The de novo assembly of mitochondrial genomes of the extinct passenger pigeon (Ectopistes migratorius with next generation sequencing.

Directory of Open Access Journals (Sweden)

Chih-Ming Hung

Full Text Available The information from ancient DNA (aDNA provides an unparalleled opportunity to infer phylogenetic relationships and population history of extinct species and to investigate genetic evolution directly. However, the degraded and fragmented nature of aDNA has posed technical challenges for studies based on conventional PCR amplification. In this study, we present an approach based on next generation sequencing to efficiently sequence the complete mitochondrial genome (mitogenome of two extinct passenger pigeons (Ectopistes migratorius using de novo assembly of massive short (90 bp, paired-end or single-end reads. Although varying levels of human contamination and low levels of postmortem nucleotide lesion were observed, they did not impact sequencing accuracy. Our results demonstrated that the de novo assembly of shotgun sequence reads could be a potent approach to sequence mitogenomes, and offered an efficient way to infer evolutionary history of extinct species.

The De Novo Assembly of Mitochondrial Genomes of the Extinct Passenger Pigeon (Ectopistes migratorius) with Next Generation Sequencing

Science.gov (United States)

Hung, Chih-Ming; Lin, Rong-Chien; Chu, Jui-Hua; Yeh, Chia-Fen; Yao, Chiou-Ju; Li, Shou-Hsien

2013-01-01

The information from ancient DNA (aDNA) provides an unparalleled opportunity to infer phylogenetic relationships and population history of extinct species and to investigate genetic evolution directly. However, the degraded and fragmented nature of aDNA has posed technical challenges for studies based on conventional PCR amplification. In this study, we present an approach based on next generation sequencing to efficiently sequence the complete mitochondrial genome (mitogenome) of two extinct passenger pigeons (Ectopistes migratorius) using de novo assembly of massive short (90 bp), paired-end or single-end reads. Although varying levels of human contamination and low levels of postmortem nucleotide lesion were observed, they did not impact sequencing accuracy. Our results demonstrated that the de novo assembly of shotgun sequence reads could be a potent approach to sequence mitogenomes, and offered an efficient way to infer evolutionary history of extinct species. PMID:23437111

An investigation of Hebbian phase sequences as assembly graphs

Directory of Open Access Journals (Sweden)

Daniel Gomes Almeida Filho

2014-04-01

Full Text Available Hebb proposed that synapses between neurons that fire synchronously are strengthened, forming cell assemblies and phase sequences. The former, on a shorter scale, are ensembles of synchronized cells that function transiently as a closed processing system; the latter, on a larger scale, correspond to the sequential activation of cell assemblies able to represent percepts and behaviors. Nowadays, the recording of large neuronal populations allows for the detection of multiple cell assemblies. Within Hebb’s theory, the next logical step is the analysis of phase sequences. Here we detected phase sequences as consecutive assembly activation patterns, and then analyzed their graph attributes in relation to behavior. We investigated action potentials recorded from the adult rat hippocampus and neocortex before, during and after novel object exploration (experimental periods. Within assembly graphs, each assembly corresponded to a node, and each edge corresponded to the temporal sequence of consecutive node activations. The sum of all assembly activations was proportional to firing rates, but the activity of individual assemblies was not. Assembly repertoire was stable across experimental periods, suggesting that novel experience does not create new assemblies in the adult rat. Assembly graph attributes, on the other hand, varied significantly across behavioral states and experimental periods, and were separable enough to correctly classify experimental periods (Naïve Bayes classifier; maximum AUROCs ranging from 0.55 to 0.99 and behavioral states (waking, slow wave sleep, and rapid eye movement sleep; maximum AUROCs s ranging from 0.64 to 0.98. Our findings agree with Hebb’s view that assemblies correspond to primitive building blocks of representation, nearly unchanged in the adult, while phase sequences are labile across behavioral states and change after novel experience. The results are compatible with a role for phase sequences in behavior

An assembly sequence planning method based on composite algorithm

Directory of Open Access Journals (Sweden)

Enfu LIU

2016-02-01

Full Text Available To solve the combination explosion problem and the blind searching problem in assembly sequence planning of complex products, an assembly sequence planning method based on composite algorithm is proposed. In the composite algorithm, a sufficient number of feasible assembly sequences are generated using formalization reasoning algorithm as the initial population of genetic algorithm. Then fuzzy knowledge of assembly is integrated into the planning process of genetic algorithm and ant algorithm to get the accurate solution. At last, an example is conducted to verify the feasibility of composite algorithm.

Genome sequencing of bacteria: sequencing, de novo assembly and rapid analysis using open source tools.

Science.gov (United States)

Kisand, Veljo; Lettieri, Teresa

2013-04-01

De novo genome sequencing of previously uncharacterized microorganisms has the potential to open up new frontiers in microbial genomics by providing insight into both functional capabilities and biodiversity. Until recently, Roche 454 pyrosequencing was the NGS method of choice for de novo assembly because it generates hundreds of thousands of long reads (tools for processing NGS data are increasingly free and open source and are often adopted for both their high quality and role in promoting academic freedom. The error rate of pyrosequencing the Alcanivorax borkumensis genome was such that thousands of insertions and deletions were artificially introduced into the finished genome. Despite a high coverage (~30 fold), it did not allow the reference genome to be fully mapped. Reads from regions with errors had low quality, low coverage, or were missing. The main defect of the reference mapping was the introduction of artificial indels into contigs through lower than 100% consensus and distracting gene calling due to artificial stop codons. No assembler was able to perform de novo assembly comparable to reference mapping. Automated annotation tools performed similarly on reference mapped and de novo draft genomes, and annotated most CDSs in the de novo assembled draft genomes. Free and open source software (FOSS) tools for assembly and annotation of NGS data are being developed rapidly to provide accurate results with less computational effort. Usability is not high priority and these tools currently do not allow the data to be processed without manual intervention. Despite this, genome assemblers now readily assemble medium short reads into long contigs (>97-98% genome coverage). A notable gap in pyrosequencing technology is the quality of base pair calling and conflicting base pairs between single reads at the same nucleotide position. Regardless, using draft whole genomes that are not finished and remain fragmented into tens of contigs allows one to characterize

Single molecule sequencing-guided scaffolding and correction of draft assemblies.

Science.gov (United States)

Zhu, Shenglong; Chen, Danny Z; Emrich, Scott J

2017-12-06

Although single molecule sequencing is still improving, the lengths of the generated sequences are inevitably an advantage in genome assembly. Prior work that utilizes long reads to conduct genome assembly has mostly focused on correcting sequencing errors and improving contiguity of de novo assemblies. We propose a disassembling-reassembling approach for both correcting structural errors in the draft assembly and scaffolding a target assembly based on error-corrected single molecule sequences. To achieve this goal, we formulate a maximum alternating path cover problem. We prove that this problem is NP-hard, and solve it by a 2-approximation algorithm. Our experimental results show that our approach can improve the structural correctness of target assemblies in the cost of some contiguity, even with smaller amounts of long reads. In addition, our reassembling process can also serve as a competitive scaffolder relative to well-established assembly benchmarks.

Oxford Nanopore MinION Sequencing and Genome Assembly

Directory of Open Access Journals (Sweden)

Hengyun Lu

2016-10-01

Full Text Available The revolution of genome sequencing is continuing after the successful second-generation sequencing (SGS technology. The third-generation sequencing (TGS technology, led by Pacific Biosciences (PacBio, is progressing rapidly, moving from a technology once only capable of providing data for small genome analysis, or for performing targeted screening, to one that promises high quality de novo assembly and structural variation detection for human-sized genomes. In 2014, the MinION, the first commercial sequencer using nanopore technology, was released by Oxford Nanopore Technologies (ONT. MinION identifies DNA bases by measuring the changes in electrical conductivity generated as DNA strands pass through a biological pore. Its portability, affordability, and speed in data production makes it suitable for real-time applications, the release of the long read sequencer MinION has thus generated much excitement and interest in the genomics community. While de novo genome assemblies can be cheaply produced from SGS data, assembly continuity is often relatively poor, due to the limited ability of short reads to handle long repeats. Assembly quality can be greatly improved by using TGS long reads, since repetitive regions can be easily expanded into using longer sequencing lengths, despite having higher error rates at the base level. The potential of nanopore sequencing has been demonstrated by various studies in genome surveillance at locations where rapid and reliable sequencing is needed, but where resources are limited.

Next-generation sequencing of multiple individuals per barcoded library by deconvolution of sequenced amplicons using endonuclease fragment analysis

DEFF Research Database (Denmark)

Andersen, Jeppe D; Pereira, Vania; Pietroni, Carlotta

2014-01-01

The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease...... digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72...... individuals using only 24 barcoded libraries....

Optimum Assembly Sequence Planning System Using Discrete Artificial Bee Colony Algorithm

Directory of Open Access Journals (Sweden)

Özkan Özmen

2018-01-01

Full Text Available Assembly refers both to the process of combining parts to create a structure and to the product resulting therefrom. The complexity of this process increases with the number of pieces in the assembly. This paper presents the assembly planning system design (APSD program, a computer program developed based on a matrix-based approach and the discrete artificial bee colony (DABC algorithm, which determines the optimum assembly sequence among numerous feasible assembly sequences (FAS. Specifically, the assembly sequences of three-dimensional (3D parts prepared in the computer-aided design (CAD software AutoCAD are first coded using the matrix-based methodology and the resulting FAS are assessed and the optimum assembly sequence is selected according to the assembly time optimisation criterion using DABC. The results of comparison of the performance of the proposed method with other methods proposed in the literature verify its superiority in finding the sequence with the lowest overall time. Further, examination of the results of application of APSD to assemblies consisting of parts in different numbers and shapes shows that it can select the optimum sequence from among hundreds of FAS.

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

Science.gov (United States)

Prakash, Celine; Haeseler, Arndt Von

2017-03-01

RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

Human Contamination in Public Genome Assemblies.

Science.gov (United States)

Kryukov, Kirill; Imanishi, Tadashi

2016-01-01

Contamination in genome assembly can lead to wrong or confusing results when using such genome as reference in sequence comparison. Although bacterial contamination is well known, the problem of human-originated contamination received little attention. In this study we surveyed 45,735 available genome assemblies for evidence of human contamination. We used lineage specificity to distinguish between contamination and conservation. We found that 154 genome assemblies contain fragments that with high confidence originate as contamination from human DNA. Majority of contaminating human sequences were present in the reference human genome assembly for over a decade. We recommend that existing contaminated genomes should be revised to remove contaminated sequence, and that new assemblies should be thoroughly checked for presence of human DNA before submitting them to public databases.

Identification of optimum sequencing depth especially for de novo genome assembly of small genomes using next generation sequencing data.

Science.gov (United States)

Desai, Aarti; Marwah, Veer Singh; Yadav, Akshay; Jha, Vineet; Dhaygude, Kishor; Bangar, Ujwala; Kulkarni, Vivek; Jere, Abhay

2013-01-01

Next Generation Sequencing (NGS) is a disruptive technology that has found widespread acceptance in the life sciences research community. The high throughput and low cost of sequencing has encouraged researchers to undertake ambitious genomic projects, especially in de novo genome sequencing. Currently, NGS systems generate sequence data as short reads and de novo genome assembly using these short reads is computationally very intensive. Due to lower cost of sequencing and higher throughput, NGS systems now provide the ability to sequence genomes at high depth. However, currently no report is available highlighting the impact of high sequence depth on genome assembly using real data sets and multiple assembly algorithms. Recently, some studies have evaluated the impact of sequence coverage, error rate and average read length on genome assembly using multiple assembly algorithms, however, these evaluations were performed using simulated datasets. One limitation of using simulated datasets is that variables such as error rates, read length and coverage which are known to impact genome assembly are carefully controlled. Hence, this study was undertaken to identify the minimum depth of sequencing required for de novo assembly for different sized genomes using graph based assembly algorithms and real datasets. Illumina reads for E.coli (4.6 MB) S.kudriavzevii (11.18 MB) and C.elegans (100 MB) were assembled using SOAPdenovo, Velvet, ABySS, Meraculous and IDBA-UD. Our analysis shows that 50X is the optimum read depth for assembling these genomes using all assemblers except Meraculous which requires 100X read depth. Moreover, our analysis shows that de novo assembly from 50X read data requires only 6-40 GB RAM depending on the genome size and assembly algorithm used. We believe that this information can be extremely valuable for researchers in designing experiments and multiplexing which will enable optimum utilization of sequencing as well as analysis resources.

Plantagora: modeling whole genome sequencing and assembly of plant genomes.

Directory of Open Access Journals (Sweden)

Roger Barthelson

Full Text Available BACKGROUND: Genomics studies are being revolutionized by the next generation sequencing technologies, which have made whole genome sequencing much more accessible to the average researcher. Whole genome sequencing with the new technologies is a developing art that, despite the large volumes of data that can be produced, may still fail to provide a clear and thorough map of a genome. The Plantagora project was conceived to address specifically the gap between having the technical tools for genome sequencing and knowing precisely the best way to use them. METHODOLOGY/PRINCIPAL FINDINGS: For Plantagora, a platform was created for generating simulated reads from several different plant genomes of different sizes. The resulting read files mimicked either 454 or Illumina reads, with varying paired end spacing. Thousands of datasets of reads were created, most derived from our primary model genome, rice chromosome one. All reads were assembled with different software assemblers, including Newbler, Abyss, and SOAPdenovo, and the resulting assemblies were evaluated by an extensive battery of metrics chosen for these studies. The metrics included both statistics of the assembly sequences and fidelity-related measures derived by alignment of the assemblies to the original genome source for the reads. The results were presented in a website, which includes a data graphing tool, all created to help the user compare rapidly the feasibility and effectiveness of different sequencing and assembly strategies prior to testing an approach in the lab. Some of our own conclusions regarding the different strategies were also recorded on the website. CONCLUSIONS/SIGNIFICANCE: Plantagora provides a substantial body of information for comparing different approaches to sequencing a plant genome, and some conclusions regarding some of the specific approaches. Plantagora also provides a platform of metrics and tools for studying the process of sequencing and assembly

Ab initio protein structure assembly using continuous structure fragments and optimized knowledge-based force field.

Science.gov (United States)

Xu, Dong; Zhang, Yang

2012-07-01

Ab initio protein folding is one of the major unsolved problems in computational biology owing to the difficulties in force field design and conformational search. We developed a novel program, QUARK, for template-free protein structure prediction. Query sequences are first broken into fragments of 1-20 residues where multiple fragment structures are retrieved at each position from unrelated experimental structures. Full-length structure models are then assembled from fragments using replica-exchange Monte Carlo simulations, which are guided by a composite knowledge-based force field. A number of novel energy terms and Monte Carlo movements are introduced and the particular contributions to enhancing the efficiency of both force field and search engine are analyzed in detail. QUARK prediction procedure is depicted and tested on the structure modeling of 145 nonhomologous proteins. Although no global templates are used and all fragments from experimental structures with template modeling score >0.5 are excluded, QUARK can successfully construct 3D models of correct folds in one-third cases of short proteins up to 100 residues. In the ninth community-wide Critical Assessment of protein Structure Prediction experiment, QUARK server outperformed the second and third best servers by 18 and 47% based on the cumulative Z-score of global distance test-total scores in the FM category. Although ab initio protein folding remains a significant challenge, these data demonstrate new progress toward the solution of the most important problem in the field. Copyright © 2012 Wiley Periodicals, Inc.

SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly.

Science.gov (United States)

Wala, Jeremiah; Beroukhim, Rameen

2017-03-01

We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. jwala@broadinstitue.org ; rameen@broadinstitute.org. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

GABenchToB: a genome assembly benchmark tuned on bacteria and benchtop sequencers.

Directory of Open Access Journals (Sweden)

Sebastian Jünemann

Full Text Available De novo genome assembly is the process of reconstructing a complete genomic sequence from countless small sequencing reads. Due to the complexity of this task, numerous genome assemblers have been developed to cope with different requirements and the different kinds of data provided by sequencers within the fast evolving field of next-generation sequencing technologies. In particular, the recently introduced generation of benchtop sequencers, like Illumina's MiSeq and Ion Torrent's Personal Genome Machine (PGM, popularized the easy, fast, and cheap sequencing of bacterial organisms to a broad range of academic and clinical institutions. With a strong pragmatic focus, here, we give a novel insight into the line of assembly evaluation surveys as we benchmark popular de novo genome assemblers based on bacterial data generated by benchtop sequencers. Therefore, single-library assemblies were generated, assembled, and compared to each other by metrics describing assembly contiguity and accuracy, and also by practice-oriented criteria as for instance computing time. In addition, we extensively analyzed the effect of the depth of coverage on the genome assemblies within reasonable ranges and the k-mer optimization problem of de Bruijn Graph assemblers. Our results show that, although both MiSeq and PGM allow for good genome assemblies, they require different approaches. They not only pair with different assembler types, but also affect assemblies differently regarding the depth of coverage where oversampling can become problematic. Assemblies vary greatly with respect to contiguity and accuracy but also by the requirement on the computing power. Consequently, no assembler can be rated best for all preconditions. Instead, the given kind of data, the demands on assembly quality, and the available computing infrastructure determines which assembler suits best. The data sets, scripts and all additional information needed to replicate our results are freely

Solving Assembly Sequence Planning using Angle Modulated Simulated Kalman Filter

Science.gov (United States)

Mustapa, Ainizar; Yusof, Zulkifli Md.; Adam, Asrul; Muhammad, Badaruddin; Ibrahim, Zuwairie

2018-03-01

This paper presents an implementation of Simulated Kalman Filter (SKF) algorithm for optimizing an Assembly Sequence Planning (ASP) problem. The SKF search strategy contains three simple steps; predict-measure-estimate. The main objective of the ASP is to determine the sequence of component installation to shorten assembly time or save assembly costs. Initially, permutation sequence is generated to represent each agent. Each agent is then subjected to a precedence matrix constraint to produce feasible assembly sequence. Next, the Angle Modulated SKF (AMSKF) is proposed for solving ASP problem. The main idea of the angle modulated approach in solving combinatorial optimization problem is to use a function, g(x), to create a continuous signal. The performance of the proposed AMSKF is compared against previous works in solving ASP by applying BGSA, BPSO, and MSPSO. Using a case study of ASP, the results show that AMSKF outperformed all the algorithms in obtaining the best solution.

Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data.

Science.gov (United States)

Chin, Chen-Shan; Alexander, David H; Marks, Patrick; Klammer, Aaron A; Drake, James; Heiner, Cheryl; Clum, Alicia; Copeland, Alex; Huddleston, John; Eichler, Evan E; Turner, Stephen W; Korlach, Jonas

2013-06-01

We present a hierarchical genome-assembly process (HGAP) for high-quality de novo microbial genome assemblies using only a single, long-insert shotgun DNA library in conjunction with Single Molecule, Real-Time (SMRT) DNA sequencing. Our method uses the longest reads as seeds to recruit all other reads for construction of highly accurate preassembled reads through a directed acyclic graph-based consensus procedure, which we follow with assembly using off-the-shelf long-read assemblers. In contrast to hybrid approaches, HGAP does not require highly accurate raw reads for error correction. We demonstrate efficient genome assembly for several microorganisms using as few as three SMRT Cell zero-mode waveguide arrays of sequencing and for BACs using just one SMRT Cell. Long repeat regions can be successfully resolved with this workflow. We also describe a consensus algorithm that incorporates SMRT sequencing primary quality values to produce de novo genome sequence exceeding 99.999% accuracy.

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

Science.gov (United States)

Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

2017-01-01

Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

Tablet—next generation sequence assembly visualization

Science.gov (United States)

Milne, Iain; Bayer, Micha; Cardle, Linda; Shaw, Paul; Stephen, Gordon; Wright, Frank; Marshall, David

2010-01-01

Summary: Tablet is a lightweight, high-performance graphical viewer for next-generation sequence assemblies and alignments. Supporting a range of input assembly formats, Tablet provides high-quality visualizations showing data in packed or stacked views, allowing instant access and navigation to any region of interest, and whole contig overviews and data summaries. Tablet is both multi-core aware and memory efficient, allowing it to handle assemblies containing millions of reads, even on a 32-bit desktop machine. Availability: Tablet is freely available for Microsoft Windows, Apple Mac OS X, Linux and Solaris. Fully bundled installers can be downloaded from http://bioinf.scri.ac.uk/tablet in 32- and 64-bit versions. Contact: tablet@scri.ac.uk PMID:19965881

A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies.

Science.gov (United States)

Utturkar, Sagar M; Klingeman, Dawn M; Hurt, Richard A; Brown, Steven D

2017-01-01

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.

Getting complete genomes from complex samples using nanopore sequencing

DEFF Research Database (Denmark)

Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads

Background Short read DNA sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes......, as they are mostly fragmented, incomplete and often contaminated with foreign DNA. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and there is some uncertainty of what is missing1. The genetic material most often missed is important multi......-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. However, long read sequencing technologies are emerging promising an end to fragmented genome assemblies2. Experimental design We extracted DNA from a full...

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

Science.gov (United States)

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

De novo protein structure prediction by dynamic fragment assembly and conformational space annealing.

Science.gov (United States)

Lee, Juyong; Lee, Jinhyuk; Sasaki, Takeshi N; Sasai, Masaki; Seok, Chaok; Lee, Jooyoung

2011-08-01

Ab initio protein structure prediction is a challenging problem that requires both an accurate energetic representation of a protein structure and an efficient conformational sampling method for successful protein modeling. In this article, we present an ab initio structure prediction method which combines a recently suggested novel way of fragment assembly, dynamic fragment assembly (DFA) and conformational space annealing (CSA) algorithm. In DFA, model structures are scored by continuous functions constructed based on short- and long-range structural restraint information from a fragment library. Here, DFA is represented by the full-atom model by CHARMM with the addition of the empirical potential of DFIRE. The relative contributions between various energy terms are optimized using linear programming. The conformational sampling was carried out with CSA algorithm, which can find low energy conformations more efficiently than simulated annealing used in the existing DFA study. The newly introduced DFA energy function and CSA sampling algorithm are implemented into CHARMM. Test results on 30 small single-domain proteins and 13 template-free modeling targets of the 8th Critical Assessment of protein Structure Prediction show that the current method provides comparable and complementary prediction results to existing top methods. Copyright © 2011 Wiley-Liss, Inc.

Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

Directory of Open Access Journals (Sweden)

Leterrier Christine

2010-07-01

Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs

DEFF Research Database (Denmark)

Yuan, Xiao Long; Zhang, Zhe; Pan, Rong Yang

2017-01-01

sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40...

Transcriptome sequencing and de novo assembly in arecanut, Areca catechu L elucidates the secondary metabolite pathway genes

Directory of Open Access Journals (Sweden)

Ramaswamy Manimekalai

2018-03-01

Full Text Available Areca catechu L. belongs to the Arecaceae family which comprises many economically important palms. The palm is a source of alkaloids and carotenoids. The lack of ample genetic information in public databases has been a constraint for the genetic improvement of arecanut. To gain molecular insight into the palm, high throughput RNA sequencing and de novo assembly of arecanut leaf transcriptome was undertaken in the present study. A total 56,321,907 paired end reads of 101 bp length consisting of 11.343 Gb nucleotides were generated. De novo assembly resulted in 48,783 good quality transcripts, of which 67% of transcripts could be annotated against NCBI non – redundant database. The Gene Ontology (GO analysis with UniProt database identified 9222 biological process, 11268 molecular function and 7574 cellular components GO terms. Large scale expression profiling through Fragments per Kilobase per Million mapped reads (FPKM showed major genes involved in different metabolic pathways of the plant. Metabolic pathway analysis of the assembled transcripts identified 124 plant related pathways. The transcripts related to carotenoid and alkaloid biosynthetic pathways had more number of reads and FPKM values suggesting higher expression of these genes. The arecanut transcript sequences generated in the study showed high similarity with coconut, oil palm and date palm sequences retrieved from public domains. We also identified 6853 genic SSR regions in the arecanut. The possible primers were designed for SSR detection and this would simplify the future efforts in genetic characterization of arecanut.

INTEGRATION OF SHIP HULL ASSEMBLY SEQUENCE PLANNING, SCHEDULING AND BUDGETING

Directory of Open Access Journals (Sweden)

Remigiusz Romuald Iwańkowicz

2015-02-01

Full Text Available The specificity of the yard work requires the particularly careful treatment of the issues of scheduling and budgeting in the production planning processes. The article presents the method of analysis of the assembly sequence taking into account the duration of individual activities and the demand for resources. A method of the critical path and resource budgeting were used. Modelling of the assembly was performed using the acyclic graphs. It has been shown that the assembly sequences can have very different feasible budget regions. The proposed model is applied to the assembly processes of large-scale welded structures, including the hulls of ships. The presented computational examples have a simulation character. They show the usefulness of the model and the possibility to use it in a variety of analyses.

Capillary electrophoresis fragment analysis and clone sequencing in detection of dynamic mutations of spinocerebellar ataxia

Directory of Open Access Journals (Sweden)

Yuan-yuan CHEN

2018-04-01

Full Text Available Objective To estimate the accuracy and stability of capillary electrophoresis fragment analysis and clone sequencing in detecting dynamic mutations of spinocerebellar ataxia (SCA. Methods Capillary electrophoresis fragment analysis and clone sequencing were used in detecting trinucleotide repeated sequence of 14 SCA patients (3 cases of SCA2, 2 cases of SCA7, 7 cases of SCA8 and 2 cases of SCA17. Results Capillary electrophoresis fragment analysis of 3 SCA2 cases showed the expanded cytosine-adenine-guanine (CAG repeats were 31, 30 and 32, and the copy numbers of 3 clone sequencing for 3 colonies in each case were 37/40/40, 37/38/39 and 38/39/40 respectively. Capillary electrophoresis fragment analysis of 2 SCA7 cases showed the expanded CAG repeats were 57 and 34, and the copy numbers of repeats were 69, 74, 75 in 3 colonies of one case, and was 45 in the other case. For the 7 SCA8 cases with the expanded cytosine-thymine-adenine (CTA/cytosine-thymine-guanine (CTG repeats of 99, 111, 104, 92, 89, 104 and 75, the results of clone sequencing were 97, 116, 104, 90, 90, 102 and 76 respectively. For 2 SCA17 cases with the short/expanded CAG repeats of 37/50 and 36/45, the results of clone sequencing were 51/50/52 and 45/44 for 3 and 2 colonies. Conclusions Although the higher mobility of polymerase chain reaction (PCR products containing dynamic mutation in the capillary electrophoresis fragment analysis might cause the deviation for analysis of copy numbers, the deviation was predictable and the results were repeatable. The clone sequencing results showed obvious instability, especially for SCA2 and SCA7 genes, which might owing to their simple CAG repeats. Consequently, clone sequencing is not suited for detection of dynamic mutation, not to mention the quantitative criteria of dynamic mutation sequencing. DOI: 10.3969/j.issn.1672-6731.2018.03.008

BESST--efficient scaffolding of large fragmented assemblies.

Science.gov (United States)

Sahlin, Kristoffer; Vezzi, Francesco; Nystedt, Björn; Lundeberg, Joakim; Arvestad, Lars

2014-08-15

The use of short reads from High Throughput Sequencing (HTS) techniques is now commonplace in de novo assembly. Yet, obtaining contiguous assemblies from short reads is challenging, thus making scaffolding an important step in the assembly pipeline. Different algorithms have been proposed but many of them use the number of read pairs supporting a linking of two contigs as an indicator of reliability. This reasoning is intuitive, but fails to account for variation in link count due to contig features.We have also noted that published scaffolders are only evaluated on small datasets using output from only one assembler. Two issues arise from this. Firstly, some of the available tools are not well suited for complex genomes. Secondly, these evaluations provide little support for inferring a software's general performance. We propose a new algorithm, implemented in a tool called BESST, which can scaffold genomes of all sizes and complexities and was used to scaffold the genome of P. abies (20 Gbp). We performed a comprehensive comparison of BESST against the most popular stand-alone scaffolders on a large variety of datasets. Our results confirm that some of the popular scaffolders are not practical to run on complex datasets. Furthermore, no single stand-alone scaffolder outperforms the others on all datasets. However, BESST fares favorably to the other tested scaffolders on GAGE datasets and, moreover, outperforms the other methods when library insert size distribution is wide. We conclude from our results that information sources other than the quantity of links, as is commonly used, can provide useful information about genome structure when scaffolding.

De novo assembly of human genomes with massively parallel short read sequencing

DEFF Research Database (Denmark)

Li, Ruiqiang; Zhu, Hongmei; Ruan, Jue

2010-01-01

genomes from short read sequences. We successfully assembled both the Asian and African human genome sequences, achieving an N50 contig size of 7.4 and 5.9 kilobases (kb) and scaffold of 446.3 and 61.9 kb, respectively. The development of this de novo short read assembly method creates new opportunities...... for building reference sequences and carrying out accurate analyses of unexplored genomes in a cost-effective way....

Next generation sequencing (NGS)technologies and applications

Energy Technology Data Exchange (ETDEWEB)

Vuyisich, Momchilo [Los Alamos National Laboratory

2012-09-11

NGS technology overview: (1) NGS library preparation - Nucleic acids extraction, Sample quality control, RNA conversion to cDNA, Addition of sequencing adapters, Quality control of library; (2) Sequencing - Clonal amplification of library fragments, (except PacBio), Sequencing by synthesis, Data output (reads and quality); and (3) Data analysis - Read mapping, Genome assembly, Gene expression, Operon structure, sRNA discovery, and Epigenetic analyses.

Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

Science.gov (United States)

Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

2017-01-25

Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

Reducing assembly complexity of microbial genomes with single-molecule sequencing

Science.gov (United States)

Genome assembly algorithms cannot fully reconstruct microbial chromosomes from the DNA reads output by first or second-generation sequencing instruments. Therefore, most genomes are left unfinished due to the significant resources required to manually close gaps left in the draft assemblies. Single-...

Graph mining for next generation sequencing: leveraging the assembly graph for biological insights.

Science.gov (United States)

Warnke-Sommer, Julia; Ali, Hesham

2016-05-06

The assembly of Next Generation Sequencing (NGS) reads remains a challenging task. This is especially true for the assembly of metagenomics data that originate from environmental samples potentially containing hundreds to thousands of unique species. The principle objective of current assembly tools is to assemble NGS reads into contiguous stretches of sequence called contigs while maximizing for both accuracy and contig length. The end goal of this process is to produce longer contigs with the major focus being on assembly only. Sequence read assembly is an aggregative process, during which read overlap relationship information is lost as reads are merged into longer sequences or contigs. The assembly graph is information rich and capable of capturing the genomic architecture of an input read data set. We have developed a novel hybrid graph in which nodes represent sequence regions at different levels of granularity. This model, utilized in the assembly and analysis pipeline Focus, presents a concise yet feature rich view of a given input data set, allowing for the extraction of biologically relevant graph structures for graph mining purposes. Focus was used to create hybrid graphs to model metagenomics data sets obtained from the gut microbiomes of five individuals with Crohn's disease and eight healthy individuals. Repetitive and mobile genetic elements are found to be associated with hybrid graph structure. Using graph mining techniques, a comparative study of the Crohn's disease and healthy data sets was conducted with focus on antibiotics resistance genes associated with transposase genes. Results demonstrated significant differences in the phylogenetic distribution of categories of antibiotics resistance genes in the healthy and diseased patients. Focus was also evaluated as a pure assembly tool and produced excellent results when compared against the Meta-velvet, Omega, and UD-IDBA assemblers. Mining the hybrid graph can reveal biological phenomena captured

Binning of shallowly sampled metagenomic sequence fragments reveals that low abundance bacteria play important roles in sulfur cycling and degradation of complex organic polymers in an acid mine drainage community

Science.gov (United States)

Dick, G. J.; Andersson, A.; Banfield, J. F.

2007-12-01

Our understanding of environmental microbiology has been greatly enhanced by community genome sequencing of DNA recovered directly the environment. Community genomics provides insights into the diversity, community structure, metabolic function, and evolution of natural populations of uncultivated microbes, thereby revealing dynamics of how microorganisms interact with each other and their environment. Recent studies have demonstrated the potential for reconstructing near-complete genomes from natural environments while highlighting the challenges of analyzing community genomic sequence, especially from diverse environments. A major challenge of shotgun community genome sequencing is identification of DNA fragments from minor community members for which only low coverage of genomic sequence is present. We analyzed community genome sequence retrieved from biofilms in an acid mine drainage (AMD) system in the Richmond Mine at Iron Mountain, CA, with an emphasis on identification and assembly of DNA fragments from low-abundance community members. The Richmond mine hosts an extensive, relatively low diversity subterranean chemolithoautotrophic community that is sustained entirely by oxidative dissolution of pyrite. The activity of these microorganisms greatly accelerates the generation of AMD. Previous and ongoing work in our laboratory has focused on reconstrucing genomes of dominant community members, including several bacteria and archaea. We binned contigs from several samples (including one new sample and two that had been previously analyzed) by tetranucleotide frequency with clustering by Self-Organizing Maps (SOM). The binning, evaluated by comparison with information from the manually curated assembly of the dominant organisms, was found to be very effective: fragments were correctly assigned with 95% accuracy. Improperly assigned fragments often contained sequences that are either evolutionarily constrained (e.g. 16S rRNA genes) or mobile elements that are

Extensive error in the number of genes inferred from draft genome assemblies.

Directory of Open Access Journals (Sweden)

James F Denton

2014-12-01

Full Text Available Current sequencing methods produce large amounts of data, but genome assemblies based on these data are often woefully incomplete. These incomplete and error-filled assemblies result in many annotation errors, especially in the number of genes present in a genome. In this paper we investigate the magnitude of the problem, both in terms of total gene number and the number of copies of genes in specific families. To do this, we compare multiple draft assemblies against higher-quality versions of the same genomes, using several new assemblies of the chicken genome based on both traditional and next-generation sequencing technologies, as well as published draft assemblies of chimpanzee. We find that upwards of 40% of all gene families are inferred to have the wrong number of genes in draft assemblies, and that these incorrect assemblies both add and subtract genes. Using simulated genome assemblies of Drosophila melanogaster, we find that the major cause of increased gene numbers in draft genomes is the fragmentation of genes onto multiple individual contigs. Finally, we demonstrate the usefulness of RNA-Seq in improving the gene annotation of draft assemblies, largely by connecting genes that have been fragmented in the assembly process.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

The fast changing landscape of sequencing technologies and their impact on microbial genome assemblies and annotation.

Science.gov (United States)

Mavromatis, Konstantinos; Land, Miriam L; Brettin, Thomas S; Quest, Daniel J; Copeland, Alex; Clum, Alicia; Goodwin, Lynne; Woyke, Tanja; Lapidus, Alla; Klenk, Hans Peter; Cottingham, Robert W; Kyrpides, Nikos C

2012-01-01

The emergence of next generation sequencing (NGS) has provided the means for rapid and high throughput sequencing and data generation at low cost, while concomitantly creating a new set of challenges. The number of available assembled microbial genomes continues to grow rapidly and their quality reflects the quality of the sequencing technology used, but also of the analysis software employed for assembly and annotation. In this work, we have explored the quality of the microbial draft genomes across various sequencing technologies. We have compared the draft and finished assemblies of 133 microbial genomes sequenced at the Department of Energy-Joint Genome Institute and finished at the Los Alamos National Laboratory using a variety of combinations of sequencing technologies, reflecting the transition of the institute from Sanger-based sequencing platforms to NGS platforms. The quality of the public assemblies and of the associated gene annotations was evaluated using various metrics. Results obtained with the different sequencing technologies, as well as their effects on downstream processes, were analyzed. Our results demonstrate that the Illumina HiSeq 2000 sequencing system, the primary sequencing technology currently used for de novo genome sequencing and assembly at JGI, has various advantages in terms of total sequence throughput and cost, but it also introduces challenges for the downstream analyses. In all cases assembly results although on average are of high quality, need to be viewed critically and consider sources of errors in them prior to analysis. These data follow the evolution of microbial sequencing and downstream processing at the JGI from draft genome sequences with large gaps corresponding to missing genes of significant biological role to assemblies with multiple small gaps (Illumina) and finally to assemblies that generate almost complete genomes (Illumina+PacBio).

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Resolving the Complexity of Human Skin Metagenomes Using Single-Molecule Sequencing

Directory of Open Access Journals (Sweden)

Yu-Chih Tsai

2016-02-01

Full Text Available Deep metagenomic shotgun sequencing has emerged as a powerful tool to interrogate composition and function of complex microbial communities. Computational approaches to assemble genome fragments have been demonstrated to be an effective tool for de novo reconstruction of genomes from these communities. However, the resultant “genomes” are typically fragmented and incomplete due to the limited ability of short-read sequence data to assemble complex or low-coverage regions. Here, we use single-molecule, real-time (SMRT sequencing to reconstruct a high-quality, closed genome of a previously uncharacterized Corynebacterium simulans and its companion bacteriophage from a skin metagenomic sample. Considerable improvement in assembly quality occurs in hybrid approaches incorporating short-read data, with even relatively small amounts of long-read data being sufficient to improve metagenome reconstruction. Using short-read data to evaluate strain variation of this C. simulans in its skin community at single-nucleotide resolution, we observed a dominant C. simulans strain with moderate allelic heterozygosity throughout the population. We demonstrate the utility of SMRT sequencing and hybrid approaches in metagenome quantitation, reconstruction, and annotation.

Resolving the Complexity of Human Skin Metagenomes Using Single-Molecule Sequencing

Science.gov (United States)

Tsai, Yu-Chih; Deming, Clayton; Segre, Julia A.; Kong, Heidi H.; Korlach, Jonas

2016-01-01

ABSTRACT Deep metagenomic shotgun sequencing has emerged as a powerful tool to interrogate composition and function of complex microbial communities. Computational approaches to assemble genome fragments have been demonstrated to be an effective tool for de novo reconstruction of genomes from these communities. However, the resultant “genomes” are typically fragmented and incomplete due to the limited ability of short-read sequence data to assemble complex or low-coverage regions. Here, we use single-molecule, real-time (SMRT) sequencing to reconstruct a high-quality, closed genome of a previously uncharacterized Corynebacterium simulans and its companion bacteriophage from a skin metagenomic sample. Considerable improvement in assembly quality occurs in hybrid approaches incorporating short-read data, with even relatively small amounts of long-read data being sufficient to improve metagenome reconstruction. Using short-read data to evaluate strain variation of this C. simulans in its skin community at single-nucleotide resolution, we observed a dominant C. simulans strain with moderate allelic heterozygosity throughout the population. We demonstrate the utility of SMRT sequencing and hybrid approaches in metagenome quantitation, reconstruction, and annotation. PMID:26861018

Sequencing and De Novo Transcriptome Assembly of Brachypodium sylvaticum (Poaceae

Directory of Open Access Journals (Sweden)

Samuel E. Fox

2013-03-01

Full Text Available Premise of the study: We report the de novo assembly and characterization of the transcriptomes of Brachypodium sylvaticum (slender false-brome accessions from native populations of Spain and Greece, and an invasive population west of Corvallis, Oregon, USA. Methods and Results: More than 350 million sequence reads from the mRNA libraries prepared from three B. sylvaticum genotypes were assembled into 120,091 (Corvallis, 104,950 (Spain, and 177,682 (Greece transcript contigs. In comparison with the B. distachyon Bd21 reference genome and GenBank protein sequences, we estimate >90% exome coverage for B. sylvaticum. The transcripts were assigned Gene Ontology and InterPro annotations. Brachypodium sylvaticum sequence reads aligned against the Bd21 genome revealed 394,654 single-nucleotide polymorphisms (SNPs and >20,000 simple sequence repeat (SSR DNA sites. Conclusions: To our knowledge, this is the first report of transcriptome sequencing of invasive plant species with a closely related sequenced reference genome. The sequences and identified SNP variant and SSR sites will provide tools for developing novel genetic markers for use in genotyping and characterization of invasive behavior of B. sylvaticum.

New tool to assemble repetitive regions using next-generation sequencing data

Science.gov (United States)

Kuśmirek, Wiktor; Nowak, Robert M.; Neumann, Łukasz

2017-08-01

The next generation sequencing techniques produce a large amount of sequencing data. Some part of the genome are composed of repetitive DNA sequences, which are very problematic for the existing genome assemblers. We propose a modification of the algorithm for a DNA assembly, which uses the relative frequency of reads to properly reconstruct repetitive sequences. The new approach was implemented and tested, as a demonstration of the capability of our software we present some results for model organisms. The new implementation, using a three-layer software architecture was selected, where the presentation layer, data processing layer, and data storage layer were kept separate. Source code as well as demo application with web interface and the additional data are available at project web-page: http://dnaasm.sourceforge.net.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

The sequence and de novo assembly of the giant panda genome

Science.gov (United States)

Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun

2013-01-01

Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809

Syntactic sequencing in Hebbian cell assemblies.

Science.gov (United States)

Wennekers, Thomas; Palm, Günther

2009-12-01

Hebbian cell assemblies provide a theoretical framework for the modeling of cognitive processes that grounds them in the underlying physiological neural circuits. Recently we have presented an extension of cell assemblies by operational components which allows to model aspects of language, rules, and complex behaviour. In the present work we study the generation of syntactic sequences using operational cell assemblies timed by unspecific trigger signals. Syntactic patterns are implemented in terms of hetero-associative transition graphs in attractor networks which cause a directed flow of activity through the neural state space. We provide regimes for parameters that enable an unspecific excitatory control signal to switch reliably between attractors in accordance with the implemented syntactic rules. If several target attractors are possible in a given state, noise in the system in conjunction with a winner-takes-all mechanism can randomly choose a target. Disambiguation can also be guided by context signals or specific additional external signals. Given a permanently elevated level of external excitation the model can enter an autonomous mode, where it generates temporal grammatical patterns continuously.

Long-read sequencing and de novo assembly of a Chinese genome

Science.gov (United States)

Short-read sequencing has enabled the de novo assembly of several individual human genomes, but with inherent limitations in characterizing repeat elements. Here we sequence a Chinese individual HX1 by single-molecule real-time (SMRT) long-read sequencing, construct a physical map by NanoChannel arr...

Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

Science.gov (United States)

Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

2017-11-21

Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

NxRepair: error correction in de novo sequence assembly using Nextera mate pairs

Directory of Open Access Journals (Sweden)

Rebecca R. Murphy

2015-06-01

Full Text Available Scaffolding errors and incorrect repeat disambiguation during de novo assembly can result in large scale misassemblies in draft genomes. Nextera mate pair sequencing data provide additional information to resolve assembly ambiguities during scaffolding. Here, we introduce NxRepair, an open source toolkit for error correction in de novo assemblies that uses Nextera mate pair libraries to identify and correct large-scale errors. We show that NxRepair can identify and correct large scaffolding errors, without use of a reference sequence, resulting in quantitative improvements in the assembly quality. NxRepair can be downloaded from GitHub or PyPI, the Python Package Index; a tutorial and user documentation are also available.

Accurate phylogenetic classification of DNA fragments based onsequence composition

Energy Technology Data Exchange (ETDEWEB)

McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

2006-05-01

Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

Gene prediction in metagenomic fragments: A large scale machine learning approach

Directory of Open Access Journals (Sweden)

Morgenstern Burkhard

2008-04-01

Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

Virtual Genome Walking across the 32 Gb Ambystoma mexicanum genome; assembling gene models and intronic sequence.

Science.gov (United States)

Evans, Teri; Johnson, Andrew D; Loose, Matthew

2018-01-12

Large repeat rich genomes present challenges for assembly using short read technologies. The 32 Gb axolotl genome is estimated to contain ~19 Gb of repetitive DNA making an assembly from short reads alone effectively impossible. Indeed, this model species has been sequenced to 20× coverage but the reads could not be conventionally assembled. Using an alternative strategy, we have assembled subsets of these reads into scaffolds describing over 19,000 gene models. We call this method Virtual Genome Walking as it locally assembles whole genome reads based on a reference transcriptome, identifying exons and iteratively extending them into surrounding genomic sequence. These assemblies are then linked and refined to generate gene models including upstream and downstream genomic, and intronic, sequence. Our assemblies are validated by comparison with previously published axolotl bacterial artificial chromosome (BAC) sequences. Our analyses of axolotl intron length, intron-exon structure, repeat content and synteny provide novel insights into the genic structure of this model species. This resource will enable new experimental approaches in axolotl, such as ChIP-Seq and CRISPR and aid in future whole genome sequencing efforts. The assembled sequences and annotations presented here are freely available for download from https://tinyurl.com/y8gydc6n . The software pipeline is available from https://github.com/LooseLab/iterassemble .

SWAP-Assembler 2: Optimization of De Novo Genome Assembler at Large Scale

Energy Technology Data Exchange (ETDEWEB)

Meng, Jintao; Seo, Sangmin; Balaji, Pavan; Wei, Yanjie; Wang, Bingqiang; Feng, Shengzhong

2016-08-16

In this paper, we analyze and optimize the most time-consuming steps of the SWAP-Assembler, a parallel genome assembler, so that it can scale to a large number of cores for huge genomes with the size of sequencing data ranging from terabyes to petabytes. According to the performance analysis results, the most time-consuming steps are input parallelization, k-mer graph construction, and graph simplification (edge merging). For the input parallelization, the input data is divided into virtual fragments with nearly equal size, and the start position and end position of each fragment are automatically separated at the beginning of the reads. In k-mer graph construction, in order to improve the communication efficiency, the message size is kept constant between any two processes by proportionally increasing the number of nucleotides to the number of processes in the input parallelization step for each round. The memory usage is also decreased because only a small part of the input data is processed in each round. With graph simplification, the communication protocol reduces the number of communication loops from four to two loops and decreases the idle communication time. The optimized assembler is denoted as SWAP-Assembler 2 (SWAP2). In our experiments using a 1000 Genomes project dataset of 4 terabytes (the largest dataset ever used for assembling) on the supercomputer Mira, the results show that SWAP2 scales to 131,072 cores with an efficiency of 40%. We also compared our work with both the HipMER assembler and the SWAP-Assembler. On the Yanhuang dataset of 300 gigabytes, SWAP2 shows a 3X speedup and 4X better scalability compared with the HipMer assembler and is 45 times faster than the SWAP-Assembler. The SWAP2 software is available at https://sourceforge.net/projects/swapassembler.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Sequencing and de novo assembly of 150 genomes from Denmark as a population reference

DEFF Research Database (Denmark)

Maretty, Lasse; Jensen, Jacob Malte; Petersen, Bent

2017-01-01

Hundreds of thousands of human genomes are now being sequenced to characterize genetic variation and use this information to augment association mapping studies of complex disorders and other phenotypic traits. Genetic variation is identified mainly by mapping short reads to the reference genome......-coverage sequencing with mate-pair libraries extending up to 20 kilobases. We report de novo assemblies of 150 individuals (50 trios) from the GenomeDenmark project. The quality of these assemblies is similar to those obtained using the more expensive long-read technology. We use the assemblies to identify a rich set...... or by performing local assembly. However, these approaches are biased against discovery of structural variants and variation in the more complex parts of the genome. Hence, large-scale de novo assembly is needed. Here we show that it is possible to construct excellent de novo assemblies from high...

Sequencing and de novo assembly of 150 genomes from Denmark as a population reference

DEFF Research Database (Denmark)

Maretty, Lasse; Jensen, Jacob Malte; Petersen, Bent

2017-01-01

Hundreds of thousands of human genomes are now being sequenced to characterize genetic variation and use this information to augment association mapping studies of complex disorders and other phenotypic traits. Genetic variation is identified mainly by mapping short reads to the reference genome...... or by performing local assembly. However, these approaches are biased against discovery of structural variants and variation in the more complex parts of the genome. Hence, large-scale de novo assembly is needed. Here we show that it is possible to construct excellent de novo assemblies from high......-coverage sequencing with mate-pair libraries extending up to 20 kilobases. We report de novo assemblies of 150 individuals (50 trios) from the GenomeDenmark project. The quality of these assemblies is similar to those obtained using the more expensive long-read technology. We use the assemblies to identify a rich set...

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

Science.gov (United States)

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-09-24

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads.

Science.gov (United States)

Wang, Zhiwen; Hobson, Neil; Galindo, Leonardo; Zhu, Shilin; Shi, Daihu; McDill, Joshua; Yang, Linfeng; Hawkins, Simon; Neutelings, Godfrey; Datla, Raju; Lambert, Georgina; Galbraith, David W; Grassa, Christopher J; Geraldes, Armando; Cronk, Quentin C; Cullis, Christopher; Dash, Prasanta K; Kumar, Polumetla A; Cloutier, Sylvie; Sharpe, Andrew G; Wong, Gane K-S; Wang, Jun; Deyholos, Michael K

2012-11-01

Flax (Linum usitatissimum) is an ancient crop that is widely cultivated as a source of fiber, oil and medicinally relevant compounds. To accelerate crop improvement, we performed whole-genome shotgun sequencing of the nuclear genome of flax. Seven paired-end libraries ranging in size from 300 bp to 10 kb were sequenced using an Illumina genome analyzer. A de novo assembly, comprised exclusively of deep-coverage (approximately 94× raw, approximately 69× filtered) short-sequence reads (44-100 bp), produced a set of scaffolds with N(50) =694 kb, including contigs with N(50)=20.1 kb. The contig assembly contained 302 Mb of non-redundant sequence representing an estimated 81% genome coverage. Up to 96% of published flax ESTs aligned to the whole-genome shotgun scaffolds. However, comparisons with independently sequenced BACs and fosmids showed some mis-assembly of regions at the genome scale. A total of 43384 protein-coding genes were predicted in the whole-genome shotgun assembly, and up to 93% of published flax ESTs, and 86% of A. thaliana genes aligned to these predicted genes, indicating excellent coverage and accuracy at the gene level. Analysis of the synonymous substitution rates (K(s) ) observed within duplicate gene pairs was consistent with a recent (5-9 MYA) whole-genome duplication in flax. Within the predicted proteome, we observed enrichment of many conserved domains (Pfam-A) that may contribute to the unique properties of this crop, including agglutinin proteins. Together these results show that de novo assembly, based solely on whole-genome shotgun short-sequence reads, is an efficient means of obtaining nearly complete genome sequence information for some plant species. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

incaRNAfbinv: a web server for the fragment-based design of RNA sequences

Science.gov (United States)

Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

2016-01-01

Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893

IDBA-UD: a de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth.

Science.gov (United States)

Peng, Yu; Leung, Henry C M; Yiu, S M; Chin, Francis Y L

2012-06-01

Next-generation sequencing allows us to sequence reads from a microbial environment using single-cell sequencing or metagenomic sequencing technologies. However, both technologies suffer from the problem that sequencing depth of different regions of a genome or genomes from different species are highly uneven. Most existing genome assemblers usually have an assumption that sequencing depths are even. These assemblers fail to construct correct long contigs. We introduce the IDBA-UD algorithm that is based on the de Bruijn graph approach for assembling reads from single-cell sequencing or metagenomic sequencing technologies with uneven sequencing depths. Several non-trivial techniques have been employed to tackle the problems. Instead of using a simple threshold, we use multiple depthrelative thresholds to remove erroneous k-mers in both low-depth and high-depth regions. The technique of local assembly with paired-end information is used to solve the branch problem of low-depth short repeat regions. To speed up the process, an error correction step is conducted to correct reads of high-depth regions that can be aligned to highconfident contigs. Comparison of the performances of IDBA-UD and existing assemblers (Velvet, Velvet-SC, SOAPdenovo and Meta-IDBA) for different datasets, shows that IDBA-UD can reconstruct longer contigs with higher accuracy. The IDBA-UD toolkit is available at our website http://www.cs.hku.hk/~alse/idba_ud

Programming molecular self-assembly of intrinsically disordered proteins containing sequences of low complexity

Science.gov (United States)

Simon, Joseph R.; Carroll, Nick J.; Rubinstein, Michael; Chilkoti, Ashutosh; López, Gabriel P.

2017-06-01

Dynamic protein-rich intracellular structures that contain phase-separated intrinsically disordered proteins (IDPs) composed of sequences of low complexity (SLC) have been shown to serve a variety of important cellular functions, which include signalling, compartmentalization and stabilization. However, our understanding of these structures and our ability to synthesize models of them have been limited. We present design rules for IDPs possessing SLCs that phase separate into diverse assemblies within droplet microenvironments. Using theoretical analyses, we interpret the phase behaviour of archetypal IDP sequences and demonstrate the rational design of a vast library of multicomponent protein-rich structures that ranges from uniform nano-, meso- and microscale puncta (distinct protein droplets) to multilayered orthogonally phase-separated granular structures. The ability to predict and program IDP-rich assemblies in this fashion offers new insights into (1) genetic-to-molecular-to-macroscale relationships that encode hierarchical IDP assemblies, (2) design rules of such assemblies in cell biology and (3) molecular-level engineering of self-assembled recombinant IDP-rich materials.

PNA Directed Sequence Addressed Self-Assembly of DNA Nanostructures

DEFF Research Database (Denmark)

Nielsen, Peter E.

2008-01-01

sequence specifically recognize another PNA oligomer. We describe how such three domain PNAs have utility for assembling dsDNA grid and clover leaf structures, and in combination with SNAP-tag technol. of protein dsDNA structures. (c) 2008 American Institute of Physics. [on SciFinder (R)] Udgivelsesdato...

Comprehensive evaluation of non-hybrid genome assembly tools for third-generation PacBio long-read sequence data.

Science.gov (United States)

Jayakumar, Vasanthan; Sakakibara, Yasubumi

2017-11-03

Long reads obtained from third-generation sequencing platforms can help overcome the long-standing challenge of the de novo assembly of sequences for the genomic analysis of non-model eukaryotic organisms. Numerous long-read-aided de novo assemblies have been published recently, which exhibited superior quality of the assembled genomes in comparison with those achieved using earlier second-generation sequencing technologies. Evaluating assemblies is important in guiding the appropriate choice for specific research needs. In this study, we evaluated 10 long-read assemblers using a variety of metrics on Pacific Biosciences (PacBio) data sets from different taxonomic categories with considerable differences in genome size. The results allowed us to narrow down the list to a few assemblers that can be effectively applied to eukaryotic assembly projects. Moreover, we highlight how best to use limited genomic resources for effectively evaluating the genome assemblies of non-model organisms. © The Author 2017. Published by Oxford University Press.

Colloidal polymers with controlled sequence and branching constructed from magnetic field assembled nanoparticles.

Science.gov (United States)

Bannwarth, Markus B; Utech, Stefanie; Ebert, Sandro; Weitz, David A; Crespy, Daniel; Landfester, Katharina

2015-03-24

The assembly of nanoparticles into polymer-like architectures is challenging and usually requires highly defined colloidal building blocks. Here, we show that the broad size-distribution of a simple dispersion of magnetic nanocolloids can be exploited to obtain various polymer-like architectures. The particles are assembled under an external magnetic field and permanently linked by thermal sintering. The remarkable variety of polymer-analogue architectures that arises from this simple process ranges from statistical and block copolymer-like sequencing to branched chains and networks. This library of architectures can be realized by controlling the sequencing of the particles and the junction points via a size-dependent self-assembly of the single building blocks.

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

International Nuclear Information System (INIS)

Sage, E.; Moustacchi, E.

1987-01-01

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

Genome-wide SNP identification by high-throughput sequencing and selective mapping allows sequence assembly positioning using a framework genetic linkage map

Directory of Open Access Journals (Sweden)

Xu Xiangming

2010-12-01

Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.

Two-Stage orders sequencing system for mixed-model assembly

Science.gov (United States)

Zemczak, M.; Skolud, B.; Krenczyk, D.

2015-11-01

In the paper, the authors focus on the NP-hard problem of orders sequencing, formulated similarly to Car Sequencing Problem (CSP). The object of the research is the assembly line in an automotive industry company, on which few different models of products, each in a certain number of versions, are assembled on the shared resources, set in a line. Such production type is usually determined as a mixed-model production, and arose from the necessity of manufacturing customized products on the basis of very specific orders from single clients. The producers are nowadays obliged to provide each client the possibility to determine a huge amount of the features of the product they are willing to buy, as the competition in the automotive market is large. Due to the previously mentioned nature of the problem (NP-hard), in the given time period only satisfactory solutions are sought, as the optimal solution method has not yet been found. Most of the researchers that implemented inaccurate methods (e.g. evolutionary algorithms) to solving sequencing problems dropped the research after testing phase, as they were not able to obtain reproducible results, and met problems while determining the quality of the received solutions. Therefore a new approach to solving the problem, presented in this paper as a sequencing system is being developed. The sequencing system consists of a set of determined rules, implemented into computer environment. The system itself works in two stages. First of them is connected with the determination of a place in the storage buffer to which certain production orders should be sent. In the second stage of functioning, precise sets of sequences are determined and evaluated for certain parts of the storage buffer under certain criteria.

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

Directory of Open Access Journals (Sweden)

Ritland Carol

2009-08-01

Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

Science.gov (United States)

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The

Moleculo Long-Read Sequencing Facilitates Assembly and Genomic Binning from Complex Soil Metagenomes

Energy Technology Data Exchange (ETDEWEB)

White, Richard Allen; Bottos, Eric M.; Roy Chowdhury, Taniya; Zucker, Jeremy D.; Brislawn, Colin J.; Nicora, Carrie D.; Fansler, Sarah J.; Glaesemann, Kurt R.; Glass, Kevin; Jansson, Janet K.; Langille, Morgan

2016-06-28

Soil metagenomics has been touted as the “grand challenge” for metagenomics, as the high microbial diversity and spatial heterogeneity of soils make them unamenable to current assembly platforms. Here, we aimed to improve soil metagenomic sequence assembly by applying the Moleculo synthetic long-read sequencing technology. In total, we obtained 267 Gbp of raw sequence data from a native prairie soil; these data included 109.7 Gbp of short-read data (~100 bp) from the Joint Genome Institute (JGI), an additional 87.7 Gbp of rapid-mode read data (~250 bp), plus 69.6 Gbp (>1.5 kbp) from Moleculo sequencing. The Moleculo data alone yielded over 5,600 reads of >10 kbp in length, and over 95% of the unassembled reads mapped to contigs of >1.5 kbp. Hybrid assembly of all data resulted in more than 10,000 contigs over 10 kbp in length. We mapped three replicate metatranscriptomes derived from the same parent soil to the Moleculo subassembly and found that 95% of the predicted genes, based on their assignments to Enzyme Commission (EC) numbers, were expressed. The Moleculo subassembly also enabled binning of >100 microbial genome bins. We obtained via direct binning the first complete genome, that of “CandidatusPseudomonas sp. strain JKJ-1” from a native soil metagenome. By mapping metatranscriptome sequence reads back to the bins, we found that several bins corresponding to low-relative-abundanceAcidobacteriawere highly transcriptionally active, whereas bins corresponding to high-relative-abundanceVerrucomicrobiawere not. These results demonstrate that Moleculo sequencing provides a significant advance for resolving complex soil microbial communities.

IMPORTANCESoil microorganisms carry out key processes for life on our planet, including cycling of carbon and other nutrients and supporting growth of plants. However, there is poor molecular-level understanding of their

Comparing memory-efficient genome assemblers on stand-alone and cloud infrastructures.

Science.gov (United States)

Kleftogiannis, Dimitrios; Kalnis, Panos; Bajic, Vladimir B

2013-01-01

A fundamental problem in bioinformatics is genome assembly. Next-generation sequencing (NGS) technologies produce large volumes of fragmented genome reads, which require large amounts of memory to assemble the complete genome efficiently. With recent improvements in DNA sequencing technologies, it is expected that the memory footprint required for the assembly process will increase dramatically and will emerge as a limiting factor in processing widely available NGS-generated reads. In this report, we compare current memory-efficient techniques for genome assembly with respect to quality, memory consumption and execution time. Our experiments prove that it is possible to generate draft assemblies of reasonable quality on conventional multi-purpose computers with very limited available memory by choosing suitable assembly methods. Our study reveals the minimum memory requirements for different assembly programs even when data volume exceeds memory capacity by orders of magnitude. By combining existing methodologies, we propose two general assembly strategies that can improve short-read assembly approaches and result in reduction of the memory footprint. Finally, we discuss the possibility of utilizing cloud infrastructures for genome assembly and we comment on some findings regarding suitable computational resources for assembly.

Comparing Memory-Efficient Genome Assemblers on Stand-Alone and Cloud Infrastructures

KAUST Repository

Kleftogiannis, Dimitrios A.

2013-09-27

A fundamental problem in bioinformatics is genome assembly. Next-generation sequencing (NGS) technologies produce large volumes of fragmented genome reads, which require large amounts of memory to assemble the complete genome efficiently. With recent improvements in DNA sequencing technologies, it is expected that the memory footprint required for the assembly process will increase dramatically and will emerge as a limiting factor in processing widely available NGS-generated reads. In this report, we compare current memory-efficient techniques for genome assembly with respect to quality, memory consumption and execution time. Our experiments prove that it is possible to generate draft assemblies of reasonable quality on conventional multi-purpose computers with very limited available memory by choosing suitable assembly methods. Our study reveals the minimum memory requirements for different assembly programs even when data volume exceeds memory capacity by orders of magnitude. By combining existing methodologies, we propose two general assembly strategies that can improve short-read assembly approaches and result in reduction of the memory footprint. Finally, we discuss the possibility of utilizing cloud infrastructures for genome assembly and we comment on some findings regarding suitable computational resources for assembly.

BioNano genome mapping of individual chromosomes supports physical mapping and sequence assembly in complex plant genomes.

Science.gov (United States)

Staňková, Helena; Hastie, Alex R; Chan, Saki; Vrána, Jan; Tulpová, Zuzana; Kubaláková, Marie; Visendi, Paul; Hayashi, Satomi; Luo, Mingcheng; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

2016-07-01

The assembly of a reference genome sequence of bread wheat is challenging due to its specific features such as the genome size of 17 Gbp, polyploid nature and prevalence of repetitive sequences. BAC-by-BAC sequencing based on chromosomal physical maps, adopted by the International Wheat Genome Sequencing Consortium as the key strategy, reduces problems caused by the genome complexity and polyploidy, but the repeat content still hampers the sequence assembly. Availability of a high-resolution genomic map to guide sequence scaffolding and validate physical map and sequence assemblies would be highly beneficial to obtaining an accurate and complete genome sequence. Here, we chose the short arm of chromosome 7D (7DS) as a model to demonstrate for the first time that it is possible to couple chromosome flow sorting with genome mapping in nanochannel arrays and create a de novo genome map of a wheat chromosome. We constructed a high-resolution chromosome map composed of 371 contigs with an N50 of 1.3 Mb. Long DNA molecules achieved by our approach facilitated chromosome-scale analysis of repetitive sequences and revealed a ~800-kb array of tandem repeats intractable to current DNA sequencing technologies. Anchoring 7DS sequence assemblies obtained by clone-by-clone sequencing to the 7DS genome map provided a valuable tool to improve the BAC-contig physical map and validate sequence assembly on a chromosome-arm scale. Our results indicate that creating genome maps for the whole wheat genome in a chromosome-by-chromosome manner is feasible and that they will be an affordable tool to support the production of improved pseudomolecules. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Draft Sequencing of the Heterozygous Diploid Genome of Satsuma (Citrus unshiu Marc. Using a Hybrid Assembly Approach

Directory of Open Access Journals (Sweden)

Tokurou Shimizu

2017-12-01

Full Text Available Satsuma (Citrus unshiu Marc. is one of the most abundantly produced mandarin varieties of citrus, known for its seedless fruit production and as a breeding parent of citrus. De novo assembly of the heterozygous diploid genome of Satsuma (“Miyagawa Wase” was conducted by a hybrid assembly approach using short-read sequences, three mate-pair libraries, and a long-read sequence of PacBio by the PLATANUS assembler. The assembled sequence, with a total size of 359.7 Mb at the N50 length of 386,404 bp, consisted of 20,876 scaffolds. Pseudomolecules of Satsuma constructed by aligning the scaffolds to three genetic maps showed genome-wide synteny to the genomes of Clementine, pummelo, and sweet orange. Gene prediction by modeling with MAKER-P proposed 29,024 genes and 37,970 mRNA; additionally, gene prediction analysis found candidates for novel genes in several biosynthesis pathways for gibberellin and violaxanthin catabolism. BUSCO scores for the assembled scaffold and predicted transcripts, and another analysis by BAC end sequence mapping indicated the assembled genome consistency was close to those of the haploid Clementine, pummel, and sweet orange genomes. The number of repeat elements and long terminal repeat retrotransposon were comparable to those of the seven citrus genomes; this suggested no significant failure in the assembly at the repeat region. A resequencing application using the assembled sequence confirmed that both kunenbo-A and Satsuma are offsprings of Kishu, and Satsuma is a back-crossed offspring of Kishu. These results illustrated the performance of the hybrid assembly approach and its ability to construct an accurate heterozygous diploid genome.

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Multi-objective Analysis for a Sequencing Planning of Mixed-model Assembly Line

Science.gov (United States)

Shimizu, Yoshiaki; Waki, Toshiya; Yoo, Jae Kyu

Diversified customer demands are raising importance of just-in-time and agile manufacturing much more than before. Accordingly, introduction of mixed-model assembly lines becomes popular to realize the small-lot-multi-kinds production. Since it produces various kinds on the same assembly line, a rational management is of special importance. With this point of view, this study focuses on a sequencing problem of mixed-model assembly line including a paint line as its preceding process. By taking into account the paint line together, reducing work-in-process (WIP) inventory between these heterogeneous lines becomes a major concern of the sequencing problem besides improving production efficiency. Finally, we have formulated the sequencing problem as a bi-objective optimization problem to prevent various line stoppages, and to reduce the volume of WIP inventory simultaneously. Then we have proposed a practical method for the multi-objective analysis. For this purpose, we applied the weighting method to derive the Pareto front. Actually, the resulting problem is solved by a meta-heuristic method like SA (Simulated Annealing). Through numerical experiments, we verified the validity of the proposed approach, and discussed the significance of trade-off analysis between the conflicting objectives.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

Science.gov (United States)

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Improving transcriptome assembly through error correction of high-throughput sequence reads

Directory of Open Access Journals (Sweden)

Matthew D. MacManes

2013-07-01

Full Text Available The study of functional genomics, particularly in non-model organisms, has been dramatically improved over the last few years by the use of transcriptomes and RNAseq. While these studies are potentially extremely powerful, a computationally intensive procedure, the de novo construction of a reference transcriptome must be completed as a prerequisite to further analyses. The accurate reference is critically important as all downstream steps, including estimating transcript abundance are critically dependent on the construction of an accurate reference. Though a substantial amount of research has been done on assembly, only recently have the pre-assembly procedures been studied in detail. Specifically, several stand-alone error correction modules have been reported on and, while they have shown to be effective in reducing errors at the level of sequencing reads, how error correction impacts assembly accuracy is largely unknown. Here, we show via use of a simulated and empiric dataset, that applying error correction to sequencing reads has significant positive effects on assembly accuracy, and should be applied to all datasets. A complete collection of commands which will allow for the production of Reptile corrected reads is available at https://github.com/macmanes/error_correction/tree/master/scripts and as File S1.

2D nanomaterials assembled from sequence-defined molecules

International Nuclear Information System (INIS)

Mu, Peng; State University of New York; Zhou, Guangwen; Chen, Chun-Long

2017-01-01

Two dimensional (2D) nanomaterials have attracted broad interest owing to their unique physical and chemical properties with potential applications in electronics, chemistry, biology, medicine and pharmaceutics. Due to the current limitations of traditional 2D nanomaterials (e.g., graphene and graphene oxide) in tuning surface chemistry and compositions, 2D nanomaterials assembled from sequence-defined molecules (e.g., DNAs, proteins, peptides and peptoids) have recently been developed. They represent an emerging class of 2D nanomaterials with attractive physical and chemical properties. Here, we summarize the recent progress in the synthesis and applications of this type of sequence-defined 2D nanomaterials. We also discuss the challenges and opportunities in this new field.

High-coverage sequencing and annotated assembly of the genome of the Australian dragon lizard Pogona vitticeps.

Science.gov (United States)

Georges, Arthur; Li, Qiye; Lian, Jinmin; O'Meally, Denis; Deakin, Janine; Wang, Zongji; Zhang, Pei; Fujita, Matthew; Patel, Hardip R; Holleley, Clare E; Zhou, Yang; Zhang, Xiuwen; Matsubara, Kazumi; Waters, Paul; Graves, Jennifer A Marshall; Sarre, Stephen D; Zhang, Guojie

2015-01-01

The lizards of the family Agamidae are one of the most prominent elements of the Australian reptile fauna. Here, we present a genomic resource built on the basis of a wild-caught male ZZ central bearded dragon Pogona vitticeps. The genomic sequence for P. vitticeps, generated on the Illumina HiSeq 2000 platform, comprised 317 Gbp (179X raw read depth) from 13 insert libraries ranging from 250 bp to 40 kbp. After filtering for low-quality and duplicated reads, 146 Gbp of data (83X) was available for assembly. Exceptionally high levels of heterozygosity (0.85 % of single nucleotide polymorphisms plus sequence insertions or deletions) complicated assembly; nevertheless, 96.4 % of reads mapped back to the assembled scaffolds, indicating that the assembly included most of the sequenced genome. Length of the assembly was 1.8 Gbp in 545,310 scaffolds (69,852 longer than 300 bp), the longest being 14.68 Mbp. N50 was 2.29 Mbp. Genes were annotated on the basis of de novo prediction, similarity to the green anole Anolis carolinensis, Gallus gallus and Homo sapiens proteins, and P. vitticeps transcriptome sequence assemblies, to yield 19,406 protein-coding genes in the assembly, 63 % of which had intact open reading frames. Our assembly captured 99 % (246 of 248) of core CEGMA genes, with 93 % (231) being complete. The quality of the P. vitticeps assembly is comparable or superior to that of other published squamate genomes, and the annotated P. vitticeps genome can be accessed through a genome browser available at https://genomics.canberra.edu.au.

Assessment of metagenomic assembly using simulated next generation sequencing data

DEFF Research Database (Denmark)

Mende, Daniel R; Waller, Alison S; Sunagawa, Shinichi

2012-01-01

with platform-specific (Sanger, pyrosequencing, Illumina) base-error models, and simulated metagenomes of differing community complexities. We first evaluated the effect of rigorous quality control on Illumina data. Although quality filtering removed a large proportion of the data, it greatly improved...... the accuracy and contig lengths of resulting assemblies. We then compared the quality-trimmed Illumina assemblies to those from Sanger and pyrosequencing. For the simple community (10 genomes) all sequencing technologies assembled a similar amount and accurately represented the expected functional composition...... the Sanger reads still represented the overall functional composition reasonably well. We further examined the effect of scaffolding of contigs using paired-end Illumina reads. It dramatically increased contig lengths of the simple community and yielded minor improvements to the more complex communities...

Impact of genome assembly status on ChIP-Seq and ChIP-PET data mapping

Directory of Open Access Journals (Sweden)

Sachs Laurent

2009-12-01

Full Text Available Abstract Background ChIP-Seq and ChIP-PET can potentially be used with any genome for genome wide profiling of protein-DNA interaction sites. Unfortunately, it is probable that most genome assemblies will never reach the quality of the human genome assembly. Therefore, it remains to be determined whether ChIP-Seq and ChIP-PET are practicable with genome sequences other than a few (e.g. human and mouse. Findings Here, we used in silico simulations to assess the impact of completeness or fragmentation of genome assemblies on ChIP-Seq and ChIP-PET data mapping. Conclusions Most currently published genome assemblies are suitable for mapping the short sequence tags produced by ChIP-Seq or ChIP-PET.

Transcriptome sequencing in an ecologically important tree species: assembly, annotation, and marker discovery

Directory of Open Access Journals (Sweden)

Benkman Craig W

2010-03-01

Full Text Available Abstract Background Massively parallel sequencing of cDNA is now an efficient route for generating enormous sequence collections that represent expressed genes. This approach provides a valuable starting point for characterizing functional genetic variation in non-model organisms, especially where whole genome sequencing efforts are currently cost and time prohibitive. The large and complex genomes of pines (Pinus spp. have hindered the development of genomic resources, despite the ecological and economical importance of the group. While most genomic studies have focused on a single species (P. taeda, genomic level resources for other pines are insufficiently developed to facilitate ecological genomic research. Lodgepole pine (P. contorta is an ecologically important foundation species of montane forest ecosystems and exhibits substantial adaptive variation across its range in western North America. Here we describe a sequencing study of expressed genes from P. contorta, including their assembly and annotation, and their potential for molecular marker development to support population and association genetic studies. Results We obtained 586,732 sequencing reads from a 454 GS XLR70 Titanium pyrosequencer (mean length: 306 base pairs. A combination of reference-based and de novo assemblies yielded 63,657 contigs, with 239,793 reads remaining as singletons. Based on sequence similarity with known proteins, these sequences represent approximately 17,000 unique genes, many of which are well covered by contig sequences. This sequence collection also included a surprisingly large number of retrotransposon sequences, suggesting that they are highly transcriptionally active in the tissues we sampled. We located and characterized thousands of simple sequence repeats and single nucleotide polymorphisms as potential molecular markers in our assembled and annotated sequences. High quality PCR primers were designed for a substantial number of the SSR loci

Sequencing and de novo assembly of 150 genomes from Denmark as a population reference

DEFF Research Database (Denmark)

Maretty, Lasse; Jensen, Jacob Malte; Petersen, Bent

2017-01-01

or by performing local assembly. However, these approaches are biased against discovery of structural variants and variation in the more complex parts of the genome. Hence, large-scale de novo assembly is needed. Here we show that it is possible to construct excellent de novo assemblies from high......-coverage sequencing with mate-pair libraries extending up to 20 kilobases. We report de novo assemblies of 150 individuals (50 trios) from the GenomeDenmark project. The quality of these assemblies is similar to those obtained using the more expensive long-read technology. We use the assemblies to identify a rich set...

Divide and conquer: enriching environmental sequencing data.

Directory of Open Access Journals (Sweden)

Anne Bergeron

2007-09-01

Full Text Available In environmental sequencing projects, a mix of DNA from a whole microbial community is fragmented and sequenced, with one of the possible goals being to reconstruct partial or complete genomes of members of the community. In communities with high diversity of species, a significant proportion of the sequences do not overlap any other fragment in the sample. This problem will arise not only in situations with a relatively even distribution of many species, but also when the community in a particular environment is routinely dominated by the same few species. In the former case, no genomes may be assembled at all, while in the latter case a few dominant species in an environment will always be sequenced at high coverage to the detriment of coverage of the greater number of sparse species.Here we show that, with the same global sequencing effort, separating the species into two or more sub-communities prior to sequencing can yield a much higher proportion of sequences that can be assembled. We first use the Lander-Waterman model to show that, if the expected percentage of singleton sequences is higher than 25%, then, under the uniform distribution hypothesis, splitting the community is always a wise choice. We then construct simulated microbial communities to show that the results hold for highly non-uniform distributions. We also show that, for the distributions considered in the experiments, it is possible to estimate quite accurately the relative diversity of the two sub-communities.Given the fact that several methods exist to split microbial communities based on physical properties such as size, density, surface biochemistry, or optical properties, we strongly suggest that groups involved in environmental sequencing, and expecting high diversity, consider splitting their communities in order to maximize the information content of their sequencing effort.

INTEGRATED APPROACH TO GENERATION OF PRECEDENCE RELATIONS AND PRECEDENCE GRAPHS FOR ASSEMBLY SEQUENCE PLANNING

Institute of Scientific and Technical Information of China (English)

无

2002-01-01

An integrated approach to generation of precedence relations and precedence graphs for assembly sequence planning is presented, which contains more assembly flexibility. The approach involves two stages. Based on the assembly model, the components in the assembly can be divided into partially constrained components and completely constrained components in the first stage, and then geometric precedence relation for every component is generated automatically. According to the result of the first stage, the second stage determines and constructs all precedence graphs. The algorithms of these two stages proposed are verified by two assembly examples.

Choice of reference sequence and assembler for alignment of Listeria monocytogenes short-read sequence data greatly influences rates of error in SNP analyses.

Directory of Open Access Journals (Sweden)

Arthur W Pightling

Full Text Available The wide availability of whole-genome sequencing (WGS and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i depth of sequencing coverage, ii choice of reference-guided short-read sequence assembler, iii choice of reference genome, and iv whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT, using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming. We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers

Assembly and melting of DNA nanotubes from single-sequence tiles

International Nuclear Information System (INIS)

Sobey, T L; Renner, S; Simmel, F C

2009-01-01

DNA melting and renaturation studies are an extremely valuable tool to study the kinetics and thermodynamics of duplex dissociation and reassociation reactions. These are important not only in a biological or biotechnological context, but also for DNA nanotechnology which aims at the construction of molecular materials by DNA self-assembly. We here study experimentally the formation and melting of a DNA nanotube structure, which is composed of many copies of an oligonucleotide containing several palindromic sequences. This is done using temperature-controlled UV absorption measurements correlated with atomic force microscopy, fluorescence microscopy and transmission electron microscopy techniques. In the melting studies, important factors such as DNA strand concentration, hierarchy of assembly and annealing protocol are investigated. Assembly and melting of the nanotubes are shown to proceed via different pathways. Whereas assembly occurs in several hierarchical steps related to the formation of tiles, lattices and tubes, melting of DNA nanotubes appears to occur in a single step. This is proposed to relate to fundamental differences between closed, three-dimensional tube-like structures and open, two-dimensional lattices. DNA melting studies can lead to a better understanding of the many factors that affect the assembly process which will be essential for the assembly of increasingly complex DNA nanostructures.

Harnessing NGS and Big Data Optimally: Comparison of miRNA Prediction from Assembled versus Non-assembled Sequencing Data--The Case of the Grass Aegilops tauschii Complex Genome.

Science.gov (United States)

Budak, Hikmet; Kantar, Melda

2015-07-01

MicroRNAs (miRNAs) are small, endogenous, non-coding RNA molecules that regulate gene expression at the post-transcriptional level. As high-throughput next generation sequencing (NGS) and Big Data rapidly accumulate for various species, efforts for in silico identification of miRNAs intensify. Surprisingly, the effect of the input genomics sequence on the robustness of miRNA prediction was not evaluated in detail to date. In the present study, we performed a homology-based miRNA and isomiRNA prediction of the 5D chromosome of bread wheat progenitor, Aegilops tauschii, using two distinct sequence data sets as input: (1) raw sequence reads obtained from 454-GS FLX Titanium sequencing platform and (2) an assembly constructed from these reads. We also compared this method with a number of available plant sequence datasets. We report here the identification of 62 and 22 miRNAs from raw reads and the assembly, respectively, of which 16 were predicted with high confidence from both datasets. While raw reads promoted sensitivity with the high number of miRNAs predicted, 55% (12 out of 22) of the assembly-based predictions were supported by previous observations, bringing specificity forward compared to the read-based predictions, of which only 37% were supported. Importantly, raw reads could identify several repeat-related miRNAs that could not be detected with the assembly. However, raw reads could not capture 6 miRNAs, for which the stem-loops could only be covered by the relatively longer sequences from the assembly. In summary, the comparison of miRNA datasets obtained by these two strategies revealed that utilization of raw reads, as well as assemblies for in silico prediction, have distinct advantages and disadvantages. Consideration of these important nuances can benefit future miRNA identification efforts in the current age of NGS and Big Data driven life sciences innovation.

Nanopore sequencing technology and tools for genome assembly: computational analysis of the current state, bottlenecks and future directions.

Science.gov (United States)

Senol Cali, Damla; Kim, Jeremie S; Ghose, Saugata; Alkan, Can; Mutlu, Onur

2018-04-02

Nanopore sequencing technology has the potential to render other sequencing technologies obsolete with its ability to generate long reads and provide portability. However, high error rates of the technology pose a challenge while generating accurate genome assemblies. The tools used for nanopore sequence analysis are of critical importance, as they should overcome the high error rates of the technology. Our goal in this work is to comprehensively analyze current publicly available tools for nanopore sequence analysis to understand their advantages, disadvantages and performance bottlenecks. It is important to understand where the current tools do not perform well to develop better tools. To this end, we (1) analyze the multiple steps and the associated tools in the genome assembly pipeline using nanopore sequence data, and (2) provide guidelines for determining the appropriate tools for each step. Based on our analyses, we make four key observations: (1) the choice of the tool for basecalling plays a critical role in overcoming the high error rates of nanopore sequencing technology. (2) Read-to-read overlap finding tools, GraphMap and Minimap, perform similarly in terms of accuracy. However, Minimap has a lower memory usage, and it is faster than GraphMap. (3) There is a trade-off between accuracy and performance when deciding on the appropriate tool for the assembly step. The fast but less accurate assembler Miniasm can be used for quick initial assembly, and further polishing can be applied on top of it to increase the accuracy, which leads to faster overall assembly. (4) The state-of-the-art polishing tool, Racon, generates high-quality consensus sequences while providing a significant speedup over another polishing tool, Nanopolish. We analyze various combinations of different tools and expose the trade-offs between accuracy, performance, memory usage and scalability. We conclude that our observations can guide researchers and practitioners in making conscious

Fragment-derived inhibitors of human N-myristoyltransferase block capsid assembly and replication of the common cold virus

Science.gov (United States)

Mousnier, Aurélie; Bell, Andrew S.; Swieboda, Dawid P.; Morales-Sanfrutos, Julia; Pérez-Dorado, Inmaculada; Brannigan, James A.; Newman, Joseph; Ritzefeld, Markus; Hutton, Jennie A.; Guedán, Anabel; Asfor, Amin S.; Robinson, Sean W.; Hopkins-Navratilova, Iva; Wilkinson, Anthony J.; Johnston, Sebastian L.; Leatherbarrow, Robin J.; Tuthill, Tobias J.; Solari, Roberto; Tate, Edward W.

2018-06-01

Rhinoviruses (RVs) are the pathogens most often responsible for the common cold, and are a frequent cause of exacerbations in asthma, chronic obstructive pulmonary disease and cystic fibrosis. Here we report the discovery of IMP-1088, a picomolar dual inhibitor of the human N-myristoyltransferases NMT1 and NMT2, and use it to demonstrate that pharmacological inhibition of host-cell N-myristoylation rapidly and completely prevents rhinoviral replication without inducing cytotoxicity. The identification of cooperative binding between weak-binding fragments led to rapid inhibitor optimization through fragment reconstruction, structure-guided fragment linking and conformational control over linker geometry. We show that inhibition of the co-translational myristoylation of a specific virus-encoded protein (VP0) by IMP-1088 potently blocks a key step in viral capsid assembly, to deliver a low nanomolar antiviral activity against multiple RV strains, poliovirus and foot and-mouth disease virus, and protection of cells against virus-induced killing, highlighting the potential of host myristoylation as a drug target in picornaviral infections.

Multi-platform next-generation sequencing of the domestic turkey (Meleagris gallopavo: genome assembly and analysis.

Directory of Open Access Journals (Sweden)

Rami A Dalloul

2010-09-01

Full Text Available A synergistic combination of two next-generation sequencing platforms with a detailed comparative BAC physical contig map provided a cost-effective assembly of the genome sequence of the domestic turkey (Meleagris gallopavo. Heterozygosity of the sequenced source genome allowed discovery of more than 600,000 high quality single nucleotide variants. Despite this heterozygosity, the current genome assembly (∼1.1 Gb includes 917 Mb of sequence assigned to specific turkey chromosomes. Annotation identified nearly 16,000 genes, with 15,093 recognized as protein coding and 611 as non-coding RNA genes. Comparative analysis of the turkey, chicken, and zebra finch genomes, and comparing avian to mammalian species, supports the characteristic stability of avian genomes and identifies genes unique to the avian lineage. Clear differences are seen in number and variety of genes of the avian immune system where expansions and novel genes are less frequent than examples of gene loss. The turkey genome sequence provides resources to further understand the evolution of vertebrate genomes and genetic variation underlying economically important quantitative traits in poultry. This integrated approach may be a model for providing both gene and chromosome level assemblies of other species with agricultural, ecological, and evolutionary interest.

When less is more: 'slicing' sequencing data improves read decoding accuracy and de novo assembly quality.

Science.gov (United States)

Lonardi, Stefano; Mirebrahim, Hamid; Wanamaker, Steve; Alpert, Matthew; Ciardo, Gianfranco; Duma, Denisa; Close, Timothy J

2015-09-15

As the invention of DNA sequencing in the 70s, computational biologists have had to deal with the problem of de novo genome assembly with limited (or insufficient) depth of sequencing. In this work, we investigate the opposite problem, that is, the challenge of dealing with excessive depth of sequencing. We explore the effect of ultra-deep sequencing data in two domains: (i) the problem of decoding reads to bacterial artificial chromosome (BAC) clones (in the context of the combinatorial pooling design we have recently proposed), and (ii) the problem of de novo assembly of BAC clones. Using real ultra-deep sequencing data, we show that when the depth of sequencing increases over a certain threshold, sequencing errors make these two problems harder and harder (instead of easier, as one would expect with error-free data), and as a consequence the quality of the solution degrades with more and more data. For the first problem, we propose an effective solution based on 'divide and conquer': we 'slice' a large dataset into smaller samples of optimal size, decode each slice independently, and then merge the results. Experimental results on over 15 000 barley BACs and over 4000 cowpea BACs demonstrate a significant improvement in the quality of the decoding and the final assembly. For the second problem, we show for the first time that modern de novo assemblers cannot take advantage of ultra-deep sequencing data. Python scripts to process slices and resolve decoding conflicts are available from http://goo.gl/YXgdHT; software Hashfilter can be downloaded from http://goo.gl/MIyZHs stelo@cs.ucr.edu or timothy.close@ucr.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

Science.gov (United States)

Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

2015-10-01

Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

Critical Features of Fragment Libraries for Protein Structure Prediction.

Science.gov (United States)

Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

2017-01-01

The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

Completion of autobuilt protein models using a database of protein fragments

International Nuclear Information System (INIS)

Cowtan, Kevin

2012-01-01

Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature

Evidence for Sequence Scrambling and Divergent H/D Exchange Reactions of Doubly-Charged Isobaric b-Type Fragment Ions

Science.gov (United States)

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H.; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10 2+ that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10 2+ and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10 2+, suggesting that b10 2+ may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10 2+; over 30 % of the observed SORI-CID fragment ions from substance P b10 2+ had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10 2+, whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10 2+.

Evidence for sequence scrambling and divergent H/D exchange reactions of doubly-charged isobaric b-type fragment ions.

Science.gov (United States)

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10(2+) that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10(2+) and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10(2+), suggesting that b10(2+) may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10(2+); over 30% of the observed SORI-CID fragment ions from substance P b10(2+) had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10(2+), whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10(2+).

Tips and tricks for the assembly of a Corynebacterium pseudotuberculosis genome using a semiconductor sequencer

DEFF Research Database (Denmark)

Ramos, Rommel Thiago Jucá; Carneiro, Adriana Ribeiro; Soares, Siomar de Castro

2013-01-01

that enable reference-based assembly, such as the one used in the present study, Corynebacterium pseudotuberculosis biovar equi, which causes high economic losses in the US equine industry. The quality treatment strategy incorporated into the assembly pipeline enabled a 16-fold greater use of the sequencing...... was validated by comparative genomics with other species of the genus Corynebacterium. The present study presents a modus operandi that enables a greater and better use of data obtained from semiconductor sequencing for obtaining the complete genome from a prokaryotic microorganism, C. pseudotuberculosis, which...

A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

Directory of Open Access Journals (Sweden)

Boulund Fredrik

2012-12-01

Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

Detection of viral sequence fragments of HIV-1 subfamilies yet unknown

Directory of Open Access Journals (Sweden)

Stanke Mario

2011-04-01

Full Text Available Abstract Background Methods of determining whether or not any particular HIV-1 sequence stems - completely or in part - from some unknown HIV-1 subtype are important for the design of vaccines and molecular detection systems, as well as for epidemiological monitoring. Nevertheless, a single algorithm only, the Branching Index (BI, has been developed for this task so far. Moving along the genome of a query sequence in a sliding window, the BI computes a ratio quantifying how closely the query sequence clusters with a subtype clade. In its current version, however, the BI does not provide predicted boundaries of unknown fragments. Results We have developed Unknown Subtype Finder (USF, an algorithm based on a probabilistic model, which automatically determines which parts of an input sequence originate from a subtype yet unknown. The underlying model is based on a simple profile hidden Markov model (pHMM for each known subtype and an additional pHMM for an unknown subtype. The emission probabilities of the latter are estimated using the emission frequencies of the known subtypes by means of a (position-wise probabilistic model for the emergence of new subtypes. We have applied USF to SIV and HIV-1 sequences formerly classified as having emerged from an unknown subtype. Moreover, we have evaluated its performance on artificial HIV-1 recombinants and non-recombinant HIV-1 sequences. The results have been compared with the corresponding results of the BI. Conclusions Our results demonstrate that USF is suitable for detecting segments in HIV-1 sequences stemming from yet unknown subtypes. Comparing USF with the BI shows that our algorithm performs as good as the BI or better.

Norgal: Extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data

DEFF Research Database (Denmark)

Al-Nakeeb, Kosai Ali Ahmed; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

2017-01-01

and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences...

Mapsembler, targeted and micro assembly of large NGS datasets on a desktop computer

Directory of Open Access Journals (Sweden)

Peterlongo Pierre

2012-03-01

Full Text Available Abstract Background The analysis of next-generation sequencing data from large genomes is a timely research topic. Sequencers are producing billions of short sequence fragments from newly sequenced organisms. Computational methods for reconstructing whole genomes/transcriptomes (de novo assemblers are typically employed to process such data. However, these methods require large memory resources and computation time. Many basic biological questions could be answered targeting specific information in the reads, thus avoiding complete assembly. Results We present Mapsembler, an iterative micro and targeted assembler which processes large datasets of reads on commodity hardware. Mapsembler checks for the presence of given regions of interest that can be constructed from reads and builds a short assembly around it, either as a plain sequence or as a graph, showing contextual structure. We introduce new algorithms to retrieve approximate occurrences of a sequence from reads and construct an extension graph. Among other results presented in this paper, Mapsembler enabled to retrieve previously described human breast cancer candidate fusion genes, and to detect new ones not previously known. Conclusions Mapsembler is the first software that enables de novo discovery around a region of interest of repeats, SNPs, exon skipping, gene fusion, as well as other structural events, directly from raw sequencing reads. As indexing is localized, the memory footprint of Mapsembler is negligible. Mapsembler is released under the CeCILL license and can be freely downloaded from http://alcovna.genouest.org/mapsembler/.

A versatile system for USER cloning-based assembly of expression vectors for mammalian cell engineering.

Directory of Open Access Journals (Sweden)

Anne Mathilde Lund

Full Text Available A new versatile mammalian vector system for protein production, cell biology analyses, and cell factory engineering was developed. The vector system applies the ligation-free uracil-excision based technique--USER cloning--to rapidly construct mammalian expression vectors of multiple DNA fragments and with maximum flexibility, both for choice of vector backbone and cargo. The vector system includes a set of basic vectors and a toolbox containing a multitude of DNA building blocks including promoters, terminators, selectable marker- and reporter genes, and sequences encoding an internal ribosome entry site, cellular localization signals and epitope- and purification tags. Building blocks in the toolbox can be easily combined as they contain defined and tested Flexible Assembly Sequence Tags, FASTs. USER cloning with FASTs allows rapid swaps of gene, promoter or selection marker in existing plasmids and simple construction of vectors encoding proteins, which are fused to fluorescence-, purification-, localization-, or epitope tags. The mammalian expression vector assembly platform currently allows for the assembly of up to seven fragments in a single cloning step with correct directionality and with a cloning efficiency above 90%. The functionality of basic vectors for FAST assembly was tested and validated by transient expression of fluorescent model proteins in CHO, U-2-OS and HEK293 cell lines. In this test, we included many of the most common vector elements for heterologous gene expression in mammalian cells, in addition the system is fully extendable by other users. The vector system is designed to facilitate high-throughput genome-scale studies of mammalian cells, such as the newly sequenced CHO cell lines, through the ability to rapidly generate high-fidelity assembly of customizable gene expression vectors.

De novo assembly of a 40 Mb eukaryotic genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis.

Science.gov (United States)

Nowrousian, Minou; Stajich, Jason E; Chu, Meiling; Engh, Ines; Espagne, Eric; Halliday, Karen; Kamerewerd, Jens; Kempken, Frank; Knab, Birgit; Kuo, Hsiao-Che; Osiewacz, Heinz D; Pöggeler, Stefanie; Read, Nick D; Seiler, Stephan; Smith, Kristina M; Zickler, Denise; Kück, Ulrich; Freitag, Michael

2010-04-08

Filamentous fungi are of great importance in ecology, agriculture, medicine, and biotechnology. Thus, it is not surprising that genomes for more than 100 filamentous fungi have been sequenced, most of them by Sanger sequencing. While next-generation sequencing techniques have revolutionized genome resequencing, e.g. for strain comparisons, genetic mapping, or transcriptome and ChIP analyses, de novo assembly of eukaryotic genomes still presents significant hurdles, because of their large size and stretches of repetitive sequences. Filamentous fungi contain few repetitive regions in their 30-90 Mb genomes and thus are suitable candidates to test de novo genome assembly from short sequence reads. Here, we present a high-quality draft sequence of the Sordaria macrospora genome that was obtained by a combination of Illumina/Solexa and Roche/454 sequencing. Paired-end Solexa sequencing of genomic DNA to 85-fold coverage and an additional 10-fold coverage by single-end 454 sequencing resulted in approximately 4 Gb of DNA sequence. Reads were assembled to a 40 Mb draft version (N50 of 117 kb) with the Velvet assembler. Comparative analysis with Neurospora genomes increased the N50 to 498 kb. The S. macrospora genome contains even fewer repeat regions than its closest sequenced relative, Neurospora crassa. Comparison with genomes of other fungi showed that S. macrospora, a model organism for morphogenesis and meiosis, harbors duplications of several genes involved in self/nonself-recognition. Furthermore, S. macrospora contains more polyketide biosynthesis genes than N. crassa. Phylogenetic analyses suggest that some of these genes may have been acquired by horizontal gene transfer from a distantly related ascomycete group. Our study shows that, for typical filamentous fungi, de novo assembly of genomes from short sequence reads alone is feasible, that a mixture of Solexa and 454 sequencing substantially improves the assembly, and that the resulting data can be used for

De novo assembly of a 40 Mb eukaryotic genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis.

Directory of Open Access Journals (Sweden)

Minou Nowrousian

2010-04-01

Full Text Available Filamentous fungi are of great importance in ecology, agriculture, medicine, and biotechnology. Thus, it is not surprising that genomes for more than 100 filamentous fungi have been sequenced, most of them by Sanger sequencing. While next-generation sequencing techniques have revolutionized genome resequencing, e.g. for strain comparisons, genetic mapping, or transcriptome and ChIP analyses, de novo assembly of eukaryotic genomes still presents significant hurdles, because of their large size and stretches of repetitive sequences. Filamentous fungi contain few repetitive regions in their 30-90 Mb genomes and thus are suitable candidates to test de novo genome assembly from short sequence reads. Here, we present a high-quality draft sequence of the Sordaria macrospora genome that was obtained by a combination of Illumina/Solexa and Roche/454 sequencing. Paired-end Solexa sequencing of genomic DNA to 85-fold coverage and an additional 10-fold coverage by single-end 454 sequencing resulted in approximately 4 Gb of DNA sequence. Reads were assembled to a 40 Mb draft version (N50 of 117 kb with the Velvet assembler. Comparative analysis with Neurospora genomes increased the N50 to 498 kb. The S. macrospora genome contains even fewer repeat regions than its closest sequenced relative, Neurospora crassa. Comparison with genomes of other fungi showed that S. macrospora, a model organism for morphogenesis and meiosis, harbors duplications of several genes involved in self/nonself-recognition. Furthermore, S. macrospora contains more polyketide biosynthesis genes than N. crassa. Phylogenetic analyses suggest that some of these genes may have been acquired by horizontal gene transfer from a distantly related ascomycete group. Our study shows that, for typical filamentous fungi, de novo assembly of genomes from short sequence reads alone is feasible, that a mixture of Solexa and 454 sequencing substantially improves the assembly, and that the resulting data

RePS: a sequence assembler that masks exact repeats identified from the shotgun data

DEFF Research Database (Denmark)

Wang, Jun; Wong, Gane Ka-Shu; Ni, Peixiang

2002-01-01

We describe a sequence assembler, RePS (repeat-masked Phrap with scaffolding), that explicitly identifies exact 20mer repeats from the shotgun data and removes them prior to the assembly. The established software is used to compute meaningful error probabilities for each base. Clone......-end-pairing information is used to construct scaffolds that order and orient the contigs. We show with real data for human and rice that reasonable assemblies are possible even at coverages of only 4x to 6x, despite having up to 42.2% in exact repeats. Udgivelsesdato: 2002-May...

Growth of rat dorsal root ganglion neurons on a novel self-assembling scaffold containing IKVAV sequence

Energy Technology Data Exchange (ETDEWEB)

Zou Zhenwei; Zheng Qixin [Department of Orthopaedics, Union Hospital, Tongji Medical college of Huazhong University of science and technology, Wuhan, 430022 (China); Wu Yongchao, E-mail: wuyongchao@hotmail.com [Department of Orthopaedics, Union Hospital, Tongji Medical college of Huazhong University of science and technology, Wuhan, 430022 (China); Song Yulin; Wu Bin [Department of Orthopaedics, Union Hospital, Tongji Medical college of Huazhong University of science and technology, Wuhan, 430022 (China)

2009-08-31

The potential benefits of self-assembly in synthesizing materials for the treatment of both peripheral and central nervous system disorders are tremendous. In this study, we synthesized peptide-amphiphile (PA) molecules containing IKVAV sequence and induced self-assembly of the PA solutions in vitro to form nanofiber gels. Then, we tested the characterization of gels by transmission electron microscopy and demonstrated the biocompatibility of this gel towards rat dorsal root ganglion neurons. The nanofiber gel was formed by self-assembly of IKVAV PA molecules, which was triggered by metal ions. The fibers were 7-8 nm in diameter and with lengths of hundreds of nanometers. Gels were shown to be non-toxic to neurons and able to promote neurons adhesion and neurite sprouting. The results indicated that the self-assembling scaffold containing IKVAV sequence had excellent biocompatibility with adult sensory neurons and could be useful in nerve tissue engineering.

mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

Science.gov (United States)

Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

2013-08-15

Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

MetaVelvet: An Extension of Velvet Assembler to de novo Metagenome Assembly from Short Sequence Reads (Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

Energy Technology Data Exchange (ETDEWEB)

Sakakibara, Yasumbumi

2011-10-13

Keio University's Yasumbumi Sakakibara on "MetaVelvet: An Extension of Velvet Assembler to de novo Metagenome Assembly from Short Sequence Reads" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

Multifunctional hybrid networks based on self assembling peptide sequences

Science.gov (United States)

Sathaye, Sameer

The overall aim of this dissertation is to achieve a comprehensive correlation between the molecular level changes in primary amino acid sequences of amphiphilic beta-hairpin peptides and their consequent solution-assembly properties and bulk network hydrogel behavior. This has been accomplished using two broad approaches. In the first approach, amino acid substitutions were made to peptide sequence MAX1 such that the hydrophobic surfaces of the folded beta-hairpins from the peptides demonstrate shape specificity in hydrophobic interactions with other beta-hairpins during the assembly process, thereby causing changes to the peptide nanostructure and bulk rheological properties of hydrogels formed from the peptides. Steric lock and key complementary hydrophobic interactions were designed to occur between two beta-hairpin molecules of a single molecule, LNK1 during beta-sheet fibrillar assembly of LNK1. Experimental results from circular dichroism, transmission electron microscopy and oscillatory rheology collectively indicate that the molecular design of the LNK1 peptide can be assigned the cause of the drastically different behavior of the networks relative to MAX1. The results indicate elimination or significant reduction of fibrillar branching due to steric complementarity in LNK1 that does not exist in MAX1, thus supporting the original hypothesis. As an extension of the designed steric lock and key complementarity between two beta-hairpin molecules of the same peptide molecule. LNK1, three new pairs of peptide molecules LP1-KP1, LP2-KP2 and LP3-KP3 that resemble complementary 'wedge' and 'trough' shapes when folded into beta-hairpins were designed and studied. All six peptides individually and when blended with their corresponding shape complement formed fibrillar nanostructures with non-uniform thickness values. Loose packing in the assembled structures was observed in all the new peptides as compared to the uniform tight packing in MAX1 by SANS analysis. This

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

SEQUENCING AND DE NOVO DRAFT ASSEMBLIES OF A FATHEAD MINNOW (Pimpehales promelas) reference genome

Data.gov (United States)

U.S. Environmental Protection Agency — The dataset provides the URLs for accessing the genome sequence data and two draft assemblies as well as fathead minnow genotyping data associated with estimating...

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

De novo assembly, characterization and functional annotation of pineapple fruit transcriptome through massively parallel sequencing.

Science.gov (United States)

Ong, Wen Dee; Voo, Lok-Yung Christopher; Kumar, Vijay Subbiah

2012-01-01

Pineapple (Ananas comosus var. comosus), is an important tropical non-climacteric fruit with high commercial potential. Understanding the mechanism and processes underlying fruit ripening would enable scientists to enhance the improvement of quality traits such as, flavor, texture, appearance and fruit sweetness. Although, the pineapple is an important fruit, there is insufficient transcriptomic or genomic information that is available in public databases. Application of high throughput transcriptome sequencing to profile the pineapple fruit transcripts is therefore needed. To facilitate this, we have performed transcriptome sequencing of ripe yellow pineapple fruit flesh using Illumina technology. About 4.7 millions Illumina paired-end reads were generated and assembled using the Velvet de novo assembler. The assembly produced 28,728 unique transcripts with a mean length of approximately 200 bp. Sequence similarity search against non-redundant NCBI database identified a total of 16,932 unique transcripts (58.93%) with significant hits. Out of these, 15,507 unique transcripts were assigned to gene ontology terms. Functional annotation against Kyoto Encyclopedia of Genes and Genomes pathway database identified 13,598 unique transcripts (47.33%) which were mapped to 126 pathways. The assembly revealed many transcripts that were previously unknown. The unique transcripts derived from this work have rapidly increased of the number of the pineapple fruit mRNA transcripts as it is now available in public databases. This information can be further utilized in gene expression, genomics and other functional genomics studies in pineapple.

Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

DEFF Research Database (Denmark)

Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

2005-01-01

subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

GAAP: Genome-organization-framework-Assisted Assembly Pipeline for prokaryotic genomes.

Science.gov (United States)

Yuan, Lina; Yu, Yang; Zhu, Yanmin; Li, Yulai; Li, Changqing; Li, Rujiao; Ma, Qin; Siu, Gilman Kit-Hang; Yu, Jun; Jiang, Taijiao; Xiao, Jingfa; Kang, Yu

2017-01-25

Next-generation sequencing (NGS) technologies have greatly promoted the genomic study of prokaryotes. However, highly fragmented assemblies due to short reads from NGS are still a limiting factor in gaining insights into the genome biology. Reference-assisted tools are promising in genome assembly, but tend to result in false assembly when the assigned reference has extensive rearrangements. Herein, we present GAAP, a genome assembly pipeline for scaffolding based on core-gene-defined Genome Organizational Framework (cGOF) described in our previous study. Instead of assigning references, we use the multiple-reference-derived cGOFs as indexes to assist in order and orientation of the scaffolds and build a skeleton structure, and then use read pairs to extend scaffolds, called local scaffolding, and distinguish between true and chimeric adjacencies in the scaffolds. In our performance tests using both empirical and simulated data of 15 genomes in six species with diverse genome size, complexity, and all three categories of cGOFs, GAAP outcompetes or achieves comparable results when compared to three other reference-assisted programs, AlignGraph, Ragout and MeDuSa. GAAP uses both cGOF and pair-end reads to create assemblies in genomic scale, and performs better than the currently available reference-assisted assembly tools as it recovers more assemblies and makes fewer false locations, especially for species with extensive rearranged genomes. Our method is a promising solution for reconstruction of genome sequence from short reads of NGS.

Getting complete genomes from complex samples using nanopore sequencing

DEFF Research Database (Denmark)

Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads

Short read sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes, as they are mostly...... fragmented, incomplete and often contaminated with foreign DNA and with no robust strategies to validate the quality. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and the uncertainty of what is missing. The genetic material most often...... missed is important multi-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. We demonstrate that using nanopore long reads it is now possible to overcome these issues and make complete genomes from...

Design strategies for self-assembly of discrete targets

International Nuclear Information System (INIS)

Madge, Jim; Miller, Mark A.

2015-01-01

Both biological and artificial self-assembly processes can take place by a range of different schemes, from the successive addition of identical building blocks to hierarchical sequences of intermediates, all the way to the fully addressable limit in which each component is unique. In this paper, we introduce an idealized model of cubic particles with patterned faces that allows self-assembly strategies to be compared and tested. We consider a simple octameric target, starting with the minimal requirements for successful self-assembly and comparing the benefits and limitations of more sophisticated hierarchical and addressable schemes. Simulations are performed using a hybrid dynamical Monte Carlo protocol that allows self-assembling clusters to rearrange internally while still providing Stokes-Einstein-like diffusion of aggregates of different sizes. Our simulations explicitly capture the thermodynamic, dynamic, and steric challenges typically faced by self-assembly processes, including competition between multiple partially completed structures. Self-assembly pathways are extracted from the simulation trajectories by a fully extendable scheme for identifying structural fragments, which are then assembled into history diagrams for successfully completed target structures. For the simple target, a one-component assembly scheme is most efficient and robust overall, but hierarchical and addressable strategies can have an advantage under some conditions if high yield is a priority

Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

Science.gov (United States)

Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

2017-11-08

The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Saturating representation of loop conformational fragments in structure databanks

Directory of Open Access Journals (Sweden)

Fiser András

2006-07-01

Full Text Available Abstract Background Short fragments of proteins are fundamental starting points in various structure prediction applications, such as in fragment based loop modeling methods but also in various full structure build-up procedures. The applicability and performance of these approaches depend on the availability of short fragments in structure databanks. Results We studied the representation of protein loop fragments up to 14 residues in length. All possible query fragments found in sequence databases (Sequence Space were clustered and cross referenced with available structural fragments in Protein Data Bank (Structure Space. We found that the expansion of PDB in the last few years resulted in a dense coverage of loop conformational fragments. For each loops of length 8 in the current Sequence Space there is at least one loop in Structure Space with 50% or higher sequence identity. By correlating sequence and structure clusters of loops we found that a 50% sequence identity generally guarantees structural similarity. These percentages of coverage at 50% sequence cutoff drop to 96, 94, 68, 53, 33 and 13% for loops of length 9, 10, 11, 12, 13, and 14, respectively. There is not a single loop in the current Sequence Space at any length up to 14 residues that is not matched with a conformational segment that shares at least 20% sequence identity. This minimum observed identity is 40% for loops of 12 residues or shorter and is as high as 50% for 10 residue or shorter loops. We also assessed the impact of rapidly growing sequence databanks on the estimated number of new loop conformations and found that while the number of sequentially unique sequence segments increased about six folds during the last five years there are almost no unique conformational segments among these up to 12 residues long fragments. Conclusion The results suggest that fragment based prediction approaches are not limited any more by the completeness of fragments in databanks but

A base composition analysis of natural patterns for the preprocessing of metagenome sequences.

Science.gov (United States)

Bonham-Carter, Oliver; Ali, Hesham; Bastola, Dhundy

2013-01-01

On the pretext that sequence reads and contigs often exhibit the same kinds of base usage that is also observed in the sequences from which they are derived, we offer a base composition analysis tool. Our tool uses these natural patterns to determine relatedness across sequence data. We introduce spectrum sets (sets of motifs) which are permutations of bacterial restriction sites and the base composition analysis framework to measure their proportional content in sequence data. We suggest that this framework will increase the efficiency during the pre-processing stages of metagenome sequencing and assembly projects. Our method is able to differentiate organisms and their reads or contigs. The framework shows how to successfully determine the relatedness between these reads or contigs by comparison of base composition. In particular, we show that two types of organismal-sequence data are fundamentally different by analyzing their spectrum set motif proportions (coverage). By the application of one of the four possible spectrum sets, encompassing all known restriction sites, we provide the evidence to claim that each set has a different ability to differentiate sequence data. Furthermore, we show that the spectrum set selection having relevance to one organism, but not to the others of the data set, will greatly improve performance of sequence differentiation even if the fragment size of the read, contig or sequence is not lengthy. We show the proof of concept of our method by its application to ten trials of two or three freshly selected sequence fragments (reads and contigs) for each experiment across the six organisms of our set. Here we describe a novel and computationally effective pre-processing step for metagenome sequencing and assembly tasks. Furthermore, our base composition method has applications in phylogeny where it can be used to infer evolutionary distances between organisms based on the notion that related organisms often have much conserved code.

Characterization of Liaoning cashmere goat transcriptome: sequencing, de novo assembly, functional annotation and comparative analysis.

Directory of Open Access Journals (Sweden)

Hongliang Liu

Full Text Available Liaoning cashmere goat is a famous goat breed for cashmere wool. In order to increase the transcriptome data and accelerate genetic improvement for this breed, we performed de novo transcriptome sequencing to generate the first expressed sequence tag dataset for the Liaoning cashmere goat, using next-generation sequencing technology.Transcriptome sequencing of Liaoning cashmere goat on a Roche 454 platform yielded 804,601 high-quality reads. Clustering and assembly of these reads produced a non-redundant set of 117,854 unigenes, comprising 13,194 isotigs and 104,660 singletons. Based on similarity searches with known proteins, 17,356 unigenes were assigned to 6,700 GO categories, and the terms were summarized into three main GO categories and 59 sub-categories. 3,548 and 46,778 unigenes had significant similarity to existing sequences in the KEGG and COG databases, respectively. Comparative analysis revealed that 42,254 unigenes were aligned to 17,532 different sequences in NCBI non-redundant nucleotide databases. 97,236 (82.51% unigenes were mapped to the 30 goat chromosomes. 35,551 (30.17% unigenes were matched to 11,438 reported goat protein-coding genes. The remaining non-matched unigenes were further compared with cattle and human reference genes, 67 putative new goat genes were discovered. Additionally, 2,781 potential simple sequence repeats were initially identified from all unigenes.The transcriptome of Liaoning cashmere goat was deep sequenced, de novo assembled, and annotated, providing abundant data to better understand the Liaoning cashmere goat transcriptome. The potential simple sequence repeats provide a material basis for future genetic linkage and quantitative trait loci analyses.

Discovery of human inversion polymorphisms by comparative analysis of human and chimpanzee DNA sequence assemblies.

Directory of Open Access Journals (Sweden)

2005-10-01

Full Text Available With a draft genome-sequence assembly for the chimpanzee available, it is now possible to perform genome-wide analyses to identify, at a submicroscopic level, structural rearrangements that have occurred between chimpanzees and humans. The goal of this study was to investigate chromosomal regions that are inverted between the chimpanzee and human genomes. Using the net alignments for the builds of the human and chimpanzee genome assemblies, we identified a total of 1,576 putative regions of inverted orientation, covering more than 154 mega-bases of DNA. The DNA segments are distributed throughout the genome and range from 23 base pairs to 62 mega-bases in length. For the 66 inversions more than 25 kilobases (kb in length, 75% were flanked on one or both sides by (often unrelated segmental duplications. Using PCR and fluorescence in situ hybridization we experimentally validated 23 of 27 (85% semi-randomly chosen regions; the largest novel inversion confirmed was 4.3 mega-bases at human Chromosome 7p14. Gorilla was used as an out-group to assign ancestral status to the variants. All experimentally validated inversion regions were then assayed against a panel of human samples and three of the 23 (13% regions were found to be polymorphic in the human genome. These polymorphic inversions include 730 kb (at 7p22, 13 kb (at 7q11, and 1 kb (at 16q24 fragments with a 5%, 30%, and 48% minor allele frequency, respectively. Our results suggest that inversions are an important source of variation in primate genome evolution. The finding of at least three novel inversion polymorphisms in humans indicates this type of structural variation may be a more common feature of our genome than previously realized.

Sequencing and De novo Draft Assemblies of the Fathead Minnow (Pimphales promelas)Reference Genome

Science.gov (United States)

This study was undertaken to develop genome-scale resources for the fathead minnow (Pimphales promelas) an important model organism widely used in both aquatic ecotoxicology research and in regulatory toxicity testing. We report on the first sequencing and two draft assemblies fo...

Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

Science.gov (United States)

Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

2017-02-01

A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

Coevolutionary constraints in the sequence-space of macromolecular complexes reflect their self-assembly pathways.

Science.gov (United States)

Mallik, Saurav; Kundu, Sudip

2017-07-01

Is the order in which biomolecular subunits self-assemble into functional macromolecular complexes imprinted in their sequence-space? Here, we demonstrate that the temporal order of macromolecular complex self-assembly can be efficiently captured using the landscape of residue-level coevolutionary constraints. This predictive power of coevolutionary constraints is irrespective of the structural, functional, and phylogenetic classification of the complex and of the stoichiometry and quaternary arrangement of the constituent monomers. Combining this result with a number of structural attributes estimated from the crystal structure data, we find indications that stronger coevolutionary constraints at interfaces formed early in the assembly hierarchy probably promotes coordinated fixation of mutations that leads to high-affinity binding with higher surface area, increased surface complementarity and elevated number of molecular contacts, compared to those that form late in the assembly. Proteins 2017; 85:1183-1189. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

The diploid genome sequence of an individual human.

Directory of Open Access Journals (Sweden)

Samuel Levy

2007-09-01

Full Text Available Presented here is a genome sequence of an individual human. It was produced from approximately 32 million random DNA fragments, sequenced by Sanger dideoxy technology and assembled into 4,528 scaffolds, comprising 2,810 million bases (Mb of contiguous sequence with approximately 7.5-fold coverage for any given region. We developed a modified version of the Celera assembler to facilitate the identification and comparison of alternate alleles within this individual diploid genome. Comparison of this genome and the National Center for Biotechnology Information human reference assembly revealed more than 4.1 million DNA variants, encompassing 12.3 Mb. These variants (of which 1,288,319 were novel included 3,213,401 single nucleotide polymorphisms (SNPs, 53,823 block substitutions (2-206 bp, 292,102 heterozygous insertion/deletion events (indels(1-571 bp, 559,473 homozygous indels (1-82,711 bp, 90 inversions, as well as numerous segmental duplications and copy number variation regions. Non-SNP DNA variation accounts for 22% of all events identified in the donor, however they involve 74% of all variant bases. This suggests an important role for non-SNP genetic alterations in defining the diploid genome structure. Moreover, 44% of genes were heterozygous for one or more variants. Using a novel haplotype assembly strategy, we were able to span 1.5 Gb of genome sequence in segments >200 kb, providing further precision to the diploid nature of the genome. These data depict a definitive molecular portrait of a diploid human genome that provides a starting point for future genome comparisons and enables an era of individualized genomic information.

The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads

DEFF Research Database (Denmark)

Wang, Zhiwen; Hobson, Neil; Galindo, Leonardo

2012-01-01

Flax (Linum usitatissimum) is an ancient crop that is widely cultivated as a source of fiber, oil and medicinally relevant compounds. To accelerate crop improvement, we performed whole-genome shotgun sequencing of the nuclear genome of flax. Seven paired-end libraries ranging in size from 300 bp...... these results show that de novo assembly, based solely on whole-genome shotgun short-sequence reads, is an efficient means of obtaining nearly complete genome sequence information for some plant species....

Mathematical model and metaheuristics for simultaneous balancing and sequencing of a robotic mixed-model assembly line

Science.gov (United States)

Li, Zixiang; Janardhanan, Mukund Nilakantan; Tang, Qiuhua; Nielsen, Peter

2018-05-01

This article presents the first method to simultaneously balance and sequence robotic mixed-model assembly lines (RMALB/S), which involves three sub-problems: task assignment, model sequencing and robot allocation. A new mixed-integer programming model is developed to minimize makespan and, using CPLEX solver, small-size problems are solved for optimality. Two metaheuristics, the restarted simulated annealing algorithm and co-evolutionary algorithm, are developed and improved to address this NP-hard problem. The restarted simulated annealing method replaces the current temperature with a new temperature to restart the search process. The co-evolutionary method uses a restart mechanism to generate a new population by modifying several vectors simultaneously. The proposed algorithms are tested on a set of benchmark problems and compared with five other high-performing metaheuristics. The proposed algorithms outperform their original editions and the benchmarked methods. The proposed algorithms are able to solve the balancing and sequencing problem of a robotic mixed-model assembly line effectively and efficiently.

MIDAS: A Modular DNA Assembly System for Synthetic Biology.

Science.gov (United States)

van Dolleweerd, Craig J; Kessans, Sarah A; Van de Bittner, Kyle C; Bustamante, Leyla Y; Bundela, Rudranuj; Scott, Barry; Nicholson, Matthew J; Parker, Emily J

2018-04-20

A modular and hierarchical DNA assembly platform for synthetic biology based on Golden Gate (Type IIS restriction enzyme) cloning is described. This enabling technology, termed MIDAS (for Modular Idempotent DNA Assembly System), can be used to precisely assemble multiple DNA fragments in a single reaction using a standardized assembly design. It can be used to build genes from libraries of sequence-verified, reusable parts and to assemble multiple genes in a single vector, with full user control over gene order and orientation, as well as control of the direction of growth (polarity) of the multigene assembly, a feature that allows genes to be nested between other genes or genetic elements. We describe the detailed design and use of MIDAS, exemplified by the reconstruction, in the filamentous fungus Penicillium paxilli, of the metabolic pathway for production of paspaline and paxilline, key intermediates in the biosynthesis of a range of indole diterpenes-a class of secondary metabolites produced by several species of filamentous fungi. MIDAS was used to efficiently assemble a 25.2 kb plasmid from 21 different modules (seven genes, each composed of three basic parts). By using a parts library-based system for construction of complex assemblies, and a unique set of vectors, MIDAS can provide a flexible route to assembling tailored combinations of genes and other genetic elements, thereby supporting synthetic biology applications in a wide range of expression hosts.

Using nanopore sequencing to get complete genomes from complex samples

DEFF Research Database (Denmark)

Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Nielsen, Per Halkjær

The advantages of “next generation sequencing” has come at the cost of genome finishing. The dominant sequencing technology provides short reads of 150-300 bp, which has made genome assembly very difficult as the reads do not span important repeat regions. Genomes have thus been added...... to the databases as fragmented assemblies and not as finished contigs that resemble the chromosomes in which the DNA is organised within the cells. This is especially troublesome for genomes derived from complex metagenome sequencing. Databases with incomplete genomes can lead to false conclusions about...... the absence of genes and functional predictions of the organisms. Furthermore, it is common that repetitive elements and marker genes such as the 16S rRNA gene are missing completely from these genome bins. Using nanopore long reads, we demonstrate that it is possible to span these regions and make complete...

Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

Science.gov (United States)

Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

2018-01-01

High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

Phylogenetic similarity of the canine parvovirus wild-type isolates on the basis of VP1/VP2 gene fragment sequence analysis.

Science.gov (United States)

Rypul, K; Chmielewski, R; Smielewska-Loś, E; Klimentowski, S

2002-04-01

Biological material was taken from dogs with diarrhoea. Faecal samples were taken from within live animals and intestinal tract fragments (i.e. small intestine, and stomach) were taken from dead animals. In total, 18 specimens were investigated from dogs housed alone or in large groups. To test for the presence of the virus, latex (On Site Biotech, Uppsala, Sweden) and direct immunofluorescence tests were performed. At the same time, polymerase chain reaction (PCR) with primers complementary to a conservative region of VP1/VP2 was carried out. The products of amplification were analysed on 2% agarose gel. The purified products were cloned with the Template Generation System (Finnzymes, Espoo, Finland) using a transposition reaction and positive clones were searched using the 'colony screening by PCR' method. The sequencing gave 12 sequences of VP1/VP2 gene fragments that were of high similarity. Among the 12 analysed sequences, six exhibited 88% similarity, four exhibited 100% similarity and two exhibited 71% similarity.

Reconstruction of Banknote Fragments Based on Keypoint Matching Method.

Science.gov (United States)

Gwo, Chih-Ying; Wei, Chia-Hung; Li, Yue; Chiu, Nan-Hsing

2015-07-01

Banknotes may be shredded by a scrap machine, ripped up by hand, or damaged in accidents. This study proposes an image registration method for reconstruction of multiple sheets of banknotes. The proposed method first constructs different scale spaces to identify keypoints in the underlying banknote fragments. Next, the features of those keypoints are extracted to represent their local patterns around keypoints. Then, similarity is computed to find the keypoint pairs between the fragment and the reference banknote. The banknote fragments can determine the coordinate and amend the orientation. Finally, an assembly strategy is proposed to piece multiple sheets of banknote fragments together. Experimental results show that the proposed method causes, on average, a deviation of 0.12457 ± 0.12810° for each fragment while the SIFT method deviates 1.16893 ± 2.35254° on average. The proposed method not only reconstructs the banknotes but also decreases the computing cost. Furthermore, the proposed method can estimate relatively precisely the orientation of the banknote fragments to assemble. © 2015 American Academy of Forensic Sciences.

Draft genome sequence of ramie, Boehmeria nivea (L.) Gaudich.

Science.gov (United States)

Luan, Ming-Bao; Jian, Jian-Bo; Chen, Ping; Chen, Jun-Hui; Chen, Jian-Hua; Gao, Qiang; Gao, Gang; Zhou, Ju-Hong; Chen, Kun-Mei; Guang, Xuan-Min; Chen, Ji-Kang; Zhang, Qian-Qian; Wang, Xiao-Fei; Fang, Long; Sun, Zhi-Min; Bai, Ming-Zhou; Fang, Xiao-Dong; Zhao, Shan-Cen; Xiong, He-Ping; Yu, Chun-Ming; Zhu, Ai-Guo

2018-05-01

Ramie, Boehmeria nivea (L.) Gaudich, family Urticaceae, is a plant native to eastern Asia, and one of the world's oldest fibre crops. It is also used as animal feed and for the phytoremediation of heavy metal-contaminated farmlands. Thus, the genome sequence of ramie was determined to explore the molecular basis of its fibre quality, protein content and phytoremediation. For further understanding ramie genome, different paired-end and mate-pair libraries were combined to generate 134.31 Gb of raw DNA sequences using the Illumina whole-genome shotgun sequencing approach. The highly heterozygous B. nivea genome was assembled using the Platanus Genome Assembler, which is an effective tool for the assembly of highly heterozygous genome sequences. The final length of the draft genome of this species was approximately 341.9 Mb (contig N50 = 22.62 kb, scaffold N50 = 1,126.36 kb). Based on ramie genome annotations, 30,237 protein-coding genes were predicted, and the repetitive element content was 46.3%. The completeness of the final assembly was evaluated by benchmarking universal single-copy orthologous genes (BUSCO); 90.5% of the 1,440 expected embryophytic genes were identified as complete, and 4.9% were identified as fragmented. Phylogenetic analysis based on single-copy gene families and one-to-one orthologous genes placed ramie with mulberry and cannabis, within the clade of urticalean rosids. Genome information of ramie will be a valuable resource for the conservation of endangered Boehmeria species and for future studies on the biogeography and characteristic evolution of members of Urticaceae. © 2018 John Wiley & Sons Ltd.

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

DEFF Research Database (Denmark)

Liu, Siyang; Huang, Shujia; Rao, Junhua

2015-01-01

present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data.

Science.gov (United States)

Nishito, Yukari; Osana, Yasunori; Hachiya, Tsuyoshi; Popendorf, Kris; Toyoda, Atsushi; Fujiyama, Asao; Itaya, Mitsuhiro; Sakakibara, Yasubumi

2010-04-16

Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for gamma-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B. subtilis natto harbors but B. subtilis 168 lacks

Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data

Directory of Open Access Journals (Sweden)

Fujiyama Asao

2010-04-01

Full Text Available Abstract Background Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. Results We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for γ-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. Conclusions The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B

Draft Genome Sequence of a “Candidatus Liberibacter europaeus” Strain Assembled from Broom Psyllids (Arytainilla spartiophila) from New Zealand

Science.gov (United States)

Thompson, Sarah M.; Kalamorz, Falk; David, Charles; Addison, Shea M.; Smith, Grant R.

2018-01-01

ABSTRACT Here, we report the draft genome sequence of “Candidatus Liberibacter europaeus” ASNZ1, assembled from broom psyllids (Arytainilla spartiophila) from New Zealand. The assembly comprises 15 contigs, with a total length of 1.33 Mb and a G+C content of 33.5%. PMID:29773636

De novo transcriptome sequencing and assembly from apomictic and sexual Eragrostis curvula genotypes.

Directory of Open Access Journals (Sweden)

Ingrid Garbus

Full Text Available A long-standing goal in plant breeding has been the ability to confer apomixis to agriculturally relevant species, which would require a deeper comprehension of the molecular basis of apomictic regulatory mechanisms. Eragrostis curvula (Schrad. Nees is a perennial grass that includes both sexual and apomictic cytotypes. The availability of a reference transcriptome for this species would constitute a very important tool toward the identification of genes controlling key steps of the apomictic pathway. Here, we used Roche/454 sequencing technologies to generate reads from inflorescences of E. curvula apomictic and sexual genotypes that were de novo assembled into a reference transcriptome. Near 90% of the 49568 assembled isotigs showed sequence similarity to sequences deposited in the public databases. A gene ontology analysis categorized 27448 isotigs into at least one of the three main GO categories. We identified 11475 SSRs, and several of them were assayed in E curvula germoplasm using SSR-based primers, providing a valuable set of molecular markers that could allow direct allele selection. The differential contribution to each library of the spliced forms of several transcripts revealed the existence of several isotigs produced via alternative splicing of single genes. The reference transcriptome presented and validated in this work will be useful for the identification of a wide range of gene(s related to agronomic traits of E. curvula, including those controlling key steps of the apomictic pathway in this species, allowing the extrapolation of the findings to other plant species.

Knowledge-based decision support for Space Station assembly sequence planning

Science.gov (United States)

1991-04-01

A complete Personal Analysis Assistant (PAA) for Space Station Freedom (SSF) assembly sequence planning consists of three software components: the system infrastructure, intra-flight value added, and inter-flight value added. The system infrastructure is the substrate on which software elements providing inter-flight and intra-flight value-added functionality are built. It provides the capability for building representations of assembly sequence plans and specification of constraints and analysis options. Intra-flight value-added provides functionality that will, given the manifest for each flight, define cargo elements, place them in the National Space Transportation System (NSTS) cargo bay, compute performance measure values, and identify violated constraints. Inter-flight value-added provides functionality that will, given major milestone dates and capability requirements, determine the number and dates of required flights and develop a manifest for each flight. The current project is Phase 1 of a projected two phase program and delivers the system infrastructure. Intra- and inter-flight value-added were to be developed in Phase 2, which has not been funded. Based on experience derived from hundreds of projects conducted over the past seven years, ISX developed an Intelligent Systems Engineering (ISE) methodology that combines the methods of systems engineering and knowledge engineering to meet the special systems development requirements posed by intelligent systems, systems that blend artificial intelligence and other advanced technologies with more conventional computing technologies. The ISE methodology defines a phased program process that begins with an application assessment designed to provide a preliminary determination of the relative technical risks and payoffs associated with a potential application, and then moves through requirements analysis, system design, and development.

Gene Discovery in the Apicomplexa as Revealed by EST Sequencing and Assembly of a Comparative Gene Database

Science.gov (United States)

Li, Li; Brunk, Brian P.; Kissinger, Jessica C.; Pape, Deana; Tang, Keliang; Cole, Robert H.; Martin, John; Wylie, Todd; Dante, Mike; Fogarty, Steven J.; Howe, Daniel K.; Liberator, Paul; Diaz, Carmen; Anderson, Jennifer; White, Michael; Jerome, Maria E.; Johnson, Emily A.; Radke, Jay A.; Stoeckert, Christian J.; Waterston, Robert H.; Clifton, Sandra W.; Roos, David S.; Sibley, L. David

2003-01-01

Large-scale EST sequencing projects for several important parasites within the phylum Apicomplexa were undertaken for the purpose of gene discovery. Included were several parasites of medical importance (Plasmodium falciparum, Toxoplasma gondii) and others of veterinary importance (Eimeria tenella, Sarcocystis neurona, and Neospora caninum). A total of 55,192 ESTs, deposited into dbEST/GenBank, were included in the analyses. The resulting sequences have been clustered into nonredundant gene assemblies and deposited into a relational database that supports a variety of sequence and text searches. This database has been used to compare the gene assemblies using BLAST similarity comparisons to the public protein databases to identify putative genes. Of these new entries, ∼15%–20% represent putative homologs with a conservative cutoff of p neurona: , , , , , , , , , , , , , –, –, –, –, –. Eimeria tenella: –, –, –, –, –, –, –, –, – , –, –, –, –, –, –, –, –, –, –, –. Neospora caninum: –, –, , – , –, –.] PMID:12618375

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

Sequencing of BAC pools by different next generation sequencing platforms and strategies

Directory of Open Access Journals (Sweden)

Scholz Uwe

2011-10-01

Full Text Available Abstract Background Next generation sequencing of BACs is a viable option for deciphering the sequence of even large and highly repetitive genomes. In order to optimize this strategy, we examined the influence of read length on the quality of Roche/454 sequence assemblies, to what extent Illumina/Solexa mate pairs (MPs improve the assemblies by scaffolding and whether barcoding of BACs is dispensable. Results Sequencing four BACs with both FLX and Titanium technologies revealed similar sequencing accuracy, but showed that the longer Titanium reads produce considerably less misassemblies and gaps. The 454 assemblies of 96 barcoded BACs were improved by scaffolding 79% of the total contig length with MPs from a non-barcoded library. Assembly of the unmasked 454 sequences without separation by barcodes revealed chimeric contig formation to be a major problem, encompassing 47% of the total contig length. Masking the sequences reduced this fraction to 24%. Conclusion Optimal BAC pool sequencing should be based on the longest available reads, with barcoding essential for a comprehensive assessment of both repetitive and non-repetitive sequence information. When interest is restricted to non-repetitive regions and repeats are masked prior to assembly, barcoding is non-essential. In any case, the assemblies can be improved considerably by scaffolding with non-barcoded BAC pool MPs.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

Science.gov (United States)

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Deep sequencing as a method of typing bluetongue virus isolates.

Science.gov (United States)

Rao, Pavuluri Panduranga; Reddy, Yella Narasimha; Ganesh, Kapila; Nair, Shreeja G; Niranjan, Vidya; Hegde, Nagendra R

2013-11-01

Bluetongue (BT) is an economically important endemic disease of livestock in tropics and subtropics. In addition, its recent spread to temperate regions like North America and Northern Europe is of serious concern. Rapid serotyping and characterization of BT virus (BTV) is an essential step in the identification of origin of the virus and for controlling the disease. Serotyping of BTV is typically performed by serum neutralization, and of late by nucleotide sequencing. This report describes the near complete genome sequencing and typing of two isolates of BTV using Illumina next generation sequencing platform. Two of the BTV RNAs were multiplexed with ten other unknown samples. Viral RNA was isolated and fragmented, reverse transcribed, the cDNA ends were repaired and ligated with a multiplex oligo. The genome library was amplified using primers complementary to the ligated oligo and subjected to single and paired end sequencing. The raw reads were assembled using a de novo method and reference-based assembly was performed based on the contig data. Near complete sequences of all segments of BTV were obtained with more than 20× coverage, and single read sequencing method was sufficient to identify the genotype and serotype of the virus. The two viruses used in this study were typed as BTV-1 and BTV-9E. Copyright © 2013 Elsevier B.V. All rights reserved.

Short-read reading-frame predictors are not created equal: sequence error causes loss of signal

Directory of Open Access Journals (Sweden)

Trimble William L

2012-07-01

Full Text Available Abstract Background Gene prediction algorithms (or gene callers are an essential tool for analyzing shotgun nucleic acid sequence data. Gene prediction is a ubiquitous step in sequence analysis pipelines; it reduces the volume of data by identifying the most likely reading frame for a fragment, permitting the out-of-frame translations to be ignored. In this study we evaluate five widely used ab initio gene-calling algorithms—FragGeneScan, MetaGeneAnnotator, MetaGeneMark, Orphelia, and Prodigal—for accuracy on short (75–1000 bp fragments containing sequence error from previously published artificial data and “real” metagenomic datasets. Results While gene prediction tools have similar accuracies predicting genes on error-free fragments, in the presence of sequencing errors considerable differences between tools become evident. For error-containing short reads, FragGeneScan finds more prokaryotic coding regions than does MetaGeneAnnotator, MetaGeneMark, Orphelia, or Prodigal. This improved detection of genes in error-containing fragments, however, comes at the cost of much lower (50% specificity and overprediction of genes in noncoding regions. Conclusions Ab initio gene callers offer a significant reduction in the computational burden of annotating individual nucleic acid reads and are used in many metagenomic annotation systems. For predicting reading frames on raw reads, we find the hidden Markov model approach in FragGeneScan is more sensitive than other gene prediction tools, while Prodigal, MGA, and MGM are better suited for higher-quality sequences such as assembled contigs.

Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.

Science.gov (United States)

Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T

2013-01-01

Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal

Distilled single-cell genome sequencing and de novo assembly for sparse microbial communities.

Science.gov (United States)

Taghavi, Zeinab; Movahedi, Narjes S; Draghici, Sorin; Chitsaz, Hamidreza

2013-10-01

Identification of every single genome present in a microbial sample is an important and challenging task with crucial applications. It is challenging because there are typically millions of cells in a microbial sample, the vast majority of which elude cultivation. The most accurate method to date is exhaustive single-cell sequencing using multiple displacement amplification, which is simply intractable for a large number of cells. However, there is hope for breaking this barrier, as the number of different cell types with distinct genome sequences is usually much smaller than the number of cells. Here, we present a novel divide and conquer method to sequence and de novo assemble all distinct genomes present in a microbial sample with a sequencing cost and computational complexity proportional to the number of genome types, rather than the number of cells. The method is implemented in a tool called Squeezambler. We evaluated Squeezambler on simulated data. The proposed divide and conquer method successfully reduces the cost of sequencing in comparison with the naïve exhaustive approach. Squeezambler and datasets are available at http://compbio.cs.wayne.edu/software/squeezambler/.

De novo sequencing, assembly and characterization of antennal transcriptome of Anomala corpulenta Motschulsky (Coleoptera: Rutelidae.

Directory of Open Access Journals (Sweden)

Haoliang Chen

Full Text Available Anomala corpulenta is an important insect pest and can cause enormous economic losses in agriculture, horticulture and forestry. It is widely distributed in China, and both larvae and adults can cause serious damage. It is difficult to control this pest because the larvae live underground. Any new control strategy should exploit alternatives to heavily and frequently used chemical insecticides. However, little genetic research has been carried out on A. corpulenta due to the lack of genomic resources. Genomic resources could be produced by next generation sequencing technologies with low cost and in a short time. In this study, we performed de novo sequencing, assembly and characterization of the antennal transcriptome of A. corpulenta.Illumina sequencing technology was used to sequence the antennal transcriptome of A. corpulenta. Approximately 76.7 million total raw reads and about 68.9 million total clean reads were obtained, and then 35,656 unigenes were assembled. Of these unigenes, 21,463 of them could be annotated in the NCBI nr database, and, among the annotated unigenes, 11,154 and 6,625 unigenes could be assigned to GO and COG, respectively. Additionally, 16,350 unigenes could be annotated in the Swiss-Prot database, and 14,499 unigenes could map onto 258 pathways in the KEGG Pathway database. We also found 24 unigenes related to OBPs, 6 to CSPs, and in total 167 unigenes related to chemodetection. We analyzed 4 OBPs and 3CSPs sequences and their RT-qPCR results agreed well with their FPKM values.We produced the first large-scale antennal transcriptome of A. corpulenta, which is a species that has little genomic information in public databases. The identified chemodetection unigenes can promote the molecular mechanistic study of behavior in A. corpulenta. These findings provide a general sequence resource for molecular genetics research on A. corpulenta.

Assembly of α-synuclein fibrils in nanoscale studied by peptide truncation and AFM

International Nuclear Information System (INIS)

Zhang Feng; Lin Xiaojing; Ji Lina; Du Haining; Tang Lin; He Jianhua; Hu Jun; Hu Hongyu

2008-01-01

α-Synuclein (α-Syn) fibrils are the major component of Lewy bodies that are closely associated with the pathogenesis of Parkinson's disease, but the mechanism for the fibril assembly remains poorly understood. Here we report using a combination of peptide truncation and atomic force microscopy (AFM) to elucidate the self-assembly and morphology of the α-Syn fibrils. The results show that protease K significantly slims the fibrils from the mean height of ∼6.6 to ∼4.7 nm, whereas chaotropic denaturant urea completely breaks down the fibrils into small particles. The in situ enzymatic digestion also results in thinning of the fibrils, giving rise to some nicks on the fibrils. Moreover, N- or C-terminally truncated α-Syn fragments assemble into thinner filaments with the heights depending on the peptide lengths. A nine-residue peptide corresponding to the homologous GAV-motif sequence can form very thin (∼2.2 nm) but long (>1 μm) filaments. Thus, the central sequence of α-Syn forms a fibrillar core by cross-β-structure that is flanked by two flexible termini, and the orientation of the fibril growth is perpendicular to the β-sheet structures

De Novo Assembly of the Donkey White Blood Cell Transcriptome and a Comparative Analysis of Phenotype-Associated Genes between Donkeys and Horses.

Science.gov (United States)

Xie, Feng-Yun; Feng, Yu-Long; Wang, Hong-Hui; Ma, Yun-Feng; Yang, Yang; Wang, Yin-Chao; Shen, Wei; Pan, Qing-Jie; Yin, Shen; Sun, Yu-Jiang; Ma, Jun-Yu

2015-01-01

Prior to the mechanization of agriculture and labor-intensive tasks, humans used donkeys (Equus africanus asinus) for farm work and packing. However, as mechanization increased, donkeys have been increasingly raised for meat, milk, and fur in China. To maintain the development of the donkey industry, breeding programs should focus on traits related to these new uses. Compared to conventional marker-assisted breeding plans, genome- and transcriptome-based selection methods are more efficient and effective. To analyze the coding genes of the donkey genome, we assembled the transcriptome of donkey white blood cells de novo. Using transcriptomic deep-sequencing data, we identified 264,714 distinct donkey unigenes and predicted 38,949 protein fragments. We annotated the donkey unigenes by BLAST searches against the non-redundant (NR) protein database. We also compared the donkey protein sequences with those of the horse (E. caballus) and wild horse (E. przewalskii), and linked the donkey protein fragments with mammalian phenotypes. As the outer ear size of donkeys and horses are obviously different, we compared the outer ear size-associated proteins in donkeys and horses. We identified three ear size-associated proteins, HIC1, PRKRA, and KMT2A, with sequence differences among the donkey, horse, and wild horse loci. Since the donkey genome sequence has not been released, the de novo assembled donkey transcriptome is helpful for preliminary investigations of donkey cultivars and for genetic improvement.

Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

Directory of Open Access Journals (Sweden)

J. Mala

2017-06-01

Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

Comparison of bacterial genome assembly software for MinION data and their applicability to medical microbiology.

Science.gov (United States)

Judge, Kim; Hunt, Martin; Reuter, Sandra; Tracey, Alan; Quail, Michael A; Parkhill, Julian; Peacock, Sharon J

2016-09-01

Translating the Oxford Nanopore MinION sequencing technology into medical microbiology requires on-going analysis that keeps pace with technological improvements to the instrument and release of associated analysis software. Here, we use a multidrug-resistant Enterobacter kobei isolate as a model organism to compare open source software for the assembly of genome data, and relate this to the time taken to generate actionable information. Three software tools (PBcR, Canu and miniasm) were used to assemble MinION data and a fourth (SPAdes) was used to combine MinION and Illumina data to produce a hybrid assembly. All four had a similar number of contigs and were more contiguous than the assembly using Illumina data alone, with SPAdes producing a single chromosomal contig. Evaluation of the four assemblies to represent the genome structure revealed a single large inversion in the SPAdes assembly, which also incorrectly integrated a plasmid into the chromosomal contig. Almost 50 %, 80 % and 90 % of MinION pass reads were generated in the first 6, 9 and 12 h, respectively. Using data from the first 6 h alone led to a less accurate, fragmented assembly, but data from the first 9 or 12 h generated similar assemblies to that from 48 h sequencing. Assemblies were generated in 2 h using Canu, indicating that going from isolate to assembled data is possible in less than 48 h. MinION data identified that genes responsible for resistance were carried by two plasmids encoding resistance to carbapenem and to sulphonamides, rifampicin and aminoglycosides, respectively.

[Complete genome sequencing of polymalic acid-producing strain Aureobasidium pullulans CCTCC M2012223].

Science.gov (United States)

Wang, Yongkang; Song, Xiaodan; Li, Xiaorong; Yang, Sang-tian; Zou, Xiang

2017-01-04

To explore the genome sequence of Aureobasidium pullulans CCTCC M2012223, analyze the key genes related to the biosynthesis of important metabolites, and provide genetic background for metabolic engineering. Complete genome of A. pullulans CCTCC M2012223 was sequenced by Illumina HiSeq high throughput sequencing platform. Then, fragment assembly, gene prediction, functional annotation, and GO/COG cluster were analyzed in comparison with those of other five A. pullulans varieties. The complete genome sequence of A. pullulans CCTCC M2012223 was 30756831 bp with an average GC content of 47.49%, and 9452 genes were successfully predicted. Genome-wide analysis showed that A. pullulans CCTCC M2012223 had the biggest genome assembly size. Protein sequences involved in the pullulan and polymalic acid pathway were highly conservative in all of six A. pullulans varieties. Although both A. pullulans CCTCC M2012223 and A. pullulans var. melanogenum have a close affinity, some point mutation and inserts were occurred in protein sequences involved in melanin biosynthesis. Genome information of A. pullulans CCTCC M2012223 was annotated and genes involved in melanin, pullulan and polymalic acid pathway were compared, which would provide a theoretical basis for genetic modification of metabolic pathway in A. pullulans.

Sequence Identification, Recombinant Production, and Analysis of the Self-Assembly of Egg Stalk Silk Proteins from Lacewing Chrysoperla carnea.

Science.gov (United States)

Neuenfeldt, Martin; Scheibel, Thomas

2017-06-13

Egg stalk silks of the common green lacewing Chrysoperla carnea likely comprise at least three different silk proteins. Based on the natural spinning process, it was hypothesized that these proteins self-assemble without shear stress, as adult lacewings do not use a spinneret. To examine this, the first sequence identification and determination of the gene expression profile of several silk proteins and various transcript variants thereof was conducted, and then the three major proteins were recombinantly produced in Escherichia coli encoded by their native complementary DNA (cDNA) sequences. Circular dichroism measurements indicated that the silk proteins in aqueous solutions had a mainly intrinsically disordered structure. The largest silk protein, which we named ChryC1, exhibited a lower critical solution temperature (LCST) behavior and self-assembled into fibers or film morphologies, depending on the conditions used. The second silk protein, ChryC2, self-assembled into nanofibrils and subsequently formed hydrogels. Circular dichroism and Fourier transform infrared spectroscopy confirmed conformational changes of both proteins into beta sheet rich structures upon assembly. ChryC3 did not self-assemble into any morphology under the tested conditions. Thereby, through this work, it could be shown that recombinant lacewing silk proteins can be produced and further used for studying the fiber formation of lacewing egg stalks.

Path planning algorithms for assembly sequence planning. [in robot kinematics

Science.gov (United States)

Krishnan, S. S.; Sanderson, Arthur C.

1991-01-01

Planning for manipulation in complex environments often requires reasoning about the geometric and mechanical constraints which are posed by the task. In planning assembly operations, the automatic generation of operations sequences depends on the geometric feasibility of paths which permit parts to be joined into subassemblies. Feasible locations and collision-free paths must be present for part motions, robot and grasping motions, and fixtures. This paper describes an approach to reasoning about the feasibility of straight-line paths among three-dimensional polyhedral parts using an algebra of polyhedral cones. A second method recasts the feasibility conditions as constraints in a nonlinear optimization framework. Both algorithms have been implemented and results are presented.

Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

Science.gov (United States)

Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

2006-05-01

The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

GapMis: a tool for pairwise sequence alignment with a single gap.

Science.gov (United States)

Flouri, Tomás; Frousios, Kimon; Iliopoulos, Costas S; Park, Kunsoo; Pissis, Solon P; Tischler, German

2013-08-01

Pairwise sequence alignment has received a new motivation due to the advent of recent patents in next-generation sequencing technologies, particularly so for the application of re-sequencing---the assembly of a genome directed by a reference sequence. After the fast alignment between a factor of the reference sequence and a high-quality fragment of a short read by a short-read alignment programme, an important problem is to find the alignment between a relatively short succeeding factor of the reference sequence and the remaining low-quality part of the read allowing a number of mismatches and the insertion of a single gap in the alignment. We present GapMis, a tool for pairwise sequence alignment with a single gap. It is based on a simple algorithm, which computes a different version of the traditional dynamic programming matrix. The presented experimental results demonstrate that GapMis is more suitable and efficient than most popular tools for this task.

Computational complexity of algorithms for sequence comparison, short-read assembly and genome alignment.

Science.gov (United States)

Baichoo, Shakuntala; Ouzounis, Christos A

A multitude of algorithms for sequence comparison, short-read assembly and whole-genome alignment have been developed in the general context of molecular biology, to support technology development for high-throughput sequencing, numerous applications in genome biology and fundamental research on comparative genomics. The computational complexity of these algorithms has been previously reported in original research papers, yet this often neglected property has not been reviewed previously in a systematic manner and for a wider audience. We provide a review of space and time complexity of key sequence analysis algorithms and highlight their properties in a comprehensive manner, in order to identify potential opportunities for further research in algorithm or data structure optimization. The complexity aspect is poised to become pivotal as we will be facing challenges related to the continuous increase of genomic data on unprecedented scales and complexity in the foreseeable future, when robust biological simulation at the cell level and above becomes a reality. Copyright © 2017 Elsevier B.V. All rights reserved.

The heterothallic sugarbeet pathogen Cercospora beticola contains exon fragments of both MAT genes that are homogenized by concerted evolution.

Science.gov (United States)

Bolton, Melvin D; de Jonge, Ronnie; Inderbitzin, Patrik; Liu, Zhaohui; Birla, Keshav; Van de Peer, Yves; Subbarao, Krishna V; Thomma, Bart P H J; Secor, Gary A

2014-01-01

Dothideomycetes is one of the most ecologically diverse and economically important classes of fungi. Sexual reproduction in this group is governed by mating type (MAT) genes at the MAT1 locus. Self-sterile (heterothallic) species contain one of two genes at MAT1 (MAT1-1-1 or MAT1-2-1) and only isolates of opposite mating type are sexually compatible. In contrast, self-fertile (homothallic) species contain both MAT genes at MAT1. Knowledge of the reproductive capacities of plant pathogens are of particular interest because recombining populations tend to be more difficult to manage in agricultural settings. In this study, we sequenced MAT1 in the heterothallic Dothideomycete fungus Cercospora beticola to gain insight into the reproductive capabilities of this important plant pathogen. In addition to the expected MAT gene at MAT1, each isolate contained fragments of both MAT1-1-1 and MAT1-2-1 at ostensibly random loci across the genome. When MAT fragments from each locus were manually assembled, they reconstituted MAT1-1-1 and MAT1-2-1 exons with high identity, suggesting a retroposition event occurred in a homothallic ancestor in which both MAT genes were fused. The genome sequences of related taxa revealed that MAT gene fragment pattern of Cercospora zeae-maydis was analogous to C. beticola. In contrast, the genome of more distantly related Mycosphaerella graminicola did not contain MAT fragments. Although fragments occurred in syntenic regions of the C. beticola and C. zeae-maydis genomes, each MAT fragment was more closely related to the intact MAT gene of the same species. Taken together, these data suggest MAT genes fragmented after divergence of M. graminicola from the remaining taxa, and concerted evolution functioned to homogenize MAT fragments and MAT genes in each species. Published by Elsevier Inc.

The 0.3-kb fragment containing the R-U5-5'leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA.

Science.gov (United States)

Choo, Yeng Cheng; Seki, Yohei; Machinaga, Akihito; Ogita, Nobuo; Takase-Yoden, Sayaka

2013-04-19

A neuropathogenic variant of Friend murine leukemia virus (Fr-MLV) clone A8 induces spongiform neurodegeneration when infected into neonatal rats. Studies with chimeras constructed from the A8 virus and the non-neuropathogenic Fr-MLV clone 57 identified a 0.3-kb KpnI-AatII fragment containing a R-U5-5'leader sequence as an important determinant for inducing spongiosis, in addition to the env gene of A8 as the primary determinant. This 0.3-kb fragment contains a 17-nucleotide difference between the A8 and 57 sequences. We previously showed that the 0.3-kb fragment influences expression levels of Env protein in both cultured cells and rat brain, but the corresponding molecular mechanisms are not well understood. Studies with expression vectors constructed from the full-length proviral genome of Fr-MLV that incorporated the luciferase (luc) gene instead of the env gene found that the vector containing the A8-0.3-kb fragment yielded a larger amount of spliced luc-mRNA and showed higher expression of luciferase when compared to the vector containing the 57-0.3-kb fragment. The amount of total transcripts from the vectors, the poly (A) tail length of their mRNAs, and the nuclear-cytoplasm distribution of luc-mRNA in transfected cells were also evaluated. The 0.3-kb fragment did not influence transcription efficiency, mRNA polyadenylation or nuclear export of luc-mRNA. Mutational analyses were carried out to determine the importance of nucleotides that differ between the A8 and 57 sequences within the 0.3-kb fragment. In particular, seven nucleotides upstream of the 5'splice site (5'ss) were found to be important in regulating the level of protein expression from spliced messages. Interestingly, these nucleotides reside within the stem-loop structure that has been speculated to limit the recognition of 5'ss. The 0.3-kb fragment containing the R-U5-5'leader sequence of Fr-MLV influences the level of protein expression from the spliced-mRNA by regulating the splicing

SWAP-Assembler: scalable and efficient genome assembly towards thousands of cores.

Science.gov (United States)

Meng, Jintao; Wang, Bingqiang; Wei, Yanjie; Feng, Shengzhong; Balaji, Pavan

2014-01-01

There is a widening gap between the throughput of massive parallel sequencing machines and the ability to analyze these sequencing data. Traditional assembly methods requiring long execution time and large amount of memory on a single workstation limit their use on these massive data. This paper presents a highly scalable assembler named as SWAP-Assembler for processing massive sequencing data using thousands of cores, where SWAP is an acronym for Small World Asynchronous Parallel model. In the paper, a mathematical description of multi-step bi-directed graph (MSG) is provided to resolve the computational interdependence on merging edges, and a highly scalable computational framework for SWAP is developed to automatically preform the parallel computation of all operations. Graph cleaning and contig extension are also included for generating contigs with high quality. Experimental results show that SWAP-Assembler scales up to 2048 cores on Yanhuang dataset using only 26 minutes, which is better than several other parallel assemblers, such as ABySS, Ray, and PASHA. Results also show that SWAP-Assembler can generate high quality contigs with good N50 size and low error rate, especially it generated the longest N50 contig sizes for Fish and Yanhuang datasets. In this paper, we presented a highly scalable and efficient genome assembly software, SWAP-Assembler. Compared with several other assemblers, it showed very good performance in terms of scalability and contig quality. This software is available at: https://sourceforge.net/projects/swapassembler.

Next-generation transcriptome assembly

Energy Technology Data Exchange (ETDEWEB)

Martin, Jeffrey A.; Wang, Zhong

2011-09-01

Transcriptomics studies often rely on partial reference transcriptomes that fail to capture the full catalog of transcripts and their variations. Recent advances in sequencing technologies and assembly algorithms have facilitated the reconstruction of the entire transcriptome by deep RNA sequencing (RNA-seq), even without a reference genome. However, transcriptome assembly from billions of RNA-seq reads, which are often very short, poses a significant informatics challenge. This Review summarizes the recent developments in transcriptome assembly approaches - reference-based, de novo and combined strategies-along with some perspectives on transcriptome assembly in the near future.

Draft Genome Sequences of 12 Dry-Heat-Resistant Bacillus Strains Isolated from the Cleanrooms Where the Viking Spacecraft Were Assembled.

Science.gov (United States)

Seuylemezian, Arman; Cooper, Kerry; Schubert, Wayne; Vaishampayan, Parag

2018-03-22

Spore-forming microorganisms are of concern for forward contamination because they can survive harsh interplanetary travel. Here, we report the draft genome sequences of 12 spore-forming strains isolated from the Manned Spacecraft Operations Building (MSOB) and the Vehicle Assembly Building (VAB) in Cape Canaveral, FL, where the Viking spacecraft were assembled. Copyright © 2018 Seuylemezian et al.

Sequencing and de novo assembly of the Asian clam (Corbicula fluminea transcriptome using the Illumina GAIIx method.

Directory of Open Access Journals (Sweden)

Huihui Chen

Full Text Available BACKGROUND: The Asian clam (Corbicula fluminea is currently one of the most economically important aquatic species in China and has been used as a test organism in many environmental studies. However, the lack of genomic resources, such as sequenced genome, expressed sequence tags (ESTs and transcriptome sequences has hindered the research on C. fluminea. Recent advances in large-scale RNA-Seq enable generation of genomic resources in a short time, and provide large expression datasets for functional genomic analysis. METHODOLOGY/PRINCIPAL FINDINGS: We used a next-generation high-throughput DNA sequencing technique with an Illumina GAIIx method to analyze the transcriptome from the whole bodies of C. fluminea. More than 62,250,336 high-quality reads were generated based on the raw data, and 134,684 unigenes with a mean length of 791 bp were assembled using the Velvet and Oases software. All of the assembly unigenes were annotated by running BLASTx and BLASTn similarity searches on the Nt, Nr, Swiss-Prot, COG and KEGG databases. In addition, the Clusters of Orthologous Groups (COGs, Gene Ontology (GO terms and Kyoto Encyclopedia of Gene and Genome (KEGG annotations were also assigned to each unigene transcript. To provide a preliminary verification of the assembly and annotation results, and search for potential environmental pollution biomarkers, 15 functional genes (five antioxidase genes, two cytochrome P450 genes, three GABA receptor-related genes and five heat shock protein genes were cloned and identified. Expressions of the 15 selected genes following fluoxetine exposure confirmed that the genes are indeed linked to environmental stress. CONCLUSIONS/SIGNIFICANCE: The C. fluminea transcriptome advances the underlying molecular understanding of this freshwater clam, provides a basis for further exploration of C. fluminea as an environmental test organism and promotes further studies on other bivalve organisms.

Whole Genome Sequencing of Enterovirus species C Isolates by High-throughput Sequencing: Development of Generic Primers

Directory of Open Access Journals (Sweden)

Maël Bessaud

2016-08-01

Full Text Available Enteroviruses are among the most common viruses infecting humans and can cause diverse clinical syndromes ranging from minor febrile illness to severe and potentially fatal diseases. Enterovirus species C (EV-C consists of more than 20 types, among which the 3 serotypes of polioviruses, the etiological agents of poliomyelitis, are included. Biodiversity and evolution of EV-C genomes are shaped by frequent recombination events. Therefore, identification and characterization of circulating EV-C strains require the sequencing of different genomic regions.A simple method was developed to sequence quickly the entire genome of EV-C isolates. Four overlapping fragments were produced separately by RT-PCR performed with generic primers. The four amplicons were then pooled and purified prior to be sequenced by high-throughput technique.The method was assessed on a panel of EV-Cs belonging to a wide-range of types. It can be used to determine full-length genome sequences through de novo assembly of thousands of reads. It was also able to discriminate reads from closely related viruses in mixtures.By decreasing the workload compared to classical Sanger-based techniques, this method will serve as a precious tool for sequencing large panels of EV-Cs isolated in cell cultures during environmental surveillance or from patients, including vaccine-derived polioviruses.

Fine de novo sequencing of a fungal genome using only SOLiD short read data: verification on Aspergillus oryzae RIB40.

Directory of Open Access Journals (Sweden)

Myco Umemura

Full Text Available The development of next-generation sequencing (NGS technologies has dramatically increased the throughput, speed, and efficiency of genome sequencing. The short read data generated from NGS platforms, such as SOLiD and Illumina, are quite useful for mapping analysis. However, the SOLiD read data with lengths of <60 bp have been considered to be too short for de novo genome sequencing. Here, to investigate whether de novo sequencing of fungal genomes is possible using only SOLiD short read sequence data, we performed de novo assembly of the Aspergillus oryzae RIB40 genome using only SOLiD read data of 50 bp generated from mate-paired libraries with 2.8- or 1.9-kb insert sizes. The assembled scaffolds showed an N50 value of 1.6 Mb, a 22-fold increase than those obtained using only SOLiD short read in other published reports. In addition, almost 99% of the reference genome was accurately aligned by the assembled scaffold fragments in long lengths. The sequences of secondary metabolite biosynthetic genes and clusters, whose products are of considerable interest in fungal studies due to their potential medicinal, agricultural, and cosmetic properties, were also highly reconstructed in the assembled scaffolds. Based on these findings, we concluded that de novo genome sequencing using only SOLiD short reads is feasible and practical for molecular biological study of fungi. We also investigated the effect of filtering low quality data, library insert size, and k-mer size on the assembly performance, and recommend for the assembly use of mild filtered read data where the N50 was not so degraded and the library has an insert size of ∼2.0 kb, and k-mer size 33.

Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

Directory of Open Access Journals (Sweden)

Can Alkan

2007-09-01

Full Text Available The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

Science.gov (United States)

Alkan, Can; Ventura, Mario; Archidiacono, Nicoletta; Rocchi, Mariano; Sahinalp, S Cenk; Eichler, Evan E

2007-09-01

The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

De Novo Assembly of Complete Chloroplast Genomes from Non-model Species Based on a K-mer Frequency-Based Selection of Chloroplast Reads from Total DNA Sequences

Directory of Open Access Journals (Sweden)

Shairul Izan

2017-08-01

Full Text Available Whole Genome Shotgun (WGS sequences of plant species often contain an abundance of reads that are derived from the chloroplast genome. Up to now these reads have generally been identified and assembled into chloroplast genomes based on homology to chloroplasts from related species. This re-sequencing approach may select against structural differences between the genomes especially in non-model species for which no close relatives have been sequenced before. The alternative approach is to de novo assemble the chloroplast genome from total genomic DNA sequences. In this study, we used k-mer frequency tables to identify and extract the chloroplast reads from the WGS reads and assemble these using a highly integrated and automated custom pipeline. Our strategy includes steps aimed at optimizing assemblies and filling gaps which are left due to coverage variation in the WGS dataset. We have successfully de novo assembled three complete chloroplast genomes from plant species with a range of nuclear genome sizes to demonstrate the universality of our approach: Solanum lycopersicum (0.9 Gb, Aegilops tauschii (4 Gb and Paphiopedilum henryanum (25 Gb. We also highlight the need to optimize the choice of k and the amount of data used. This new and cost-effective method for de novo short read assembly will facilitate the study of complete chloroplast genomes with more accurate analyses and inferences, especially in non-model plant genomes.

Combining independent de novo assemblies optimizes the coding transcriptome for nonconventional model eukaryotic organisms.

Science.gov (United States)

Cerveau, Nicolas; Jackson, Daniel J

2016-12-09

Next-generation sequencing (NGS) technologies are arguably the most revolutionary technical development to join the list of tools available to molecular biologists since PCR. For researchers working with nonconventional model organisms one major problem with the currently dominant NGS platform (Illumina) stems from the obligatory fragmentation of nucleic acid material that occurs prior to sequencing during library preparation. This step creates a significant bioinformatic challenge for accurate de novo assembly of novel transcriptome data. This challenge becomes apparent when a variety of modern assembly tools (of which there is no shortage) are applied to the same raw NGS dataset. With the same assembly parameters these tools can generate markedly different assembly outputs. In this study we present an approach that generates an optimized consensus de novo assembly of eukaryotic coding transcriptomes. This approach does not represent a new assembler, rather it combines the outputs of a variety of established assembly packages, and removes redundancy via a series of clustering steps. We test and validate our approach using Illumina datasets from six phylogenetically diverse eukaryotes (three metazoans, two plants and a yeast) and two simulated datasets derived from metazoan reference genome annotations. All of these datasets were assembled using three currently popular assembly packages (CLC, Trinity and IDBA-tran). In addition, we experimentally demonstrate that transcripts unique to one particular assembly package are likely to be bioinformatic artefacts. For all eight datasets our pipeline generates more concise transcriptomes that in fact possess more unique annotatable protein domains than any of the three individual assemblers we employed. Another measure of assembly completeness (using the purpose built BUSCO databases) also confirmed that our approach yields more information. Our approach yields coding transcriptome assemblies that are more likely to be

Gene Prediction in Metagenomic Fragments with Deep Learning

Directory of Open Access Journals (Sweden)

Shao-Wu Zhang

2017-01-01

Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

Sequencing and De Novo Assembly of the Toxicodendron radicans (Poison Ivy) Transcriptome.

Science.gov (United States)

Weisberg, Alexandra J; Kim, Gunjune; Westwood, James H; Jelesko, John G

2017-11-10

Contact with poison ivy plants is widely dreaded because they produce a natural product called urushiol that is responsible for allergenic contact delayed-dermatitis symptoms lasting for weeks. For this reason, the catchphrase most associated with poison ivy is "leaves of three, let it be", which serves the purpose of both identification and an appeal for avoidance. Ironically, despite this notoriety, there is a dearth of specific knowledge about nearly all other aspects of poison ivy physiology and ecology. As a means of gaining a more molecular-oriented understanding of poison ivy physiology and ecology, Next Generation DNA sequencing technology was used to develop poison ivy root and leaf RNA-seq transcriptome resources. De novo assembled transcriptomes were analyzed to generate a core set of high quality expressed transcripts present in poison ivy tissue. The predicted protein sequences were evaluated for similarity to SwissProt homologs and InterProScan domains, as well as assigned both GO terms and KEGG annotations. Over 23,000 simple sequence repeats were identified in the transcriptome, and corresponding oligo nucleotide primer pairs were designed. A pan-transcriptome analysis of existing Anacardiaceae transcriptomes revealed conserved and unique transcripts among these species.

Bacteriophage Assembly

Directory of Open Access Journals (Sweden)

Anastasia A. Aksyuk

2011-02-01

Full Text Available Bacteriophages have been a model system to study assembly processes for over half a century. Formation of infectious phage particles involves specific protein-protein and protein-nucleic acid interactions, as well as large conformational changes of assembly precursors. The sequence and molecular mechanisms of phage assembly have been elucidated by a variety of methods. Differences and similarities of assembly processes in several different groups of bacteriophages are discussed in this review. The general principles of phage assembly are applicable to many macromolecular complexes.

Genome Sequencing

DEFF Research Database (Denmark)

Sato, Shusei; Andersen, Stig Uggerhøj

2014-01-01

The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

De Novo Assembly of the Donkey White Blood Cell Transcriptome and a Comparative Analysis of Phenotype-Associated Genes between Donkeys and Horses.

Directory of Open Access Journals (Sweden)

Feng-Yun Xie

Full Text Available Prior to the mechanization of agriculture and labor-intensive tasks, humans used donkeys (Equus africanus asinus for farm work and packing. However, as mechanization increased, donkeys have been increasingly raised for meat, milk, and fur in China. To maintain the development of the donkey industry, breeding programs should focus on traits related to these new uses. Compared to conventional marker-assisted breeding plans, genome- and transcriptome-based selection methods are more efficient and effective. To analyze the coding genes of the donkey genome, we assembled the transcriptome of donkey white blood cells de novo. Using transcriptomic deep-sequencing data, we identified 264,714 distinct donkey unigenes and predicted 38,949 protein fragments. We annotated the donkey unigenes by BLAST searches against the non-redundant (NR protein database. We also compared the donkey protein sequences with those of the horse (E. caballus and wild horse (E. przewalskii, and linked the donkey protein fragments with mammalian phenotypes. As the outer ear size of donkeys and horses are obviously different, we compared the outer ear size-associated proteins in donkeys and horses. We identified three ear size-associated proteins, HIC1, PRKRA, and KMT2A, with sequence differences among the donkey, horse, and wild horse loci. Since the donkey genome sequence has not been released, the de novo assembled donkey transcriptome is helpful for preliminary investigations of donkey cultivars and for genetic improvement.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

Science.gov (United States)

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

High efficiency hydrodynamic DNA fragmentation in a bubbling system

NARCIS (Netherlands)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

2017-01-01

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

The carbohydrate-binding module (CBM)-like sequence is crucial for rice CWA1/BC1 function in proper assembly of secondary cell wall materials.

Science.gov (United States)

Sato, Kanna; Ito, Sachiko; Fujii, Takeo; Suzuki, Ryu; Takenouchi, Sachi; Nakaba, Satoshi; Funada, Ryo; Sano, Yuzou; Kajita, Shinya; Kitano, Hidemi; Katayama, Yoshihiro

2010-11-01

We recently reported that the cwa1 mutation disturbed the deposition and assembly of secondary cell wall materials in the cortical fiber of rice internodes. Genetic analysis revealed that cwa1 is allelic to bc1, which encodes glycosylphosphatidylinositol (GPI)-anchored COBRA-like protein with the highest homology to Arabidopsis COBRA-like 4 (COBL4) and maize Brittle Stalk 2 (Bk2). Our results suggested that CWA1/BC1 plays a role in assembling secondary cell wall materials at appropriate sites, enabling synthesis of highly ordered secondary cell wall structure with solid and flexible internodes in rice. The N-terminal amino acid sequence of CWA1/BC1, as well as its orthologs (COBL4, Bk2) and other BC1-like proteins in rice, shows weak similarity to a family II carbohydrate-binding module (CBM2) of several bacterial cellulases. To investigate the importance of the CBM-like sequence of CWA1/BC1 in the assembly of secondary cell wall materials, Trp residues in the CBM-like sequence, which is important for carbohydrate binding, were substituted for Val residues and introduced into the cwa1 mutant. CWA1/BC1 with the mutated sequence did not complement the abnormal secondary cell walls seen in the cwa1 mutant, indicating that the CBM-like sequence is essential for the proper function of CWA1/BC1, including assembly of secondary cell wall materials.

Transcriptome Sequencing, De Novo Assembly and Differential Gene Expression Analysis of the Early Development of Acipenser baeri.

Directory of Open Access Journals (Sweden)

Wei Song

Full Text Available The molecular mechanisms that drive the development of the endangered fossil fish species Acipenser baeri are difficult to study due to the lack of genomic data. Recent advances in sequencing technologies and the reducing cost of sequencing offer exclusive opportunities for exploring important molecular mechanisms underlying specific biological processes. This manuscript describes the large scale sequencing and analyses of mRNA from Acipenser baeri collected at five development time points using the Illumina Hiseq2000 platform. The sequencing reads were de novo assembled and clustered into 278167 unigenes, of which 57346 (20.62% had 45837 known homologues proteins in Uniprot protein databases while 11509 proteins matched with at least one sequence of assembled unigenes. The remaining 79.38% of unigenes could stand for non-coding unigenes or unigenes specific to A. baeri. A number of 43062 unigenes were annotated into functional categories via Gene Ontology (GO annotation whereas 29526 unigenes were associated with 329 pathways by mapping to KEGG database. Subsequently, 3479 differentially expressed genes were scanned within developmental stages and clustered into 50 gene expression profiles. Genes preferentially expressed at each stage were also identified. Through GO and KEGG pathway enrichment analysis, relevant physiological variations during the early development of A. baeri could be better cognized. Accordingly, the present study gives insights into the transcriptome profile of the early development of A. baeri, and the information contained in this large scale transcriptome will provide substantial references for A. baeri developmental biology and promote its aquaculture research.

Assembling large, complex environmental metagenomes

Energy Technology Data Exchange (ETDEWEB)

Howe, A. C. [Michigan State Univ., East Lansing, MI (United States). Microbiology and Molecular Genetics, Plant Soil and Microbial Sciences; Jansson, J. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Earth Sciences Division; Malfatti, S. A. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Tringe, S. G. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Tiedje, J. M. [Michigan State Univ., East Lansing, MI (United States). Microbiology and Molecular Genetics, Plant Soil and Microbial Sciences; Brown, C. T. [Michigan State Univ., East Lansing, MI (United States). Microbiology and Molecular Genetics, Computer Science and Engineering

2012-12-28

The large volumes of sequencing data required to sample complex environments deeply pose new challenges to sequence analysis approaches. De novo metagenomic assembly effectively reduces the total amount of data to be analyzed but requires significant computational resources. We apply two pre-assembly filtering approaches, digital normalization and partitioning, to make large metagenome assemblies more computationaly tractable. Using a human gut mock community dataset, we demonstrate that these methods result in assemblies nearly identical to assemblies from unprocessed data. We then assemble two large soil metagenomes from matched Iowa corn and native prairie soils. The predicted functional content and phylogenetic origin of the assembled contigs indicate significant taxonomic differences despite similar function. The assembly strategies presented are generic and can be extended to any metagenome; full source code is freely available under a BSD license.

Comprehensive transcriptome assembly of Chickpea (Cicer arietinum L. using sanger and next generation sequencing platforms: development and applications.

Directory of Open Access Journals (Sweden)

Himabindu Kudapa

Full Text Available A comprehensive transcriptome assembly of chickpea has been developed using 134.95 million Illumina single-end reads, 7.12 million single-end FLX/454 reads and 139,214 Sanger expressed sequence tags (ESTs from >17 genotypes. This hybrid transcriptome assembly, referred to as Cicer arietinumTranscriptome Assembly version 2 (CaTA v2, available at http://data.comparative-legumes.org/transcriptomes/cicar/lista_cicar-201201, comprising 46,369 transcript assembly contigs (TACs has an N50 length of 1,726 bp and a maximum contig size of 15,644 bp. Putative functions were determined for 32,869 (70.8% of the TACs and gene ontology assignments were determined for 21,471 (46.3%. The new transcriptome assembly was compared with the previously available chickpea transcriptome assemblies as well as to the chickpea genome. Comparative analysis of CaTA v2 against transcriptomes of three legumes - Medicago, soybean and common bean, resulted in 27,771 TACs common to all three legumes indicating strong conservation of genes across legumes. CaTA v2 was also used for identification of simple sequence repeats (SSRs and intron spanning regions (ISRs for developing molecular markers. ISRs were identified by aligning TACs to the Medicago genome, and their putative mapping positions at chromosomal level were identified using transcript map of chickpea. Primer pairs were designed for 4,990 ISRs, each representing a single contig for which predicted positions are inferred and distributed across eight linkage groups. A subset of randomly selected ISRs representing all eight chickpea linkage groups were validated on five chickpea genotypes and showed 20% polymorphism with average polymorphic information content (PIC of 0.27. In summary, the hybrid transcriptome assembly developed and novel markers identified can be used for a variety of applications such as gene discovery, marker-trait association, diversity analysis etc., to advance genetics research and breeding

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

Science.gov (United States)

Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants.

Science.gov (United States)

Lukan, Tjaša; Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster

Efficient identification of Y chromosome sequences in the human and Drosophila genomes

Science.gov (United States)

Carvalho, Antonio Bernardo; Clark, Andrew G.

2013-01-01

Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes. PMID:23921660

Efficient identification of Y chromosome sequences in the human and Drosophila genomes.

Science.gov (United States)

Carvalho, Antonio Bernardo; Clark, Andrew G

2013-11-01

Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes.

Optimizing Transcriptome Assemblies for Eleusine indica Leaf and Seedling by Combining Multiple Assemblies from Three De Novo Assemblers

Directory of Open Access Journals (Sweden)

Shu Chen

2015-03-01

Full Text Available Due to rapid advances in sequencing technology, increasing amounts of genomic and transcriptomic data are available for plant species, presenting enormous challenges for biocomputing analysis. A crucial first step for a successful transcriptomics-based study is the building of a high-quality assembly. Here, we utilized three different de novo assemblers (Trinity, Velvet, and CLC and the EvidentialGene pipeline tr2aacds to assemble two optimized transcript sets for the notorious weed species, . Two RNA sequencing (RNA-seq datasets from leaf and aboveground seedlings were processed using three assemblers, which resulted in 20 assemblies for each dataset. The contig numbers and N50 values of each assembly were compared to study the effect of read number, k-mer size, and in silico normalization on assembly output. The 20 assemblies were then processed through the tr2aacds pipeline to remove redundant transcripts and to select the transcript set with the best coding potential. Each assembly contributed a considerable proportion to the final transcript combination with the exception of the CLC-k14. Thus each assembler and parameter set did assemble better contigs for certain transcripts. The redundancy, total contig number, N50, fully assembled contig number, and transcripts related to target-site herbicide resistance were evaluated for the EvidentialGene and Trinity assemblies. Comparing the EvidentialGene set with the Trinity assembly revealed improved quality and reduced redundancy in both leaf and seedling EvidentialGene sets. The optimized transcriptome references will be useful for studying herbicide resistance in and the evolutionary process in the three allotetraploid offspring.

Genome-wide engineering of an infectious clone of herpes simplex virus type 1 using synthetic genomics assembly methods.

Science.gov (United States)

Oldfield, Lauren M; Grzesik, Peter; Voorhies, Alexander A; Alperovich, Nina; MacMath, Derek; Najera, Claudia D; Chandra, Diya Sabrina; Prasad, Sanjana; Noskov, Vladimir N; Montague, Michael G; Friedman, Robert M; Desai, Prashant J; Vashee, Sanjay

2017-10-17

Here, we present a transformational approach to genome engineering of herpes simplex virus type 1 (HSV-1), which has a large DNA genome, using synthetic genomics tools. We believe this method will enable more rapid and complex modifications of HSV-1 and other large DNA viruses than previous technologies, facilitating many useful applications. Yeast transformation-associated recombination was used to clone 11 fragments comprising the HSV-1 strain KOS 152 kb genome. Using overlapping sequences between the adjacent pieces, we assembled the fragments into a complete virus genome in yeast, transferred it into an Escherichia coli host, and reconstituted infectious virus following transfection into mammalian cells. The virus derived from this yeast-assembled genome, KOS YA , replicated with kinetics similar to wild-type virus. We demonstrated the utility of this modular assembly technology by making numerous modifications to a single gene, making changes to two genes at the same time and, finally, generating individual and combinatorial deletions to a set of five conserved genes that encode virion structural proteins. While the ability to perform genome-wide editing through assembly methods in large DNA virus genomes raises dual-use concerns, we believe the incremental risks are outweighed by potential benefits. These include enhanced functional studies, generation of oncolytic virus vectors, development of delivery platforms of genes for vaccines or therapy, as well as more rapid development of countermeasures against potential biothreats.

Sequencing and de novo assembly of the transcriptome of the glassy-winged sharpshooter (Homalodisca vitripennis.

Directory of Open Access Journals (Sweden)

Raja Sekhar Nandety

Full Text Available BACKGROUND: The glassy-winged sharpshooter Homalodisca vitripennis (Hemiptera: Cicadellidae, is a xylem-feeding leafhopper and important vector of the bacterium Xylella fastidiosa; the causal agent of Pierce's disease of grapevines. The functional complexity of the transcriptome of H. vitripennis has not been elucidated thus far. It is a necessary blueprint for an understanding of the development of H. vitripennis and for designing efficient biorational control strategies including those based on RNA interference. RESULTS: Here we elucidate and explore the transcriptome of adult H. vitripennis using high-throughput paired end deep sequencing and de novo assembly. A total of 32,803,656 paired-end reads were obtained with an average transcript length of 624 nucleotides. We assembled 32.9 Mb of the transcriptome of H. vitripennis that spanned across 47,265 loci and 52,708 transcripts. Comparison of our non-redundant database showed that 45% of the deduced proteins of H. vitripennis exhibit identity (e-value ≤1(-5 with known proteins. We assigned Gene Ontology (GO terms, Kyoto Encyclopedia of Genes and Genomes (KEGG annotations, and potential Pfam domains to each transcript isoform. In order to gain insight into the molecular basis of key regulatory genes of H. vitripennis, we characterized predicted proteins involved in the metabolism of juvenile hormone, and biogenesis of small RNAs (Dicer and Piwi sequences from the transcriptomic sequences. Analysis of transposable element sequences of H. vitripennis indicated that the genome is less expanded in comparison to many other insects with approximately 1% of the transcriptome carrying transposable elements. CONCLUSIONS: Our data significantly enhance the molecular resources available for future study and control of this economically important hemipteran. This transcriptional information not only provides a more nuanced understanding of the underlying biological and physiological mechanisms that

A simple and accurate two-step long DNA sequences synthesis strategy to improve heterologous gene expression in pichia.

Directory of Open Access Journals (Sweden)

Jiang-Ke Yang

Full Text Available In vitro gene chemical synthesis is a powerful tool to improve the expression of gene in heterologous system. In this study, a two-step gene synthesis strategy that combines an assembly PCR and an overlap extension PCR (AOE was developed. In this strategy, the chemically synthesized oligonucleotides were assembled into several 200-500 bp fragments with 20-25 bp overlap at each end by assembly PCR, and then an overlap extension PCR was conducted to assemble all these fragments into a full length DNA sequence. Using this method, we de novo designed and optimized the codon of Rhizopus oryzae lipase gene ROL (810 bp and Aspergillus niger phytase gene phyA (1404 bp. Compared with the original ROL gene and phyA gene, the codon-optimized genes expressed at a significantly higher level in yeasts after methanol induction. We believe this AOE method to be of special interest as it is simple, accurate and has no limitation with respect to the size of the gene to be synthesized. Combined with de novo design, this method allows the rapid synthesis of a gene optimized for expression in the system of choice and production of sufficient biological material for molecular characterization and biotechnological application.

Construction of high resolution genetic linkage maps to improve the soybean genome sequence assembly Glyma1.01

Science.gov (United States)

A landmark in soybean research, Glyma1.01, the first whole genome sequence of variety Williams 82 (Glycine max L. Merr.) was completed in 2010 and is widely used. However, because the assembly was primarily built based on the linkage maps constructed with a limited number of markers and recombinant...

A sweetpotato gene index established by de novo assembly of pyrosequencing and Sanger sequences and mining for gene-based microsatellite markers

Directory of Open Access Journals (Sweden)

Solis Julio

2010-10-01

Full Text Available Abstract Background Sweetpotato (Ipomoea batatas (L. Lam., a hexaploid outcrossing crop, is an important staple and food security crop in developing countries in Africa and Asia. The availability of genomic resources for sweetpotato is in striking contrast to its importance for human nutrition. Previously existing sequence data were restricted to around 22,000 expressed sequence tag (EST sequences and ~ 1,500 GenBank sequences. We have used 454 pyrosequencing to augment the available gene sequence information to enhance functional genomics and marker design for this plant species. Results Two quarter 454 pyrosequencing runs used two normalized cDNA collections from stems and leaves from drought-stressed sweetpotato clone Tanzania and yielded 524,209 reads, which were assembled together with 22,094 publically available expressed sequence tags into 31,685 sets of overlapping DNA segments and 34,733 unassembled sequences. Blastx comparisons with the UniRef100 database allowed annotation of 23,957 contigs and 15,342 singletons resulting in 24,657 putatively unique genes. Further, 27,119 sequences had no match to protein sequences of UniRef100database. On the basis of this gene index, we have identified 1,661 gene-based microsatellite sequences, of which 223 were selected for testing and 195 were successfully amplified in a test panel of 6 hexaploid (I. batatas and 2 diploid (I. trifida accessions. Conclusions The sweetpotato gene index is a useful source for functionally annotated sweetpotato gene sequences that contains three times more gene sequence information for sweetpotato than previous EST assemblies. A searchable version of the gene index, including a blastn function, is available at http://www.cipotato.org/sweetpotato_gene_index.

Fragment assignment in the cloud with eXpress-D

Science.gov (United States)

2013-01-01

Background Probabilistic assignment of ambiguously mapped fragments produced by high-throughput sequencing experiments has been demonstrated to greatly improve accuracy in the analysis of RNA-Seq and ChIP-Seq, and is an essential step in many other sequence census experiments. A maximum likelihood method using the expectation-maximization (EM) algorithm for optimization is commonly used to solve this problem. However, batch EM-based approaches do not scale well with the size of sequencing datasets, which have been increasing dramatically over the past few years. Thus, current approaches to fragment assignment rely on heuristics or approximations for tractability. Results We present an implementation of a distributed EM solution to the fragment assignment problem using Spark, a data analytics framework that can scale by leveraging compute clusters within datacenters–“the cloud”. We demonstrate that our implementation easily scales to billions of sequenced fragments, while providing the exact maximum likelihood assignment of ambiguous fragments. The accuracy of the method is shown to be an improvement over the most widely used tools available and can be run in a constant amount of time when cluster resources are scaled linearly with the amount of input data. Conclusions The cloud offers one solution for the difficulties faced in the analysis of massive high-thoughput sequencing data, which continue to grow rapidly. Researchers in bioinformatics must follow developments in distributed systems–such as new frameworks like Spark–for ways to port existing methods to the cloud and help them scale to the datasets of the future. Our software, eXpress-D, is freely available at: http://github.com/adarob/express-d. PMID:24314033

De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L..

Directory of Open Access Journals (Sweden)

Nan Fu

Full Text Available BACKGROUND: Celery is an increasing popular vegetable species, but limited transcriptome and genomic data hinder the research to it. In addition, a lack of celery molecular markers limits the process of molecular genetic breeding. High-throughput transcriptome sequencing is an efficient method to generate a large transcriptome sequence dataset for gene discovery, molecular marker development and marker-assisted selection breeding. PRINCIPAL FINDINGS: Celery transcriptomes from four tissues were sequenced using Illumina paired-end sequencing technology. De novo assembling was performed to generate a collection of 42,280 unigenes (average length of 502.6 bp that represent the first transcriptome of the species. 78.43% and 48.93% of the unigenes had significant similarity with proteins in the National Center for Biotechnology Information (NCBI non-redundant protein database (Nr and Swiss-Prot database respectively, and 10,473 (24.77% unigenes were assigned to Clusters of Orthologous Groups (COG. 21,126 (49.97% unigenes harboring Interpro domains were annotated, in which 15,409 (36.45% were assigned to Gene Ontology(GO categories. Additionally, 7,478 unigenes were mapped onto 228 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG. Large numbers of simple sequence repeats (SSRs were indentified, and then the rate of successful amplication and polymorphism were investigated among 31 celery accessions. CONCLUSIONS: This study demonstrates the feasibility of generating a large scale of sequence information by Illumina paired-end sequencing and efficient assembling. Our results provide a valuable resource for celery research. The developed molecular markers are the foundation of further genetic linkage analysis and gene localization, and they will be essential to accelerate the process of breeding.

Improvement of methods for large scale sequencing; application to human Xq28

Energy Technology Data Exchange (ETDEWEB)

Gibbs, R.A.; Andersson, B.; Wentland, M.A. [Baylor College of Medicine, Houston, TX (United States)] [and others

1994-09-01

Sequencing of a one-metabase region of Xq28, spanning the FRAXA and IDS loci has been undertaken in order to investigate the practicality of the shotgun approach for large scale sequencing and as a platform to develop improved methods. The efficiency of several steps in the shotgun sequencing strategy has been increased using PCR-based approaches. An improved method for preparation of M13 libraries has been developed. This protocol combines a previously described adaptor-based protocol with the uracil DNA glycosylase (UDG)-cloning procedure. The efficiency of this procedure has been found to be up to 100-fold higher than that of previously used protocols. In addition the novel protocol is more reliable and thus easy to establish in a laboratory. The method has also been adapted for the simultaneous shotgun sequencing of multiple short fragments by concentrating them before library construction is presented. This protocol is suitable for rapid characterization of cDNA clones. A library was constructed from 15 PCR-amplified and concentrated human cDNA inserts, and the insert sequences could easily be identified as separate contigs during the assembly process and the sequence coverage was even along each fragment. Using this strategy, the fine structures of the FraxA and IDS loci have been revealed and several EST homologies indicating novel expressed sequences have been identified. Use of PCR to close repetitive regions that are difficult to clone was tested by determination of the sequence of a cosmid mapping DXS455 in Xq28, containing a polymorphic VNTR. The region containing the VNTR was not represented in the shotgun library, but by designing PCR primers in the sequences flanking the gap and by cloning and sequencing the PCR product, the fine structure of the VNTR has been determined. It was found to be an AT-rich VNTR with a repeated 25-mer at the center.

Thread extraction for polyadic instruction sequences

NARCIS (Netherlands)

Bergstra, J.; Middelburg, C.

2011-01-01

In this paper, we study the phenomenon that instruction sequences are split into fragments which somehow produce a joint behaviour. In order to bring this phenomenon better into the picture, we formalize a simple mechanism by which several instruction sequence fragments can produce a joint

Detection of bacterial contaminants and hybrid sequences in the genome of the kelp Saccharina japonica using Taxoblast

Directory of Open Access Journals (Sweden)

Simon M. Dittami

2017-11-01

Full Text Available Modern genome sequencing strategies are highly sensitive to contamination making the detection of foreign DNA sequences an important part of analysis pipelines. Here we use Taxoblast, a simple pipeline with a graphical user interface, for the post-assembly detection of contaminating sequences in the published genome of the kelp Saccharina japonica. Analyses were based on multiple blastn searches with short sequence fragments. They revealed a number of probable bacterial contaminations as well as hybrid scaffolds that contain both bacterial and algal sequences. This or similar types of analysis, in combination with manual curation, may thus constitute a useful complement to standard bioinformatics analyses prior to submission of genomic data to public repositories. Our analysis pipeline is open-source and freely available at http://sdittami.altervista.org/taxoblast and via SourceForge (https://sourceforge.net/projects/taxoblast.

Assembly of Repeat Content Using Next Generation Sequencing Data

Energy Technology Data Exchange (ETDEWEB)

labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex

2014-03-17

Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.

De novo assembly and characterization of the spleen transcriptome of common carp (Cyprinus carpio) using Illumina paired-end sequencing.

Science.gov (United States)

Li, Guoxi; Zhao, Yinli; Liu, Zhonghu; Gao, Chunsheng; Yan, Fengbin; Liu, Bianzhi; Feng, Jianxin

2015-06-01

Common carp (Cyprinus carpio) is one of the most important aquacultured species of the family Cyprinidae, and breeding this species for disease resistance is becoming more and more important. However, at the genome or transcriptome levels, study of the immunogenetics of disease resistance in the common carp is lacking. In this study, 60,316,906 and 75,200,328 paired-end clean reads were obtained from two cDNA libraries of the common carp spleen by Illumina paired-end sequencing technology. Totally, 130,293 unique transcript fragments (unigenes) were assembled, with an average length of 1400.57 bp. Approximately 105,612 (81.06%) unigenes could be annotated according to their homology with matches in the Nr, Nt, Swiss-Prot, COG, GO, or KEGG databases, and they were found to represent 46,747 non-redundant genes. Comparative analysis showed that 59.82% of the unigenes have significant similarity to zebrafish Refseq proteins. Gene expression comparison revealed that 10,432 and 6889 annotated unigenes were, respectively, up- and down-regulated with at least twofold changes between two developmental stages of the common carp spleen. Gene ontology and KEGG analysis were performed to classify all unigenes into functional categories for understanding gene functions and regulation pathways. In addition, 46,847 simple sequence repeats (SSRs) were detected from 35,618 unigenes, and a large number of single nucleotide polymorphism (SNP) and insertion/deletion (INDEL) sites were identified in the spleen transcriptome of common carp. This study has characterized the spleen transcriptome of the common carp for the first time, providing a valuable resource for a better understanding of the common carp immune system and defense mechanisms. This knowledge will also facilitate future functional studies on common carp immunogenetics that may eventually be applied in breeding programs. Copyright © 2015 Elsevier Ltd. All rights reserved.

Method and apparatus for biological sequence comparison

Science.gov (United States)

Marr, T.G.; Chang, W.I.

1997-12-23

A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

Mechanical fragmentation of nuclear reactor fuel assemblies by the double cutting method

International Nuclear Information System (INIS)

Voitsekhovskii, B.V.; Istomin, V.L.; Mitrofanov, V.V.

1995-01-01

A method is described for cutting a spent fuel assembly with straight shears into pieces of a prescribed size. The method does not require separation of the casing and the lattices. The double cutting method is briefly described, and experiments designed for cutting BN-350 and VVER-440 fuel assemblies are outlined. The testing showed that the cutting method was suitable for mechanical polarization of fuel assemblies. The investigations led to the development of turnkey industrial equipment for cutting spent fuel assemblies of different geometries with a maximum size up to 170 mm. 6 refs., 8 figs., 1 tab

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

Energy Technology Data Exchange (ETDEWEB)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

Science.gov (United States)

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

Spike protein assembly into the coronavirion: exploring the limits of its sequence requirements

International Nuclear Information System (INIS)

Bosch, Berend Jan; Haan, Cornelis A.M. de; Smits, Saskia L.; Rottier, Peter J.M.

2005-01-01

The coronavirus spike (S) protein, required for receptor binding and membrane fusion, is incorporated into the assembling virion by interactions with the viral membrane (M) protein. Earlier we showed that the ectodomain of the S protein is not involved in this process. Here we further defined the requirements of the S protein for virion incorporation. We show that the cytoplasmic domain, not the transmembrane domain, determines the association with the M protein and suffices to effect the incorporation into viral particles of chimeric spikes as well as of foreign viral glycoproteins. The essential sequence was mapped to the membrane-proximal region of the cytoplasmic domain, which is also known to be of critical importance for the fusion function of the S protein. Consistently, only short C-terminal truncations of the S protein were tolerated when introduced into the virus by targeted recombination. The important role of the about 38-residues cytoplasmic domain in the assembly of and membrane fusion by this approximately 1300 amino acids long protein is discussed

Sequencing and assembly of low copy and genic regions of isolated Triticum aestivum chromosome arm 7DS

Czech Academy of Sciences Publication Activity Database

Berkman, O. J.; Skarshewski, A.; Lorenc, M. T.; Kubaláková, Marie; Šimková, Hana; Batley, J.; Doležel, Jaroslav; Edwards, D.

2011-01-01

Roč. 9, č. 7 (2011), s. 768-775 ISSN 1467-7644 R&D Projects: GA ČR GA521/07/1573; GA MŠk ED0007/01/01 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat genome sequence * chromosome 7 * genome assembly Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.442, year: 2011

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Technology for assembling and welding of top and bottom nozzles in fuel assembly

International Nuclear Information System (INIS)

Xia Chenglie; Wan Longfu

1989-10-01

The construction character, technology and sequence of assembling and welding, assembling jig used for preventing from deformation, and acceptance test of welding technology for top and bottom nozzles are presented

Modular assembly of transposable element arrays by microsatellite targeting in the guayule and rice genomes.

Science.gov (United States)

Valdes Franco, José A; Wang, Yi; Huo, Naxin; Ponciano, Grisel; Colvin, Howard A; McMahan, Colleen M; Gu, Yong Q; Belknap, William R

2018-04-19

Guayule (Parthenium argentatum A. Gray) is a rubber-producing desert shrub native to Mexico and the United States. Guayule represents an alternative to Hevea brasiliensis as a source for commercial natural rubber. The efficient application of modern molecular/genetic tools to guayule improvement requires characterization of its genome. The 1.6 Gb guayule genome was sequenced, assembled and annotated. The final 1.5 Gb assembly, while fragmented (N 50  = 22 kb), maps > 95% of the shotgun reads and is essentially complete. Approximately 40,000 transcribed, protein encoding genes were annotated on the assembly. Further characterization of this genome revealed 15 families of small, microsatellite-associated, transposable elements (TEs) with unexpected chromosomal distribution profiles. These SaTar (Satellite Targeted) elements, which are non-autonomous Mu-like elements (MULEs), were frequently observed in multimeric linear arrays of unrelated individual elements within which no individual element is interrupted by another. This uniformly non-nested TE multimer architecture has not been previously described in either eukaryotic or prokaryotic genomes. Five families of similarly distributed non-autonomous MULEs (microsatellite associated, modularly assembled) were characterized in the rice genome. Families of TEs with similar structures and distribution profiles were identified in sorghum and citrus. The sequencing and assembly of the guayule genome provides a foundation for application of current crop improvement technologies to this plant. In addition, characterization of this genome revealed SaTar elements with distribution profiles unique among TEs. Satar targeting appears based on an alternative MULE recombination mechanism with the potential to impact gene evolution.

BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data

Science.gov (United States)

Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel

2012-01-01

BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310

BG7: a new approach for bacterial genome annotation designed for next generation sequencing data.

Directory of Open Access Journals (Sweden)

Pablo Pareja-Tobes

Full Text Available BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version - which is developed in Java, takes advantage of Amazon Web Services (AWS cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future.

Melt jet fragmentation and oxidation in the lower plenum

International Nuclear Information System (INIS)

Berthoud, G.

2001-01-01

During the late phases of a PWR Severe Accident, the core materials discharge into the lower plenum in which water is still present. In that case, we are then concerned by the possible occurrence of a Steam Explosion which may endanger the vessel structure and by the following cooling of the melt debris. So, we have two possible ways of vessel rupture: a mechanical one following an energetic Steam Explosion and a thermal one due to insufficient debris cooling. Both types of problems are linked with the degree of fragmentation of the core material during its penetration into the water of the lower plenum. One of the most likely mode of discharge consists in corium streams or jets. The fragmentation will build a corium-water mixture (the pre-mixing sequence) which, under certain circumstances, may undergo a fine fragmentation sequence leading to an energetic Steam Explosion (the explosion sequence). Whatever the occurrence of a Steam Explosion, the resulting debris will accumulate at the bottom of the Reactor Vessel and the cooling of such a ''debris bed'' is known to be highly dependant of the granulometry and build up of the debris bed which are linked with the previous sequence of corium fragmentation and dispersion. In CEA, the MC3D Code has been developed to deal with all these phenomena. (author)

Comparing de novo assemblers for 454 transcriptome data.

Science.gov (United States)

Kumar, Sujai; Blaxter, Mark L

2010-10-16

Roche 454 pyrosequencing has become a method of choice for generating transcriptome data from non-model organisms. Once the tens to hundreds of thousands of short (250-450 base) reads have been produced, it is important to correctly assemble these to estimate the sequence of all the transcripts. Most transcriptome assembly projects use only one program for assembling 454 pyrosequencing reads, but there is no evidence that the programs used to date are optimal. We have carried out a systematic comparison of five assemblers (CAP3, MIRA, Newbler, SeqMan and CLC) to establish best practices for transcriptome assemblies, using a new dataset from the parasitic nematode Litomosoides sigmodontis. Although no single assembler performed best on all our criteria, Newbler 2.5 gave longer contigs, better alignments to some reference sequences, and was fast and easy to use. SeqMan assemblies performed best on the criterion of recapitulating known transcripts, and had more novel sequence than the other assemblers, but generated an excess of small, redundant contigs. The remaining assemblers all performed almost as well, with the exception of Newbler 2.3 (the version currently used by most assembly projects), which generated assemblies that had significantly lower total length. As different assemblers use different underlying algorithms to generate contigs, we also explored merging of assemblies and found that the merged datasets not only aligned better to reference sequences than individual assemblies, but were also more consistent in the number and size of contigs. Transcriptome assemblies are smaller than genome assemblies and thus should be more computationally tractable, but are often harder because individual contigs can have highly variable read coverage. Comparing single assemblers, Newbler 2.5 performed best on our trial data set, but other assemblers were closely comparable. Combining differently optimal assemblies from different programs however gave a more credible

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

Science.gov (United States)

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

Science.gov (United States)

Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

2017-06-26

IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino

Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

Science.gov (United States)

2012-01-01

Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource

Assembling the Marine Metagenome, One Cell at a Time

Energy Technology Data Exchange (ETDEWEB)

Woyke, Tanja; Xie, Gary; Copeland, Alex; Gonzalez, Jose M.; Han, Cliff; Kiss, Hajnalka; Saw, Jimmy H.; Senin, Pavel; Yang, Chi; Chatterji, Sourav; Cheng, Jan-Fang; Eisen, Jonathan A.; Sieracki, Michael E.; Stepanauskas, Ramunas

2010-06-24

The difficulty associated with the cultivation of most microorganisms and the complexity of natural microbial assemblages, such as marine plankton or human microbiome, hinder genome reconstruction of representative taxa using cultivation or metagenomic approaches. Here we used an alternative, single cell sequencing approach to obtain high-quality genome assemblies of two uncultured, numerically significant marine microorganisms. We employed fluorescence-activated cell sorting and multiple displacement amplification to obtain hundreds of micrograms of genomic DNA from individual, uncultured cells of two marine flavobacteria from the Gulf of Maine that were phylogenetically distant from existing cultured strains. Shotgun sequencing and genome finishing yielded 1.9 Mbp in 17 contigs and 1.5 Mbp in 21 contigs for the two flavobacteria, with estimated genome recoveries of about 91percent and 78percent, respectively. Only 0.24percent of the assembling sequences were contaminants and were removed from further analysis using rigorous quality control. In contrast to all cultured strains of marine flavobacteria, the two single cell genomes were excellent Global Ocean Sampling (GOS) metagenome fragment recruiters, demonstrating their numerical significance in the ocean. The geographic distribution of GOS recruits along the Northwest Atlantic coast coincided with ocean surface currents. Metabolic reconstruction indicated diverse potential energy sources, including biopolymer degradation, proteorhodopsin photometabolism, and hydrogen oxidation. Compared to cultured relatives, the two uncultured flavobacteria have small genome sizes, few non-coding nucleotides, and few paralogous genes, suggesting adaptations to narrow ecological niches. These features may have contributed to the abundance of the two taxa in specific regions of the ocean, and may have hindered their cultivation. We demonstrate the power of single cell DNA sequencing to generate reference genomes of uncultured

Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

Science.gov (United States)

Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

2016-10-01

Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

Assembly of the PLT device

International Nuclear Information System (INIS)

Marino, R.

1975-11-01

The assembly of the PLT device began in June 1974 with a preassembly of the mechanical structure at a remote site. The preassembly sequence incorporated final fabrication procedures with an initial staging operation. This successful staging/fabrication procedure proved to be an invaluable asset when the final assembly was started in August 1974. The assembly continued with the initial reassembly of the previously tested structural components at the final machine site. Construction was interrupted at several points to allow for toroidal field coil, vacuum vessel, and poloidal coil installation. Two phases of toroidal field coil power tests were included in the assembly sequence prior to, and just after the vacuum vessel insertion

Exact algorithms for haplotype assembly from whole-genome sequence data.

Science.gov (United States)

Chen, Zhi-Zhong; Deng, Fei; Wang, Lusheng

2013-08-15

Haplotypes play a crucial role in genetic analysis and have many applications such as gene disease diagnoses, association studies, ancestry inference and so forth. The development of DNA sequencing technologies makes it possible to obtain haplotypes from a set of aligned reads originated from both copies of a chromosome of a single individual. This approach is often known as haplotype assembly. Exact algorithms that can give optimal solutions to the haplotype assembly problem are highly demanded. Unfortunately, previous algorithms for this problem either fail to output optimal solutions or take too long time even executed on a PC cluster. We develop an approach to finding optimal solutions for the haplotype assembly problem under the minimum-error-correction (MEC) model. Most of the previous approaches assume that the columns in the input matrix correspond to (putative) heterozygous sites. This all-heterozygous assumption is correct for most columns, but it may be incorrect for a small number of columns. In this article, we consider the MEC model with or without the all-heterozygous assumption. In our approach, we first use new methods to decompose the input read matrix into small independent blocks and then model the problem for each block as an integer linear programming problem, which is then solved by an integer linear programming solver. We have tested our program on a single PC [a Linux (x64) desktop PC with i7-3960X CPU], using the filtered HuRef and the NA 12878 datasets (after applying some variant calling methods). With the all-heterozygous assumption, our approach can optimally solve the whole HuRef data set within a total time of 31 h (26 h for the most difficult block of the 15th chromosome and only 5 h for the other blocks). To our knowledge, this is the first time that MEC optimal solutions are completely obtained for the filtered HuRef dataset. Moreover, in the general case (without the all-heterozygous assumption), for the HuRef dataset our

Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

International Nuclear Information System (INIS)

Robinson, M.A.

1989-01-01

Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

Designer genes. Recombinant antibody fragments for biological imaging

Energy Technology Data Exchange (ETDEWEB)

Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

2000-09-01

Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

Designer genes. Recombinant antibody fragments for biological imaging

International Nuclear Information System (INIS)

Wu, A.M.; Yazaki, P.J.

2000-01-01

Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

Scaling and universality in binary fragmenting with inhibition

International Nuclear Information System (INIS)

Ploszajczak, M.; Botet, R.

1994-01-01

We investigate a new model of binary fragmentation with inhibition, driven by the white noise. In a broad range of fragmentation probabilities, the power-law spatio-temporal correlations ar found to arise due to self-organized criticality (SOC). We find in the SOC phase a non-trivial power spectrum of the temporal sequence of the fragmentation events. The 1/∫ behaviour is recovered in the irreversible, near-equilibrium part of this phase. (authors). 13 refs., 3 figs., 1 tab

Scaling and universality in binary fragmenting with inhibition

Energy Technology Data Exchange (ETDEWEB)

Ploszajczak, M [Grand Accelerateur National d` Ions Lourds (GANIL), 14 - Caen (France); Botet, R [Paris-11 Univ., 91 - Orsay (France). Lab. de Physique des Solides

1994-12-31

We investigate a new model of binary fragmentation with inhibition, driven by the white noise. In a broad range of fragmentation probabilities, the power-law spatio-temporal correlations ar found to arise due to self-organized criticality (SOC). We find in the SOC phase a non-trivial power spectrum of the temporal sequence of the fragmentation events. The 1/{integral} behaviour is recovered in the irreversible, near-equilibrium part of this phase. (authors). 13 refs., 3 figs., 1 tab.

MetaPhinder-Identifying Bacteriophage Sequences in Metagenomic Data Sets

DEFF Research Database (Denmark)

Jurtz, Vanessa Isabell; Villarroel, Julia; Lund, Ole

2016-01-01

genome structure of many bacteriophages. The method is demonstrated to outperform both BLAST methods based on single hits and methods based on k-mer comparisons. MetaPhinder is available as a web service at the Center for Genomic Epidemiology https://cge.cbs.dtu.dk/services/MetaPhinder/, while the source...... and understand them. Here we present MetaPhinder, a method to identify assembled genomic fragments (i.e. contigs) of phage origin in metage-nomic data sets. The method is based on a comparison to a database of whole genome bacteriophage sequences, integrating hits to multiple genomes to accomodate for the mosaic...... code can be downloaded from https://bitbucket.org/genomicepidemiology/metaphinder or https://github.com/vanessajurtz/MetaPhinder....

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

Multiple tag labeling method for DNA sequencing

Science.gov (United States)

Mathies, R.A.; Huang, X.C.; Quesada, M.A.

1995-07-25

A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

OTU analysis using metagenomic shotgun sequencing data.

Directory of Open Access Journals (Sweden)

Xiaolin Hao

Full Text Available Because of technological limitations, the primer and amplification biases in targeted sequencing of 16S rRNA genes have veiled the true microbial diversity underlying environmental samples. However, the protocol of metagenomic shotgun sequencing provides 16S rRNA gene fragment data with natural immunity against the biases raised during priming and thus the potential of uncovering the true structure of microbial community by giving more accurate predictions of operational taxonomic units (OTUs. Nonetheless, the lack of statistically rigorous comparison between 16S rRNA gene fragments and other data types makes it difficult to interpret previously reported results using 16S rRNA gene fragments. Therefore, in the present work, we established a standard analysis pipeline that would help confirm if the differences in the data are true or are just due to potential technical bias. This pipeline is built by using simulated data to find optimal mapping and OTU prediction methods. The comparison between simulated datasets revealed a relationship between 16S rRNA gene fragments and full-length 16S rRNA sequences that a 16S rRNA gene fragment having a length >150 bp provides the same accuracy as a full-length 16S rRNA sequence using our proposed pipeline, which could serve as a good starting point for experimental design and making the comparison between 16S rRNA gene fragment-based and targeted 16S rRNA sequencing-based surveys possible.

V-GAP: Viral genome assembly pipeline

KAUST Repository

Nakamura, Yoji

2015-10-22

Next-generation sequencing technologies have allowed the rapid determination of the complete genomes of many organisms. Although shotgun sequences from large genome organisms are still difficult to reconstruct perfect contigs each of which represents a full chromosome, those from small genomes have been assembled successfully into a very small number of contigs. In this study, we show that shotgun reads from phage genomes can be reconstructed into a single contig by controlling the number of read sequences used in de novo assembly. We have developed a pipeline to assemble small viral genomes with good reliability using a resampling method from shotgun data. This pipeline, named V-GAP (Viral Genome Assembly Pipeline), will contribute to the rapid genome typing of viruses, which are highly divergent, and thus will meet the increasing need for viral genome comparisons in metagenomic studies.

V-GAP: Viral genome assembly pipeline

KAUST Repository

Nakamura, Yoji; Yasuike, Motoshige; Nishiki, Issei; Iwasaki, Yuki; Fujiwara, Atushi; Kawato, Yasuhiko; Nakai, Toshihiro; Nagai, Satoshi; Kobayashi, Takanori; Gojobori, Takashi; Ototake, Mitsuru

2015-01-01

Next-generation sequencing technologies have allowed the rapid determination of the complete genomes of many organisms. Although shotgun sequences from large genome organisms are still difficult to reconstruct perfect contigs each of which represents a full chromosome, those from small genomes have been assembled successfully into a very small number of contigs. In this study, we show that shotgun reads from phage genomes can be reconstructed into a single contig by controlling the number of read sequences used in de novo assembly. We have developed a pipeline to assemble small viral genomes with good reliability using a resampling method from shotgun data. This pipeline, named V-GAP (Viral Genome Assembly Pipeline), will contribute to the rapid genome typing of viruses, which are highly divergent, and thus will meet the increasing need for viral genome comparisons in metagenomic studies.

Protein-Templated Fragment Ligations-From Molecular Recognition to Drug Discovery.

Science.gov (United States)

Jaegle, Mike; Wong, Ee Lin; Tauber, Carolin; Nawrotzky, Eric; Arkona, Christoph; Rademann, Jörg

2017-06-19

Protein-templated fragment ligation is a novel concept to support drug discovery and can help to improve the efficacy of protein ligands. Protein-templated fragment ligations are chemical reactions between small molecules ("fragments") utilizing a protein's surface as a reaction vessel to catalyze the formation of a protein ligand with increased binding affinity. The approach exploits the molecular recognition of reactive small-molecule fragments by proteins both for ligand assembly and for the identification of bioactive fragment combinations. In this way, chemical synthesis and bioassay are integrated in one single step. This Review discusses the biophysical basis of reversible and irreversible fragment ligations and gives an overview of the available methods to detect protein-templated ligation products. The chemical scope and recent applications as well as future potential of the concept in drug discovery are reviewed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Human Assisted Assembly Processes

Energy Technology Data Exchange (ETDEWEB)

CALTON,TERRI L.; PETERS,RALPH R.

2000-01-01

Automatic assembly sequencing and visualization tools are valuable in determining the best assembly sequences, but without Human Factors and Figure Models (HFFMs) it is difficult to evaluate or visualize human interaction. In industry, accelerating technological advances and shorter market windows have forced companies to turn to an agile manufacturing paradigm. This trend has promoted computerized automation of product design and manufacturing processes, such as automated assembly planning. However, all automated assembly planning software tools assume that the individual components fly into their assembled configuration and generate what appear to be a perfectly valid operations, but in reality the operations cannot physically be carried out by a human. Similarly, human figure modeling algorithms may indicate that assembly operations are not feasible and consequently force design modifications; however, if they had the capability to quickly generate alternative assembly sequences, they might have identified a feasible solution. To solve this problem HFFMs must be integrated with automated assembly planning to allow engineers to verify that assembly operations are possible and to see ways to make the designs even better. Factories will very likely put humans and robots together in cooperative environments to meet the demands for customized products, for purposes including robotic and automated assembly. For robots to work harmoniously within an integrated environment with humans the robots must have cooperative operational skills. For example, in a human only environment, humans may tolerate collisions with one another if they did not cause much pain. This level of tolerance may or may not apply to robot-human environments. Humans expect that robots will be able to operate and navigate in their environments without collisions or interference. The ability to accomplish this is linked to the sensing capabilities available. Current work in the field of cooperative

Next-Generation Sequencing of the Chrysanthemum nankingense (Asteraceae) Transcriptome Permits Large-Scale Unigene Assembly and SSR Marker Discovery

Science.gov (United States)

Wang, Haibin; Jiang, Jiafu; Chen, Sumei; Qi, Xiangyu; Peng, Hui; Li, Pirui; Song, Aiping; Guan, Zhiyong; Fang, Weimin; Liao, Yuan; Chen, Fadi

2013-01-01

Background Simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Chrysanthemum is one of the largest genera in the Asteraceae family. Only few Chrysanthemum expressed sequence tag (EST) sequences have been acquired to date, so the number of available EST-SSR markers is very low. Methodology/Principal Findings Illumina paired-end sequencing technology produced over 53 million sequencing reads from C. nankingense mRNA. The subsequent de novo assembly yielded 70,895 unigenes, of which 45,789 (64.59%) unigenes showed similarity to the sequences in NCBI database. Out of 45,789 sequences, 107 have hits to the Chrysanthemum Nr protein database; 679 and 277 sequences have hits to the database of Helianthus and Lactuca species, respectively. MISA software identified a large number of putative EST-SSRs, allowing 1,788 primer pairs to be designed from the de novo transcriptome sequence and a further 363 from archival EST sequence. Among 100 primer pairs randomly chosen, 81 markers have amplicons and 20 are polymorphic for genotypes analysis in Chrysanthemum. The results showed that most (but not all) of the assays were transferable across species and that they exposed a significant amount of allelic diversity. Conclusions/Significance SSR markers acquired by transcriptome sequencing are potentially useful for marker-assisted breeding and genetic analysis in the genus Chrysanthemum and its related genera. PMID:23626799

Spaced Seed Data Structures for De Novo Assembly

Directory of Open Access Journals (Sweden)

Inanç Birol

2015-01-01

Full Text Available De novo assembly of the genome of a species is essential in the absence of a reference genome sequence. Many scalable assembly algorithms use the de Bruijn graph (DBG paradigm to reconstruct genomes, where a table of subsequences of a certain length is derived from the reads, and their overlaps are analyzed to assemble sequences. Despite longer subsequences unlocking longer genomic features for assembly, associated increase in compute resources limits the practicability of DBG over other assembly archetypes already designed for longer reads. Here, we revisit the DBG paradigm to adapt it to the changing sequencing technology landscape and introduce three data structure designs for spaced seeds in the form of paired subsequences. These data structures address memory and run time constraints imposed by longer reads. We observe that when a fixed distance separates seed pairs, it provides increased sequence specificity with increased gap length. Further, we note that Bloom filters would be suitable to implicitly store spaced seeds and be tolerant to sequencing errors. Building on this concept, we describe a data structure for tracking the frequencies of observed spaced seeds. These data structure designs will have applications in genome, transcriptome and metagenome assemblies, and read error correction.

Comparing de novo assemblers for 454 transcriptome data

Directory of Open Access Journals (Sweden)

Blaxter Mark L

2010-10-01

Full Text Available Abstract Background Roche 454 pyrosequencing has become a method of choice for generating transcriptome data from non-model organisms. Once the tens to hundreds of thousands of short (250-450 base reads have been produced, it is important to correctly assemble these to estimate the sequence of all the transcripts. Most transcriptome assembly projects use only one program for assembling 454 pyrosequencing reads, but there is no evidence that the programs used to date are optimal. We have carried out a systematic comparison of five assemblers (CAP3, MIRA, Newbler, SeqMan and CLC to establish best practices for transcriptome assemblies, using a new dataset from the parasitic nematode Litomosoides sigmodontis. Results Although no single assembler performed best on all our criteria, Newbler 2.5 gave longer contigs, better alignments to some reference sequences, and was fast and easy to use. SeqMan assemblies performed best on the criterion of recapitulating known transcripts, and had more novel sequence than the other assemblers, but generated an excess of small, redundant contigs. The remaining assemblers all performed almost as well, with the exception of Newbler 2.3 (the version currently used by most assembly projects, which generated assemblies that had significantly lower total length. As different assemblers use different underlying algorithms to generate contigs, we also explored merging of assemblies and found that the merged datasets not only aligned better to reference sequences than individual assemblies, but were also more consistent in the number and size of contigs. Conclusions Transcriptome assemblies are smaller than genome assemblies and thus should be more computationally tractable, but are often harder because individual contigs can have highly variable read coverage. Comparing single assemblers, Newbler 2.5 performed best on our trial data set, but other assemblers were closely comparable. Combining differently optimal assemblies

De novo assembly and characterization of the garlic (Allium sativum) bud transcriptome by Illumina sequencing.

Science.gov (United States)

Sun, Xiudong; Zhou, Shumei; Meng, Fanlu; Liu, Shiqi

2012-10-01

Garlic is widely used as a spice throughout the world for the culinary value of its flavor and aroma, which are created by the chemical transformation of a series of organic sulfur compounds. To analyze the transcriptome of Allium sativum and discover the genes involved in sulfur metabolism, cDNAs derived from the total RNA of Allium sativum buds were analyzed by Illumina sequencing. Approximately 26.67 million 90 bp paired-end clean reads were achieved in two libraries. A total of 127,933 unigenes were generated by de novo assembly and were compared with the sequences in public databases. Of these, 45,286 unigenes had significant hits to the sequences in the Nr database, 29,514 showed significant similarity to known proteins in the Swiss-Prot database and, 20,706 and 21,952 unigenes had significant similarity to existing sequences in the KEGG and COG databases, respectively. Moreover, genes involved in organic sulfur biosynthesis were identified. These unigenes data will provide the foundation for research on gene expression, genomics and functional genomics in Allium sativum. Key message The obtained unigenes will provide the foundation for research on functional genomics in Allium sativum and its closely related species, and fill the gap of the existing plant EST database.

Expression sequence tag library derived from peripheral blood mononuclear cells of the chlorocebus sabaeus

Directory of Open Access Journals (Sweden)

Tchitchek Nicolas

2012-06-01

Full Text Available Abstract Background African Green Monkeys (AGM are amongst the most frequently used nonhuman primate models in clinical and biomedical research, nevertheless only few genomic resources exist for this species. Such information would be essential for the development of dedicated new generation technologies in fundamental and pre-clinical research using this model, and would deliver new insights into primate evolution. Results We have exhaustively sequenced an Expression Sequence Tag (EST library made from a pool of Peripheral Blood Mononuclear Cells from sixteen Chlorocebus sabaeus monkeys. Twelve of them were infected with the Simian Immunodeficiency Virus. The mononuclear cells were or not stimulated in vitro with Concanavalin A, with lipopolysacharrides, or through mixed lymphocyte reaction in order to generate a representative and broad library of expressed sequences in immune cells. We report here 37,787 sequences, which were assembled into 14,410 contigs representing an estimated 12% of the C. sabaeus transcriptome. Using data from primate genome databases, 9,029 assembled sequences from C. sabaeus could be annotated. Sequences have been systematically aligned with ten cDNA references of primate species including Homo sapiens, Pan troglodytes, and Macaca mulatta to identify ortholog transcripts. For 506 transcripts, sequences were quasi-complete. In addition, 6,576 transcript fragments are potentially specific to the C. sabaeus or corresponding to not yet described primate genes. Conclusions The EST library we provide here will prove useful in gene annotation efforts for future sequencing of the African Green Monkey genomes. Furthermore, this library, which particularly well represents immunological and hematological gene expression, will be an important resource for the comparative analysis of gene expression in clinically relevant nonhuman primate and human research.

De novo assembly of highly diverse viral populations

Directory of Open Access Journals (Sweden)

Yang Xiao

2012-09-01

Full Text Available Abstract Background Extensive genetic diversity in viral populations within infected hosts and the divergence of variants from existing reference genomes impede the analysis of deep viral sequencing data. A de novo population consensus assembly is valuable both as a single linear representation of the population and as a backbone on which intra-host variants can be accurately mapped. The availability of consensus assemblies and robustly mapped variants are crucial to the genetic study of viral disease progression, transmission dynamics, and viral evolution. Existing de novo assembly techniques fail to robustly assemble ultra-deep sequence data from genetically heterogeneous populations such as viruses into full-length genomes due to the presence of extensive genetic variability, contaminants, and variable sequence coverage. Results We present VICUNA, a de novo assembly algorithm suitable for generating consensus assemblies from genetically heterogeneous populations. We demonstrate its effectiveness on Dengue, Human Immunodeficiency and West Nile viral populations, representing a range of intra-host diversity. Compared to state-of-the-art assemblers designed for haploid or diploid systems, VICUNA recovers full-length consensus and captures insertion/deletion polymorphisms in diverse samples. Final assemblies maintain a high base calling accuracy. VICUNA program is publicly available at: http://www.broadinstitute.org/scientific-community/science/projects/viral-genomics/ viral-genomics-analysis-software. Conclusions We developed VICUNA, a publicly available software tool, that enables consensus assembly of ultra-deep sequence derived from diverse viral populations. While VICUNA was developed for the analysis of viral populations, its application to other heterogeneous sequence data sets such as metagenomic or tumor cell population samples may prove beneficial in these fields of research.

Fragger: a protein fragment picker for structural queries.

Science.gov (United States)

Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

2017-01-01

Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Cyprinus carpio Genome sequencing and assembly

NARCIS (Netherlands)

Kolder, I.C.R.M.; Plas-Duivesteijn, van der Suzanne J.; Tan, G.; Wiegertjes, G.; Forlenza, M.; Guler, A.T.; Travin, D.Y.; Nakao, M.; Moritomo, T.; Irnazarow, I.; Jansen, H.J.

2013-01-01

Sequencing of the common carp (Cyprinus carpio carpio Linnaeus, 1758) genome, with the objective of establishing carp as a model organism to supplement the closely related zebrafish (Danio rerio). The sequenced individual is a homozygous female (by gynogenesis) of R3 x R8 carp, the heterozygous

Sequencing, de novo assembling, and annotating the genome of the endangered Chinese crocodile lizard Shinisaurus crocodilurus.

Science.gov (United States)

Gao, Jian; Li, Qiye; Wang, Zongji; Zhou, Yang; Martelli, Paolo; Li, Fang; Xiong, Zijun; Wang, Jian; Yang, Huanming; Zhang, Guojie

2017-07-01

The Chinese crocodile lizard, Shinisaurus crocodilurus, is the only living representative of the monotypic family Shinisauridae under the order Squamata. It is an obligate semi-aquatic, viviparous, diurnal species restricted to specific portions of mountainous locations in southwestern China and northeastern Vietnam. However, in the past several decades, this species has undergone a rapid decrease in population size due to illegal poaching and habitat disruption, making this unique reptile species endangered and listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora Appendix II since 1990. A proposal to uplist it to Appendix I was passed at the Convention on International Trade in Endangered Species of Wild Fauna and Flora Seventeenth meeting of the Conference of the Parties in 2016. To promote the conservation of this species, we sequenced the genome of a male Chinese crocodile lizard using a whole-genome shotgun strategy on the Illumina HiSeq 2000 platform. In total, we generated ∼291 Gb of raw sequencing data (×149 depth) from 13 libraries with insert sizes ranging from 250 bp to 40 kb. After filtering for polymerase chain reaction-duplicated and low-quality reads, ∼137 Gb of clean data (×70 depth) were obtained for genome assembly. We yielded a draft genome assembly with a total length of 2.24 Gb and an N50 scaffold size of 1.47 Mb. The assembled genome was predicted to contain 20 150 protein-coding genes and up to 1114 Mb (49.6%) of repetitive elements. The genomic resource of the Chinese crocodile lizard will contribute to deciphering the biology of this organism and provides an essential tool for conservation efforts. It also provides a valuable resource for future study of squamate evolution. © The Authors 2017. Published by Oxford University Press.

Supramolecular gel electrophoresis of large DNA fragments.

Science.gov (United States)

Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

2017-10-01

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly.

Directory of Open Access Journals (Sweden)

Andreas I Andreou

Full Text Available Synthetic biology builds upon the foundation of engineering principles, prompting innovation and improvement in biotechnology via a design-build-test-learn cycle. A community-wide standard in DNA assembly would enable bio-molecular engineering at the levels of predictivity and universality in design and construction that are comparable to other engineering fields. Golden Gate Assembly technology, with its robust capability to unidirectionally assemble numerous DNA fragments in a one-tube reaction, has the potential to deliver a universal standard framework for DNA assembly. While current Golden Gate Assembly frameworks (e.g. MoClo and Golden Braid render either high cloning capacity or vector toolkit simplicity, the technology can be made more versatile-simple, streamlined, and cost/labor-efficient, without compromising capacity. Here we report the development of a new Golden Gate Assembly framework named Mobius Assembly, which combines vector toolkit simplicity with high cloning capacity. It is based on a two-level, hierarchical approach and utilizes a low-frequency cutter to reduce domestication requirements. Mobius Assembly embraces the standard overhang designs designated by MoClo, Golden Braid, and Phytobricks and is largely compatible with already available Golden Gate part libraries. In addition, dropout cassettes encoding chromogenic proteins were implemented for cost-free visible cloning screening that color-code different cloning levels. As proofs of concept, we have successfully assembled up to 16 transcriptional units of various pigmentation genes in both operon and multigene arrangements. Taken together, Mobius Assembly delivers enhanced versatility and efficiency in DNA assembly, facilitating improved standardization and automation.

[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

Science.gov (United States)

Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

2008-05-01

One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Oxidative stress induces mitochondrial fragmentation in frataxin-deficient cells

Energy Technology Data Exchange (ETDEWEB)

Lefevre, Sophie [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France); ED515 UPMC, 4 place Jussieu 75005 Paris (France); Sliwa, Dominika [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France); Rustin, Pierre [Inserm, U676, Physiopathology and Therapy of Mitochondrial Disease Laboratory, 75019 Paris (France); Universite Paris-Diderot, Faculte de Medecine Denis Diderot, IFR02 Paris (France); Camadro, Jean-Michel [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France); Santos, Renata, E-mail: santos.renata@ijm.univ-paris-diderot.fr [Mitochondria, Metals and Oxidative Stress Laboratory, Institut Jacques Monod, CNRS-Universite Paris-Diderot, Sorbonne Paris Cite, 15 rue Helene Brion, 75205 Paris cedex 13 (France)

2012-02-10

Highlights: Black-Right-Pointing-Pointer Yeast frataxin-deficiency leads to increased proportion of fragmented mitochondria. Black-Right-Pointing-Pointer Oxidative stress induces complete mitochondrial fragmentation in {Delta}yfh1 cells. Black-Right-Pointing-Pointer Oxidative stress increases mitochondrial fragmentation in patient fibroblasts. Black-Right-Pointing-Pointer Inhibition of mitochondrial fission in {Delta}yfh1 induces oxidative stress resistance. -- Abstract: Friedreich ataxia (FA) is the most common recessive neurodegenerative disease. It is caused by deficiency in mitochondrial frataxin, which participates in iron-sulfur cluster assembly. Yeast cells lacking frataxin ({Delta}yfh1 mutant) showed an increased proportion of fragmented mitochondria compared to wild-type. In addition, oxidative stress induced complete fragmentation of mitochondria in {Delta}yfh1 cells. Genetically controlled inhibition of mitochondrial fission in these cells led to increased resistance to oxidative stress. Here we present evidence that in yeast frataxin-deficiency interferes with mitochondrial dynamics, which might therefore be relevant for the pathophysiology of FA.

De Novo Assembly of Human Herpes Virus Type 1 (HHV-1) Genome, Mining of Non-Canonical Structures and Detection of Novel Drug-Resistance Mutations Using Short- and Long-Read Next Generation Sequencing Technologies.

Science.gov (United States)

Karamitros, Timokratis; Harrison, Ian; Piorkowska, Renata; Katzourakis, Aris; Magiorkinis, Gkikas; Mbisa, Jean Lutamyo

2016-01-01

Human herpesvirus type 1 (HHV-1) has a large double-stranded DNA genome of approximately 152 kbp that is structurally complex and GC-rich. This makes the assembly of HHV-1 whole genomes from short-read sequencing data technically challenging. To improve the assembly of HHV-1 genomes we have employed a hybrid genome assembly protocol using data from two sequencing technologies: the short-read Roche 454 and the long-read Oxford Nanopore MinION sequencers. We sequenced 18 HHV-1 cell culture-isolated clinical specimens collected from immunocompromised patients undergoing antiviral therapy. The susceptibility of the samples to several antivirals was determined by plaque reduction assay. Hybrid genome assembly resulted in a decrease in the number of contigs in 6 out of 7 samples and an increase in N(G)50 and N(G)75 of all 7 samples sequenced by both technologies. The approach also enhanced the detection of non-canonical contigs including a rearrangement between the unique (UL) and repeat (T/IRL) sequence regions of one sample that was not detectable by assembly of 454 reads alone. We detected several known and novel resistance-associated mutations in UL23 and UL30 genes. Genome-wide genetic variability ranged from genomes will be useful in determining genetic determinants of drug resistance, virulence, pathogenesis and viral evolution. The numerous, complex repeat regions of the HHV-1 genome currently remain a barrier towards this goal.

Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

Directory of Open Access Journals (Sweden)

Kush Shrivastava

2015-10-01

Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

The A, C, G, and T of Genome Assembly.

Science.gov (United States)

Wajid, Bilal; Sohail, Muhammad U; Ekti, Ali R; Serpedin, Erchin

2016-01-01

Genome assembly in its two decades of history has produced significant research, in terms of both biotechnology and computational biology. This contribution delineates sequencing platforms and their characteristics, examines key steps involved in filtering and processing raw data, explains assembly frameworks, and discusses quality statistics for the assessment of the assembled sequence. Furthermore, the paper explores recent Ubuntu-based software environments oriented towards genome assembly as well as some avenues for future research.

Effect of amino acid sequence and pH on nanofiber formation of self-assembling peptides EAK16-II and EAK16-IV.

Science.gov (United States)

Hong, Yooseong; Legge, Raymond L; Zhang, S; Chen, P

2003-01-01

Atomic force microscopy (AFM) and axisymmetric drop shape analysis-profile (ASDA-P) were used to investigate the mechanism of self-assembly of peptides. The peptides chosen consisted of 16 alternating hydrophobic and hydrophilic amino acids, where the hydrophilic residues possess alternating negative and positive charges. Two types of peptides, AEAEAKAKAEAEAKAK (EAK16-II) and AEAEAEAEAKAKAKAK (EAK16-IV), were investigated in terms of nanostructure formation through self-assembly. The experimental results, which focused on the effects of the amino acid sequence and pH, show that the nanostructures formed by the peptides are dependent on the amino acid sequence and the pH of the solution. For pH conditions around neutrality, one of the peptides used in this study, EAK16-IV, forms globular assemblies and has lower surface tension at air-water interfaces than another peptide, EAK16-II, which forms fibrillar assemblies at the same pH. When the pH is lowered below 6.5 or raised above 7.5, there is a transition from globular to fibrillar structures for EAK16-IV, but EAK16-II does not show any structural transition. Surface tension measurements using ADSA-P showed different surface activities of peptides at air-water interfaces. EAK16-II does not show a significant difference in surface tension for the pH range between 4 and 9. However, EAK16-IV shows a noticeable decrease in surface tension at pH around neutrality, indicating that the formation of globular assemblies is related to the molecular hydrophobicity.

Evaluation of GRCh38 and de novo haploid genome assemblies demonstrates the enduring quality of the reference assembly.

Science.gov (United States)

Schneider, Valerie A; Graves-Lindsay, Tina; Howe, Kerstin; Bouk, Nathan; Chen, Hsiu-Chuan; Kitts, Paul A; Murphy, Terence D; Pruitt, Kim D; Thibaud-Nissen, Françoise; Albracht, Derek; Fulton, Robert S; Kremitzki, Milinn; Magrini, Vincent; Markovic, Chris; McGrath, Sean; Steinberg, Karyn Meltz; Auger, Kate; Chow, William; Collins, Joanna; Harden, Glenn; Hubbard, Timothy; Pelan, Sarah; Simpson, Jared T; Threadgold, Glen; Torrance, James; Wood, Jonathan M; Clarke, Laura; Koren, Sergey; Boitano, Matthew; Peluso, Paul; Li, Heng; Chin, Chen-Shan; Phillippy, Adam M; Durbin, Richard; Wilson, Richard K; Flicek, Paul; Eichler, Evan E; Church, Deanna M

2017-05-01

The human reference genome assembly plays a central role in nearly all aspects of today's basic and clinical research. GRCh38 is the first coordinate-changing assembly update since 2009; it reflects the resolution of roughly 1000 issues and encompasses modifications ranging from thousands of single base changes to megabase-scale path reorganizations, gap closures, and localization of previously orphaned sequences. We developed a new approach to sequence generation for targeted base updates and used data from new genome mapping technologies and single haplotype resources to identify and resolve larger assembly issues. For the first time, the reference assembly contains sequence-based representations for the centromeres. We also expanded the number of alternate loci to create a reference that provides a more robust representation of human population variation. We demonstrate that the updates render the reference an improved annotation substrate, alter read alignments in unchanged regions, and impact variant interpretation at clinically relevant loci. We additionally evaluated a collection of new de novo long-read haploid assemblies and conclude that although the new assemblies compare favorably to the reference with respect to continuity, error rate, and gene completeness, the reference still provides the best representation for complex genomic regions and coding sequences. We assert that the collected updates in GRCh38 make the newer assembly a more robust substrate for comprehensive analyses that will promote our understanding of human biology and advance our efforts to improve health. © 2017 Schneider et al.; Published by Cold Spring Harbor Laboratory Press.

Genetic diversity of nifH gene sequences in Paenibacillus azotofixans strains and soil samples analyzed by denaturing gradiënt gel electrophoresis of PCR-amplified gene fragments

NARCIS (Netherlands)

Rosado, A.S.; Duarte, G.F.; Seldin, L.; Elsas, van J.D.

1998-01-01

The diversity of dinitrogenase reductase gene (nifH) fragments in Paenibacillus azotofixans strains was investigated by using molecular methods. The partial nifH gene sequences of eight P. azotofixans strains, as well as one strain each of the close relatives Paenibacillus durum, Paenibacillus

Sequencing and de novo transcriptome assembly of the Chinese giant salamander (Andrias davidianus

Directory of Open Access Journals (Sweden)

Yong Huang

2017-06-01

Full Text Available Next-generation technologies for determination of genomics and transcriptomics composition have a wide range of applications. Andrias davidianus, has become an endangered amphibian species of salamander endemic in China. However, there is a lack of the molecular information. In this study, we obtained the RNA-Seq data from a pool of A. davidianus tissue including spleen, liver, muscle, kidney, skin, testis, gut and heart using Illumina HiSeq 2500 platform. A total of 15,398,997,600 bp were obtained, corresponding to 102,659,984 raw reads. A total of 102,659,984 reads were filtered after removing low-quality reads and trimming the adapter sequences. The Trinity program was used to de novo assemble 132,912 unigenes with an average length of 690 bp and N50 of 1263 bp. Unigenes were annotated through number of databases. These transcriptomic data of A. davidianus should open the door to molecular evolution studies based on the entire transcriptome or targeted genes of interest to sequence. The raw data in this study can be available in NCBI SRA database with accession number of SRP099564.

FRAGSION: ultra-fast protein fragment library generation by IOHMM sampling.

Science.gov (United States)

Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin

2016-07-01

Speed, accuracy and robustness of building protein fragment library have important implications in de novo protein structure prediction since fragment-based methods are one of the most successful approaches in template-free modeling (FM). Majority of the existing fragment detection methods rely on database-driven search strategies to identify candidate fragments, which are inherently time-consuming and often hinder the possibility to locate longer fragments due to the limited sizes of databases. Also, it is difficult to alleviate the effect of noisy sequence-based predicted features such as secondary structures on the quality of fragment. Here, we present FRAGSION, a database-free method to efficiently generate protein fragment library by sampling from an Input-Output Hidden Markov Model. FRAGSION offers some unique features compared to existing approaches in that it (i) is lightning-fast, consuming only few seconds of CPU time to generate fragment library for a protein of typical length (300 residues); (ii) can generate dynamic-size fragments of any length (even for the whole protein sequence) and (iii) offers ways to handle noise in predicted secondary structure during fragment sampling. On a FM dataset from the most recent Critical Assessment of Structure Prediction, we demonstrate that FGRAGSION provides advantages over the state-of-the-art fragment picking protocol of ROSETTA suite by speeding up computation by several orders of magnitude while achieving comparable performance in fragment quality. Source code and executable versions of FRAGSION for Linux and MacOS is freely available to non-commercial users at http://sysbio.rnet.missouri.edu/FRAGSION/ It is bundled with a manual and example data. chengji@missouri.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

Directory of Open Access Journals (Sweden)

Ashish V Tendulkar

Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

De novo assembly and next-generation sequencing to analyse full-length gene variants from codon-barcoded libraries.

Science.gov (United States)

Cho, Namjin; Hwang, Byungjin; Yoon, Jung-ki; Park, Sangun; Lee, Joongoo; Seo, Han Na; Lee, Jeewon; Huh, Sunghoon; Chung, Jinsoo; Bang, Duhee

2015-09-21

Interpreting epistatic interactions is crucial for understanding evolutionary dynamics of complex genetic systems and unveiling structure and function of genetic pathways. Although high resolution mapping of en masse variant libraries renders molecular biologists to address genotype-phenotype relationships, long-read sequencing technology remains indispensable to assess functional relationship between mutations that lie far apart. Here, we introduce JigsawSeq for multiplexed sequence identification of pooled gene variant libraries by combining a codon-based molecular barcoding strategy and de novo assembly of short-read data. We first validate JigsawSeq on small sub-pools and observed high precision and recall at various experimental settings. With extensive simulations, we then apply JigsawSeq to large-scale gene variant libraries to show that our method can be reliably scaled using next-generation sequencing. JigsawSeq may serve as a rapid screening tool for functional genomics and offer the opportunity to explore evolutionary trajectories of protein variants.

The A, C, G, and T of Genome Assembly

Directory of Open Access Journals (Sweden)

Bilal Wajid

2016-01-01

Full Text Available Genome assembly in its two decades of history has produced significant research, in terms of both biotechnology and computational biology. This contribution delineates sequencing platforms and their characteristics, examines key steps involved in filtering and processing raw data, explains assembly frameworks, and discusses quality statistics for the assessment of the assembled sequence. Furthermore, the paper explores recent Ubuntu-based software environments oriented towards genome assembly as well as some avenues for future research.

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Analytical and experimental evaluation of a proposed self-forging fragment munition

International Nuclear Information System (INIS)

Tuft, D.B.; Folsom, E.N.

1982-01-01

Analytical and experimental tools have been used to study the formation of a proposed self-forging fragment projectile. The primary objective of this study is the determination of the interior and exterior shape of the fully formed fragment, and to determine if the fragment tumbles in flight. In addition, it is of interest to compare computer predictions to experimental results. An experiment was performed using high speed photography and high-energy flash x-ray radiography to study liner and case motion and projectile formation. Fabrication and assembly tolerances were closely controlled in an effort to eliminate tolerances as a possible source of fragment instability. X-ray film-density contours were analyzed to determine the fully formed fragment interior and exterior shape. Down-range yaw screens showed fragment tumbling in flight. The computed fragment shape was compared to experimental results and it was found that a retaining ring in the computational model near the liner periphery had a significant effect on the final computed fragment shape. With the retaining ring in the computational model and full two-way sliding between all material interfaces, the final computed fragment showed very good agreement with the experiment on both exterior and interior shapes

De novo assembly and phasing of a Korean human genome.

Science.gov (United States)

Seo, Jeong-Sun; Rhie, Arang; Kim, Junsoo; Lee, Sangjin; Sohn, Min-Hwan; Kim, Chang-Uk; Hastie, Alex; Cao, Han; Yun, Ji-Young; Kim, Jihye; Kuk, Junho; Park, Gun Hwa; Kim, Juhyeok; Ryu, Hanna; Kim, Jongbum; Roh, Mira; Baek, Jeonghun; Hunkapiller, Michael W; Korlach, Jonas; Shin, Jong-Yeon; Kim, Changhoon

2016-10-13

Advances in genome assembly and phasing provide an opportunity to investigate the diploid architecture of the human genome and reveal the full range of structural variation across population groups. Here we report the de novo assembly and haplotype phasing of the Korean individual AK1 (ref. 1) using single-molecule real-time sequencing, next-generation mapping, microfluidics-based linked reads, and bacterial artificial chromosome (BAC) sequencing approaches. Single-molecule sequencing coupled with next-generation mapping generated a highly contiguous assembly, with a contig N50 size of 17.9 Mb and a scaffold N50 size of 44.8 Mb, resolving 8 chromosomal arms into single scaffolds. The de novo assembly, along with local assemblies and spanning long reads, closes 105 and extends into 72 out of 190 euchromatic gaps in the reference genome, adding 1.03 Mb of previously intractable sequence. High concordance between the assembly and paired-end sequences from 62,758 BAC clones provides strong support for the robustness of the assembly. We identify 18,210 structural variants by direct comparison of the assembly with the human reference, identifying thousands of breakpoints that, to our knowledge, have not been reported before. Many of the insertions are reflected in the transcriptome and are shared across the Asian population. We performed haplotype phasing of the assembly with short reads, long reads and linked reads from whole-genome sequencing and with short reads from 31,719 BAC clones, thereby achieving phased blocks with an N50 size of 11.6 Mb. Haplotigs assembled from single-molecule real-time reads assigned to haplotypes on phased blocks covered 89% of genes. The haplotigs accurately characterized the hypervariable major histocompatability complex region as well as demonstrating allele configuration in clinically relevant genes such as CYP2D6. This work presents the most contiguous diploid human genome assembly so far, with extensive investigation of

Research on Key Technologies of Unit-Based CNC Machine Tool Assembly Design

Directory of Open Access Journals (Sweden)

Zhongqi Sheng

2014-01-01

Full Text Available Assembly is the part that produces the maximum workload and consumed time during product design and manufacturing process. CNC machine tool is the key basic equipment in manufacturing industry and research on assembly design technologies of CNC machine tool has theoretical significance and practical value. This study established a simplified ASRG for CNC machine tool. The connection between parts, semantic information of transmission, and geometric constraint information were quantified to assembly connection strength to depict the assembling difficulty level. The transmissibility based on trust relationship was applied on the assembly connection strength. Assembly unit partition based on assembly connection strength was conducted, and interferential assembly units were identified and revised. The assembly sequence planning and optimization of parts in each assembly unit and between assembly units was conducted using genetic algorithm. With certain type of high speed CNC turning center, as an example, this paper explored into the assembly modeling, assembly unit partition, and assembly sequence planning and optimization and realized the optimized assembly sequence of headstock of CNC machine tool.

Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

Directory of Open Access Journals (Sweden)

Jian eWu

2012-11-01

Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

Detection of M-Sequences from Spike Sequence in Neuronal Networks

Directory of Open Access Journals (Sweden)

Yoshi Nishitani

2012-01-01

Full Text Available In circuit theory, it is well known that a linear feedback shift register (LFSR circuit generates pseudorandom bit sequences (PRBS, including an M-sequence with the maximum period of length. In this study, we tried to detect M-sequences known as a pseudorandom sequence generated by the LFSR circuit from time series patterns of stimulated action potentials. Stimulated action potentials were recorded from dissociated cultures of hippocampal neurons grown on a multielectrode array. We could find several M-sequences from a 3-stage LFSR circuit (M3. These results show the possibility of assembling LFSR circuits or its equivalent ones in a neuronal network. However, since the M3 pattern was composed of only four spike intervals, the possibility of an accidental detection was not zero. Then, we detected M-sequences from random spike sequences which were not generated from an LFSR circuit and compare the result with the number of M-sequences from the originally observed raster data. As a result, a significant difference was confirmed: a greater number of “0–1” reversed the 3-stage M-sequences occurred than would have accidentally be detected. This result suggests that some LFSR equivalent circuits are assembled in neuronal networks.

An Improved Genome Assembly of Azadirachta indica A. Juss.

Directory of Open Access Journals (Sweden)

Neeraja M. Krishnan

2016-07-01

Full Text Available Neem (Azadirachta indica A. Juss., an evergreen tree of the Meliaceae family, is known for its medicinal, cosmetic, pesticidal and insecticidal properties. We had previously sequenced and published the draft genome of a neem plant, using mainly short read sequencing data. In this report, we present an improved genome assembly generated using additional short reads from Illumina and long reads from Pacific Biosciences SMRT sequencer. We assembled short reads and error-corrected long reads using Platanus, an assembler designed to perform well for heterozygous genomes. The updated genome assembly (v2.0 yielded 3- and 3.5-fold increase in N50 and N75, respectively; 2.6-fold decrease in the total number of scaffolds; 1.25-fold increase in the number of valid transcriptome alignments; 13.4-fold less misassembly and 1.85-fold increase in the percentage repeat, over the earlier assembly (v1.0. The current assembly also maps better to the genes known to be involved in the terpenoid biosynthesis pathway. Together, the data represent an improved assembly of the A. indica genome.

Codon-Precise, Synthetic, Antibody Fragment Libraries Built Using Automated Hexamer Codon Additions and Validated through Next Generation Sequencing

Directory of Open Access Journals (Sweden)

Laura Frigotto

2015-05-01

Full Text Available We have previously described ProxiMAX, a technology that enables the fabrication of precise, combinatorial gene libraries via codon-by-codon saturation mutagenesis. ProxiMAX was originally performed using manual, enzymatic transfer of codons via blunt-end ligation. Here we present Colibra™: an automated, proprietary version of ProxiMAX used specifically for antibody library generation, in which double-codon hexamers are transferred during the saturation cycling process. The reduction in process complexity, resulting library quality and an unprecedented saturation of up to 24 contiguous codons are described. Utility of the method is demonstrated via fabrication of complementarity determining regions (CDR in antibody fragment libraries and next generation sequencing (NGS analysis of their quality and diversity.

Hapsembler: An Assembler for Highly Polymorphic Genomes

Science.gov (United States)

Donmez, Nilgun; Brudno, Michael

As whole genome sequencing has become a routine biological experiment, algorithms for assembly of whole genome shotgun data has become a topic of extensive research, with a plethora of off-the-shelf methods that can reconstruct the genomes of many organisms. Simultaneously, several recently sequenced genomes exhibit very high polymorphism rates. For these organisms genome assembly remains a challenge as most assemblers are unable to handle highly divergent haplotypes in a single individual. In this paper we describe Hapsembler, an assembler for highly polymorphic genomes, which makes use of paired reads. Our experiments show that Hapsembler produces accurate and contiguous assemblies of highly polymorphic genomes, while performing on par with the leading tools on haploid genomes. Hapsembler is available for download at http://compbio.cs.toronto.edu/hapsembler.

fRMSDPred: Predicting Local RMSD Between Structural Fragments Using Sequence Information

National Research Council Canada - National Science Library

Rangwala, Huzefa; Karypis, George

2007-01-01

.... We present algorithms to solve this fragment-level RMSD prediction problem using a supervised learning framework based on support vector regression and classification that incorporates protein...

Evaluation of nine popular de novo assemblers in microbial genome assembly.

Science.gov (United States)

Forouzan, Esmaeil; Maleki, Masoumeh Sadat Mousavi; Karkhane, Ali Asghar; Yakhchali, Bagher

2017-12-01

Next generation sequencing (NGS) technologies are revolutionizing biology, with Illumina being the most popular NGS platform. Short read assembly is a critical part of most genome studies using NGS. Hence, in this study, the performance of nine well-known assemblers was evaluated in the assembly of seven different microbial genomes. Effect of different read coverage and k-mer parameters on the quality of the assembly were also evaluated on both simulated and actual read datasets. Our results show that the performance of assemblers on real and simulated datasets could be significantly different, mainly because of coverage bias. According to outputs on actual read datasets, for all studied read coverages (of 7×, 25× and 100×), SPAdes and IDBA-UD clearly outperformed other assemblers based on NGA50 and accuracy metrics. Velvet is the most conservative assembler with the lowest NGA50 and error rate. Copyright © 2017. Published by Elsevier B.V.

De Novo Assembly of the Pea (Pisum sativum L. Nodule Transcriptome

Directory of Open Access Journals (Sweden)

Vladimir A. Zhukov

2015-01-01

Full Text Available The large size and complexity of the garden pea (Pisum sativum L. genome hamper its sequencing and the discovery of pea gene resources. Although transcriptome sequencing provides extensive information about expressed genes, some tissue-specific transcripts can only be identified from particular organs under appropriate conditions. In this study, we performed RNA sequencing of polyadenylated transcripts from young pea nodules and root tips on an Illumina GAIIx system, followed by de novo transcriptome assembly using the Trinity program. We obtained more than 58,000 and 37,000 contigs from “Nodules” and “Root Tips” assemblies, respectively. The quality of the assemblies was assessed by comparison with pea expressed sequence tags and transcriptome sequencing project data available from NCBI website. The “Nodules” assembly was compared with the “Root Tips” assembly and with pea transcriptome sequencing data from projects indicating tissue specificity. As a result, approximately 13,000 nodule-specific contigs were found and annotated by alignment to known plant protein-coding sequences and by Gene Ontology searching. Of these, 581 sequences were found to possess full CDSs and could thus be considered as novel nodule-specific transcripts of pea. The information about pea nodule-specific gene sequences can be applied for gene-based markers creation, polymorphism studies, and real-time PCR.

Sequence finishing and mapping of Drosophila melanogasterheterochromatin

Energy Technology Data Exchange (ETDEWEB)

Hoskins, Roger A.; Carlson, Joseph W.; Kennedy, Cameron; Acevedo,David; Evans-Holm, Martha; Frise, Erwin; Wan, Kenneth H.; Park, Soo; Mendez-Lago, Maria; Rossi, Fabrizio; Villasante, Alfredo; Dimitri,Patrizio; Karpen, Gary H.; Celniker, Susan E.

2007-06-15

Genome sequences for most metazoans are incomplete due tothe presence of repeated DNA in the pericentromeric heterochromatin. Theheterochromatic regions of D. melanogaster contain 20 Mb of sequenceamenable to mapping, sequence assembly and finishing. Here we describethe generation of 15 Mb of finished or improved heterochromatic sequenceusing available clone resources and assembly and mapping methods. We alsoconstructed a BAC-based physical map that spans approximately 13 Mb ofthe pericentromeric heterochromatin, and a cytogenetic map that positionsapproximately 11 Mb of BAC contigs and sequence scaffolds in specificchromosomal locations. The integrated sequence assembly and maps greatlyimprove our understanding of the structure and composition of this poorlyunderstood fraction of a metazoan genome and provide a framework forfunctional analyses.

AutoAssemblyD: a graphical user interface system for several genome assemblers.

Science.gov (United States)

Veras, Adonney Allan de Oliveira; de Sá, Pablo Henrique Caracciolo Gomes; Azevedo, Vasco; Silva, Artur; Ramos, Rommel Thiago Jucá

2013-01-01

Next-generation sequencing technologies have increased the amount of biological data generated. Thus, bioinformatics has become important because new methods and algorithms are necessary to manipulate and process such data. However, certain challenges have emerged, such as genome assembly using short reads and high-throughput platforms. In this context, several algorithms have been developed, such as Velvet, Abyss, Euler-SR, Mira, Edna, Maq, SHRiMP, Newbler, ALLPATHS, Bowtie and BWA. However, most such assemblers do not have a graphical interface, which makes their use difficult for users without computing experience given the complexity of the assembler syntax. Thus, to make the operation of such assemblers accessible to users without a computing background, we developed AutoAssemblyD, which is a graphical tool for genome assembly submission and remote management by multiple assemblers through XML templates. AssemblyD is freely available at https://sourceforge.net/projects/autoassemblyd. It requires Sun jdk 6 or higher.

Survey of transposable elements in sugarcane expressed sequence tags (ESTs

Directory of Open Access Journals (Sweden)

Rossi Magdalena

2001-01-01

Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

Genome Sequence, Assembly and Characterization of Two Metschnikowia fructicola Strains Used as Biocontrol Agents of Postharvest Diseases

Directory of Open Access Journals (Sweden)

Edoardo Piombo

2018-04-01

Full Text Available The yeast Metschnikowia fructicola was reported as an efficient biological control agent of postharvest diseases of fruits and vegetables, and it is the bases of the commercial formulated product “Shemer.” Several mechanisms of action by which M. fructicola inhibits postharvest pathogens were suggested including iron-binding compounds, induction of defense signaling genes, production of fungal cell wall degrading enzymes and relatively high amounts of superoxide anions. We assembled the whole genome sequence of two strains of M. fructicola using PacBio and Illumina shotgun sequencing technologies. Using the PacBio, a high-quality draft genome consisting of 93 contigs, with an estimated genome size of approximately 26 Mb, was obtained. Comparative analysis of M. fructicola proteins with the other three available closely related genomes revealed a shared core of homologous proteins coded by 5,776 genes. Comparing the genomes of the two M. fructicola strains using a SNP calling approach resulted in the identification of 564,302 homologous SNPs with 2,004 predicted high impact mutations. The size of the genome is exceptionally high when compared with those of available closely related organisms, and the high rate of homology among M. fructicola genes points toward a recent whole-genome duplication event as the cause of this large genome. Based on the assembled genome, sequences were annotated with a gene description and gene ontology (GO term and clustered in functional groups. Analysis of CAZymes family genes revealed 1,145 putative genes, and transcriptomic analysis of CAZyme expression levels in M. fructicola during its interaction with either grapefruit peel tissue or Penicillium digitatum revealed a high level of CAZyme gene expression when the yeast was placed in wounded fruit tissue.

Quality Assessment of Domesticated Animal Genome Assemblies

DEFF Research Database (Denmark)

Seemann, Stefan E; Anthon, Christian; Palasca, Oana

2015-01-01

affected by the lack of genomic sequence. Herein, we quantify the quality of the genome assemblies of 20 domesticated animals and related species by assessing a range of measurable parameters, and we show that there is a positive correlation between the fraction of mappable reads from RNAseq data...... domesticated animal genomes still need to be sequenced deeper in order to produce high-quality assemblies. In the meanwhile, ironically, the extent to which RNAseq and other next-generation data is produced frequently far exceeds that of the genomic sequence. Furthermore, basic comparative analysis is often...

OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

Directory of Open Access Journals (Sweden)

Kevin M. Bradley

2014-08-01

Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

Assembly of 500,000 inter-specific catfish expressed sequence tags and large scale gene-associated marker development for whole genome association studies

Energy Technology Data Exchange (ETDEWEB)

Catfish Genome Consortium; Wang, Shaolin; Peatman, Eric; Abernathy, Jason; Waldbieser, Geoff; Lindquist, Erika; Richardson, Paul; Lucas, Susan; Wang, Mei; Li, Ping; Thimmapuram, Jyothi; Liu, Lei; Vullaganti, Deepika; Kucuktas, Huseyin; Murdock, Christopher; Small, Brian C; Wilson, Melanie; Liu, Hong; Jiang, Yanliang; Lee, Yoona; Chen, Fei; Lu, Jianguo; Wang, Wenqi; Xu, Peng; Somridhivej, Benjaporn; Baoprasertkul, Puttharat; Quilang, Jonas; Sha, Zhenxia; Bao, Baolong; Wang, Yaping; Wang, Qun; Takano, Tomokazu; Nandi, Samiran; Liu, Shikai; Wong, Lilian; Kaltenboeck, Ludmilla; Quiniou, Sylvie; Bengten, Eva; Miller, Norman; Trant, John; Rokhsar, Daniel; Liu, Zhanjiang

2010-03-23

Background-Through the Community Sequencing Program, a catfish EST sequencing project was carried out through a collaboration between the catfish research community and the Department of Energy's Joint Genome Institute. Prior to this project, only a limited EST resource from catfish was available for the purpose of SNP identification. Results-A total of 438,321 quality ESTs were generated from 8 channel catfish (Ictalurus punctatus) and 4 blue catfish (Ictalurus furcatus) libraries, bringing the number of catfish ESTs to nearly 500,000. Assembly of all catfish ESTs resulted in 45,306 contigs and 66,272 singletons. Over 35percent of the unique sequences had significant similarities to known genes, allowing the identification of 14,776 unique genes in catfish. Over 300,000 putative SNPs have been identified, of which approximately 48,000 are high-quality SNPs identified from contigs with at least four sequences and the minor allele presence of at least two sequences in the contig. The EST resource should be valuable for identification of microsatellites, genome annotation, large-scale expression analysis, and comparative genome analysis. Conclusions-This project generated a large EST resource for catfish that captured the majority of the catfish transcriptome. The parallel analysis of ESTs from two closely related Ictalurid catfishes should also provide powerful means for the evaluation of ancient and recent gene duplications, and for the development of high-density microarrays in catfish. The inter- and intra-specific SNPs identified from all catfish EST dataset assembly will greatly benefit the catfish introgression breeding program and whole genome association studies.

De Novo Sequencing and Assembly Analysis of Transcriptome in Pinus bungeana Zucc. ex Endl.

Directory of Open Access Journals (Sweden)

Qifei Cai

2018-03-01

Full Text Available To enrich the molecular data of Pinus bungeana Zucc. ex Endl. and study the regulating factors of different morphology controled by apical dominance. In this study, de novo assembly of transcriptome annotation was performed for two varieties of Pinus bungeana Zucc. ex Endl. that are obviously different in morphology. More than 147 million reads were produced, which were assembled into 88,092 unigenes. Based on a similarity search, 11,692 unigenes showed significant similarity to proteins from Picea sitchensis (Bong. Carr. From this collection of unigenes, a large number of molecular markers were identified, including 2829 simple sequence repeats (SSRs. A total of 158 unigenes expressed differently between two varieties, including 98 up-regulated and 60 down-regulated unigenes. Furthermore, among the differently expressed genes (DEGs, five genes which may impact the plant morphology were further validated by reverse transcription quantitative polymerase chain reaction (RT-qPCR. The five genes related to cytokinin oxidase/dehydrogenase (CKX, two-component response regulator ARR-A family (ARR-A, plant hormone signal transduction (AHP, and MADS-box transcription factors have a close relationship with apical dominance. This new dataset will be a useful resource for future genetic and genomic studies in Pinus bungeana Zucc. ex Endl.

Biomedical Applications of Self-Assembling Peptides

NARCIS (Netherlands)

Radmalekshahi, Mazda; Lempsink, Ludwijn; Amidi, Maryam; Hennink, Wim E.; Mastrobattista, Enrico

2016-01-01

Self-assembling peptides have gained increasing attention as versatile molecules to generate diverse supramolecular structures with tunable functionality. Because of the possibility to integrate a wide range of functional domains into self-assembling peptides including cell attachment sequences,

Whole genome sequence of the emerging oomycete pathogen Pythium insidiosum strain CDC-B5653 isolated from an infected human in the USA

Directory of Open Access Journals (Sweden)

Marina S. Ascunce

2016-03-01

Full Text Available Pythium insidiosum ATCC 200269 strain CDC-B5653, an isolate from necrotizing lesions on the mouth and eye of a 2-year-old boy in Memphis, Tennessee, USA, was sequenced using a combination of Illumina MiSeq (300 bp paired-end, 14 millions reads and PacBio (10  Kb fragment library, 356,001 reads. The sequencing data were assembled using SPAdes version 3.1.0, yielding a total genome size of 45.6 Mb contained in 8992 contigs, N50 of 13 Kb, 57% G + C content, and 17,867 putative protein-coding genes. This Whole Genome Shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession JRHR00000000. Keywords: Oomycete, Pythium insidiosum, Pythiosis, Human emerging pathogen, Genome sequencing

Single-molecule sequencing and Hi-C-based proximity-guided assembly of amaranth (Amaranthus hypochondriacus) chromosomes provide insights into genome evolution

KAUST Repository

Lightfoot, D. J.; Jarvis, David Erwin; Ramaraj, T.; Lee, R.; Jellen, E. N.; Maughan, P. J.

2017-01-01

Background: Amaranth (Amaranthus hypochondriacus) was a food staple among the ancient civilizations of Central and South America that has recently received increased attention due to the high nutritional value of the seeds, with the potential to help alleviate malnutrition and food security concerns, particularly in arid and semiarid regions of the developing world. Here, we present a reference-quality assembly of the amaranth genome which will assist the agronomic development of the species.Results: Utilizing single-molecule, real-time sequencing (Pacific Biosciences) and chromatin interaction mapping (Hi-C) to close assembly gaps and scaffold contigs, respectively, we improved our previously reported Illumina-based assembly to produce a chromosome-scale assembly with a scaffold N50 of 24.4 Mb. The 16 largest scaffolds contain 98% of the assembly and likely represent the haploid chromosomes (n = 16). To demonstrate the accuracy and utility of this approach, we produced physical and genetic maps and identified candidate genes for the betalain pigmentation pathway. The chromosome-scale assembly facilitated a genome-wide syntenic comparison of amaranth with other Amaranthaceae species, revealing chromosome loss and fusion events in amaranth that explain the reduction from the ancestral haploid chromosome number (n = 18) for a tetraploid member of the Amaranthaceae. as major evolutionary events in the 2n = 32 amaranths and clearly establish the homoeologous relationship among most of the subgenome chromosomes, which will facilitate future investigations of intragenomic changes that occurred post polyploidization.

Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

Directory of Open Access Journals (Sweden)

Kristen K. Merritt

2014-10-01

Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

Evaluation of a transposase protocol for rapid generation of shotgun high-throughput sequencing libraries from nanogram quantities of DNA.

Science.gov (United States)

Marine, Rachel; Polson, Shawn W; Ravel, Jacques; Hatfull, Graham; Russell, Daniel; Sullivan, Matthew; Syed, Fraz; Dumas, Michael; Wommack, K Eric

2011-11-01

Construction of DNA fragment libraries for next-generation sequencing can prove challenging, especially for samples with low DNA yield. Protocols devised to circumvent the problems associated with low starting quantities of DNA can result in amplification biases that skew the distribution of genomes in metagenomic data. Moreover, sample throughput can be slow, as current library construction techniques are time-consuming. This study evaluated Nextera, a new transposon-based method that is designed for quick production of DNA fragment libraries from a small quantity of DNA. The sequence read distribution across nine phage genomes in a mock viral assemblage met predictions for six of the least-abundant phages; however, the rank order of the most abundant phages differed slightly from predictions. De novo genome assemblies from Nextera libraries provided long contigs spanning over half of the phage genome; in four cases where full-length genome sequences were available for comparison, consensus sequences were found to match over 99% of the genome with near-perfect identity. Analysis of areas of low and high sequence coverage within phage genomes indicated that GC content may influence coverage of sequences from Nextera libraries. Comparisons of phage genomes prepared using both Nextera and a standard 454 FLX Titanium library preparation protocol suggested that the coverage biases according to GC content observed within the Nextera libraries were largely attributable to bias in the Nextera protocol rather than to the 454 sequencing technology. Nevertheless, given suitable sequence coverage, the Nextera protocol produced high-quality data for genomic studies. For metagenomics analyses, effects of GC amplification bias would need to be considered; however, the library preparation standardization that Nextera provides should benefit comparative metagenomic analyses.

Sequence determinants of human microsatellite variability

Directory of Open Access Journals (Sweden)

Jakobsson Mattias

2009-12-01

Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

Science.gov (United States)

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

Challenges, Solutions, and Quality Metrics of Personal Genome Assembly in Advancing Precision Medicine

Directory of Open Access Journals (Sweden)

Wenming Xiao

2016-04-01

Full Text Available Even though each of us shares more than 99% of the DNA sequences in our genome, there are millions of sequence codes or structure in small regions that differ between individuals, giving us different characteristics of appearance or responsiveness to medical treatments. Currently, genetic variants in diseased tissues, such as tumors, are uncovered by exploring the differences between the reference genome and the sequences detected in the diseased tissue. However, the public reference genome was derived with the DNA from multiple individuals. As a result of this, the reference genome is incomplete and may misrepresent the sequence variants of the general population. The more reliable solution is to compare sequences of diseased tissue with its own genome sequence derived from tissue in a normal state. As the price to sequence the human genome has dropped dramatically to around $1000, it shows a promising future of documenting the personal genome for every individual. However, de novo assembly of individual genomes at an affordable cost is still challenging. Thus, till now, only a few human genomes have been fully assembled. In this review, we introduce the history of human genome sequencing and the evolution of sequencing platforms, from Sanger sequencing to emerging “third generation sequencing” technologies. We present the currently available de novo assembly and post-assembly software packages for human genome assembly and their requirements for computational infrastructures. We recommend that a combined hybrid assembly with long and short reads would be a promising way to generate good quality human genome assemblies and specify parameters for the quality assessment of assembly outcomes. We provide a perspective view of the benefit of using personal genomes as references and suggestions for obtaining a quality personal genome. Finally, we discuss the usage of the personal genome in aiding vaccine design and development, monitoring host

Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

Science.gov (United States)

Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

2014-11-01

Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

Optimization of de novo transcriptome assembly from high-throughput short read sequencing data improves functional annotation for non-model organisms

Directory of Open Access Journals (Sweden)

Haznedaroglu Berat Z

2012-07-01

Full Text Available Abstract Background The k-mer hash length is a key factor affecting the output of de novo transcriptome assembly packages using de Bruijn graph algorithms. Assemblies constructed with varying single k-mer choices might result in the loss of unique contiguous sequences (contigs and relevant biological information. A common solution to this problem is the clustering of single k-mer assemblies. Even though annotation is one of the primary goals of a transcriptome assembly, the success of assembly strategies does not consider the impact of k-mer selection on the annotation output. This study provides an in-depth k-mer selection analysis that is focused on the degree of functional annotation achieved for a non-model organism where no reference genome information is available. Individual k-mers and clustered assemblies (CA were considered using three representative software packages. Pair-wise comparison analyses (between individual k-mers and CAs were produced to reveal missing Kyoto Encyclopedia of Genes and Genomes (KEGG ortholog identifiers (KOIs, and to determine a strategy that maximizes the recovery of biological information in a de novo transcriptome assembly. Results Analyses of single k-mer assemblies resulted in the generation of various quantities of contigs and functional annotations within the selection window of k-mers (k-19 to k-63. For each k-mer in this window, generated assemblies contained certain unique contigs and KOIs that were not present in the other k-mer assemblies. Producing a non-redundant CA of k-mers 19 to 63 resulted in a more complete functional annotation than any single k-mer assembly. However, a fraction of unique annotations remained (~0.19 to 0.27% of total KOIs in the assemblies of individual k-mers (k-19 to k-63 that were not present in the non-redundant CA. A workflow to recover these unique annotations is presented. Conclusions This study demonstrated that different k-mer choices result in various quantities

Meta-IDBA: a de Novo assembler for metagenomic data.

Science.gov (United States)

Peng, Yu; Leung, Henry C M; Yiu, S M; Chin, Francis Y L

2011-07-01

Next-generation sequencing techniques allow us to generate reads from a microbial environment in order to analyze the microbial community. However, assembling of a set of mixed reads from different species to form contigs is a bottleneck of metagenomic research. Although there are many assemblers for assembling reads from a single genome, there are no assemblers for assembling reads in metagenomic data without reference genome sequences. Moreover, the performances of these assemblers on metagenomic data are far from satisfactory, because of the existence of common regions in the genomes of subspecies and species, which make the assembly problem much more complicated. We introduce the Meta-IDBA algorithm for assembling reads in metagenomic data, which contain multiple genomes from different species. There are two core steps in Meta-IDBA. It first tries to partition the de Bruijn graph into isolated components of different species based on an important observation. Then, for each component, it captures the slight variants of the genomes of subspecies from the same species by multiple alignments and represents the genome of one species, using a consensus sequence. Comparison of the performances of Meta-IDBA and existing assemblers, such as Velvet and Abyss for different metagenomic datasets shows that Meta-IDBA can reconstruct longer contigs with similar accuracy. Meta-IDBA toolkit is available at our website http://www.cs.hku.hk/~alse/metaidba. chin@cs.hku.hk.

The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

Science.gov (United States)

Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

2012-01-01

Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

Estimating gene gain and loss rates in the presence of error in genome assembly and annotation using CAFE 3.

Science.gov (United States)

Han, Mira V; Thomas, Gregg W C; Lugo-Martinez, Jose; Hahn, Matthew W

2013-08-01

Current sequencing methods produce large amounts of data, but genome assemblies constructed from these data are often fragmented and incomplete. Incomplete and error-filled assemblies result in many annotation errors, especially in the number of genes present in a genome. This means that methods attempting to estimate rates of gene duplication and loss often will be misled by such errors and that rates of gene family evolution will be consistently overestimated. Here, we present a method that takes these errors into account, allowing one to accurately infer rates of gene gain and loss among genomes even with low assembly and annotation quality. The method is implemented in the newest version of the software package CAFE, along with several other novel features. We demonstrate the accuracy of the method with extensive simulations and reanalyze several previously published data sets. Our results show that errors in genome annotation do lead to higher inferred rates of gene gain and loss but that CAFE 3 sufficiently accounts for these errors to provide accurate estimates of important evolutionary parameters.

Combining de novo and reference-guided assembly with scaffold_builder

NARCIS (Netherlands)

Silva, G.G.; Dutilh, B.E.; Matthews, T.D.; Elkins, K.; Schmieder, R.; Dinsdale, E.A.; Edwards, R.A.

2013-01-01

Genome sequencing has become routine, however genome assembly still remains a challenge despite the computational advances in the last decade. In particular, the abundance of repeat elements in genomes makes it difficult to assemble them into a single complete sequence. Identical repeats shorter

Biglycan fragmentation in pathologies associated with extracellular matrix remodeling by matrix metalloproteinases

DEFF Research Database (Denmark)

Genovese, Federica; Barascuk, Natasha; Larsen, Lise Skakkebæk

2013-01-01

The proteoglycan biglycan (BGN) is involved in collagen fibril assembly and its fragmentation is likely to be associated with collagen turnover during the pathogenesis of diseases which involve dysregulated extracellular matrix remodeling (ECMR), such as rheumatoid arthritis (RA) and liver fibrosis...

Improving Phrap-based assembly of the rat using "reliable" overlaps.

Directory of Open Access Journals (Sweden)

Michael Roberts

2008-03-01

Full Text Available The assembly methods used for whole-genome shotgun (WGS data have a major impact on the quality of resulting draft genomes. We present a novel algorithm to generate a set of "reliable" overlaps based on identifying repeat k-mers. To demonstrate the benefits of using reliable overlaps, we have created a version of the Phrap assembly program that uses only overlaps from a specific list. We call this version PhrapUMD. Integrating PhrapUMD and our "reliable-overlap" algorithm with the Baylor College of Medicine assembler, Atlas, we assemble the BACs from the Rattus norvegicus genome project. Starting with the same data as the Nov. 2002 Atlas assembly, we compare our results and the Atlas assembly to the 4.3 Mb of rat sequence in the 21 BACs that have been finished. Our version of the draft assembly of the 21 BACs increases the coverage of finished sequence from 93.4% to 96.3%, while simultaneously reducing the base error rate from 4.5 to 1.1 errors per 10,000 bases. There are a number of ways of assessing the relative merits of assemblies when the finished sequence is available. If one views the overall quality of an assembly as proportional to the inverse of the product of the error rate and sequence missed, then the assembly presented here is seven times better. The UMD Overlapper with options for reliable overlaps is available from the authors at http://www.genome.umd.edu. We also provide the changes to the Phrap source code enabling it to use only the reliable overlaps.

Extracellular matrix fragmentation in young, healthy cartilaginous tissues.

Science.gov (United States)

Craddock, R J; Hodson, N W; Ozols, M; Shearer, T; Hoyland, J A; Sherratt, M J

2018-02-09

Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC) and the nucleus pulposus (NP) of the intervertebral disc (IVD). Whilst structural heterogeneity of intact aggrecan ( containing three globular domains) is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months), bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 %) were fragmented (lacking one or more globular domains). Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa) comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis). As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2) as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2), it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally) and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.

Detection of a Usp-like gene in Calotropis procera plant from the de novo assembled genome contigs of the high-throughput sequencing dataset

KAUST Repository

Shokry, Ahmed M.

2014-02-01

The wild plant species Calotropis procera (C. procera) has many potential applications and beneficial uses in medicine, industry and ornamental field. It also represents an excellent source of genes for drought and salt tolerance. Genes encoding proteins that contain the conserved universal stress protein (USP) domain are known to provide organisms like bacteria, archaea, fungi, protozoa and plants with the ability to respond to a plethora of environmental stresses. However, information on the possible occurrence of Usp in C. procera is not available. In this study, we uncovered and characterized a one-class A Usp-like (UspA-like, NCBI accession No. KC954274) gene in this medicinal plant from the de novo assembled genome contigs of the high-throughput sequencing dataset. A number of GenBank accessions for Usp sequences were blasted with the recovered de novo assembled contigs. Homology modelling of the deduced amino acids (NCBI accession No. AGT02387) was further carried out using Swiss-Model, accessible via the EXPASY. Superimposition of C. procera USPA-like full sequence model on Thermus thermophilus USP UniProt protein (PDB accession No. Q5SJV7) was constructed using RasMol and Deep-View programs. The functional domains of the novel USPA-like amino acids sequence were identified from the NCBI conserved domain database (CDD) that provide insights into sequence structure/function relationships, as well as domain models imported from a number of external source databases (Pfam, SMART, COG, PRK, TIGRFAM). © 2014 Académie des sciences.

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

OpenAIRE

Haggarty, N W; Dunbar, B; Fothergill, L A

1983-01-01

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important...

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

Mojibake - The rehearsal of word fragments in verbal recall.

Science.gov (United States)

Lange-Küttner, Christiane; Sykorova, Eva

2015-01-01

Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the 'grain size' of word units (Ziegler and Goswami, 2005). In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF) English words versus geographical (UK) town names to control for content. We also tested unfamiliar international (INT) non-words and names of international (INT) European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words.

Process for environmentally safe disposal of used fluorescent lamp potted ballast assemblies with component part reclamation and/or recycling

Energy Technology Data Exchange (ETDEWEB)

Nardella, A.; Norian, B.

1993-07-27

A process is described for the environmentally safe and economical disposal of used fluorescent lamp potted ballast housing assemblies comprising removing from the housing the potted assembly with its embedded electrical component assemblies including a component capacitor containing environmentally hazardous material PCB's; after or before such removing, immersing the potted assembly in a cryogenic bath and freezing the same to reader the potting sufficiently brittle to fragment into small pieces upon being impacted; impacting the potting thoroughly to crush and fragment the same into small pieces and to cleanly remove substantially all traces of the potting from all the electrical components and parts embedded therein and without imparting damage to the components and parts; disconnecting the component containing the environmentally hazardous material; and incinerating only the component containing the environmentally hazardous material, leaving all other components and parts including the housing and potting fragments for salvage, re-use and/or recycling.

Optimized core loading sequence for Ukraine WWER-1000 reactors

International Nuclear Information System (INIS)

Dye, M.; Shah, H.

2015-01-01

Fuel Assemblies (WFAs) experienced mechanical damage of the grids during loading at both South Ukraine 2 (SU2) and South Ukraine 3 (SU3). The grids were damaged due to high lateral loads exceeding their strength limit. The high lateral loads were caused by a combination of distortion and stiffness of the mixed core fuel assemblies and significant fuel assembly-to-fuel assembly interaction combined with the core loading sequence being used. To prevent damage of the WFA grids during core loading, Westinghouse has developed a loading sequence technique and loading aides (smooth sided dummies and top nozzle loading guides) designed to minimize fuel assembly-to-fuel assembly interaction while maximizing the potential for successful loading (i.e., no fuel assembly damage and minimized loading time). The loading sequence technique accounts for cycle-specific core loading patterns and is based on previous Westinghouse WWER core loading experience and fundamental principles. The loading aids are developed to “open-up” the target core location or to provide guidance into a target core location. The Westinghouse optimized core loading sequence and smooth sided dummies were utilized during the successful loading of SU3 Cycle 25 mixed core in March 2015, with no instances of fuel assembly damage and yet still provided considerable time savings relative to the 2012 and 2013 SU3 reload campaigns. (authors)

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

Science.gov (United States)

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

An efficient method for isolating antibody fragments against small peptides by antibody phage display

DEFF Research Database (Denmark)

Duan, Zhi; Siegumfeldt, Henrik

2010-01-01

We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....

Zseq: An Approach for Preprocessing Next-Generation Sequencing Data.

Science.gov (United States)

Alkhateeb, Abedalrhman; Rueda, Luis

2017-08-01

Next-generation sequencing technology generates a huge number of reads (short sequences), which contain a vast amount of genomic data. The sequencing process, however, comes with artifacts. Preprocessing of sequences is mandatory for further downstream analysis. We present Zseq, a linear method that identifies the most informative genomic sequences and reduces the number of biased sequences, sequence duplications, and ambiguous nucleotides. Zseq finds the complexity of the sequences by counting the number of unique k-mers in each sequence as its corresponding score and also takes into the account other factors such as ambiguous nucleotides or high GC-content percentage in k-mers. Based on a z-score threshold, Zseq sweeps through the sequences again and filters those with a z-score less than the user-defined threshold. Zseq algorithm is able to provide a better mapping rate; it reduces the number of ambiguous bases significantly in comparison with other methods. Evaluation of the filtered reads has been conducted by aligning the reads and assembling the transcripts using the reference genome as well as de novo assembly. The assembled transcripts show a better discriminative ability to separate cancer and normal samples in comparison with another state-of-the-art method. Moreover, de novo assembled transcripts from the reads filtered by Zseq have longer genomic sequences than other tested methods. Estimating the threshold of the cutoff point is introduced using labeling rules with optimistic results.

Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

Science.gov (United States)

Schwessinger, Benjamin; Rathjen, John P

2017-01-01

Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

Extracellular matrix fragmentation in young, healthy cartilaginous tissues

Directory of Open Access Journals (Sweden)

RJ Craddock

2018-02-01

Full Text Available Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC and the nucleus pulposus (NP of the intervertebral disc (IVD. Whilst structural heterogeneity of intact aggrecan ( containing three globular domains is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months, bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 % were fragmented (lacking one or more globular domains. Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p < 0.0001. In contrast, fibrillar collagen appeared structurally intact and tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis. As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2 as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2, it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

Science.gov (United States)

Shi, Jinming

In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

Science.gov (United States)

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Assembly of viral genomes from metagenomes

Directory of Open Access Journals (Sweden)

Saskia L Smits

2014-12-01

Full Text Available Viral infections remain a serious global health issue. Metagenomic approaches are increasingly used in the detection of novel viral pathogens but also to generate complete genomes of uncultivated viruses. In silico identification of complete viral genomes from sequence data would allow rapid phylogenetic characterization of these new viruses. Often, however, complete viral genomes are not recovered, but rather several distinct contigs derived from a single entity, some of which have no sequence homology to any known proteins. De novo assembly of single viruses from a metagenome is challenging, not only because of the lack of a reference genome, but also because of intrapopulation variation and uneven or insufficient coverage. Here we explored different assembly algorithms, remote homology searches, genome-specific sequence motifs, k-mer frequency ranking, and coverage profile binning to detect and obtain viral target genomes from metagenomes. All methods were tested on 454-generated sequencing datasets containing three recently described RNA viruses with a relatively large genome which were divergent to previously known viruses from the viral families Rhabdoviridae and Coronaviridae. Depending on specific characteristics of the target virus and the metagenomic community, different assembly and in silico gap closure strategies were successful in obtaining near complete viral genomes.

Brain transcriptome sequencing and assembly of three songbird model systems for the study of social behavior

Directory of Open Access Journals (Sweden)

Christopher N. Balakrishnan

2014-05-01

Full Text Available Emberizid sparrows (emberizidae have played a prominent role in the study of avian vocal communication and social behavior. We present here brain transcriptomes for three emberizid model systems, song sparrow Melospiza melodia, white-throated sparrow Zonotrichia albicollis, and Gambel’s white-crowned sparrow Zonotrichia leucophrys gambelii. Each of the assemblies covered fully or in part, over 89% of the previously annotated protein coding genes in the zebra finch Taeniopygia guttata, with 16,846, 15,805, and 16,646 unique BLAST hits in song, white-throated and white-crowned sparrows, respectively. As in previous studies, we find tissue of origin (auditory forebrain versus hypothalamus and whole brain as an important determinant of overall expression profile. We also demonstrate the successful isolation of RNA and RNA-sequencing from post-mortem samples from building strikes and suggest that such an approach could be useful when traditional sampling opportunities are limited. These transcriptomes will be an important resource for the study of social behavior in birds and for data driven annotation of forthcoming whole genome sequences for these and other bird species.

High molecular weight DNA assembly in vivo for synthetic biology applications.

Science.gov (United States)

Juhas, Mario; Ajioka, James W

2017-05-01

DNA assembly is the key technology of the emerging interdisciplinary field of synthetic biology. While the assembly of smaller DNA fragments is usually performed in vitro, high molecular weight DNA molecules are assembled in vivo via homologous recombination in the host cell. Escherichia coli, Bacillus subtilis and Saccharomyces cerevisiae are the main hosts used for DNA assembly in vivo. Progress in DNA assembly over the last few years has paved the way for the construction of whole genomes. This review provides an update on recent synthetic biology advances with particular emphasis on high molecular weight DNA assembly in vivo in E. coli, B. subtilis and S. cerevisiae. Special attention is paid to the assembly of whole genomes, such as those of the first synthetic cell, synthetic yeast and minimal genomes.

Assembling draft genomes using contiBAIT

OpenAIRE

O'Neill, Kieran; Hills, Mark; Gottlieb, Mike; Borkowski, Matthew; Karsan, Aly; Lansdorp, Peter M.

2017-01-01

A Summary: Massively parallel sequencing is now widely used, but data interpretation is only as good as the reference assembly to which it is aligned. While the number of reference assemblies has rapidly expanded, most of these remain at intermediate stages of completion, either as scaffold builds, or as chromosome builds (consisting of correctly ordered, but not necessarily correctly oriented scaffolds separated by gaps). Completion of de novo assemblies remains difficult, as regions that ar...

IDENTIFICATION OF AVIAN-SPECIFIC FECAL METAGENOMIC SEQUENCES USING GENOME FRAGMENT ENRICHMENTS

Science.gov (United States)

Sequence analysis of microbial genomes has provided biologists the opportunity to compare genetic differences between closely related microorganisms. While random sequencing has also been used to study natural microbial communities, metagenomic comparisons via sequencing analysis...

Reliable Detection of Herpes Simplex Virus Sequence Variation by High-Throughput Resequencing.

Science.gov (United States)

Morse, Alison M; Calabro, Kaitlyn R; Fear, Justin M; Bloom, David C; McIntyre, Lauren M

2017-08-16

High-throughput sequencing (HTS) has resulted in data for a number of herpes simplex virus (HSV) laboratory strains and clinical isolates. The knowledge of these sequences has been critical for investigating viral pathogenicity. However, the assembly of complete herpesviral genomes, including HSV, is complicated due to the existence of large repeat regions and arrays of smaller reiterated sequences that are commonly found in these genomes. In addition, the inherent genetic variation in populations of isolates for viruses and other microorganisms presents an additional challenge to many existing HTS sequence assembly pipelines. Here, we evaluate two approaches for the identification of genetic variants in HSV1 strains using Illumina short read sequencing data. The first, a reference-based approach, identifies variants from reads aligned to a reference sequence and the second, a de novo assembly approach, identifies variants from reads aligned to de novo assembled consensus sequences. Of critical importance for both approaches is the reduction in the number of low complexity regions through the construction of a non-redundant reference genome. We compared variants identified in the two methods. Our results indicate that approximately 85% of variants are identified regardless of the approach. The reference-based approach to variant discovery captures an additional 15% representing variants divergent from the HSV1 reference possibly due to viral passage. Reference-based approaches are significantly less labor-intensive and identify variants across the genome where de novo assembly-based approaches are limited to regions where contigs have been successfully assembled. In addition, regions of poor quality assembly can lead to false variant identification in de novo consensus sequences. For viruses with a well-assembled reference genome, a reference-based approach is recommended.

De novo assembly of a haplotype-resolved human genome.

Science.gov (United States)

Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

2015-06-01

The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

The sequence d(CGGCGGCCGC) self-assembles into a two dimensional rhombic DNA lattice

International Nuclear Information System (INIS)

Venkadesh, S.; Mandal, P.K.; Gautham, N.

2011-01-01

Highlights: → This is the first crystal structure of a four-way junction with sticky ends. → Four junction structures bind to each other and form a rhombic cavity. → Each rhombus binds to others to form 'infinite' 2D tiles. → This is an example of bottom-up fabrication of a DNA nano-lattice. -- Abstract: We report here the crystal structure of the partially self-complementary decameric sequence d(CGGCGGCCGC), which self assembles to form a four-way junction with sticky ends. Each junction binds to four others through Watson-Crick base pairing at the sticky ends to form a rhombic structure. The rhombuses bind to each other and form two dimensional tiles. The tiles stack to form the crystal. The crystal diffracted in the space group P1 to a resolution of 2.5 A. The junction has the anti-parallel stacked-X conformation like other junction structures, though the formation of the rhombic net noticeably alters the details of the junction geometry.

BlockLogo: Visualization of peptide and sequence motif conservation

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

2013-01-01

BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

Directory of Open Access Journals (Sweden)

Salem Mohamed

2009-11-01

Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

Science.gov (United States)

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

Easy and accurate reconstruction of whole HIV genomes from short-read sequence data with shiver

Science.gov (United States)

Blanquart, François; Golubchik, Tanya; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Croucher, Nicholas J; Hall, Matthew; Hillebregt, Mariska; Ratmann, Oliver; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle; Grabowski, M Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Cornelissen, Marion; Kellam, Paul; Reiss, Peter

2018-01-01

Abstract Studying the evolution of viruses and their molecular epidemiology relies on accurate viral sequence data, so that small differences between similar viruses can be meaningfully interpreted. Despite its higher throughput and more detailed minority variant data, next-generation sequencing has yet to be widely adopted for HIV. The difficulty of accurately reconstructing the consensus sequence of a quasispecies from reads (short fragments of DNA) in the presence of large between- and within-host diversity, including frequent indels, may have presented a barrier. In particular, mapping (aligning) reads to a reference sequence leads to biased loss of information; this bias can distort epidemiological and evolutionary conclusions. De novo assembly avoids this bias by aligning the reads to themselves, producing a set of sequences called contigs. However contigs provide only a partial summary of the reads, misassembly may result in their having an incorrect structure, and no information is available at parts of the genome where contigs could not be assembled. To address these problems we developed the tool shiver to pre-process reads for quality and contamination, then map them to a reference tailored to the sample using corrected contigs supplemented with the user’s choice of existing reference sequences. Run with two commands per sample, it can easily be used for large heterogeneous data sets. We used shiver to reconstruct the consensus sequence and minority variant information from paired-end short-read whole-genome data produced with the Illumina platform, for sixty-five existing publicly available samples and fifty new samples. We show the systematic superiority of mapping to shiver’s constructed reference compared with mapping the same reads to the closest of 3,249 real references: median values of 13 bases called differently and more accurately, 0 bases called differently and less accurately, and 205 bases of missing sequence recovered. We also

Bromine isotopic signature facilitates de novo sequencing of peptides in free-radical-initiated peptide sequencing (FRIPS) mass spectrometry.

Science.gov (United States)

Nam, Jungjoo; Kwon, Hyuksu; Jang, Inae; Jeon, Aeran; Moon, Jingyu; Lee, Sun Young; Kang, Dukjin; Han, Sang Yun; Moon, Bongjin; Oh, Han Bin

2015-02-01

We recently showed that free-radical-initiated peptide sequencing mass spectrometry (FRIPS MS) assisted by the remarkable thermochemical stability of (2,2,6,6-tetramethyl-piperidin-1-yl)oxyl (TEMPO) is another attractive radical-driven peptide fragmentation MS tool. Facile homolytic cleavage of the bond between the benzylic carbon and the oxygen of the TEMPO moiety in o-TEMPO-Bz-C(O)-peptide and the high reactivity of the benzylic radical species generated in •Bz-C(O)-peptide are key elements leading to extensive radical-driven peptide backbone fragmentation. In the present study, we demonstrate that the incorporation of bromine into the benzene ring, i.e. o-TEMPO-Bz(Br)-C(O)-peptide, allows unambiguous distinction of the N-terminal peptide fragments from the C-terminal fragments through the unique bromine doublet isotopic signature. Furthermore, bromine substitution does not alter the overall radical-driven peptide backbone dissociation pathways of o-TEMPO-Bz-C(O)-peptide. From a practical perspective, the presence of the bromine isotopic signature in the N-terminal peptide fragments in TEMPO-assisted FRIPS MS represents a useful and cost-effective opportunity for de novo peptide sequencing. Copyright © 2015 John Wiley & Sons, Ltd.

OCCURRENCE OF SMALL HOMOLOGOUS AND COMPLEMENTARY FRAGMENTS IN HUMAN VIRUS GENOMES AND THEIR POSSIBLE ROLE

Directory of Open Access Journals (Sweden)

E. P. Kharchenko

2017-01-01

Full Text Available With computer analysis occurrence of small homologous and complementary fragments (21 nucleotides in length has been studied in genomes of 14 human viruses causing most dangerous infections. The sample includes viruses with (+ and (– single stranded RNA and DNA-containing hepatitis A virus. Analysis of occurrence of homologous sequences has shown the existence two extreme situations. On the one hand, the same virus contains homologous sequences to almost all other viruses (for example, Ebola virus, severe acute respiratory syndrome-related coronavirus, and mumps virus, and numerous homologous sequences to the same other virus (especially in severe acute respiratory syndrome-related coronavirus to Dengue virus and in Ebola virus to poliovirus. On the other hand, there are rare occurrence and not numerous homologous sequences in genomes of other viruses (rubella virus, hepatitis A virus, and hepatitis B virus. Similar situation exists for occurrence of complementary sequences. Rubella virus, the genome of which has the high content of guanine and cytosine, has no complementary sequences to almost all other viruses. Most viruses have moderate level of occurrence for homologous and complementary sequences. Autocomplementary sequences are numerous in most viruses and one may suggest that the genome of single stranded RNA viruses has branched secondary structure. In addition to possible role in recombination among strains autocomplementary sequences could be regulators of translation rate of virus proteins and determine its optimal proportion in virion assembly with genome and mRNA folding. Occurrence of small homologous and complementary sequences in RNA- and DNA-containing viruses may be the result of multiple recombinations in the past and the present and determine their adaptation and variability. Recombination may take place in coinfection of human and/or common hosts. Inclusion of homologous and complementary sequences into genome could not

Antral content, secretion and peripheral metabolism of N-terminal progastrin fragments

DEFF Research Database (Denmark)

Goetze, Jens Peter; Hansen, Carsten Palnaes; Rehfeld, Jens F

2006-01-01

OBJECTIVES: In addition to the acid-stimulatory gastrins, progastrin also release N-terminal fragments. In order to examine the cellular content, secretion and peripheral metabolism of these fragments, we developed an immunoassay specific for the N-terminal sequence of human progastrin. RESULTS......-terminal progastrin fragments. The basal concentration of N-terminal fragments in normal human plasma was almost 30-fold higher than that of the amidated, acid-stimulatory gastrins (286 pmol/l versus 9.8 pmol/l, n=26, P...-35 in circulation was 30 min, and a pig model revealed the kidneys and the vasculature to the head as the primary sites of degradation. CONCLUSION: The cellular and circulatory concentration profiles of N-terminal progastrin fragments differ markedly from those of the acid-stimulatory gastrins. The high basal...

Harnessing Whole Genome Sequencing in Medical Mycology.

Science.gov (United States)

Cuomo, Christina A

2017-01-01

Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.

Structural fragment clustering reveals novel structural and functional motifs in α-helical transmembrane proteins

Directory of Open Access Journals (Sweden)

Vassilev Boris

2010-04-01

Full Text Available Abstract Background A large proportion of an organism's genome encodes for membrane proteins. Membrane proteins are important for many cellular processes, and several diseases can be linked to mutations in them. With the tremendous growth of sequence data, there is an increasing need to reliably identify membrane proteins from sequence, to functionally annotate them, and to correctly predict their topology. Results We introduce a technique called structural fragment clustering, which learns sequential motifs from 3D structural fragments. From over 500,000 fragments, we obtain 213 statistically significant, non-redundant, and novel motifs that are highly specific to α-helical transmembrane proteins. From these 213 motifs, 58 of them were assigned to function and checked in the scientific literature for a biological assessment. Seventy percent of the motifs are found in co-factor, ligand, and ion binding sites, 30% at protein interaction interfaces, and 12% bind specific lipids such as glycerol or cardiolipins. The vast majority of motifs (94% appear across evolutionarily unrelated families, highlighting the modularity of functional design in membrane proteins. We describe three novel motifs in detail: (1 a dimer interface motif found in voltage-gated chloride channels, (2 a proton transfer motif found in heme-copper oxidases, and (3 a convergently evolved interface helix motif found in an aspartate symporter, a serine protease, and cytochrome b. Conclusions Our findings suggest that functional modules exist in membrane proteins, and that they occur in completely different evolutionary contexts and cover different binding sites. Structural fragment clustering allows us to link sequence motifs to function through clusters of structural fragments. The sequence motifs can be applied to identify and characterize membrane proteins in novel genomes.

MOJIBAKE – The Rehearsal of Word Fragments In Verbal Recall

Directory of Open Access Journals (Sweden)

Dr. Christiane eLange-Küttner

2015-04-01

Full Text Available Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the ‘grain size’ of word units (Ziegler & Goswami, 2005. In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF English words versus geographical UK town names to control for content. We also tested unfamiliar international (INT non-words and names of international (INT European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words.

Mojibake – The rehearsal of word fragments in verbal recall

Science.gov (United States)

Lange-Küttner, Christiane; Sykorova, Eva

2015-01-01

Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the ‘grain size’ of word units (Ziegler and Goswami, 2005). In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF) English words versus geographical (UK) town names to control for content. We also tested unfamiliar international (INT) non-words and names of international (INT) European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words. PMID:25941500

Automated ensemble assembly and validation of microbial genomes

Science.gov (United States)

2014-01-01

Background The continued democratization of DNA sequencing has sparked a new wave of development of genome assembly and assembly validation methods. As individual research labs, rather than centralized centers, begin to sequence the majority of new genomes, it is important to establish best practices for genome assembly. However, recent evaluations such as GAGE and the Assemblathon have concluded that there is no single best approach to genome assembly. Instead, it is preferable to generate multiple assemblies and validate them to determine which is most useful for the desired analysis; this is a labor-intensive process that is often impossible or unfeasible. Results To encourage best practices supported by the community, we present iMetAMOS, an automated ensemble assembly pipeline; iMetAMOS encapsulates the process of running, validating, and selecting a single assembly from multiple assemblies. iMetAMOS packages several leading open-source tools into a single binary that automates parameter selection and execution of multiple assemblers, scores the resulting assemblies based on multiple validation metrics, and annotates the assemblies for genes and contaminants. We demonstrate the utility of the ensemble process on 225 previously unassembled Mycobacterium tuberculosis genomes as well as a Rhodobacter sphaeroides benchmark dataset. On these real data, iMetAMOS reliably produces validated assemblies and identifies potential contamination without user intervention. In addition, intelligent parameter selection produces assemblies of R. sphaeroides comparable to or exceeding the quality of those from the GAGE-B evaluation, affecting the relative ranking of some assemblers. Conclusions Ensemble assembly with iMetAMOS provides users with multiple, validated assemblies for each genome. Although computationally limited to small or mid-sized genomes, this approach is the most effective and reproducible means for generating high-quality assemblies and enables users to

A genome sequence resource for the aye-aye (Daubentonia madagascariensis), a nocturnal lemur from Madagascar.

Science.gov (United States)

Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.

PAVE: Program for assembling and viewing ESTs

Directory of Open Access Journals (Sweden)

Bomhoff Matthew

2009-08-01

Full Text Available Abstract Background New sequencing technologies are rapidly emerging. Many laboratories are simultaneously working with the traditional Sanger ESTs and experimenting with ESTs generated by the 454 Life Science sequencers. Though Sanger ESTs have been used to generate contigs for many years, no program takes full advantage of the 5' and 3' mate-pair information, hence, many tentative transcripts are assembled into two separate contigs. The new 454 technology has the benefit of high-throughput expression profiling, but introduces time and space problems for assembling large contigs. Results The PAVE (Program for Assembling and Viewing ESTs assembler takes advantage of the 5' and 3' mate-pair information by requiring that the mate-pairs be assembled into the same contig and joined by n's if the two sub-contigs do not overlap. It handles the depth of 454 data sets by "burying" similar ESTs during assembly, which retains the expression level information while circumventing time and space problems. PAVE uses MegaBLAST for the clustering step and CAP3 for assembly, however it assembles incrementally to enforce the mate-pair constraint, bury ESTs, and reduce incorrect joins and splits. The PAVE data management system uses a MySQL database to store multiple libraries of ESTs along with their metadata; the management system allows multiple assemblies with variations on libraries and parameters. Analysis routines provide standard annotation for the contigs including a measure of differentially expressed genes across the libraries. A Java viewer program is provided for display and analysis of the results. Our results clearly show the benefit of using the PAVE assembler to explicitly use mate-pair information and bury ESTs for large contigs. Conclusion The PAVE assembler provides a software package for assembling Sanger and/or 454 ESTs. The assembly software, data management software, Java viewer and user's guide are freely available.

PAVE: program for assembling and viewing ESTs.

Science.gov (United States)

Soderlund, Carol; Johnson, Eric; Bomhoff, Matthew; Descour, Anne

2009-08-26

New sequencing technologies are rapidly emerging. Many laboratories are simultaneously working with the traditional Sanger ESTs and experimenting with ESTs generated by the 454 Life Science sequencers. Though Sanger ESTs have been used to generate contigs for many years, no program takes full advantage of the 5' and 3' mate-pair information, hence, many tentative transcripts are assembled into two separate contigs. The new 454 technology has the benefit of high-throughput expression profiling, but introduces time and space problems for assembling large contigs. The PAVE (Program for Assembling and Viewing ESTs) assembler takes advantage of the 5' and 3' mate-pair information by requiring that the mate-pairs be assembled into the same contig and joined by n's if the two sub-contigs do not overlap. It handles the depth of 454 data sets by "burying" similar ESTs during assembly, which retains the expression level information while circumventing time and space problems. PAVE uses MegaBLAST for the clustering step and CAP3 for assembly, however it assembles incrementally to enforce the mate-pair constraint, bury ESTs, and reduce incorrect joins and splits. The PAVE data management system uses a MySQL database to store multiple libraries of ESTs along with their metadata; the management system allows multiple assemblies with variations on libraries and parameters. Analysis routines provide standard annotation for the contigs including a measure of differentially expressed genes across the libraries. A Java viewer program is provided for display and analysis of the results. Our results clearly show the benefit of using the PAVE assembler to explicitly use mate-pair information and bury ESTs for large contigs. The PAVE assembler provides a software package for assembling Sanger and/or 454 ESTs. The assembly software, data management software, Java viewer and user's guide are freely available.

Structure of non-(1-84) PTH fragments secreted by parathyroid glands in primary and secondary hyperparathyroidism.

Science.gov (United States)

D'Amour, Pierre; Brossard, Jean-Hugues; Rousseau, Louise; Nguyen-Yamamoto, Loan; Nassif, Edgard; Lazure, Claude; Gauthier, Dany; Lavigne, Jeffrey R; Zahradnik, Richard J

2005-09-01

Non-(1-84) parathyroid hormone (PTH) fragments are large circulating carboxyl-terminal (C) fragments with a partially preserved amino-terminal (N) structure. hPTH (7-84), a synthetic surrogate, has been demonstrated to exert biologic effects in vivo and in vitro which are opposite to those of hPTH (1-34) on the PTH/PTHrP type I receptor through a C-PTH receptor. We wanted to determine the N structure of non-(1-84) PTH fragments. Parathyroid cells isolated from glands obtained at surgery from three patients with primary hyperparathyroidism and three patients with secondary hyperparathyroidism were incubated with 35S-methionine to internally label their secretion products. Incubations were performed for 8 hours at the patient-ionized calcium concentration and in the presence of various protease inhibitors. The supernatant was fractionated by high-performance liquid chromatography (HPLC) and fractions were analyzed with PTH assays having (1 to 4) and (12 to 23) epitopes, respectively. The serum of each patient was similarly analyzed. Peaks of immunoreactivity identified were submitted to sequence analysis to recover the 35S-methionine residues in positions 8 and 18. Three regions of interest were identified with PTH assays. They corresponded to non-(1-84) PTH fragments (further divided in regions 3 and 4), a peak of N-PTH migrating in front of hPTH (1-84) (region 2) and a peak of immunoreactivity corresponding to the elution position of hPTH (1-84) (region 1). The last corresponded to a single sequence starting at position 1. Region 2 gave similar results in all cases (a major signal starting at position 1) but also sometimes minor sequences starting at position 4 or 7. Regions 3 and 4 always identified a major sequence starting at positions 7 and minor sequences starting at positions 8, 10, and 15. Surprisingly, a major signal starting at position 1 was also present in region 3. The HPLC profile obtained from a given patient's parathyroid cells was qualitatively

Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

Science.gov (United States)

Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

2010-07-22

Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

Science.gov (United States)

Haggarty, N W; Dunbar, B; Fothergill, L A

1983-01-01

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356

Fragmentation in rotating isothermal protostellar clouds

International Nuclear Information System (INIS)

Bodenheimer, P.; Black, D.C.

1980-01-01

In this paper we report briefly the results of an extensive set of 3-D hydrodynamic calculations that have been performed during the past two and one-half years to investigate the susceptibility of rotating clouds to gravitational fragmentation. Because of the immensity of parameter space and the expense of computations, we have chosen to restrict this investigation to strictly isothermal collapse sequences. (orig./WL)

Transcriptome sequencing of different narrow-leafed lupin tissue types provides a comprehensive uni-gene assembly and extensive gene-based molecular markers

Science.gov (United States)

Kamphuis, Lars G; Hane, James K; Nelson, Matthew N; Gao, Lingling; Atkins, Craig A; Singh, Karam B

2015-01-01

Narrow-leafed lupin (NLL; Lupinus angustifolius L.) is an important grain legume crop that is valuable for sustainable farming and is becoming recognized as a human health food. NLL breeding is directed at improving grain production, disease resistance, drought tolerance and health benefits. However, genetic and genomic studies have been hindered by a lack of extensive genomic resources for the species. Here, the generation, de novo assembly and annotation of transcriptome datasets derived from five different NLL tissue types of the reference accession cv. Tanjil are described. The Tanjil transcriptome was compared to transcriptomes of an early domesticated cv. Unicrop, a wild accession P27255, as well as accession 83A:476, together being the founding parents of two recombinant inbred line (RIL) populations. In silico predictions for transcriptome-derived gene-based length and SNP polymorphic markers were conducted and corroborated using a survey assembly sequence for NLL cv. Tanjil. This yielded extensive indel and SNP polymorphic markers for the two RIL populations. A total of 335 transcriptome-derived markers and 66 BAC-end sequence-derived markers were evaluated, and 275 polymorphic markers were selected to genotype the reference NLL 83A:476 × P27255 RIL population. This significantly improved the completeness, marker density and quality of the reference NLL genetic map. PMID:25060816

Comparative Genomics in Switchgrass Using 61,585 High-Quality Expressed Sequence Tags

Directory of Open Access Journals (Sweden)

Christian M. Tobias

2008-11-01

Full Text Available The development of genomic resources for switchgrass ( L., a perennial NAD-malic enzyme type C grass, is required to enable molecular breeding and biotechnological approaches for improving its value as a forage and bioenergy crop. Expressed sequence tag (EST sequencing is one method that can quickly sample gene inventories and produce data suitable for marker development or analysis of tissue-specific patterns of expression. Toward this goal, three cDNA libraries from callus, crown, and seedling tissues of ‘Kanlow’ switchgrass were end-sequenced to generate a total of 61,585 high-quality ESTs from 36,565 separate clones. Seventy-three percent of the assembled consensus sequences could be aligned with the sorghum [ (L. Moench] genome at a -value of <1 × 10, indicating a high degree of similarity. Sixty-five percent of the ESTs matched with gene ontology molecular terms, and 3.3% of the sequences were matched with genes that play potential roles in cell-wall biogenesis. The representation in the three libraries of gene families known to be associated with C photosynthesis, cellulose and β-glucan synthesis, phenylpropanoid biosynthesis, and peroxidase activity indicated likely roles for individual family members. Pairwise comparisons of synonymous codon substitutions were used to assess genome sequence diversity and indicated an overall similarity between the two genome copies present in the tetraploid. Identification of EST–simple sequence repeat markers and amplification on two individual parents of a mapping population yielded an average of 2.18 amplicons per individual, and 35% of the markers produced fragment length polymorphisms.

Sequence-Dependent Self-Assembly and Structural Diversity of Islet Amyloid Polypeptide-Derived β-Sheet Fibrils

International Nuclear Information System (INIS)

Wang, Shih-Ting; Lin, Yiyang; Spencer, Ryan K.; Thomas, Michael R.; Nguyen, Andy I.

2017-01-01

Determining the structural origins of amyloid fibrillation is essential for understanding both the pathology of amyloidosis and the rational design of inhibitors to prevent or reverse amyloid formation. In this work, the decisive roles of peptide structures on amyloid self-assembly and morphological diversity were investigated by the design of eight amyloidogenic peptides derived from islet amyloid polypeptide. Among the segments, two distinct morphologies were highlighted in the form of twisted and planar (untwisted) ribbons with varied diameters, thicknesses, and lengths. In particular, transformation of amyloid fibrils from twisted ribbons into untwisted structures was triggered by substitution of the C-terminal serine with threonine, where the side chain methyl group was responsible for the distinct morphological change. This effect was confirmed following serine substitution with alanine and valine and was ascribed to the restriction of intersheet torsional strain through the increased hydrophobic interactions and hydrogen bonding. We also studied the variation of fibril morphology (i.e., association and helicity) and peptide aggregation propensity by increasing the hydrophobicity of the peptide side group, capping the N-terminus, and extending sequence length. Lastly, we anticipate that our insights into sequence-dependent fibrillation and morphological diversity will shed light on the structural interpretation of amyloidogenesis and development of structure-specific imaging agents and aggregation inhibitors.

Assembly and comparative analysis of complete mitochondrial genome sequence of an economic plant Salix suchowensis

Directory of Open Access Journals (Sweden)

Ning Ye

2017-03-01

Full Text Available Willow is a widely used dioecious woody plant of Salicaceae family in China. Due to their high biomass yields, willows are promising sources for bioenergy crops. In this study, we assembled the complete mitochondrial (mt genome sequence of S. suchowensis with the length of 644,437 bp using Roche-454 GS FLX Titanium sequencing technologies. Base composition of the S. suchowensis mt genome is A (27.43%, T (27.59%, C (22.34%, and G (22.64%, which shows a prevalent GC content with that of other angiosperms. This long circular mt genome encodes 58 unique genes (32 protein-coding genes, 23 tRNA genes and 3 rRNA genes, and 9 of the 32 protein-coding genes contain 17 introns. Through the phylogenetic analysis of 35 species based on 23 protein-coding genes, it is supported that Salix as a sister to Populus. With the detailed phylogenetic information and the identification of phylogenetic position, some ribosomal protein genes and succinate dehydrogenase genes are found usually lost during evolution. As a native shrub willow species, this worthwhile research of S. suchowensis mt genome will provide more desirable information for better understanding the genomic breeding and missing pieces of sex determination evolution in the future.

Rock fragmentation control in opencast blasting

Directory of Open Access Journals (Sweden)

P.K. Singh

2016-04-01

Full Text Available The blasting operation plays a pivotal role in the overall economics of opencast mines. The blasting sub-system affects all the other associated sub-systems, i.e. loading, transport, crushing and milling operations. Fragmentation control through effective blast design and its effect on productivity are the challenging tasks for practicing blasting engineer due to inadequate knowledge of actual explosive energy released in the borehole, varying initiation practice in blast design and its effect on explosive energy release characteristic. This paper describes the result of a systematic study on the impact of blast design parameters on rock fragmentation at three mines in India. The mines use draglines and shovel–dumper combination for removal of overburden. Despite its pivotal role in controlling the overall economics of a mining operation, the expected blasting performance is often judged almost exclusively on the basis of poorly defined parameters such as powder factor and is often qualitative which results in very subjective assessment of blasting performance. Such an approach is very poor substitutes for accurate assessment of explosive and blasting performance. Ninety one blasts were conducted with varying blast designs and charging patterns, and their impacts on the rock fragmentation were documented. A high-speed camera was deployed to record the detonation sequences of the blasts. The efficiency of the loading machines was also correlated with the mean fragment size obtained from the fragmentation analyses.

Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

Science.gov (United States)

Wehrmann, A; Eggeling, L; Sahm, H

1994-12-01

In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

Illustrating how mechanical assemblies work

KAUST Repository

Mitra, Niloy J.; Yang, Yongliang; Yan, Dongming; Li, Wilmot; Agrawala, Maneesh

2010-01-01

How things work visualizations use a variety of visual techniques to depict the operation of complex mechanical assemblies. We present an automated approach for generating such visualizations. Starting with a 3D CAD model of an assembly, we first infer the motions of individual parts and the interactions between parts based on their geometry and a few user specified constraints. We then use this information to generate visualizations that incorporate motion arrows, frame sequences and animation to convey the causal chain of motions and mechanical interactions between parts. We present results for a wide variety of assemblies. © 2010 ACM.

Illustrating how mechanical assemblies work

KAUST Repository

Mitra, Niloy J.

2010-07-26

How things work visualizations use a variety of visual techniques to depict the operation of complex mechanical assemblies. We present an automated approach for generating such visualizations. Starting with a 3D CAD model of an assembly, we first infer the motions of individual parts and the interactions between parts based on their geometry and a few user specified constraints. We then use this information to generate visualizations that incorporate motion arrows, frame sequences and animation to convey the causal chain of motions and mechanical interactions between parts. We present results for a wide variety of assemblies. © 2010 ACM.

Reference genome sequence of the model plant Setaria.

Science.gov (United States)

Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M

2012-05-13

We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

Reference genome sequence of the model plant Setaria

Energy Technology Data Exchange (ETDEWEB)

Bennetzen, Jeffrey L [ORNL; Schmutz, Jeremy [Hudson Alpha Institute of Biotechnology; Wang, Hao [University of Georgia, Athens, GA; Percifield, Ryan [University of Georgia, Athens, GA; Hawkins, Jennifer [University of Georgia, Athens, GA; Pontaroli, Ana C. [University of Georgia, Athens, GA; Estep, Matt [University of Georgia, Athens, GA; Feng, Liang [University of Georgia, Athens, GA; Vaughn, Justin N [ORNL; Grimwood, Jane [Hudson Alpha Institute of Biotechnology; Jenkins, Jerry [Hudson Alpha Institute of Biotechnology; Barry, Kerrie [U.S. Department of Energy, Joint Genome Institute; Lindquist, Erika [U.S. Department of Energy, Joint Genome Institute; Hellsten, Uffe [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Wang, Xuewen [University of Georgia, Athens, GA; Wu, Xiaomei [University of Georgia, Athens, GA; Mitros, Therese [University of California, Berkeley; Triplett, Jimmy [University of Missouri, St. Louis; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Mauro-Herrera, Margarita [Oklahoma State University; Wang, Lin [Cornell University; Li, Pinghua [Cornell University; Sharma, Manoj [University of California, Davis; Sharma, Rita [University of California, Davis; Ronald, Pamela [University of California, Davis; Panaud, Olivier [Universite de Perpignan, Perpignan, France; Kellogg, Elizabeth A. [University of Missouri, St. Louis; Brutnell, Thomas P. [Cornell University; Doust, Andrew N. [Oklahoma State University; Tuskan, Gerald A [ORNL; Rokhsar, Daniel [U.S. Department of Energy, Joint Genome Institute; Devos, Katrien M [ORNL

2012-01-01

We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

Reference genome sequence of the model plant Setaria

Energy Technology Data Exchange (ETDEWEB)

Bennetzen, Jeffrey L [ORNL; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tuskan, Gerald A [ORNL

2012-01-01

We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

Sequence analysis of cereal sucrose synthase genes and isolation ...

African Journals Online (AJOL)

SERVER

2007-10-18

Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Elevation or Suppression? The Resolved Star Formation Main Sequence of Galaxies with Two Different Assembly Modes

Science.gov (United States)

Liu, Qing; Wang, Enci; Lin, Zesen; Gao, Yulong; Liu, Haiyang; Berhane Teklu, Berzaf; Kong, Xu

2018-04-01

We investigate the spatially resolved star formation main sequence in star-forming galaxies using Integral Field Spectroscopic observations from the Mapping Nearby Galaxies at the Apache Point Observatory survey. We demonstrate that the correlation between the stellar mass surface density (Σ*) and star formation rate surface density (ΣSFR) holds down to the sub-galactic scale, leading to the sub-galactic main sequence (SGMS). By dividing galaxies into two populations based on their recent mass assembly modes, we find the resolved main sequence in galaxies with the “outside-in” mode is steeper than that in galaxies with the “inside-out” mode. This is also confirmed on a galaxy-by-galaxy level, where we find the distributions of SGMS slopes for individual galaxies are clearly separated for the two populations. When normalizing and stacking the SGMS of individual galaxies on one panel for the two populations, we find that the inner regions of galaxies with the “inside-out” mode statistically exhibit a suppression in star formation, with a less significant trend in the outer regions of galaxies with the “outside-in” mode. In contrast, the inner regions of galaxies with “outside-in” mode and the outer regions of galaxies with “inside-out” mode follow a slightly sublinear scaling relation with a slope ∼0.9, which is in good agreement with previous findings, suggesting that they are experiencing a universal regulation without influences of additional physical processes.

Prediction of phenotypes of missense mutations in human proteins from biological assemblies.

Science.gov (United States)

Wei, Qiong; Xu, Qifang; Dunbrack, Roland L

2013-02-01

Single nucleotide polymorphisms (SNPs) are the most frequent variation in the human genome. Nonsynonymous SNPs that lead to missense mutations can be neutral or deleterious, and several computational methods have been presented that predict the phenotype of human missense mutations. These methods use sequence-based and structure-based features in various combinations, relying on different statistical distributions of these features for deleterious and neutral mutations. One structure-based feature that has not been studied significantly is the accessible surface area within biologically relevant oligomeric assemblies. These assemblies are different from the crystallographic asymmetric unit for more than half of X-ray crystal structures. We find that mutations in the core of proteins or in the interfaces in biological assemblies are significantly more likely to be disease-associated than those on the surface of the biological assemblies. For structures with more than one protein in the biological assembly (whether the same sequence or different), we find the accessible surface area from biological assemblies provides a statistically significant improvement in prediction over the accessible surface area of monomers from protein crystal structures (P = 6e-5). When adding this information to sequence-based features such as the difference between wildtype and mutant position-specific profile scores, the improvement from biological assemblies is statistically significant but much smaller (P = 0.018). Combining this information with sequence-based features in a support vector machine leads to 82% accuracy on a balanced dataset of 50% disease-associated mutations from SwissVar and 50% neutral mutations from human/primate sequence differences in orthologous proteins. Copyright © 2012 Wiley Periodicals, Inc.

Fragger: a protein fragment picker for structural queries [version 2; referees: 2 approved