energy transfer spectrum of secondary particles, called target fragments. These nuclear fragments are often more biologically harmful than the direct ionization of the incident nucleon. That these secondary particles increase tissue absorbed dose in regions adjacent to the bone-soft tissue interface was demonstrated in a previous publication. To assess radiological risks to tissue near the bone-soft tissue interface, a computer transport model for nuclear fragments produced by high energy nucleons was used in this study to calculate integral linear energy transfer spectra and dose equivalents resulting from nuclear collisions of 1-GeV protons transversing bone and red bone marrow. In terms of dose equivalent averaged over trabecular bone marrow, target fragments emitted from interactions in both tissues are predicted to be at least as important as the direct ionization of the primary protons-twice as important, if recently recommended radiation weighting factors and "worst-case" geometry are used. The use of conventional dosimetry (absorbed dose weighted by aa linear energy transfer-dependent quality factor) as an appropriate framework for predicting risk from low fluences of high-linear energy transfer target fragments is discussed.
International Nuclear Information System (INIS)
Molina, Carlos Israel; Gibon, Francois-Marie; Duprey, Jean-Louis; Dominguez, Eduardo; Guimaraes, Jean-Remy D.; Roulet, Marc
2010-01-01
We have evaluated the mercury and methylmercury transfers to and within the macroinvertebrate communities of a floodplain lake of the Beni River basin, Bolivia, during three hydrological seasons and in two habitats (open water and vegetation belt). Using the stable isotopes δ 13 C and δ 15 N, six trophic chains were identified during a previous study. Four are based on only one source: seston, organic matter from the bottom sediment, periphyton and macrophytes. Two are based on mixed sources (seston and periphyton in one case, periphyton and macrophytes in the other). During sampling, we found only one taxon that had surface sediment organic matter as food source and very few taxa whose trophic source was constituted by macrophytes. The periphyton was the most important source during all seasons; it produced the longest chain, with three trophic positions. Whatever the season and trophic source, all collected macroinvertebrates contained methyl mercury and the latter was biomagnified in all trophic chains that we identified. The biomagnification of methylmercury through invertebrate trophic chains accurately reflected the existence and length of these chains. Biomagnification was virtually non-existent in the sediment-based chain, low and restricted to the dry season in the macrophyte-based chain. It was significant in the seston-based chain, but limited by the existence of only two trophic levels and restricted to the wet season. Finally, it was very effective in the periphyton-based chain, which offers the highest rate of contamination of the source but, above all, the largest number of trophic levels.
Energy Technology Data Exchange (ETDEWEB)
Molina, Carlos Israel, E-mail: camoar6088@gmail.com [Instituto de Ecologia, Unidad de Limnologia, UMSA, Casilla postal 10077, La Paz (Bolivia, Plurinational State of); Institut de Recherche pour le Developpement IRD, Casilla postal 9214, La Paz (Bolivia, Plurinational State of); CONICET-Facultad de Ciencias Naturales, Universidad Nacional de Tucuman, Miguel Lillo 205, 4 000, Tucuman (Argentina); Gibon, Francois-Marie [Institut de Recherche pour le Developpement IRD, Casilla postal 9214, La Paz (Bolivia, Plurinational State of); IRD, UMR BOREA, Museum national d' Histoire Naturelle MNHN, Case postale 26, 75231, Paris cedex 05 (France); Duprey, Jean-Louis [Institut de Recherche pour le Developpement IRD, Casilla postal 9214, La Paz (Bolivia, Plurinational State of); Dominguez, Eduardo [CONICET-Facultad de Ciencias Naturales, Universidad Nacional de Tucuman, Miguel Lillo 205, 4 000, Tucuman (Argentina); Guimaraes, Jean-Remy D. [Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Bloco G-CCS, Rio de Janeiro, CEP 21949-900 (Brazil); Roulet, Marc [Institut de Recherche pour le Developpement IRD, Casilla postal 9214, La Paz (Bolivia, Plurinational State of)
2010-07-15
We have evaluated the mercury and methylmercury transfers to and within the macroinvertebrate communities of a floodplain lake of the Beni River basin, Bolivia, during three hydrological seasons and in two habitats (open water and vegetation belt). Using the stable isotopes {delta}{sup 13}C and {delta}{sup 15}N, six trophic chains were identified during a previous study. Four are based on only one source: seston, organic matter from the bottom sediment, periphyton and macrophytes. Two are based on mixed sources (seston and periphyton in one case, periphyton and macrophytes in the other). During sampling, we found only one taxon that had surface sediment organic matter as food source and very few taxa whose trophic source was constituted by macrophytes. The periphyton was the most important source during all seasons; it produced the longest chain, with three trophic positions. Whatever the season and trophic source, all collected macroinvertebrates contained methyl mercury and the latter was biomagnified in all trophic chains that we identified. The biomagnification of methylmercury through invertebrate trophic chains accurately reflected the existence and length of these chains. Biomagnification was virtually non-existent in the sediment-based chain, low and restricted to the dry season in the macrophyte-based chain. It was significant in the seston-based chain, but limited by the existence of only two trophic levels and restricted to the wet season. Finally, it was very effective in the periphyton-based chain, which offers the highest rate of contamination of the source but, above all, the largest number of trophic levels.
Chain transitivity in hyperspaces
International Nuclear Information System (INIS)
Fernández, Leobardo; Good, Chris; Puljiz, Mate; Ramírez, Ártico
2015-01-01
Given a non-empty compact metric space X and a continuous function f: X → X, we study the dynamics of the induced maps on the hyperspace of non-empty compact subsets of X and on various other invariant subspaces thereof, in particular symmetric products. We show how some important dynamical properties transfer across induced systems. These amongst others include, chain transitivity, chain (weakly) mixing, chain recurrence, exactness by chains. From our main theorem we derive an ε-chain version of Furstenberg’s celebrated 2 implies n Theorem. We also show the implications our results have for dynamics on continua.
Cueny, Eric S; Johnson, Heather C; Anding, Bernie J; Landis, Clark R
2017-08-30
Chromophore quench-labeling applied to 1-octene polymerization as catalyzed by hafnium-pyridyl amido precursors enables quantification of the amount of active catalyst and observation of the molecular weight distribution (MWD) of Hf-bound polymers via UV-GPC analysis. Comparison of the UV-detected MWD with the MWD of the "bulk" (all polymers, from RI-GPC analysis) provides important mechanistic information. The time evolution of the dual-detection GPC data, concentration of active catalyst, and monomer consumption suggests optimal activation conditions for the Hf pre-catalyst in the presence of the activator [Ph 3 C][B(C 6 F 5 ) 4 ]. The chromophore quench-labeling agents do not react with the chain-transfer agent ZnEt 2 under the reaction conditions. Thus, Hf-bound polymeryls are selectively labeled in the presence of zinc-polymeryls. Quench-labeling studies in the presence of ZnEt 2 reveal that ZnEt 2 does not influence the rate of propagation at the Hf center, and chain transfer of Hf-bound polymers to ZnEt 2 is fast and quasi-irreversible. The quench-label techniques represent a means to study commercial polymerization catalysts that operate with high efficiency at low catalyst concentrations without the need for specialized equipment.
Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies.
Qamsari, Elmira Safaie; Sharifzadeh, Zahra; Bagheri, Salman; Riazi-Rad, Farhad; Younesi, Vahid; Abolhassani, Mohsen; Ghaderi, Sepideh Safaei; Baradaran, Behzad; Somi, Mohammad Hossein; Yousefi, Mehdi
2017-12-01
The receptor tyrosine kinase (RTK) Met is the cell surface receptor for hepatocyte growth factor (HGF) involved in invasive growth programs during embryogenesis and tumorgenesis. There is compelling evidence suggesting important roles for c-Met in colorectal cancer proliferation, migration, invasion, angiogenesis, and survival. Hence, a molecular inhibitor of an extracellular domain of c-Met receptor that blocks c-Met-cell surface interactions could be of great thera-peutic importance. In an attempt to develop molecular inhibitors of c-Met, single chain variable fragment (scFv) phage display libraries Tomlinson I + J against a specific synthetic oligopeptide from the extracellular domain of c-Met receptor were screened; selected scFv were then characterized using various immune techniques. Three c-Met specific scFv (ES1, ES2, and ES3) were selected following five rounds of panning procedures. The scFv showed specific binding to c-Met receptor, and significantly inhibited proliferation responses of a human colorectal carcinoma cell line (HCT-116). Moreover, anti- apoptotic effects of selected scFv antibodies on the HCT-116 cell line were also evaluated using Annexin V/PI assays. The results demonstrated rates of apoptotic cell death of 46.0, 25.5, and 37.8% among these cells were induced by use of ES1, ES2, and ES3, respectively. The results demonstrated ability to successfully isolate/char-acterize specific c-Met scFv that could ultimately have a great therapeutic potential in immuno-therapies against (colorectal) cancers.
International Nuclear Information System (INIS)
Mao, Fei; Zhang, Chao; Gao, Cong-Zhang; Dai, Jinxia; Zhang, Feng-Shou
2014-01-01
Electronic energy loss in the collision processes of slow ions with a graphene fragment is investigated by combining ab initio time-dependent density functional theory calculations for electrons with molecular dynamics simulations for ions in real time and real space. We study the electronic energy loss of slow He 2+ , C 2+ , and C 4+ ions penetrating the graphene fragment as a function of the ion velocity, and establish the velocity-proportional energy loss for low-charged ions down to 0.1 a.u. One mechanism clarified in the simulations for electron transfer is polarization capture, which is effective for bare ions at low velocities. The other one is resonance capture, by which the incident ion can capture electrons from the graphene fragment to its electron affinity levels, which have the same, or nearly the same, energy as those of the electron donor levels. The results demonstrate that the nonlinear behavior of energy loss of C 4+ is attributed to the large number of electrons captured by this multi-charged ion during the collision. (paper)
High-energy nuclear reaction mechanisms - fission, fragmentation and spallation
International Nuclear Information System (INIS)
Kaufman, S.B.
1987-01-01
Measurements of the correlations in kinetic energy, mass, charge, and angle of coincident fragments formed in high-energy nuclear reactions have helped to characterize the processes of fission, fragmentation and spallation. For example, fission or fission-like two-body breakup mechanisms result in a strong angular correlation between two heavy fragments; in addition, the momentum transfer in the reaction can be deduced from the correlation. Another example is the multiplicity of light charged particles associated with a given heavy fragment, which is a measure of the violence of the collision, thus distinguishing between central and peripheral collisions. A summary of what has been learned about these processes from such studies will be given, along with some suggestions for further experiments
Fragmentation of low-melting metals by collapsing steam bubbles
International Nuclear Information System (INIS)
Benz, R.
1979-08-01
When a hot melt meets a vaporable liquid of lower temperature, explosive vaporisation of the cooler liquid may be the result. This is called a steam explosion if a substantial amount of thermal energy is converted into mechanical energy. One important step in understanding about steam explosions is to explain the surface increase of the hot melt. There are several competing fragmentation hypotheses, but so far there has been no model to describe fragmentation criteria as well as the time curve of surface increase on the basis of physical processes. An overall model is now given for one of the possible fragmentation mechanisms, i.e. the division of the melt by collapsing steam bubbles. The model estimates the surface increase of the melt on the basis of heavy supercooled boiling, the heat transfer connected with it, the transfer of mechanical energy during steam bubble collapse, and the solidification of the melt. The results of the calculations have shown that basic experimental observations, e.g. time and extent of fragmentation, are well presented in the model with regard to their order of magnitude. The model presents a qualitatively correct description of the effects of important influencing factors, e.g. supercooling of the coolant or initial temperature of the melt. (orig.) [de
Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George
2003-05-01
Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.
Microbial platform technology for recombinant antibody fragment production: A review.
Gupta, Sanjeev Kumar; Shukla, Pratyoosh
2017-02-01
Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.
SCit: web tools for protein side chain conformation analysis
Gautier, R.; Camproux, A.-C.; Tufféry, P.
2004-01-01
SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each...
Energy Technology Data Exchange (ETDEWEB)
Thomas, P A
1991-01-01
Study to investigate the accumulation and transfer of polonium-210 and lead-210 in the Arctic food chain lichen-caribou-wolf in the Northwest Territories. With the participation of the hunters of Baker Lake, caribou and wolf samples were collected and analyzed for polonium. The level of polonium-210 was determined in lichen, several caribou tissues, and several wolf tissues. Transfer coefficients were derived between trophic levels in the food chain and the Po-210:PB-210 ratios for lichens and selected tissues in caribou and wolf were determined.
SCit: web tools for protein side chain conformation analysis.
Gautier, R; Camproux, A-C; Tufféry, P
2004-07-01
SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.
International Nuclear Information System (INIS)
Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.
1990-01-01
Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment
Properties, production and applications of camelid single-domain antibody fragments
Harmsen, M.M.; Haard, de H.J.
2007-01-01
Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms
Characterization of Lipid A Variants by Energy-Resolved Mass Spectrometry: Impact of Acyl Chains
Crittenden, Christopher M.; Akin, Lucas D.; Morrison, Lindsay J.; Trent, M. Stephen; Brodbelt, Jennifer S.
2017-06-01
Lipid A molecules consist of a diglucosamine sugar core with a number of appended acyl chains that vary in their length and connectivity. Because of the challenging nature of characterizing these molecules and differentiating between isomeric species, an energy-resolved MS/MS strategy was undertaken to track the fragmentation trends and map genealogies of product ions originating from consecutive cleavages of acyl chains. Generalizations were developed based on the number and locations of the primary and secondary acyl chains as well as variations in preferential cleavages arising from the location of the phosphate groups. Secondary acyl chain cleavage occurs most readily for lipid A species at the 3' position, followed by primary acyl chain fragmentation at both the 3' and 3 positions. In the instances of bisphosphorylated lipid A variants, phosphate loss occurs readily in conjunction with the most favorable primary and secondary acyl chain cleavages. [Figure not available: see fulltext.
International Nuclear Information System (INIS)
Rivet, M.F.; Bimbot, R.; Gardes, D.; Fleury, A.; Hubert, F.; Llabador, Y.
1978-01-01
The excitation functions for deep inelastic reactions in which two to six charges are transferred from 40 Ar and 63 Cu ions to rare earth targets have been measured using activation techniques, the observed radionuclides being 150 Dy, 151 Dy and 149 gTb. From the comparison of the curves relative to 149 gTb and those relative to 150 Dy, 151 Dy, it was deduced that the low spin isomer 149 gTb was produced with significant probability for low incident energies. Using data from (heavy ions, xn) reactions, it was possible to attribute this production to the deexcitation of Tb fragments formed in deep inelastic transfers with angular momenta lower than 9n. This result is in good agreement with the angular momentum calculations performed under the hypothesis that the initial angular momentum window leading to deep inelastic reactions is situated between the critical angular momentum for fusion and that corresponding to grazing collisions. As far as Cu induced reactions are concerned, both hypothesis of rolling and sticking are consistent with the experimental data. For Ar induced reactions, the results indicate that the stage of sticking is not reached when the incident energy is lower than 200 MeV
Transfer of 6Li break-up fragments at 6Li projectile energies far above the coulomb barrier
International Nuclear Information System (INIS)
Neumann, B.; Buschmann, J.; Rebel, H.; Gils, H.J.; Klewe-Nebenius, H.
1979-05-01
Transfer of beam-velocity fragments has been experimentally investigated in 6 Li induced reactions on 208 Pb and 209 Bi in the energy range Esub(Li) = 60-156 MeV. The experimental techniques involve the observation of the target residues and measurements of the recoil ranges of heavy residual nuclei produced by charged particle bombardment. The determination of the recoil energy enables the discrimination of different reaction paths leading to the same residual nuclei. ( 6 Li, xn+p) excitation functions prove to be very similar to (α,(x-1)n) reactions at Esub(α) approximately 2/3 x Esub(Li). The results present experimental evidence for a particular reaction type indicated in previous experiments: Dissociation of the 6 Li projectile with capture of the beam-velocity alpha particle indicating an (α,xn) reaction ('internal break-up'). (orig.) [de
Li, Pengfei; Kreft, Iris; Jackson, Glen P.
2018-02-01
Top-down analyses of protonated insulin cations of charge states of 4+, 5+, or 6+ were performed by exposing the isolated precursor ions to a beam of helium cations with kinetic energy of more than 6 keV, in a technique termed charge transfer dissociation (CTD). The 100 ms charge transfer reaction resulted in approximately 20% conversion efficiency to other intact charge exchange products (CTnoD), and a range of low abundance fragment ions. To increase backbone and sulfide cleavages, and to provide better structural information than straightforward MS2 CTD, the CTnoD oxidized products were isolated and subjected to collisional activation at the MS3 level. The MS3 CTD/CID reaction effectively broke the disulfide linkages, separated the two chains, and yielded more structurally informative fragment ions within the inter-chain cyclic region. CTD also provided doubly oxidized intact product ions at the MS2 level, and resonance ejection of the singly oxidized product ion revealed that the doubly oxidized product originates directly from the isolated precursor ion and not from consecutive CTD reactions of a singly oxidized intermediate. MS4 experiments were employed to help identify potential radical cations and diradical cations, but the results were negative or inconclusive. Nonetheless, the two-electron oxidation process is a demonstration of the very large potential energy (>20 eV) available through CTD, and is a notable capability for a 3D ion trap platform.
Process of Fragment-Based Lead Discovery—A Perspective from NMR
Directory of Open Access Journals (Sweden)
Rongsheng Ma
2016-07-01
Full Text Available Fragment-based lead discovery (FBLD has proven fruitful during the past two decades for a variety of targets, even challenging protein–protein interaction (PPI systems. Nuclear magnetic resonance (NMR spectroscopy plays a vital role, from initial fragment-based screening to lead generation, because of its power to probe the intrinsically weak interactions between targets and low-molecular-weight fragments. Here, we review the NMR FBLD process from initial library construction to lead generation. We describe technical aspects regarding fragment library design, ligand- and protein-observed screening, and protein–ligand structure model generation. For weak binders, the initial hit-to-lead evolution can be guided by structural information retrieved from NMR spectroscopy, including chemical shift perturbation, transferred pseudocontact shifts, and paramagnetic relaxation enhancement. This perspective examines structure-guided optimization from weak fragment screening hits to potent leads for challenging PPI targets.
Ricotta, Fernanda
2010-01-01
In this paper the extent of international fragmentation of production in Italian manufacturing industries for the years 1985, 1995 and 2000 is assessed with different indicators. The objective is to determine where fragmentation is most prevalent and to provide a description of the key characteristics of those sectors. The paper first presents a survey of global value chain indicators and how these have been used in the economic literature. The second part supplies empirical evidence on the g...
Characterizing Peptide Neutral Losses Induced by Negative Electron-Transfer Dissociation (NETD)
Rumachik, Neil G.; McAlister, Graeme C.; Russell, Jason D.; Bailey, Derek J.; Wenger, Craig D.; Coon, Joshua J.
2012-01-01
We implemented negative electron-transfer dissociation (NETD) on a hybrid ion trap/Orbitrap mass spectrometer to conduct ion/ion reactions using peptide anions and radical reagent cations. In addition to sequence-informative ladders of a•- and x-type fragment ions, NETD generated intense neutral loss peaks corresponding to the entire or partial side-chain cleavage from amino acids constituting a given peptide. Thus, a critical step towards the characterization of this recently introduced fragmentation technique is a systematic study of synthetic peptides to identify common neutral losses and preferential fragmentation pathways. Examining 46 synthetic peptides with high mass accuracy and high resolution analysis permitted facile determination of the chemical composition of each neutral loss. We identified 19 unique neutral losses from 14 amino acids and three modified amino acids, and assessed the specificity and sensitivity of each neutral loss using a database of 1542 confidently identified peptides generated from NETD shotgun experiments employing high-pH separations and negative electrospray ionization. As residue-specific neutral losses indicate the presence of certain amino acids, we determined that many neutral losses have potential diagnostic utility. We envision this catalogue of neutral losses being incorporated into database search algorithms to improve peptide identification specificity and to further advance characterization of the acidic proteome. PMID:22290482
Fragmentation of the projectile near the Fermi energy
International Nuclear Information System (INIS)
Dayras, R.
1986-05-01
The experimental data about projectile fragmentation around the Fermi energy are reviewed. Comparisons with low and high energy data suggest that this energy domain is indeed a transition region. Reaction mechanisms dominated by the mean field at low energy progressively give way to individual n-n collisions. In the present case, this transition manifests itself by a rapid decrease of transfer reactions for the benefit of fragmentation processes. A coherent description of the observed results requires to take into account mean field effects as well as individual n-n collisions
Plasmon-Polariton Properties in Metallic Nanosphere Chains
Directory of Open Access Journals (Sweden)
Witold Aleksander Jacak
2015-06-01
Full Text Available The propagation of collective wave type plasmonic excitations along infinite chains of metallic nanospheres has been analyzed, including near-, medium- and far-field contributions to the plasmon dipole interaction with all retardation effects taken into account. It is proven that there exist weakly-damped self-modes of plasmon-polaritons in the chain for which the propagation range is limited by relatively small Ohmic losses only. In this regime, the Lorentz friction irradiation losses on each nanosphere in the chain are ideally compensated by the energy income from the rest of the chain. The completely undamped collective waves were identified in the case of the presence of persistent external excitation of some fragment of the chain. The obtained characteristics of these excitations fit the experimental observations well.
International Nuclear Information System (INIS)
Sobotka, L.G.
1988-01-01
The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this emission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of large fragment production in low energy reactions should go hand in hand with the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report
Chang, Yongzhi; Zhou, Shuxi; Li, Enqin; Zhao, Wenfeng; Ji, Yanpeng; Wen, Xiaoan; Sun, Hongbin; Yuan, Haoliang
2017-01-27
Cholesteryl Ester Transfer Protein (CETP) is an important therapeutic target for the treatment of atherosclerotic cardiovascular disease. Our molecular modeling study revealed that pentacyclic triterpenoid compounds could mimic the protein-ligand interactions of the endogenous ligand cholesteryl ester (CE) by occupying its binding site. Alignment of the docking conformations of oleanolic acid (OA), ursolic acid (UA) and the crystal conformations of known CETP inhibitor Torcetrapib in the active site proposed the applicability of fragment-based drug design (FBDD) approaches in this study. Accordingly, a series of pentacyclic triterpenoid derivatives have been designed and synthesized as novel CETP inhibitors. The most potent compound 12e (IC 50 :0.28 μM) validated our strategy for molecular design. Molecular dynamics simulations illustrated that the more stable hydrogen bond interaction of the UA derivative 12e with Ser191 and stronger hydrophobic interactions with Val198, Phe463 than those of OA derivative 12b mainly led to their significantly different CETP inhibitory activity. These novel potent CETP inhibitors based on ursane-type scaffold should deserve further investigation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Kakiuchi, Toshifumi; Ito, Fuyuki; Nagamura, Toshihiko
2008-04-03
The excitation energy transfer from meso-tetrakis(N-methylpyridinium-4-yl)porphyrin (TMPyP) to 3,3'-diethyl-2,2'-thiatricarbocyanine iodide (DTTCI) along the deoxyribonucleic acid (DNA) double strand was investigated by the steady-state absorption and fluorescence measurements and time-resolved fluorescence measurements. The steady-state fluorescence spectra showed that the near-infrared fluorescence of DTTCI was strongly enhanced up to 86 times due to the energy transfer from the excited TMPyP molecule in DNA buffer solution. Furthermore, we elucidated the mechanism of fluorescence quenching and enhancement by the direct observation of energy transfer using the time-resolved measurements. The fluorescence quenching of TMPyP chiefly consists of a static component due to the formation of complex and dynamic components due to the excitation energy transfer. In a heterogeneous one-dimensional system such as a DNA chain, it was proved that the energy transfer process only carries out within the critical distance based on the Förster theory and within a threshold value estimated from the modified Stern-Volmer equation. The present results showed that DNA chain is one of the most powerful tools for nanoassemblies and will give a novel concepts of material design.
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Nieuwenhuizen, W.; Gravesen, M.
1981-01-01
Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and
Tumour targeting with monovalent fragments of anti-neuroblastoma antibody chCE7
International Nuclear Information System (INIS)
Carrel, F.; Novak-Hofer, I.; Ruch, C.; Zimmermann, K.; Amstutz, H.
1997-01-01
The in vitro and in vivo behaviour of the monovalent single chain (scFv) and Fab-fragments derived from anti-neuroblastoma antibody chCE7 is reported. When comparing tumour uptake and -retention of radioactivity of 67 Cu-labelled monovalent chCE7 with divalent chCE7 F(ab') 2 the advantage of the radiocopper label over the radioiodine label was more pronounced with the divalent (internalising) F(ab') 2 fragments. (author) 1 fig., 1 ref
Element Distribution and Multiplicity of Heavy Fragments
2002-01-01
This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...
When fragments link: a bibliometric perspective on the development of fragment-based drug discovery.
Romasanta, Angelo K S; van der Sijde, Peter; Hellsten, Iina; Hubbard, Roderick E; Keseru, Gyorgy M; van Muijlwijk-Koezen, Jacqueline; de Esch, Iwan J P
2018-05-05
Fragment-based drug discovery (FBDD) is a highly interdisciplinary field, rich in ideas integrated from pharmaceutical sciences, chemistry, biology, and physics, among others. To enrich our understanding of the development of the field, we used bibliometric techniques to analyze 3642 publications in FBDD, complementing accounts by key practitioners. Mapping its core papers, we found the transfer of knowledge from academia to industry. Co-authorship analysis showed that university-industry collaboration has grown over time. Moreover, we show how ideas from other scientific disciplines have been integrated into the FBDD paradigm. Keyword analysis showed that the field is organized into four interconnected practices: library design, fragment screening, computational methods, and optimization. This study highlights the importance of interactions among various individuals and institutions from diverse disciplines in newly emerging scientific fields. Copyright © 2018. Published by Elsevier Ltd.
Quantum Spin Models for Copper Oxide Chains in High-T{sub c} Superconductors
Energy Technology Data Exchange (ETDEWEB)
Haugerud, H.
1996-12-31
This doctoral thesis presents some of the most important features of high temperature superconductors, emphasizing the properties of YBa{sub 2}Cu{sub 3}O{sub 6+x} (YBCO). The family of Hubbard-like models is considered and a simplified version of the Emery model derived. This model is applied to fermions on a cyclic chain and solved analytically in the strong correlation limit. For realistic model parameter values the effects of an external magnetic field is investigated by numerical diagonalization. Applying the Emery model to finite cyclic Cu-O chains it is shown that the behaviour of the chains is typical for a 1D Fermi-liquid. The relatively small difference between the values of the local charge and the local magnetic moment indicates that the degree of correlation in this system is very high. The ground state of the Emery model is shown to be antiferromagnetic for half and quarter filling, resembling the ground state of the Heisenberg model. The role of the ensemble of Cu-O chain fragments of the oxygen deficient planes of YBCO is addressed. By applying the Emery model to short Cu-O chains and calculating the free energy of the chains, the parameters of an Ising like lattice gas model are estimated. Several thermodynamical quantities are calculated by applying Monte Carlo technique to the model. The charge transfer from the chains to the planes is shown to correspond to the measured values of T{sub c}. The phase diagram and the average chain length agree well with experiments. The model is also capable of explaining the behaviour of the REBCO series of superconductors, where RE are various rare earth ions. A framework for simultaneously visualizing and computing numerical quantities from lattice simulations is presented and illustrated. 195 refs., 69 figs., 4 tabs.
International Nuclear Information System (INIS)
Xu, Feng; Davis, Anthony B.; Diner, David J.
2016-01-01
A Markov chain formalism is developed for computing the transport of polarized radiation according to Generalized Radiative Transfer (GRT) theory, which was developed recently to account for unresolved random fluctuations of scattering particle density and can also be applied to unresolved spectral variability of gaseous absorption as an improvement over the standard correlated-k method. Using Gamma distribution to describe the probability density function of the extinction or absorption coefficient, a shape parameter a that quantifies the variability is introduced, defined as the mean extinction or absorption coefficient squared divided by its variance. It controls the decay rate of a power-law transmission that replaces the usual exponential Beer-Lambert-Bouguer law. Exponential transmission, hence classic RT, is recovered when a→∞. The new approach is verified to high accuracy against numerical benchmark results obtained with a custom Monte Carlo method. For a<∞, angular reciprocity is violated to a degree that increases with the spatial variability, as observed for finite portions of real-world cloudy scenes. While the degree of linear polarization in liquid water cloudbows, supernumerary bows, and glories is affected by spatial heterogeneity, the positions in scattering angle of these features are relatively unchanged. As a result, a single-scattering model based on the assumption of subpixel homogeneity can still be used to derive droplet size distributions from polarimetric measurements of extended stratocumulus clouds. - Highlights: • A Markov chain formalism is developed for Generalized Radiative Transfer theory. • Angular reciprocity is violated to a degree that increases with spatial variability. • The positions of cloudbows and glories in scattering angle are relatively unchanged.
Energy Technology Data Exchange (ETDEWEB)
Jones, G. II; Farahat, C.W.; Oh, C. (Boston Univ., MA (United States))
1994-07-14
The electron-transfer photochemistry of the covalent derivatives of the dye eosin, in which the xanthene dye is covalently attached to the amino acid L-tryptophan via the thiohydantoin derivative, the tryptophan dipeptide, and an ethyl ester derivative, has been investigated. The singlet excited state of the dye is significantly quenched on attachment of the aromatic amino acid residue. Dye triplet states are also intercepted through intramolecular interaction of excited dye and amino acid pendants. Flash photolysis experiments verify that this interaction involves electron transfer from the indole side chains of tryptophan. Rate constants for electron transfer are discussed in terms of the distance relationships for the eosin chromophore and aromatic redox sites on peptide derivatives, the pathway for [sigma]-[pi] through-bond interaction between redox sites, and the multiplicity and state of protonation for electron-transfer intermediates. Selected electron-transfer photoreactions were studied under conditions of binding of the peptide derivatives in a high molecular weight, water-soluble, globular polymer, poly(vinyl-2-pyrrolidinone). 28 refs., 4 figs., 1 tab.
Plug and Play Firms in the TNCs' Virtual Value Chain
Directory of Open Access Journals (Sweden)
Teresa Pakulska
2016-04-01
Full Text Available Growing virtualisation of the value chain appears to be an expression of implementation of ICT solutions in international business represented by TNCs. This creates new opportunities for cooperation within the value chain and its composition. The growing importance in this area can be attributed to companies integrating the value chain, known as plug and play. Their integration into the value creation chain gives a new dimension to TNCs' strategic choices from the fragmentation of activity and its integration on an international scale point of view.
Non-equilibrium versus equilibrium emission of complex fragments from hot nuclei
International Nuclear Information System (INIS)
Viola, V.E.; Kwiatkowski, K.; Yennello, S.; Fields, D.E.
1989-01-01
The relative contributions of equilibrium and non-equilibrium mechanisms for intermediate-mass fragment emission have been deduced for Z=3-14 fragments formed in 3 He- and 14 N-induced reactions on Ag and Au targets. Complete inclusive excitation function measurements have been performed for 3 He projectiles from E/A=67 to 1,200 MeV and for 14 N from E/A=20 to 50 MeV. The data are consistent with a picture in which equilibrated emission is important at the lowest energies, but with increasing bombarding energy the cross sections are increasingly dominated by non-equilibrium processes. Non-equilibrium emission is also shown to be favored for light fragments relative to heavy fragments. These results are supported by coincidence studies of intermediate-mass fragments tagged by linear momentum transfer measurements
Directory of Open Access Journals (Sweden)
Nica Dragos V
2012-06-01
Full Text Available Abstract Background Copper (Cu, zinc (Zn, cadmium (Cd, and lead (Pb can pose serious threats to environmental health because they tend to bioaccumulate in terrestrial ecosystems. We investigated under field conditions the transfer of these heavy metals in a soil-plant-snail food chain in Banat area, Romania. The main goal of this paper was to assess the Roman snail (Helix pomatia usefulness in environmental monitoring as bioindicator of heavy metal accumulation. Eight sampling sites, selected by different history of heavy metal (HM exposure, were chosen to be sampled for soil, nettle leaves, and newly matured snails. This study also aimed to identify the putative effects of HM accumulation in the environment on phenotypic variability in selected shell features, which included shell height (SH, relative shell height (RSH, and whorl number (WN. Results Significantly higher amounts of HMs were accumulated in snail hepatopancreas and not in foot. Cu, Zn, and Cd have biomagnified in the snail body, particularly in the hepatopancreas. In contrast, Pb decreased when going up into the food chain. Zn, Cd, and Pb correlated highly with each other at all levels of the investigated food chain. Zn and Pb exhibited an effective soil–plant transfer, whereas in the snail body only foot Cu concentration was correlated with that in soil. There were significant differences among sampling sites for WN, SH, and RSH when compared with reference snails. WN was strongly correlated with Cd and Pb concentrations in nettle leaves but not with Cu and Zn. SH was independent of HM concentrations in soil, snail hepatopancreas, and foot. However, SH correlated negatively with nettle leaves concentrations for each HM except Cu. In contrast, RSH correlated significantly only with Pb concentration in hepatopancreas. Conclusions The snail hepatopancreas accumulates high amounts of HMs, and therefore, this organ can function as a reliable biomarker for tracking HM bioavailability
THE ROLE OF PEBBLE FRAGMENTATION IN PLANETESIMAL FORMATION. I. EXPERIMENTAL STUDY
Energy Technology Data Exchange (ETDEWEB)
Syed, M. Bukhari; Blum, J. [Institut für Geophysik und extraterrestrische Physik, Technische Universität zu Braunschweig, Mendelssohnstr. 3, D-38106 Braunschweig (Germany); Jansson, K. Wahlberg; Johansen, A. [Lund Observatory, Department of Astronomy and Theoretical Physics, Lund University, Box 43, SE-221 00 Lund (Sweden)
2017-01-10
Previous work on protoplanetary dust growth shows a halt at centimeter sizes owing to the occurrence of bouncing at velocities of ≳0.1 m s{sup −1} and fragmentation at velocities ≳1 m s{sup −1}. To overcome these barriers, spatial concentration of centimeter-sized dust pebbles and subsequent gravitational collapse have been proposed. However, numerical investigations have shown that dust aggregates may undergo fragmentation during the gravitational collapse phase. This fragmentation in turn changes the size distribution of the solids and thus must be taken into account in order to understand the properties of the planetesimals that form. To explore the fate of dust pebbles undergoing fragmenting collisions, we conducted laboratory experiments on dust-aggregate collisions with a focus on establishing a collision model for this stage of planetesimal formation. In our experiments, we analyzed collisions of dust aggregates with masses between 0.7 and 91 g mass ratios between target and projectile from 1 to 126 at a fixed porosity of 65%, within the velocity range of 1.5–8.7 m s{sup −1}, at low atmospheric pressure of ∼10{sup −3} mbar, and in free-fall conditions. We derived the mass of the largest fragment, the fragment size/mass distribution, and the efficiency of mass transfer as a function of collision velocity and projectile/target aggregate size. Moreover, we give recipes for an easy-to-use fragmentation and mass-transfer model for further use in modeling work. In a companion paper, we use the experimental findings and the derived dust-aggregate collision model to investigate the fate of dust pebbles during gravitational collapse.
A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth
Energy Technology Data Exchange (ETDEWEB)
Zhao, Shuli [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Nanjing Affiliated First Hospital, Nanjing Medical University, Nanjing (China); Zhao, Guangfeng; Xie, Hao; Huang, Yahong [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Hou, Yayi [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing (China)
2012-01-27
Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex){sub 1.3}(DOX){sub 20}. In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers.
A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth
International Nuclear Information System (INIS)
Zhao, Shuli; Zhao, Guangfeng; Xie, Hao; Huang, Yahong; Hou, Yayi
2012-01-01
Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex) 1.3 (DOX) 20 . In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers
Knitting distributed cluster-state ladders with spin chains
Energy Technology Data Exchange (ETDEWEB)
Ronke, R.; D' Amico, I. [Department of Physics, University of York, York YO10 5DD, United Kingdom. (United Kingdom); Spiller, T. P. [School of Physics and Astronomy, E C Stoner Building, University of Leeds, Leeds, LS2 9JT (United Kingdom)
2011-09-15
Recently there has been much study on the application of spin chains to quantum state transfer and communication. Here we discuss the utilization of spin chains (set up for perfect quantum state transfer) for the knitting of distributed cluster-state structures, between spin qubits repeatedly injected and extracted at the ends of the chain. The cluster states emerge from the natural evolution of the system across different excitation number sectors. We discuss the decohering effects of errors in the injection and extraction process as well as the effects of fabrication and random errors.
Knitting distributed cluster-state ladders with spin chains
International Nuclear Information System (INIS)
Ronke, R.; D'Amico, I.; Spiller, T. P.
2011-01-01
Recently there has been much study on the application of spin chains to quantum state transfer and communication. Here we discuss the utilization of spin chains (set up for perfect quantum state transfer) for the knitting of distributed cluster-state structures, between spin qubits repeatedly injected and extracted at the ends of the chain. The cluster states emerge from the natural evolution of the system across different excitation number sectors. We discuss the decohering effects of errors in the injection and extraction process as well as the effects of fabrication and random errors.
Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A
2010-04-01
The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.
Li, Qing; Wang, Ze-yuan; Cao, Zhi-chao; Du, Rui-yang; Luo, Hao
2015-08-01
With the process of globalisation and the development of management models and information technology, enterprise cooperation and collaboration has developed from intra-enterprise integration, outsourcing and inter-enterprise integration, and supply chain management, to virtual enterprises and enterprise networks. Some midfielder enterprises begin to serve for different supply chains. Therefore, they combine related supply chains into a complex enterprise network. The main challenges for enterprise network's integration and collaboration are business process and data fragmentation beyond organisational boundaries. This paper reviews the requirements of enterprise network's integration and collaboration, as well as the development of new information technologies. Based on service-oriented architecture (SOA), collaboration modelling and collaboration agents are introduced to solve problems of collaborative management for service convergence under the condition of process and data fragmentation. A model-driven methodology is developed to design and deploy the integrating framework. An industrial experiment is designed and implemented to illustrate the usage of developed technologies in this paper.
Universal Rim Thickness in Unsteady Sheet Fragmentation
Wang, Y.; Dandekar, R.; Bustos, N.; Poulain, S.; Bourouiba, L.
2018-05-01
Unsteady fragmentation of a fluid bulk into droplets is important for epidemiology as it governs the transport of pathogens from sneezes and coughs, or from contaminated crops in agriculture. It is also ubiquitous in industrial processes such as paint, coating, and combustion. Unsteady fragmentation is distinct from steady fragmentation on which most theoretical efforts have been focused thus far. We address this gap by studying a canonical unsteady fragmentation process: the breakup from a drop impact on a finite surface where the drop fluid is transferred to a free expanding sheet of time-varying properties and bounded by a rim of time-varying thickness. The continuous rim destabilization selects the final spray droplets, yet this process remains poorly understood. We combine theory with advanced image analysis to study the unsteady rim destabilization. We show that, at all times, the rim thickness is governed by a local instantaneous Bond number equal to unity, defined with the instantaneous, local, unsteady rim acceleration. This criterion is found to be robust and universal for a family of unsteady inviscid fluid sheet fragmentation phenomena, from impacts of drops on various surface geometries to impacts on films. We discuss under which viscous and viscoelastic conditions the criterion continues to govern the unsteady rim thickness.
International Nuclear Information System (INIS)
Sobotka, L.G.
1987-01-01
The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of large fragment production in low energy reactions should go hand in hand with the study of energy, mass, and angular momentum transfer in non-compound reactions. This thread joins the apparently divergent subjects covered in this report. 39 refs., 24 figs., 2 tabs
Newton's Cradle and Entanglement Transport in a Flexible Rydberg Chain
International Nuclear Information System (INIS)
Wuester, S.; Ates, C.; Eisfeld, A.; Rost, J. M.
2010-01-01
In a regular, flexible chain of Rydberg atoms, a single electronic excitation localizes on two atoms that are in closer mutual proximity than all others. We show how the interplay between excitonic and atomic motion causes electronic excitation and diatomic proximity to propagate through the Rydberg chain as a combined pulse. In this manner entanglement is transferred adiabatically along the chain, reminiscent of momentum transfer in Newton's cradle.
Directory of Open Access Journals (Sweden)
M.M. Sevryukova
2017-12-01
Full Text Available The optical properties and dynamics of transport of electron excitation and the ways of its relaxation in the supramolecular D–π–A complex on the basis of merocyanines have been investigated. There have been found two components in the transfer of charge: fast and slow, which correspond to different conformational states of the carbon chain in merocyanines. It was found that the main photoluminescence of the studied molecular solutions of merocyanines by its nature is similar to the exciplex luminescence, as a manifestation of resonant and charge transfer interaction in an excited state. The lifetime in this state is about 2000 ps.
Ghadge, Ghanashyam D; Pavlovic, John D; Koduvayur, Sujatha P; Kay, Brian K; Roos, Raymond P
2013-08-01
Approximately 10% of amyotrophic lateral sclerosis (ALS) cases are familial (known as FALS) with an autosomal dominant inheritance pattern, and ~25% of FALS cases are caused by mutations in Cu/Zn superoxide dismutase (SOD1). There is convincing evidence that mutant SOD1 (mtSOD1) kills motor neurons (MNs) because of a gain-of-function toxicity, most likely related to aggregation of mtSOD1. A number of recent reports have suggested that antibodies can be used to treat mtSOD1-induced FALS. To follow up on the use of antibodies as potential therapeutics, we generated single chain fragments of variable region antibodies (scFvs) against SOD1, and then expressed them as 'intrabodies' within a motor neuron cell line. In the present study, we describe isolation of human scFvs that interfere with mtSOD1 in vitro aggregation and toxicity. These scFvs may have therapeutic potential in sporadic ALS, as well as FALS, given that sporadic ALS may also involve abnormalities in the SOD1 protein or activity. Copyright © 2013 Elsevier Inc. All rights reserved.
Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah
2016-07-29
A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.
Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H
1998-02-01
A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.
Influence of dispersants on trophic transfer of petroleum hydrocarbons in a marine food chain
Energy Technology Data Exchange (ETDEWEB)
Wolfe, M.; Tjeerdema, R. [Univ. of California, Santa Cruz, CA (United States). Dept. of Chemistry and Biochemistry; Sowby, M. [California Dept. of Fish and Game, Sacramento, CA (United States)
1995-12-31
When crude oil is accidentally released into the ocean, it threatens many levels of marine life. Intervention, in the form of chemical dispersing agents, alters the normal behavior of petroleum hydrocarbons (PH) by increasing their functional water solubility and the extent of their exposure to sub-surface organisms. Dispersing agents may modify bioavailability as a result of altered interactions between dispersed PH droplets and organismal cell membranes.The objective of this research was to determine the impact of dispersing agents on PH bioavailability and trophic transfer in primary levels of a marine food chain. Uptake, bioaccumulation, depuration, and metabolic transformation of a model PH, {sup 14}C-naphthalene, were measured and compared for Prudhoe Bay Crude Oil (PBCO) dispersed with Corexit 9527 and undispersed preparations of the water-accommodated fractions (WAF) of PBCO at two salinities and temperatures. The model food chain consisted of Isochrysis galbana and Brachionus plicatilis. Direct aqueous exposure was compared with combined aqueous and dietary exposure. Fractionation and identification of metabolites was done by HPLC co-chromatography with analytical standards, and quantitation was done by liquid scintillation counting. GC-FID characterization of WAF and dispersed oil (DO) preparations shows higher concentrations of petroleum hydrocarbons and a greater number of individual constituents in the dispersed oil preparations.
Influence of dispersants on trophic transfer of petroleum hydrocarbons in a marine food chain
International Nuclear Information System (INIS)
Wolfe, M.; Tjeerdema, R.
1995-01-01
When crude oil is accidentally released into the ocean, it threatens many levels of marine life. Intervention, in the form of chemical dispersing agents, alters the normal behavior of petroleum hydrocarbons (PH) by increasing their functional water solubility and the extent of their exposure to sub-surface organisms. Dispersing agents may modify bioavailability as a result of altered interactions between dispersed PH droplets and organismal cell membranes.The objective of this research was to determine the impact of dispersing agents on PH bioavailability and trophic transfer in primary levels of a marine food chain. Uptake, bioaccumulation, depuration, and metabolic transformation of a model PH, 14 C-naphthalene, were measured and compared for Prudhoe Bay Crude Oil (PBCO) dispersed with Corexit 9527 and undispersed preparations of the water-accommodated fractions (WAF) of PBCO at two salinities and temperatures. The model food chain consisted of Isochrysis galbana and Brachionus plicatilis. Direct aqueous exposure was compared with combined aqueous and dietary exposure. Fractionation and identification of metabolites was done by HPLC co-chromatography with analytical standards, and quantitation was done by liquid scintillation counting. GC-FID characterization of WAF and dispersed oil (DO) preparations shows higher concentrations of petroleum hydrocarbons and a greater number of individual constituents in the dispersed oil preparations
Free-radical-induced chain scission and cross-linking of polymers in aqueous solution. An overview
International Nuclear Information System (INIS)
Von Sonntag, C.
2002-01-01
Complete text of publication follows. In the radiolysis of N 2 O-saturated aqueous solutions OH are generated. In their reactions with polymers, they give rise to polymer-derived radicals. The kinetics of the formation and decay of these radicals are reviewed. The rate of reaction of a polymer with a reactive free radical is noticeably lower than that of an equivalent concentration of monomer due to the non-random distribution of the reaction sites. Once a larger number of radicals are formed on one polymer molecule, e.g. upon pulse radiolysis, close-by radicals recombine more rapidly while the more distant ones survive for much longer times than an equivalent concentration of freely diffusing radicals. Intermolecular cross-linking (between two polymer chains, increase in molecular weight) and intramolecular cross-linking (formation of small loops, no increase in polymer weight) are competing processes, and their relative yields thus depend on the dose rate and polymer concentration. Hydrogen-transfer reactions within the polymer, e.g. transformation of a secondary radical into a tertiary one, are common and facilitated by the high local density of reactive sites. Due to repulsive forces, the lifetime of radicals of charged polymers is substantially increased. This enables even relatively slow b-fragmentation reactions to become of importance. In the case of poly(methacrylic acid), where β-fragmentation is comparatively fast, this even leads to an unzipping, and as a consequence of the efficient release of methacrylic acid the situation of equilibrium polymerization is approached. Heterolytic β-fragmentation is possible when adequate leaving groups are available, e.g. in polynucleotides and DNA. In the presence of O 2 , chain scission occurs via oxyl radicals as intermediates. Some implications for technical applications are discussed
Yan, Guiping; Smiley, Richard W
2010-03-01
The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.
International Nuclear Information System (INIS)
Grennan, Kathleen; Strachan, Gillian; Porter, Andrew J.; Killard, Anthony J.; Smyth, Malcolm R.
2003-01-01
This work describes the development of an electrochemical immunosensor for the analysis of atrazine using recombinant single-chain antibody (scAb) fragments. The sensors are based on carbon paste screen-printed electrodes incorporating the conducting polymer polyaniline (PANI)/poly(vinylsulphonic acid) (PVSA), which enables direct mediatorless coupling to take place between the redox centres of antigen-labelled horseradish peroxidase (HRP) and the electrode surface. Competitive immunoassays can be performed in real-time using this separation-free system. Analytical measurements based on the pseudo-linear relationship between the slope of a real-time amperometric signal and the concentration of analyte, yield a novel immunosensor set-up capable of regenerationless amperometric analysis. Multiple, sequential measurements of standards and samples can be performed on a single scAb-modified surface in a matter of minutes. No separation of bound and unbound species was necessary prior to detection. The system is capable of measuring atrazine to a detection limit of 0.1 ppb (0.1 μg l -1 ). This system offers the potential for rapid, cost-effective immunosensing for the analysis of samples of environmental, medical and pharmaceutical significance
Rapid transfer of DNA from agarose gels to nylon membranes.
Reed, K C; Mann, D A
1985-01-01
The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...
Kailemia, Muchena J; Patel, Anish B; Johnson, Dane T; Li, Lingyun; Linhardt, Robert J; Amster, I Jonathan
2015-01-01
The stereochemistry of the hexuronic acid residues of the structure of glycosaminoglycans (GAGs) is a key feature that affects their interactions with proteins and other biological functions. Electron based tandem mass spectrometry methods, in particular electron detachment dissociation (EDD), have been able to distinguish glucuronic acid (GlcA) from iduronic acid (IdoA) residues in some heparan sulfate tetrasaccharides by producing epimer-specific fragments. Similarly, the relative abundance of glycosidic fragment ions produced by collision-induced dissociation (CID) or EDD has been shown to correlate with the type of hexuronic acid present in chondroitin sulfate GAGs. The present work examines the effect of charge state and degree of sodium cationization on the CID fragmentation products that can be used to distinguish GlcA and IdoA containing chondroitin sulfate A and dermatan sulfate chains. The cross-ring fragments (2,4)A(n) and (0,2)X(n) formed within the hexuronic acid residues are highly preferential for chains containing GlcA, distinguishing it from IdoA. The diagnostic capability of the fragments requires the selection of a molecular ion and fragment ions with specific ionization characteristics, namely charge state and number of ionizable protons. The ions with the appropriate characteristics display diagnostic properties for all the chondroitin sulfate and dermatan sulfate chains (degree of polymerization of 4-10) studied.
Liu, Yihua; Inoue, Yuuki; Ishihara, Kazuhiko
2015-11-01
To add novel functionality to quantum dots (QDs), we synthesized water-soluble and pH-responsive block-type polymers by reversible addition-fragmentation chain transfer (RAFT) polymerization. The polymers were composed of cytocompatible 2-methacryloyloxyethyl phosphorylcholine (MPC) polymer segments, which contain a small fraction of active ester groups and can be used to conjugate biologically active compounds to the polymer, and pH-responsive poly(2-(N,N-diethylamino) ethyl methacrylate (DEAEMA)) segments. One terminal of the polymer chain had a hydrophobic alkyl group that originated from the RAFT initiator. This hydrophobic group can bind to the hydrophobic layer on the QD surface. A fluorescent dye was conjugated to the polymer chains via the active ester group. The block-type polymers have an amphiphilic nature in aqueous medium. The polymers were thus easily bound to the QD surface upon evaporation of the solvent from a solution containing the block-type polymer and QDs, yielding QD/fluorescence dye-conjugated polymer hybrid nanoparticles. Fluorescence resonance energy transfer (FRET) between the QDs (donors) and the fluorescent dye molecules (acceptors) was used to obtain information on the conformational dynamics of the immobilized polymers. Higher FRET efficiency of the QD/fluorescent dye-conjugated polymer hybrid nanoparticles was observed at pH 7.4 as compared to pH 5.0 due to a stretching-shrinking conformational motion of the poly(DEAEMA) segments in response to changes in pH. We concluded that the block-type MPC polymer-modified nanoparticles could be used to evaluate the pH of cells via FRET fluorescence based on the cytocompatibility of the MPC polymer. Copyright © 2015 Elsevier B.V. All rights reserved.
Review of the ecological parameters of radionuclide turnover in vertebrate food chains
International Nuclear Information System (INIS)
Kitchings, T.; DiGregorio, D.; Van Voris, P.
1976-01-01
Ecological studies of radionuclides in the environment have a long tradition in developing the capability to identify and predict movement and concentration of nuclides in agricultural food chains leading to man. Food chain pathways and transfer coefficients for the nonagricultural portions of natural and managed ecosystems characteristic of affected habitats adjacent to nuclear facilities have not been adequately characterized to establish reliable models for radionuclide releases. This information is necessary in order to assess the impact that such installations will have on the biota of natural ecosystems. Since food chains are the major processes transferring elements from one trophic level to another in terrestrial ecosystems, information is needed on the (a) food-chain transfer pathways, (b) bioconcentration by each trophic component and (c) turnover rates by receptor organisms. These data are prerequisite inputs for food-chain transport models and can be correlated with species characteristics (e.g., body weight and feeding habits), to provide indices for predictive calculations. Application of these models for radionuclide transfer can aid in the assessment of radioactive releases from nuclear reactor facilities to terrestrial nonagricultural food chains
International Nuclear Information System (INIS)
Meuer, D.; Frey, R.; Hoffmann, D.H.H.; Richter, A.; Spamer, E.; Titze, O.; Knuepfer, W.
1980-01-01
High-resolution (FWHM approx. 30 keV) inelastic electron scattering on 90 Zr at low momentum transfer (0.20 -1 ) has been used to study magnetic transitions at excitation energies Esub(x) = 8-10 MeV. The experimental data were analyzed in the distorted-wave Born approximation (DWBA) with wave functions calculated in the random phase approximation (RPA). Three Jsup(π) = 1 + states have been identified Esub(x) = 8.233, 9.000 and 9.371 MeV. There is some indication of further very fragmented dipole strength and the upper limit for the total M1 strength in the investigated energy region is ΣB(M1)up 2 sub(K). It is much smaller than any theoretical prediction. Furthermore, a large number of 2 - states has been observed, with the center of gravity located at Esub(x) approx. 9 MeV. These states carry a total strength of ΣB(M2)up = 1000 μ 2 sub(K) x fm 2 . Their strong fragmentation is in qualitative agreement with theoretical calculations, but the deduced strength is much smaller than theoretically predicted. In addition the distributions of spacings and radiative widths of the 2 - states are consistent with a Wigner and a Porter-Thomas distribution, respectively. (orig.)
Modeling the fine fragmentation following the triggering stage of a vapor explosion
International Nuclear Information System (INIS)
Darbord, I.
1997-01-01
In the frame of PWR severe accidents, where the core melt, this thesis studies one of the stages of an FCI (fuel coolant interaction) or vapor explosion. An FCI is a rapid evaporation of a coolant when it comes into contact with a hot liquid. More precisely, the subject of this study is the triggering stage of the FCI, when a fuel drop of diameter around one centimeter breaks up into many fragments, diameter of which is around a hundred micrometers. The model describes the cyclic collapse and growth of a vapor bubble around the fuel droplet and its fragmentation. The main features of the model are: - the destabilization of the film or the vapor bubble due to the growth of Rayleigh-Taylor instabilities (those form coolant jets that contact the fuel surface); - The mechanisms of fragmentation, following the contacts (in the case of entrapment of a certain amount of coolant in the fuel, the entrapped coolant evaporates violently after it has been heated to the homogeneous nucleation temperature); - the transient heat transfer from the fragments to the coolant and the elevated vapor production, which leads to an important expansion of the bubble (about this point, the cooling of the fragments has been described by a transient heat transfer coefficient linked to nucleate boiling). The results of the model show good agreement with experimental data. (Author)
International Nuclear Information System (INIS)
Pacifico, M.D.; Pearl, R.A.; Kupsch, J.M.
2006-01-01
Radio scintigraphy using single chain antibody fragments (scFvs) offers a potenti al means of early detection of melanoma metastases. However, previous studies have shown suboptimal levels of tumour localization and nonspecific background accumulation which may be due to antigen heterogeneity. We aimed to improve tumour localization by using a cocktail of different scFvs targeting different epitopes on melanoma cells. We have previously developed three scFvs against distinct and highly tumour-specific melanoma cell-surface antigens by chain shuffling and antibody phage selection on melanoma cells. Three scFvs, RAFT3, B3 and B4 were labeled with 1 25I odine and tested both individually and as a cocktail in a nude mouse xenograft model far human melanoma. Results demonstrated improved tumour localization in vivo when compared to the individual scFvs. Tumour uptake of the cocktail at l hour was 24.220% ID/g (injected dose/gram) compared with 2.854%, 2.263% and 1.355% far B4, RAFT3 and B3, respectively, when injected individually. In addition, the cocktail exhibited significantly superior tumour to normal tissue ratios far muscle and spleen (p<0.05). A combination or cocktail of scFv clones may have an advantage aver individual scFvs far melanoma targeting in patients because of heterogeneity in the expression of different epitopes of antigens on melanoma cells
Directory of Open Access Journals (Sweden)
Zhao Jianjun
2011-02-01
Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.
Optimization of the southern electrophoretic transfer method
International Nuclear Information System (INIS)
Allison, M.A.; Fujimura, R.K.
1987-01-01
The technique of separating DNA fragments using agarose gel electrophoresis is essential in the analysis of nucleic acids. Further, after the method of transferring specific DNA fragments from those agarose gels to cellulose nitrate membranes was developed in 1975, a method was developed to transfer DNA, RNA, protein and ribonucleoprotein particles from various gels onto diazobenzyloxymethyl (DBM) paper using electrophoresis as well. This paper describes the optimum conditions for quantitative electrophoretic transfer of DNA onto nylon membranes. This method exemplifies the ability to hybridize the membrane more than once with specific RNA probes by providing sufficient retention of the DNA. Furthermore, the intrinsic properties of the nylon membrane allow for an increase in the efficiency and resolution of transfer while using somewhat harsh alkaline conditions. The use of alkaline conditions is of critical importance since we can now denature the DNA during transfer and thus only a short pre-treatment in acid is required for depurination. 9 refs., 7 figs
Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats
DEFF Research Database (Denmark)
Kastern, W.; Dyrberg, T.; Scholler, J.
1984-01-01
DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Markov Chains and Markov Processes
Ogunbayo, Segun
2016-01-01
Markov chain, which was named after Andrew Markov is a mathematical system that transfers a state to another state. Many real world systems contain uncertainty. This study helps us to understand the basic idea of a Markov chain and how is been useful in our daily lives. For some times there had been suspense on distinct predictions and future existences. Also in different games there had been different expectations or results involved. That is the reason why we need Markov chains to predict o...
Collisions of Oq+ with neutral C-60 : Charge transfer and fragmentation
Schlatholter, T; Hoekstra, R; Morgenstern, R
1998-01-01
Fragmentation of C-60 fullerenes by collisions with multiply charged Oq+ ions (1 less than or equal to q less than or equal to 7) has been studied experimentally for Oq+ collision energies of 1.16 keV amu(-1) For high projectile charges the potential energy of the projectiles is mainly responsible
Recombinant fragment of an antibody tailored for direct radioiodination
Czech Academy of Sciences Publication Activity Database
Sedláček, Juraj; Fábry, Milan; Sieglová, Irena; Král, Vlastimil; Uhnáková, Bronislava; Mudra, M.; Kronrád, L.; Sawicka, A.; Mikolajczak, R.; Řezáčová, Pavlína
2012-01-01
Roč. 55, č. 1 (2012), s. 52-56 ISSN 0362-4803 R&D Projects: GA MPO 2A-2TP1/076; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z50520514 Keywords : I125 labelling * single-chain antibody variable fragment * tyrosine-rich polypeptide segment * fusion protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.240, year: 2012
Quantum communication through an unmodulated spin chain
International Nuclear Information System (INIS)
Bose, Sougato
2003-01-01
We propose a scheme for using an unmodulated and unmeasured spin chain as a channel for short distance quantum communications. The state to be transmitted is placed on one spin of the chain and received later on a distant spin with some fidelity. We first obtain simple expressions for the fidelity of quantum state transfer and the amount of entanglement sharable between any two sites of an arbitrary Heisenberg ferromagnet using our scheme. We then apply this to the realizable case of an open ended chain with nearest neighbor interactions. The fidelity of quantum state transfer is obtained as an inverse discrete cosine transform and as a Bessel function series. We find that in a reasonable time, a qubit can be directly transmitted with better than classical fidelity across the full length of chains of up to 80 spins. Moreover, our channel allows distillable entanglement to be shared over arbitrary distances
Review of the ecological parameters of radionuclide turnover in vertebrate food chains
International Nuclear Information System (INIS)
Kitchings, T.; DiGregorio, D.; Van Voris, P.
1975-01-01
Ecological studies of radionuclides in the environment have a long tradition in developing the capability to identify and predict movement and concentration of nuclides in agronomic food chains leading to man. Food chain pathways and transfer coefficients for the non-agronomic portions of natural and managed ecosystems characteristic of affected habitats adjacent to nuclear facilities have not been adequately characterized to establish reliable dispersion models for radionuclide releases. This information is necessary in order to assess the impact that such installations will have on the biota of natural ecosystems. Since food chains are the major processes transferring elements from one trophic level to another in terrestrial ecosystems, information is needed on the food-chain transfer pathways, bioconcentration by each trophic component, and turnover rates by receptor organisms. These data are prerequisite inputs for food-chain transport models and can be correlated with species characteristics (e.g., body weight and feeding habitats), to provide indices for predictive dispersion calculations. Application of these models for radionuclide transfer can aid in the assessment of radioactive releases from nuclear reactor facilities to terrestrial non-agronomic food chains. (U.S.)
Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima
2015-09-01
To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.
DEFF Research Database (Denmark)
Duan, Zhi; Siegumfeldt, Henrik
2010-01-01
We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....
Attallah, Carolina; Aguilar, María Fernanda; Garay, A Sergio; Herrera, Fernando E; Etcheverrigaray, Marina; Oggero, Marcos; Rodrigues, Daniel E
2017-10-01
The Cys residues are almost perfectly conserved in all antibodies. They contribute significantly to the antibody fragment stability. The relevance of two natural contiguous Cys residues of an anti-recombinant human-follicle stimulation hormone (rhFSH) in a format of single-chain variable fragment (scFv) was studied. This scFv contains 5 Cys residues: V H 22 and V H 92 in the variable heavy chain (V H ) and V L 23, V L 87 and V L 88 in the variable light chain (V L ). The influence of two unusual contiguous Cys at positions V L 87 and V L 88 was studied by considering the wild type fragment and mutant variants: V L -C88S, V L -C87S, V L -C87Y. The analysis was carried out using antigen-binding ability measurement by indirect specific ELISA and a detailed molecular modeling that comprises homology methods, long molecular dynamics simulations and docking. We found that V L -C87 affected the antibody fragment stability without interfering with the disulfide bond formation. The effect of mutating the V L -C87 by a usual residue at this position like Tyr caused distant structural changes at the V H region that confers a higher mobility to the V H -CDR2 and V H -CDR3 loops improving the scFv binding to the antigen. Copyright © 2017 Elsevier Ltd. All rights reserved.
Vincke, Cécile; Gutiérrez, Carlos; Wernery, Ulrich; Devoogdt, Nick; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge
2012-01-01
Immunizing a camelid (camels and llamas) with soluble, properly folded proteins raises an affinity-matured immune response in the unique camelid heavy-chain only antibodies (HCAbs). The peripheral blood lymphocytes of the immunized animal are used to clone the antigen-binding antibody fragment from the HCAbs in a phage display vector. A representative aliquot of the library of these antigen-binding fragments is used to retrieve single domain antigen-specific binders by successive rounds of panning. These single domain antibody fragments are cloned in tandem to generate manifold constructs (bivalent, biparatopic or bispecific constructs) to increase their functional affinity, to increase specificity, or to connect two independent antigen molecules.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
DEFF Research Database (Denmark)
Refslund, Bjarke
Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...
Energy Technology Data Exchange (ETDEWEB)
Picard, Y
1999-04-15
The goal of this work is the complete analysis of the fragmentation of alkali clusters (Na{sub n}{sup +} (n < 10), NaK{sup +} and K{sub 2}{sup +}) induced by collision with light atomic (He) or molecular (H{sub 2}) targets. The main point is to study how the energy is transmitted to the cluster during the collision and how this energy is shared among the various degrees of freedom of the system and leads to its fragmentation. Two types of interactions govern the collision induced dissociation processes: on one hand, the electronic mechanisms where the target perturbs the electronic cloud and brings the molecule into a dissociative state, and on the other hand, the impulsive mechanisms where the momentum transferred to the atomic cores leads to the rotational-vibrational dissociation of the molecule. The experimental procedure is based on the measurement of the velocity vectors of the outgoing fragments detected in coincidence. This allows to reconstruct the full kinematics of the fragmentation and to separate and characterize for the first time the two types of interactions. The two basic mechanisms of collision induced dissociation are then clearly resolved for the diatomic molecule Na{sub 2}{sup +}. For the heteronuclear molecular ion NaK{sup +}, it is shown that the dissociation process is due to a combination of electronic and impulsive mechanisms in some of the dissociation pathways. The extension to the study of metallic clusters Na{sub n}{sup +} (n < 10) fragmentation shows the role and the relative importance of the electronic and impulsive mechanisms and their evolution with the cluster size. The complete analysis of Na{sub 3}{sup +} multi-fragmentation is also presented. (author)
Threshold Switching Induced by Controllable Fragmentation in Silver Nanowire Networks.
Wan, Tao; Pan, Ying; Du, Haiwei; Qu, Bo; Yi, Jiabao; Chu, Dewei
2018-01-24
Silver nanowire (Ag NW) networks have been widely studied because of a great potential in various electronic devices. However, nanowires usually undergo a fragmentation process at elevated temperatures due to the Rayleigh instability that is a result of reduction of surface/interface energy. In this case, the nanowires become completely insulating due to the formation of randomly distributed Ag particles with a large distance and further applications are hindered. Herein, we demonstrate a novel concept based on the combination of ultraviolet/ozone irradiation and a low-temperature annealing process to effectively utilize and control the fragmentation behavior to realize the resistive switching performances. In contrast to the conventional fragmentation, the designed Ag/AgO x interface facilitates a unique morphology of short nanorod-like segments or chains of tiny Ag nanoparticles with a very small spacing distance, providing conduction paths for achieving the tunneling process between the isolated fragments under the electric field. On the basis of this specific morphology, the Ag NW network has a tunable resistance and shows volatile threshold switching characteristics with a high selectivity, which is the ON/OFF current ratio in selector devices. Our concept exploits a new function of Ag NW network, i.e., resistive switching, which can be developed by designing a controllable fragmentation.
Energy Technology Data Exchange (ETDEWEB)
OEztuerk, Yavuz; Yuecel, Meral; Guenduez, Ufuk [Department of Biology, Middle East Technical University, Ankara (Turkey); Daldal, Fevzi [Department of Biology, Plant Science Institute, University of Pennsylvania, Philadelphia, PA 19104-6018 (United States); Mandaci, Sevnur [TUEBITAK Research Institute for Genetic Engineering and Biotechnology, Gebze Kocaeli 41470 (Turkey); Tuerker, Lemi [Department of Chemistry, Middle East Technical University, Ankara (Turkey); Eroglu, Inci [Department of Chemical Engineering, Middle East Technical University, Ankara (Turkey)
2006-09-15
In Rhodobacter capsulatus excess reducing equivalents generated by organic acid oxidation is consumed to reduce protons into hydrogen by the activity of nitrogenase. Nitrogenase serves as a redox-balancing tool and is activated by the RegB/RegA global regulatory system during photosynthetic growth. The terminal cytochrome cbb{sub 3} oxidase and the redox state of the cyclic photosynthetic electron transfer chain serve redox signaling to the RegB/RegA regulatory systems in Rhodobacter. In this study, hydrogen production of various R. capsulatus strains harboring the genetically modified electron carrier cytochromes or lacking the cyt cbb{sub 3} oxidase or the quinol oxidase were compared with the wild type. The results indicated that hydrogen production of mutant strains with modified electron carrier cytochromes decreased 3- to 4-fold, but the rate of hydrogen production increased significantly in a cbb{sub 3}{sup -} mutant. Moreover, hydrogen production efficiency of various R. capsulatus strains further increased by inactivation of uptake hydrogenase genes. (author)
Projectile like fragment production in Ar induced reactions around the Fermi energy
International Nuclear Information System (INIS)
Borrel, V.; Gatty, B.; Jacquet, D.; Galin, J.
1986-01-01
The production of projectile like fragments (PLF) has been studied in Ar induced reactions on various targets. It shows very clearly, that besides the predominance of fragmentation for most of the products, the transfer process is still a very strong component for products nearby the projectile. The influence of the target neutron excess on the PLF production is investigated as well as the evolution with incident energy of the characteristics of the different competing processes
Structure of antigenetic determinants in the amino-terminal region of bovine fibrinogen Aα chain
International Nuclear Information System (INIS)
Tanswell, P.; Reiter, H.; Timpl, R.
1978-01-01
A radioimmunoassay was developed for peptide F-CB1α from the amino of bovine fibrinogen Aα chain, isolated after reduction and carboxymethylation of the multichain disulfide-linked cyanogen bromide peptide F-CB1. Seven out of twelve different rabbit antisera produced against fibrinogen, peptide F-CB1 or Aα chain showed distinct binding to 125 I-labelled F-CB1α. Thrombin cleavage of F-CB1α yielded two fragments: fibrinopeptide A (residues 1-19) and the carboxy-terminal fragment Th2 (residues 20-54). Antisera could be classified into three groups according to whether they recognized antigenic determinants on fibrinopeptide A, on peptide Th2 or as they showed diminished reactions with both fragments. Only little or no cross-reaction was observed with the amino-terminal cyanogen bromide peptides of Bβ and γ chain. Proteolytic fragments of fibrinopeptide A were isolated and tested for inhibitory activity with two antisera. One antiserum contained anitbodies binding selectively to the amino-terminal sequence (residues 4-11) and did not cross-react with human fibrinopeptide A. Another antiserum showed a specific binding restricted to the carboxy-terminal sequence (residues 11-18) and cross-reacted completely with human fibrinopeptide A. These results correlate well with the primary structures of the two fibrinopeptides. The antigenic activity of the peptide fragment Th2 was localized on a 15-residue tryptic peptide derived from the central portion of the sequence. These and further data indicate that at least six different antigenic determinants are present in peptide F-CB1α. (orig.) 891 AJ [de
Customer-Driven Supply Chains From Glass Pipelines to Open Innovation Networks
Lyons, Andrew C; Piller, Frank; Poler, Raúl
2012-01-01
In recent years, the supply chain has become a key element to the survival and prosperity of organisations in different industry sectors. Organisations dealing in dynamic business environments demand supply chains that support the satisfaction of customer needs. The principles of lean thinking that once permeated standalone organisations have now been transferred to the supply chain, making imperative the development of innovative approaches to supply chain management. Customer-Driven Supply Chains: From Glass Pipelines to Open Innovation Networks reviews the concept of lean thinking and its relationship to other key initiatives associated with supply chain management. Detailed industrial case studies based on the authors’ experience illustrate the principles behind lean supply chains. Moreover, a series of diagrams are used to illustrate critical concepts and supply chain architectures. Special emphasis is placed on the importance of transferring lean principles from the organisational level to the s...
Nucleus fragmentation induced by a high-energy hadron. Pt. 2
International Nuclear Information System (INIS)
Zielinski, P.
1981-09-01
The author compares some experimental results concerning the emission of 8 Li nuclei in hadron induced reactions from nuclear emulsions. Especially he considers the vanishing of the Coulomb barrier, fission-like processes, and the rise of the heavy fragment yield with energy-transfer. (HSI) [de
Application of a GIS-BIOLOCO tool for the design and assessment of biomass delivery chains
Geijzendorffer, I.R.; Annevelink, E.; Elbersen, B.S.; Smidt, R.A.; Mol, de R.M.
2008-01-01
The spatial fragmentation of different biomass sources in one or more regions makes design and assessment of sustainable biomass delivery chains rather complicated. This paper presents a GIS tool that supports the design and facilitates a sustainability assessment of biomass delivery chains at a
Directory of Open Access Journals (Sweden)
Irina Muljajew
2018-03-01
Full Text Available Depending on the degree of grafting (DG and the side chain degree of polymerization (DP, graft copolymers may feature properties similar to statistical copolymers or to block copolymers. This issue is approached by studying aqueous solutions of PMMA-g-OEtOx graft copolymers comprising a hydrophobic poly(methyl methacrylate (PMMA backbone and hydrophilic oligo(2-ethyl-2-oxazoline (OEtOx side chains. The graft copolymers were synthesized via reversible addition-fragmentation chain transfer (RAFT copolymerization of methyl methacrylate (MMA and OEtOx-methacrylate macromonomers of varying DP. All aqueous solutions of PMMA-g-OEtOx (9% ≤ DG ≤ 34%; 5 ≤ side chain DP ≤ 24 revealed lower critical solution temperature behavior. The graft copolymer architecture significantly influenced the aggregation behavior, the conformation in aqueous solution and the coil to globule transition, as verified by means of turbidimetry, dynamic light scattering, nuclear magnetic resonance spectroscopy, and analytical ultracentrifugation. The aggregation behavior of graft copolymers with a side chain DP of 5 was significantly affected by small variations of the DG, occasionally forming mesoglobules above the cloud point temperature (Tcp, which was around human body temperature. On the other hand, PMMA-g-OEtOx with elongated side chains assembled into well-defined structures below the Tcp (apparent aggregation number (Nagg = 10 that were able to solubilize Disperse Orange 3. The thermoresponsive behavior of aqueous solutions thus resembled that of micelles comprising a poly(2-ethyl-2-oxazoline (PEtOx shell (Tcp > 60 °C.
DEFF Research Database (Denmark)
Hoffmann, Christian; Chiaula, Valeria; Yu, Liyun
2018-01-01
functionalization of excess thiol groups via photochemical thiol-ene chemistry (TEC) resulting in a functional monolayer. In addition, surface chain transfer free radical polymerization (SCT-FRP) was used for the first time to introduce a thicker polymer layer on the particle surface. The application potential...
Gong, Hong-Liang; Lei, Lei; Shi, Shu-Xian; Xia, Yu-Zheng; Chen, Xiao-Nong
2018-05-01
In this work, polylactide-b-poly(N-isopropylacrylamide) were synthesized by the combination of controlled ring-opening polymerization and reversible addition fragmentation chain transfer polymerization. These block copolymers with molecular weight range from 7,900 to 12,000 g/mol and narrow polydispersity (≤1.19) can self-assemble into micelles (polylactide core, poly(N-isopropylacrylamide) shell) in water at certain temperature range, which have been evidenced by laser particle size analyzer proton nuclear magnetic resonance and transmission electron microscopy. Such micelles exhibit obvious thermo-responsive properties: (1) Poly(N-isopropylacrylamide) blocks collapse on the polylactide core as system temperature increase, leading to reduce of micelle size. (2) Micelles with short poly(N-isopropylacrylamide) blocks tend to aggregate together when temperature increased, which is resulted from the reduction of the system hydrophilicity and the decreased repulsive force between micelles.
International Nuclear Information System (INIS)
Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji
1991-01-01
The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C H 1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides 1 H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2'-H and Tyr C3',5'-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed
Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis
Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.
2018-04-01
Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).
Modelling antibody side chain conformations using heuristic database search.
Ritchie, D W; Kemp, G J
1997-01-01
We have developed a knowledge-based system which models the side chain conformations of residues in the variable domains of antibody Fv fragments. The system is written in Prolog and uses an object-oriented database of aligned antibody structures in conjunction with a side chain rotamer library. The antibody database provides 3-dimensional clusters of side chain conformations which can be copied en masse into the model structure. The object-oriented database architecture facilitates a navigational style of database access, necessary to assemble side chains clusters. Around 60% of the model is built using side chain clusters and this eliminates much of the combinatorial complexity associated with many other side chain placement algorithms. Construction and placement of side chain clusters is guided by a heuristic cost function based on a simple model of side chain packing interactions. Even with a simple model, we find that a large proportion of side chain conformations are modelled accurately. We expect our approach could be used with other homologous protein families, in addition to antibodies, both to improve the quality of model structures and to give a "smart start" to the side chain placement problem.
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Formation of amyloid fibers by monomeric light chain variable domains.
Brumshtein, Boris; Esswein, Shannon R; Landau, Meytal; Ryan, Christopher M; Whitelegge, Julian P; Phillips, Martin L; Cascio, Duilio; Sawaya, Michael R; Eisenberg, David S
2014-10-03
Systemic light chain amyloidosis is a lethal disease characterized by excess immunoglobulin light chains and light chain fragments composed of variable domains, which aggregate into amyloid fibers. These fibers accumulate and damage organs. Some light chains induce formation of amyloid fibers, whereas others do not, making it unclear what distinguishes amyloid formers from non-formers. One mechanism by which sequence variation may reduce propensity to form amyloid fibers is by shifting the equilibrium toward an amyloid-resistant quaternary structure. Here we identify the monomeric form of the Mcg immunoglobulin light chain variable domain as the quaternary unit required for amyloid fiber assembly. Dimers of Mcg variable domains remain stable and soluble, yet become prone to assemble into amyloid fibers upon disassociation into monomers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Antiretroviral procurement and supply chain management.
Ripin, David J; Jamieson, David; Meyers, Amy; Warty, Umesh; Dain, Mary; Khamsi, Cyril
2014-01-01
Procurement, the country-level process of ordering antiretrovirals (ARVs), and supply chain management, the mechanism by which they are delivered to health-care facilities, are critical processes required to move ARVs from manufacturers to patients. To provide a glimpse into the ARV procurement and supply chain, the following pages provide an overview of the primary stakeholders, principal operating models, and policies and regulations involved in ARV procurement. Also presented are key challenges that need to be addressed to ensure that the supply chain is not a barrier to the goal of universal coverage. This article will cover the steps necessary to order and distribute ARVs, including different models of delivery, key stakeholders involved, strategic considerations that vary depending on context and policies affecting them. The single drug examples given illustrate the complications inherent in fragmented supply and demand-driven models of procurement and supply chain management, and suggest tools for navigating these hurdles that will ultimately result in more secure and reliable ARV provision. Understanding the dynamics of ARV supply chain is important for the global health community, both to ensure full and efficient treatment of persons living with HIV as well as to inform the supply chain decisions for other public health products.
A probabilistic fragment-based protein structure prediction algorithm.
Directory of Open Access Journals (Sweden)
David Simoncini
Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
Linnander, Erika; Yuan, Christina T; Ahmed, Shirin; Cherlin, Emily; Talbert-Slagle, Kristina; Curry, Leslie A
2017-01-01
Persistent gaps in the availability of essential medicines have slowed the achievement of global health targets. Despite the supply chain knowledge and expertise that ministries of health might glean from other industries, limited empirical research has examined the process of knowledge transfer from other industries into global public health. We examined a partnership designed to improve the availability of medical supplies in Tanzania by transferring knowledge from The Coca-Cola system to Tanzania's Medical Stores Department (MSD). We conducted a process evaluation including in-depth interviews with 70 participants between July 2011 and May 2014, corresponding to each phase of the partnership, with focus on challenges and strategies to address them, as well as benefits perceived by partners. Partners faced challenges in (1) identifying relevant knowledge to transfer, (2) translating operational solutions from Coca-Cola to MSD, and (3) maintaining momentum between project phases. Strategies to respond to these challenges emerged through real-time problem solving and included (1) leveraging the receptivity of MSD leadership, (2) engaging a boundary spanner to identify knowledge to transfer, (3) promoting local recognition of commonalities across industries, (4) engaging external technical experts to manage translation activities, (5) developing tools with visible benefits for MSD, (6) investing in local relationships, and (7) providing time and space for the partnership model to evolve. Benefits of the partnership perceived by MSD staff included enhanced collaboration and communication, more proactive orientations in managing operations, and greater attention to performance management. Benefits perceived by Coca-Cola staff included strengthened knowledge transfer capability and enhanced job satisfaction. Linking theoretical constructs with practical experiences from the field, we highlight the challenges, emergent strategies, and perceived benefits of a partnership
Directory of Open Access Journals (Sweden)
Erika Linnander
Full Text Available Persistent gaps in the availability of essential medicines have slowed the achievement of global health targets. Despite the supply chain knowledge and expertise that ministries of health might glean from other industries, limited empirical research has examined the process of knowledge transfer from other industries into global public health. We examined a partnership designed to improve the availability of medical supplies in Tanzania by transferring knowledge from The Coca-Cola system to Tanzania's Medical Stores Department (MSD. We conducted a process evaluation including in-depth interviews with 70 participants between July 2011 and May 2014, corresponding to each phase of the partnership, with focus on challenges and strategies to address them, as well as benefits perceived by partners. Partners faced challenges in (1 identifying relevant knowledge to transfer, (2 translating operational solutions from Coca-Cola to MSD, and (3 maintaining momentum between project phases. Strategies to respond to these challenges emerged through real-time problem solving and included (1 leveraging the receptivity of MSD leadership, (2 engaging a boundary spanner to identify knowledge to transfer, (3 promoting local recognition of commonalities across industries, (4 engaging external technical experts to manage translation activities, (5 developing tools with visible benefits for MSD, (6 investing in local relationships, and (7 providing time and space for the partnership model to evolve. Benefits of the partnership perceived by MSD staff included enhanced collaboration and communication, more proactive orientations in managing operations, and greater attention to performance management. Benefits perceived by Coca-Cola staff included strengthened knowledge transfer capability and enhanced job satisfaction. Linking theoretical constructs with practical experiences from the field, we highlight the challenges, emergent strategies, and perceived benefits of a
Angular correlations and fragmentation in intermediate energy heavy ion collisions
International Nuclear Information System (INIS)
Kristiansson, Anders.
1990-05-01
Intermediate energy heavy-ion collisions have been studied from 35 A MeV up to 94 A MeV at various accelerators. Angular correlations between light particles and detection of projectile- and target-fragments have been used to investigate the reaction mechanisms in this transition region between low- and high energy. An excess of correlations is observed in the particle-particle elastic scattering plane. This excess increases with particle mass and can be understood in terms of momentum conservation. The fragmentation measurements gives an indication that both energy and momentum transfer to the spectator volumes does occur. (author)
Laurent Guiraud
2001-01-01
CERN Central Library : 2000 year old technology transfer. Two fragments of columns from a Roman building discovered during excavations for the PS in 1956 have prominent places in the Library where they can be enjoyed by all
Dupré, Mathieu; Cantel, Sonia; Martinez, Jean; Enjalbal, Christine
2012-02-01
By screening a data set of 392 synthetic peptides MS/MS spectra, we found that a known C-terminal rearrangement was unexpectedly frequently occurring from monoprotonated molecular ions in both ESI and MALDI tandem mass spectrometry upon low and high energy collision activated dissociations with QqTOF and TOF/TOF mass analyzer configuration, respectively. Any residue localized at the C-terminal carboxylic acid end, even a basic one, was lost, provided that a basic amino acid such arginine and to a lesser extent histidine and lysine was present in the sequence leading to a fragment ion, usually depicted as (bn-1 + H2O) ion, corresponding to a shortened non-scrambled peptide chain. Far from being an epiphenomenon, such a residue exclusion from the peptide chain C-terminal extremity gave a fragment ion that was the base peak of the MS/MS spectrum in certain cases. Within the frame of the mobile proton model, the ionizing proton being sequestered onto the basic amino acid side chain, it is known that the charge directed fragmentation mechanism involved the C-terminal carboxylic acid function forming an anhydride intermediate structure. The same mechanism was also demonstrated from cationized peptides. To confirm such assessment, we have prepared some of the peptides that displayed such C-terminal residue exclusion as a C-terminal backbone amide. As expected in this peptide amide series, the production of truncated chains was completely suppressed. Besides, multiply charged molecular ions of all peptides recorded in ESI mass spectrometry did not undergo such fragmentation validating that any mobile ionizing proton will prevent such a competitive C-terminal backbone rearrangement. Among all well-known nondirect sequence fragment ions issued from non specific loss of neutral molecules (mainly H2O and NH3) and multiple backbone amide ruptures (b-type internal ions), the described C-terminal residue exclusion is highly identifiable giving raise to a single fragment ion in
Duplex quantum communication through a spin chain
Wang, Zhao-Ming; Bishop, C. Allen; Gu, Yong-Jian; Shao, Bin
2011-08-01
Data multiplexing within a quantum computer can allow for the simultaneous transfer of multiple streams of information over a shared medium thereby minimizing the number of channels needed for requisite data transmission. Here, we investigate a two-way quantum communication protocol using a spin chain placed in an external magnetic field. In our scheme, Alice and Bob each play the role of a sender and a receiver as two states, cos((θ1)/(2))0+sin((θ1)/(2))eiφ11 and cos((θ2)/(2))0+sin((θ2)/(2))eiφ21, are transferred through one channel simultaneously. We find that the transmission fidelity at each end of a spin chain can usually be enhanced by the presence of a second party. This is an important result for establishing the viability of duplex quantum communication through spin chain networks.
Probing the RAFT process using a model reaction between alkoxyamine and dithioester
Zhou, Y.
2012-01-01
A small-molecular model reaction was designed to probe the reversible addition–fragmentation chain transfer (RAFT) process. In this reaction, alkoxyamine releases radicals that react in situ with dithioester through the RAFT process, generating new radicals through the fragmentation of the
[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].
Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan
2017-03-01
Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.
International Nuclear Information System (INIS)
Solov'ev, V.G.
1993-01-01
To find out at what excitation energies the order-disorder transformations occur in intermediate and heavy nuclei, it is suggested to study fragmentation of multiquasiparticle and quasiparticle-phonon configurations. One-nucleon transfer reactions on odd-odd targets, for instance on 176 Lu and 180 Ta, should be taken as a particular case of fragmentation of three-quasiparticle configurations on the long living isomer 178 m 2 Hf-fragmentation of five-quasiparticle configurations. From the analysis of γ-decay of high-spin isomers one can information on fragmentation of quasi-phonon configurations
Nucleus fragmentation induced by a high-energy hadron
International Nuclear Information System (INIS)
Zielinski, P.
1982-10-01
The author presents a review about the spallation in hadron reactions. Especially he considers proton-proton correlations at low relative momentum, angular distributions of 30-100 MeV protons, emission of fast deuterons, the vanishing of the Coulomb barrier, fission-like processes, the rise of the heavy fragment yield with energy transfer, proton-deuteron breakup reactions, and the backward emission of fast protons. (HSI)
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji (Univ. of Tokyo (Japan))
1991-03-19
The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C{sub H}1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides {sup 1}H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2{prime}-H and Tyr C3{prime},5{prime}-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed.
On low frequency dynamics of CuO finite chains in YBa2Cu3O7-δ type high-tc superconductors
International Nuclear Information System (INIS)
Stasyuk, I.V.; Kotsur, S.S.; Ivankiv, A.L.; Dublenich, Yu.I.
1992-01-01
A problem of vibration spectrum of a crystal, featuring availability of sublattices with sufficient anharmonicity of single-ion potential is considered. Dynamics of Cu (1) O (1) finite chains in YBa 2 Cu 3 O 7-δ type crystals is studies on the basis of pseudo-spin model. Dependences of chains vibration spectra with small number of fragments on theory parameters are obtained. It is shown that in low-energy spectrum part there is a transition (from the main state), which energy decreases with increase of chain fragments number. Intensities of vibration transitions between the levels are calculated
Activation energies for fragmentation channels of anthracene dications : Experiment and theory
Reitsma, G.; Zettergren, H.; Martin, S.; Bredy, R.; Chen, L.; Bernard, J.; Hoekstra, R.; Schlathölter, Thomas
2012-01-01
We have studied the fragmentation of the polycyclic aromatic hydrocarbon anthracene (C14H10) after double electron transfer to a 5 keV proton. The excitation energies leading to the most relevant dissociation and fission channels of the resulting molecular dication were directly determined
International Nuclear Information System (INIS)
Zhu Shoupeng; Xiao Dong; Han Xiaofeng
1997-01-01
The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen
Dolk, E.; Vliet, C. van; Perez, J.M.J.; Vriend, G.; Darbon, H.; Ferrat, G.; Cambillau, C.; Frenken, L.G.J.; Verrips, T.
2005-01-01
In a previous study we have shown that llama VHH antibody fragments are able to bind their antigen after a heat shock of 90°C, in contrast to the murine monoclonal antibodies. However, the molecular mechanism by which antibody:antigen interaction occurs under these extreme conditions remains
Senet, P; Aparicio, F
2007-04-14
By using the exact density functional theory, one demonstrates that the value of the local electronic softness of a molecular fragment is directly related to the polarization charge (Coulomb hole) induced by a test electron removed (or added) from (at) the fragment. Our finding generalizes to a chemical group a formal relation between these molecular descriptors recently obtained for an atom in a molecule using an approximate atomistic model [P. Senet and M. Yang, J. Chem. Sci. 117, 411 (2005)]. In addition, a practical ab initio computational scheme of the Coulomb hole and related local descriptors of reactivity of a molecular family having in common a similar fragment is presented. As a blind test, the method is applied to the lateral chains of the 20 isolated amino acids. One demonstrates that the local softness of the lateral chain is a quantitative measure of the similarity of the amino acids. It predicts the separation of amino acids in different biochemical groups (aliphatic, basic, acidic, sulfur contained, and aromatic). The present approach may find applications in quantitative structure activity relationship methodology.
Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins
de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin
2016-01-01
Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381
The transfer of radio-active products through food chain
International Nuclear Information System (INIS)
Russell, R.S.
1979-01-01
The food chain mechanism on dry land is considered. The deposition of 90 Sr and 137 Cs are compared and a fuller investigation of 90 Sr deposition on soils. Calculated values of annual mean deposition of 90 Sr, in mCi/Km 2 , and content of milk, in pCi/gCa, from world wide fallout, 1958-75, in the UK agrees well with those observed by within 10%. The significance of radiation doses received through the food chain are discussed. The total estimated average exposure of members of the UK to natural background radiation in 1977 was 1100μSv, of which 0.2% was due to the discharge of radioactive materials into the environment. (U.K.)
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Probing conformational states of glutaryl-CoA dehydrogenase by fragment screening
Energy Technology Data Exchange (ETDEWEB)
Begley, Darren W.; Davies, Douglas R.; Hartley, Robert C.; Hewitt, Stephen N.; Rychel, Amanda L.; Myler, Peter J.; Van Voorhis, Wesley C.; Staker, Bart L.; Stewart, Lance J. (Emerald)
2014-10-02
Glutaric acidemia type 1 is an inherited metabolic disorder which can cause macrocephaly, muscular rigidity, spastic paralysis and other progressive movement disorders in humans. The defects in glutaryl-CoA dehydrogenase (GCDH) associated with this disease are thought to increase holoenzyme instability and reduce cofactor binding. Here, the first structural analysis of a GCDH enzyme in the absence of the cofactor flavin adenine dinucleotide (FAD) is reported. The apo structure of GCDH from Burkholderia pseudomallei reveals a loss of secondary structure and increased disorder in the FAD-binding pocket relative to the ternary complex of the highly homologous human GCDH. After conducting a fragment-based screen, four small molecules were identified which bind to GCDH from B. pseudomallei. Complex structures were determined for these fragments, which cause backbone and side-chain perturbations to key active-site residues. Structural insights from this investigation highlight differences from apo GCDH and the utility of small-molecular fragments as chemical probes for capturing alternative conformational states of preformed protein crystals.
Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L
2015-10-08
Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.
Spontaneous charged lipid transfer between lipid vesicles.
Richens, Joanna L; Tyler, Arwen I I; Barriga, Hanna M G; Bramble, Jonathan P; Law, Robert V; Brooks, Nicholas J; Seddon, John M; Ces, Oscar; O'Shea, Paul
2017-10-03
An assay to study the spontaneous charged lipid transfer between lipid vesicles is described. A donor/acceptor vesicle system is employed, where neutrally charged acceptor vesicles are fluorescently labelled with the electrostatic membrane probe Fluoresceinphosphatidylethanolamine (FPE). Upon addition of charged donor vesicles, transfer of negatively charged lipid occurs, resulting in a fluorescently detectable change in the membrane potential of the acceptor vesicles. Using this approach we have studied the transfer properties of a range of lipids, varying both the headgroup and the chain length. At the low vesicle concentrations chosen, the transfer follows a first-order process where lipid monomers are transferred presumably through the aqueous solution phase from donor to acceptor vesicle. The rate of transfer decreases with increasing chain length which is consistent with energy models previously reported for lipid monomer vesicle interactions. Our assay improves on existing methods allowing the study of a range of unmodified lipids, continuous monitoring of transfer and simplified experimental procedures.
Expression, production and renaturation of a functional single-chain ...
African Journals Online (AJOL)
The single-chain variable antibody fragment (scFv) against human intercellular adhesion molecule-1 (ICAM-1) was expressed at a high level in Escherichia coli as inclusion bodies. We attempted to refold the scFv by ion-exchange chromatography (IEC), dialysis and dilution. The results show that the column ...
Robustness of spin-coupling distributions for perfect quantum state transfer
International Nuclear Information System (INIS)
Zwick, Analia; Alvarez, Gonzalo A.; Stolze, Joachim; Osenda, Omar
2011-01-01
The transmission of quantum information between different parts of a quantum computer is of fundamental importance. Spin chains have been proposed as quantum channels for transferring information. Different configurations for the spin couplings were proposed in order to optimize the transfer. As imperfections in the creation of these specific spin-coupling distributions can never be completely avoided, it is important to find out which systems are optimally suited for information transfer by assessing their robustness against imperfections or disturbances. We analyze different spin coupling distributions of spin chain channels designed for perfect quantum state transfer. In particular, we study the transfer of an initial state from one end of the chain to the other end. We quantify the robustness of different coupling distributions against perturbations and we relate it to the properties of the energy eigenstates and eigenvalues. We find that the localization properties of the systems play an important role for robust quantum state transfer.
The role of the spectator assumption in models for projectile fragmentation
International Nuclear Information System (INIS)
Mc Voy, K.W.
1984-01-01
This review is restricted to direct-reaction models for the production of projectile fragments in nuclear collisions, at beam energies of 10 or more MeV/nucleon. Projectile fragments are normally identified as those which have near-beam velocities, and there seem to be two principal mechanisms for the production of these fast particles: 1. Direct breakup, 2. Sequential breakup. Of the two, the authors exclude from their discussion the ''sequential breakup'' process, in which the projectile is excited by the initial collision (either via inelastic scattering or transfer to unbound states) and then subsequently decays, outside the range of interaction
Yuan, Christina T.; Ahmed, Shirin; Cherlin, Emily; Talbert-Slagle, Kristina; Curry, Leslie A.
2017-01-01
Persistent gaps in the availability of essential medicines have slowed the achievement of global health targets. Despite the supply chain knowledge and expertise that ministries of health might glean from other industries, limited empirical research has examined the process of knowledge transfer from other industries into global public health. We examined a partnership designed to improve the availability of medical supplies in Tanzania by transferring knowledge from The Coca-Cola system to Tanzania’s Medical Stores Department (MSD). We conducted a process evaluation including in-depth interviews with 70 participants between July 2011 and May 2014, corresponding to each phase of the partnership, with focus on challenges and strategies to address them, as well as benefits perceived by partners. Partners faced challenges in (1) identifying relevant knowledge to transfer, (2) translating operational solutions from Coca-Cola to MSD, and (3) maintaining momentum between project phases. Strategies to respond to these challenges emerged through real-time problem solving and included (1) leveraging the receptivity of MSD leadership, (2) engaging a boundary spanner to identify knowledge to transfer, (3) promoting local recognition of commonalities across industries, (4) engaging external technical experts to manage translation activities, (5) developing tools with visible benefits for MSD, (6) investing in local relationships, and (7) providing time and space for the partnership model to evolve. Benefits of the partnership perceived by MSD staff included enhanced collaboration and communication, more proactive orientations in managing operations, and greater attention to performance management. Benefits perceived by Coca-Cola staff included strengthened knowledge transfer capability and enhanced job satisfaction. Linking theoretical constructs with practical experiences from the field, we highlight the challenges, emergent strategies, and perceived benefits of a
Spatial- and Time-Correlated Detection of Fission Fragments
Directory of Open Access Journals (Sweden)
Platkevic M.
2012-02-01
Full Text Available With the goal to measure angular correlations of fission fragments in rare fission decay (e.g. ternary and quaternary fission, a multi-detector coincidence system based on two and up to four position sensitive pixel detectors Timepix has been built. In addition to the high granularity, wide dynamic range and per pixel signal threshold, these devices are equipped with per pixel energy and time sensitivity providing more information (position, energy, time, enhances particle-type identification and selectivity of event-by-event detection. Operation of the device with the integrated USB 2.0 based readout interface FITPix and the control and data acquisition software tool Pixelman enables online visualization and flexible/adjustable operation for a different type of experiments. Spatially correlated fission fragments can be thus registered in coincidence. Similarly triggered measurements are performed using an integrated spectrometric module with analogue signal chain electronics. The current status of development together with demonstration of the technique with a 252Cf source is presented.
OECD Skills Outlook 2017: Skills and Global Value Chains
OECD Publishing, 2017
2017-01-01
Since the 1990s, the world has entered a new phase of globalisation. Information and communication technology, trade liberalisation and lower transport costs have enabled firms and countries to fragment the production process into global value chains (GVCs). Many products are now designed in one country and assembled in another country from parts…
Directory of Open Access Journals (Sweden)
Carla N. Toledo
2014-01-01
Full Text Available Myoglobin was immobilized with poly(methyl methacrylate-block-poly[(2-dimethylaminoethyl methacrylate]PMMA-block-PDMAEMA polymer synthesized by reversible addition-fragmentation chain transfer technique (RAFT. Cyclic voltammograms gave direct and slow quasireversible heterogeneous electron transfer kinetics between Mb-PMMA-block-PDMAEMA modified electrode and the redox center of the protein. The values for electron rate constant (Ks and transfer coefficient (α were 0.055±0.01·s−1 and 0.81±0.08, respectively. The reduction potential determined as a function of temperature (293–328 K revealed a value of reaction center entropy of ΔS0 of 351.3±0.0002 J·mol−1·K−1 and enthalpy change of -76.8±0.1 kJ·mol−1, suggesting solvent effects and charge ionization atmosphere involved in the reaction parallel to hydrophobic interactions with the copolymer. The immobilized protein also exhibits an electrocatalytical response to reduction of hydrogen peroxide, with an apparent Km of 114.7±58.7 μM. The overall results substantiate the design and use of RAFT polymers towards the development of third-generation biosensors.
Research on Knowledge-Oriented Supply ChainRisk Management System Model
Yingchun Guo
2011-01-01
Based on analyzing the characteristics of supply chain risk management under the influences of knowledge, in this paper integrates basic theories and methods of knowledge management into the process of risk management, builds a knowledge-oriented supply chain risk management system model, and proposes relevant strategies, presenting references for practical application of knowledge-oriented supply chain risk management. By means of acquiring, storing, sharing, and transferring supply chain ri...
Monoclonal antibody fragment removal mediated by mixed mode resins.
O'Connor, Ellen; Aspelund, Matthew; Bartnik, Frank; Berge, Mark; Coughlin, Kelly; Kambarami, Mutsa; Spencer, David; Yan, Huiming; Wang, William
2017-05-26
Efforts to increase monoclonal antibody expression in cell culture can result in the presence of fragmented species requiring removal in downstream processing. Capto adhere, HEA Hypercel, and PPA Hypercel anion exchange/hydrophobic interaction mixed mode resins were evaluated for their fragment removal capabilities and found to separate large hinge IgG1 antibody fragment (LHF) from monomer. Removal of greater than 75% of LHF population occurred at pH 8 and low conductivity. The mechanism of fragment removal was investigated in two series of experiments. The first experimental series consisted of comparison to chromatographic behavior on corresponding single mode resins. Both single mode anion exchange and hydrophobic interaction resins failed to separate LHF. The second experimental series studied the impact of phase modifiers, ethylene glycol, urea, and arginine on the mixed mode mediated removal. The addition of ethylene glycol decreased LHF removal by half. Further decreases in LHF separation were seen upon incubation with urea and arginine. Therefore, it was discovered that the purification is the result of a mixed mode phenomena dominated by hydrophobic interaction and hydrogen bonding effects. The site of interaction between the LHF and mixed mode resin was determined by chemical labeling of lysine residues with sulfo-NHS acetate. The labeling identified the antibody hinge and light chain regions as mediating the fragment separation. Sequence analysis showed that under separation conditions, a hydrophobic proline patch and hydrogen bonding serine and threonine residues mediate the hinge interaction with the Capto adhere ligand. Additionally, a case study is presented detailing the optimization of fragment removal using Capto adhere resin to achieve purity and yield targets in a manufacturing facility. This study demonstrated that mixed mode resins can be readily integrated into commercial antibody platform processes when additional chromatographic abilities
Energy Technology Data Exchange (ETDEWEB)
Harris, T.J.R.; Dunn, J.J.; Wimmer, E.
1978-11-01
The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.
Energy Technology Data Exchange (ETDEWEB)
Green, I.D., E-mail: igreen@bournemouth.ac.u [Centre for Conservation Ecology and Environmental Change, School of Conservation Sciences, Bournemouth University, Talbot Campus, Poole, Dorset BH12 5BB (United Kingdom); Diaz, A., E-mail: adiaz@bournemouth.ac.u [Centre for Conservation Ecology and Environmental Change, School of Conservation Sciences, Bournemouth University, Talbot Campus, Poole, Dorset BH12 5BB (United Kingdom); Tibbett, M., E-mail: mark.tibbett@uwa.edu.a [Centre for Land Rehabilitation, School of Earth and Environment, Faculty of Natural and Agricultural Sciences, University of Western Australia, 35 Stirling Highway, Crawley WA 6009 (Australia)
2010-01-15
The transfer of Cd and Zn from soils amended with sewage sludge was followed through a food chain consisting of wheat, aphids and the predator Coccinella septempunctata. Multiple regression models were generated to predict the concentrations of Cd and Zn in C. septempunctata. No significant model could be generated for Cd, indicting that the concentration of this metal was maintained within relatively narrow limits. A model predicting 64% of the variability in the Zn concentration of C. septempunctata was generated from of the concentration of Zn in the diet, time and rate of Zn consumption. The results suggest that decreasing the rate of food consumption is an effective mechanism to prevent the accumulation of Zn and that the availability of Zn in the aphid prey increased with the concentration in the aphids. The results emphasise the importance of using ecologically relevant food chains and exposure pathways during ecotoxicological studies. - Arthropod predators can regulate trace metal body burden through physiological and behavioural mechanisms.
International Nuclear Information System (INIS)
Green, I.D.; Diaz, A.; Tibbett, M.
2010-01-01
The transfer of Cd and Zn from soils amended with sewage sludge was followed through a food chain consisting of wheat, aphids and the predator Coccinella septempunctata. Multiple regression models were generated to predict the concentrations of Cd and Zn in C. septempunctata. No significant model could be generated for Cd, indicting that the concentration of this metal was maintained within relatively narrow limits. A model predicting 64% of the variability in the Zn concentration of C. septempunctata was generated from of the concentration of Zn in the diet, time and rate of Zn consumption. The results suggest that decreasing the rate of food consumption is an effective mechanism to prevent the accumulation of Zn and that the availability of Zn in the aphid prey increased with the concentration in the aphids. The results emphasise the importance of using ecologically relevant food chains and exposure pathways during ecotoxicological studies. - Arthropod predators can regulate trace metal body burden through physiological and behavioural mechanisms.
Liang, Yuxue; Neta, Pedatsur; Yang, Xiaoyu; Stein, Stephen E
2018-03-01
High-accuracy MS/MS spectra of deprotonated ions of 390 dipeptides and 137 peptides with three to six residues are studied. Many amino acid residues undergo neutral losses from their side chains. The most abundant is the loss of acetaldehyde from threonine. The abundance of losses from the side chains of other amino acids is estimated relative to that of threonine. While some amino acids lose the whole side chain, others lose only part of it, and some exhibit two or more different losses. Side-chain neutral losses are less abundant in the spectra of protonated peptides, being significant mainly for methionine and arginine. In addition to the neutral losses, many amino acid residues in deprotonated peptides produce specific negative ions after peptide bond cleavage. An expanded list of fragment ions from protonated peptides is also presented and compared with those of deprotonated peptides. Fragment ions are mostly different for these two cases. These lists of fragments are used to annotate peptide mass spectral libraries and to aid in the confirmation of specific amino acids in peptides. Graphical Abstract ᅟ.
Directory of Open Access Journals (Sweden)
Zúñiga Manuel
2008-05-01
Full Text Available Abstract Background The phosphoenolpyruvate phosphotransferase system (PTS plays a major role in sugar transport and in the regulation of essential physiological processes in many bacteria. The PTS couples solute transport to its phosphorylation at the expense of phosphoenolpyruvate (PEP and it consists of general cytoplasmic phosphoryl transfer proteins and specific enzyme II complexes which catalyze the uptake and phosphorylation of solutes. Previous studies have suggested that the evolution of the constituents of the enzyme II complexes has been driven largely by horizontal gene transfer whereas vertical inheritance has been prevalent in the general phosphoryl transfer proteins in some bacterial groups. The aim of this work is to test this hypothesis by studying the evolution of the phosphoryl transfer proteins of the PTS. Results We have analyzed the evolutionary history of the PTS phosphoryl transfer chain (PTS-ptc components in 222 complete genomes by combining phylogenetic methods and analysis of genomic context. Phylogenetic analyses alone were not conclusive for the deepest nodes but when complemented with analyses of genomic context and functional information, the main evolutionary trends of this system could be depicted. Conclusion The PTS-ptc evolved in bacteria after the divergence of early lineages such as Aquificales, Thermotogales and Thermus/Deinococcus. The subsequent evolutionary history of the PTS-ptc varied in different bacterial lineages: vertical inheritance and lineage-specific gene losses mainly explain the current situation in Actinobacteria and Firmicutes whereas horizontal gene transfer (HGT also played a major role in Proteobacteria. Most remarkably, we have identified a HGT event from Firmicutes or Fusobacteria to the last common ancestor of the Enterobacteriaceae, Pasteurellaceae, Shewanellaceae and Vibrionaceae. This transfer led to extensive changes in the metabolic and regulatory networks of these bacteria
Projectile and target fragmentation at intermediate energies (20 MeV <= E/A <= 100 MeV)
International Nuclear Information System (INIS)
Dayras, R.A.
1985-04-01
In order to follow the evolution of the reaction mechanisms in the transition region of the intermediate energy range, detailed studies of projectile-like fragments from a 44 MeV/u 40 Ar projectile bombarding 27 Al and sup(NAT)T: targets have been made. Experimental results are given. Discussion of the data is presented: transfer reactions, isotopic distributions, the fragmentation model, and abrasion model are used in the discussion
Validation of cold chain during distribution of parenteral nutrition
Directory of Open Access Journals (Sweden)
Federico Tuan
2015-09-01
Full Text Available Objective: this study aims to demonstrate the suitability of the process used to condition the extemporaneous mixtures of parenteral nutrition for distribution, considering the objective of preserving the cold chain during transport until it reaches the patient, necessary to ensure stability, effectiveness and safety of these mixtures. Method: concurrent validation, design and implementation of a protocol for evaluating the process of packaging and distribution of MNPE developed by a pharmaceutical laboratory. Running tests, according to predefined acceptance criteria. It is performed twice, in summer and on routes that require longer transfer time. Evaluation of conservation of temperature by monitoring the internal temperature values of each type of packaging, recorded by data loggers calibrated equipment. Results: the different tests meet the established criteria. The collected data ensure the maintenance of the cold chain for longer than the transfer time to the most distant points. Conclusions: this study establishes the suitability of the processes to maintaining the cold chain for transfer from the laboratory to the patient pharmacist. Whereas the breaking of cold chain can cause changes of compatibility and stability of parenteral nutrition and failures nutritional support, this study contributes to patient safety, one of the relevant dimensions of quality of care the health.
Synthesis and characterization of telechelic polymers prepared by RAFT
Lima, V.G.R.; Brokken-Zijp, J.C.M.; Klumperman, B.; Benthem - van Duuren, van A.M.G.; Linde, van der R.
2003-01-01
The reversible addn.-fragmentation chain transfer (RAFT) polymn. technique was employed to synthesize telechelic polymers. Me methacrylate, Bu methacrylate were polymd. using RAFT polymn. The polymns. exhibit the usual characteristics of living processes, and were followed by a two-step chain-end
International Nuclear Information System (INIS)
Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Plasil, F.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Kristiansson, P.; Loehner, H.; Obenshain, F.E.; Sorensen, S.P.; Poskanzer, A.M.; Ritter, H.G.; Siemiarczuk, T.
1989-07-01
Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 AGeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the Multi-Chain Fragmentation Model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)
International Nuclear Information System (INIS)
Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Saini, S.; Sorensen, S.P.; Tincknell, M.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Jacobs, P.; Poskanzer, A.M.; Ritter, H.G.; Kristiansson, P.
1990-01-01
Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 A GeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the multi-chain fragmentation model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)
Alajarin, Mateo; Bonillo, Baltasar; Ortin, Maria-Mar; Sanchez-Andrada, Pilar; Vidal, Angel; Orenes, Raul-Angel
2010-10-21
The ability of triarylmethane and diarylmethane fragments to behave as hydride donors participating in thermal [1,5]-H shift/6π-ERC tandem processes involving ketenimine and carbodiimide functions is disclosed. C-Alkyl-C-phenyl ketenimines N-substituted by a triarylmethane substructure convert into a variety of 3,3,4,4-tetrasubstituted-3,4-dihydroquinolines, as structurally related carbodiimides transform into 3,4,4-trisubstituted-3,4-dihydroquinazolines via transient ortho-azaxylylenes. The first step of these one-pot conversions, the [1,5]-H shift, is considered to be a hydride migration on the basis of the known hydricity of the tri(di)arylmethane fragment and the electrophilicity of the central heterocumulenic carbon atom, whereas the final electrocyclization involves the formation of a sterically congested C-C or C-N bond. In the cases of C,C-diphenyl substituted triarylmethane-ketenimines the usual 6π-ERC becomes prohibited by the presence of two phenyl rings at each end of the azatrienic system. This situation opens new reaction channels: (a) following the initial hydride shift, the tandem sequence continues with an alternative electrocyclization mode to give 9,10-dihydroacridines, (b) the full sequence is initiated by a rare 1,5 migration of an electron-rich aryl group, followed by a 6π-ERC which leads to 2-aryl-3,4-dihydroquinolines, or (c) a different [1,5]-H shift/6π-ERC sequence involving the initial migration of a hydrogen atom from a methyl group at the ortho position to the nitrogen atom of the ketenimine function. Diarylmethane-ketenimines bearing a methyl group at the benzylic carbon atom experience a tandem double [1,5]-H shift, the first one being the usual benzylic hydride transfer whereas the second one involves the methyl group at the initial benzylic carbon atom, the reaction products being 2-aminostyrenes. Diarylmethane-ketenimines lacking such a methyl group convert into 3,4-dihydroquinolines by the habitual tandem [1,5]-H shift/6
Extraction of Fragmentation Functions from Charged Kaon and Pion Production at COMPASS
Panknin, Regine Antje
Quark helicity distributions can be accessed by measuring spin asymmetries in polarised deep-inelastic scattering, but for a full flavour separation the precise knowledge of quark fragmentation functions is essential. Those can only be inf erred from experimental data, and are still poorly determined today. The few existing para metrisations of fragmentation functions are derived from world data (mainly on electron-positron annihilation), and often differ considerably, most notably for strange quarks. This thesis presents an independent evaluation of fragmentation functions from deep- inelastic scattering data recorded at the COMPASS experiment. A method of extraction was developed, based on the relation between hadron multiplicities, r h ( x, z ), unpolarised parton distribution functions, q ( x ), and quark fragmentation functions into hadrons, D h d ( z ). (In this work x stands for the Bjorken scaling variable, and z for the fraction of the quark momentum that is transferred to the pro duced hadron.) Mult...
Barbara, D J; Morton, A; Spence, N J; Miller, A
1995-09-01
Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.
Imaoka, Naruaki; Houferak, Camille; Murphy, Megan P; Nguyen, Huong T H; Dang, Andy; Tureček, František
2018-01-16
Peptide cation radicals of the z-type were produced by electron transfer dissociation (ETD) of peptide dications and studied by UV-Vis photodissociation (UVPD) action spectroscopy. Cation radicals containing the Asp (D), Asn (N), Glu (E), and Gln (Q) residues were found to spontaneously isomerize by hydrogen atom migrations upon ETD. Canonical N-terminal [z 4 + H] +● fragment ion-radicals of the R-C ● H-CONH- type, initially formed by N-C α bond cleavage, were found to be minor components of the stable ion fraction. Vibronically broadened UV-Vis absorption spectra were calculated by time-dependent density functional theory for several [ ● DAAR + H] + isomers and used to assign structures to the action spectra. The potential energy surface of [ ● DAAR + H] + isomers was mapped by ab initio and density functional theory calculations that revealed multiple isomerization pathways by hydrogen atom migrations. The transition-state energies for the isomerizations were found to be lower than the dissociation thresholds, accounting for the isomerization in non-dissociating ions. The facile isomerization in [ ● XAAR + H] + ions (X = D, N, E, and Q) was attributed to low-energy intermediates having the radical defect in the side chain that can promote hydrogen migration along backbone C α positions. A similar side-chain mediated mechanism is suggested for the facile intermolecular hydrogen migration between the c- and [z + H] ● -ETD fragments containing Asp, Asn, Glu, and Gln residues. Graphical Abstract ᅟ.
Imaoka, Naruaki; Houferak, Camille; Murphy, Megan P.; Nguyen, Huong T. H.; Dang, Andy; Tureček, František
2018-01-01
Peptide cation radicals of the z-type were produced by electron transfer dissociation (ETD) of peptide dications and studied by UV-Vis photodissociation (UVPD) action spectroscopy. Cation radicals containing the Asp (D), Asn (N), Glu (E), and Gln (Q) residues were found to spontaneously isomerize by hydrogen atom migrations upon ETD. Canonical N-terminal [z4 + H]+● fragment ion-radicals of the R-C●H-CONH- type, initially formed by N-Cα bond cleavage, were found to be minor components of the stable ion fraction. Vibronically broadened UV-Vis absorption spectra were calculated by time-dependent density functional theory for several [●DAAR + H]+ isomers and used to assign structures to the action spectra. The potential energy surface of [●DAAR + H]+ isomers was mapped by ab initio and density functional theory calculations that revealed multiple isomerization pathways by hydrogen atom migrations. The transition-state energies for the isomerizations were found to be lower than the dissociation thresholds, accounting for the isomerization in non-dissociating ions. The facile isomerization in [●XAAR + H]+ ions (X = D, N, E, and Q) was attributed to low-energy intermediates having the radical defect in the side chain that can promote hydrogen migration along backbone Cα positions. A similar side-chain mediated mechanism is suggested for the facile intermolecular hydrogen migration between the c- and [z + H]●-ETD fragments containing Asp, Asn, Glu, and Gln residues. [Figure not available: see fulltext.
International Nuclear Information System (INIS)
Furnica, Gh.
1980-01-01
The aqueous ecosystem of the Danube has been investigated in the period of 1976-1979. Data on the ecological transfer of radionuclides in the human food chain made an estimation available on the risk of the affected population. In the assessment of population exposure, the internal radiation dose for a period of one year and the continuous external irradiation determined by TLD have been considered. - The results revealed very low Sr-90 and Cs-137 contents in the Danube water and in the drinking water. The radioactivity contents are higher in the sediment and in some biota than in the water. The H-3 content in the Danube water varies in a wider range and higher concentration was found in fish than in the water. Both the Danube sediment and the irrigated sandy soil contain very low concentrations of fission products. During 1976-1979, the radioiodine content in air, milk and cow thyroid around the 679-Km is continuously decreasing. - Based on the data obtained, the corresponding collective dose equivalent value was calculated and the risk on the health of the population was found to be very low from contamination during 1975-1978. The radioactivity concentration values in critical human food chain, however, are not negligible. (author)
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
Modelling of 137Cs concentration change in organisms of the Japanese coastal food chains
International Nuclear Information System (INIS)
Tateda, Y.; Nakahara, M.; Nakamura, R.
1999-01-01
In order to predict 137 CS concentrations in marine organisms of Japanese coastal food chains, a basic compartment model being composed of nuclide transfer both from seawater and food chain was investigated. Food chain structure of typical Japanese coastal water is established to include detritus, food chain, benthic food chain and planktonic food chain
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
Cieluch, Ewelina; Pietryga, Krzysztof; Sarewicz, Marcin; Osyczka, Artur
2010-02-01
Cytochrome c(1) of Rhodobacter (Rba.) species provides a series of mutants which change barriers for electron transfer through the cofactor chains of cytochrome bc(1) by modifying heme c(1) redox midpoint potential. Analysis of post-flash electron distribution in such systems can provide useful information about the contribution of individual reactions to the overall electron flow. In Rba. capsulatus, the non-functional low-potential forms of cytochrome c(1) which are devoid of the disulfide bond naturally present in this protein revert spontaneously by introducing a second-site suppression (mutation A181T) that brings the potential of heme c(1) back to the functionally high levels, yet maintains it some 100 mV lower from the native value. Here we report that the disulfide and the mutation A181T can coexist in one protein but the mutation exerts a dominant effect on the redox properties of heme c(1) and the potential remains at the same lower value as in the disulfide-free form. This establishes effective means to modify a barrier for electron transfer between the FeS cluster and heme c(1) without breaking disulfide. A comparison of the flash-induced electron transfers in native and mutated cytochrome bc(1) revealed significant differences in the post-flash equilibrium distribution of electrons only when the connection of the chains with the quinone pool was interrupted at the level of either of the catalytic sites by the use of specific inhibitors, antimycin or myxothiazol. In the non-inhibited system no such differences were observed. We explain the results using a kinetic model in which a shift in the equilibrium of one reaction influences the equilibrium of all remaining reactions in the cofactor chains. It follows a rather simple description in which the direction of electron flow through the coupled chains of cytochrome bc(1) exclusively depends on the rates of all reversible partial reactions, including the Q/QH2 exchange rate to/from the catalytic sites
High-fidelity state transfer over an unmodulated linear XY spin chain
International Nuclear Information System (INIS)
Bishop, C. Allen; Ou Yongcheng; Byrd, Mark S.; Wang Zhaoming
2010-01-01
We provide a class of initial encodings that can be sent with a high fidelity over an unmodulated, linear, XY spin chain. As an example, an average fidelity of 96% can be obtained using an 11-spin encoding to transmit a state over a chain containing 10 000 spins. An analysis of the magnetic-field dependence is given, and conditions for field optimization are provided.
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
Fairbanks, Benjamin D; Gunatillake, Pathiraja A; Meagher, Laurence
2015-08-30
RAFT- mediated polymerization, providing control over polymer length and architecture as well as facilitating post polymerization modification of end groups, has been applied to virtually every facet of biomedical materials research. RAFT polymers have seen particularly extensive use in drug delivery research. Facile generation of functional and telechelic polymers permits straightforward conjugation to many therapeutic compounds while synthesis of amphiphilic block copolymers via RAFT allows for the generation of self-assembled structures capable of carrying therapeutic payloads. With the large and growing body of literature employing RAFT polymers as drug delivery aids and vehicles, concern over the potential toxicity of RAFT derived polymers has been raised. While literature exploring this complication is relatively limited, the emerging consensus may be summed up in three parts: toxicity of polymers generated with dithiobenzoate RAFT agents is observed at high concentrations but not with polymers generated with trithiocarbonate RAFT agents; even for polymers generated with dithiobenzoate RAFT agents, most reported applications call for concentrations well below the toxicity threshold; and RAFT end-groups may be easily removed via any of a variety of techniques that leave the polymer with no intrinsic toxicity attributable to the mechanism of polymerization. The low toxicity of RAFT-derived polymers and the ability to remove end groups via straightforward and scalable processes make RAFT technology a valuable tool for practically any application in which a polymer of defined molecular weight and architecture is desired. Copyright © 2015. Published by Elsevier B.V.
A reconsideration of fission fragment angular distributions from nuclei of high spin
International Nuclear Information System (INIS)
Vaz, L.C.; Alexander, J.M.
1983-01-01
It has often been stated that fission fragment angular anisotropy, as predicted by equilibrium statistical theory, should disappear with increasing spin of the composite nucleus. However, several recent experimental studies reveal strong anisotropies for fission fragments from high-spin nuclear systems. We discuss this apparent discrepancy and its relationship to the rigid-rotor approximation used in the standard theory. A systematic comparison is given for fission fragment anisotropies from many experiments via the empirical parameters K 0 2 and Ssub(eff). These systematics indicate a strong regularity, provided one allows for the perturbing effects of fission after transfer reactions. Many of the observed anisotropies exceed the predictions of the standard theory, but, as these predictions are based on a rigid rotor model, this does not seem particularly noteworthy. (orig.)
International Nuclear Information System (INIS)
Light, K.J.; Loo, J.A.; Edmonds, C.G.; Smith, R.D.
1991-06-01
Electrospray ionization mass spectroscopy (ESI-MS) is rapidly becoming a practical biochemical tool for peptide and protein sequence analysis. The utility of ESI-MS is through use of Collisionally Activated Dissociation (ESI-CAD-MS). Human hemoglobin (Hb, ∼62 kDa) consists of four polypeptide chains and a prosthetic heme group. There are over 400 Hb variants, characterized by amino acid substitutions in either the alpha or beta polypeptide chains. We investigated ESI-CAD-MS as a tool for rapidly analyzing amino acid substitutions, using eight Hb beta chain variants. The approximate location of the modification can be deduced from comparison of the CAD mass spectra and observance of the mass shifts of the fragment ion containing the substitution. Fragmentation occurs preferentially at the amino terminus of proline residues. For most substitutions, differences in CAD mass spectra were not seen. 2 figs
Nature of defects produced on thymine fragment by gamma irradiation of DNA
International Nuclear Information System (INIS)
Teoule, R.; Bonicel, A.
1975-01-01
A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions
Amplifier channel for a fission fragment semiconductor detector
International Nuclear Information System (INIS)
Tyurin, G.P.
1981-01-01
To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru
Harvey, David J
2005-01-01
Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.
Goldstein, G R
2001-01-01
Spin dependent fragmentation functions for heavy flavor quarks to fragment into heavy baryons are calculated in a quark-diquark model. The production of intermediate spin 1/2 and 3/2 excited states is explicity included. $\\Lambda_b$ , $\\Lambda_c$ and $\\Xi_c$ production rate and polarization at LEP energies are calculated and, where possible, compared with experiment. A different approach, also relying on a heavy quark-diquark model, is proposed for the small momentum transfer inclusive production of polarized heavy flavor hyperons. The predicted $\\Lambda_c$ polarization is roughly in agreement with experiment.
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
Directory of Open Access Journals (Sweden)
Tzu-Li Lu
2011-01-01
Full Text Available Type-2 ribosome-inactivating proteins, composed of a toxic A-chain and lectin-like B-chain, display various biological functions, including cytotoxicity and immunomodulation. We here cloned the lectin-like B-chain encoding fragment of a newly identified type-2 RIP gene, articulatin gene, from Viscum articulatum, into a bacterial expression vector to obtain nonglycosylated recombinant protein expressed in inclusion bodies. After purification and protein refolding, soluble refolded recombinant articulatin B-chain (rATB showed lectin activity specific toward galactoside moiety and was stably maintained while stored in low ionic strength solution. Despite lacking glycosylation, rATB actively bound leukocytes with preferential binding to monocytes and in vitro stimulated PBMCs to release cytokines without obvious cytotoxicity. These results implicated such a B-chain fragment as a potential immunomodulator.
Coincidence study of alpha particle fragmentation at E/sub alpha/ = 140 MeV
International Nuclear Information System (INIS)
Koontz, R.W.
1980-01-01
Results of an experimental study of the interaction of 140 MeV alpha particles with 90 Zr nuclei resulting in fragmentation of the alpha particle are reported. The experimental observations of the study are analyzed and are found to show that alpha particle breakup reactions leading to at least 4-body final states, composed of two charged alpha particle fragments, contribute significantly to the singles yield of charged fragments observed at a fixed forward angle. The conclusions are based on coincidence measurements where one charged fragment is detected at a small forward angle which remains fixed, while the second charged fragment is detected at a series of coplanar secondary angles. The largest coincidence charged particle yield for the multiparticle final state events results from 90 Zr(α,pp)X reactions, where both of the measured protons have energy distributions similar to the proton singles energy distributions. The second largest observed coincidence yield involving two charged fragments arises from 90 Zr(α,pd)X reactions, where the p and d fragments, as in the 90 Zr(α,pp)X reactions also have energy distribution similar to the singles energy distributions. Analysis of additional measurements, where alpha particle fragments at the fixed angle are detected in coincidence with evaporation and nonequilibrium particles at many coplanar angles, show that the alpha particle fragmentation reactions are also generally associated with large energy transfer to the target nucleus. A multiple scattering model of the fragmentation reaction is employed, in conjunction with the experimental observations, to estimate the cross sections for alpha particle fragmentation into multi-particle final states resulting in n, 2n, p, pp, d, dn, dp, t and 3 He fragments. The estimated total cross section for all fragmentation reactions is 755 mb or approximately 38% of the total reaction cross section for 140 MeV alpha particle interactions with 90 Zr
International Nuclear Information System (INIS)
Kawata, Y.; Goto, Y.; Hamaguchi, K.; Hayashi, F.; Kobayashi, Y.; Kyogoku, Y.
1988-01-01
The constant fragment of the immunoglobulin light chain (type λ) has two trytophyl residues at positions 150 and 187. Trp-150 is buried in the interior, and Trp-187 lies on the surface of the molecule. The hydrogen-deuterium exchange kinetics of the indole NH proton Trp-150 were studied at various pH values at 25 0 C by 1 H nuclear magnetic resonance. Exchange rates were approximately first order in hydroxyl ion dependence above pH 8, were relatively independent of pH between pH 7 and 8, and decreased below pH 7. On the assumption that the exchange above pH 8 proceeds through local fluctuations of the protein molecule, the exchange rates between pH 7 and 8 through global unfolding were estimated. The exchange rate constant within this pH range at 25 0 C thus estimated was consistent with that of the global unfolding of the constant fragment under the same conditions as those reported previously. The activation energy for the exchange process at pH 7.8 was the same as that for the unfolding process by 2 M guanidine hydrochloride. The exchange rates of backbone NH protons were almost the same as that of the indole NH proton of Trp-150 at pH 7.l. These observations also indicated that the exchange between pH 7 and 8 occurs through global unfolding of the protein molecule and is rate-limited by the unfolding. At around pH 9, on the other hand, the activation energy for the exchange process of the indole NH proton of Trp-150 was smaller than that for the unfolding process, and the exchange rates differed according to the different signals of backbone NH protons. These findings together with the pH dependence of the rate constant indicated that exchange due to local fluctuations is predominant above pH 8
Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe
2016-05-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.
Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe
2016-01-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825
Supply Chain Coordination and Consumer Awareness for Pollution Reduction
Directory of Open Access Journals (Sweden)
Bowon Kim
2016-04-01
Full Text Available To understand the dynamics of the manufacturer’s effort to reduce pollution in a supply chain consisting of manufacturer, retailer, and consumers, we analyze four cases according to consumer awareness of the pollution’s harmful effect, i.e., environmentally aware versus ignorant, and supply chain coordination, i.e., competitive versus cooperative. Applying differential games, we derive managerial implications: the most significant is that the supply chain coordination strategy becomes irrelevant to reducing the pollution, if the consumers are not environmentally aware or sensitive enough. It highlights the critical role played by the consumer awareness in curbing the pollution in the supply chain. In addition, we find the transfer price and the potential market size are important factors to determine each case’s relative effectiveness. Under a regular condition, where the transfer price from the retailer to the manufacturer is sufficiently high, the consumer-aware and competitive case can generate a better outcome in reducing the pollution than those with ignorant consumers. However, the opposite might occur if the transfer price is excessively low, giving the manufacturer little motivation to make an effort to reduce the pollution. For the cooperative supply chain, it is the potential market size that determines whether the consumer-aware case is better than the consumer-ignorant. In fact, it turns out that there is a stronger result, i.e., the feasibility condition enforces that the market is always big enough to make the consumer-aware cooperative case better than the consumer-ignorant cases. We further discuss managerial as well as policy implications of these analysis outcomes.
Analysing global value chains using input-output economics : proceed with care
Nomaler, Z.O.; Verspagen, B.
2014-01-01
Input-output economics has become a popular tool to analyse the international fragmentation of value chains, especially now that several multi-regional tables that cover large parts of the global economy have become available. It has been argued that these tables, when analysed with the help of the
Analysing global value chains using input-output economics: Proceed with care
Nomaler, Ö.; Verspagen, B.
2014-01-01
Input-output economics has become a popular tool to analyse the international fragmentation of value chains, especially now that several multi-regional tables that cover large parts of the global economy have become available. It has been argued that these tables, when analysed with the help of the
Horizontal gene transfer between Wolbachia and the mosquito Aedes aegypti
Directory of Open Access Journals (Sweden)
Walker Thomas
2009-01-01
Full Text Available Abstract Background The evolutionary importance of horizontal gene transfer (HGT from Wolbachia endosymbiotic bacteria to their eukaryotic hosts is a topic of considerable interest and debate. Recent transfers of genome fragments from Wolbachia into insect chromosomes have been reported, but it has been argued that these fragments may be on an evolutionary trajectory to degradation and loss. Results We have discovered a case of HGT, involving two adjacent genes, between the genomes of Wolbachia and the currently Wolbachia-uninfected mosquito Aedes aegypti, an important human disease vector. The lower level of sequence identity between Wolbachia and insect, the transcription of all the genes involved, and the fact that we have identified homologs of the two genes in another Aedes species (Ae. mascarensis, suggest that these genes are being expressed after an extended evolutionary period since horizontal transfer, and therefore that the transfer has functional significance. The association of these genes with Wolbachia prophage regions also provides a mechanism for the transfer. Conclusion The data support the argument that HGT between Wolbachia endosymbiotic bacteria and their hosts has produced evolutionary innovation.
Trophic transfer of naturally produced brominated aromatic compounds in a Baltic Sea food chain.
Dahlgren, Elin; Lindqvist, Dennis; Dahlgren, Henrik; Asplund, Lillemor; Lehtilä, Kari
2016-02-01
Brominated aromatic compounds (BACs) are widely distributed in the marine environment. Some of these compounds are highly toxic, such as certain hydroxylated polybrominated diphenyl ethers (OH-PBDEs). In addition to anthropogenic emissions through use of BACs as e.g. flame retardants, BACs are natural products formed by marine organisms such as algae, sponges, and cyanobacteria. Little is known of the transfer of BACs from natural producers and further up in the trophic food chain. In this study it was observed that total sum of methoxylated polybrominated diphenyl ethers (MeO-PBDEs) and OH-PBDEs increased in concentration from the filamentous red alga Ceramium tenuicorne, via Gammarus sp. and three-spined stickleback (Gasterosteus aculeatus) to perch (Perca fluviatilis). The MeO-PBDEs, which were expected to bioaccumulate, increased in concentration accordingly up to perch, where the levels suddenly dropped dramatically. The opposite pattern was observed for OH-PBDEs, where the concentration exhibited a general trend of decline up the food web, but increased in perch, indicating metabolic demethylation of MeO-PBDEs. Debromination was also indicated to occur when progressing through the food chain resulting in high levels of tetra-brominated MeO-PBDE and OH-PBDE congeners in fish, while some penta- and hexa-brominated congeners were observed to be the dominant products in the alga. As it has been shown that OH-PBDEs are potent disruptors of oxidative phosphorylation and that mixtures of different congener may act synergistically in terms of this toxic mode of action, the high levels of OH-PBDEs detected in perch in this study warrants further investigation into potential effects of these compounds on Baltic wildlife, and monitoring of their levels. Copyright © 2015 Elsevier Ltd. All rights reserved.
Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.
2018-03-01
It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.
The Bullwhip Effect: Concretization of Entropic Information Dissipation in Supply Chain Systems
Directory of Open Access Journals (Sweden)
Tarik Saikouk
2012-08-01
Full Text Available Supply chains represent complex and dynamic systems that incorporate autonomous firms interacting with one another to fulfill a common goal, while insuring their own ones. These firms’ behaviors are considered to be non-linear and sometimes unpredictable. This makes information transfer in the supply chain complex and causes instability when information transferred is incomplete or incorrect. This instability is characterized by the Bullwhip Effect that represents concretization of entropy, namely the degree of disorder within a system. In this paper we develop a new analytical approach assuming that the bullwhip effect is a consequence of the entropy of the supply chain system that is represented by information dissipation.
Coupled motions direct electrons along human microsomal P450 Chains.
Directory of Open Access Journals (Sweden)
Christopher R Pudney
2011-12-01
Full Text Available Protein domain motion is often implicated in biological electron transfer, but the general significance of motion is not clear. Motion has been implicated in the transfer of electrons from human cytochrome P450 reductase (CPR to all microsomal cytochrome P450s (CYPs. Our hypothesis is that tight coupling of motion with enzyme chemistry can signal "ready and waiting" states for electron transfer from CPR to downstream CYPs and support vectorial electron transfer across complex redox chains. We developed a novel approach to study the time-dependence of dynamical change during catalysis that reports on the changing conformational states of CPR. FRET was linked to stopped-flow studies of electron transfer in CPR that contains donor-acceptor fluorophores on the enzyme surface. Open and closed states of CPR were correlated with key steps in the catalytic cycle which demonstrated how redox chemistry and NADPH binding drive successive opening and closing of the enzyme. Specifically, we provide evidence that reduction of the flavin moieties in CPR induces CPR opening, whereas ligand binding induces CPR closing. A dynamic reaction cycle was created in which CPR optimizes internal electron transfer between flavin cofactors by adopting closed states and signals "ready and waiting" conformations to partner CYP enzymes by adopting more open states. This complex, temporal control of enzyme motion is used to catalyze directional electron transfer from NADPH→FAD→FMN→heme, thereby facilitating all microsomal P450-catalysed reactions. Motions critical to the broader biological functions of CPR are tightly coupled to enzyme chemistry in the human NADPH-CPR-CYP redox chain. That redox chemistry alone is sufficient to drive functionally necessary, large-scale conformational change is remarkable. Rather than relying on stochastic conformational sampling, our study highlights a need for tight coupling of motion to enzyme chemistry to give vectorial electron
Precast Pearl-Chain concrete arch bridges
DEFF Research Database (Denmark)
Halding, Philip Skov; Hertz, Kristian Dahl; Schmidt, Jacob Wittrup
2015-01-01
A Pearl-Chain Bridge is a closed-spandrel arch bridge consisting of a number of straight pre-fabricated so called Super-Light Deck elements put together in an arch shape by post-tensioning cables. Several Pearl-Chain arches can be positioned adjacent to each other by a crane to achieve a bridge...... of a desired width. On top of the arch is a filling material to level out the surface of the above road. The filling only transfers vertical loads to the arch. The geometry and material properties of Super-Light Decks are presented, and we refer to several fullscale tests of Pearl-Chain arches where...... the technology was used. We also study other important components and details in the Pearl-Chain Bridge concept and review the effects of different types of loads. A theoretical case study of a circular 30 m span Pearl-Chain Bridge is presented showing the influence of a number of parameters: The number of post...
Directory of Open Access Journals (Sweden)
Patrícia Carvalho de Sequeira
2005-11-01
Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.
Huls, GA; Heijnen, IAFM; Cuomo, ME; Koningsberger, JC; Boel, E; de Vries, ARV; Loyson, SAJ; Helfrich, W; Henegouwen, GPV; van Meijer, M; de Kruif, J; Logtenberg, T
A single-chain Fv antibody fragment specific for the tumor-associated Ep-CAM molecule was isolated from a semisynthetic phage display library and converted into an intact, fully human IgG1 monoclonal antibody (huMab), The purified huMab had an affinity of 5 nM and effectively mediated tumor cell
Universal elements of fragmentation
International Nuclear Information System (INIS)
Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.
2010-01-01
A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.
International Nuclear Information System (INIS)
1976-01-01
In the period 1972-1975, the EURATOM-CEA Association continued its research in the following fields: human biology, study of iodine metabolism and its variability, study of the mineral composition of the human body. Transfers of contamination from sources of pollution to man - dry and moist deposits of iodine on grass - transfers of Cr, Zn and Cd in aquatic chains - transfers of heavy metals in marine chains - transfers of iodine and mercury from soil and sediments - transfers in foodstuffs during processing and distribution. Studies of the assessment of the radiological capacity of the environment and methods of assessing individual and collective doses [fr
Energy Technology Data Exchange (ETDEWEB)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan
2016-11-15
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
International Nuclear Information System (INIS)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan
2016-01-01
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
Energy Technology Data Exchange (ETDEWEB)
Brown, J. [National Radiological Protection Board (United Kingdom); Goossens, L.H.J.; Kraan, B.C.P. [Delft Univ. of Technology (Netherlands)] [and others
1997-06-01
This volume is the second of a two-volume document that summarizes a joint project by the US Nuclear Regulatory and the Commission of European Communities to assess uncertainties in the MACCS and COSYMA probabilistic accident consequence codes. These codes were developed primarily for estimating the risks presented by nuclear reactors based on postulated frequencies and magnitudes of potential accidents. This two-volume report, which examines mechanisms and uncertainties of transfer through the food chain, is the first in a series of five such reports. A panel of sixteen experts was formed to compile credible and traceable uncertainty distributions for food chain transfer that affect calculations of offsite radiological consequences. Seven of the experts reported on transfer into the food chain through soil and plants, nine reported on transfer via food products from animals, and two reported on both. The expert judgment elicitation procedure and its outcomes are described in these volumes. This volume contains seven appendices. Appendix A presents a brief discussion of the MAACS and COSYMA model codes. Appendix B is the structure document and elicitation questionnaire for the expert panel on soils and plants. Appendix C presents the rationales and responses of each of the members of the soils and plants expert panel. Appendix D is the structure document and elicitation questionnaire for the expert panel on animal transfer. The rationales and responses of each of the experts on animal transfer are given in Appendix E. Brief biographies of the food chain expert panel members are provided in Appendix F. Aggregated results of expert responses are presented in graph format in Appendix G.
International Nuclear Information System (INIS)
Brown, J.; Goossens, L.H.J.; Kraan, B.C.P.
1997-06-01
This volume is the second of a two-volume document that summarizes a joint project by the US Nuclear Regulatory and the Commission of European Communities to assess uncertainties in the MACCS and COSYMA probabilistic accident consequence codes. These codes were developed primarily for estimating the risks presented by nuclear reactors based on postulated frequencies and magnitudes of potential accidents. This two-volume report, which examines mechanisms and uncertainties of transfer through the food chain, is the first in a series of five such reports. A panel of sixteen experts was formed to compile credible and traceable uncertainty distributions for food chain transfer that affect calculations of offsite radiological consequences. Seven of the experts reported on transfer into the food chain through soil and plants, nine reported on transfer via food products from animals, and two reported on both. The expert judgment elicitation procedure and its outcomes are described in these volumes. This volume contains seven appendices. Appendix A presents a brief discussion of the MAACS and COSYMA model codes. Appendix B is the structure document and elicitation questionnaire for the expert panel on soils and plants. Appendix C presents the rationales and responses of each of the members of the soils and plants expert panel. Appendix D is the structure document and elicitation questionnaire for the expert panel on animal transfer. The rationales and responses of each of the experts on animal transfer are given in Appendix E. Brief biographies of the food chain expert panel members are provided in Appendix F. Aggregated results of expert responses are presented in graph format in Appendix G
Fragmentation characteristics of hydroxycinnamic acids in ESI-MSn by density functional theory.
Yin, Zhi-Hui; Sun, Chang-Hai; Fang, Hong-Zhuang
2017-07-01
This work aims to analyze the electrospray ionization multistage mass spectrometry (ESI-MS n ) fragmentation characteristics of hydroxycinnamic acids (HCAs) in negative ion mode. The geometric parameters, energies, natural bond orbitals and frontier orbitals of fragments were calculated by density functional theory (DFT) to investigate mass spectral fragmentation mechanisms. The results showed that proton transfer always occurred during fragmentation of HCAs; their quasi-molecular ions ([M - H] - ) existed in more than one form and were mainly with the lowest energy. The fragmentation characteristics included the followings: (1) according to the different substitution position of phenolic hydroxyl group, the ring contraction reaction by CO elimination from benzene was in an increasingly difficult order: m-phenolic hydroxyl > p-phenolic hydroxyl > o-phenolic hydroxyl; and (2) ortho effect always occurred in o-dihydroxycinnamic acids (o-diHCAs), i.e. one phenolic hydroxyl group offered H + , which combined with the other one to lose H 2 O. In addition, there was a nucleophilic reaction during ring contraction in diHCAs that oxygen atom attacked the carbon atom binding with the other phenolic hydroxyl to lose CO 2 . The fragmentation characteristics and mechanism of HCAs could be used for analysis and identification of such compounds quickly and effectively, and as reference for structural analogues by ESI-MS. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Influence of external magnetic field on laser-induced gold nanoparticles fragmentation
International Nuclear Information System (INIS)
Serkov, A. A.; Rakov, I. I.; Simakin, A. V.; Kuzmin, P. G.; Shafeev, G. A.; Mikhailova, G. N.; Antonova, L. Kh.; Troitskii, A. V.; Kuzmin, G. P.
2016-01-01
Laser-assisted fragmentation is an efficient method of the nanoparticles size and morphology control. However, its exact mechanisms are still under consideration. One of the remaining problems is the plasma formation, inevitably occurring upon the high intensity laser irradiation. In this Letter, the role of the laser-induced plasma is studied via introduction of high-intensity external magnetic field (up to 7.5 T). Its presence is found to cause the plasma emission to start earlier regarding to a laser pulse, also increasing the plume luminosity. Under these conditions, the acceleration of nanoparticles fragmentation down to a few nanometers is observed. Laser-induced plasma interaction with magnetic field and consequent energy transfer from plasma to nanoparticles are discussed.
Complete isotopic distributions of fragments produced in transfer- and fusion-induced reactions
International Nuclear Information System (INIS)
Delaune, O.; Caamano, M.; Farget, F.; Tarasov, O. B.; Derkx, X.; Schmidt, K. H.; Audouin, L.; Amthor, A. M.; Bacri, C. O.; Barreau, G.; Bastin, B.; Bazin, D.; Benlliure, J.; Blank, B.; Caceres, L.; Casarejos, E.; Fernandez-Dominguez, B.; Gaudefroy, L.; Golabek, C.; Grevy, S.; Jurado, B.; Kamalou, O.; Lemasson, A.; Lukyanov, S. M.; Mittig, W.; Morrissey, D. J.; Navin, A.; Pereira, J.; Perrot, L.; Rejmund, M.; Roger, T.; Saint-Laurent, M. G.; Savajols, H.; Schmitt, C.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C. C.
2013-01-01
Two fission experiments have been performed at GANIL using 238 U beams at different energies and light targets. Different fissioning systems were produced with centre of mass energies from 10 to 240 MeV and their decay by fission was investigated with GANIL spectrometers. Fission-fragment isotopic distributions have been obtained. The evolution with impinging energy of their properties, the neutron excess and the width of the neutron-number distributions, gives important insights into the dynamics of the fusion-fission mechanism. (authors)
The Kinetic Chain Revisited: New Concepts on Throwing Mechanics and Injury.
Chu, Samuel K; Jayabalan, Prakash; Kibler, W Ben; Press, Joel
2016-03-01
The overhead throwing motion is a complex activity that is achieved through activation of the kinetic chain. The kinetic chain refers to the linkage of multiple segments of the body that allows for transfer of forces and motion. The lower extremities and core provide a base of support, generating energy that is transferred eventually through the throwing arm and hand, resulting in release of the ball. The kinetic chain requires optimal anatomy, physiology, and mechanics and is involved in all 6 phases of overhead throwing: windup, stride, arm cocking, acceleration, deceleration, and follow-through. Breaks or deficits in the kinetic chain can lead to injury or decreased performance. Through an understanding of the mechanics and pathomechanics seen in each phase of throwing, the clinician can better evaluate and screen for potential kinetic chain deficits in the overhead throwing athlete. The purpose of this article is to review the biomechanics of the overhead throwing motion, the role of the kinetic chain in throwing, and the clinical evaluation and management of abnormal throwing mechanics and related injuries. Copyright © 2016 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.
Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F
1999-03-09
The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.
van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.
2018-03-01
Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
Supply chain optimization by implementation of modern ICT
Directory of Open Access Journals (Sweden)
Soldat Drago S.
2014-01-01
Full Text Available This paper deals with most important techniques used for supply chain management including the latest applications and program tools intended for companies that do business in transport and logistics. The main goal of these technologies is management coherent data and exchange of information between companies and business units within the supply chain. The expansion of modern e-logistics applications transfers from private networks to Internet has been noticed in recent few years. Market globalization and e-business implementation have positioned portal as key element gathering employers, employees, business partners and end users P/S - main participants in every supply chain - by mutual interface. Thus, portals are often called mega portals of -supply chains.
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Control of Chain Walking by Weak Neighbouring Group Interac-tions in Unsymmetric Catalysts
Falivene, Laura; Wiedemann, Thomas; Gö ttker-Schnetmann, Inigo; Caporaso, Lucia; Cavallo, Luigi; Mecking, Stefan
2017-01-01
A combined theoretical and experimental study shows how weak attractive interactions of a neighbouring group can strongly promote chain walking and chain transfer. This accounts for the previously observed very different micro-structures obtained
Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli
2015-04-30
Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
Universality of fragment shapes.
Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea
2015-03-16
The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.
Dimer coverings on random multiple chains of planar honeycomb lattices
International Nuclear Information System (INIS)
Ren, Haizhen; Zhang, Fuji; Qian, Jianguo
2012-01-01
We study dimer coverings on random multiple chains. A multiple chain is a planar honeycomb lattice constructed by successively fusing copies of a ‘straight’ condensed hexagonal chain at the bottom of the previous one in two possible ways. A random multiple chain is then generated by admitting the Bernoulli distribution on the two types of fusing, which describes a zeroth-order Markov process. We determine the expectation of the number of the pure dimer coverings (perfect matchings) over the ensemble of random multiple chains by the transfer matrix approach. Our result shows that, with only two exceptions, the average of the logarithm of this expectation (i.e., the annealed entropy per dimer) is asymptotically nonzero when the fusing process goes to infinity and the length of the hexagonal chain is fixed, though it is zero when the fusing process and the length of the hexagonal chain go to infinity simultaneously. Some numerical results are provided to support our conclusion, from which we can see that the asymptotic behavior fits well to the theoretical results. We also apply the transfer matrix approach to the quenched entropy and reveal that the quenched entropy of random multiple chains has a close connection with the well-known Lyapunov exponent of random matrices. Using the theory of Lyapunov exponents we show that, for some random multiple chains, the quenched entropy per dimer is strictly smaller than the annealed one when the fusing process goes to infinity. Finally, we determine the expectation of the free energy per dimer over the ensemble of the random multiple chains in which the three types of dimers in different orientations are distinguished, and specify a series of non-random multiple chains whose free energy per dimer is asymptotically equal to this expectation. (paper)
Fragmentation of molten copper drop caused by entrapment of liquid sodium
International Nuclear Information System (INIS)
Abe, N.; Sugiyama, K.; Nishimura, S.; Kinoshita, I.
2001-01-01
In core meltdown accidents, it is possible to occur thermal interactions between molten fuel and coolant. Analysis of the steam explosion, which is one of the most severe phenomena in such thermal interactions, is important for the safety evaluation. The steam explosion is a phenomenon that intensive pressure waves are caused by the explosive thermal interaction between high and low temperature liquids, and is considered to be one of the phenomena that can cause a serious failure of the nuclear reactor structures. In a large-scale steam explosion, the fragmentation of hot molten material causes a rapid increase of heat transfer area, and it is achieved to transmit instantaneously a large amount of heat to coolant. Two ideas are chiefly considered as the mechanism of the fragmentation. The one is the hypothesis that hydrodynamic effect causes fragmentation of hot liquid. According to this hypothesis, the high temperature drops flake off from the surface. The other is that fragmentation is caused by the interface instability accompanied by collapse of the steam bubble formed around a hot liquid. In this research, the possibility of the internal fragmentation caused by the coolant jet is focused in. Experiments were conducted on the condition that the surface of melt drops solidify at the moment drops contact the coolant. The possibility of the fragmentation of hot liquid from its surface was eliminated in this condition. To satisfy this condition, molten copper was chosen as hot liquid, and liquid sodium was used as coolant to verify the effect of the driving force of the sodium jet. (author)
An efficient algorithm to perform local concerted movements of a chain molecule.
Directory of Open Access Journals (Sweden)
Stefano Zamuner
Full Text Available The devising of efficient concerted rotation moves that modify only selected local portions of chain molecules is a long studied problem. Possible applications range from speeding the uncorrelated sampling of polymeric dense systems to loop reconstruction and structure refinement in protein modeling. Here, we propose and validate, on a few pedagogical examples, a novel numerical strategy that generalizes the notion of concerted rotation. The usage of the Denavit-Hartenberg parameters for chain description allows all possible choices for the subset of degrees of freedom to be modified in the move. They can be arbitrarily distributed along the chain and can be distanced between consecutive monomers as well. The efficiency of the methodology capitalizes on the inherent geometrical structure of the manifold defined by all chain configurations compatible with the fixed degrees of freedom. The chain portion to be moved is first opened along a direction chosen in the tangent space to the manifold, and then closed in the orthogonal space. As a consequence, in Monte Carlo simulations detailed balance is easily enforced without the need of using Jacobian reweighting. Moreover, the relative fluctuations of the degrees of freedom involved in the move can be easily tuned. We show different applications: the manifold of possible configurations is explored in a very efficient way for a protein fragment and for a cyclic molecule; the "local backbone volume", related to the volume spanned by the manifold, reproduces the mobility profile of all-α helical proteins; the refinement of small protein fragments with different secondary structures is addressed. The presented results suggest our methodology as a valuable exploration and sampling tool in the context of bio-molecular simulations.
Thermoresponsive AuNPs Stabilized by Pillararene-Containing Polymers.
Liao, Xiaojuan; Guo, Lei; Chang, Junxia; Liu, Sha; Xie, Meiran; Chen, Guosong
2015-08-01
Pillararene-containing thermoresponsive polymers are synthesized via reversible addition-fragmentation chain transfer polymerization using pillararene derivatives as the effective chain transfer agents for the first time. These polymers can self-assemble into micelles and form vesicles after guest molecules are added. Furthermore, such functional polymers can be further applied to prepare hybrid gold nanoparticles, which integrate the thermoresponsivity of polymers and molecular recognition of pillararenes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Environmental behaviour of radionuclides and transfer to man
International Nuclear Information System (INIS)
Smith, H.
1982-01-01
The environmental behaviour of the radionuclides making the major contribution to man's irradiation through diet is described. The following stages are emphasized: transfer of radionuclides to plants; transfer of radionuclides to animals; metabolism of inhaled or ingested radionuclides in animals providing food for man; transfer of radionuclides through the aquatic environment; application of food chain models. (43 references)
International Nuclear Information System (INIS)
Karmanov, V.A.
1983-01-01
Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative
Electron spin resonance of gamma, electron, neutron and fission fragments irradiated K2SO4
International Nuclear Information System (INIS)
Kamali, J.; Walton, G.N.
1985-01-01
The electron spin resonance (ESR) of K 2 SO 4 irradiated by γ, electron, neutron and fission fragments has been investigated. The ESR spectra are attributed mainly to the formation of SO 3 - , SO 4 - , SO 2 - , and O 3 - radical ions. The most intense radical ion observed was due to the SO 3 - , and the other radicals were relatively much lower in intensity. Thermal annealing showed a significant decrease in the concentration of radical ions. The concentration of SO 3 - was measured in γ-irradiated K 2 SO 4 and K 2 SO 4 containing fission fragments. In fission fragments irradiated K 2 SO 4 , the G-value observed for SO 3 - radical formation was about eight times higher than that of γ-irradiated K 2 SO 4 . This was attributed to the high LET (Linear Energy Transfer) of the fission fragments. (author)
Magnetization processes in quantum spin chains with regularly alternating intersite interactions
International Nuclear Information System (INIS)
Derzhko, O.
2001-01-01
We consider the dependence of magnetization on field at zero temperature for spin-1/2 chains in which intersite interactions regularly vary from site to site with period p. In the limiting case, where the smallest value of the intersite interactions tends to zero, the chain splits into noninteracting identical fragments of p sites and the dependence of magnetization on field can be examined rigorously. We comment on the influence of an anisotropy in the inter spin interaction on the magnetization profiles. Finally, we show how the case of a nonzero smallest value of the intersite interactions can be considered
Fragmentation of deuteronated aromatic derivatives: The role of ion-neutral complexes
Harrison, Alex G.; Wang, Jian-Yao
1997-01-01
The low-energy collision-induced dissociation reactions of the MD+ ions of a number of alkyl phenyl ethers, alkylbenzenes, acetophenones and benzaldehyde have been studied as a function of collision energy to establish qualitatively the dependence of the fragmentation reactions observed on internal energy. Deuteronated alkyl phenyl ethers (ROC6H5·D+, R = C3H7, C4H9) fragment at low collision energies to form C6H5OHD+ + (R-H), the thermochemically favoured products; with increasing collision energy (and, hence, internal energy) formation of the alkyl ion R+ increases significantly in importance. Deuteronated alkylbenzenes (RC6H5, RC6H4R', R = C2H5, C3H7) similarly form the deuteronated benzene (the thermochemically favoured product) at low collision energies with formation of the alkyl ion R+ being observed at higher collision energies. The results for both systems are consistent with a fragmentation mechanism involving initial formation of an R+/aromatic ion/neutral complex. At low internal energies proton transfer occurs within this complex to form an ion/neutral complex consisting of the deuteronated aromatic and a neutral olefin; this complex fragments to the thermochemically favoured products. Since the transition state leading to these products is a "tight" transition state involving loss of rotational degrees of freedom, the proton transfer reaction is unfavourable entropically with respect to simple dissociation of the R+/aromatic complex to R+ + ArD. Consequently, these products increase in importance as the internal energy is increased. The fragmentation of deuteronated aromatic carbonyl compounds can also be rationalized by similar mechanisms involving the intermediacy of ion/neutral complexes. Deuteronated acetophenone forms only CH3CO+ at all collision energies; this is both the thermochemically and entropically favoured product. However, deuteronated p-aminoacetophenone forms deuteronated aniline, the thermochemically favoured product at low collision
Lau, Wan F.; Withka, Jane M.; Hepworth, David; Magee, Thomas V.; Du, Yuhua J.; Bakken, Gregory A.; Miller, Michael D.; Hendsch, Zachary S.; Thanabal, Venkataraman; Kolodziej, Steve A.; Xing, Li; Hu, Qiyue; Narasimhan, Lakshmi S.; Love, Robert; Charlton, Maura E.; Hughes, Samantha; van Hoorn, Willem P.; Mills, James E.
2011-07-01
Fragment Based Drug Discovery (FBDD) continues to advance as an efficient and alternative screening paradigm for the identification and optimization of novel chemical matter. To enable FBDD across a wide range of pharmaceutical targets, a fragment screening library is required to be chemically diverse and synthetically expandable to enable critical decision making for chemical follow-up and assessing new target druggability. In this manuscript, the Pfizer fragment library design strategy which utilized multiple and orthogonal metrics to incorporate structure, pharmacophore and pharmacological space diversity is described. Appropriate measures of molecular complexity were also employed to maximize the probability of detection of fragment hits using a variety of biophysical and biochemical screening methods. In addition, structural integrity, purity, solubility, fragment and analog availability as well as cost were important considerations in the selection process. Preliminary analysis of primary screening results for 13 targets using NMR Saturation Transfer Difference (STD) indicates the identification of uM-mM hits and the uniqueness of hits at weak binding affinities for these targets.
A Formal Model of Trust Chain based on Multi-level Security Policy
Kong Xiangying
2013-01-01
Trust chain is the core technology of trusted computing. A formal model of trust chain based on finite state automata theory is proposed. We use communicating sequential processes to describe the system state transition in trust chain and by combining with multi-level security strategy give the definition of trust system and trust decision theorem of trust chain transfer which is proved meantime. Finally, a prototype system is given to show the efficiency of the model.
International Nuclear Information System (INIS)
Fields, D.J.; Lynch, W.G.; Nayak, T.K.
1986-01-01
Single- and two-particle inclusive cross sections for the production of light nuclei and intermediate mass fragments, 3< or =Z< or =24, were measured at angles well beyond the grazing angle for /sup 32/S-induced reactions on Ag at 720 MeV. Information about fragment multiplicities and reaction dynamics was extracted from measurements of light particles, intermediate mass fragments, and targetlike residues in coincidence with intermediate mass fragments. Incomplete linear momentum transfer and non-compound-particle emission are important features of collisions producing intermediate mass fragments. About half of the incident kinetic energy in these collisions is converted into internal excitation. The mean multiplicity of intermediate mass fragments is of the order of 1. Particle correlations are strongly enhanced in the plane which contains the intermediate mass fragment and the beam axis
Directory of Open Access Journals (Sweden)
Silke Dornieden
Full Text Available Alzheimer's disease (AD is a progressive neurodegenerative disorder with devastating effects. Currently, therapeutic options are limited to symptomatic treatment. For more than a decade, research focused on immunotherapy for the causal treatment of AD. However, clinical trials with active immunization using Aβ encountered severe complications, for example meningoencephalitis. Consequently, attention focused on passive immunization using antibodies. As an alternative to large immunoglobulins (IgGs, Aβ binding single-chain variable fragments (scFvs were used for diagnostic and therapeutic research approaches. scFvs can be expressed in E. coli and may provide improved pharmacokinetic properties like increased blood-brain barrier permeability or reduced side-effects in vivo. In this study, we constructed an scFv from an Aβ binding IgG, designated IC16, which binds the N-terminal region of Aβ (Aβ(1-8. scFv-IC16 was expressed in E. coli, purified and characterized with respect to its interaction with different Aβ species and its influence on Aβ fibril formation. We were able to show that scFv-IC16 strongly influenced the aggregation behavior of Aβ and could be applied as an Aβ detection probe for plaque staining in the brains of transgenic AD model mice. The results indicate potential for therapy and diagnosis of AD.
Ordóñez, Adriana; Pérez, Juan; Tan, Lu; Dickens, Jennifer A; Motamedi-Shad, Neda; Irving, James A; Haq, Imran; Ekeowa, Ugo; Marciniak, Stefan J; Miranda, Elena; Lomas, David A
2015-06-01
Mutant Z α1-antitrypsin (E342K) accumulates as polymers within the endoplasmic reticulum (ER) of hepatocytes predisposing to liver disease, whereas low levels of circulating Z α1-antitrypsin lead to emphysema by loss of inhibition of neutrophil elastase. The ideal therapy should prevent polymer formation while preserving inhibitory activity. Here we used mAb technology to identify interactors with Z α1-antitrypsin that comply with both requirements. We report the generation of an mAb (4B12) that blocked α1-antitrypsin polymerization in vitro at a 1:1 molar ratio, causing a small increase of the stoichiometry of inhibition for neutrophil elastase. A single-chain variable fragment (scFv) intrabody was generated based on the sequence of mAb4B12. The expression of scFv4B12 within the ER (scFv4B12KDEL) and along the secretory pathway (scFv4B12) reduced the intracellular polymerization of Z α1-antitrypsin by 60%. The scFv4B12 intrabody also increased the secretion of Z α1-antitrypsin that retained inhibitory activity against neutrophil elastase. MAb4B12 recognized a discontinuous epitope probably located in the region of helices A/C/G/H/I and seems to act by altering protein dynamics rather than binding preferentially to the native state. This novel approach could reveal new target sites for small-molecule intervention that may block the transition to aberrant polymers without compromising the inhibitory activity of Z α1-antitrypsin. © FASEB.
Spin-directed momentum transfers in SIDIS baryon production
International Nuclear Information System (INIS)
Sivers, D.
2016-01-01
The measurement of transverse single-spin asymmetries for baryon production in the target fragmentation region of semi-inclusive deep-inelastic scattering (SIDIS), can produce important insight into those nonperturbative aspects of QCD directly associated with confinement and with the dynamical breaking of chiral symmetry. We discuss here, in terms of spin-directed momentum transfers, the powerful quantum field- theoretical constraints on the spin-orbit dynamics underlying these transverse spin observables. The A τ -odd spin-directed momentum shifts, originating either in the target nucleon (δk TN ) or in the QCD jets (δp TN ) produced in the deep inelastic scattering process, represent significant quantum entanglement effects connecting information from current fragmentation with observables in target fragmentation. (author)
Live birth rate and number of blastomeres on day 2 transfer
DEFF Research Database (Denmark)
Azzarello, Antonino; Hoest, Thomas; Hay-Schmidt, Anders
2016-01-01
-lapse assessment, ACDs and/or recalculated fragmentation >25 % was recognized in 106/578 (18.3 %) of transferred embryos. None of them resulted in a live birth. After exclusion of these embryos, the number of blastomeres on the day of transfer did not have any impact on life birth rate. Conclusion Conventional...
A lattice gas model on a tangled chain
International Nuclear Information System (INIS)
Mejdani, R.
1993-04-01
We have used a model of a lattice gas defined on a tangled chain to study the enzyme kinetics by a modified transfer matrix method. By using a simple iterative algorithm we have obtained different kinds of saturation curves for different configurations of the tangled chain and different types of the additional interactions. In some special cases of configurations and interactions we have found the same equations for the saturation curves, which we have obtained before studying the lattice gas model with nearest neighbor interactions or the lattice gas model with alternate nearest neighbor interactions, using different techniques as the correlated walks' theory, the partition point technique or the transfer matrix model. This more general model and the new results could be useful for the experimental investigations. (author). 20 refs, 6 figs
Elementary excitations in single-chain magnets
Lutz, Philipp; Aguilà, David; Mondal, Abhishake; Pinkowicz, Dawid; Marx, Raphael; Neugebauer, Petr; Fâk, Björn; Ollivier, Jacques; Clérac, Rodolphe; van Slageren, Joris
2017-09-01
Single-chain magnets (SCMs) are one-dimensional coordination polymers or spin chains that display slow relaxation of the magnetization. Typically their static magnetic properties are described by the Heisenberg model, while the description of their dynamic magnetic properties is based on an Ising-like model. The types of excitations predicted by these models (collective vs localized) are quite different. Therefore we probed the nature of the elementary excitations for two SCMs abbreviated Mn2Ni and Mn2Fe , as well as a mononuclear derivative of the Mn2Fe chain, by means of high-frequency electron paramagnetic resonance spectroscopy (HFEPR) and inelastic neutron scattering (INS). We find that the HFEPR spectra of the chains are clearly distinct from those of the monomer. The momentum transfer dependence of the INS intensity did not reveal significant dispersion, indicating an essentially localized nature of the excitations. At the lowest temperatures these are modified by the occurrence of short-range correlations.
DEFF Research Database (Denmark)
Hviid, T V; Madsen, H O; Morling, N
1992-01-01
endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
International Nuclear Information System (INIS)
Chung, K.C.
1989-01-01
An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)
Characterizing Plasmonic Excitations of Quasi-2D Chains
Townsend, Emily; Bryant, Garnett
A quantum description of the optical response of nanostructures and other atomic-scale systems is desirable for modeling systems that use plasmons for quantum information transfer, or coherent transport and interference of quantum states, as well as systems small enough for electron tunneling or quantum confinement to affect the electronic states of the system. Such a quantum description is complicated by the fact that collective and single-particle excitations can have similar energies and thus will mix. We seek to better understand the excitations of nanosystems to identify which characteristics of the excitations are most relevant to modeling their behavior. In this work we use a quasi 2-dimensional linear atomic chain as a model system, and exact diagonalization of the many-body Hamiltonian to obtain its excitations. We compare this to previous work in 1-d chains which used a combination of criteria involving a many-body state's transfer dipole moment, balance, transfer charge, dynamical response, and induced-charge distribution to identify which excitations are plasmonic in character.
Hamuro, Yoshitomo; E, Sook Yen
2018-05-01
The technological goal of hydrogen/deuterium exchange-mass spectrometry (HDX-MS) is to determine backbone amide hydrogen exchange rates. The most critical challenge to achieve this goal is obtaining the deuterium incorporation in single-amide resolution, and gas-phase fragmentation may provide a universal solution. The gas-phase fragmentation may generate the daughter ions which differ by a single amino acid and the difference in deuterium incorporations in the two analogous ions can yield the deuterium incorporation at the sub-localized site. Following the pioneering works by Jørgensen and Rand, several papers utilized the electron transfer dissociation (ETD) to determine the location of deuterium in single-amide resolution. This paper demonstrates further advancement of the strategy by determining backbone amide hydrogen exchange rates, instead of just determining deuterium incorporation at a single time point, in combination with a wide time window monitoring. A method to evaluate the effects of scrambling and to determine the exchange rates from partially scrambled HDX-ETD-MS data is described. All parent ions for ETD fragmentation were regio-selectively scrambled: The deuterium in some regions of a peptide ion was scrambled while that in the other regions was not scrambled. The method determined 31 backbone amide hydrogen exchange rates of cytochrome c in the non-scrambled regions. Good fragmentation of a parent ion, a low degree of scrambling, and a low number of exchangeable hydrogens in the preceding side chain are the important factors to determine the exchange rate. The exchange rates determined by the HDX-MS are in good agreement with those determined by NMR. [Figure not available: see fulltext.
Hamuro, Yoshitomo; E, Sook Yen
2018-05-01
The technological goal of hydrogen/deuterium exchange-mass spectrometry (HDX-MS) is to determine backbone amide hydrogen exchange rates. The most critical challenge to achieve this goal is obtaining the deuterium incorporation in single-amide resolution, and gas-phase fragmentation may provide a universal solution. The gas-phase fragmentation may generate the daughter ions which differ by a single amino acid and the difference in deuterium incorporations in the two analogous ions can yield the deuterium incorporation at the sub-localized site. Following the pioneering works by Jørgensen and Rand, several papers utilized the electron transfer dissociation (ETD) to determine the location of deuterium in single-amide resolution. This paper demonstrates further advancement of the strategy by determining backbone amide hydrogen exchange rates, instead of just determining deuterium incorporation at a single time point, in combination with a wide time window monitoring. A method to evaluate the effects of scrambling and to determine the exchange rates from partially scrambled HDX-ETD-MS data is described. All parent ions for ETD fragmentation were regio-selectively scrambled: The deuterium in some regions of a peptide ion was scrambled while that in the other regions was not scrambled. The method determined 31 backbone amide hydrogen exchange rates of cytochrome c in the non-scrambled regions. Good fragmentation of a parent ion, a low degree of scrambling, and a low number of exchangeable hydrogens in the preceding side chain are the important factors to determine the exchange rate. The exchange rates determined by the HDX-MS are in good agreement with those determined by NMR. Graphical Abstract ᅟ.
Hamuro, Yoshitomo; E, Sook Yen
2018-03-01
The technological goal of hydrogen/deuterium exchange-mass spectrometry (HDX-MS) is to determine backbone amide hydrogen exchange rates. The most critical challenge to achieve this goal is obtaining the deuterium incorporation in single-amide resolution, and gas-phase fragmentation may provide a universal solution. The gas-phase fragmentation may generate the daughter ions which differ by a single amino acid and the difference in deuterium incorporations in the two analogous ions can yield the deuterium incorporation at the sub-localized site. Following the pioneering works by Jørgensen and Rand, several papers utilized the electron transfer dissociation (ETD) to determine the location of deuterium in single-amide resolution. This paper demonstrates further advancement of the strategy by determining backbone amide hydrogen exchange rates, instead of just determining deuterium incorporation at a single time point, in combination with a wide time window monitoring. A method to evaluate the effects of scrambling and to determine the exchange rates from partially scrambled HDX-ETD-MS data is described. All parent ions for ETD fragmentation were regio-selectively scrambled: The deuterium in some regions of a peptide ion was scrambled while that in the other regions was not scrambled. The method determined 31 backbone amide hydrogen exchange rates of cytochrome c in the non-scrambled regions. Good fragmentation of a parent ion, a low degree of scrambling, and a low number of exchangeable hydrogens in the preceding side chain are the important factors to determine the exchange rate. The exchange rates determined by the HDX-MS are in good agreement with those determined by NMR. [Figure not available: see fulltext.
The use of many-body expansions and geometry optimizations in fragment-based methods.
Fedorov, Dmitri G; Asada, Naoya; Nakanishi, Isao; Kitaura, Kazuo
2014-09-16
Conspectus Chemists routinely work with complex molecular systems: solutions, biochemical molecules, and amorphous and composite materials provide some typical examples. The questions one often asks are what are the driving forces for a chemical phenomenon? How reasonable are our views of chemical systems in terms of subunits, such as functional groups and individual molecules? How can one quantify the difference in physicochemical properties of functional units found in a different chemical environment? Are various effects on functional units in molecular systems additive? Can they be represented by pairwise potentials? Are there effects that cannot be represented in a simple picture of pairwise interactions? How can we obtain quantitative values for these effects? Many of these questions can be formulated in the language of many-body effects. They quantify the properties of subunits (fragments), referred to as one-body properties, pairwise interactions (two-body properties), couplings of two-body interactions described by three-body properties, and so on. By introducing the notion of fragments in the framework of quantum chemistry, one obtains two immense benefits: (a) chemists can finally relate to quantum chemistry, which now speaks their language, by discussing chemically interesting subunits and their interactions and (b) calculations become much faster due to a reduced computational scaling. For instance, the somewhat academic sounding question of the importance of three-body effects in water clusters is actually another way of asking how two hydrogen bonds affect each other, when they involve three water molecules. One aspect of this is the many-body charge transfer (CT), because the charge transfers in the two hydrogen bonds are coupled to each other (not independent). In this work, we provide a generalized view on the use of many-body expansions in fragment-based methods, focusing on the general aspects of the property expansion and a contraction of a
Supply chain integration in the South African conveyancing environment
Directory of Open Access Journals (Sweden)
Anthea P. Amadi-Echendu
2016-05-01
Full Text Available Background: Although conveyancing is a legal term, business management and specifically operations management principles also apply to the processes involved in conveyancing. From a business perspective, each organisation is usually concerned with its own profit margins and processes. In our global market, however, organisations now realise that they can no longer compete successfully on the basis of their internal operational efficiencies alone. They are therefore constantly aware of the need to improve not only their internal processes but also their alignment with other supply chain linkages in an effort to optimise the performance of the whole supply chain. Such alignment, in the conveyancing environment, includes government departments that are generally less willing to adopt business principles, which in turn makes optimisation of the whole supply chain more difficult. Objectives: The article describes a supply chain perspective of the conveyancing processes in South Africa and reports some of the factors that influence and delay conveyancing transactions. It explores possibilities of collaborative relationships between different role players in the conveyancing supply chain. It aims to show that a supply chain approach, as opposed to a singular organisational approach, can help to reduce process bottlenecks and delays in order to improve overall process efficiency. Method: The research, on which the findings are based, was exploratory in nature and followed a mixed-methods (quantitative or qualitative approach and included both structured questionnaires and personal interviews. Results: The results of the study revealed that many different types of delays occur at various entities across the whole supply chain involved in property transfers. These delays are presented in a table and diagram. Conclusion: It is recommended that greater adoption of electronic technology across the whole supply chain would improve overall efficiency
Momentum transfer in relativistic heavy ion charge-exchange reactions
Townsend, L. W.; Wilson, J. W.; Khan, F.; Khandelwal, G. S.
1991-01-01
Relativistic heavy ion charge-exchange reactions yield fragments (Delta-Z = + 1) whose longitudinal momentum distributions are downshifted by larger values than those associated with the remaining fragments (Delta-Z = 1, -2,...). Kinematics alone cannot account for the observed downshifts; therefore, an additional contribution from collision dynamics must be included. In this work, an optical model description of collision momentum transfer is used to estimate the additional dynamical momentum downshift. Good agreement between theoretical estimates and experimental data is obtained.
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-07-01
The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Hoffman, F.O.; Bergstroem, U.; Gyllander, C.; Wilkens, A.B.
1984-01-01
Six internationally recognized terrestrial food-chain models developed in Sweden, the United States, the United Kingdom, the Federal Republic of Germany, and the International Atomic Energy Agency are compared. This comparison includes the data bases and predictions for the transfer of Co-60, Sr-90, I-131, and Cs-137 into milk, and leafy and nonleafy vegetables from a hypothetical 30-yr continuous rate of atmospheric deposition onto agricultural systems. Model predictions are compared against United Nations summaries of empirical relationships between atmospheric deposition and concentrations in food of Sr-90 and Cs-137. The results of statistical analyses of the effect of parameter uncertainties on model predictions are also included for Sr-90, Cs-137, and I-131. Discrepancies among model predictions vary between factors of 6 and 30. These results reflect differences in model assumptions rather than uncertainties in model parameters
A reactive polystyrene-block-polyisoprene star copolymer as a toughening agent in an epoxy thermoset
Francis, Raju; Baby, Deepa K.
2015-01-01
© 2015 Springer-Verlag Berlin Heidelberg A polystyrene-block-polyisoprene ((PS-b-PI)3) star polymer was synthesized by photochemical reversible addition fragmentation chain transfer (RAFT) polymerization. The obtained star polymer was epoxidized
Biomagnification of organic pollutants in benthic and pelagic marine food chains from the Baltic Sea
International Nuclear Information System (INIS)
Nfon, Erick; Cousins, Ian T.; Broman, Dag
2008-01-01
The trophic transfer of organic pollutants with varying physical chemical properties was determined in both a pelagic and benthic food chain using δ 15 N as a continuous variable for assessing trophic levels. The trophic transfer of organic pollutants through the entire food chain in terms of food chain magnification factors (FCMFs) was quantified from the slope of the regression between ln [concentration] and δ 15 N. Organic pollutants with statistically significant FCMFs > 1 were considered to biomagnify within the food chain, whereas those with FCMFs 1 were found for PCB congeners and organochlorine pesticides in the Baltic food chains whereas statistically significant FCMFs 15 N method suggested a food chain structure which was not consistent with the known dietary patterns of the species. Biomagnification factors (BMFs) were additionally calculated as the ratio of the lipid normalized concentrations in the predator and prey species with adjustment for trophic level and were generally consistent with the FCMFs with BMF > 1 for PCBs and organochlorines
High-voltage pulsed generator for dynamic fragmentation of rocks.
Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
High-voltage pulsed generator for dynamic fragmentation of rocks
Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
BstXI RFLP in the human inter-alpha-trypsin inhibitor light chain gene
Energy Technology Data Exchange (ETDEWEB)
Leveillard, T; Bourguignon, J; Sesbouee, R; Hanauer, A; Salier, J P; Diarra-Mehrpour, M; Martin, J P
1988-03-25
The 1.2 kb EcoRI/SmaI fragment of lambdaHuLITI2 was used as probe. lambdaHuLITI2 is a full length cDNA clone coding for human inter-alpha-trypsin inhibitor light chain isolated from immunochemical screening of a lambdagt11 library. Its sequence coding for HI-30 and alpha-1-microglobulin is in agreement. BstXI identifies five invariant bands at 5.0 kb, 2.3 kb, 1.5 kb, 1.1 kb, and 0.7 kb and a diallelic polymorphism with DNA fragments at 2.0 kb or 1.7 kb.
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik
2017-01-01
Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.
Trienekens, J.H.; Petersen, B.; Wognum, P.M.; Brinkmann, D.
2009-01-01
In this book the results are presented of a comprehensive inventory of pork chains that has been conducted through expert interviews and in-depth case studies. The main focus of the book is on how well diverse and fragmented supply in the European pork sector matches differentiating demands for pork
Directory of Open Access Journals (Sweden)
John M Louis
Full Text Available We previously reported a series of antibodies, in fragment antigen binding domain (Fab formats, selected from a human non-immune phage library, directed against the internal trimeric coiled-coil of the N-heptad repeat (N-HR of HIV-1 gp41. Broadly neutralizing antibodies from that series bind to both the fully exposed N-HR trimer, representing the pre-hairpin intermediate state of gp41, and to partially-exposed N-HR helices within the context of the gp41 six-helix bundle. While the affinities of the Fabs for pre-hairpin intermediate mimetics vary by only 2 to 20-fold between neutralizing and non-neutralizing antibodies, differences in inhibition of viral entry exceed three orders of magnitude. Here we compare the binding of neutralizing (8066 and non-neutralizing (8062 antibodies, differing in only four positions within the CDR-H2 binding loop, in Fab and single chain variable fragment (ScFv formats, to several pre-hairpin intermediate and six-helix bundle constructs of gp41. Residues 56 and 58 of the mini-antibodies are shown to be crucial for neutralization activity. There is a large differential (≥ 150-fold in binding affinity between neutralizing and non-neutralizing antibodies to the six-helix bundle of gp41 and binding to the six-helix bundle does not involve displacement of the outer C-terminal helices of the bundle. The binding stoichiometry is one six-helix bundle to one Fab or three ScFvs. We postulate that neutralization by the 8066 antibody is achieved by binding to a continuum of states along the fusion pathway from the pre-hairpin intermediate all the way to the formation of the six-helix bundle, but prior to irreversible fusion between viral and cellular membranes.
Long quantum channels for high-quality entanglement transfer
International Nuclear Information System (INIS)
Banchi, L; Apollaro, T J G; Cuccoli, A; Verrucchi, P; Vaia, R
2011-01-01
High-quality quantum-state and entanglement transfer can be achieved in an unmodulated spin bus operating in the ballistic regime, which occurs when the endpoint qubits A and B are nonperturbatively coupled to the chain by a suitable exchange interaction j 0 . Indeed, the transition amplitude characterizing the transfer quality exhibits a maximum for a finite optimal value j opt 0 (N), where N is the channel length. We show that j opt 0 (N) scales as N -1/6 for large N and that it ensures a high-quality entanglement transfer even in the limit of arbitrarily long channels, almost independently of the channel initialization. For instance, for any chain length the average quantum-state transmission fidelity exceeds 90% and decreases very little in a broad neighbourhood of j opt 0 (N). We emphasize that, taking the reverse point of view, should j 0 be experimentally constrained, high-quality transfer can still be obtained by adjusting the channel length to its optimal value. (paper)
Supply-chain trade and labor market outcomes : The case of the 2004 European Union enlargement
Kaplan, Lennart C.; Kohl, Tristan; Martínez-Zarzoso, Inmaculada
2018-01-01
The structure of international trade is increasingly characterized by fragmentation of production processes and trade policy. Yet, how trade policy affects supply-chain trade is largely unexplored territory. This paper shows how the accession of 10 Central and Eastern European Countries (CEECs) to
Legal-Economic Barriers To Price Transfers in Food Supply Chains
Bremmers, H.J.; Meulen, van der B.M.J.; Sredojevic, Z.; Wijnands, J.H.M.
2012-01-01
Recent price movements have put food supply chains under pressure. On the one side, upward price tendencies on commodity markets result in higher costs to processing firms. On the other side, these firms are confronted with a strong retail sector that is able to prevent compensation to protect
Failures in combined knowledge and material supply chains
DEFF Research Database (Denmark)
Koch, Christian
2005-01-01
by configuration by project. In such a setting creating value for the customers and the enterprises becomes dependent of the ability to organise and coordinate in the supply chains. That the configuration is not always successful can be demonstrated by studying the emergence of failures occurring in the supply......-month observation period. These were compiled and analysed. The economic consequences are calculated to be 8% of the production costs. The analysis of relations in the supply chain both shows relations to materials and knowledge chains and their interaction. Most of the failures were generated in the knowledge...... stream and then occasionally transfer into the material stream. The paper proposes initiatives to strengthen partnerships in supply chains and especially at engineer to order production. The contradiction between the permanent enterprise organisation potentially capable of handling purchasing...
Corrections to scaling for block entanglement in massive spin chains
International Nuclear Information System (INIS)
Calabrese, Pasquale; Cardy, John; Peschel, Ingo
2010-01-01
We consider the Rényi entropies S n in one-dimensional massive integrable models diagonalizable by means of corner transfer matrices (such as Heisenberg and Ising spin chains). By means of explicit examples and using the relation of the corner transfer matrix with the Virasoro algebra, we show that close to a conformally invariant critical point, when the correlation length ξ is finite but large, the corrections to the scaling are of the unusual form ξ −x/n , with x the dimension of a relevant operator in the conformal theory. This is reminiscent of the results for gapless chains and should be valid for any massive one-dimensional model close to a conformal critical point
The transverse momentum dependence of quark fragmentation functions from cascade models
International Nuclear Information System (INIS)
Groot, E.H. de; Engels, J.
1979-01-01
A covariant generalization of the onedimensional cascade model for quark fragmentation functions is presented, so as to include the transverse momentum behaviour and the possibility to produce different particles at different vertices along the chain. In the scaling limit the exact solution is given, if the primordial function is of the type αZsup(α-1). T(pT). For the more general case of factorizing primordial functions an analytic expression for the seagull effect is derived, which turns out to be independent of the function T(pT). (orig.) [de
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory
Energy Technology Data Exchange (ETDEWEB)
Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)
2016-11-15
The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Nanostructured Polysulfone-Based Block Copolymer Membranes
Xie, Yihui
2016-01-01
polycondensation and reversible addition-fragmentation chain-transfer polymerization. The obtained membrane has a highly porous interconnected skin layer composed of elongated micelles with a flower-like arrangement, on top of the graded finger-like macrovoids
Directory of Open Access Journals (Sweden)
Zu-Quan Hu
2012-06-01
Full Text Available Fusarium verticillioides is the primary causal agent of Fusarium ear and kernel rot in maize, producing fumonisin mycotoxins that are toxic to humans and domestic animals. Rapid detection and monitoring of fumonisin-producing fungi are pivotally important for the prevention of mycotoxins from entering into food/feed products. Chicken-derived single-chain variable fragments (scFvs against cell wall-bound proteins from F. verticillioides were isolated from an immunocompetent phage display library. Comparative phage enzyme-linked immunosorbant assays (ELISAs and sequencing analyses identified four different scFv antibodies with high sensitivity. Soluble antibody ELISAs identified two highly sensitive scFv antibodies, FvCA3 and FvCA4, with the latter being slightly more sensitive. Three-dimensional modeling revealed that the FvCA4 may hold a better overall structure with CDRH3, CDRL1 and CDRL3 centered in the core region of antibody surface compared with that of other scFvs. Immunofluorescence labeling revealed that the binding of FvCA4 antibody was localized to the cell walls of conidiospores and hyphae of F. verticillioides, confirming the specificity of this antibody for a surface target. This scFv antibody was able to detect the fungal mycelium as low as 10−2 μg/mL and contaminating mycelium at a quantity of 10−2 mg/g maize. This is the first report that scFv antibodies derived from phage display have a wide application for rapid and accurate detection and monitoring of fumonisin-producing pathogens in agricultural samples.
International Nuclear Information System (INIS)
Luu Thi Tho; Nguyen Van Thong; Vu Thi Hong Khanh; Tran Minh Quynh
2014-01-01
Three kind of Vietnamese chitosans with the same deacetylation degrees of about 75% and viscosity average molecular weights are 69.000, 187.000 and 345.000 Da, respectively, were produced from shrimp shells and cuttle-bone at the MTV chitosan company (Kien Giang). These chitosans were irradiated at 25, 50, 75, 100, 200 and 500 kGy under Cobalt-60 gamma source at Hanoi Irradiation Center in order to prepare a series of chitosan segments with wide distribution of molecular weights. Different chitosan samples of the predetermined average molecular weight from 3,000 to 50,000 Da were separated from the irradiated chitosans by ultrafiltration with series of filter membranes (Centriprep devices). Molecular properties of the fragmented chitosans were analysed with gel permeation chromatography, Fourier transfer infra red spectrometry, and the results suggested that principal characteristics of chitosan were not affected by gamma irradiation, even its deacetylation degrees was increased. Solubility of the fragmented chitosans were much improved by radiation processing, and the chitosans having molecular weights below 5.000 Da were water-soluble polymers, which can easily apply as the auxiliary agent in textile. (author)
Jordan, John B; Whittington, Douglas A; Bartberger, Michael D; Sickmier, E Allen; Chen, Kui; Cheng, Yuan; Judd, Ted
2016-04-28
Fragment-based drug discovery (FBDD) has become a widely used tool in small-molecule drug discovery efforts. One of the most commonly used biophysical methods in detecting weak binding of fragments is nuclear magnetic resonance (NMR) spectroscopy. In particular, FBDD performed with (19)F NMR-based methods has been shown to provide several advantages over (1)H NMR using traditional magnetization-transfer and/or two-dimensional methods. Here, we demonstrate the utility and power of (19)F-based fragment screening by detailing the identification of a second-site fragment through (19)F NMR screening that binds to a specific pocket of the aspartic acid protease, β-secretase (BACE-1). The identification of this second-site fragment allowed the undertaking of a fragment-linking approach, which ultimately yielded a molecule exhibiting a more than 360-fold increase in potency while maintaining reasonable ligand efficiency and gaining much improved selectivity over cathepsin-D (CatD). X-ray crystallographic studies of the molecules demonstrated that the linked fragments exhibited binding modes consistent with those predicted from the targeted screening approach, through-space NMR data, and molecular modeling.
DEFF Research Database (Denmark)
Duan, Zhi; Brüggemann, Dagmar Adeline; Siegumfeldt, Henrik
2009-01-01
three small synthetic peptides of the alpha(s1)-casein sequence. These peptides traverse enzymatic cleavage sites of casein during cheese ripening. The specificity of the generated anti-peptide antibodies was determined by ELISA and Western blot. Finally, an immunofluorescent labeling protocol......A novel method to monitor in situ hydrolyzable casein fragments during cheese ripening by using immunofluorescent labeling and confocal laser scanning microscopy (CLSM) was developed. Monoclonal single chain variable fragments of antibody (scFvs) were generated by antibody phage display toward...
Characterization of IFR metal fuel fragmentation
International Nuclear Information System (INIS)
Gabor, J.D.; Purviance, R.T.; Aeschlimann, R.W.; Spencer, B.W.
1987-01-01
The integral fast reactor (IFR) employs a reactor design that has inherent safety features. An important safety advantage is derived from its pool configuration, which facilitates passive decay heat removal and isolates the core from accidents that might occur elsewhere in the plant. The metal-alloy fuel has superior heat transfer properties compared to oxide fuels. While the IFR design has these inherent safety features, a complete analysis of reactor safety requires assessment of the consequences of the melting of the uranium alloy fuel in the core and the contact of molten core materials with sodium. A series of eight tests was conducted in which the fragmentation and interaction behavior of kilogram quantities of uranium-zirconium alloy in sodium was studied
Homology of yeast photoreactivating gene fragment with human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1984-01-01
Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes
How to learn about polarized lambda-baryon fragmentation functions?
International Nuclear Information System (INIS)
Soffer, J.
1999-01-01
We study the inclusive production of Λ (Λ-bar) in several high energy collision processes (e + e - , e ± p, ν(ν-bar)p, pp), in view of an accurate determination of the polarized fragmentation functions of a quark into a Λ (Λ-bar). We will recall that present data are unable to distinguish between various theoretical models, in particular for the spin transfer mechanisms and we will indicate how future measurements will provide ways to discriminate between them and also how to achieve a necessary quark flavor separation
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
Di, Shanshan; Liu, Ruiquan; Chen, Li; Diao, Jinling; Zhou, Zhiqiang
2018-04-30
Hexachlorocyclohexane isomers (HCHs) are persistent organic pollutants (POPs), having potential risks to humans and ecosystem. This work evaluated the propensity of organisms to accumulate, eliminate, and transfer HCHs along the food chain (Tubifex tubifex and common carp (Cyprinus carpio)). The accumulation of HCHs from water by worms and carp was observed, and the concentrations increased with exposure time. After 8 days, the HCH concentrations in organisms remained stable. The accumulation factor (AF) values of HCHs in T. tubifex were higher than those in carp, indicating that the bioaccumulation abilities of HCHs in T. tubifex were higher than those in carp. The contaminated worms as a dietary source in the food chain led to significantly higher bioaccumulation in carp. The biomagnification factor (BMF) values of HCH isomers were all greater than 1. In the dissipation experiments, the elimination was fast and the half-lives were shorter than 2.5 days. The enantioselective accumulation and dissipation of α-HCH enantiomers were observed in worms and carp (food chain), and the enantiomeric differences should be taken into consideration in the study of contaminants risk assessment. The results on trophic transfer of HCHs in a freshwater food chain should be helpful for better understanding the fate, transport, and transfer of HCHs in freshwater environments.
Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D
2017-10-17
Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.
Energy Technology Data Exchange (ETDEWEB)
Dong Jiexian; Li Zhenfeng; Lei Hongtao; Sun Yuanming [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Ducancel, Frederic [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Xu Zhenlin [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Boulain, Jean-Claude [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Yang Jinyi; Shen Yudong [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Wang Hong, E-mail: gzwhongd@63.com [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China)
2012-07-29
Graphical abstract: Detection model of dc-CLEIA based on anti-RAC scFv-AP fusion protein. Highlights: Black-Right-Pointing-Pointer The scFv-AP fusion protein against ractopamine (RAC) was produced. Black-Right-Pointing-Pointer A dc-CLEIA for RAC was developed based on the purified scFv-AP fusion protein. Black-Right-Pointing-Pointer The sensitivity of dc-CLEIA was 10 times as sensitive as dc-ELISA for RAC. Black-Right-Pointing-Pointer Recovery tests from pork samples were studied. Black-Right-Pointing-Pointer Good accuracy was obtained. - Abstract: A rapid, sensitive chemiluminescent enzyme immunoassay (CLEIA) for ractopamine (RAC) based on a single-chain variable fragment (scFv)-alkaline phosphatase (AP) fusion protein was developed. The scFv gene was prepared by cloning the heavy- and light-chain variable region genes (V{sub H} and V{sub L}) from hybridoma cell line AC2, which secretes antibodies against RAC, and assembling V{sub H} and V{sub L} genes with a linker by means of splicing overlap extension polymerase chain reaction. The resulting scFv gene was inserted into the expression vector pLIP6/GN containing AP to produce the fusion protein in Escherichia coli strain BL21. The purified scFv-AP fusion protein was used to develop a direct competitive CLEIA (dcCLEIA) protocol for detection of RAC. The average concentration required for 50% inhibition of binding and the limit of detection of the assay were 0.25 {+-} 0.03 and 0.02 {+-} 0.004 ng mL{sup -1}, respectively, and the linear response range extended from 0.05 to 1.45 ng mL{sup -1}. The assay was 10 times as sensitive as the corresponding enzyme-linked immunosorbent assay based on the same fusion protein. Cross-reactivity studies showed that the fusion protein did not cross react with RAC analogs. DcCLEIA was used to analyze RAC spiked pork samples, and the validation was confirmed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). The results showed a good correlation between
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
Equilibrium simulations of proteins using molecular fragment replacement and NMR chemical shifts.
Boomsma, Wouter; Tian, Pengfei; Frellsen, Jes; Ferkinghoff-Borg, Jesper; Hamelryck, Thomas; Lindorff-Larsen, Kresten; Vendruscolo, Michele
2014-09-23
Methods of protein structure determination based on NMR chemical shifts are becoming increasingly common. The most widely used approaches adopt the molecular fragment replacement strategy, in which structural fragments are repeatedly reassembled into different complete conformations in molecular simulations. Although these approaches are effective in generating individual structures consistent with the chemical shift data, they do not enable the sampling of the conformational space of proteins with correct statistical weights. Here, we present a method of molecular fragment replacement that makes it possible to perform equilibrium simulations of proteins, and hence to determine their free energy landscapes. This strategy is based on the encoding of the chemical shift information in a probabilistic model in Markov chain Monte Carlo simulations. First, we demonstrate that with this approach it is possible to fold proteins to their native states starting from extended structures. Second, we show that the method satisfies the detailed balance condition and hence it can be used to carry out an equilibrium sampling from the Boltzmann distribution corresponding to the force field used in the simulations. Third, by comparing the results of simulations carried out with and without chemical shift restraints we describe quantitatively the effects that these restraints have on the free energy landscapes of proteins. Taken together, these results demonstrate that the molecular fragment replacement strategy can be used in combination with chemical shift information to characterize not only the native structures of proteins but also their conformational fluctuations.
Mechanism and kinetics of dithiobenzoate-mediated RAFT polymerization. I. The current situation
Barner-Kowollik, C.; Buback, M.; Charleux, B.; Coote, M.L.; Drache, M.; Fukuda, T.; Goto, A.; Klumperman, B.; Lowe, A.B.; McLeary, J.B.; Moad, G.; Monteiro, M.J.; Sanderson, R.D.; Tonge, M.P.; Vana, P.
2006-01-01
Investigations into the kinetics and mechanism of dithiobenzoate-mediated Reversible Addition-Fragmentation Chain Transfer (RAFT) polymerizations, which exhibit nonideal kinetic behavior, such as induction periods and rate retardation, are comprehensively reviewed. The appreciable uncertainty in the
Vasantha, Vivek Arjunan; Jana, Satyasankar; Lee, Serina Siew Chen; Lim, Chin-Sing; Teo, Serena Lay Ming; Parthiban, Anbanandam; Vancso, Gyula J.
2015-01-01
A new class of dual hydrophilic diblock copolymers (BCPs) possessing poly(ethylene glycol) (PEG) and zwitterionic polysulfabetaine (PSB) was synthesized by reversible addition–fragmentation chain transfer (RAFT) polymerization. These BCPs formed schizophrenic micelles undergoing core–shell
Ma, Xin; Dagan, Shai; Somogyi, Árpád; Wysocki, Vicki H.; Scaraffia, Patricia Y.
2013-04-01
Glu, Gln, Pro, and Ala are the main amino acids involved in ammonia detoxification in mosquitoes. In order to develop a tandem mass spectrometry method (MS2) to monitor each carbon of the above isotopically-labeled 13C-amino acids for metabolic studies, the compositions and origins of atoms in fragments of the protonated amino acid should be first elucidated. Thus, various electrospray (ESI)-based MS2 tools were employed to study the fragmentation of these unlabeled and isotopically-labeled amino acids and better understand their dissociation pathways. A broad range of fragments, including previously-undescribed low m/z fragments was revealed. The formulae of the fragments (from m/z 130 down to m/z 27) were confirmed by their accurate masses. The structures and conformations of the larger fragments of Glu were also explored by ion mobility mass spectrometry (IM-MS) and gas-phase hydrogen/deuterium exchange (HDX) experiments. It was found that some low m/z fragments ( m/z 27-30) are common to Glu, Gln, Pro, and Ala. The origins of carbons in these small fragments are discussed and additional collision induced dissociation (CID) MS2 fragmentation pathways are proposed for them. It was also found that small fragments (≤ m/z 84) of protonated, methylated Glu, and methylated Gln are the same as those of the underivatized Glu and Gln. Taken together, the new approach of utilizing low m/z fragments can be applied to distinguish, identify, and quantify 13C-amino acids labeled at various positions, either in the backbone or side chain.
Kinetic chain abnormalities in the athletic shoulder.
Sciascia, Aaron; Thigpen, Charles; Namdari, Surena; Baldwin, Keith
2012-03-01
Overhead activities require the shoulder to be exposed to and sustain repetitive loads. The segmental activation of the body's links, known as the kinetic chain, allows this to occur effectively. Proper muscle activation is achieved through generation of energy from the central segment or core, which then transfers the energy to the terminal links of the shoulder, elbow, and hand. The kinetic chain is best characterized by 3 components: optimized anatomy, reproducible efficient motor patterns, and the sequential generation of forces. However, tissue injury and anatomic deficits such as weakness and/or tightness in the leg, pelvic core, or scapular musculature can lead to overuse shoulder injuries. These injuries can be prevented and maladaptations can be detected with a thorough understanding of biomechanics of the kinetic chain as it relates to overhead activity.
BUSINESS MODELS FOR INCREASING TECHNOLOGICAL TRANSFER EFFECTIVENESS
Directory of Open Access Journals (Sweden)
Simina FULGA
2016-05-01
Full Text Available The present paper is devoted to analyze the appropriate recommendations to increase the effectiveness of technology transfer organizations (centers from ReNITT, by using the specific instruments of Business Model Canvas, associated to the technological transfer value chain for the value added services addressed to their clients and according to a continuously improved competitive strategy over competition analysis.
Directory of Open Access Journals (Sweden)
S. C. Oukouomi Noutchie
2014-01-01
Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.
Land fragmentation and production diversification
Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.
2018-01-01
We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver
Target-fragment angular distributions for the interaction of 86 MeV/A 12C with 197Au
International Nuclear Information System (INIS)
Kraus, R.H. Jr.; Loveland, W.; McGaughey, P.L.; Seaborg, G.T.; Morita, Y.; Hageboe, E.; Haldorsen, I.R.; Sugihara, T.T.
1985-01-01
Target-fragment angular distributions were measured using radiochemical techniques for 69 different fragments (44 12 C with 197 Au. The angular distributions in the laboratory system are forward-peaked with some distributions also showing a backward peaking. The shapes of the laboratory system distributions were compared with the predictions of the nuclear firestreak model. The measured angular distributions differed markedly from the predictions of the firestreak model in most cases. This discrepancy could be due, in part, to overestimation of the transferred longitudinal momentum by the firestreak model, the assumption of isotropic angular distributions for fission and particle emission in the moving frame and incorrect assumptions about how the lightest (A 145) fragment distributions were symmetric about 90 0 . (orig.)
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
α-decay chain and associated cluster emission from neutron deficient 237Cf nucleus
International Nuclear Information System (INIS)
Jain, Deepika; Sharma, Manoj K.
2015-01-01
We have studied the α-decay chain of 237 Cf nucleus, which has been observed in the 3n evaporation channel when the semi-magic projectile 36 S strikes on 204 Pbv nucleus. The calculations are carried out by using preformed cluster model (PCM), with choices of spherical and quadruple deformation with in cold optimum orientation approach. The calculated half-lives of α-decay chain find relatively in nice agreement with experimental data for the deformed fragmentation approach. Along with α emission, the possibility of heavier clusters is also worked out and corresponding half-lives are predicted. (author)
Cowardin, H.; Anz-Meador, P.; Reyes, J. A.
In a continued effort to better characterize the geosynchronous orbit (GEO) environment, NASA’s Orbital Debris Program Office (ODPO) utilizes various ground-based optical assets to acquire photometric and spectral data of known debris associated with fragmentations in or near GEO. The Titan IIIC Transtage upper stage is known to have fragmented four times. Two of the four fragmentations were in GEO while the Transtage fragmented a third time in GEO transfer orbit. The forth fragmentation occurred in low Earth orbit. To better assess and characterize these fragmentations, the NASA ODPO acquired a Titan Transtage test and display article previously in the custody of the 309th Aerospace Maintenance and Regeneration Group (AMARG) in Tucson, Arizona. After initial inspections at AMARG demonstrated that it was of sufficient fidelity to be of interest, the test article was brought to NASA Johnson Space Center (JSC) to continue material analysis and historical documentation. The Transtage has undergone two separate spectral measurement campaigns to characterize the reflectance spectroscopy of historical aerospace materials. These data have been incorporated into the NASA Spectral Database, with the goal of using telescopic data comparisons for potential material identification. A Light Detection and Ranging (LIDAR) system scan also has been completed and a scale model has been created for use in the Optical Measurement Center (OMC) for photometric analysis of an intact Transtage, including bidirectional reflectance distribution function (BRDF) measurements. An historical overview of the Titan IIIC Transtage, the current analysis that has been done to date, and the future work to be completed in support of characterizing the GEO and near GEO orbital debris environment will be discussed in the subsequent presentation.
Chain of care development in Sweden: results of a national study
Directory of Open Access Journals (Sweden)
Bengt Åhgren
2003-10-01
Full Text Available Chains of Care are today an important counterbalance to the ever-increasing fragmentation of Swedish health care, and the ongoing development work has high priority. Improved quality of care is the most important reason for developing Chains of Care. Despite support in the form of goals and activity plans, seven of ten county councils are uncertain whether they have been quite successful in the development work. Strong departmentalisation of responsibilities between different medical professions and departments, types of responsibilities and power still remaining in the vertical organisation structure, together with limited participation from the local authorities, are some of the most commonly mentioned reasons for the lack of success. Even though there is hesitation regarding the development work up to today, all county councils will continue developing Chains of Care. The main reason is, as was the case with Chain of Care development up to today, to improve quality of care. Although one of the main purposes is to make health care more patient-focused, patients in general seem to have limited impact on the development work. Therefore, the challenge is to design Chains of Care which regards patients as partners, and not objects.