WorldWideScience

Sample records for forms homodimers characterisation

  1. Nicotinamidase/pyrazinamidase of Mycobacterium tuberculosis forms homo-dimers stabilized by disulfide bonds.

    Science.gov (United States)

    Rueda, Daniel; Sheen, Patricia; Gilman, Robert H; Bueno, Carlos; Santos, Marco; Pando-Robles, Victoria; Batista, Cesar V; Zimic, Mirko

    2014-12-01

    Recombinant wild-pyrazinamidase from H37Rv Mycobacterium tuberculosis was analyzed by gel electrophoresis under differential reducing conditions to evaluate its quaternary structure. PZAse was fractionated by size exclusion chromatography under non-reducing conditions. PZAse activity was measured and mass spectrometry analysis was performed to determine the identity of proteins by de novo sequencing and to determine the presence of disulfide bonds. This study confirmed that M. tuberculosis wild type PZAse was able to form homo-dimers in vitro. Homo-dimers showed a slightly lower specific PZAse activity compared to monomeric PZAse. PZAse dimers were dissociated into monomers in response to reducing conditions. Mass spectrometry analysis confirmed the existence of disulfide bonds (C72-C138 and C138-C138) stabilizing the quaternary structure of the PZAse homo-dimer. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. ThWRKY4 from Tamarix hispida Can Form Homodimers and Heterodimers and Is Involved in Abiotic Stress Responses

    Directory of Open Access Journals (Sweden)

    Liuqiang Wang

    2015-11-01

    Full Text Available WRKY proteins are a large family of transcription factors that are involved in diverse developmental processes and abiotic stress responses in plants. However, our knowledge of the regulatory mechanisms of WRKYs participation in protein–protein interactions is still fragmentary, and such protein–protein interactions are fundamental in understanding biological networks and the functions of proteins. In this study, we report that a WRKY protein from Tamarix hispida, ThWRKY4, can form both homodimers and heterodimers with ThWRKY2 and ThWRKY3. In addition, ThWRKY2 and ThWRKY3 can both bind to W-box motif with binding affinities similar to that of ThWRKY4. Further, the expression patterns of ThWRKY2 and ThWRKY3 are similar to that of ThWRKY4 when plants are exposed to abscisic acid (ABA. Subcellular localization shows that these three ThWRKY proteins are nuclear proteins. Taken together, these results demonstrate that ThWRKY4 is a dimeric protein that can form functional homodimers or heterodimers that are involved in abiotic stress responses.

  3. ThWRKY4 from Tamarix hispida Can Form Homodimers and Heterodimers and Is Involved in Abiotic Stress Responses.

    Science.gov (United States)

    Wang, Liuqiang; Zheng, Lei; Zhang, Chunrui; Wang, Yucheng; Lu, Mengzhu; Gao, Caiqiu

    2015-11-13

    WRKY proteins are a large family of transcription factors that are involved in diverse developmental processes and abiotic stress responses in plants. However, our knowledge of the regulatory mechanisms of WRKYs participation in protein-protein interactions is still fragmentary, and such protein-protein interactions are fundamental in understanding biological networks and the functions of proteins. In this study, we report that a WRKY protein from Tamarix hispida, ThWRKY4, can form both homodimers and heterodimers with ThWRKY2 and ThWRKY3. In addition, ThWRKY2 and ThWRKY3 can both bind to W-box motif with binding affinities similar to that of ThWRKY4. Further, the expression patterns of ThWRKY2 and ThWRKY3 are similar to that of ThWRKY4 when plants are exposed to abscisic acid (ABA). Subcellular localization shows that these three ThWRKY proteins are nuclear proteins. Taken together, these results demonstrate that ThWRKY4 is a dimeric protein that can form functional homodimers or heterodimers that are involved in abiotic stress responses.

  4. Construction of a hybrid β-hexosaminidase subunit capable of forming stable homodimers that hydrolyze GM2 ganglioside in vivo

    Directory of Open Access Journals (Sweden)

    Michael B Tropak

    2016-01-01

    Full Text Available Tay-Sachs or Sandhoff disease result from mutations in either the evolutionarily related HEXA or HEXB genes encoding respectively, the α- or β-subunits of β-hexosaminidase A (HexA. Of the three Hex isozymes, only HexA can interact with its cofactor, the GM2 activator protein (GM2AP, and hydrolyze GM2 ganglioside. A major impediment to establishing gene or enzyme replacement therapy based on HexA is the need to synthesize both subunits. Thus, we combined the critical features of both α- and β-subunits into a single hybrid µ-subunit that contains the α-subunit active site, the stable β-subunit interface and unique areas in each subunit needed to interact with GM2AP. To facilitate intracellular analysis and the purification of the µ-homodimer (HexM, CRISPR-based genome editing was used to disrupt the HEXA and HEXB genes in a Human Embryonic Kidney 293 cell line stably expressing the µ-subunit. In association with GM2AP, HexM was shown to hydrolyze a fluorescent GM2 ganglioside derivative both in cellulo and in vitro. Gene transfer studies in both Tay-Sachs and Sandhoff mouse models demonstrated that HexM expression reduced brain GM2 ganglioside levels.

  5. Construction of a hybrid β-hexosaminidase subunit capable of forming stable homodimers that hydrolyze GM2 ganglioside in vivo

    Science.gov (United States)

    Tropak, Michael B; Yonekawa, Sayuri; Karumuthil-Melethil, Subha; Thompson, Patrick; Wakarchuk, Warren; Gray, Steven J; Walia, Jagdeep S; Mark, Brian L; Mahuran, Don

    2016-01-01

    Tay-Sachs or Sandhoff disease result from mutations in either the evolutionarily related HEXA or HEXB genes encoding respectively, the α- or β-subunits of β-hexosaminidase A (HexA). Of the three Hex isozymes, only HexA can interact with its cofactor, the GM2 activator protein (GM2AP), and hydrolyze GM2 ganglioside. A major impediment to establishing gene or enzyme replacement therapy based on HexA is the need to synthesize both subunits. Thus, we combined the critical features of both α- and β-subunits into a single hybrid µ-subunit that contains the α-subunit active site, the stable β-subunit interface and unique areas in each subunit needed to interact with GM2AP. To facilitate intracellular analysis and the purification of the µ-homodimer (HexM), CRISPR-based genome editing was used to disrupt the HEXA and HEXB genes in a Human Embryonic Kidney 293 cell line stably expressing the µ-subunit. In association with GM2AP, HexM was shown to hydrolyze a fluorescent GM2 ganglioside derivative both in cellulo and in vitro. Gene transfer studies in both Tay-Sachs and Sandhoff mouse models demonstrated that HexM expression reduced brain GM2 ganglioside levels. PMID:26966698

  6. Characterisation of a low pathogenic form of Gyrodactylus salaris from rainbow trout

    DEFF Research Database (Denmark)

    Jørgensen, Thomas Rohde; Larsen, Thomas Bjerre; Jørgensen, Louise von Gersdorff

    2007-01-01

    A Danish form of Gyrodactylus salaris has been isolated and characterised. It is not pathogenic to Atlantic salmon.......A Danish form of Gyrodactylus salaris has been isolated and characterised. It is not pathogenic to Atlantic salmon....

  7. Characterisation

    Science.gov (United States)

    2007-03-01

    Characterisation. In Nanotechnology Aerospace Applications – 2006 (pp. 4-1 – 4-8). Educational Notes RTO-EN-AVT-129bis, Paper 4. Neuilly-sur-Seine, France: RTO...the Commercialisation Processes Concept IDEA Proof-of- Principle Trial Samples Engineering Verification Samples Design Verification Samples...SEIC Systems Engineering for commercialisation Design Houses, Engineering & R&D USERS & Integrators SE S U R Integrators Fabs & Wafer Processing Die

  8. Ophthalmic Drug Dosage Forms: Characterisation and Research Methods

    OpenAIRE

    Baranowski, Przemysław; Karolewicz, Bożena; Gajda, Maciej; Pluta, Janusz

    2014-01-01

    This paper describes hitherto developed drug forms for topical ocular administration, that is, eye drops, ointments, in situ gels, inserts, multicompartment drug delivery systems, and ophthalmic drug forms with bioadhesive properties. Heretofore, many studies have demonstrated that new and more complex ophthalmic drug forms exhibit advantage over traditional ones and are able to increase the bioavailability of the active substance by, among others, reducing the susceptibility of drug forms to...

  9. Ophthalmic Drug Dosage Forms: Characterisation and Research Methods

    Directory of Open Access Journals (Sweden)

    Przemysław Baranowski

    2014-01-01

    Full Text Available This paper describes hitherto developed drug forms for topical ocular administration, that is, eye drops, ointments, in situ gels, inserts, multicompartment drug delivery systems, and ophthalmic drug forms with bioadhesive properties. Heretofore, many studies have demonstrated that new and more complex ophthalmic drug forms exhibit advantage over traditional ones and are able to increase the bioavailability of the active substance by, among others, reducing the susceptibility of drug forms to defense mechanisms of the human eye, extending contact time of drug with the cornea, increasing the penetration through the complex anatomical structure of the eye, and providing controlled release of drugs into the eye tissues, which allows reducing the drug application frequency. The rest of the paper describes recommended in vitro and in vivo studies to be performed for various ophthalmic drugs forms in order to assess whether the form is acceptable from the perspective of desired properties and patient’s compliance.

  10. Observation of an E2 (Ubc9-homodimer by crystallography

    Directory of Open Access Journals (Sweden)

    Aileen Y. Alontaga

    2016-06-01

    Full Text Available Post-translational modifications by the small ubiquitin-like modifiers (SUMO, in particular the formation of poly-SUMO-2 and -3 chains, regulates essential cellular functions and its aberration leads to life-threatening diseases (Geoffroy and Hay, 2009 [1]. It was shown previously that the non-covalent interaction between SUMO and the conjugating enzyme (E2 for SUMO, known as Ubc9, is required for poly-SUMO-2/3 chain formation (Knipscheer et al., 2007 [2]. However, the structure of SUMO-Ubc9 non-covalent complex, by itself, could not explain how the poly-SUMO-2/3 chain forms and consequently a Ubc9 homodimer, although never been observed, was proposed for poly-SUMO-2/3 chain formation (Knipscheer et al., 2007 [2]. Here, we solved the crystal structure of a heterotrimer containing a homodimer of Ubc9 and the RWD domain from RWDD3. The asymmetric Ubc9 homodimer is mediated by the N-terminal region of one Ubc9 molecule and a surface near the catalytic Cys of the second Ubc9 molecule (Fig. 1A. This N-terminal surface of Ubc9 that is involved in the homodimer formation also interacts with the RWD domain, the ubiquitin-fold domain of the SUMO activating enzyme (E1, SUMO, and the E3 ligase, RanBP2 (Knipscheer et al., 2007; Tong et al.. 1997; Tatham et al., 2005; Reverter and Lima, 2005; Capili and Lima, 2007; Wang et al., 2009, 2010; Wang and Chen, 2010; Alontaga et al., 2015 [2–10]. The existence of the Ubc9 homodimer in solution is supported by previously published solution NMR studies of rotational correlation time and chemical shift perturbation (Alontaga et al., 2015; Yuan et al., 1999 [10,11]. Site-directed mutagenesis and biochemical analysis suggests that this dimeric arrangement of Ubc9 is likely important for poly-SUMO chain formation (Fig. 1B and C. The asymmetric Ubc9 homodimer described for the first time in this work could provide the critical missing link in the poly-SUMO chain formation mechanism. The data presented here are related

  11. Fast-Scan DSC and its role in pharmaceutical physical form characterisation and selection.

    Science.gov (United States)

    Ford, James L; Mann, Timothy E

    2012-04-01

    Conventional rate Differential Scanning Calorimetry (DSC) has been used for many years as a tool in the analysis of pharmaceutical materials. In recent years an extension of the technique to include fast heating and cooling rates has become more prevalent. Broadly termed Fast-Scan DSC, this review examines the current applications of this technique to the characterisation and selection of pharmaceutical materials. Its increasing use encompasses the characterisation of amorphousness in crystalline materials, the characterisation of polymorphs and polymorphic transitions, the solubility of drugs in polymers, and characterisation of dosage forms. Notwithstanding the advantages of analytical speed in analytical turnover, the review emphasises the advantages of Fast-Scan DSC in its sensitivity which allows the separation of overlapping thermal events, the reduction it provides in degradation during the scanning process and its role in determining solubility in waxy and polymeric based systems. A comparison of the uses of Fast-Scan DSC to modulated DSC techniques and localised thermal analysis is also given. © 2011 Elsevier B.V. All rights reserved.

  12. Nanostructure characterisation of flow-formed Cr–Mo–V steel using transmission Kikuchi diffraction technique

    International Nuclear Information System (INIS)

    Birosca, S.; Ding, R.; Ooi, S.; Buckingham, R.; Coleman, C.; Dicks, K.

    2015-01-01

    Nowadays flow-forming has become a desired near net shape manufacturing method as it provides excellent mechanical properties with improved surface finish and significant manufacturing cost reduction. However, the material is subjected to excessive plastic deformation during flow-forming process, generating a very fine and complex microstructure. In addition, the intense dislocation density and residual stress that is generated in the component during processing makes the microstructure characterisation using conventional micro-analytical tools challenging. Thus, the microstructure/property relationship study in such a material is rather difficult. In the present study a flow-formed Cr–Mo–V steel nanostructure and crystallographic texture were characterised by means of Transmission Kikuchi Diffraction (TKD). Here, TKD is shown to be a powerful technique in revealing very fine martensite laths within an austenite matrix. Moreover, fine precipitates in the order of 20–70 nm on the martensite lath boundaries were clearly imaged and characterised. This greatly assisted in understanding the preferable site formation of the carbides in such a complex microstructure. The results showed that the actual TKD spatial resolution was in the range of 5–10 nm using 25 kV for flow-formed Cr–Mo–V steel. - Highlights: • Optimum Transmission Kikuchi Diffraction (TKD) technique's configuration is reported. • TKD could reveal detailed nanostructural features and the microtexture of martensite laths. • Actual TKD spatial resolution was in the range of 5–10 nm using 25 kV for flow-formed Cr-Mo-V steel. • At nano scale the sub-structure morphology of martensite lath were determined using TKD

  13. Nanostructure characterisation of flow-formed Cr–Mo–V steel using transmission Kikuchi diffraction technique

    Energy Technology Data Exchange (ETDEWEB)

    Birosca, S., E-mail: s.birosca@swansea.ac.uk [Materials Research Centre, College of Engineering, Swansea University, Singleton Park, Swansea SA2 8PP (United Kingdom); Ding, R. [School of Metallurgy and Materials, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Ooi, S. [Department of Materials Science and Metallurgy, University of Cambridge, 27 Charles Babbage Road, Cambridge CB3 0FS (United Kingdom); Buckingham, R.; Coleman, C. [Materials Research Centre, College of Engineering, Swansea University, Singleton Park, Swansea SA2 8PP (United Kingdom); Dicks, K. [Oxford Instruments NanoAnalysis, Halifax Road, High Wycombe, Buckinghamshire HP12 3SE (United Kingdom)

    2015-06-15

    Nowadays flow-forming has become a desired near net shape manufacturing method as it provides excellent mechanical properties with improved surface finish and significant manufacturing cost reduction. However, the material is subjected to excessive plastic deformation during flow-forming process, generating a very fine and complex microstructure. In addition, the intense dislocation density and residual stress that is generated in the component during processing makes the microstructure characterisation using conventional micro-analytical tools challenging. Thus, the microstructure/property relationship study in such a material is rather difficult. In the present study a flow-formed Cr–Mo–V steel nanostructure and crystallographic texture were characterised by means of Transmission Kikuchi Diffraction (TKD). Here, TKD is shown to be a powerful technique in revealing very fine martensite laths within an austenite matrix. Moreover, fine precipitates in the order of 20–70 nm on the martensite lath boundaries were clearly imaged and characterised. This greatly assisted in understanding the preferable site formation of the carbides in such a complex microstructure. The results showed that the actual TKD spatial resolution was in the range of 5–10 nm using 25 kV for flow-formed Cr–Mo–V steel. - Highlights: • Optimum Transmission Kikuchi Diffraction (TKD) technique's configuration is reported. • TKD could reveal detailed nanostructural features and the microtexture of martensite laths. • Actual TKD spatial resolution was in the range of 5–10 nm using 25 kV for flow-formed Cr-Mo-V steel. • At nano scale the sub-structure morphology of martensite lath were determined using TKD.

  14. FcγRll: Characterisation of novel Fc receptor interactions and a new receptor form.

    OpenAIRE

    JESSICA CLAIRE ANANIA

    2018-01-01

    Leukocyte Fc receptors (FcR) bind to immunogloulins (Ig) to link the innate and humoral immune system to help balance the immune system and clear infections. We have characterised a novel FcR for IgG (FcγR) form, designated FcγRIIa3, which contains a 19 amino acid insert. This insert interacts with cytoskeletal structures allowing the receptor to be retained for longer periods of time at the cells surface upon activation, higher cell signalling which causes greater cellular activation. Theref...

  15. Relish2 mediates bursicon homodimer-induced prophylactic immunity in the mosquito Aedes aegypti

    Science.gov (United States)

    Bursicon is a neuropeptide hormone consisting of two cystine-knot proteins (burs a and burs ß), responsible for cuticle tanning and other developmental processes in insects. Recent studies show that each bursicon subunit forms homodimers that induce prophylactic immunity in Drosophila melanogaster. ...

  16. Insect neuropeptide bursicon homodimers induce innate immune and stress genes during molting by activating the NF-κB transcription factor Relish.

    Directory of Open Access Journals (Sweden)

    Shiheng An

    Full Text Available BACKGROUND: Bursicon is a heterodimer neuropeptide composed of two cystine knot proteins, bursicon α (burs α and bursicon β (burs β, that elicits cuticle tanning (melanization and sclerotization through the Drosophila leucine-rich repeats-containing G protein-coupled receptor 2 (DLGR2. Recent studies show that both bursicon subunits also form homodimers. However, biological functions of the homodimers have remained unknown until now. METHODOLOGY/PRINCIPAL FINDINGS: In this report, we show in Drosophila melanogaster that both bursicon homodimers induced expression of genes encoding antimicrobial peptides (AMPs in neck-ligated adults following recombinant homodimer injection and in larvae fat body after incubation with recombinant homodimers. These AMP genes were also up-regulated in 24 h old unligated flies (when the endogenous bursicon level is low after injection of recombinant homodimers. Up-regulation of AMP genes by the homodimers was accompanied by reduced bacterial populations in fly assay preparations. The induction of AMP expression is via activation of the NF-κB transcription factor Relish in the immune deficiency (Imd pathway. The influence of bursicon homodimers on immune function does not appear to act through the heterodimer receptor DLGR2, i.e. novel receptors exist for the homodimers. CONCLUSIONS/SIGNIFICANCE: Our results reveal a mechanism of CNS-regulated prophylactic innate immunity during molting via induced expression of genes encoding AMPs and genes of the Turandot family. Turandot genes are also up-regulated by a broader range of extreme insults. From these data we infer that CNS-generated bursicon homodimers mediate innate prophylactic immunity to both stress and infection during the vulnerable molting cycle.

  17. Characterising the acoustoplastic effect in an ultrasonically assisted metal forming process

    International Nuclear Information System (INIS)

    Aziz, S A; Lucas, M

    2012-01-01

    An investigation through experiments and finite element analysis (FEA) has been carried out to study the effects of applying ultrasonic oscillations to the lower platen in forming tests for two different metals. Previous research has shown that by applying ultrasonic vibrations to the lower platen in compression tests on pure aluminium specimens, the resulting stress-strain relationship can be characterised by a temporary effective softening of the material properties during intervals of ultrasonic excitation. The current research demonstrates this effect in two different metal specimens and additionally shows that finite element simulations can be used to model the behaviour in terms of both volume and surface effects. In this study, the ultrasonic excitation was introduced both prior to and post yield and the process simulations were developed in the FEA software Abaqus. The data recorded from experiments and predicted by the FEA illustrate how ultrasonically assisted metal forming can result in a lowering of the static flow stress, consistent with the effective material softening proposed previously in studies of the acoustoplastic effect.

  18. Characterisation of algal organic matter produced by bloom-forming marine and freshwater algae

    KAUST Repository

    Villacorte, Loreen O.

    2015-04-01

    Algal blooms can seriously affect the operation of water treatment processes including low pressure (micro- and ultra-filtration) and high pressure (nanofiltration and reverse osmosis) membranes mainly due to accumulation of algal-derived organic matter (AOM). In this study, the different components of AOM extracted from three common species of bloom-forming algae (Alexandrium tamarense, Chaetoceros affinis and Microcystis sp.) were characterised employing various analytical techniques, such as liquid chromatography - organic carbon detection, fluorescence spectroscopy, fourier transform infrared spectroscopy, alcian blue staining and lectin staining coupled with laser scanning microscopy to indentify its composition and force measurement using atomic force microscopy to measure its stickiness. Batch culture monitoring of the three algal species illustrated varying characteristics in terms of growth pattern, cell concentration and AOM release. The AOM produced by the three algal species comprised mainly biopolymers (e.g., polysaccharides and proteins) but some refractory compounds (e.g., humic-like substances) and other low molecular weight acid and neutral compounds were also found. Biopolymers containing fucose and sulphated functional groups were found in all AOM samples while the presence of other functional groups varied between different species. A large majority (>80%) of the acidic polysaccharide components (in terms of transparent exopolymer particles) were found in the colloidal size range (<0.4μm). The relative stickiness of AOM substantially varied between algal species and that the cohesion between AOM-coated surfaces was much stronger than the adhesion of AOM on AOM-free surfaces. Overall, the composition as well as the physico-chemical characteristics (e.g., stickiness) of AOM will likely dictate the severity of fouling in membrane systems during algal blooms.

  19. Chemical shift imprint of intersubunit communication in a symmetric homodimer

    Science.gov (United States)

    Falk, Bradley T.; Sapienza, Paul J.; Lee, Andrew L.

    2016-01-01

    Allosteric communication is critical for protein function and cellular homeostasis, and it can be exploited as a strategy for drug design. However, unlike many protein–ligand interactions, the structural basis for the long-range communication that underlies allostery is not well understood. This lack of understanding is most evident in the case of classical allostery, in which a binding event in one protomer is sensed by a second symmetric protomer. A primary reason why study of interdomain signaling is challenging in oligomeric proteins is the difficulty in characterizing intermediate, singly bound species. Here, we use an NMR approach to isolate and characterize a singly ligated state (“lig1”) of a homodimeric enzyme that is otherwise obscured by rapid exchange with apo and saturated forms. Mixed labeled dimers were prepared that simultaneously permit full population of the lig1 state and isotopic labeling of either protomer. Direct visualization of peaks from lig1 yielded site-specific ligand-state multiplets that provide a convenient format for assessing mechanisms of intersubunit communication from a variety of NMR measurements. We demonstrate this approach on thymidylate synthase from Escherichia coli, a homodimeric enzyme known to be half-the-sites reactive. Resolving the dUMP1 state shows that active site communication occurs not upon the first dUMP binding, but upon the second. Surprisingly, for many sites, dUMP1 peaks are found beyond the limits set by apo and dUMP2 peaks, indicating that binding the first dUMP pushes the enzyme ensemble to further conformational extremes than the apo or saturated forms. The approach used here should be generally applicable to homodimers. PMID:27466406

  20. Characterisation of rust surfaces formed on mild steel exposed to marine atmospheres using XRD and SEM/Micro-Raman techniques

    International Nuclear Information System (INIS)

    Fuente, D. de la; Alcántara, J.; Chico, B.; Díaz, I.; Jiménez, J.A.; Morcillo, M.

    2016-01-01

    Highlights: • SEM/Micro-Raman is very useful for characterizing rust phases morphologies. • SEM/Micro-Raman enables unequivocal rust phases identification. • γ-FeOOH basically presents two types of morphologies: globular and laminar. • Fe 3 O 4 presents two morphologies: flat patches and black doughnut-type formations. • β-FeOOH presents highly porous morphologies comprised by fine prismatic crystals. - Abstract: The exposure of mild steel to marine atmospheres gives rise to the formation of various corrosion products, mainly lepidocrocite, goethite, magnetite and akaganeite. In this study, Grazing Incidence X-Ray Diffraction, Micro-X-Ray Diffraction and Scanning Electron Microscopy/Micro-Raman are used to characterise rust layer surfaces and to identify the principal component rust phases and their morphology. The main conclusion reached is that lepidocrocite is preferentially located on the outermost surface while magnetite and akaganeite form mostly close to base steel. The Scanning Electron Microscopy/Micro-Raman technique has been very useful for characterising (identifying) the wide variety of morphologies presented by the rust phases.

  1. Quantification of Galling in Sheet Metal Forming by surface topography characterisation

    DEFF Research Database (Denmark)

    Andreasen, Jan Lasson; Bay, Niels; De Chiffre, Leonardo

    1998-01-01

    One of the major problems in forming of stainless steel sheet is galling due to lubricant film breakdown leading to scoring and bad surface quality. In a Danish research programme new lubricants substituting the normally applied chlorinated paraffin oils are being developed and tested...... for this purpose. In order to determine the limits of lubrication of these new lubricants, as well as commercial ones already available on the market, two sheet forming tests have been developed. Quantification of the degree of galling is done by roughness measurements on the workpiece surface. In a strip...

  2. Characterisation of poly(methacrylates) formed inside zeolites by gamma irradiation

    International Nuclear Information System (INIS)

    Kwiatkowski, J.; Whittaker, A.K.

    1996-01-01

    Full text: Inclusion polymerisation was first developed in the second half of the 50's as an alternative to Ziegler-Natta co-ordination polymerisation to obtain highly stereo-regular polymers. Inclusion polymerisation was performed in organic clathrates such as thio-urea channels. However the channels are only stable when formed around the monomer. This means there is a specific concentration of monomer, namely saturation, for which the host/channel system can exist. There is also a limited number of monomers which are suitable for use with a given clathrate and the channel dimension is not usually a variable parameter for a given monomer/clathrate system. One exception is Tris(o-phenolenedioxy)cycotriphosphazene. Initiation of the monomer can be easily achieved by high energy irradiation and many of the polymers obtained show considerable chemical and steric regularity. For example poly (2,3 -dimethylbutadiene) obtained by polymerisation in a thio-urea inclusion compound has only the 1,4 trans structure and is highly crystalline. The restriction on the number of clathrate and monomer systems has lead us to investigate the use of zeolites as hosts for inclusion compounds. Zeolites exist independently of any included guest compound. They are aluminosilicate compounds whose structures form molecular-dimension channels and belong to a class of materials known as molecular sieves. Channel structures can be in 1,2 or 3 dimensions. The structural aluminium in the zeolite creates a negative charge on the lattice which is balanced by cations. In this study we have diffused methyl and ethyl methacrylate into Na-ZSM5, Beta, Y and Mordenite zeolites. The samples where irradiated under vacuum and then extracted. The structures of the exrtracted polymer have been characterized by GPC, NMR and DSC The results will be correlated as a function of the channel size of the zeolite and compared to the bulk system

  3. Characterisation and functional properties of antimicrobial bio-barriers formed by natural fibres.

    Science.gov (United States)

    Tomšič, Brigita; Ilec, Eva; Žerjav, Metka; Hladnik, Aleš; Simončič, Andrej; Simončič, Barbara

    2014-10-01

    Antimicrobial bio-barriers formed on cotton (CO), silk (SE), and woollen (WO) fabrics were prepared by the application of 3-(trimethoxysilyl)-propyldimethyloctadecyl ammonium chloride (Si-QAC) at 11 concentrations ranging from 0.5% to 20% using an exhaustion method. The presence of the Si-QAC coating on the treated fabric samples was detected by X-ray photoelectron spectroscopy. The bromophenol blue reagent was used to determine the concentration of quaternary ammonium groups in the coating. The antimicrobial activity of the coated fibres against Gram-negative and Gram-positive bacteria (Escherichia coli and Staphylococcus aureus), fungi (Aspergillus niger and Chaetomium globosum), and soil microflora was assessed using standard microbiological methods. The antimicrobial protection of the fibres increased with increases in the applied concentration of Si-QAC. The fibre type strongly influenced the antimicrobial activity of Si-QAC. Si-QAC was most effective for CO fibres, less effective for WO fibres, and least effective for SE fibres, suggesting that Si-QAC is less accessible for interactions with microorganisms when applied to protein fibres than to cellulose. Although Si-QAC reduced the microbial growth, it did not significantly hinder the biodegradability or sustainability of the coated fibres when exposed to soil microflora. The extent of rotting was more influenced by the morphological and chemical properties of the fibres than by the presence of Si-QAC. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Characterisation of a large family of polymorphic collagen-like proteins in the endospore-forming bacterium Pasteuria ramosa.

    Science.gov (United States)

    McElroy, Kerensa; Mouton, Laurence; Du Pasquier, Louis; Qi, Weihong; Ebert, Dieter

    2011-09-01

    Collagen-like proteins containing glycine-X-Y repeats have been identified in several pathogenic bacteria potentially involved in virulence. Recently, a collagen-like surface protein, Pcl1a, was identified in Pasteuria ramosa, a spore-forming parasite of Daphnia. Here we characterise 37 novel putative P. ramosa collagen-like protein genes (PCLs). PCR amplification and sequencing across 10 P. ramosa strains showed they were polymorphic, distinguishing genotypes matching known differences in Daphnia/P. ramosa interaction specificity. Thirty PCLs could be divided into four groups based on sequence similarity, conserved N- and C-terminal regions and G-X-Y repeat structure. Group 1, Group 2 and Group 3 PCLs formed triplets within the genome, with one member from each group represented in each triplet. Maximum-likelihood trees suggested that these groups arose through multiple instances of triplet duplication. For Group 1, 2, 3 and 4 PCLs, X was typically proline and Y typically threonine, consistent with other bacterial collagen-like proteins. The amino acid composition of Pcl2 closely resembled Pcl1a, with X typically being glutamic acid or aspartic acid and Y typically being lysine or glutamine. Pcl2 also showed sequence similarity to Pcl1a and contained a predicted signal peptide, cleavage site and transmembrane domain, suggesting that it is a surface protein. Copyright © 2011 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  5. Characterisation of the coke formed during metal dusting of iron in CO-H2-H2O gas mixtures

    International Nuclear Information System (INIS)

    Zhang, J.; Schneider, A.; Inden, G.

    2003-01-01

    Carbon deposits formed on the surface of iron samples during carburisation at 700 deg. C in a gas mixture of 75%CO-24.81%H 2 -0.19%H 2 O were characterised by using scanning electron microscopy (SEM), X-ray diffraction (XRD), Moessbauer spectroscopy and transmission electron microscopy (TEM). Cross-section observation of the iron sample by light optical microscopy revealed the formation of cementite after only 10 min reaction, together with a thin layer of graphite. After 4 h reaction, a thick coke layer was formed on top of the cementite surface. SEM surface observation indicated the formation of filamentous carbon in the coke layer. Further analysis of the coke by XRD and Moessbauer showed the presence of mainly Fe 3 C and small amount of Fe 2 C but no metallic iron in the carbon deposit. TEM analysis of the coke detected very convoluted filaments with iron-containing particles at the tip or along their length. These particles were identified to be cementite by selected area diffraction. Carbon deposits produced at the same temperature but with other gas compositions were also analysed by using XRD. It was found that with a low content of CO, e.g. 5%, both α-Fe and Fe 3 C were detected in the coke. Increasing CO content to more than 30%, iron carbide was the only iron-containing phase

  6. Beta2-adrenergic receptor homodimers: Role of transmembrane domain 1 and helix 8 in dimerization and cell surface expression.

    Science.gov (United States)

    Parmar, Vikas K; Grinde, Ellinor; Mazurkiewicz, Joseph E; Herrick-Davis, Katharine

    2017-09-01

    Even though there are hundreds of reports in the published literature supporting the hypothesis that G protein-coupled receptors (GPCR) form and function as dimers this remains a highly controversial area of research and mechanisms governing homodimer formation are poorly understood. Crystal structures revealing homodimers have been reported for many different GPCR. For adrenergic receptors, a potential dimer interface involving transmembrane domain 1 (TMD1) and helix 8 (H8) was identified in crystal structures of the beta 1 -adrenergic (β 1 -AR) and β 2 -AR. The purpose of this study was to investigate a potential role for TMD1 and H8 in dimerization and plasma membrane expression of functional β 2 -AR. Charged residues at the base of TMD1 and in the distal portion of H8 were replaced, singly and in combination, with non-polar residues or residues of opposite charge. Wild type and mutant β 2 -AR, tagged with YFP and expressed in HEK293 cells, were evaluated for plasma membrane expression and function. Homodimer formation was evaluated using bioluminescence resonance energy transfer, bimolecular fluorescence complementation, and fluorescence correlation spectroscopy. Amino acid substitutions at the base of TMD1 and in the distal portion of H8 disrupted homodimer formation and caused receptors to be retained in the endoplasmic reticulum. Mutations in the proximal region of H8 did not disrupt dimerization but did interfere with plasma membrane expression. This study provides biophysical evidence linking a potential TMD1/H8 interface with ER export and the expression of functional β 2 -AR on the plasma membrane. This article is part of a Special Issue entitled: Interactions between membrane receptors in cellular membranes edited by Kalina Hristova. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Comparison of MukB homodimer versus MukBEF complex molecular architectures by electron microscopy reveals a higher-order multimerization

    International Nuclear Information System (INIS)

    Matoba, Kyoko; Yamazoe, Mitsuyoshi; Mayanagi, Kouta; Morikawa, Kosuke; Hiraga, Sota

    2005-01-01

    The complex of MukF, MukE, and MukB proteins participates in organization of sister chromosomes and partitioning into both daughter cells in Escherichia coli. We purified the MukB homodimer and the MukBEF complex and analyzed them by electron microscopy to compare both structures. A MukB homodimer shows a long rod-hinge-rod v-shape with small globular domains at both ends. The MukBEF complex shows a similar structure having larger globular domains than those of the MukB homodimer. These results suggest that MukF and MukE bind to the globular domains of a MukB homodimer. The globular domains of the MukBEF complex frequently associate with each other in an intramolecular fashion, forming a ring. In addition, MukBEF complex molecules tend to form multimers by the end-to-end joining with other MukBEF molecules in an intermolecular fashion, resulting in fibers and rosette-form structures in the absence of ATP and DNA in vitro

  8. Molecular Characterisation and Co-cultivation of Bacterial Biofilm Communities Associated with the Mat-Forming Diatom Didymosphenia geminata.

    Science.gov (United States)

    Brandes, Josephin; Kuhajek, Jeanne M; Goodwin, Eric; Wood, Susanna A

    2016-10-01

    Didymosphenia geminata (Lyngbye) M. Schmidt is a stalked freshwater diatom that is expanding its range globally. In some rivers, D. geminata forms thick and expansive polysaccharide-dominated mats. Like other stalked diatoms, D. geminata cells attach to the substratum with a pad of adhesive extracellular polymeric substance. Research on D. geminata and other diatoms suggests that bacterial biofilm composition may contribute to successful attachment. The aim of this study was to investigate the composition and role of bacterial biofilm communities in D. geminata attachment and survival. Bacterial biofilms were collected at four sites in the main stem of a river (containing D. geminata) and in four tributaries (free of D. geminata). Samples were characterised using automated rRNA intergenic spacer analysis and high-throughput sequencing (HTS). Mat-associated bacteria were isolated and their effect on the early establishment of D. geminata cells assessed using co-culturing experiments. ARISA and HTS data showed differences in bacterial communities between samples with and without D. geminata at two of the four sites. Samples with D. geminata had a higher relative abundance of Sphingobacteria (p geminata reduced survival (p geminata. Attachment was enhanced by Micrococcus sp. and Pseudomonas sp. (p geminata, and may partly explain observed distribution patterns.

  9. Cloning, characterisation, and comparative quantitative expression analyses of receptor for advanced glycation end products (RAGE) transcript forms.

    Science.gov (United States)

    Sterenczak, Katharina A; Willenbrock, Saskia; Barann, Matthias; Klemke, Markus; Soller, Jan T; Eberle, Nina; Nolte, Ingo; Bullerdiek, Jörn; Murua Escobar, Hugo

    2009-04-01

    RAGE is a member of the immunoglobulin superfamily of cell surface molecules playing key roles in pathophysiological processes, e.g. immune/inflammatory disorders, Alzheimer's disease, diabetic arteriosclerosis and tumourigenesis. In humans 19 naturally occurring RAGE splicing variants resulting in either N-terminally or C-terminally truncated proteins were identified and are lately discussed as mechanisms for receptor regulation. Accordingly, deregulation of sRAGE levels has been associated with several diseases e.g. Alzheimer's disease, Type 1 diabetes, and rheumatoid arthritis. Administration of recombinant sRAGE to animal models of cancer blocked tumour growth successfully. In spite of its obvious relationship to cancer and metastasis data focusing sRAGE deregulation and tumours is rare. In this study we screened a set of tumours, healthy tissues and various cancer cell lines for RAGE splicing variants and analysed their structure. Additionally, we analysed the ratio of the mainly found transcript variants using quantitative Real-Time PCR. In total we characterised 24 previously not described canine and 4 human RAGE splicing variants, analysed their structure, classified their characteristics, and derived their respective protein forms. Interestingly, the healthy and the neoplastic tissue samples showed in majority RAGE transcripts coding for the complete receptor and transcripts showing insertions of intron 1.

  10. Characterisation of 20S Proteasome in Tritrichomonas foetus and Its Role during the Cell Cycle and Transformation into Endoflagellar Form.

    Directory of Open Access Journals (Sweden)

    Antonio Pereira-Neves

    Full Text Available Proteasomes are intracellular complexes that control selective protein degradation in organisms ranging from Archaea to higher eukaryotes. These structures have multiple proteolytic activities that are required for cell differentiation, replication and maintaining cellular homeostasis. Here, we document the presence of the 20S proteasome in the protist parasite Tritrichomonas foetus. Complementary techniques, such as a combination of whole genome sequencing technologies, bioinformatics algorithms, cell fractionation and biochemistry and microscopy approaches were used to characterise the 20S proteasome of T. foetus. The 14 homologues of the typical eukaryotic proteasome subunits were identified in the T. foetus genome. Alignment analyses showed that the main regulatory and catalytic domains of the proteasome were conserved in the predicted amino acid sequences from T. foetus-proteasome subunits. Immunofluorescence assays using an anti-proteasome antibody revealed a labelling distributed throughout the cytosol as punctate cytoplasmic structures and in the perinuclear region. Electron microscopy of a T. foetus-proteasome-enriched fraction confirmed the presence of particles that resembled the typical eukaryotic 20S proteasome. Fluorogenic assays using specific peptidyl substrates detected presence of the three typical peptidase activities of eukaryotic proteasomes in T. foetus. As expected, these peptidase activities were inhibited by lactacystin, a well-known specific proteasome inhibitor, and were not affected by inhibitors of serine or cysteine proteases. During the transformation of T. foetus to endoflagellar form (EFF, also known as pseudocyst, we observed correlations between the EFF formation rates, increases in the proteasome activities and reduced levels of ubiquitin-protein conjugates. The growth, cell cycle and EFF transformation of T. foetus were inhibited after treatment with lactacystin in a dose-dependent manner. Lactacystin

  11. Formation of a cerium conversion coating on magnesium alloy using ascorbic acid as additive. Characterisation and anticorrosive properties of the formed films

    OpenAIRE

    A.P. Loperena; I.L. Lehr; S.B. Saidman.

    2016-01-01

    Cerium-based conversion coatings were formed on AZ91D magnesium alloy by immersion of the substrate in solutions containing Ce(NO3)3, H2O2 and ascorbic acid (HAsc). The characterisation of the films was performed by electrochemical and surface analysis techniques such as SEM, EDS, X-ray diffraction and X-ray photoelectron spectroscopy (XPS). The degree of corrosion protection achieved was evaluated in simulated physiological solution by the open circuit potential monitoring, polarisation tech...

  12. NMR Study of Solvation Effect on Geometry of Proton-Bound Homodimers of Increasing Size

    KAUST Repository

    Gurinov, Andrei A.

    2017-10-24

    Hydrogen bond geometries in the proton-bound homodimers of quinoline and acridine derivatives in an aprotic polar solution have been experimentally studied using 1H NMR at 120 K. The reported results show that increase of the dielec-tric permittivity of the medium results in contraction of the N…N distance. The degree of contraction depends on the homodimer\\'s size and its substituent-specific solvation features. Neither of these effects can be reproduced using conven-tional implicit solvent models employed in computational studies. In general, the N…N distance in the homodimers of pyridine, quinoline, and acridine derivatives decreases in the sequence gas phase > solid state > polar solvent.

  13. Structural characterisation of degradation products formed upon di-n-butyl phthalate radiolysis by high-performance liquid chromatography electro-spray tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Tintaru, A.; Charles, L. [Univ Aix Marseille 1, CNRS, Lab Chim Provence Spectrometries Appl Chim Struct, UMR 6264, F-13397 Marseille (France); Univ Aix Marseille 2, CNRS, Lab Chim Provence Spectrometries Appl Chim Struct, UMR 6264, F-13397 Marseille (France); Labed, V. [CEA Marcoule, DTCD SPDE L2ED, F-30207 Bagnols Sur Ceze (France)

    2010-07-01

    Complete text of publication follows: Structural characterisation of 15 degradation products, formed upon di-n-butyl phthalate (DBP) radiolysis, has been achieved using a high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) coupling. The dissociation behaviour of protonated DBP was first established to be further used to characterise structural deviation in the degradation products. Based on accurate mass measurements, compounds shown by HPLC-MS analysis were all found to be DBP oxidation products, amongst which various sets of isomers could be distinguished. Collision-induced dissociation experiments performed on each electro-sprayed molecule first allowed unambiguous definition of the location of the additional oxygen atoms; that is, in the alkyl branch or on the aromatic ring. Although location of the oxygen atom in the alkyl branches could not always be precisely determined, relative abundances of some product ions allowed oxygenated functions to be identified

  14. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  15. Trastuzumab has preferential activity against breast cancers driven by HER2 homodimers

    Science.gov (United States)

    Ghosh, Ritwik; Narasanna, Archana; Wang, Shizhen Emily; Liu, Shuying; Chakrabarty, Anindita; Balko, Justin M.; González-Angulo, Ana María; Mills, Gordon B.; Penuel, Elicia; Winslow, John; Sperinde, Jeff; Dua, Rajiv; Pidaparthi, Sailaja; Mukherjee, Ali; Leitzel, Kim; Kostler, Wolfgang J.; Lipton, Allan; Bates, Michael; Arteaga, Carlos L.

    2011-01-01

    In breast cancer cells with HER2 gene amplification, HER2 receptors exist on the cell surface as monomers, homodimers and heterodimers with EGFR/HER3. The therapeutic antibody trastuzumab, an approved therapy for HER2+ breast cancer, cannot block ligand-induced HER2 heterodimers, suggesting it cannot effectively inhibit HER2 signaling. Hence, HER2 oligomeric states may predict the odds of a clinical response to trastuzumab in HER2-driven tumors. To test this hypothesis, we generated non-transformed human MCF10A mammary epithelial cells stably expressing a chimeric HER2-FKBP molecule that could be conditionally induced to homodimerize by adding the FKBP ligand AP1510, or instead induced to heterodimerize with EGFR or HER3 by adding the heterodimer ligands EGF/TGFα or heregulin. AP1510, EGF, and heregulin each induced growth of MCF10A cells expressing HER2-FKBP. As expected, trastuzumab inhibited homodimer-mediated but not heterodimer-mediated cell growth. In contrast, the HER2 antibody pertuzumab, which blocks HER2 heterodimerization, inhibited growth induced by heregulin but not AP1510. Lastly, HER2/EGFR tyrosine kinase inhibitor lapatinib blocked both homodimer- and heterodimer-induced growth. AP1510 triggered phosphorylation of Erk1/2 but not AKT, whereas trastuzumab inhibited AP1510-induced Erk1/2 phosphorylation and Shc-HER2 homodimer binding, but not TGFα-induced AKT phosphorylation. Consistent with these observations, high levels of HER2 homodimers correlated with longer time to progression following trastuzumab therapy in a cohort of HER2-overexpressing patients. Together, our findings corroborate the hypothesis that HER2 oligomeric states regulate HER2 signaling, also arguing that trastuzumab sensitivity of homodimers reflects an inability to activate the PI3K/AKT pathway. One of the most important clinical implications of our results is that high levels of HER2 homodimers may predict a positive response to trastuzumab. PMID:21324925

  16. Secreted Progranulin Is a Homodimer and Is Not a Component of High Density Lipoproteins (HDL)*

    Science.gov (United States)

    Nguyen, Andrew D.; Nguyen, Thi A.; Cenik, Basar; Yu, Gang; Herz, Joachim; Walther, Tobias C.; Davidson, W. Sean; Farese, Robert V.

    2013-01-01

    Progranulin is a secreted glycoprotein, and the GRN gene is mutated in some cases of frontotemporal dementia. Progranulin has also been implicated in cell growth, wound healing, inflammation, and cancer. We investigated the molecular nature of secreted progranulin and provide evidence that progranulin exists as a homodimer. Although recombinant progranulin has a molecular mass of ∼85 kDa by SDS-PAGE, it elutes in fractions corresponding to ∼170–180 kDa by gel-filtration chromatography. Additionally, recombinant progranulin can be intermolecularly cross-linked, yielding a complex corresponding to a dimer (∼180 kDa), and progranulins containing different epitope tags physically interact. In plasma, progranulin similarly forms complexes of ∼180–190 kDa. Although progranulin partially co-fractionated with high density lipoproteins (HDL) by gel-filtration chromatography, we found no evidence that progranulin in mouse or human plasma is a component of HDL either by ultracentrifugation or by lipid binding assays. We conclude that circulating progranulin exists as a dimer and is not likely a component of HDL. PMID:23364791

  17. Secreted progranulin is a homodimer and is not a component of high density lipoproteins (HDL).

    Science.gov (United States)

    Nguyen, Andrew D; Nguyen, Thi A; Cenik, Basar; Yu, Gang; Herz, Joachim; Walther, Tobias C; Davidson, W Sean; Farese, Robert V

    2013-03-22

    Progranulin is a secreted glycoprotein, and the GRN gene is mutated in some cases of frontotemporal dementia. Progranulin has also been implicated in cell growth, wound healing, inflammation, and cancer. We investigated the molecular nature of secreted progranulin and provide evidence that progranulin exists as a homodimer. Although recombinant progranulin has a molecular mass of ∼85 kDa by SDS-PAGE, it elutes in fractions corresponding to ∼170-180 kDa by gel-filtration chromatography. Additionally, recombinant progranulin can be intermolecularly cross-linked, yielding a complex corresponding to a dimer (∼180 kDa), and progranulins containing different epitope tags physically interact. In plasma, progranulin similarly forms complexes of ∼180-190 kDa. Although progranulin partially co-fractionated with high density lipoproteins (HDL) by gel-filtration chromatography, we found no evidence that progranulin in mouse or human plasma is a component of HDL either by ultracentrifugation or by lipid binding assays. We conclude that circulating progranulin exists as a dimer and is not likely a component of HDL.

  18. Optical determination of the electronic coupling and intercalation geometry of thiazole orange homodimer in DNA

    Science.gov (United States)

    Cunningham, Paul D.; Bricker, William P.; Díaz, Sebastián A.; Medintz, Igor L.; Bathe, Mark; Melinger, Joseph S.

    2017-08-01

    Sequence-selective bis-intercalating dyes exhibit large increases in fluorescence in the presence of specific DNA sequences. This property makes this class of fluorophore of particular importance to biosensing and super-resolution imaging. Here we report ultrafast transient anisotropy measurements of resonance energy transfer (RET) between thiazole orange (TO) molecules in a complex formed between the homodimer TOTO and double-stranded (ds) DNA. Biexponential homo-RET dynamics suggest two subpopulations within the ensemble: 80% intercalated and 20% non-intercalated. Based on the application of the transition density cube method to describe the electronic coupling and Monte Carlo simulations of the TOTO/dsDNA geometry, the dihedral angle between intercalated TO molecules is estimated to be 81° ± 5°, corresponding to a coupling strength of 45 ± 22 cm-1. Dye intercalation with this geometry is found to occur independently of the underlying DNA sequence, despite the known preference of TOTO for the nucleobase sequence CTAG. The non-intercalated subpopulation is inferred to have a mean inter-dye separation distance of 19 Å, corresponding to coupling strengths between 0 and 25 cm-1. This information is important to enable the rational design of energy transfer systems that utilize TOTO as a relay dye. The approach used here is generally applicable to determining the electronic coupling strength and intercalation configuration of other dimeric bis-intercalators.

  19. NMR Study of Solvation Effect on Geometry of Proton-Bound Homodimers of Increasing Size

    KAUST Repository

    Gurinov, Andrei A.; Denisov, Gleb S.; Borissova, Alexandra O.; Goloveshkin, Alexander S.; Greindl, Julian; Limbach, Hans-Heinrich; Shenderovich, Ilya G.

    2017-01-01

    Hydrogen bond geometries in the proton-bound homodimers of quinoline and acridine derivatives in an aprotic polar solution have been experimentally studied using 1H NMR at 120 K. The reported results show that increase of the dielec-tric permittivity of the medium results in contraction of the N…N distance. The degree of contraction depends on the homodimer's size and its substituent-specific solvation features. Neither of these effects can be reproduced using conven-tional implicit solvent models employed in computational studies. In general, the N…N distance in the homodimers of pyridine, quinoline, and acridine derivatives decreases in the sequence gas phase > solid state > polar solvent.

  20. Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant

    Energy Technology Data Exchange (ETDEWEB)

    Atwell, Shane; Brouillette, Christie G.; Conners, Kris; Emtage, Spencer; Gheyi, Tarun; Guggino, William B.; Hendle, Jorg; Hunt, John F.; Lewis, Hal A.; Lu, Frances; Protasevich, Irina I.; Rodgers, Logan A.; Romero, Rich; Wasserman, Stephen R.; Weber, Patricia C.; Wetmore, Diana; Zhang, Feiyu F.; Zhao, Xun (Cystic); (UAB); (JHU); (Columbia); (Lilly)

    2010-04-26

    Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646({Delta}405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-{angstrom} resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The {Delta}F508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

  1. Characterisation of intermetallic particles formed during solution treatment of an Al–7Si–0.4Mg–0.12Fe alloy

    International Nuclear Information System (INIS)

    Yao, J.Y.; Taylor, J.A.

    2012-01-01

    Highlights: ► It is concluded in this work that the fine needle-like particles formed during the solution treatment of the 356 type alloy are indeed β phase plates similar to those frequently observed in as-cast aluminium alloys but of much finer sizes, most likely formed by precipitation in the vicinity of the dissolving π phase particles. ► The crystal structure of the needle-like particles, as examined by selected area electron diffraction, can be essentially indexed as either the A-Centred Monoclinic lattice or the Orthorhombic lattice . ► The particles appear to co-exist in two distinct forms: single crystal particles and composite micro-constituent particles. - Abstract: When Fe-containing Al–7Si–xMg alloys are solution-treated, usually as the initial stage of a T6 heat treatment, some of the π-Al 9 Mg 3 FeSi 5 phase present in the as-cast alloy transforms into fine needle-like intermetallic particles (as seen on a polished surface). These precipitated needles, speculated to be β-Al 5 FeSi phase, have not been definitively characterised to date. In this work, electron microscopy characterisation by various techniques was conducted to assess the nature (i.e. the composition, morphology and crystallography) of these particles to verify or otherwise the validity of the above hypothesis. It is found that the particles are indeed β phase platelets, of the same Al 5 FeSi or Al 4.5 FeSi stoichiometry as particles formed during solidification. Close observation of their crystallographic structure suggests fine-scale internal complexities in some of the particles.

  2. Characterisation of Oxides Formed on the Internal Surface of Steam Generator Tubes in Alloy 690 Corroded in the Primary Environment of Pressurised Water Reactors

    International Nuclear Information System (INIS)

    Carrette, Florence; Leclercq, Stephanie; Legras, Laurent

    2012-09-01

    Since the end of the 1990s, EDF R and D has been studying the phenomenon of corrosion product release from Steam Generator tubes in order to minimize the Source Term of the contamination and radiation exposure during operation and maintenance of Pressurised Water Reactors. With the BOREAL loop, release tests in primary water at 325 deg. C were performed on various Steam Generator tubes made of alloy 690. The experimental conditions of these tests (chemistry, temperature and hydraulics) were the same for all the tests but the results showed various behaviours towards release. For some tubes, the release was weak whereas for others, it was higher; the release rate of the tubes decreased more or less quickly with time. In order to explain these results, the internal surface of the tubes was characterised before and after the tests. Before the tests, various parameters were studied; the main parameters were the roughness, the impurities, the grain size and the cold work. The results demonstrated that it was not easy to quantify the influence of each parameter on release and to differentiate the tubes. A new parameter was proposed to characterise the internal extreme surface of SG tubes: the surface nano-hardness by nano-indentation measurements. The tubes were also observed and analysed by SEM, (X)TEM. Data obtained by (X)TEM revealed differences of the surface state (layer of perturbed microstructure, density of dislocations, grain size, impurities, initial oxide,...). After the tests, the oxides formed on the internal surface and the underlying material of the samples were characterised by SEM, (X)TEM and SIMS. The examinations showed various types of oxides. For some tubes, a duplex oxide scale was identified, for the others, only one oxide scale was observed. For equivalent durations of corrosion, the thickness of the enriched - chromium oxide layer can vary from 5 nm to 100 nm and the chemical composition can be different. The examinations of the underlying

  3. A Sub-Microanalysis Approach in Chemical Characterisation of Gold Nanorods Formed by a Novel Polymer-Immobilised Gold Seeds Base

    Directory of Open Access Journals (Sweden)

    Majid Kazemian Abyaneh

    2017-10-01

    Full Text Available Gold nanorods (GNRs have been fabricated by a novel polymer-immobilised seed mediated method using ultraviolet (UV photoreduced gold-polymethylmethacrylate (Au–PMMA nanocomposites as a seed platform and characterised at sub-micron scale regime with synchrotron-based techniques; near-edge X-ray absorption fine structure (NEXAFS spectroscopy and X-ray fluorescence (XRF mapping. In this report, it is shown that investigating polymer nanocomposites using combination of XRF mapping and NEXAFS spectromicroscopy can help to see the growth phenomenon from different perspective than conventional characterisation techniques. XRF maps are used to explore distribution of the constituent elements and showing how polymer matrix making stripe patterns along with regions where GNRs are formed. NEXAFS carbon (C K-edge spectra have been taken at three different stages of synthesis: (1 on Au–PMMA nanocomposites before UV irradiation, (2 after gold nanoparticles formation, and (3 after GNRs formation. It reveals how polymer matrix has been degraded during GNRs formation and avoiding chemically or physically damage to polymer matrix is crucial to control the formation of GNRs.

  4. Reaction of carbon tetrachloride with methane in a non-equilibrium plasma at atmospheric pressure, and characterisation of the polymer thus formed

    Energy Technology Data Exchange (ETDEWEB)

    Gaikwad, Vaibhav [Process Safety and Environment Protection Research Group, School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); Kennedy, Eric, E-mail: Eric.Kennedy@newcastle.edu.au [Process Safety and Environment Protection Research Group, School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); Mackie, John [Process Safety and Environment Protection Research Group, School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); Holdsworth, Clovia [Centre for Organic Electronics, Chemistry Building, School of Environmental and Life Sciences, University of Newcastle, Callaghan, NSW 2308 (Australia); Molloy, Scott; Kundu, Sazal; Stockenhuber, Michael [Process Safety and Environment Protection Research Group, School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); Dlugogorski, Bogdan [School of Engineering and Information Technology, Murdoch University, Murdoch, WA 6150 (Australia)

    2014-09-15

    Highlights: • CCl{sub 4} remediation using non-equilibrium plasma and non-oxidative conditions is proposed. • The reaction mechanism relies on experimental data and quantum chemical analysis. • Comprehensive mass balance for the reaction is provided. • CCl{sub 4} is converted to an environmentally benign and potentially useful polymer. • Characterisation of the polymer structure based on NMR and FTIR analyses is presented. - Abstract: In this paper we focus on the development of a methodology for treatment of carbon tetrachloride utilising a non-equilibrium plasma operating at atmospheric pressure, which is not singularly aimed at destroying carbon tetrachloride but rather at converting it to a non-hazardous, potentially valuable commodity. This method encompasses the reaction of carbon tetrachloride and methane, with argon as a carrier gas, in a quartz dielectric barrier discharge reactor. The reaction is performed under non-oxidative conditions. Possible pathways for formation of major products based on experimental results and supported by quantum chemical calculations are outlined in the paper. We elucidate important parameters such as carbon tetrachloride conversion, product distribution, mass balance and characterise the chlorinated polymer formed in the process.

  5. Finite element modelling of shot peening and peen forming processes and characterisation of peened AA2024-T351 aluminium alloy

    Science.gov (United States)

    Gariepy, Alexandre

    The main purpose of this thesis was to develop and validate finite element (FE) simulation tools for shot peening and peen forming. The specific aim was to achieve quantitatively accurate predictions for both processes and demonstrate the potential of reliable FE modelling for scientific investigation and industrial applications. First, an improved dynamic impact model that takes into account the stochastic nature of shot peening was proposed by carefully studying its dimensions, introducing a dispersion of shot sizes and significantly reducing its computational cost. In addition, cyclic mechanical testing was conducted to define a suitable material constitutive theory for aluminium alloy (AA) 2024-T3/T351 subjected to shot peening. By combining a realistic shot peening model with an appropriate material law, fairly good residual stress predictions were achieved for three different sets of shot peening parameters. Second, an experimental and numerical characterization of AA2024-T351 shot peened with parameters representative of fatigue life improvement applications was conducted. Multiple techniques, such as micro-indentation, residual stress determination and electron backscatter diffraction, were combined to gain a better understanding of the influence of shot peening on the material. The potential uses of finite element simulation to complement experimental data were also studied. The material heterogeneity arising from the random impact sequence was investigated and it was found that the impact modelling methodology could provide useful information on such heterogeneities. Third, a novel peen forming simulation methodology was introduced. The impact model provided the necessary input data as part of a multiscale approach. Numerically calculated unbalanced induced stress profiles were input into shell elements and the deformed shape after peen forming was computed as a springback analysis. In addition, a simple interpolation method was proposed to model the

  6. Characterisation of different forms of the accessory gp3 canine coronavirus type I protein identified in cats.

    Science.gov (United States)

    d'Orengiani, Anne-Laure Pham-Hung d'Alexandry; Duarte, Lidia; Pavio, Nicole; Le Poder, Sophie

    2015-04-16

    ORF3 is a supplemental open reading frame coding for an accessory glycoprotein gp3 of unknown function, only present in genotype I canine strain (CCoV-I) and some atypical feline FCoV strains. In these latter hosts, the ORF3 gene systematically displays one or two identical deletions leading to the synthesis of truncated proteins gp3-Δ1 and gp3-Δ2. As deletions in CoV accessory proteins have already been involved in tissue or host switch, studies of these different gp3 proteins were conducted in canine and feline cell. All proteins oligomerise through covalent bonds, are N-glycosylated and are maintained in the ER in non-infected but also in CCoV-II infected cells, without any specific retention signal. However, deletions influence their level of expression. In canine cells, all proteins are expressed with similar level whereas in feline cells, the expression of gp3-Δ1 is higher than the two other forms of gp3. None of the gp3 proteins modulate the viral replication cycle of heterologous genotype II CCoV in canine cell line, leading to the conclusion that the gp3 proteins are probably advantageous only for CCoV-I and atypical FCoV strains. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Origin of Asymmetric Charge Partitioning in the Dissociation of Gas-Phase Protein Homodimers

    OpenAIRE

    Jurchen, John C.; Williams, Evan R.

    2003-01-01

    The origin of asymmetric charge and mass partitioning observed for gas-phase dissociation of multiply charged macromolecular complexes has been hotly debated. These experiments hold the potential to provide detailed information about the interactions between the macromolecules within the complex. Here, this unusual phenomenon of asymmetric charge partitioning is investigated for several protein homodimers. Asymmetric charge partitioning in these ions depends on a number of factors, including ...

  8. Purification, biochemical, and immunological characterisation of a major food allergen: different immunoglobulin E recognition of the apo- and calcium-bound forms of carp parvalbumin.

    Science.gov (United States)

    Bugajska-Schretter, A; Grote, M; Vangelista, L; Valent, P; Sperr, W R; Rumpold, H; Pastore, A; Reichelt, R; Valenta, R; Spitzauer, S

    2000-05-01

    Almost 4% of the population suffer from food allergy which is an adverse reaction to food with an underlying immunological mechanism. To characterise one of the most frequent IgE defined food allergens, fish parvalbumin. Tissue and subcellular distribution of carp parvalbumin was analysed by immunogold electron microscopy and cell fractionation. Parvalbumin was purified to homogeneity, analysed by mass spectrometry and circular dichroism (CD) spectroscopy, and its allergenic activity was analysed by IgE binding and basophil histamine release tests. The isoelectric point (pI) 4.7 form of carp parvalbumin, a three EF-hand calcium-binding protein, was purified to homogeneity. CD analysis revealed a remarkable stability and refolding capacity of calcium-bound parvalbumin. This may explain why parvalbumin, despite cooking and exposure to the gastrointestinal tract, can sensitise patients. Purified parvalbumin reacted with IgE of more than 95% of individuals allergic to fish, induced dose-dependent basophil histamine release and contained, on average, 83% of the IgE epitopes present in other fish species. Calcium depletion reduced the IgE binding capacity of parvalbumin which, according to CD analysis, may be due to conformation-dependent IgE recognition. Purified carp parvalbumin represents an important cross reactive food allergen. It can be used for in vitro and in vivo diagnosis of fish-induced food allergy. Our finding that the apo-form of parvalbumin had a greatly reduced IgE binding capacity indicates that this form may be a candidate for safe immunotherapy of fish-related food allergy.

  9. Rheological and structural characterisation of film-forming solutions and biodegradable edible film made from kefiran as affected by various plasticizer types.

    Science.gov (United States)

    Ghasemlou, Mehran; Khodaiyan, Faramarz; Oromiehie, Abdulrasoul

    2011-11-01

    The rheological properties of kefiran film-forming solutions, as well as the structural characterisation of the resulting films, were investigated as a function of various plasticizer types. The behaviours of the storage (G') and loss (G″) moduli as a function of frequency were typical of gel-like material, with the G' higher than the G″. Kefiran-based films, which may find application as edible films, were prepared by a casting and solvent-evaporation method. Possible interaction between the adjacent chains in the kefiran polymer and various plasticizers was proven by Fourier-transform infrared spectroscopy (FT-IR). The crystallinity of plasticized kefiran film was also analysed using X-ray diffraction (XRD); this revealed an amorphous-crystalline structure. These results were explained by the film's microstructure, which was analysed by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The present study has helped determine possible interactions of kefiran, plasticizer and water molecules in determining film properties. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Materials characterisation

    International Nuclear Information System (INIS)

    Azali Muhammad

    2005-01-01

    Various nuclear techniques have been developed and employed by technologies and scientists worldwide to physically and chemically characterise the material particularly those that have applications in industry. These include small angle neutron scattering (SANS), x-ray diffraction (XRD), scanning electron microscope (SEM) and transmission electron microscope (TEM) for the internal structural study of material, whereas, the x-ray fluorescence (XRF) for the chemical analysis, while the Moessbauer spectroscopy for the study on the magnetic properties and structural identity of material. Basic principle and instrumentations of the techniques are discussed in this chapter. Example of their applications in various disciplines particularly in characterisation of industrial materials also described

  11. APP Homodimers Transduce an Amyloid-β-Mediated Increase in Release Probability at Excitatory Synapses

    Directory of Open Access Journals (Sweden)

    Hilla Fogel

    2014-06-01

    Full Text Available Accumulation of amyloid-β peptides (Aβ, the proteolytic products of the amyloid precursor protein (APP, induces a variety of synaptic dysfunctions ranging from hyperactivity to depression that are thought to cause cognitive decline in Alzheimer’s disease. While depression of synaptic transmission has been extensively studied, the mechanisms underlying synaptic hyperactivity remain unknown. Here, we show that Aβ40 monomers and dimers augment release probability through local fine-tuning of APP-APP interactions at excitatory hippocampal boutons. Aβ40 binds to the APP, increases the APP homodimer fraction at the plasma membrane, and promotes APP-APP interactions. The APP activation induces structural rearrangements in the APP/Gi/o-protein complex, boosting presynaptic calcium flux and vesicle release. The APP growth-factor-like domain (GFLD mediates APP-APP conformational changes and presynaptic enhancement. Thus, the APP homodimer constitutes a presynaptic receptor that transduces signal from Aβ40 to glutamate release. Excessive APP activation may initiate a positive feedback loop, contributing to hippocampal hyperactivity in Alzheimer’s disease.

  12. Purification, biochemical, and immunological characterisation of a major food allergen: different immunoglobulin E recognition of the apo- and calcium-bound forms of carp parvalbumin

    OpenAIRE

    Bugajska-Schrette..., A; Grote, M; Vangelista, L; Valent, P; Sperr, W; Rumpold, H; Pastore, A; Reichelt, R; Valenta, R; Spitzauer, S

    2000-01-01

    BACKGROUND—Almost 4% of the population suffer from food allergy which is an adverse reaction to food with an underlying immunological mechanism.
AIMS—To characterise one of the most frequent IgE defined food allergens, fish parvalbumin.
METHODS—Tissue and subcellular distribution of carp parvalbumin was analysed by immunogold electron microscopy and cell fractionation. Parvalbumin was purified to homogeneity, analysed by mass spectrometry and circular dichroism (CD) spectroscopy, and its alle...

  13. Homodimers of Vanillin and Apocynin Decrease the Metastatic Potential of Human Cancer Cells by Inhibiting the FAK/PI3K/Akt Signaling Pathway.

    Science.gov (United States)

    Jantaree, Phatcharida; Lirdprapamongkol, Kriengsak; Kaewsri, Wilailak; Thongsornkleeb, Charnsak; Choowongkomon, Kiattawee; Atjanasuppat, Korakot; Ruchirawat, Somsak; Svasti, Jisnuson

    2017-03-22

    The spread of cancer cells to distant organs, in a process called metastasis, is the main factor that contributes to most death in cancer patients. Vanillin, the vanilla flavoring agent, has been shown to suppress metastasis in a mouse model. Here, we evaluated the antimetastatic potential of the food additive divanillin, the homodimer of vanillin, and their structurally related compounds, apocynin and diapocynin, in hepatocellular carcinoma cells. The Transwell invasion assay showed that the dimeric forms exhibited a potency higher than those of vanillin and apocynin in inhibiting invasion, with IC 50 values of 23.3 ± 7.4 to 41.3 ± 4.2 μM for the dimers, which are 26-34-fold lower than IC 50 values of vanillin and apocynin (p vanillin and apocynin to the Y397 pocket of the FAK FERM domain. Thus, the food additive divanillin has antimetastatic potential greater than that of the flavoring agent vanillin.

  14. PDB-NMA of a protein homodimer reproduces distinct experimental motility asymmetry

    Science.gov (United States)

    Tirion, Monique M.; ben-Avraham, Daniel

    2018-03-01

    We have extended our analytically derived PDB-NMA formulation, Atomic Torsional Modal Analysis or ATMAN (Tirion and ben-Avraham 2015 Phys. Rev. E 91 032712), to include protein dimers using mixed internal and Cartesian coordinates. A test case on a 1.3 {\\mathringA} resolution model of a small homodimer, ActVA-ORF6, consisting of two 112-residue subunits identically folded in a compact 50 {\\mathringA} sphere, reproduces the distinct experimental Debye-Waller motility asymmetry for the two chains, demonstrating that structure sensitively selects vibrational signatures. The vibrational analysis of this PDB entry, together with biochemical and crystallographic data, demonstrates the cooperative nature of the dimeric interaction of the two subunits and suggests a mechanical model for subunit interconversion during the catalytic cycle.

  15. Plasmon-mediated binding forces on gold or silver homodimer and heterodimer

    International Nuclear Information System (INIS)

    Liaw, Jiunn-Woei; Kuo, Ting-Yu; Kuo, Mao-Kuen

    2016-01-01

    This study theoretically investigates plasmon-mediated optical binding forces, which are exerted on metal homo or heterodimers, induced by the normal illumination of a linearly polarized plane wave or Gaussian beam. Using the multiple multipole method, we analyzed the optical force in terms of Maxwell's stress tensor for various interparticle distance at some specific wavelengths. Numerical results show that for a given wavelength there are several stable equilibrium distances between two nanoparticles (NPs) of a homodimer, which are slightly shorter than some integer multiples of the wavelength in medium, such that metal dimer acts as bonded together. At these specific interparticle distances, the optical force between dimer is null and serves a restoring force, which is repulsive and attractive, respectively, as the two NPs are moving closer to and away from each other. The spring constant of the restoring force at the first stable equilibrium is always the largest, indicating that the first stable equilibrium distance is the most stable one. Moreover, the central line (orientation) of a dimer tends to be perpendicular to the polarization of light. For the cases of heterodimers, the phenomenon of stable equilibrium interparticle distance still exists, except there is an extra net photophoretic force drifting the heterodimer as one. Moreover, gradient force provided by a Gaussian beam may reduce the stability of these equilibriums, so larger NPs are preferred to stabilize a dimer under illumination of Gaussian beam. The finding may pave the way for using optical manipulation on the gold or silver colloidal self-assembly. - Highlights: • Optical binding force on Au/Ag dimer by linearly polarized light is studied. • For a wavelength several stable equilibriums for homodimer bound together exist. • The central line of a dimer tends to be perpendicular to the polarization of light. • For a heterodimer, stable equilibriums still exist with a net photophoretic

  16. Probing intermolecular protein-protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET)

    DEFF Research Database (Denmark)

    Jensen, Anders A.; Hansen, Jakob L; Sheikh, Søren P

    2002-01-01

    -induced intermolecular movements in the CaR homodimer using the new bioluminescence resonance energy transfer technique, BRET2, which is based on the transference of energy from Renilla luciferase (Rluc) to the green fluorescent protein mutant GFP2. We tagged CaR with Rluc and GFP2 at different intracellular locations...

  17. HLA-B27-Homodimer-Specific Antibody Modulates the Expansion of Pro-Inflammatory T-Cells in HLA-B27 Transgenic Rats.

    Directory of Open Access Journals (Sweden)

    Osiris Marroquin Belaunzaran

    Full Text Available HLA-B27 is a common genetic risk factor for the development of Spondyloarthritides (SpA. HLA-B27 can misfold to form cell-surface heavy chain homodimers (B272 and induce pro-inflammatory responses that may lead to SpA pathogenesis. The presence of B272 can be detected on leukocytes of HLA-B27+ Ankylosing spondylitis (AS patients and HLA-B27 transgenic rats. We characterized a novel B272-specific monoclonal antibody to study its therapeutic use in HLA-B27 associated disorders.The monoclonal HD5 antibody was selected from a phage library to target cell-surface B272 homodimers and characterized for affinity, specificity and ligand binding. The immune modulating effect of HD5 was tested in HLA-B27 transgenic rats. Onset and progression of disease profiles were monitored during therapy. Cell-surface B272 and expansion of pro-inflammatory cells from blood, spleen and draining lymph nodes were assessed by flow cytometry.HD5 bound B272 with high specificity and affinity (Kd = 0.32 nM. HD5 blocked cell-surface interaction of B272 with immune regulatory receptors KIR3DL2, LILRB2 and Pirb. In addition, HD5 modulated the production of TNF from CD4+ T-cells by limiting B272 interactions in vitro. In an HLA-B27 transgenic rat model repetitive dosing of HD5 reduced the expansion of pro-inflammatory CD4+ T-cells, and decreased the levels of soluble TNF and number of cell-surface B272 molecules.HD5 predominantly inhibits early TNF production and expansion of pro-inflammatory CD4+ T-cells in HLA-B27 transgenic rats. Monoclonal antibodies targeting cell-surface B272 propose a new concept for the modulation of inflammatory responses in HLA-B27 related disorders.

  18. HLA-B27-Homodimer-Specific Antibody Modulates the Expansion of Pro-Inflammatory T-Cells in HLA-B27 Transgenic Rats

    Science.gov (United States)

    Marroquin Belaunzaran, Osiris; Kleber, Sascha; Schauer, Stefan; Hausmann, Martin; Nicholls, Flora; Van den Broek, Maries; Payeli, Sravan; Ciurea, Adrian; Milling, Simon; Stenner, Frank; Shaw, Jackie; Kollnberger, Simon; Bowness, Paul; Petrausch, Ulf; Renner, Christoph

    2015-01-01

    Objectives HLA-B27 is a common genetic risk factor for the development of Spondyloarthritides (SpA). HLA-B27 can misfold to form cell-surface heavy chain homodimers (B272) and induce pro-inflammatory responses that may lead to SpA pathogenesis. The presence of B272 can be detected on leukocytes of HLA-B27+ Ankylosing spondylitis (AS) patients and HLA-B27 transgenic rats. We characterized a novel B272–specific monoclonal antibody to study its therapeutic use in HLA-B27 associated disorders. Methods The monoclonal HD5 antibody was selected from a phage library to target cell-surface B272 homodimers and characterized for affinity, specificity and ligand binding. The immune modulating effect of HD5 was tested in HLA-B27 transgenic rats. Onset and progression of disease profiles were monitored during therapy. Cell-surface B272 and expansion of pro-inflammatory cells from blood, spleen and draining lymph nodes were assessed by flow cytometry. Results HD5 bound B272 with high specificity and affinity (Kd = 0.32 nM). HD5 blocked cell-surface interaction of B272 with immune regulatory receptors KIR3DL2, LILRB2 and Pirb. In addition, HD5 modulated the production of TNF from CD4+ T-cells by limiting B272 interactions in vitro. In an HLA-B27 transgenic rat model repetitive dosing of HD5 reduced the expansion of pro-inflammatory CD4+ T-cells, and decreased the levels of soluble TNF and number of cell-surface B272 molecules. Conclusion HD5 predominantly inhibits early TNF production and expansion of pro-inflammatory CD4+ T-cells in HLA-B27 transgenic rats. Monoclonal antibodies targeting cell-surface B272 propose a new concept for the modulation of inflammatory responses in HLA-B27 related disorders. PMID:26125554

  19. Use of the α-mannosidase I inhibitor kifunensine allows the crystallization of apo CTLA-4 homodimer produced in long-term cultures of Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Yu, Chao; Crispin, Max; Sonnen, Andreas F.-P.; Harvey, David J.; Chang, Veronica T.; Evans, Edward J.; Scanlan, Christopher N.; Stuart, David I.; Gilbert, Robert J. C.; Davis, Simon J.

    2011-01-01

    The α-mannosidase I inhibitor kifunensine inhibited N-glycan processing in long-term cultures of Chinese hamster ovary cells, allowing deglycosylation and crystallization of the homodimeric extracellular region of the inhibitory glycoprotein receptor CTLA-4 (CD152). Glycoproteins present problems for structural analysis since they often have to be glycosylated in order to fold correctly and because their chemical and conformational heterogeneity generally inhibits crystallization. It is shown that the α-mannosidase I inhibitor kifunensine, which has previously been used for the purpose of glycoprotein crystallization in short-term (3–5 d) cultures, is apparently stable enough to be used to produce highly endoglycosidase H-sensitive glycoprotein in long-term (3–4 week) cultures of stably transfected Chinese hamster ovary (CHO) cells. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry-based analysis of the extracellular region of the cytotoxic T-lymphocyte antigen 4 (CTLA-4; CD152) homodimer expressed in long-term CHO cell cultures in the presence of kifunensine revealed that the inhibitor restricted CTLA-4 glycan processing to Man 9 GlcNAc 2 and Man 5 GlcNAc 2 structures. Complex-type glycans were undetectable, suggesting that the inhibitor was active for the entire duration of the cultures. Endoglycosidase treatment of the homodimer yielded protein that readily formed orthorhombic crystals with unit-cell parameters a = 43.9, b = 51.5, c = 102.9 Å and space group P2 1 2 1 2 1 that diffracted to Bragg spacings of 1.8 Å. The results indicate that kifunensine will be effective in most, if not all, transient and long-term mammalian cell-based expression systems

  20. Role of α-Helical Structure in Organic Solvent-Activated Homodimer of Elastase Strain K

    Directory of Open Access Journals (Sweden)

    Chee Fah Wong

    2011-09-01

    Full Text Available Recombinant elastase strain K overexpressed from E. coli KRX/pCon2(3 was purified to homogeneity by a combination of hydrophobic interaction chromatography and ion exchange chromatography, with a final yield of 48% and a 25-fold increase in specific activity. The purified protein had exhibited a first ever reported homodimer size of 65 kDa by SDS-PAGE and MALDI-TOF, a size which is totally distinct from that of typically reported 33 kDa monomer from P. aeruginosa. The organic solvent stability experiment had demonstrated a stability pattern which completely opposed the rules laid out in previous reports in which activity stability and enhancement were observed in hydrophilic organic solvents such as DMSO, methanol, ethanol and 1-propanol. The high stability and enhancement of the enzyme in hydrophilic solvents were explained from the view of alteration in secondary structures. Elastinolytic activation and stability were observed in 25 and 50% of methanol, respectively, despite slight reduction in α-helical structure caused upon the addition of the solvent. Further characterization experiments had postulated great stability and enhancement of elastase strain K in broad range of temperatures, pHs, metal ions, surfactants, denaturing agents and substrate specificity, indicating its potential application in detergent formulation.

  1. Regulation of the PI3K pathway through a p85α monomer–homodimer equilibrium

    KAUST Repository

    Cheung, Lydia W T; Walkiewicz, Katarzyna Wiktoria; Besong, Tabot M.D.; Guo, Huifang; Hawke, David H.; Arold, Stefan T.; Mills, Gordon B.

    2015-01-01

    The canonical action of the p85α regulatory subunit of phosphatidylinositol 3-kinase (PI3K) is to associate with the p110α catalytic subunit to allow stimuli-dependent activation of the PI3K pathway. We elucidate a p110α-independent role of homodimerized p85α in the positive regulation of PTEN stability and activity. p110α-free p85α homodimerizes via two intermolecular interactions (SH3:proline-rich region and BH:BH) to selectively bind unphosphorylated activated PTEN. As a consequence, homodimeric but not monomeric p85α suppresses the PI3K pathway by protecting PTEN from E3 ligase WWP2-mediated proteasomal degradation. Further, the p85α homodimer enhances the lipid phosphatase activity and membrane association of PTEN. Strikingly, we identified cancer patient-derived oncogenic p85α mutations that target the homodimerization or PTEN interaction surface. Collectively, our data suggest the equilibrium of p85α monomerdimers regulates the PI3K pathway and disrupting this equilibrium could lead to disease development. © Cheung et al.

  2. Regulation of the PI3K pathway through a p85α monomer–homodimer equilibrium

    KAUST Repository

    Cheung, Lydia W T

    2015-07-29

    The canonical action of the p85α regulatory subunit of phosphatidylinositol 3-kinase (PI3K) is to associate with the p110α catalytic subunit to allow stimuli-dependent activation of the PI3K pathway. We elucidate a p110α-independent role of homodimerized p85α in the positive regulation of PTEN stability and activity. p110α-free p85α homodimerizes via two intermolecular interactions (SH3:proline-rich region and BH:BH) to selectively bind unphosphorylated activated PTEN. As a consequence, homodimeric but not monomeric p85α suppresses the PI3K pathway by protecting PTEN from E3 ligase WWP2-mediated proteasomal degradation. Further, the p85α homodimer enhances the lipid phosphatase activity and membrane association of PTEN. Strikingly, we identified cancer patient-derived oncogenic p85α mutations that target the homodimerization or PTEN interaction surface. Collectively, our data suggest the equilibrium of p85α monomerdimers regulates the PI3K pathway and disrupting this equilibrium could lead to disease development. © Cheung et al.

  3. Assembly and Molecular Architecture of the Phosphoinositide 3-Kinase p85α Homodimer.

    Science.gov (United States)

    LoPiccolo, Jaclyn; Kim, Seung Joong; Shi, Yi; Wu, Bin; Wu, Haiyan; Chait, Brian T; Singer, Robert H; Sali, Andrej; Brenowitz, Michael; Bresnick, Anne R; Backer, Jonathan M

    2015-12-18

    Phosphoinositide 3-kinases (PI3Ks) are a family of lipid kinases that are activated by growth factor and G-protein-coupled receptors and propagate intracellular signals for growth, survival, proliferation, and metabolism. p85α, a modular protein consisting of five domains, binds and inhibits the enzymatic activity of class IA PI3K catalytic subunits. Here, we describe the structural states of the p85α dimer, based on data from in vivo and in vitro solution characterization. Our in vitro assembly and structural analyses have been enabled by the creation of cysteine-free p85α that is functionally equivalent to native p85α. Analytical ultracentrifugation studies showed that p85α undergoes rapidly reversible monomer-dimer assembly that is highly exothermic in nature. In addition to the documented SH3-PR1 dimerization interaction, we identified a second intermolecular interaction mediated by cSH2 domains at the C-terminal end of the polypeptide. We have demonstrated in vivo concentration-dependent dimerization of p85α using fluorescence fluctuation spectroscopy. Finally, we have defined solution conditions under which the protein is predominantly monomeric or dimeric, providing the basis for small angle x-ray scattering and chemical cross-linking structural analysis of the discrete dimer. These experimental data have been used for the integrative structure determination of the p85α dimer. Our study provides new insight into the structure and assembly of the p85α homodimer and suggests that this protein is a highly dynamic molecule whose conformational flexibility allows it to transiently associate with multiple binding proteins. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Comparative analysis of three-dimensional structures of homodimers of uridine phosphorylase from Salmonella typhimurium in the unligated state and in a complex with potassium ion

    International Nuclear Information System (INIS)

    Lashkov, A. A.; Zhukhlistova, N. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2009-01-01

    The spatial organization of the homodimer of unligated uridine phosphorylase from Salmonella typhimurium (St UPh) was determined with high accuracy. The structure was refined at 1.80 A resolution to R work = 16.1% and R free = 20.0%. The rms deviations for the bond lengths, bond angles, and chiral angles are 0.006 A, 1.042 o , and 0.071 o , respectively. The coordinate error estimated by the Luzzati plot is 0.166 A. The coordinate error based on the maximum likelihood is 0.199 A. A comparative analysis of the spatial organization of the homodimer in two independently refined structures and the structure of the homodimer St UPh in the complex with a K + ion was performed. The substrate-binding sites in the homodimers StUPhs in the unligated state were found to act asynchronously. In the presence of a potassium ion, the three-dimensional structures of the subunits in the homodimer are virtually identical, which is apparently of importance for the synchronous action of both substrate-binding sites. The atomic coordinates of the refined structure of the homodimer and structure factors have been deposited in the Protein Data Bank (PDB ID code 3DPS).

  5. Comparative analysis of three-dimensional structures of homodimers of uridine phosphorylase from Salmonella typhimurium in the unligated state and in a complex with potassium ion

    Energy Technology Data Exchange (ETDEWEB)

    Lashkov, A. A.; Zhukhlistova, N. E.; Gabdulkhakov, A. G.; Mikhailov, A. M., E-mail: amm@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2009-03-15

    The spatial organization of the homodimer of unligated uridine phosphorylase from Salmonella typhimurium (St UPh) was determined with high accuracy. The structure was refined at 1.80 A resolution to R{sub work} = 16.1% and R{sub free} = 20.0%. The rms deviations for the bond lengths, bond angles, and chiral angles are 0.006 A, 1.042{sup o}, and 0.071{sup o}, respectively. The coordinate error estimated by the Luzzati plot is 0.166 A. The coordinate error based on the maximum likelihood is 0.199 A. A comparative analysis of the spatial organization of the homodimer in two independently refined structures and the structure of the homodimer St UPh in the complex with a K{sup +} ion was performed. The substrate-binding sites in the homodimers StUPhs in the unligated state were found to act asynchronously. In the presence of a potassium ion, the three-dimensional structures of the subunits in the homodimer are virtually identical, which is apparently of importance for the synchronous action of both substrate-binding sites. The atomic coordinates of the refined structure of the homodimer and structure factors have been deposited in the Protein Data Bank (PDB ID code 3DPS).

  6. Purification, cloning and characterisation of two forms of thermostable and highly active cellobiohydrolase I (Cel7A) produced by the industrial strain of Chrysosporium lucknowense

    NARCIS (Netherlands)

    Gusakov, A.V.; Sinitsyn, A.P.; Salanovich, T.N.; Bukhtojarov, F.E.; Markov, A.V.; Ustinov, B.B.; Zeijl, C.V.; Punt, P.; Burlingame, R.

    2005-01-01

    Two forms of cellobiohydrolase I (CBH I, Cel7A) were purified from the culture ultrafiltrate of a mutant strain of the fungus Chrysosporium lucknowense, an industrial producer of cellulases and hemicellulases. The enzymes had different molecular masses (52 and 65 kDa, SDS-PAGE data) but the same pI

  7. The asymmetric binding of PGC-1α to the ERRα and ERRγ nuclear receptor homodimers involves a similar recognition mechanism.

    Directory of Open Access Journals (Sweden)

    Maria Takacs

    Full Text Available PGC-1α is a crucial regulator of cellular metabolism and energy homeostasis that functionally acts together with the estrogen-related receptors (ERRα and ERRγ in the regulation of mitochondrial and metabolic gene networks. Dimerization of the ERRs is a pre-requisite for interactions with PGC-1α and other coactivators, eventually leading to transactivation. It was suggested recently (Devarakonda et al that PGC-1α binds in a strikingly different manner to ERRγ ligand-binding domains (LBDs compared to its mode of binding to ERRα and other nuclear receptors (NRs, where it interacts directly with the two ERRγ homodimer subunits.Here, we show that PGC-1α receptor interacting domain (RID binds in an almost identical manner to ERRα and ERRγ homodimers. Microscale thermophoresis demonstrated that the interactions between PGC-1α RID and ERR LBDs involve a single receptor subunit through high-affinity, ERR-specific L3 and low-affinity L2 interactions. NMR studies further defined the limits of PGC-1α RID that interacts with ERRs. Consistent with these findings, the solution structures of PGC-1α/ERRα LBDs and PGC-1α/ERRγ LBDs complexes share an identical architecture with an asymmetric binding of PGC-1α to homodimeric ERR.These studies provide the molecular determinants for the specificity of interactions between PGC-1α and the ERRs, whereby negative cooperativity prevails in the binding of the coactivators to these receptors. Our work indicates that allosteric regulation may be a general mechanism controlling the binding of the coactivators to homodimers.

  8. Characterisation of gold from Fiji

    OpenAIRE

    Naden, Jon; Henney, P.J.

    1995-01-01

    This is a study of the variation in chemistry and inclusion mineralogy of bedrock and placer gold from Fiji. It forms part of a large project, undertaking gold characterisation from a wide range of geological environments in Ecuador, Zimbabwe, Malaysia and Fiji. The work was carried out under the Overseas Development AdministratiodBritish Geological Survey Technology Development and Research programme (Project R5549) as part of the British Government’s provision of technical...

  9. CCS site characterisation criteria

    Energy Technology Data Exchange (ETDEWEB)

    Bachu, S.; Hawkes, C.; Lawton, D.; Pooladi-Darvish, M.; Perkins, E.

    2009-12-15

    IEA GHG recently commissioned the Alberta Research Counil in Canada to conduct a review of storage site selection criteria and site characterisation methods in order to produce a synthesis report. This report reviews the literature on the subject on the site seleciton and characterisation since the publication of the IPCC Special Report on CCS, and provides a synthesis and classification of criteria. 161 refs.

  10. Characterisation of bulk solids

    Energy Technology Data Exchange (ETDEWEB)

    D. McGlinchey [Glasgow Caledonian University, Glasgow (United Kingdom). Centre for Industrial Bulk Solids Handling

    2005-07-01

    Handling of powders and bulk solids is a critical industrial technology across a broad spectrum of industries, including minerals processing. With contributions from leading authors in their respective fields, this book provides the reader with a sound understanding of the techniques, importance and application of particulate materials characterisation. It covers the fundamental characteristics of individual particles and bulk particulate materials, and includes discussion of a wide range of measurement techniques, and the use of material characteristics in design and industrial practice. Contents: Characterising particle properties; Powder mechanics and rheology; Characterisation for hopper and stockpile design; Fluidization behaviour; Characterisation for pneumatic conveyor design; Explosiblility; 'Designer' particle characteristics; Current industrial practice; and Future trends. 130 ills.

  11. Albumin Homodimers in Patients with Cirrhosis: Clinical and Prognostic Relevance of a Novel Identified Structural Alteration of the Molecule.

    Science.gov (United States)

    Baldassarre, Maurizio; Domenicali, Marco; Naldi, Marina; Laggetta, Maristella; Giannone, Ferdinando A; Biselli, Maurizio; Patrono, Daniela; Bertucci, Carlo; Bernardi, Mauro; Caraceni, Paolo

    2016-10-26

    Decompensated cirrhosis is associated to extensive post-transcriptional changes of human albumin (HA). This study aims to characterize the occurrence of HA homodimerization in a large cohort of patients with decompensated cirrhosis and to evaluate its association with clinical features and prognosis. HA monomeric and dimeric isoforms were identified in peripheral blood by using a HPLC-ESI-MS technique in 123 cirrhotic patients hospitalized for acute decompensation and 50 age- and sex-comparable healthy controls. Clinical and biochemical parameters were recorded and patients followed up to one year. Among the monomeric isoforms identified, the N- and C-terminal truncated and the native HA underwent homodimerization. All three homodimers were significantly more abundant in patients with cirrhosis, acute-on-chronic liver failure and correlate with the prognostic scores. The homodimeric N-terminal truncated isoform was independently associated to disease complications and was able to stratify 1-year survival. As a result of all these changes, the monomeric native HA was significantly decreased in patients with cirrhosis, being also associated with a poorer prognosis. In conclusion homodimerization is a novel described structural alteration of the HA molecule in decompensated cirrhosis and contributes to the progressive reduction of the monomeric native HA, the only isoform provided of structural and functional integrity.

  12. Expression, purification, crystallization and preliminary X-ray diffraction analysis of rhesus macaque CD8αα homodimer

    International Nuclear Information System (INIS)

    Zong, Lili; Chen, Yong; Yan, Jinghua; Zhang, Jianhua

    2010-01-01

    CD8α exodomain protein, a crucial immune-system factor in rhesus macaque (M. mulatta), one of the best animal models for vaccine design, was assembled and crystallized. The full structure data will contribute to future studies of immune responses in rhesus macaques. As a T-cell co-receptor, CD8 binds to MHC class I molecules and plays a pivotal role in the activation of cytotoxic T lymphocytes. To date, structures of CD8 have been solved for two different mammals: human and mouse. The infection of rhesus macaques (Macaca mulatta) by simian immunodeficiency virus (SIV) is the best animal model for studying HIV. In this study, the rhesus macaque CD8 (rCD8) αα homodimer was obtained and rCD8α exodomain protein crystals were successfully obtained for further structural analysis. Diffraction data were collected to a resolution of 2.4 Å. The crystal belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 46.52, b = 56.28, c = 82.40 Å. These data will facilitate further studies on the structural differences between these CD8 structures and the cellular immune responses of rhesus macaque

  13. Characterisation of mouse prothymocytes

    NARCIS (Netherlands)

    W.J.A. Boersma (Wim)

    1982-01-01

    textabstractIn this thesis, the study of growth kinetics of thymocytes in lethally irradiated mice as a means to characterise the early T-cell progenitors is described. Normal bone marrow cells were used as the source of hemopoietic cells. The experiments show that it is possible to obtain

  14. Characterisation of mouse prothymocytes

    NARCIS (Netherlands)

    Boersma, W.J.A.

    1982-01-01

    In this thesis, the study of growth kinetics of thymocytes in lethally irradiated mice as a means to characterise the early T-cell progenitors is described. Normal bone marrow cells were used as the source of hemopoietic cells. The experiments show that it is possible to obtain information on T-cell

  15. Nodeless vibrational amplitudes and quantum nonadiabatic dynamics in the nested funnel for a pseudo Jahn-Teller molecule or homodimer

    Science.gov (United States)

    Peters, William K.; Tiwari, Vivek; Jonas, David M.

    2017-11-01

    The nonadiabatic states and dynamics are investigated for a linear vibronic coupling Hamiltonian with a static electronic splitting and weak off-diagonal Jahn-Teller coupling through a single vibration with a vibrational-electronic resonance. With a transformation of the electronic basis, this Hamiltonian is also applicable to the anti-correlated vibration in a symmetric homodimer with marginally strong constant off-diagonal coupling, where the non-adiabatic states and dynamics model electronic excitation energy transfer or self-exchange electron transfer. For parameters modeling a free-base naphthalocyanine, the nonadiabatic couplings are deeply quantum mechanical and depend on wavepacket width; scalar couplings are as important as the derivative couplings that are usually interpreted to depend on vibrational velocity in semiclassical curve crossing or surface hopping theories. A colored visualization scheme that fully characterizes the non-adiabatic states using the exact factorization is developed. The nonadiabatic states in this nested funnel have nodeless vibrational factors with strongly avoided zeroes in their vibrational probability densities. Vibronic dynamics are visualized through the vibrational coordinate dependent density of the time-dependent dipole moment in free induction decay. Vibrational motion is amplified by the nonadiabatic couplings, with asymmetric and anisotropic motions that depend upon the excitation polarization in the molecular frame and can be reversed by a change in polarization. This generates a vibrational quantum beat anisotropy in excess of 2/5. The amplitude of vibrational motion can be larger than that on the uncoupled potentials, and the electronic population transfer is maximized within one vibrational period. Most of these dynamics are missed by the adiabatic approximation, and some electronic and vibrational motions are completely suppressed by the Condon approximation of a coordinate-independent transition dipole between

  16. Waste package characterisation

    Energy Technology Data Exchange (ETDEWEB)

    Sannen, L.; Bruggeman, M.; Wannijn, J.P

    1998-09-01

    Radioactive wastes originating from the hot labs of the Belgian Nuclear Research Centre SCK-CEN contain a wide variety of radiotoxic substances. The accurate characterisation of the short- and long-term radiotoxic components is extremely difficult but required in view of geological disposal. This paper describes the methodology which was developed and adopted to characterise the high- and medium-level waste packages at the SCK-CEN hot laboratories. The proposed method is based on the estimation of the fuel inventory evacuated in a particular waste package; a calculation of the relative fission product contribution on the fuel fabrication and irradiation footing; a comparison of the calculated, as expected, dose rate and the real measured dose rate of the waste package. To cope with the daily practice an appropriate fuel inventory estimation route, a user friendly computer programme for fission product and corresponding dose rate calculation, and a simple dose rate measurement method have been developed and implemented.

  17. Waste package characterisation

    International Nuclear Information System (INIS)

    Sannen, L.; Bruggeman, M.; Wannijn, J.P.

    1998-09-01

    Radioactive wastes originating from the hot labs of the Belgian Nuclear Research Centre SCK-CEN contain a wide variety of radiotoxic substances. The accurate characterisation of the short- and long-term radiotoxic components is extremely difficult but required in view of geological disposal. This paper describes the methodology which was developed and adopted to characterise the high- and medium-level waste packages at the SCK-CEN hot laboratories. The proposed method is based on the estimation of the fuel inventory evacuated in a particular waste package; a calculation of the relative fission product contribution on the fuel fabrication and irradiation footing; a comparison of the calculated, as expected, dose rate and the real measured dose rate of the waste package. To cope with the daily practice an appropriate fuel inventory estimation route, a user friendly computer programme for fission product and corresponding dose rate calculation, and a simple dose rate measurement method have been developed and implemented

  18. Soil Radiological Characterisation Methodology

    International Nuclear Information System (INIS)

    Attiogbe, Julien; Aubonnet, Emilie; De Maquille, Laurence; De Moura, Patrick; Desnoyers, Yvon; Dubot, Didier; Feret, Bruno; Fichet, Pascal; Granier, Guy; Iooss, Bertrand; Nokhamzon, Jean-Guy; Ollivier Dehaye, Catherine; Pillette-Cousin, Lucien; Savary, Alain

    2014-12-01

    This report presents the general methodology and best practice approaches which combine proven existing techniques for sampling and characterisation to assess the contamination of soils prior to remediation. It is based on feedback of projects conducted by main French nuclear stakeholders involved in the field of remediation and dismantling (EDF, CEA, AREVA and IRSN). The application of this methodology will enable the project managers to obtain the elements necessary for the drawing up of files associated with remediation operations, as required by the regulatory authorities. It is applicable to each of the steps necessary for the piloting of remediation work-sites, depending on the objectives targeted (release into the public domain, re-use, etc.). The main part describes the applied statistical methodology with the exploratory analysis and variogram data, identification of singular points and their location. The results obtained permit assessment of a mapping to identify the contaminated surface and subsurface areas. It stakes the way for radiological site characterisation since the initial investigations from historical and functional analysis to check that the remediation objectives have been met. It follows an example application from the feedback of the remediation of a contaminated site on the Fontenay aux Roses facility. It is supplemented by a glossary of main terms used in the field from different publications or international standards. This technical report is a support of the ISO Standard ISO ISO/TC 85/SC 5 N 18557 'Sampling and characterisation principles for soils, buildings and infrastructures contaminated by radionuclides for remediation purposes'. (authors) [fr

  19. Characterisation of humic material for inter-laboratory comparison

    International Nuclear Information System (INIS)

    Peachy, D.; Bradley, A.D.; Davis, A.E.; Stuart, M.E.; Tait, B.A.R.; Vickers, B.P.; Williams, G.M.

    1988-01-01

    The characterisation and interlaboratory comparison of common humic materials by members of the European Commission's COCO group (set up to study complexes and colloids), forms part of a study of the effects of natural organic compounds in groundwater on the complexation and mobility of radionuclides. Three samples have been characterised: a sodium salt and a protonated form of the commercially available humic acid from Aldrich Chemicals; and a protonated humic acid from the Gorleben research site in Germany. Characterisation undertaken by BGS includes moisture content, elemental analysis, metal content, functional group analysis, infra-red spectroscopy, ultra-violet absorbance (E 4 /E 6 ratios), and ultra-filtration. (author)

  20. Characterisation of polymers, 1

    CERN Document Server

    Crompton, Roy

    2008-01-01

    This essential guide to Polymer Characterisation is a complete compendium of methodologies that have evolved for the determination of the chemical composition of polymers. This 478-page book gives an up-to-date and thorough exposition of the state-of-the-art theories and availability of instrumentation needed to effect chemical and physical analysis of polymers. This is supported by approximately 1200 references. Volume 1 covers the methodology used for the determination of metals, non-metals and organic functional groups in polymers, and for the determination of the ratio in which different m

  1. ONKALO. Underground characterisation and research programme (UCRP)

    International Nuclear Information System (INIS)

    2003-09-01

    impacts of ONKALO's construction and operation. Basically all geoscientific disciplines, geology, hydrogeology, geochemistry and rock mechanics follow the same workflow. Integration between modelling in different disciplines is essential and an integrated modelling task force will be formed. Posiva will also use ONKALO for tests and experiments, in which the site-specific conditions at Olkiluoto have to be taken into account. The detailed programme for such testing will be developed once the tunnel progresses further. Already at present specific tests are planned related to construction and characterisation issues. These involve exploration of the mechanical and chemical impact on the rock and the impact of grouting. (orig.)

  2. Binding of superantigen toxins into the CD28 homodimer interface is essential for induction of cytokine genes that mediate lethal shock.

    Directory of Open Access Journals (Sweden)

    Gila Arad

    2011-09-01

    Full Text Available Bacterial superantigens, a diverse family of toxins, induce an inflammatory cytokine storm that can lead to lethal shock. CD28 is a homodimer expressed on T cells that functions as the principal costimulatory ligand in the immune response through an interaction with its B7 coligands, yet we show here that to elicit inflammatory cytokine gene expression and toxicity, superantigens must bind directly into the dimer interface of CD28. Preventing access of the superantigen to CD28 suffices to block its lethality. Mice were protected from lethal superantigen challenge by short peptide mimetics of the CD28 dimer interface and by peptides selected to compete with the superantigen for its binding site in CD28. Superantigens use a conserved β-strand/hinge/α-helix domain of hitherto unknown function to engage CD28. Mutation of this superantigen domain abolished inflammatory cytokine gene induction and lethality. Structural analysis showed that when a superantigen binds to the T cell receptor on the T cell and major histocompatibility class II molecule on the antigen-presenting cell, CD28 can be accommodated readily as third superantigen receptor in the quaternary complex, with the CD28 dimer interface oriented towards the β-strand/hinge/α-helix domain in the superantigen. Our findings identify the CD28 homodimer interface as a critical receptor target for superantigens. The novel role of CD28 as receptor for a class of microbial pathogens, the superantigen toxins, broadens the scope of pathogen recognition mechanisms.

  3. Characterising Super-Earths

    Directory of Open Access Journals (Sweden)

    Valencia D.

    2011-02-01

    Full Text Available The era of Super-Earths has formally begun with the detection of transiting low-mass exoplanets CoRoT-7b and GJ 1214b. In the path of characterising super-Earths, the first step is to infer their composition. While the discovery data for CoRoT-7b, in combination with the high atmospheric mass loss rate inferred from the high insolation, suggested that it was a rocky planet, the new proposed mass values have widened the possibilities. The combined mass range 1−10 M⊕ allows for a volatile-rich (and requires it if the mass is less than 4 M⊕ , an Earth-like or a super-Mercury-like composition. In contrast, the radius of GJ 1214b is too large to admit a solid composition, thus it necessarily to have a substantial gas layer. Some evidence suggests that within this gas layer H/He is a small but non-negligible component. These two planets are the first of many transiting low-mass exoplanets expected to be detected and they exemplify the limitations faced when inferring composition, which come from the degenerate character of the problem and the large error bars in the data.

  4. Characterisation of areal surface texture

    CERN Document Server

    Leach, Richard

    2014-01-01

    This book presents the areal framework that is being adopted by the international community, concentrating on characterisation methods, and presenting case studies highlighting use of areal methods in applications from automobile manufacturing to archaeology.

  5. The neonatal Fc receptor (FcRn) binds independently to both sites of the IgG homodimer with identical affinity.

    Science.gov (United States)

    Abdiche, Yasmina Noubia; Yeung, Yik Andy; Chaparro-Riggers, Javier; Barman, Ishita; Strop, Pavel; Chin, Sherman Michael; Pham, Amber; Bolton, Gary; McDonough, Dan; Lindquist, Kevin; Pons, Jaume; Rajpal, Arvind

    2015-01-01

    The neonatal Fc receptor (FcRn) is expressed by cells of epithelial, endothelial and myeloid lineages and performs multiple roles in adaptive immunity. Characterizing the FcRn/IgG interaction is fundamental to designing therapeutic antibodies because IgGs with moderately increased binding affinities for FcRn exhibit superior serum half-lives and efficacy. It has been hypothesized that 2 FcRn molecules bind an IgG homodimer with disparate affinities, yet their affinity constants are inconsistent across the literature. Using surface plasmon resonance biosensor assays that eliminated confounding experimental artifacts, we present data supporting an alternate hypothesis: 2 FcRn molecules saturate an IgG homodimer with identical affinities at independent sites, consistent with the symmetrical arrangement of the FcRn/Fc complex observed in the crystal structure published by Burmeister et al. in 1994. We find that human FcRn binds human IgG1 with an equilibrium dissociation constant (KD) of 760 ± 60 nM (N = 14) at 25°C and pH 5.8, and shows less than 25% variation across the other human subtypes. Human IgG1 binds cynomolgus monkey FcRn with a 2-fold higher affinity than human FcRn, and binds both mouse and rat FcRn with a 10-fold higher affinity than human FcRn. FcRn/IgG interactions from multiple species show less than a 2-fold weaker affinity at 37°C than at 25°C and appear independent of an IgG's variable region. Our in vivo data in mouse and rat models demonstrate that both affinity and avidity influence an IgG's serum half-life, which should be considered when choosing animals, especially transgenic systems, as surrogates.

  6. Radiological characterisation experience with Magnox reactors

    International Nuclear Information System (INIS)

    Westall, Bill A.; Towton, Barbara

    2012-01-01

    At the end of generation, power reactors will be decommissioned. Whether decommissioning is prompt or deferred, knowledge of the radioactive inventory of plant and structures is needed to develop and underpin the decommissioning strategy. As decommissioning progresses the level of detail required for the radioactive inventory increases as more specific and detailed questions need answering. Failure to adequately characterise will result in increased costs and project overruns due to missing optimal solutions, over pessimistic assumptions or unforeseen problems and regulatory issues. Radiological characterisation for decommissioning of Magnox power stations in the UK has been in progress for over a quarter of a century. Firstly measurements and calculations were carried out to develop a strategy. These have been followed by measurements to determine radioactive inventories of waste streams and packages or to allow decontamination of structures and most recently for partial de-licensing of sites. Some examples of the work carried out for the Magnox stations will be given, ranging from the neutron activation calculations to estimate the radioactive inventory within a bio-shield and measurements to validate them. Various plant and structures where the radioactive inventory is due to contamination have been characterised by measurements and examples for boilers and cooling ponds will be discussed. Various routine and ad-hoc measurements and shielding assessments have been performed on waste forms to help satisfy conditions for acceptance for disposal or exemption, which will be reviewed. Finally the measurements for de-licensing and the successful application of Data Quality Objectives will be addressed. (authors)

  7. Characterisation of Ductile Prepregs

    Science.gov (United States)

    Pinto, F.; White, A.; Meo, M.

    2013-04-01

    This study is focused on the analysis of micro-perforated prepregs created from standard, off the shelf prepregs modified by a particular laser process to enhance ductility of prepregs for better formability and drapability. Fibres are shortened through the use of laser cutting in a predetermined pattern intended to maintain alignment, and therefore mechanical properties, yet increase ductility at the working temperature. The increase in ductility allows the product to be more effectively optimised for specific forming techniques. Tensile tests were conducted on several specimens in order to understand the ductility enhancement offered by this process with different micro-perforation patterns over standard prepregs. Furthermore, the effects of forming temperature was also analysed to assess the applicability of this material to hot draping techniques and other heated processes.

  8. Radiological characterisation - Know your objective

    International Nuclear Information System (INIS)

    Lindow, Veronica; Moeller, Jennifer

    2012-01-01

    When developing a programme for mapping the radiological characteristics of a facility to be decommissioned it is important to take into account the objectives of the programme. Will the results be used to plan for radiological control and selection of appropriate decontamination and dismantling techniques? Will the radiological inventory be used for dimensioning of future waste repositories? These are two examples of the applications for such studies, which could require that a radiological characterisation programme be adapted to provide the data appropriate to the intended use. The level of detail and scope needed for a radiological characterisation will also vary depending on how the data will be used. An application to free-release a facility requires a comprehensive survey and well documented analysis in order to ensure that no radioactive contamination above prescribed levels is present. A bounding calculation to determine the maximum anticipated volumes and activity of radioactive waste requires a different approach. During the past few years, older decommissioning studies for the Swedish nuclear power plants have been updated (or are in the process of being updated). The decommissioning study's main purpose is to estimate the cost for decommissioning. The cost estimation is based on material and activity inventories, which in turn is based on previous and, in some cases, updated radiological characterisations of the facilities. The radiological inventory is an important part of the study as it affects the cost of decommissioning but also the uncertainties and accuracy of the cost estimation. The presentation will discuss the challenges in specifying a radiological characterisation programme with multiple objectives, together with insights on how data delivered can be applied to yield results suitable for the intended purpose, without introducing excessive conservatism. The intent of the presentation is to define issues that can be of use in various aspects

  9. The characterisation of precipitated magnetites

    International Nuclear Information System (INIS)

    Rush, D.F.; Segal, D.L.

    1982-06-01

    Methods are described for the preparation of magnetite by precipitation from aqueous solutions of iron(II) and iron(III) salts. The magnetites have been characterised by transmission electron microscopy, chemical analysis and X-ray diffraction. Transmission Moessbauer spectroscopy has also been used to characterise precipitated magnetites and a comparison of the spectra has been made with those obtained from nickel ferrite and hydrated ferric oxides. The hydrothermal stability of magnetite at 573 K has also been investigated. This work is relevant to corrosion processes that can occur in the water coolant circuits of nuclear reactors. (author)

  10. Database characterisation of HEP applications

    International Nuclear Information System (INIS)

    Piorkowski, Mariusz; Grancher, Eric; Topurov, Anton

    2012-01-01

    Oracle-based database applications underpin many key aspects of operations for both the LHC accelerator and the LHC experiments. In addition to the overall performance, the predictability of the response is a key requirement to ensure smooth operations and delivering predictability requires understanding the applications from the ground up. Fortunately, database management systems provide several tools to check, measure, analyse and gather useful information. We present our experiences characterising the performance of several typical HEP database applications performance characterisations that were used to deliver improved predictability and scalability as well as for optimising the hardware platform choice as we migrated to new hardware and Oracle 11g.

  11. The NF-κB p65 and p50 homodimer cooperate with IRF8 to activate iNOS transcription

    International Nuclear Information System (INIS)

    Simon, Priscilla S.; Sharman, Sarah K.; Lu, Chunwan; Yang, Dafeng; Paschall, Amy V.; Tulachan, Sidhartha S.; Liu, Kebin

    2015-01-01

    observed that the p65/p65 and p50/p50 homodimers, not the canonical p65/p50 heterodimer, directly binds to the nos2 promoter to regulate iNOS expression in myeloid cells. IFNγ-induced IRF8 acts in concert with NF-κB to regulate iNOS expression in both colon carcinoma and myeloid cells. In myeloid cells, the NF-κB complexes that bind to the nos2 promoter are p65/p65 and p50/p50 homodimers

  12. Characterisation of subsonic axisymmetric nozzles

    Czech Academy of Sciences Publication Activity Database

    Tesař, Václav

    2008-01-01

    Roč. 86, č. 11 (2008), s. 1253-1262 ISSN 0263-8762 R&D Projects: GA AV ČR IAA200760705 Institutional research plan: CEZ:AV0Z20760514 Keywords : nozzle * characterisation * nozzle properties * nozzle invariants Subject RIV: BK - Fluid Dynamics Impact factor: 0.989, year: 2008

  13. Sensory analysis of characterising flavours

    NARCIS (Netherlands)

    Krüsemann, Erna J.Z.; Lasschuijt, Marlou P.; Graaf, de C.; Wijk, de René A.; Punter, Pieter H.; Tiel, van Loes; Cremers, Johannes W.J.M.; Nobelen, van de Suzanne; Boesveldt, Sanne; Talhout, Reinskje

    2018-01-01

    Objectives: Tobacco flavours are an important regulatory concept in several jurisdictions, for example in the USA, Canada and Europe. The European Tobacco Products Directive 2014/40/EU prohibits cigarettes and roll-your-own tobacco having a characterising flavour. This directive defines

  14. Quantitative Characterisation of Surface Texture

    DEFF Research Database (Denmark)

    De Chiffre, Leonardo; Lonardo, P.M.; Trumpold, H.

    2000-01-01

    This paper reviews the different methods used to give a quantitative characterisation of surface texture. The paper contains a review of conventional 2D as well as 3D roughness parameters, with particular emphasis on recent international standards and developments. It presents new texture...

  15. Characterising performance of environmental models

    NARCIS (Netherlands)

    Bennett, N.D.; Croke, B.F.W.; Guariso, G.; Guillaume, J.H.A.; Hamilton, S.H.; Jakeman, A.J.; Marsili-Libelli, S.; Newham, L.T.H.; Norton, J.; Perrin, C.; Pierce, S.; Robson, B.; Seppelt, R.; Voinov, A.; Fath, B.D.; Andreassian, V.

    2013-01-01

    In order to use environmental models effectively for management and decision-making, it is vital to establish an appropriate level of confidence in their performance. This paper reviews techniques available across various fields for characterising the performance of environmental models with focus

  16. Characterisations of Partition of Unities Generated by Entire Functions in Cd

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young

    2017-01-01

    Collections of functions forming a partition of unity play an important role in analysis. In this paper we characterise for any N∈N the entire functions P for which the partition of unity condition ∑n∈ZdP(x+n)χ[0,N]d(x+n)=1 holds for all x∈Rd. The general characterisation leads to various easy wa...

  17. Comparison of central HER2 testing with quantitative total HER2 expression and HER2 homodimer measurements using a novel proximity-based assay.

    Science.gov (United States)

    Huang, Weidong; Reinholz, Monica; Weidler, Jodi; Yolanda, Lie; Paquet, Agnes; Whitcomb, Jeannette; Lingle, Wilma; Jenkins, Robert B; Chen, Beiyun; Larson, Jeffrey S; Tan, Yuping; Sherwood, Thomas; Bates, Michael; Perez, Edith A

    2010-08-01

    The accuracy and reliability of immunohistochemical analysis and in situ hybridization for the assessment of HER2 status remains a subject of debate. We developed a novel assay (HERmark Breast Cancer Assay, Monogram Biosciences, South San Francisco, CA) that provides precise quantification of total HER2 protein expression (H2T) and HER2 homodimers (H2D) in formalin-fixed, paraffin-embedded tissue specimens. H2T and H2D results of 237 breast cancers were compared with those of immunohistochemical studies and fluorescence in situ hybridization (FISH) centrally performed at the Mayo Clinic, Rochester, MN. H2T described a continuum across a wide dynamic range ( approximately 2.5 log). Excluding the equivocal cases, HERmark showed 98% concordance with immunohistochemical studies for positive and negative assay values. For the 94 immunohistochemically equivocal cases, 67% and 39% concordance values were observed between HERmark and FISH for positive and negative assay values, respectively. Polysomy 17 in the absence of HER2 gene amplification did not result in HER2 overexpression as evaluated quantitatively using the HERmark assay.

  18. Characterisation of Silicon Pad Diodes

    CERN Document Server

    Hodson, Thomas Connor

    2017-01-01

    Silicon pad sensors are used in high luminosity particle detectors because of their excellent timing resolution, radiation tolerance and possible high granularity. The effect of different design decisions on detector performance can be investigated nondestructively through electronic characterisation of the sensor diodes. Methods for making accurate measurements of leakage current and cell capacitance are described using both a standard approach with tungsten needles and an automated approach with a custom multiplexer and probing setup.

  19. Image analysis for material characterisation

    Science.gov (United States)

    Livens, Stefan

    In this thesis, a number of image analysis methods are presented as solutions to two applications concerning the characterisation of materials. Firstly, we deal with the characterisation of corrosion images, which is handled using a multiscale texture analysis method based on wavelets. We propose a feature transformation that deals with the problem of rotation invariance. Classification is performed with a Learning Vector Quantisation neural network and with combination of outputs. In an experiment, 86,2% of the images showing either pit formation or cracking, are correctly classified. Secondly, we develop an automatic system for the characterisation of silver halide microcrystals. These are flat crystals with a triangular or hexagonal base and a thickness in the 100 to 200 nm range. A light microscope is used to image them. A novel segmentation method is proposed, which allows to separate agglomerated crystals. For the measurement of shape, the ratio between the largest and the smallest radius yields the best results. The thickness measurement is based on the interference colours that appear for light reflected at the crystals. The mean colour of different thickness populations is determined, from which a calibration curve is derived. With this, the thickness of new populations can be determined accurately.

  20. Formation of disulfide bonds and homodimers of the major cat allergen Fel d 1 equivalent to the natural allergen by expression in Escherichia coli.

    Science.gov (United States)

    Grönlund, Hans; Bergman, Tomas; Sandström, Kristofer; Alvelius, Gunvor; Reininger, Renate; Verdino, Petra; Hauswirth, Alexander; Liderot, Karin; Valent, Peter; Spitzauer, Susanne; Keller, Walter; Valenta, Rudolf; van Hage-Hamsten, Marianne

    2003-10-10

    Dander from the domestic cat (Felis domesticus) is one of the most common causes of IgE-mediated allergy. Attempts to produce tetrameric folded major allergen Fel d 1 by recombinant methods with structural features similar to the natural allergen have been only partially successful. In this study, a recombinant folded Fel d 1 with molecular and biological properties similar to the natural counterpart was produced. A synthetic gene coding for direct fusion of the Fel d 1 chain 2 N-terminally to chain 1 was constructed by overlapping oligonucleotides in PCR. Escherichia coli expression resulted in a non-covalently associated homodimer with an apparent molecular mass of 30 kDa defined by size exclusion chromatography. Furthermore, each 19,177-Da subunit displayed a disulfide pattern identical to that found in the natural Fel d 1, i.e. Cys3(1) Cys73(2), Cys44(1)-Cys48(2), Cys70(1)-Cys7(2), as determined by electrospray mass spectrometry after tryptic digestion. Circular dichroism analysis showed identical folds of natural and recombinant Fel d 1. Furthermore, recombinant Fel d l reacted specifically with serum IgE, inducing expression of CD203c on basophils and lymphoproliferative responses in cat-allergic patients. The results show that the overall fold and immunological properties of the recombinant Fel d 1 are very similar to those of natural Fel d 1. Moreover, the recombinant Fel d 1 construct provides a tool for defining the three-dimensional structure of Fel d 1 and represents a reagent for diagnosis and allergen-specific immunotherapy of cat allergy.

  1. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  2. An extended characterisation theorem for quantum logics

    International Nuclear Information System (INIS)

    Sharma, C.S.; Mukherjee, M.K.

    1977-01-01

    Two theorems are proved. In the first properties of an important mapping from an orthocomplemented lattice to itself are studied. In the second the characterisation theorem of Zierler (Pacific J. Math.; 11:1151 (1961)) is extended to obtain a very useful theorem characterising orthomodular lattices. Since quantum logics are merely sigma-complete orthomodular lattices, the principal result is, for application in quantum physics, a characterisation theorem for quantum logics. (author)

  3. Superficially located enlarged lymphoid follicles characterise nodular gastritis.

    Science.gov (United States)

    Okamura, Takuma; Sakai, Yasuhiro; Hoshino, Hitomi; Iwaya, Yugo; Tanaka, Eiji; Kobayashi, Motohiro

    2015-01-01

    Nodular gastritis is a form of chronic Helicobacter pylori gastritis affecting the gastric antrum and characterised endoscopically by the presence of small nodular lesions resembling gooseflesh. It is generally accepted that hyperplasia of lymphoid follicles histologically characterises nodular gastritis; however, quantitative analysis in support of this hypothesis has not been reported. Our goal was to determine whether nodular gastritis is characterised by lymphoid follicle hyperplasia.The number, size, and location of lymphoid follicles in nodular gastritis were determined and those properties compared to samples of atrophic gastritis. The percentages of high endothelial venule (HEV)-like vessels were also evaluated.The number of lymphoid follicles was comparable between nodular and atrophic gastritis; however, follicle size in nodular gastritis was significantly greater than that seen in atrophic gastritis. Moreover, lymphoid follicles in nodular gastritis were positioned more superficially than were those in atrophic gastritis. The percentage of MECA-79 HEV-like vessels was greater in areas with gooseflesh-like lesions in nodular versus atrophic gastritis.Superficially located hyperplastic lymphoid follicles characterise nodular gastritis, and these follicles correspond to gooseflesh-like nodular lesions observed endoscopically. These observations suggest that MECA-79 HEV-like vessels could play at least a partial role in the pathogenesis of nodular gastritis.

  4. 16 kDa heat shock protein from heat-inactivated Mycobacterium tuberculosis is a homodimer - suitability for diagnostic applications with specific llama VHH monoclonals.

    Directory of Open Access Journals (Sweden)

    Saurabh K Srivastava

    Full Text Available BACKGROUND: The 16 kDa heat shock protein (HSP is an immuno-dominant antigen, used in diagnosis of infectious Mycobacterium tuberculosis (M.tb. causing tuberculosis (TB. Its use in serum-based diagnostics is limited, but for the direct identification of M.tb. bacteria in sputum or cultures it may represent a useful tool. Recently, a broad set of twelve 16 kDa specific heavy chain llama antibodies (VHH has been isolated, and their utility for diagnostic applications was explored. METHODOLOGY/PRINCIPAL FINDINGS: To identify the epitopes recognized by the nine (randomly selected from a set of twelve 16 kDa specific VHH antibodies distinct VHH antibodies, 14 overlapping linear epitopes (each 20 amino acid long were characterized using direct and sandwich ELISA techniques. Seven out of 14 epitopes were recognized by 8 out of 9 VHH antibodies. The two highest affinity binders B-F10 and A-23 were found to bind distinct epitopes. Sandwich ELISA and SPR experiments showed that only B-F10 was suitable as secondary antibody with both B-F10 and A-23 as anchoring antibodies. To explain this behavior, the epitopes were matched to the putative 3D structure model. Electrospray ionization time-of-flight mass spectrometry and size exclusion chromatography were used to determine the higher order conformation. A homodimer model best explained the differential immunological reactivity of A-23 and B-F10 against heat-treated M.tb. lysates. CONCLUSIONS/SIGNIFICANCE: The concentrations of secreted antigens of M.tb. in sputum are too low for immunological detection and existing kits are only used for identifying M.tb. in cultures. Here we describe how specific combinations of VHH domains could be used to detect the intracellular HSP antigen. Linked to methods of pre-concentrating M.tb. cells prior to lysis, HSP detection may enable the development of protein-based diagnostics of sputum samples and earlier diagnosis of diseases.

  5. Health Behaviour Change Through Computer Games: Characterising Interventions.

    Science.gov (United States)

    Poultney, Nathan; Maeder, Anthony; Ginige, Jeewani Anupama

    2016-01-01

    Recently games in the form of video, computer, or mobile apps have been utilised as an effective component of interventions for health behaviour change. This paper provides an overview of related projects reported in peer-review literature in the period 2006 to 2016. Nine highly relevant references were considered for analysis. The findings are presented according to 3 dimensions of characterisation: health intention, behaviour change principle, and health purpose.

  6. Characterisation of TRISO fuel particles

    International Nuclear Information System (INIS)

    Lopez H, E.; Yang, D.

    2012-10-01

    The TRISO (tri structural isotropic) coated fuel particle is a key component contributing to the inherent safety of the High Temperature Reactor. A uranium kernel is coated with three layers of pyrolytic carbon and one of silicon carbide. The purpose of these coatings is to work as a miniature fission product containment vessel capable of enclosing all important radio nuclei under normal and off-normal reactor operating conditions. Due to the importance of these coatings, is of great interest to establish characterisation techniques capable of providing a detailed description of their microstructure and physical properties. Here we describe the use of Raman spectroscopy and two modulator generalised ellipsometry to study the anisotropy and thermal conductivity of pyrolytic carbon coatings, as well as the stoichiometry of the silicon carbide coatings and fibres. (Author)

  7. Characterising Complex Enzyme Reaction Data.

    Directory of Open Access Journals (Sweden)

    Handan Melike Dönertaş

    Full Text Available The relationship between enzyme-catalysed reactions and the Enzyme Commission (EC number, the widely accepted classification scheme used to characterise enzyme activity, is complex and with the rapid increase in our knowledge of the reactions catalysed by enzymes needs revisiting. We present a manual and computational analysis to investigate this complexity and found that almost one-third of all known EC numbers are linked to more than one reaction in the secondary reaction databases (e.g., KEGG. Although this complexity is often resolved by defining generic, alternative and partial reactions, we have also found individual EC numbers with more than one reaction catalysing different types of bond changes. This analysis adds a new dimension to our understanding of enzyme function and might be useful for the accurate annotation of the function of enzymes and to study the changes in enzyme function during evolution.

  8. Characterisation of wood combustion ashes

    DEFF Research Database (Denmark)

    Maresca, Alberto

    The combustion of wood chips and wood pellets for the production of renewable energy in Denmark increased from 5.7 PJ to 16 PJ during the period 2000-2015, and further increases are expected to occur within the coming years. In 2012, about 22,300 tonnes of wood ashes were generated in Denmark....... Currently, these ashes are mainly landfilled, despite Danish legislation allowing their application onto forest and agricultural soils for fertilising and/or liming purposes. During this PhD work, 16 wood ash samples generated at ten different Danish combustion plants were collected and characterised...... for their composition and leaching properties. Despite the relatively large variations in the contents of nutrients and trace metals, the overall levels were comparable to typical ranges reported in the literature for other wood combustion ashes, as well as with regards to leaching. In general, the composition...

  9. Characterisation of radiation crosslinked polydimethylsiloxane

    International Nuclear Information System (INIS)

    Preston, C.M.L.; Hill, D.J.T.; Pomery, P.J.; Whittaker, A.K.

    1998-01-01

    Polysiloxanes, or silicones, are used widely in industry, as lubricants and process additives, as well as in many household products. The most common of the silicones is polydimethylsiloxane (PDMS). The fact that silicones crosslink during exposure to high energy radiation is well established. However, despite the number of studies performed on these systems, the exact mechanism of crosslinking has yet to be determined. Nuclear Magnetic Resonance spectroscopy (NMR) provides a useful method for the analysis of crosslinked polymer systems. Linear uncrosslinked PDMS is easily characterised in the solution state by NMR, as PDMS is readily soluble in common organic solvents. However, the onset of gelation caused by crosslinking results in an insoluble polymer network. The use of cross-polarisation (CP) and magic-angle spinning (MAS) in conjunction with high power decoupling has been shown to greatly enhance sensitivity of the NMR technique in solids. The true mechanism of crosslinking between polymer chains will be discussed

  10. Characterisation of Tmmmian Local Sorghmn Varieties

    African Journals Online (AJOL)

    Many local varieties of sorghum grown in Tanzania have not been characterised in terms of their end uses. This study was conducted to characterise 14 such varieties. Three improved varieties commonly grown in this country were includedfor comparison. Physical analyses that included 100-grain weight, percent dehulling ...

  11. Characterisation of wastewater for modelling of wastewater ...

    African Journals Online (AJOL)

    Bio-process modelling is increasingly used in design, modification and troubleshooting of wastewater treatment plants (WWTPs). Characterisation of the influent wastewater to a WWTP is an important part of developing such a model. The characterisation required for modelling is more detailed than that routinely employed ...

  12. IAEA Perspectives on Radiological Characterisation

    International Nuclear Information System (INIS)

    O'Sullivan, Patrick; Ljubenov, Vladan

    2012-01-01

    Requirements for characterization of radiological and other hazards in nuclear facilities are reflected in the IAEA Safety Standards. WS-R-5, Safety Requirements for Decommissioning of Facilities using Radioactive Material, includes a requirement that 'During the preparation of the final decommissioning plan, the extent and type of radioactive material (irradiated and contaminated structures and components) at the facility shall be determined by means of a detailed characterization survey and on the basis of records collected during the operational period'. The subsidiary Safety Guide WS-G-2.1, Decommissioning of Nuclear Power Plants and Research Reactors, further elaborates that 'A survey of radiological and non-radiological hazards provides an important input for the safety assessment and for implementing a safe approach during the work'. Although the characterisation requirements addressed in the Safety Standards relate primarily to the detailed survey activities undertaken following the shutdown of the facility, it is evident that radiological characterization is of relevance to all major phases of the lifetime of a nuclear facility, including: - the siting phase - baseline surveys are undertaken to determine background radiation levels; - the construction phase - construction materials are retained to support future calculations of radioactivity distributions; - the operational phase - surveys are done regularly, with additional surveys being required following incidents involving plant contamination; - the transition phase - detailed radiological surveys are required to support the development of the final decommissioning plan; and - the closure phase - a final survey of the site and any remaining structures will be needed to support an application for release of the site from regulatory control. In the case of facilities that are already shut down, the main purpose of radiological characterisation is to provide a reliable database of information on the

  13. Physiochemical characterisation of mangafodipir trisodium

    International Nuclear Information System (INIS)

    Tirkkonen, B.; Grace, D.; Haile, Y.; Holm, K.M.; Hope, H.; Larsen, Aa.; Lunde, H.S.; Sjoegren, C.E.

    1997-01-01

    Purpose: To determine the structure and various physicochemical properties of mangafodipir (MnDPDP) trisodium, the active ingredient of Teslascan, a new organ-specific contrast medium for MR imaging. Material and Methods: The structure of MnDPDP trisodium crystals was determined by X-ray crystallography. The possible existence of polymorphism in MnDPDI trisodium was evaluated by powder X-ray diffraction, optical microscopy, thermal analysis and IR spectroscopy. In addition, various spectroscopic techniques and phyicochemical measurements were used for characterisation of MnDPDP trisodium. Results: The crystallogrpahic data obtained for MnDPDP trisodium show that the general core structure of the MnDPDP anion is similar to that seen in related substances. The metal coordination geometry is a distorted octahedron defined by 2 phenolate oxygens, 2 carboxylate oxygens and 2 amine nitrogens. The unit cell contains 2 MnDPDP anions, 6 sodium ions and 50 water molecules. The various spectroscopic data are consistent with the structure determined by X-ray crystallography. The product (Teslascan) has low viscosity, is isotonic with blood and has a physiological pH. (orig./AJ)

  14. Characterisation: Challenges and Opportunities - A UK Perspective

    International Nuclear Information System (INIS)

    Emptage, Matthew; Loudon, David; Mcleod, Richard; Milburn, Helen

    2016-01-01

    Characterisation plays a very important role in the nuclear industry supporting: the development and implementation of decommissioning strategies/plans (and the optimisation of associated costs through reduction in technical risks); regulatory compliance demonstration; waste prevention/minimisation; evaluation and optimisation of worker radiation doses; and maintaining public confidence. Recognising these important drivers, the UK regulators are working with the UK Nuclear Decommissioning Authority (NDA) to undertake a review of characterisation practice in the UK nuclear (decommissioning) industry. The objective of the characterisation review is to understand the current characterisation challenges and to determine strategic and tactical opportunities (including sharing of standards and guidance, capabilities, learning from experience, good practice, research and development, training, quality assurance) to optimise characterisation practice. The work is being undertaken through review of nuclear operator's characterisation practice, with input from the NDA, the UK regulators, nuclear operators and representatives from the supply chain, and through consideration of good practice case studies. To support this, a catalogue of relevant national/international guidance documents is also be compiled. Finally a workshop with representatives from all parties has taken place to consider the findings and establish a common understanding of challenges and opportunities and to start to consider how they can be addressed. The review is establishing a collective (UK regulator's, NDA; nuclear operator's and supply chain) understanding of opportunities to improve characterisation practice in the UK. The characterisation review process is described and early results are presented and discussed. Subsequent work in 2016 will be required to prioritise the opportunities and to build a consensus to facilitate development and implementation of an improvement plan. The aim

  15. Site characterisation and monitoring for environmental remediation

    International Nuclear Information System (INIS)

    Adsley, Ian; Davies, Michael; Murley, Robert; Pearman, Ian; Harman, Nicholas; Proctor, Lorna; Armitage, Jack; Beddow, Helen

    2007-01-01

    Available in abstract form only. Full text of publication follows: Radioactive contamination of nuclear and mineral processing sites can be very varied. Early work in the extraction of uranium and thorium led to the disposal of large amounts of waste containing a variety of daughter radioisotopes. Later, the development of nuclear weapon programs led to large scale processing of uranium and thorium ores, physical separation of isotopes, and the initiation of nuclear fission with the resulting production of fission product radionuclides and activated metals. Weapons testing and reprocessing of reactor fuel again led to the release of fission and activation products, together with radioelements from the chemistry of fuel extraction. Finally the recovery of oil and gas reserves have once again led to renewed interest in NORM (naturally occurring radioactive materials) in the form of Pb-210/Po-210 scales in gas pipelines and Ra-226/Ra-228 in oil pipelines. Methods of monitoring for the contamination generated from all of these processes are considered together with recommended monitoring options for contamination products using gamma, beta and alpha measuring techniques. Specific examples of several site characterisation and monitoring projects are given - covering site investigation through to in-situ and on-site monitoring during the actual remediation. Many of the projects described are of a large scale, typically involving many thousands of tons of waste material. The rapid identification and sentencing into the relevant waste categories is essential in support of on-site civil engineering processes. Consideration of tailoring the monitoring process to achieve such high throughput rates is given. (authors)

  16. Molecular characterisation of radish cultivars

    Directory of Open Access Journals (Sweden)

    Sara Michelly Cruz

    Full Text Available The radish has been gaining importance in the Brazilian market due to its use as a green manure and cover crop, and also due to its potential for the production of biodiesel, however there are only two registered cultivars, which are morphologically very similar. Determination of genetic purity is a prerequisite in marketing seeds as it ensures uniformity of the crop and is important in breeding programs. The aim of this work therefore was to evaluate the similarity and genotype patterns which permit differentiation of the commercial radish cultivars IPR 116 and CATI AL-1000. In order to do this, isoenzyme electrophoretic patterns were analysed in dry seeds, soaked seeds, seedling leaves and young leaves; the isoenzymes used being: superoxide dismutase, catalase, esterase, glutamate-oxalocetate, malate dehydrogenase and isocitrate lyase. Thirty-seven RAPD primers and 10 ISSR primers in leaves of the CATI AL-1000 and IPR-116 cultivars were analysed. Among the isoenzymes under study, the most polymorphic were glutamate oxalocetate, malate dehydrogenase, esterase and superoxide dismutase, with the superoxide dismutase system giving the best characterisation for all stages of development. The catalase isoenzyme system did not make it possible to differentiate between cultivars at any stage of development, and isocitrate lyase was not revealed by the protocol used. In analysis of the markers, 27 RAPD primers and eight ISSR primers showed polymorphism. The results indicate that it is possible to determine reliable descriptors based on isoenzymes at different stages of development of the radish and with the use of RAPD and ISSR primers.

  17. Molecular weight characterisation of synthetic polymers

    CERN Document Server

    Holding, Steve R

    1995-01-01

    The report comprises a state-of-the-art overview of the subject of molecular weight characterisation, supported by an extensive, indexed bibliography. The bibliography contains over 400 references and abstracts, compiled from the Polymer Library.

  18. Imaging spectroscopy for characterisation of grass swards

    NARCIS (Netherlands)

    Schut, A.G.T.

    2003-01-01

    Keywords: Imaging spectroscopy, imaging spectrometry, remote sensing, reflection, reflectance, grass sward, white clover, recognition, characterisation, ground cover, growth monitoring, stress detection, heterogeneity quantification

    The potential of imaging spectroscopy as a tool for

  19. Characterisation of nanomaterial hydrophobicity using engineered surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Desmet, Cloé; Valsesia, Andrea; Oddo, Arianna; Ceccone, Giacomo; Spampinato, Valentina; Rossi, François; Colpo, Pascal, E-mail: pascal.colpo@ec.europa.eu [Directorate Health, Consumer and Reference Materials, Consumer Products Safety Unit (Italy)

    2017-03-15

    Characterisation of engineered nanomaterials (NMs) is of outmost importance for the assessment of the potential risks arising from their extensive use. NMs display indeed a large variety of physico-chemical properties that drastically affect their interaction with biological systems. Among them, hydrophobicity is an important property that is nevertheless only slightly covered by the current physico-chemical characterisation techniques. In this work, we developed a method for the direct characterisation of NM hydrophobicity. The determination of the nanomaterial hydrophobic character is carried out by the direct measurement of the affinity of the NMs for different collectors. Each collector is an engineered surface designed in order to present specific surface charge and hydrophobicity degrees. Being thus characterised by a combination of surface energy components, the collectors enable the NM immobilisation with surface coverage in relation to their hydrophobicity. The experimental results are explained by using the extended DLVO theory, which takes into account the hydrophobic forces acting between NMs and collectors.

  20. Experimental characterisation of Polyethylene Terephthalate (PET) bottle Eco-bricks

    International Nuclear Information System (INIS)

    Taaffe, Jonathan; O’Sullivan, Seán; Rahman, Muhammad Ekhlasur; Pakrashi, Vikram

    2014-01-01

    Highlights: • Characterisation of a novel “Eco-brick” by recycling PET bottles and plastic waste. • Eco-bricks have properties for possible uses in construction. • Consistent manufacturing of Eco-bricks demonstrated to be possible. • Weight of Eco-bricks has a nearly linear relationship with mechanical strength. • Light passage and sound reduction potential of Eco-bricks shown to be good. - Abstract: This paper addresses the issue of recycling waste plastic by considering the feasibility of use of Eco-bricks for constructional purposes. The Eco-bricks are formed by packing plastic within Polyethylene Terephthalate (PET) bottles. Guidelines were provided for the construction of Eco-bricks. Experiments were carried out to characterise some of the properties of these bricks. Compression test, sound insulation assessment and light transmission were considered in this regard and compared with traditional construction materials and conditions. Possible applications of Eco-bricks were discussed. The paper presents the first attempt to characterise these bricks and the results encourage future use of them to a significantly wider extent and for various purposes

  1. Phase characterisation in spark plasma sintered TiPt alloy

    CSIR Research Space (South Africa)

    Chikosha, S

    2011-12-01

    Full Text Available stream_source_info chikosha_2011.pdf.txt stream_content_type text/plain stream_size 4354 Content-Encoding UTF-8 stream_name chikosha_2011.pdf.txt Content-Type text/plain; charset=UTF-8 PHASE CHARACTERISATION IN SPARK... to form “necks”  Radiant Joule heat and pressure drives “neck” growth and material transfer © CSIR 2006 www.csir.co.za Page 6 Objective  Produce TiPt alloy compacts by Spark plasma sintering (SPS) of equiatomic...

  2. In silico analysis of the three-dimensional structures of the homodimer of uridine phosphorylase from Yersinia Pseudotuberculosis in the ligand-free state and in a complex with 5-fluorouracil

    Energy Technology Data Exchange (ETDEWEB)

    Lashkov, A. A., E-mail: alashkov83@gmail.com; Sotnichenko, S. E.; Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2013-03-15

    Pseudotuberculosis is an acute infectious disease characterized by a lesion of the gastrointestinal tract. A positive therapeutic effect can be achieved by selectively suppressing the activity of uridine phosphorylase from the causative agent of the disease Yersinia pseudotuberculosis. The synergistic effect of a combination of the chemotherapeutic agent 5-fluorouracil and antimicrobial drugs, which block the synthesis of pyrimidine bases, on the cells of pathogenic protozoa and bacteria is described in the literature. The three-dimensional structures of uridine phosphorylase from Yersinia pseudotuberculosis (YptUPh) both in the ligand-free state and in complexes with pharmacological agents are unknown, which hinders the search for and design of selective inhibitors of YptUPh. The three-dimensional structure of the ligand-free homodimer of YptUPh was determined by homology-based molecular modeling. The three-dimensional structure of the subunit of the YptUPh molecule belongs to {alpha}/{beta} proteins, and its topology is a three-layer {alpha}/{beta}/{alpha} sandwich. The subunit monomer of the YptUPh molecule consists of 38% helices and 24% {beta} strands. A model of the homodimer structure of YptUPh in a complex with 5-FU was obtained by the molecular docking. The position of 5-FU in the active site of the molecule is very consistent with the known data on the X-ray diffraction structures of other bacterial uridine phosphorylases (the complex of uridine phosphorylase from Salmonella typhimurium (StUPh) with 5-FU, ID PDB: 4E1V and the complex of uridine phosphorylase from Escherichia coli (EcUPh) with 5-FU and ribose 1-phosphate, ID PDB: 1RXC).

  3. Best Practice on facility characterisation from a material and waste end-state perspective. Radiological characterisation in a waste and materials end-state perspective - International Characterisation Survey Aiming to Understand Good Practice

    International Nuclear Information System (INIS)

    Larsson, Arne; Weber, Inge; Emptage, Matthew; )

    2016-01-01

    Full text of publication follows: The Task Group on Radiological Characterisation and Decommissioning within the Nuclear Energy Agency (NEA) Working Party on Decommissioning was established to identify and present Best Practice in radiological characterisation at different stages of decommissioning as well as areas that could or should be developed further by international cooperation and coordination. The first phase of the project was focusing on general aspects of strategies for radiological characterisation in decommissioning of nuclear facilities. The second phase of the project focus on strategies for optimising radiological characterisation in a waste and materials end-state perspective, building on previous task group findings. One of the activities within the second phase has been to conduct a survey with the main objective to identify Best Practice. The survey was in the form of a questionnaire in two versions, one for regulators and one for owners/implementers. Sections of the questionnaire to gather views on Best Practice: - Initiation of a characterisation program; - Planning and preparation; - Implementation (i.e. conducting the characterisation measurements and samplings); - Data assessment phase (evaluation of the results); - Quality assurance. A section on the national legislation in the regulator version and a case study section in the owner version complement the questionnaire in order to get an overview of the regulatory frameworks and also practical experiences. The extensive questionnaire was distributed to a wide audience of recognised experts throughout the member states. 53 responses were received from in total 12 countries. Most responses were from Europe but also Asia and North America were represented. The preliminary conclusions are: - There is a solid experience in radiological characterisation among regulators as well as owners/implementers; - Responses demonstrates to large extent a common view of regulators and owners

  4. Combustion char characterisation. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Rosenberg, P; Ingermann Petersen, H; Sund Soerensen, H; Thomsen, E; Guvad, C

    1996-06-01

    The aim was to correlate reactivity measures of raw coals and the maceral concentrates of the coals obtained in a previous project with the morphology of the produced chars by using a wire grid devolatilization method. Work involved determination of morphology, macroporosity and a detailed study by Scanning Electron Microscopy (SEM). Systematic variations in the texture of chars produced in different temperature domains and heating rates were demonstrated by using incident light microscopy on polished blocks and by SEM studies directly on the surfaces of untreated particles. Results suggest that work in the field of char reactivity estimates and correlations between char morphology and coal petrography can be accomplished only on chars produced under heating rates and temperatures comparable to those for the intended use of coal. A general correlation between the coals` petrography and the the morphology of high temperature chars was found. The SEM study of the chars revealed that during the devolatilization period the particles fuse and the macroporosity and thus the morphotypes are formed. After devolatilization ceases, secondary micropores are formed. These develop in number and size throughout the medium combustion interval. At the end of the combustion interval the macrostructure breaks down, caused by coalescence of the increased number of microspores. This can be observed as a change in the morphology and the macroporosity of the chars. Results indicate that char reactivity is a function of the macroporosity and thus the morphology of combustion chars. (AB) 34 refs.

  5. Phenotypic characterisation and molecular polymorphism of ...

    African Journals Online (AJOL)

    The study of the phenotypic characterisation and molecular polymorphism of local chicken populations was carried out in Benin on 326 chickens of the Forest ecological area and 316 of the Savannah ecological area, all were 7 months old at least. The collection of blood for the molecular typing was achieved on 121 ...

  6. Characterisation of potential aquaculture pond effluents, and ...

    African Journals Online (AJOL)

    Conventional treatment of effluents from these small-scale, low-volume operations, which discharge relatively dilute effluents infrequently, might not be cost-effective. Keywords: aquaculture–environment interaction, earthen ponds, effluent characterisation, K-means clustering, t ilapia, water quality. African Journal of Aquatic ...

  7. Raw materials resources classification and characterisation for ...

    African Journals Online (AJOL)

    Raw materials resources classification and characterisation for ceramic tableware production in Nigeria. PSA Irabor. Abstract. No Abstract. Journal of Applied Science, Engineering and Technology Vol. 2(1) 2002: 48-52. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  8. Characterisation of fracture network and groundwater preferential ...

    African Journals Online (AJOL)

    Characterisation of fractured rocks and evaluation of fracture connectivity are essential for the study of subsurface flow and transport in fractured rock aquifers. In this study, we use a new method to present fracture networks and analyse the connectivity of the fractures, based on the technique of randomly-generated ...

  9. Dynamic and Acoustic Characterisation of Automotive Wheels

    Directory of Open Access Journals (Sweden)

    Francesca Curà

    2004-01-01

    Full Text Available The subject of this paper is the dynamic and acoustic characterisation of an automotive wheel. In particular, an experimental research activity previously performed by the authors about the dynamic behaviour of automotive wheels has been extended to the acoustic field.

  10. Identification and Characterisation of Major Hydrocarbons in ...

    African Journals Online (AJOL)

    Identification and Characterisation of Major Hydrocarbons in Thermally Degraded Low Density Polyethylene Films. ... There were alkanes, alkenes, halogenated alkanes, and very few aromatics in the liquid product and, the hydrocarbons were observed to range between C10 - C27. The FTIR and GC-MS results show the ...

  11. Characterisation and concentration profile of aluminium during ...

    African Journals Online (AJOL)

    An aluminium(Al) characterisation study was conducted at a surface water treatment plant (Buffalo Pound Water Treatment Plant (BPWTP) in Moose Jaw, Saskatchewan, Canada) to understand better the effect of alum coagulant on various Al fractions. The raw water source for BPWTP is Buffalo Pound Lake water. The Al ...

  12. Characterisation of childhood and adolescence accidental fatalities ...

    African Journals Online (AJOL)

    Background: Accidental death in childhood and adolescence is posing a public health problem in Nigeria, as most of these deaths were not caused by the victims. There is need to research into the pattern and circumstances surrounding the death. Aim: To characterise and study accidental deaths in childhood and ...

  13. Advanced characterisation of municipal solid waste ashes

    Energy Technology Data Exchange (ETDEWEB)

    Skytte Pedersen, Randi

    2002-12-15

    This report deals with characterisation of Municipal Solid Waste (MSW) ashes from the Danish power plant Maebjergvaerket, Holstebro. MSW has been used as a fuel since the mid 1960's and since then, the MSW incineration plants have experienced operational problems due to deposit formation and corrosion. Inorganic elements tightly or loosely bound in the waste are the main cause of these problems. The tightly bound elements will mainly stay on the grate during combustion, whereas the loosely bound elements are volatilised and recondensed elsewhere in the furnace. Many of the heavy metals form volatile chlorides during the incineration, and the fly ash fraction thus show enrichment in these elements. Presence of chlorides and heavy metals in deposits may cause severe corrosion due to formation of low-melting eutectics. Chlorine gas in the flue gas is also of major concern with respect to corrosion, due to formation of volatile chlorides when chlorine comes in contact with the tube material. Four different ash fractions (bottom ash, super heater ash, economiser ash and fly ash) taken from Maebjergvaerket have been analysed with respect to particle sizes, structures, shapes and composition. The applied methods were scanning electron microscopy (SEM), energy dispersive X-ray analyses (EDX) and mapping, which were used in order to determine sizes, chemical composition and structure of the particles. X-ray powder diffraction (XRD) was used to provide information about crystallography and mineral phases. Chemical analysis was also performed along with a particle size distribution for the fine-grained fractions (economiser and fly ash). The amount of silicates consisting of Ca, Al and Si, were found to decrease through the furnace, whereas the amount of alkali (Na, K) chlorides and heavy metals (Pb, Zn) increased. The bonding in the waste before incineration is the direct cause of this, since silicates are tightly bound and chlorides are loosely bound. There was a

  14. In-flight scalar calibration and characterisation of the Swarm magnetometry package

    DEFF Research Database (Denmark)

    Tøffner-Clausen, Lars; Lesur, Vincent; Olsen, Nils

    2016-01-01

    of magnetometers is demonstrated, confirming the high performance of these instruments. The results presented here, including the characterisation of a Sun-driven disturbance field, form the basis of the correction of the magnetic vector measurements from Swarm which is applied to the Swarm Level 1b magnetic data.......We present the in-flight scalar calibration and characterisation of the Swarm magnetometry package consisting of the absolute scalar magnetometer, the vector magnetometer, and the spacecraft structure supporting the instruments. A significant improvement in the scalar residuals between the pairs...

  15. Modelling, fabrication and characterisation of THz fractal meta-materials

    DEFF Research Database (Denmark)

    Xiao, S.; Zhou, L.; Malureanu, Radu

    2011-01-01

    We present theoretical predictions, fabrication procedure and characterisation results of fractal metamaterials for the THz frequency range. The characterisation results match well the predicted response thus validating both the fabrication procedure as well as the simulation one. Such systems sh...

  16. Impedimetric method for physiologically characterisation of fungi

    DEFF Research Database (Denmark)

    Nielsen, Per Væggemose; Petersen, Karina

    1998-01-01

    Fungi are playing an important role in the food and pharmaceutical industry today, both as starter cultures, fermentation organisms, and as contaminants. Characterisation of fungal growth is normally time consuming as it includes measurements and study on a wide range of media at different...... temperatures, pH, water activity and atmosphere composition. Nevertheless is it important information in ecophysiological studies, where the growth potential by fungi are related to composition and storage of food. It is therefore of great interest to device a rapid method for characterisation of fungi.......The objective was to determine the growth phases of various fungi using an impedimetric method and compare this with traditional methods using agar plates, in order to determine if this rapid method can replace the traditional method.The method is based on impedimetric assessment of growth on the Bactometer 128...

  17. Detailed Electrochemical Characterisation of Large SOFC Stacks

    DEFF Research Database (Denmark)

    Mosbæk, Rasmus Rode; Hjelm, Johan; Barfod, R.

    2012-01-01

    application of advanced methods for detailed electrochemical characterisation during operation. An operating stack is subject to steep compositional gradients in the gaseous reactant streams, and significant temperature gradients across each cell and across the stack, which makes it a complex system...... Fuel Cell A/S was characterised in detail using electrochemical impedance spectroscopy. An investigation of the optimal geometrical placement of the current probes and voltage probes was carried out in order to minimise measurement errors caused by stray impedances. Unwanted stray impedances...... are particularly problematic at high frequencies. Stray impedances may be caused by mutual inductance and stray capacitance in the geometrical set-up and do not describe the fuel cell. Three different stack geometries were investigated by electrochemical impedance spectroscopy. Impedance measurements were carried...

  18. Quantitative characterisation of complexity and predictability

    International Nuclear Information System (INIS)

    Badii, R.

    1990-04-01

    A measure of complexity for sequentially created symbolic patterns is introduced. The underlying grammatical rules are systematically detected in terms of variable-length prefix-free codewords and arranged on a 'logic' tree. Predictions on the scaling structure of the system are then formulated and compared with the observation. The discrepancy between the two, evaluated through a generalisation of the information gain, characterises the complexity of the system, relative to the unfolding scheme. (author) 1 fig., 20 refs

  19. Electronic cigarettes: product characterisation and design considerations

    OpenAIRE

    Brown, Christopher J; Cheng, James M

    2014-01-01

    Objective To review the available evidence regarding electronic cigarette (e-cigarette) product characterisation and design features in order to understand their potential impact on individual users and on public health. Methods Systematic literature searches in 10 reference databases were conducted through October 2013. A total of 14 articles and documents and 16 patents were included in this analysis. Results Numerous disposable and reusable e-cigarette product options exist, representing w...

  20. Characterisation of contamination migration in the workplace

    International Nuclear Information System (INIS)

    Boulaud, D.; Laborde, J.C.; Pourprix, M.

    1994-01-01

    The Institute for Nuclear Safety and Protection (IPSN) has developed a procedure for characterising airborne contamination between processes and the workplace in nuclear facilities. It was initially intended to use this process to validate operator choices concerning the monitoring of indoor air contamination (personnel monitoring, and environmental detection at fixed locations), but also to optimise the fundamental parameters which have a more or less direct influence on potential exposure of staff in the workplace (at the same time optimising the contamination source, close confinement, process ventilation and general ventilation). In practice, the methods used to obtain these expert appraisals were usually based on experiments carried out in situ: (i) characterisation of aerosol contamination by accurate measurement of the nature, concentration and particle size distribution at various locations; (ii) characterisation of the migration of contamination by precise measurement involving gas and/or particle tracing techniques. In parallel with these experiments, a considerable effort was made to develop and qualify computer codes capable of predicting or estimating the migration of contamination through complex ventilated areas, by means of both fluid mechanics and aerosol science. (Author)

  1. Analytical Validation of a Highly Quantitative, Sensitive, Accurate, and Reproducible Assay (HERmark® for the Measurement of HER2 Total Protein and HER2 Homodimers in FFPE Breast Cancer Tumor Specimens

    Directory of Open Access Journals (Sweden)

    Jeffrey S. Larson

    2010-01-01

    Full Text Available We report here the results of the analytical validation of assays that measure HER2 total protein (H2T and HER2 homodimer (H2D expression in Formalin Fixed Paraffin Embedded (FFPE breast cancer tumors as well as cell line controls. The assays are based on the VeraTag technology platform and are commercially available through a central CAP-accredited clinical reference laboratory. The accuracy of H2T measurements spans a broad dynamic range (2-3 logs as evaluated by comparison with cross-validating technologies. The measurement of H2T expression demonstrates a sensitivity that is approximately 7–10 times greater than conventional immunohistochemistry (IHC (HercepTest. The HERmark assay is a quantitative assay that sensitively and reproducibly measures continuous H2T and H2D protein expression levels and therefore may have the potential to stratify patients more accurately with respect to response to HER2-targeted therapies than current methods which rely on semiquantitative protein measurements (IHC or on indirect assessments of gene amplification (FISH.

  2. Corrosion product characterisation by fibre optic raman spectroscopy

    International Nuclear Information System (INIS)

    Guzonas, D.A.; Rochefort, P.A.; Turner, C.W.

    1998-01-01

    Fibre optic Raman spectroscopy has been used to characterise secondary-side deposits removed from CANDU steam generators. The deposits examined were in the form of powders, millimetre-sized flakes, and deposits on the surfaces of pulled steam generator tubes. The compositions of the deposits obtained using Raman spectroscopy are similar to the compositions obtained using other ex-situ analytical techniques. A semi-quantitative estimate of amounts of the major components can be obtained from the spectra. It was noted that the signal-to-noise ratio of the Raman spectra decreased as the amount of magnetite in the deposit increased, as a result of absorption of the laser light by the magnetite. The conversion of magnetite to hematite by the laser beam was observed when high laser powers were used. The Raman spectra of larger flake samples clearly illustrate the inhomogeneous nature of the deposits. (author)

  3. Synthesis and characterisation of star polymer/silicon carbide nanocomposites

    International Nuclear Information System (INIS)

    Majewski, Peter; Choudhury, Namita Roy; Spori, Doris; Wohlfahrt, Ellen; Wohlschloegel, Markus

    2006-01-01

    A new type of composite material's preparation and property are reported in this paper. The composite was formed by solution blending a styrene ethylene butylenes (SEBS) star polymer with silicon carbide at various compositions. The composites were characterised using spectroscopic, microscopic and thermal techniques. Photo-acoustic Fourier transform infrared spectroscopy (PA-FT-IR) and transmission electron microscopy (TEM) results show that the SiC resides uniformly in the organic network. Thermogravimetric analysis (TGA) of the hybrid shows that the thermal stability of the composite is higher than that of the star polymer. The maximum decomposition temperature increases by 73 deg. C. Dynamic mechanical analysis (DMA) of the hybrid shows that the storage modulus of the star polymer increases after the composite formation, indicating the existence of thermodynamically stable SiC nanoparticles mostly in the micro-phase separated multiarm structure of the polymer

  4. Characterisation of magnetron sputtered SmCo5 thin films

    International Nuclear Information System (INIS)

    Wang, Y.; Sood, D.K.; Kothari

    1999-01-01

    SmCo 5 thin films were deposited using DC magnetron sputtering on single crystal silicon substrate with chromium and SiO 2 top layers. Deposition was carried out at three different substrate temperatures: room temperature, 400 deg C and 600 deg C. Films were characterised by using Rutherford Backscattering Spectroscopy (RBS), X-ray Diffraction (XRD), Secondary Ion Mass Spectrometry (SIMS) and SQUID magnetometer. RBS analysis indicated that the films have excellent stoichiometry with the Sm to Co ratio of 1:5. This analysis also showed that the films deposited or annealed at high temperatures (≥600 deg C) indicated significant inter-diffusion at the interface between the barrier layer and the film. Oxygen was found to be the major impurity in the films. XRD data indicated that the films formed 1:5 and 2:17 phases under different deposition conditions. The preliminary studies of these films using magnetic force microscopy revealed the presence of magnetic domains

  5. Economic method for helical gear flank surface characterisation

    Science.gov (United States)

    Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.

    2018-03-01

    Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.

  6. The characterisation of magnetic pigment dispersions using pulsed magnetic fields

    International Nuclear Information System (INIS)

    Blackwell, J.J.; O'Grady, K.; Nelson, N.K.; Sharrock, M.P.

    2003-01-01

    In this work, we describe the application of pulsed field magnetometry techniques for the characterisation of magnetic pigment dispersions. Magnetic pigment dispersions are important technological materials as in one form they are the material which are used to coat base film in order to make magnetic recording tape. It is these materials that have been evaluated. In this work, we describe the use of two pulsed field magnetometers, one being a low-field instrument with a maximum field of 750 Oe and the other a high-field instrument with a maximum field of 4.1 kOe. Using inductive sensing, the magnetisation is monitored in real time as the pulse is applied. We find that using these techniques we can successfully monitor the progress of the dispersion process, the effects of different resin systems and the effect of different processing conditions. We find that our results are consistent with rheological and other measurements

  7. The characterisation of magnetic pigment dispersions using pulsed magnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Blackwell, J.J.; O' Grady, K. E-mail: kog1@york.ac.uk; Nelson, N.K.; Sharrock, M.P

    2003-10-01

    In this work, we describe the application of pulsed field magnetometry techniques for the characterisation of magnetic pigment dispersions. Magnetic pigment dispersions are important technological materials as in one form they are the material which are used to coat base film in order to make magnetic recording tape. It is these materials that have been evaluated. In this work, we describe the use of two pulsed field magnetometers, one being a low-field instrument with a maximum field of 750 Oe and the other a high-field instrument with a maximum field of 4.1 kOe. Using inductive sensing, the magnetisation is monitored in real time as the pulse is applied. We find that using these techniques we can successfully monitor the progress of the dispersion process, the effects of different resin systems and the effect of different processing conditions. We find that our results are consistent with rheological and other measurements.

  8. (EOI) Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dorine Odongo

    COLLABORATING TECHNICAL AGENCIES: EXPRESSION OF INTEREST FORM. • Please read the information provided about the initiative and the eligibility requirements in the Prospectus before completing this application form. • Ensure all the sections of the form are accurately completed and saved in PDF format.

  9. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.

    2008-01-01

    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  10. Sensory analysis of characterising flavours: evaluating tobacco product odours using an expert panel.

    Science.gov (United States)

    Krüsemann, Erna J Z; Lasschuijt, Marlou P; de Graaf, C; de Wijk, René A; Punter, Pieter H; van Tiel, Loes; Cremers, Johannes W J M; van de Nobelen, Suzanne; Boesveldt, Sanne; Talhout, Reinskje

    2018-05-23

    Tobacco flavours are an important regulatory concept in several jurisdictions, for example in the USA, Canada and Europe. The European Tobacco Products Directive 2014/40/EU prohibits cigarettes and roll-your-own tobacco having a characterising flavour. This directive defines characterising flavour as 'a clearly noticeable smell or taste other than one of tobacco […]'. To distinguish between products with and without a characterising flavour, we trained an expert panel to identify characterising flavours by smelling. An expert panel (n=18) evaluated the smell of 20 tobacco products using self-defined odour attributes, following Quantitative Descriptive Analysis. The panel was trained during 14 attribute training, consensus training and performance monitoring sessions. Products were assessed during six test sessions. Principal component analysis, hierarchical clustering (four and six clusters) and Hotelling's T-tests (95% and 99% CIs) were used to determine differences and similarities between tobacco products based on odour attributes. The final attribute list contained 13 odour descriptors. Panel performance was sufficient after 14 training sessions. Products marketed as unflavoured that formed a cluster were considered reference products. A four-cluster method distinguished cherry-flavoured, vanilla-flavoured and menthol-flavoured products from reference products. Six clusters subdivided reference products into tobacco leaves, roll-your-own and commercial products. An expert panel was successfully trained to assess characterising odours in cigarettes and roll-your-own tobacco. This method could be applied to other product types such as e-cigarettes. Regulatory decisions on the choice of reference products and significance level are needed which directly influences the products being assessed as having a characterising odour. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use

  11. Radiological Characterisation for Decommissioning of Nuclear Installations - Final Report of the Task Group on Radiological Characterisation and Decommissioning (RCD) of the Working Party on Decommissioning and Dismantling (WPDD) - Final Report, September 2013

    International Nuclear Information System (INIS)

    Andrieu, Caroline; Olivier Dehaye, Catherine; Tardy, Frederic; Boisserie, Thierry; Desnoyers, Yvon; Thierfeldt, Stefan; Martin, Nieves; Henrik Efraimsson; Haakansson, Lars; Larsson, Arne; Dunlop, Alister A.; Jarman, Sean; Orr, Peter; Abu-Eid, Boby

    2013-01-01

    , or during the dismantling phase where systems, structures, components and buildings have to be characterised for decisions regarding the extent of decontamination, application of appropriate dismantling techniques, identification, classification, treatment of radioactive materials, etc. The final status survey on the site has quite distinctive features as it also has to take into account the possibility of subsurface contamination, which may lead to radionuclide transfer into ground water and surface water bodies. Careful planning and implementation of radiological characterisation campaigns will allow significant reduction of time, costs and effort. On a strategic and managerial level, there are ways to maximise the efficiency of measurement techniques (e.g. by combining several types of measurement and sampling approaches) to increase efficiency of characterisation (e.g. by integrating characterisation into other tasks), or to choose an optimum form of organisation by allocating staff and resources timely and adequately to achieve the required characterisation results when needed, thus avoiding delays in the normal decommissioning work-flow or radioactive waste management. Today, experience gained from a large number of decommissioning projects helps to implement radiological characterisation effectively. Radiological characterisation is undoubtedly one of the key factors for any successful decommissioning project. The aim of this report is to identify and give an overview of the best practice for radiological characterisation at different stages of decommissioning and to point out areas that could or should be developed further through international co-operation and co-ordination. The report summarises various issues relating to radiological characterisation in a short and succinct way, giving an overview of the issues, the techniques, possible obstacles, strategic aspects and lessons learned. The reader interested in more in-depth or detailed information should

  12. Tablet surface characterisation by various imaging techniques

    DEFF Research Database (Denmark)

    Seitavuopio, Paulus; Rantanen, Jukka; Yliruusi, Jouko

    2003-01-01

    The aim of this study was to characterise tablet surfaces using different imaging and roughness analytical techniques including optical microscopy, scanning electron microscopy (SEM), laser profilometry and atomic force microscopy (AFM). The test materials compressed were potassium chloride (KCl......) and sodium chloride (NaCl). It was found that all methods used suggested that the KCl tablets were smoother than the NaCl tablets and higher compression pressure made the tablets smoother. Imaging methods like optical microscopy and SEM can give useful information about the roughness of the sample surface...

  13. Geological exploration strategies and site characterisation methodologies

    International Nuclear Information System (INIS)

    Sprecher, C.

    1997-01-01

    Starting with a short overview of the Swiss HLW disposal programme the paper addresses the more general issue of how site characterisation programmes can better be matched to the acknowledged data requirements of safety analysts and repository designers. Swiss experience suggests that measures to promote mutual understanding between geologistsand quantitative modelers and advance planning of the GEO-data-synthesis can help to bridge the gap separating performance assessment input parameters and field measurements. This represents a step towards more effective and cost efficient field investigations. (author). 4 figs

  14. Hyphenated analytical techniques for materials characterisation

    Science.gov (United States)

    Armstrong, Gordon; Kailas, Lekshmi

    2017-09-01

    This topical review will provide a survey of the current state of the art in ‘hyphenated’ techniques for characterisation of bulk materials, surface, and interfaces, whereby two or more analytical methods investigating different properties are applied simultaneously to the same sample to better characterise the sample than can be achieved by conducting separate analyses in series using different instruments. It is intended for final year undergraduates and recent graduates, who may have some background knowledge of standard analytical techniques, but are not familiar with ‘hyphenated’ techniques or hybrid instrumentation. The review will begin by defining ‘complementary’, ‘hybrid’ and ‘hyphenated’ techniques, as there is not a broad consensus among analytical scientists as to what each term means. The motivating factors driving increased development of hyphenated analytical methods will also be discussed. This introduction will conclude with a brief discussion of gas chromatography-mass spectroscopy and energy dispersive x-ray analysis in electron microscopy as two examples, in the context that combining complementary techniques for chemical analysis were among the earliest examples of hyphenated characterisation methods. The emphasis of the main review will be on techniques which are sufficiently well-established that the instrumentation is commercially available, to examine physical properties including physical, mechanical, electrical and thermal, in addition to variations in composition, rather than methods solely to identify and quantify chemical species. Therefore, the proposed topical review will address three broad categories of techniques that the reader may expect to encounter in a well-equipped materials characterisation laboratory: microscopy based techniques, scanning probe-based techniques, and thermal analysis based techniques. Examples drawn from recent literature, and a concluding case study, will be used to explain the

  15. A rock characterisation facility consultative document

    International Nuclear Information System (INIS)

    1992-10-01

    This U.K. Nirex Ltd., consultative document describes a proposed underground rock characterisation facility, east of Sellafield, for conducting geophysical surveys as a basis for refining long-term safety analysis of an underground repository for intermediate-level and low-level radioactive wastes. Planning application will be submitted in 1993. The construction of shafts and galleries is described and the site's geologic, topographical, climatic and archaeological features discussed. The effects to the local environment and on local populations and other socio-economic factors are discussed. (UK)

  16. Hyphenated analytical techniques for materials characterisation

    International Nuclear Information System (INIS)

    Armstrong, Gordon; Kailas, Lekshmi

    2017-01-01

    This topical review will provide a survey of the current state of the art in ‘hyphenated’ techniques for characterisation of bulk materials, surface, and interfaces, whereby two or more analytical methods investigating different properties are applied simultaneously to the same sample to better characterise the sample than can be achieved by conducting separate analyses in series using different instruments. It is intended for final year undergraduates and recent graduates, who may have some background knowledge of standard analytical techniques, but are not familiar with ‘hyphenated’ techniques or hybrid instrumentation. The review will begin by defining ‘complementary’, ‘hybrid’ and ‘hyphenated’ techniques, as there is not a broad consensus among analytical scientists as to what each term means. The motivating factors driving increased development of hyphenated analytical methods will also be discussed. This introduction will conclude with a brief discussion of gas chromatography-mass spectroscopy and energy dispersive x-ray analysis in electron microscopy as two examples, in the context that combining complementary techniques for chemical analysis were among the earliest examples of hyphenated characterisation methods. The emphasis of the main review will be on techniques which are sufficiently well-established that the instrumentation is commercially available, to examine physical properties including physical, mechanical, electrical and thermal, in addition to variations in composition, rather than methods solely to identify and quantify chemical species. Therefore, the proposed topical review will address three broad categories of techniques that the reader may expect to encounter in a well-equipped materials characterisation laboratory: microscopy based techniques, scanning probe-based techniques, and thermal analysis based techniques. Examples drawn from recent literature, and a concluding case study, will be used to explain the

  17. X-ray characterisation of nanostructured materials

    DEFF Research Database (Denmark)

    Oddershede, Jette

    X-ray powder di®raction (XRPD) is an excellent tool for characterising the bulk structure of crystalline materials. Along with the growing interest in exploiting materials with decreasing particle sizes and increasing number of defects, factors that complicate the traditional interpretation...... of the experi- mental XRPD patterns, the need for new interpretation methods has arisen. The method described in the present thesis is by no means new, in fact it was developed by Debye in 1915. However, the Debye method it is rather computationally heavy, so in practise it is only applicable to the X-ray char...

  18. Nanocatalysts for Ethanol Oxidation: Synthesis and Characterisation

    OpenAIRE

    Bonesi, A.; Triaca, W. E.; Luna, A. M. Castro

    2009-01-01

    Carb on-supported binary PtSn/C and ternary PtSnNi/C catalysts were prepared for the electro-oxidation of ethanol. The carbon-supported nanoparticles were synthesised by employing a modified polyol methodology and characterised in terms of structure, morphology and composition by using XRD, EDX and TEM techniques. Their electro-catalytic behaviour for ethanol oxidation (EO) was investigated by employing a disc-composite electrode covered by a thin layer of catalyst imbedded in a Nafion polyme...

  19. Radiological characterisation and decommissioning in Denmark

    International Nuclear Information System (INIS)

    Nellemenn, Thomas

    2012-01-01

    Danish Decommissioning (DD) is currently decommissioning the last Danish research reactor (DR3) and the Hot Cell facility. The DR3 project will soon finish dismantling of the external parts of the reactor (January 2012). The approval for dismantling of neutron activated and tritium contaminated heavy water pumps and tubing was granted in December 2011. DD will begin the work on the inner parts as the tendering process for equipment will start in 2012. Hereafter the dismantling of the top of the reactor will begin using the obtained remote controlled equipment. The Hot Cell facility consists of 6 contaminated cells. The first cell have been opened and cleaned. Currently the work progresses by removing parts and hot spots from the other cells with the use of robotic equipment. Challenges, lack of conventional and radiological documentation, dose rates and contamination higher than expected and the confined space in the cells have delayed the project. No final repository exists in Denmark. Therefore no official Waste Acceptance Criteria (WAC) have been formulated. However the Danish authority (SIS) does require a description of the waste in the interim storage facility (Inventory). Furthermore radiological characterisation of key nuclides is needed during decommissioning and dismantling. The information gained from the characterisation helps in the planning phase prior to the dismantling and for inventory calculations for later use. DD performs the radiological characterisation via both non-destructive and destructive analysis on samples. The samples are measured with gamma spectroscopy using mathematical and geometrical analysis. Scaling factors are used for neutron activated waste (DR3) to determine the difficult-to-measure isotopes and pure beta emitters. The primary scaling isotope is Co-60. Waste from the Hot Cell facility is alpha contaminated and scaling procedures for determination of alpha contamination are currently used in the planning process. Scaling of

  20. Geological exploration strategies and site characterisation methodologies

    Energy Technology Data Exchange (ETDEWEB)

    Sprecher, C. [National Cooperative for the Disposal of Radioactive Waste, Wettingen (Switzerland)

    1997-12-31

    Starting with a short overview of the Swiss HLW disposal programme the paper addresses the more general issue of how site characterisation programmes can better be matched to the acknowledged data requirements of safety analysts and repository designers. Swiss experience suggests that measures to promote mutual understanding between geologistsand quantitative modelers and advance planning of the GEO-data-synthesis can help to bridge the gap separating performance assessment input parameters and field measurements. This represents a step towards more effective and cost efficient field investigations. (author). 4 figs.

  1. Underground characterisation and research facility ONKALO

    International Nuclear Information System (INIS)

    Ikonen, Antti; Ylae-Mella, Mia; Aeikaes, Timo

    2006-01-01

    Posiva's repository for geological disposal of the spent fuel from Finnish nuclear reactors will be constructed at Olkiluoto. The selection of Olkiluoto was made based on site selection research programme conducted between 1987-2001. The next step is to carry out complementary investigations of the site and apply for the construction license for the disposal facility. The license application will be submitted in 2012. To collect detailed information of the geological environment at planned disposal depth an underground characterisation and research facility will be built at the site. This facility, named as ONKALO, will comprise a spiral access tunnel and two vertical shafts. The excavation of ONKALO is in progress and planned depth (400 m) will be reached in 2009. During the course of the excavation Posiva will conduct site characterisation activities to assess the structure and other properties of the site geology. The aim is that construction will not compromise the favourable conditions of the planned disposal depth or introduce harmful effects in the surrounding bedrock which could jeopardize the long-term safety of the geological disposal. (author)

  2. Soil radiological characterisation and remediation at CIEMAT

    International Nuclear Information System (INIS)

    Correa, Cristina; Garcia Tapias, Esther; Leganes, Jose

    2012-01-01

    Located in Madrid, CIEMAT is the Spanish Centre for Energy-Related, Environmental and Technological Research. It used to have more than 60 facilities in operation that allowed a wide range of activities in the nuclear field and in the application of ionising radiations. At present, the centre includes several facilities; some of them are now obsolete, shut down and in dismantling phases. In 2000 CIEMAT started the 'Integrated plan for the improvement of CIEMAT facilities (PIMIC)', which includes activities for the decontamination, dismantling, rehabilitation of obsolete installations and soil remediation activities. A small contaminated area named with the Spanish word 'Lenteja' (Lentil), has had to be remediate and restored. In the 70's, an incidental leakage of radioactive liquid occurred during a transference operation from the Reprocessing Plant to the Liquid Treatment Installation, and contaminated about 1000 m 3 of soil. Remediation activities in this area started with an exhaustive radiological characterisation of the soil, including surface samples and up to 16 meters boreholes, and the development of a comprehensive radiological characterization methodology for pre-classification of materials. Once the framework was defined the following tasks were being carried out: preparation of the area, soil extraction activities and final radiological characterisation for release purposes. Next step will be the refilling of the resulting hole from the removal soil activities. This paper will describe the soil radiological characterization and remediation activities at the Lentil Zone in Ciemat Research Centre. (authors)

  3. Towards a complete characterisation of guaiacwood oil.

    Science.gov (United States)

    Tissandié, Loïc; Viciana, Stéphane; Brevard, Hugues; Meierhenrich, Uwe J; Filippi, Jean-Jacques

    2018-05-01

    Guaiacwood oil is a common perfume ingredient used in modern compositions for its suave woody-rosy scent. This essential oil is a byproduct of the timber industry obtained by hydrodistillation of the heartwood of Bulnesia sarmientoi, a tree native from Latin America. Despite being widely used in perfumery, guaiacwood oil has been poorly described in the past. This study aims at giving an in-depth characterisation of its chemical composition as well as disclosing the odorant compounds responsible for its characteristic fragrance. Our methodology was based on a combination of fractionation and analytical techniques, including comprehensive two-dimensional gas chromatography coupled to mass spectrometry and preparative capillary-gas chromatography. The entire analytical work led to the isolation of 20 constituents among which 14 have never been reported so far in natural extracts. Each isolated compound was fully characterised by spectroscopic methods. Finally, the accurate knowledge of the chemical composition permitted the identification of the odour-active constituents by gas chromatography-olfactometry. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Impedance Characterisation of the SPS Wire Scanner

    CERN Document Server

    AUTHOR|(CDS)2091911; Prof. Sillanpää, Mika

    As a beam diagnostic tool, the SPS wire scanner interacts with the proton bunches traversing the vacuum pipes of the Super Proton Synchrotron particle accelerator. Following the interaction, the bunches decelerate or experience momentum kicks off-axis and couple energy to the cavity walls, resonances and to the diagnostic tool, the scanning wire. The beam coupling impedance and, in particular, the beam induced heating of the wire motivate the characterisation and redesign of the SPS wire scanner. In this thesis, we characterise RF-wise the low frequency modes of the SPS wire scanner. These have the highest contribution to the impedance. We measure the cavity modes in terms of resonance frequency and quality factor by traditional measurement techniques and data analysis. We carry out a 4-port measurement to evaluate the beam coupling to the scanning wire, that yields the spectral heating power. If combined with the simulations, one is able to extract the beam coupling impedance and deduce the spectral dissipa...

  5. Characterisation of a uranium fire aerosol

    International Nuclear Information System (INIS)

    Leuscher, A.H.

    1976-01-01

    Uranium swarf, which can burn spontaneously in air, creates an aerosol which is chemically toxic and radiotoxic. The uptake of uranium oxide in the respiratory system is determined to a large extent by the characteristics of the aerosol. A study has been made of the methods by which aerosols can be characterised. The different measured and defined characteristics of particles are given. The normal and lognormal particle size distributions are discussed. Shape factors interrelating characteristics are explained. Experimental techniques for the characterisation of an aerosol are discussed, as well as the instruments that have been used in this study; namely the Andersen impactor, point-to-plane electrostatic precipitator and the Pollak counter. Uranium swarf was made to burn with a heated filament, and the resulting aerosol was measured. Optical and electron microscopy have been used for the determination of the projected area diameters, and the aerodynamic diameters have been determined with the impactor. The uranium fire aerosol can be represented by a bimodal, or monomodal, lognormal particle size distribution depending on the way in which the swarf burns. The determined activity median aerodynamic diameter of the two peaks were 0,49μm and 6,0μm respectively [af

  6. Characterisation factors for life cycle impact assessment of sound emissions.

    Science.gov (United States)

    Cucurachi, S; Heijungs, R

    2014-01-15

    Noise is a serious stressor affecting the health of millions of citizens. It has been suggested that disturbance by noise is responsible for a substantial part of the damage to human health. However, no recommended approach to address noise impacts was proposed by the handbook for life cycle assessment (LCA) of the European Commission, nor are characterisation factors (CFs) and appropriate inventory data available in commonly used databases. This contribution provides CFs to allow for the quantification of noise impacts on human health in the LCA framework. Noise propagation standards and international reports on acoustics and noise impacts were used to define the model parameters. Spatial data was used to calculate spatially-defined CFs in the form of 10-by-10-km maps. The results of this analysis were combined with data from the literature to select input data for representative archetypal situations of emission (e.g. urban day with a frequency of 63 Hz, rural night at 8000 Hz, etc.). A total of 32 spatial and 216 archetypal CFs were produced to evaluate noise impacts at a European level (i.e. EU27). The possibility of a user-defined characterisation factor was added to support the possibility of portraying the situation of full availability of information, as well as a highly-localised impact analysis. A Monte Carlo-based quantitative global sensitivity analysis method was applied to evaluate the importance of the input factors in determining the variance of the output. The factors produced are ready to be implemented in the available LCA databases and software. The spatial approach and archetypal approach may be combined and selected according to the amount of information available and the life cycle under study. The framework proposed and used for calculations is flexible enough to be expanded to account for impacts on target subjects other than humans and to continents other than Europe. © 2013 Elsevier B.V. All rights reserved.

  7. Usefulness of tenderness to characterise fibromyalgia severity in women.

    Science.gov (United States)

    Aparicio, V A; Carbonell-Baeza, A; Ortega, F B; Estevez, F; Ruiz, J R; Delgado-Fernández, M

    2011-01-01

    To investigate the usefulness of tenderness (tender points count (TPC) and algometer score) to characterise fibromyalgia (FM) severity and symptomatology in women. The study sample comprised 174 women aged 51±7 years. We ossesse tenderness using pressure algometry; quality of life by means of the Short-Form 36 Health Survey (SF-36) and the Hospital Anxiety and Depression Scale (HADS). We used the FM impact questionnaire (FIQ) to assess FM severity and symptomatology. Patients were categorised according to three FIQ-derived categories: FIQFIQFIQ≥59 (16.9±2 vs. 15.6±4, p=0.02), whereas no differences between groups were observed according to FIQ≥70 (17.0±2 vs. 16.2±3, p=0.12) or FM type (16.8±3 for type II vs. 15.9±4 for type I, p=0.13). We observed a significant association between TPC and FIQ-job difficulty, pain, morning tiredness and stiffness dimensions (all pFIQ, FIQ-anxiety, fatigue and depression dimensions (all p>0.05). Algometer score was lower in the FIQ≥70 (45.7±12 vs. 51.1±14, p=0.05) and FIQ≥59 (46.7±13 vs. 52.7±14, p=0.05) groups, and there were no difference between FM types (48.7±13 vs. 49.5±14 for type II and I respectively, p=0.81). Algometer score was not associated with total score of FIQ or FIQ dimensions (all p≥0.1). Widespread pain and pain hypersensitivity, as measured by TPC and algometer score, do not seem to be useful to characterise FM severity and symptomatology (measured by FIQ) in women.

  8. Micro-Physical characterisation of Convective & Stratiform Rainfall at Tropics

    Science.gov (United States)

    Sreekanth, T. S.

    Large Micro-Physical characterisation of Convective & Stratiform Rainfall at Tropics begin{center} begin{center} Sreekanth T S*, Suby Symon*, G. Mohan Kumar (1) , and V Sasi Kumar (2) *Centre for Earth Science Studies, Akkulam, Thiruvananthapuram (1) D-330, Swathi Nagar, West Fort, Thiruvananthapuram 695023 (2) 32. NCC Nagar, Peroorkada, Thiruvananthapuram ABSTRACT Micro-physical parameters of rainfall such as rain drop size & fall speed distribution, mass weighted mean diameter, Total no. of rain drops, Normalisation parameters for rain intensity, maximum & minimum drop diameter from different rain intensity ranges, from both stratiform and convective rain events were analysed. Convective -Stratiform classification was done by the method followed by Testud et al (2001) and as an additional information electrical behaviour of clouds from Atmospheric Electric Field Mill was also used. Events which cannot be included in both types are termed as 'mixed precipitation' and identified separately. For the three years 2011, 2012 & 2013, rain events from both convective & stratiform origin are identified from three seasons viz Pre-Monsoon (March-May), Monsoon (June-September) and Post-Monsoon (October-December). Micro-physical characterisation was done for each rain events and analysed. Ground based and radar observations were made and classification of stratiform and convective rainfall was done by the method followed by Testud et al (2001). Radar bright band and non bright band analysis was done for confimation of stratifom and convective rain respectievely. Atmospheric electric field data from electric field mill is also used for confirmation of convection during convective events. Statistical analyses revealed that the standard deviation of rain drop size in higher rain rates are higher than in lower rain rates. Normalised drop size distribution is ploted for selected events from both forms. Inter relations between various precipitation parameters were analysed in three

  9. Characterisation of semiconductor materials for ionising radiation detectors

    International Nuclear Information System (INIS)

    Vaitkus, J.; Gaubas, E.; Jasinskaite, R.; Juska, G.; Kazukauskas, V.; Puras, R.; Rahman, M.; Sakalauskas, S.; Smith, K.

    2002-01-01

    Methods for the detection and characterisation of semiconductor material parameters and inhomogeneities are analysed. The peculiarities of different 'classical' material and structure characterisation methods are discussed. The methods of lifetime and surface recombination mapping and electric field distribution in the samples are presented. Some results of investigations of GaAs, Si and SiC are used for the characterisation of different peculiarities or methods

  10. Characterisation of metal combustion with DUST code

    Energy Technology Data Exchange (ETDEWEB)

    García-Cascales, José R., E-mail: jr.garcia@upct.es [DITF, ETSII, Universidad Politécnica de Cartagena, Dr Fleming s/n, 30202 Murcia (Spain); Velasco, F.J.S. [Centro Universitario de la Defensa de San Javier, MDE-UPCT, C/Coronel Lopez Peña s/n, 30730 Murcia (Spain); Otón-Martínez, Ramón A.; Espín-Tolosa, S. [DITF, ETSII, Universidad Politécnica de Cartagena, Dr Fleming s/n, 30202 Murcia (Spain); Bentaib, Ahmed; Meynet, Nicolas; Bleyer, Alexandre [Institut de Radioprotection et Sûreté Nucléaire, BP 17, 92260 Fontenay-aux-Roses (France)

    2015-10-15

    Highlights: • This paper is part of the work carried out by researchers of the Technical University of Cartagena, Spain and the Institute of Radioprotection and Nuclear Security of France. • We have developed a code for the study of mobilisation and combustion that we have called DUST by using CAST3M, a multipurpose software for studying many different problems of Mechanical Engineering. • In this paper, we present the model implemented in the code to characterise metal combustion which describes the combustion model, the kinetic reaction rates adopted and includes a first comparison between experimental data and calculated ones. • The results are quite promising although suggest that improvement must be made on the kinetic of the reaction taking place. - Abstract: The code DUST is a CFD code developed by the Technical University of Cartagena, Spain and the Institute of Radioprotection and Nuclear Security, France (IRSN) with the objective to assess the dust explosion hazard in the vacuum vessel of ITER. Thus, DUST code permits the analysis of dust spatial distribution, remobilisation and entrainment, explosion, and combustion. Some assumptions such as particle incompressibility and negligible effect of pressure on the solid phase make the model quite appealing from the mathematical point of view, as the systems of equations that characterise the behaviour of the solid and gaseous phases are decoupled. The objective of this work is to present the model implemented in the code to characterise metal combustion. In order to evaluate its ability analysing reactive mixtures of multicomponent gases and multicomponent solids, two combustion problems are studied, namely H{sub 2}/N{sub 2}/O{sub 2}/C and H{sub 2}/N{sub 2}/O{sub 2}/W mixtures. The system of equations considered and finite volume approach are briefly presented. The closure relationships used are commented and special attention is paid to the reaction rate correlations used in the model. The numerical

  11. Electrochemical and optical characterisation of passive films on stainless steels

    International Nuclear Information System (INIS)

    Wijesighe, T L Sudesh L; Blackwood, D J

    2006-01-01

    The formation and breakdown of the passive film are mainly controlled by ionic and electronic transport processes; processes that are in turn controlled by the electronic properties of the film. Consequently a comprehensive understanding of mechanisms behind passivity and localised corrosion require a detailed perception of the electronic properties of the passive films together with compositional and structural information. As a step towards this goal the passive film on austenitic stainless steel, AISI 316L, formed in borate solution was characterised by in situ Raman spectroscopy and photocurrent spectroscopy coupled with electrochemical measurements. The composition, structure and semiconductivity of the passive films depended on the potential; Fe rich n-type oxide and a Cr rich p-type oxide dominated at more positive potentials and more negative potentials respectively whilst n-type dual layered film formed at intermediate potentials. Analyses of the bandgap determined for these oxides suggested their structures to be Fe 2 O 3 and a Fe-Cr spinel. This hypothesis was supported by the results of in situ Raman spectroscopy

  12. Characterisation of multifunctional surfaces with robust filters

    DEFF Research Database (Denmark)

    Friis, Kasper Storgaard; Godi, Alessandro; De Chiffre, Leonardo

    2011-01-01

    Research has shown that engineered surfaces containing lubrication pockets and directional surface texture can decrease wear and friction in sliding or rolling contacts. A new generation of multifunctional (MUFU) surfaces is achieved by hard machining followed by robot assisted polishing (RAP......). The novel production method allows for a large degree of freedom in specifying surface characteristics such as frequency, depth and volume of the lubricant retention valleys, as well as the amount of load bearing area and the surface roughness. The surfaces cannot readily be characterized by means...... of conventional roughness parameters due to the multi-process production method involved. A series of MUFU surfaces were characterized by using the ISO 13565 standard for stratified surfaces and it is shown that the standard in some cases is inadequate for characterisation of a MUFU surface. To improve...

  13. FRACTIONATION AND CHARACTERISATION OF TECHNICAL AMMONIUM LIGNOSULPHONATE

    Directory of Open Access Journals (Sweden)

    Cheryl Ann Leger

    2010-08-01

    Full Text Available It is difficult to use lignin in any analytical methodology without reducing its considerable polydispersity by fractionation. An ammonium lignosulphonate sample was fractionated using a method of partial solubility in solutions of isopropanol increasingly diluted with distilled water, effectively fractionating by polarity. Selected fractions were characterised by gravimetric determination of the fractions, and determination of acid insoluble lignin, soluble lignin, and carbohydrate contents. Acid-insoluble lignin content was very low, and soluble lignin provided the majority of the lignin content, as should be expected from sulphonated lignin. Carbohydrate contents were also fairly low, the highest percentage at 14.5 being in Fraction 2, with the bulk lignin and Fraction 3 having 6.5% and 3.2%, respectively. Differences in the composition of each fraction support the efficacy of the fractionation process and permitted selection of fractions for use in subsequent studies.

  14. Characterisation of the TAPIRO BNCT epithermal facility

    Energy Technology Data Exchange (ETDEWEB)

    Burn, K. W. [FIS-NUC, ENEA, Via Martiri di Montesole 4, Bologna (Italy); Colli, V. [Dept. of Physics of Univ., INFN, Via Celoria 16, I-20133 Milano (Italy); Curzio, G.; D' Errico, F. [DIMNP, Univ. of Pisa, Via Diotisalvi 2, I-56126 Pisa (Italy); Gambarini, G. [Dept. of Physics of Univ., INFN, Via Celoria 16, I-20133 Milano (Italy); Rosi, G. [FIS-ION, ENEA, Casaccia, Via Anguillarese 301, I-00060 Santa Maria di Galeria, Roma (Italy); Scolari, L. [Dept. of Physics of Univ., INFN, Via Celoria 16, I-20133 Milano (Italy)

    2004-07-01

    A collimated epithermal beam for boron neutron capture therapy (BNCT) research has been designed and built at the TAPIRO fast research reactor. A complete experimental characterisation of the radiation field in the irradiation chamber has been performed, to verify agreement with IAEA requirements. Slow neutron fluxes have been measured by means of an activation technique and with thermoluminescent detectors (TLDs). The fast neutron dose has been determined with gel dosemeters, while the fast neutron spectrum has been acquired by means of a neutron spectrometer based on superheated drop detectors. The gamma-dose has been measured with gel dosemeters and TLDs. For an independent verification of the experimental results, fluxes, doses and neutron spectra have been calculated with Monte Carlo simulations using the codes MCNP4B and MCNPX 2.1.5 with the direct statistical approach (DSA). The results obtained confirm that the epithermal beams achievable at TAPIRO are of suitable quality for BNCT purposes. (authors)

  15. Synthesis and characterisation of new laser dyes

    International Nuclear Information System (INIS)

    Scala-Valero, Claudine

    1997-01-01

    Rhodamines are very efficient laser dyes for the red part of the visible spectrum: their fluorescence quantum efficiencies are about hundred per cent. However, their conversion efficiencies in dye amplifier are about fifty per cent, due to the presence of S n electronic level which is responsible of the re-absorption of a part of photons. In this research thesis, the author aims at trying to move this S n level out of the stimulated emission bandwidth. Models have been developed to propose new structures derived from rhodamines and theoretically possessing the desired properties. The so-recommended molecules have then been synthesised and characterised in terms of absorption and fluorescence spectra, of quantum efficiency, and of fluorescence lifetime. Two modifications are proposed for the rhodamine 6G structure, either by grafting methyl substitutes, or by grafting variously substituted amines. The searched result is obtained with the second modification [fr

  16. Characterising antimicrobial protein-membrane complexes

    International Nuclear Information System (INIS)

    Xun, Gloria; Dingley, Andrew; Tremouilhac, Pierre

    2009-01-01

    Full text: Antimicrobial proteins (AMPs) are host defence molecules that protect organisms from microbial infection. A number of hypotheses for AMP activity have been proposed which involve protein membrane interactions. However, there is a paucity of information describing AMP-membrane complexes in detail. The aim of this project is to characterise the interactions of amoebapore-A (APA-1) with membrane models using primarily solution-state NMR spectroscopy. APA-1 is an AMP which is regulated by a pH-dependent dimerisation event. Based on the atomic resolution solution structure of monomeric APA-1, it is proposed that this dimerisation is a prerequisite for ring-like hexameric pore formation. Due to the cytotoxicity of APA-1, we have developed a cell-free system to produce this protein. To facilitate our studies, we have adapted the cell-free system to isotope label APA-1. 13 C /15 N -enriched APA-1 sample was achieved and we have begun characterising APA-1 dimerisation and membrane interactions using NMR spectroscopy and other biochemical/biophysical methods. Neutron reflectometry is a surface-sensitive technique and therefore represents an ideal technique to probe how APA-1 interacts with membranes at the molecular level under different physiological conditions. Using Platypus, the pH-induced APA-1-membrane interactions should be detectable as an increase of the amount of protein adsorbed at the membrane surface and changes in the membrane properties. Specifically, detailed information of the structure and dimensions of the protein-membrane complex, the position and amount of the protein in the membrane, and the perturbation of the membrane phospholipids on protein incorporation can be extracted from the neutron reflectometry measurement. Such information will enable critical assessment of current proposed mechanisms of AMP activity in bacterial membranes and complement our NMR studies

  17. Two-phase flow characterisation by nuclear magnetic resonance

    International Nuclear Information System (INIS)

    Leblond, J.; Javelot, S.; Lebrun, D.; Lebon, L.

    1998-01-01

    The results presented in this paper demonstrate the performance of the PFGSE-NMR to obtain a complete characterisation of two-phase flows. Different methods are proposed to characterise air-water flows in different regimes: stationary two-phase flows and flows in transient condition. Finally a modified PFGSE is proposed to analyse the turbulence of air-water bubbly flow. (author)

  18. Characterisation and application of NovaFiber lignin

    NARCIS (Netherlands)

    Gosselink, R.J.A.; Snijder, M.H.B.; Kranenbarg, A.; Keijsers, E.R.P.; Jong, de E.; Stigsson, L.L.

    2004-01-01

    Sulphur-free lignin coming from a novel alkaline-pulping process called NovaFiber, which has been developed by KIRAM AB, has been characterised and evaluated for potential applications. A Kraft lignin has been used for comparison. Considering the characterisation results of a NovaFiber softwood and

  19. Characterising thermal resistances and capacitances of GaN high-electron-mobility transistors through dynamic electrothermal measurements

    DEFF Research Database (Denmark)

    Wei, Wei; Mikkelsen, Jan H.; Jensen, Ole Kiel

    2014-01-01

    This study presents a method to characterise thermal resistances and capacitances of GaN high-electron-mobility transistors (HEMTs) through dynamic electrothermal measurements. A measured relation between RF gain and the channel temperature (Tc) is formed and used for indirect measurements...

  20. Characterising the thermoforming behaviour of glass fibre textile reinforced thermoplastic composite materials

    Science.gov (United States)

    Kuhtz, M.; Maron, B.; Hornig, A.; Müller, M.; Langkamp, A.; Gude, M.

    2018-05-01

    Textile reinforced thermoplastic composites are predestined for highly automated medium- and high-volume production processes. The presented work focusses on experimental studies of different types of glass fibre reinforced polypropylene (GF-PP) semi-finished thermoplastic textiles to characterise the forming behaviour. The main deformation modes fabric shear, tension, thought-thickness compression and bending are investigated with special emphasis on the impact of the textile structure, the deformation temperature and rate dependency. The understanding of the fundamental forming behaviour is required to allow FEM based assessment and improvement of thermoforming process chains.

  1. Comprehensive characterisation of sewage sludge for thermochemical conversion processes - Based on Singapore survey.

    Science.gov (United States)

    Chan, Wei Ping; Wang, Jing-Yuan

    2016-08-01

    Recently, sludge attracted great interest as a potential feedstock in thermochemical conversion processes. However, compositions and thermal degradation behaviours of sludge were highly complex and distinctive compared to other traditional feedstock led to a need of fundamental research on sludge. Comprehensive characterisation of sludge specifically for thermochemical conversion was carried out for all existing Water Reclamation Plants in Singapore. In total, 14 sludge samples collected based on the type, plant, and batch categorisation. Existing characterisation methods for physical and chemical properties were analysed and reviewed using the collected samples. Qualitative similarities and quantitative variations of different sludge samples were identified and discussed. Oxidation of inorganic in sludge during ash forming analysis found to be causing significant deviations on proximate and ultimate analysis. Therefore, alternative parameters and comparison basis including Fixed Residues (FR), Inorganic Matters (IM) and Total Inorganics (TI) were proposed for better understanding on the thermochemical characteristics of sludge. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Characterisation of eddy current signals using different types of artificial neural networks

    International Nuclear Information System (INIS)

    Shyamsunder, M.T.; Rajagopalan, C.; Jayakumar, T.; Kalyanasundaram, P.; Baldev Raj; Ray, K.K.

    1996-01-01

    Eddy current testing is one of the important techniques in nondestructive testing. Automated characterisation of eddy current signals (ECS), either in the form of lissajous patterns (figure-of-eight) or individual voltage vs. time signals is an area of growing interest. This is particularly relevant in environments where the signal-to-noise ratio (SNR) of ECS are very poor. Intelligent, timely and precise interpretation of resulting data, is the key for improving the efficiency of NDT and E. A comprehensive study has been undertaken by the authors for the characterisation of ECS having poor SNR, using three types of artificial neural networks (ANNs). The types of ANNs used in this study are [a] the error-back propagation model, [b] the binary Hopfield model and [c] the Kohonen's self-organising maps model. Eddy current signals, acquired from different types of defects such as holes and notches on stainless steel type 316 sheets were used in this study. (author)

  3. Synthesis and characterisation of mucoadhesive thiolated polyallylamine.

    Science.gov (United States)

    Duggan, Sarah; Hughes, Helen; Owens, Eleanor; Duggan, Elaine; Cummins, Wayne; O' Donovan, Orla

    2016-02-29

    The thiolation of polyallylamine (PAAm) for use in mucoadhesive drug delivery has been achieved. PAAm was reacted with different ratios of Traut's reagent, yielding products with thiol contents ranging from 134-487μmol/g. Full mucoadhesive characterisation of the thiolated PAAm samples was conducted using swelling studies, mucoadhesive testing on porcine intestinal tissue and rheology. Both swelling and cohesive properties of the thiolated PAAm products were vastly improved in comparison to an unmodified PAAm control. The swelling abilities of the thiolated samples were high and the degree of thiolation of the products affected the initial rate of swelling. High levels of mucoadhesion were demonstrated by the thiolated PAAm samples, with adhesion times of greater than 24h measured for all three samples and, thus, thiol content did not appear to influence mucoadhesion. Rheological studies of the thiolated PAAm samples showed an increase in G' and G″ values upon the addition of a mucin solution which was not observed in the unmodified control, again highlighting the mucoadhesive interactions between these thiolated polymers and mucin. The synthesis of thiolated PAAm by reaction with Traut's reagent and resulting mucoadhesive properties demonstrates its potential for use a mucoadhesive drug delivery device. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Characterisation of Ferrosilicon Dense Medium Separation Material

    International Nuclear Information System (INIS)

    Waanders, F. B.; Mans, A.

    2003-01-01

    Ferrosilicon is used in the dense medium separation of iron ore at Kumba resources, Sishen, South Africa. Due to high cost and losses that occur during use, maximum recovery by means of magnetic separation is aimed for. The purpose of this project was to determine the characteristics of the unused Fe-Si and then to characterise the changes that occur during storage and use thereof. Scanning electron microscopy was used to determine the composition of each sample, whilst Moessbauer spectroscopy yielded a two-sextet spectrum with hyperfine magnetic field strengths of 20 and 31 T, respectively, for the fresh samples. Additional hematite oxide peaks appeared in the Moessbauer spectra after use of the Fe-Si over a length of time, but this did not result in a dramatic degradation of the medium. No definite changes occurred during correct storage methods. It was, however, found that the biggest loss of Fe-Si was due to the abrasion of the particles, which resulted in the formation of an oxihydroxide froth, during the process.

  5. 3D characterisation of RCF crack networks

    Directory of Open Access Journals (Sweden)

    Ahlström Johan

    2014-06-01

    Full Text Available Rolling contact fatigue (RCF damage is becoming more frequent with increased traffic and loading conditions in the railway industry. Defects which are characterized by a two-lobe darkened surface and a V-shaped surface-breaking crack are often so-called squats. The origination and propagation of squats in railway rails is the topic of many recent studies; the associated crack networks develop with complicated geometry near the surface of rails that is difficult to characterise using most non-destructive methods. The cracks can be examined with repeated metallographic sectioning, but the process is time-consuming and destructive. In order to reduce time, as well as information and material loss, high-resolution and high-energy X-ray imaging of railway rails was done in the current study. Combining the exposures from a range of angles using image analysis, a 3D representation of the complex crack network is achieved. The latter was complemented with metallographic sectioning to determine the accuracy of prediction of the geometrical reconstruction.

  6. CHARACTERISATION OF SOLID AND LIQUID PINEAPPLE WASTE

    Directory of Open Access Journals (Sweden)

    Abdullah Abdullah

    2011-07-01

    Full Text Available The pineapple waste is contain high concentration of biodegradable organic material and suspended solid. As a result it has a high BOD and extremes of pH conditions. The pineapple wastes juice contains mainly sucrose, glucose, fructose and other nutrients. The characterisation this waste is needed to reduce it by  recycling to get raw material or  for  conversion into useful product of higher value added products such as organic acid, methane , ethanol, SCP and enzyme. Analysis of sugar indicates that liquid waste contains mainly sucrose, glucose and fructose.  The dominant sugar was fructose, glucose and sucrose.  The fructose and glucose levels were similar to each other, with fructose usually slightly higher than glucose. The total sugar and citric acid content were 73.76 and 2.18 g/l. The sugar content in solid waste is glucose and fructose was 8.24 and 12.17 %, no sucrose on this waste

  7. Characterisation of fume from hyperbaric welding operations

    Energy Technology Data Exchange (ETDEWEB)

    Ross, John A S; Semple, Sean [Environmental and Occupational Medicine, University of Aberdeen (United Kingdom); Duffin, Rodger [ELEGI Colt Laboratory, University of Edinburgh (United Kingdom); Kelly, Frank [Lung Biology Group, Kings College, University of London (United Kingdom); Seldmann, Joerg; Raab, Andrea, E-mail: j.a.ross@abdn.ac.u [Trace Element Speciation Laboratory, University of Aberdeen (United Kingdom)

    2009-02-01

    We report preliminary work characterising dust from hyperbaric welding trials carried out at increased pressure in a helium and oxygen atmosphere. Particle size and concentration were measured during welding. Samples for quartz and metal analysis and toxicity assessment were taken from a filter in the local fume extraction system. The residue of dust after metal extraction by nitric acid in hydrogen peroxide predominantly a non-metallic white powder assumed to be dust from welding rod coatings and thermal insulation material. Metallic analysis showed predominantly calcium, from the welding rod coating, and period 4 transition metals such as iron, manganese, magnesium and titanium (inductively coupled mass spectrometry, Agilent 7500c). The presence of zirconium indicated a contribution from grinding. The fume was nanoparticulate in nature with a mean particle diameter of 20-30 nm (MSI Inc WPS 1000XP). It showed an intermediate level of oxidative potential regarding the low-molecular weight respiratory tract lining fluid antioxidants ascorbate and glutathione and caused release of the inflammatory marker IL-8 in a human lung A 549 epithelial cell culture with no indication of cytotoxicity. The study findings have strong implications for the measurement techniques needed to assess fume exposure in hyperbaric welding and the provision of respiratory protection.

  8. The Wigner distribution function in modal characterisation

    CSIR Research Space (South Africa)

    Mredlana, Prince

    2016-07-01

    Full Text Available function in modal characterisation P. MREDLANA1, D. NAIDOO1, C MAFUSIRE2, T. KRUGER2, A. DUDLEY1,3, A. FORBES1,3 1CSIR National Laser Centre, PO BOX 395, Pretoria 0001, South Africa. 2Department of Physics, Faculty of Natural and Agricultural..., the Wigner distribution of 𝑓 𝑥 is an integral of the correlation function 𝑓 𝑥 + 1 2 𝑥′ 𝑓 ∗ 𝑥 + 1 2 𝑥′ represented as: 𝑊𝑓 𝑥, 𝑒 = 𝑓 𝑥 + 1 2 𝑥′ 𝑓 ∗ 𝑥 + 1 2 𝑥′ 𝑒−𝑖𝑒𝑥′𝑑ð...

  9. Commercial Charcoal Characterisation For Water Purification

    International Nuclear Information System (INIS)

    Saryati; Sumardjo; Sutisna; Handayani, Ari; Suprapti, Siti

    2001-01-01

    In order to provide a drinking water purification substance, has been studied the charcoal characterisation that based on a porous profile and an adsorption properties of the charcoal. There were using the commercial charcoal like wood charcoals, coconut shell charcoals and activated charcoals. The porous profile was studied by using an electron microscope SEM-EDX and the adsorption properties was studied by using the water sample simulation that contains several metal ions. The concentration of all ions was ten times greater that the maximum ions concentration that permissible in the drinking water. From the grain surface microscopic analysis was shown that the pore structure of the wood charcoal was more regular than the coconut shell charcoal. Mean while the activated charcoal has pore more than wood and coconut shell charcoal. Grains size was not an adsorption parameter. The absorptivitas charcoal was affected by pH solution, but this effect was not linear proportion. There are no significant deference in the adsorptivitas among the tree charcoals that has been studied for Al 3 + , Cr 3+ , Ag 1 +, and Pb 2+ ions the adsorption was large enough (> 60%), for Mn 2+ , Fe 3+ , Se 4+ , Cd 2+ and Ba 2+ ions was 20%-60% dan for Mg 2+ , Na 1+ , Ca 2+ , and Zn 2+ ions was less than 20 %. Generally the wood and coconut shell charcoal absorptivity in the pH 4 solutions was lower than in the pH 5-7 solutions

  10. Characterising risk - aggregated metrics: radiation and noise

    International Nuclear Information System (INIS)

    Passchier, W.

    1998-01-01

    The characterisation of risk is an important phase in the risk assessment - risk management process. From the multitude of risk attributes a few have to be selected to obtain a risk characteristic or profile that is useful for risk management decisions and implementation of protective measures. One way to reduce the number of attributes is aggregation. In the field of radiation protection such an aggregated metric is firmly established: effective dose. For protection against environmental noise the Health Council of the Netherlands recently proposed a set of aggregated metrics for noise annoyance and sleep disturbance. The presentation will discuss similarities and differences between these two metrics and practical limitations. The effective dose has proven its usefulness in designing radiation protection measures, which are related to the level of risk associated with the radiation practice in question, given that implicit judgements on radiation induced health effects are accepted. However, as the metric does not take into account the nature of radiation practice, it is less useful in policy discussions on the benefits and harm of radiation practices. With respect to the noise exposure metric, only one effect is targeted (annoyance), and the differences between sources are explicitly taken into account. This should make the metric useful in policy discussions with respect to physical planning and siting problems. The metric proposed has only significance on a population level, and can not be used as a predictor for individual risk. (author)

  11. Characterisation of Supra- and Infratentorial ICP Profiles.

    Science.gov (United States)

    Moyse, Emmanuel; Ros, Maxime; Marhar, Fouad; Swider, Pascal; Schmidt, Eric Albert

    2016-01-01

    In pathophysiology and clinical practice, the intracranial pressure (ICP) profiles in the supratentorial and infratentorial compartments are unclear. We know that the pressure within the skull is unevenly distributed, with demonstrated ICP gradients. We recorded and characterised the supra- and infratentorial ICP patterns to understand what drives the transtentorial ICP gradient.A 70-year-old man was operated on for acute cerebellar infarction. One supratentorial probe and one cerebellar probe were implanted. Both signals were recorded concurrently and analysed off-line. We calculated mean ICP, ICP pulse amplitude, respiratory waves, slow waves and the RAP index of supra- and infratentorial ICP signals. Then, we measured transtentorial difference and performed correlation analysis for every index.Supratentorial ICP mean was 8.5 mmHg lower than infratentorial ICP, but the difference lessens for higher values. Both signals across the tentorium showed close correlation. Supra- and infratentorial pulse amplitude, respiratory waves and slow waves also showed a high degree of correlation. The compensatory reserve (RAP) showed good correlation. In this case report, we demonstrate that the mean value of ICP is higher in the posterior fossa, with a strong correlation across the tentorium. All other ICP-derived parameters display a symmetrical profile.

  12. Characterisation of aerosols produced by laser cutting

    International Nuclear Information System (INIS)

    Fauvel, S.; Pilot, G.; Dinechin, G. de; Gosse, X.; Arnaud, P.

    2007-01-01

    Powerful lasers represent a promising alternative solution to traditional cutting processes used in dismantling nuclear equipments. The use of optical fibers has an unquestionable advantage when dealing with airtight workshops. A study funded by COGEMA Marcoule was undertaken by IRSN/SERAC in collaboration with GIP/GERAILP in order to characterise the aerosols emitted by the cutting of evaporators elements with a 4 kW continuous wave Nd:YAG laser. For this study, laser cutting has been carried out in a tight room of 35 m 3 connected to a particle sampling pipe. Iso-kinetic samplers allowed the measurement of the aerosol concentration. A diffusional and inertial spectrometer (SDI 2001) - an Andersen impinger coupled to a diffusion battery - provided the size distribution. An electrostatic filter used upstream a HEPA filter, itself placed before the extractor fan, collected the majority of the emitted aerosol. Its efficiency was measured and controlled throughout the experiments. The results show the influence of the cutting conditions on the characteristics of the aerosol, and allow a comparison with other cutting tools. (authors)

  13. Characterisation and Modelling of MEMS Ultrasonic Transducers

    International Nuclear Information System (INIS)

    Teng, M F; Hariz, A J

    2006-01-01

    Silicon ultrasonic transducer micro arrays based on micro-electro-mechanicalsystem (MEMS) technologies are gaining popularity for applications in sonar sensing and excitation. A current challenge for many researchers is modelling the dynamic performance of these and other micro-mechanical devices to ascertain their performance and explain experimental observations reported. In this work, the performance simulation of a MEMS ultrasonic transducer array made from silicon nitride has been successfully carried out using CoventorWare package. The dynamic response of the entire transducer array was characterised, and the results were compared with theoretical predictions. Individual elements were found to vibrate with Bessel-like displacement patterns, and they were resonant at approximately 3 MHz, depending on thickness and lateral dimensions. The frequency shows a linear dependence around the common thickness of 2 μm. Peak displacement levels were examined as a function of frequency, DC bias voltage, and AC drive voltage. Accounting for fabrication variations, and uniformity variations across the wafer, the full array showed minimal variations in peak out-of-plane displacement levels across the device, and isolated elements that were over-responsive and under-responsive. Presently, the effect of observed variations across the array on the performance of the transducers and their radiated fields are being examined

  14. Characterisation of lignite as an industrial adsorbent

    Energy Technology Data Exchange (ETDEWEB)

    Ying Qi; Andrew F.A. Hoadley; Alan L. Chaffee; Gil Garnier [Monash University, Clayton, Vic. (Australia). Department of Chemical Engineering

    2011-04-15

    An alternative use of the abundant and inexpensive lignite (also known as brown coal) as an industrial adsorbent has been characterised. The adsorptive properties of two Victorian lignite without any pre-treatment were investigated using the cationic methylene blue dye as a model compound in aqueous solutions. Two commercial activated carbon products were also studied for comparison. The adsorption equilibrium of the four adsorbents was better described by the Langmuir isotherm model than the Freundlich model. The adsorption capacities of the two untreated lignite adsorbents, Loy Yang and Yallourn, calculated using Langmuir isotherms were 286 and 370 mg/g, respectively, higher than a coconut shell-based activated carbon (167 mg/g), but lower than a coal-based activated carbon (435 mg/g). Surface area results suggested that larger micropores and mesopores were important for achieving good methylene blue adsorption by the activated carbons. However, FTIR and cation exchange capacity analyses revealed that, for the lignite, chemical interactions between lignite surface functional groups and methylene blue molecules occurred, thereby augmenting its adsorption capacity. 63 refs., 3 figs., 7 tabs.

  15. Preparation and characterisation of immobilised humic acid on silicon wafer

    International Nuclear Information System (INIS)

    Szabo, Gy.; Guczi, J.; Telegdi, J.; Pashalidis, I.; Szymczak, W.; Buckau, G.

    2005-01-01

    Full text of publication follows: The chemistry of the interactions of radionuclides with humic acid needs to be understood in details so that humate-mediated migration of radionuclides through the environment can be predicted. To achieve such a data in microscopic scale, several detective techniques, such as atomic force microscopy (AFM), chemical force microscopy (CFM), nuclear microprobe analysis (NMA) and X-ray photoelectron spectroscopy (XPS) can be used to measure intermolecular forces and to visualize the surface morphology. The main aim of this work was to provide humic material with specific properties in order to study with different spectroscopic techniques, the complexation behaviour of surface bound humic acid in microscopic scale. Namely, humic acid has been immobilised on silicon wafers in order to mimic surface bound humic substances in natural aquatic systems. In this communication, we present a simple protocol to immobilize humic acid on silicon wafer surface. A tri-functional silane reagent 3-amino-propyl-tri-methoxy-silane (APTES) was used to modify the surface of silicon wafers and appeared to be able to strongly attached soluble humic acid through their carboxylic groups to solid support. Characterisation of the surfaces, after any preparation steps, was done by ATR-FTIR, AFM and TOF-SIMS. These methods have proved that the humic acid forms a relatively homogeneous layer on the wafers. Immobilisation of humic acid on silicon wafer was further proved by binding isotherm of Am/Nd. (authors)

  16. Preparation and characterisation of ethylcellulose microparticles containing propolis

    Directory of Open Access Journals (Sweden)

    G. B. AVANçO

    2009-02-01

    Full Text Available

    Ethylcellulose microparticles containing propolis ethanolic extract (PE were prepared by the emulsification and solvent evaporation method. Three ratios of ethylcellulose to PE dry residue value (DR were tested (1:0.25, 1:4 and 1:10. Moreover, polysorbate 80 was used as emulsifier in the external phase (1.0 or 1.5% w/w. Regular particle morphology without amorphous and/or sticking characteristics was achieved only when an ethylcellulose:DR ratio of 1:0.25 and 1.0% polysorbate 80 were used. Microparticles had a mean diameter of 85.83 µm. The entrapment efficiency for propolis of the microparticles was 62.99 ± 0.52%. These ethylcellulose microparticles containing propolis would be useful for developing propolis aqueous dosage forms without the strong and unpleasant taste, aromatic odour and high ethanol concentration of PE. Keywords: Brazilian propolis; ethylcellulose; emulsification and solvent evaporation; microparticle characterisation; optimisation.

  17. Characterisation of silica surfaces III: Characterisation of aerosil samples through ethanol adsorption and contact angle studies

    Directory of Open Access Journals (Sweden)

    M.S. Nadiye–Tabbiruka

    2009-12-01

    Full Text Available Aerosil samples, heat treated and then silylated with various silanes at various temperatures have been characterised by adsorption of ethanol at 293 K. Adsorption isotherms were plotted and the BET specific surface areas were determined. Contact angles were measured by the captive bubble method at the three phase contact line in ethanol, on glass slides similarly modified. Silylation was found to alter the ethanol adsorptive properties on aerosil and increase the contact angles on the glass slides to extents that depend on the silane used as well as the concentration of residual silanols and that of surface silyl groups.

  18. Fabrication and Characterisation of Optical Semiconductor Components

    DEFF Research Database (Denmark)

    Christiansen, Lotte Jin

    2006-01-01

    Formålet med projektet har været at fremstille en ny og simpel halvleder komponent til regenerering af optiske telekommunikations signaler. Mange af de hidtil mest brugte komponenter til dette formål er såkaldte interferometre, som kan være meget svære at fremstille rent procesteknisk, samtidig m...

  19. Magnetic characterisation of longitudinal thin film media

    International Nuclear Information System (INIS)

    Dova, P.

    1998-09-01

    Magnetic characterisation techniques, as applied to longitudinal thin film media, have been investigated. These included the study of the differentials of the remanence curves, the delta-M plot and the examination of the critical volumes. Several thin film structures, which are currently used or are being considered for future media applications, have been examined using these techniques. Most of the films were Co-alloys with the exception of a set of Barium ferrite films. Both monolayer and multilayer structures were studied. It was found that the study of activation volumes provides a better insight into the reversal mechanisms of magnetic media, especially in the case of complex structures such as multilayer films and films with bicrystal microstructure. Furthermore, an evaluation study of different methods of determining critical volumes showed that the method using time dependence measurements and the micromagnetic approach is the most appropriate. The magnetic characteristics of the thin film media under investigation were correlated with their microstructure and, where possible, with their noise performance. Magnetic force microscopy was also used for acquiring quasi-domain images in the ac-demagnetised state. It was found that in all Co-alloy films the dominant intergranular coupling is magnetising in nature, the level of which is governed by the Cr content in the magnetic layer. In the case of laminated media it was found that when non-magnetic spacers are used, the nature of the interlayer coupling depends on the spacer thickness. In double layer structures with no spacer, the top layer replicates the crystallographic texture of the bottom layer, and the overall film properties are a combination of the two layers. In bicrystal films the coupling is determined by the Cr segregation in the grain boundaries. Furthermore, the presence of stacking faults in bicrystal films deteriorates their thermal stability, but can be prevented by improving the epitaxial

  20. Physico-chemical characterisation of Slovak wines

    Directory of Open Access Journals (Sweden)

    Barbora Lapčíková

    2017-01-01

    Full Text Available The aim of the present study was characterisation of selected varieties of still wines produced in Slovak Republic in vintage year 2013 and one 2012. There were tested ten samples of nine varieties of wines originated from Malokarpatská "Lesser Carpathian" and Južnoslovenská "Southern Slovakia" wine regions of Slovak Republic, Dornfelder, Frankovka modrá, Svätovarinecké, Zweigeltrebe, Müller Thurgau, Veltlínské zelené, Rizling rýnsky, Rizling vlašský and Sauvignon wines. There were studied selected physico-chemical properties of tested wines as a total contents of anthocyanins and polyphenols by means of spectrophotometry, titratable acidity, density and chromatic characteristics. The highest content of anthocyanins (TAC was found in red wine Frankovka modrá, 183 mg.L-1 and the lowest for sample rose wine St. Laurent 19 mg.L-1. The content of total phenolic compounds as a gallic acid was in range 2833 to 1961 mg.L-1 for red wines, 1016 and 1013 mg.L-1 for rose wines, 1085 to 549 mg.L-1for white wines.  Total acidy was average 6.3 ±0.3 g.L-1 only for Ryzling rýnský, 8.2 g.L-1 and Sauvignon rose 8.0 g.L-1 and was expressed as the amount of tartaric acid. Quality of wines can be expressed by colour intensity too. Was evaluated and compared intensity of colour in wines by CIE Lab method and the total differences between red, rose and white wine DE* was calculated. The most differences was found for Svätovarinecké a Frankovka modrá (2.5 - red wines ("clearly perceptible" and 4.9 for Veltlýnské zelené and Müller Thurgau - white wine ("moderating effect".

  1. Magnetooptical garnet films: preparation, characterisation, application

    International Nuclear Information System (INIS)

    Goernert, P.; Lorenz, A.; Lindner, M.; Richert, H.

    2007-01-01

    Full text: In contemporary magnetooptics both Kerr effect and Faraday effect are applied. The Kerr effect of metals and alloys - such as Fe, Ni, Co, FePt, CoPt, MnBi, PtMnSb - with thicknesses 300 μm are established as commercial isolators in optical systems and for developments of waveguide applications. Bi-REIG is prepared mostly by conventional liquid phase epitaxy (LPE) in PbO-B 2 O 3 -Bi 2 O 3 based solvents and sometimes by laser ablation and as nanocrystalline powders. In each case high Faraday rotation and low optical absorption is necessary. Additionally, magnetooptical sensors should possess high sensitivity and a large dynamic range. All these demands can be fulfilled with (REBi) 3 (FeGaAl) 5 O 12 LPE layers. Here we discuss some new results concerning preparation, characterisation, and application of Bi-TmIG and Bi-DyIG LPE layers on high-quality gadolinium gallium garnet (GGG) or lattice matched Ca-, Mg-, Zr-substituted GGG substrates. Optimization of flux melt composition and under cooling result in sensor films with a Faraday rotation of e.g. -1.2 0 /μm at a wavelength of l=590 nm and saturation induction of Bs=70 mT. Such films are already applied for forensic investigations. However, the responsivity of the garnet films is restricted by their coercivity Hc. Surface defects are found to give rise to pinned magnetic domains correlated with typical hysteresis. Obviously, Hc and the formation of pits are due to misfit stress and substrate surface quality. Besides, it is shown that an increase of working temperature leads to smaller coercivities. (authors)

  2. [Characterisation of Suicide in Colombia, 2000 2010].

    Science.gov (United States)

    Cardona Arango, Doris; Medina-Pérez, Óscar Adolfo; Cardona Duque, Deisy Viviana

    2016-01-01

    Suicide is a serious public health problem worldwide, affecting all population groups, regardless of age, gender, or area of residence. The aim of this investigation was to characterise the recorded suicides in Colombia, between the years 2000 and 2010, according to the variables of the person, time and place. Descriptive quantitative study with information from secondary sources, from the death certificates of deceased people by suicide registered with the National Bureau of Statistics. The behaviour of the deaths and mortality, were determined using the denominator population projections of Colombia and the Amazon, Andean, Atlantic Coast, Eastern Plains and Pacific regions. Descriptive measurements and mortality rates were calculated using these. A total of 24,882 suicides were recorded in the eleven years studied, with a mean of 6.2 people per day, which increased to 8.0 during holidays The mean age of death was 34.5 years (men 36.4, women 27.7), with male deaths (78.1%) and urban areas (66%) predominating. The greatest risk of dying from this cause was recorded in the Eastern Plains, in young adults and seniors, and residents in rural areas. Suicide rates in Colombia show a downward trend, with a mean of 5.3/100,000 inhabitants, and with an increased risk in men (3.7 times the risk in women, in young adults (9/100,000). A higher death rate was recorded in single people in the months of December and January, and at weekends. Copyright © 2015 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  3. Electronic cigarettes: product characterisation and design considerations.

    Science.gov (United States)

    Brown, Christopher J; Cheng, James M

    2014-05-01

    To review the available evidence regarding electronic cigarette (e-cigarette) product characterisation and design features in order to understand their potential impact on individual users and on public health. Systematic literature searches in 10 reference databases were conducted through October 2013. A total of 14 articles and documents and 16 patents were included in this analysis. Numerous disposable and reusable e-cigarette product options exist, representing wide variation in product configuration and component functionality. Common e-cigarette components include an aerosol generator, a flow sensor, a battery and a nicotine-containing solution storage area. e-cigarettes currently include many interchangeable parts, enabling users to modify the character of the delivered aerosol and, therefore, the product's 'effectiveness' as a nicotine delivery product. Materials in e-cigarettes may include metals, rubber and ceramics. Some materials may be aerosolised and have adverse health effects. Several studies have described significant performance variability across and within e-cigarette brands. Patent applications include novel product features designed to influence aerosol properties and e-cigarette efficiency at delivering nicotine. Although e-cigarettes share a basic design, engineering variations and user modifications result in differences in nicotine delivery and potential product risks. e-cigarette aerosols may include harmful and potentially harmful constituents. Battery explosions and the risks of exposure to the e-liquid (especially for children) are also concerns. Additional research will enhance the current understanding of basic e-cigarette design and operation, aerosol production and processing, and functionality. A standardised e-cigarette testing regime should be developed to allow product comparisons.

  4. Production and characterisation of recombinant forms of human pulmonary surfactant protein C (SP-C)

    DEFF Research Database (Denmark)

    Lukovic, Dunja; Plasencia, Inés; Taberner, Francisco J

    2006-01-01

    Surfactant protein C (SP-C) is an essential component for the surface tension-lowering activity of the pulmonary surfactant system. It contains a valine-rich alpha helix that spans the lipid bilayer, and is one of the most hydrophobic proteins known so far. SP-C is also an essential component of ...

  5. Characterisation by esca of iron componds formed on the nuclear steels by surface engeneering

    International Nuclear Information System (INIS)

    Minca, M.; Oncioiu, G.; Coaca, E.; Rusu, O.; Florea, S.; Andrei, V.

    2013-01-01

    In this work it is presented an approach for characterization of the oxide films by assigning the binding energy of the chemical states according with a theoretical analysis. In order to exemplify the method developed there are presented analyses on the internal standards a-Fe 2 O 3 and Fe 3 O 4 ), as well as analysis of superficial structure on austenitic steel samples on which different treatments of surface engineering were made. It is also presented a depth profiling analysis type, achieved by ball cratering method, which allow determining the distribution of different chemical elements with depth. One can follow the distribution of the valence states, Fe 2+ and Fe 3+ , with depth. By means of the presented method it can be precisely determined the valence states of Fe and their weight in the oxide iron films. (authors)

  6. Characterisation of algal organic matter produced by bloom-forming marine and freshwater algae

    KAUST Repository

    Villacorte, Loreen O.; Ekowati, Yuli; Neu, Thomas R.; Kleijn, J. Mieke; Winters, Harvey; Amy, Gary L.; Schippers, Jan Cornelis; Kennedy, Maria Dolores

    2015-01-01

    , such as liquid chromatography - organic carbon detection, fluorescence spectroscopy, fourier transform infrared spectroscopy, alcian blue staining and lectin staining coupled with laser scanning microscopy to indentify its composition and force measurement using

  7. Chemical and biological characterisation of biofilms formed on different substrata in Tisza river (Hungary)

    International Nuclear Information System (INIS)

    Kroepfl, Krisztina; Vladar, Peter; Szabo, Katalin; Acs, Eva; Borsodi, Andrea K.; Szikora, Szilvia; Caroli, Sergio; Zaray, Gyula

    2006-01-01

    Natural biofilms were simultaneously grown on granite, polished granite, andesite, polycarbonate and Plexi-glass substrata for six weeks in the Tisza River. Biofilm production and abundance of algae were influenced by the substratum. Magnitude of the substratum effect was andesite < polished granite < Plexi-glass < granite < polycarbonate. The benthic diatom community on polycarbonate had a high population of Achnantes helvetica. Bacterial activity was similar among substrates for 95 different carbon sources. The concentrations of essential elements and heavy metal pollutants (Zn, Ni, Pb and Cu) were highest in biofilms on polished granite or granite. On basis of algological, bacteriological and chemical investigations, as well as literature data, the Plexi-glass substratum is recommended for biomonitoring of river benthic microbiota. - The Plexi-glass substrate is recommended for monitoring river benthic microbiota

  8. Chemical and biological characterisation of biofilms formed on different substrata in Tisza river (Hungary)

    Energy Technology Data Exchange (ETDEWEB)

    Kroepfl, Krisztina [Research Group of Environmental Chemistry, Hungarian Academy of Sciences, H-1518, Budapest, P.O. Box 32 (Hungary); Vladar, Peter [Research Group of Environmental Chemistry, Hungarian Academy of Sciences, H-1518, Budapest, P.O. Box 32 (Hungary); Szabo, Katalin [Department of Microbiology, Eoetvoes University, H-1518, Budapest, P.O. Box 32 (Hungary); Acs, Eva [Danube Research Station of Hungarian Academy of Sciences, H-2131 Goed (Hungary); Borsodi, Andrea K. [Department of Microbiology, Eoetvoes University, H-1518, Budapest, P.O. Box 32 (Hungary); Szikora, Szilvia [Department of Inorganic and Analytical Chemistry, Eoetvoes University, H-1518, Budapest, P.O. Box 32 (Hungary); Caroli, Sergio [Istituto Superiore di Sanita, 00161 Roma, Viale Regina Elena, 299 (Italy); Zaray, Gyula [Research Group of Environmental Chemistry, Hungarian Academy of Sciences, H-1518, Budapest, P.O. Box 32 (Hungary) and Department of Inorganic and Analytical Chemistry, Eoetvoes University, H-1518, Budapest, P.O. Box 32 (Hungary)]. E-mail: zaray@ludens.elte.hu

    2006-11-15

    Natural biofilms were simultaneously grown on granite, polished granite, andesite, polycarbonate and Plexi-glass substrata for six weeks in the Tisza River. Biofilm production and abundance of algae were influenced by the substratum. Magnitude of the substratum effect was andesite < polished granite < Plexi-glass < granite < polycarbonate. The benthic diatom community on polycarbonate had a high population of Achnantes helvetica. Bacterial activity was similar among substrates for 95 different carbon sources. The concentrations of essential elements and heavy metal pollutants (Zn, Ni, Pb and Cu) were highest in biofilms on polished granite or granite. On basis of algological, bacteriological and chemical investigations, as well as literature data, the Plexi-glass substratum is recommended for biomonitoring of river benthic microbiota. - The Plexi-glass substrate is recommended for monitoring river benthic microbiota.

  9. Synthesis and characterisation of doxorubicin-loaded functionalised ...

    African Journals Online (AJOL)

    that it modified the CFNP surface from hydrophobic to hydrophilic. VSM analysis ... characterisation of. XG-coated. CFNPs ..... nanoparticles display a characteristic plasmon resonance .... coating method and its application to grow thin films of.

  10. Synthesis and Characterisation of Eight Isomeric Bis(2-pyridyloxynaphthalenes

    Directory of Open Access Journals (Sweden)

    Peter J. Steel

    2006-09-01

    Full Text Available Eight isomeric bis(2-pyridyloxynaphthalenes have been prepared from reactions of 2-bromopyridine with the appropriate dihydroxynaphthalene and the products fully characterised by 1- and 2-D NMR spectroscopy.

  11. The hydrological characterisation and water budget of a South ...

    African Journals Online (AJOL)

    The hydrological characterisation and water budget of a South African rehabilitated ... Hydrograph separation, based on stable isotopes (18O), revealed that the ... during the summer rains when the wetlands soil moisture deficit is close to 0, ...

  12. Analytical protocols for characterisation of sulphur-free lignin

    NARCIS (Netherlands)

    Gosselink, R.J.A.; Abächerli, A.; Semke, H.; Malherbe, R.; Käuper, P.; Nadif, A.; Dam, van J.E.G.

    2004-01-01

    Interlaboratory tests for chemical characterisation of sulphur-free lignins were performed by five laboratories to develop useful analytical protocols, which are lacking, and identify quality-related properties. Protocols have been established for reproducible determination of the chemical

  13. Cross-genus amplification and characterisation of microsatellite loci ...

    African Journals Online (AJOL)

    Cross-genus amplification and characterisation of microsatellite loci in the little free tailed bat, Chaerephon pumilus s. l. (Molossidae) from South Eastern Africa. Theshnie Naidoo, Angus Macdonald, Jennifer M Lamb ...

  14. Characterisation of COPD heterogeneity in the ECLIPSE cohort

    DEFF Research Database (Denmark)

    Agusti, Alvar; Calverley, Peter M A; Celli, Bartolome

    2010-01-01

    Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE)....

  15. Nutrient characterisation of river inflow into the estuaries of the ...

    African Journals Online (AJOL)

    Nutrient characterisation of river inflow into the estuaries of the Gouritz Water ... into the estuaries within the Gouritz Water Management Area (WMA) of South Africa. ... Long-term water quality monitoring data (dissolved inorganic nitrogen, i.e. ...

  16. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  17. History of radiological characterisation in Studsvik - History of radiological characterisation in decommissioning projects in Studsvik

    International Nuclear Information System (INIS)

    Hedvall, Robert

    2012-01-01

    AB SVAFO is a nuclear waste technology and decommissioning company based in Sweden in the scenic surroundings of Studsvik on the Baltic coast. SVAFO is owned by the Swedish nuclear power industry. The company was created in 1992 by Sydsvenska Vaermekraft AB, Vattenfall AB, Forsmarks Kraftgrupp AB and Oskarshamns Kraftgrupp AB as a consequence of the Act on the Financing of the Management of Certain Radioactive Waste etc, from 1988. AB SVAFO's main business is to take care of formerly state-owned spent nuclear waste at the site, including small amounts of nuclear fuel. Buildings are also included, mainly nuclear waste storage buildings and a research reactor. Some buildings have already been decommissioned and all the fuel is treated. In the past 30 years, various decommissioning projects have been carried out, encompassing areas such as an underground research reactor, a Van de Graaff accelerator, 15,000 m 2 of nuclear laboratories, two 150 m 3 underground concrete sludge silos and several waste-storage buildings. Up till now only one or two persons did a simple characterisation before the project started to get the level of contamination. With the start of the decommissioning of the former uranium mine in Ranstad and the R2-reactor, more efforts have been put for the characterisation. The change in methods will be described. (author)

  18. Elaboration and characterisation of plutonium waste reference materials

    International Nuclear Information System (INIS)

    Perolat, J.P.

    1990-01-01

    The Analysis Methods Establishment Commission (CETAMA) has set up a program for the elaboration and characterisation of plutonium waste reference materials. The object of this program is to give laboratories the possibility to test and calibrate apparatus used in non-destructive methods for the analysis of plutonium waste. The different parameters of this program are presented: - characterisation of plutonium, - type and number of containers, - plutonium distribution inside the different containers, - description of the matrix

  19. Characterisation of COPD heterogeneity in the ECLIPSE cohort

    DEFF Research Database (Denmark)

    Agusti, Alvar; Calverley, Peter M A; Celli, Bartolome

    2010-01-01

    Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE).......Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE)....

  20. Characterisation of random Gaussian and non-Gaussian stress processes in terms of extreme responses

    Directory of Open Access Journals (Sweden)

    Colin Bruno

    2015-01-01

    Full Text Available In the field of military land vehicles, random vibration processes generated by all-terrain wheeled vehicles in motion are not classical stochastic processes with a stationary and Gaussian nature. Non-stationarity of processes induced by the variability of the vehicle speed does not form a major difficulty because the designer can have good control over the vehicle speed by characterising the histogram of instantaneous speed of the vehicle during an operational situation. Beyond this non-stationarity problem, the hard point clearly lies in the fact that the random processes are not Gaussian and are generated mainly by the non-linear behaviour of the undercarriage and the strong occurrence of shocks generated by roughness of the terrain. This non-Gaussian nature is expressed particularly by very high flattening levels that can affect the design of structures under extreme stresses conventionally acquired by spectral approaches, inherent to Gaussian processes and based essentially on spectral moments of stress processes. Due to these technical considerations, techniques for characterisation of random excitation processes generated by this type of carrier need to be changed, by proposing innovative characterisation methods based on time domain approaches as described in the body of the text rather than spectral domain approaches.

  1. Characterisation of the Redox Sensitive NMDA Receptor

    KAUST Repository

    Alzahrani, Ohood

    2016-05-01

    Glucose entry into the brain and its subsequent metabolism to L-lactate, regulated by astrocytes, plays a major role in synaptic plasticity and memory formation. A recent study has shown that L-lactate produced by the brain upon stimulation of glycolysis, and glycogen-derived L-lactate from astrocytes and its transport into neurons, is crucial for memory formation. A recent study revealed the molecular mechanisms that underlie the role of L-lactate in neuronal plasticity and long-term memory formation. L-lactate was shown to induce a cascade of molecular events via modulation of redox-sensitive N-Methyl-D-aspartate (NMDA) receptor activity that was mimicked by nicotinamide adenine dinucleotide hydride (NADH) co-enzyme. This indicated that changes in cellular redox state, following L-lactate transport inside the cells and its subsequent metabolism, production of NADH, and favouring a reduced state are the key effects of L-lactate. Therefore, we are investigating the role of L-lactate in modulating NMDA receptor function via redox modulatory sites. Accordingly, crucial redox-sensitive cysteine residues, Cys320 and Cys87, of the NR2A NMDA receptor subunit are mutated using site-directed mutation, transfected, and expressed in HEK293 cells. This cellular system will then be used to characterise and monitor its activity upon Llactate stimulation, compared to the wild type. This will be achieved by calcium imaging, using fluorescent microscopy. Our data shows that L-lactate potentiated NMDA receptor activity and increased intracellular calcium influx in NR1/NR2A wild type compared to the control condition (WT NR1/NR2A perfused with (1μM) glutamate and (1μM) glycine agonist only), showing faster response initiation and slower decay rate of the calcium signal to the baseline. Additionally, stimulating with L-lactate associated with greater numbers of cells having high fluorescent intensity (peak amplitude) compared to the control. Furthermore, L-lactate rescued the

  2. Characterising Record Flooding in the United Kingdom

    Science.gov (United States)

    Cox, A.; Bates, P. D.; Smith, J. A.

    2017-12-01

    Though the most notable floods in history have been carefully explained, there remains a lack of literature that explores the nature of record floods as a whole in the United Kingdom. We characterise the seasonality, statistical and spatial distribution, and meteorological causes of peak river flows for 521 gauging stations spread across the British Isles. We use annual maximum data from the National River Flow Archive, catchment descriptors from the Flood Estimation Handbook, and historical records of large floods. What we aim to find is in what ways, if any, the record flood for a station is different from more 'typical' floods. For each station, we calculate two indices: the seasonal anomaly and the flood index. Broadly, the seasonal anomaly is the degree to which a station's record flood happens at a different time of year compared to typical floods at that site, whilst the flood index is a station's record flood discharge divided by the discharge of the 1-in-10-year return period event. We find that while annual maximum peaks are dominated by winter frontal rainfall, record floods are disproportionately caused by summer convective rainfall. This analysis also shows that the larger the seasonal anomaly, the higher the flood index. Additionally, stations across the country have record floods that occur in the summer with no notable spatial pattern, yet the most seasonally anomalous record events are concentrated around the south and west of the British Isles. Catchment descriptors tell us little about the flood index at a particular station, but generally areas with lower mean annual precipitation have a higher flood index. The inclusion of case studies from recent and historical examples of notable floods across the UK supplements our analysis and gives insight into how typical these events are, both statistically and meteorologically. Ultimately, record floods in general happen at relatively unexpected times and with unpredictable magnitudes, which is a

  3. Innovative forms of citizen participation

    DEFF Research Database (Denmark)

    Nyseth, Torill; Ringholm, Toril; Agger, Annika

    in practice. Some scholars claim that a reason is due to rigid and formal procedures and that the ways citizen meetings are structured tend to appeal to a limited amount of the population. At the same time, we are witnessing a proliferation in novel and more experimental ways of how citizens and authorities...... interact within the field of urban governance. This is for example seen in urban regeneration projects in Denmark and planning experiments in Norway where we are witnessing more inclusive and bottom-up initiated interactions between public authorities and local actors. The key question in this paper is......: What characterises the new and innovative forms of citizen participation in urban planning in terms of innovation? And in what ways and to what degree is input from these processes fed into the formal planning processes? Theoretically, the paper is inspired by the concept of: ‘planning...

  4. Contributor Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2014-09-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  5. Contributors Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2016-06-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  6. Source-term characterisation and solid speciation of plutonium at the Semipalatinsk NTS, Kazakhstan.

    Science.gov (United States)

    Nápoles, H Jiménez; León Vintró, L; Mitchell, P I; Omarova, A; Burkitbayev, M; Priest, N D; Artemyev, O; Lukashenko, S

    2004-01-01

    New data on the concentrations of key fission/activation products and transuranium nuclides in samples of soil and water from the Semipalatinsk Nuclear Test Site are presented and interpreted. Sampling was carried out at Ground Zero, Lake Balapan, the Tel'kem craters and reference locations within the test site boundary well removed from localised sources. Radionuclide ratios have been used to characterise the source term(s) at each of these sites. The geochemical partitioning of plutonium has also been examined and it is shown that the bulk of the plutonium contamination at most of the sites examined is in a highly refractory, non-labile form.

  7. Source-term characterisation and solid speciation of plutonium at the Semipalatinsk NTS, Kazakhstan

    Energy Technology Data Exchange (ETDEWEB)

    Napoles, H.J.H. Jimenez; Leon Vintro, L. E-mail: luis.leon@ucd.ie; Mitchell, P.I.; Omarova, A.; Burkitbayev, M.; Priest, N.D.; Artemyev, O.; Lukashenko, S

    2004-09-01

    New data on the concentrations of key fission/activation products and transuranium nuclides in samples of soil and water from the Semipalatinsk Nuclear Test Site are presented and interpreted. Sampling was carried out at Ground Zero, Lake Balapan, the Tel'kem craters and reference locations within the test site boundary well removed from localised sources. Radionuclide ratios have been used to characterise the source term(s) at each of these sites. The geochemical partitioning of plutonium has also been examined and it is shown that the bulk of the plutonium contamination at most of the sites examined is in a highly refractory, non-labile form.

  8. Characterisation of a Zn / Ni Plating Bath

    Science.gov (United States)

    2009-09-03

    accelerated corrosion in the first stages which is then slowed down by its own product of corrosion, Zn(OH)212. Zinc hydroxide dehydrates in time to form ZnO ... Electrochemistry , 1991, 21, 642 [5] – Alfantasi, A.M., A study on the synthesis, characterization ans properties of pulse-plated ultrafine- grained Zn-Ni alloy

  9. Development and characterisation of supramolecular autovectoring system for selective drug delivery.

    Science.gov (United States)

    Jaitely, V; Vyas, S P

    1999-01-01

    Supramolecules since ages have been characterised as self-associating systems emanating the properties directly related to the mode of molecular association. Similar to supramolecules, liquid crystals may also be considered as an associated system. The liquid crystals are defined as the state of matter with the characterstic order of the crystal and the mobility of liquid. The system has been compared to the transporting form of cholesterol in body. The present study reports autovectoring potentials of the drug liquid crystals using diclofenac diethylammonium (DD) as a model. The drug based liquid crystals of DD were prepared employing temperature induced transformation of isotropic form to the liquid crystal form. The prepared liquid crystal systems were incubated with 1% phosphatidylcholine in order to stabilise the surface and restrict it into the liquid crystalline state. The system was characterised for viscosity variation, X-ray diffraction pattern, partitioning behaviour and in vitro diffusion profile. In vivo vectorising potential of the developed system was evaluated using rats as test animal and studying for the organ level distribution and drug compartmentalisation. The system exhibited satisfactory vecterisation as significant amount of administered dose was localised selectively in liver.

  10. On Closed Form Calculation of Line Spectral Frequencies (LSF)

    DEFF Research Database (Denmark)

    Dalsgaard, Paul; Andersen, Ove

    2014-01-01

    of characteristic polynomial zeros. The theoretical analysis is based on decomposition of sequences into symmetric and anti-symmetric polynomials defined as a series expansion of reduced Chebyshev polynomials of the first kind. Two variants of closed form functions are presented — each characterised by using...

  11. Characterisation of focal liver lesions with contrast enhanced ultrasonography

    International Nuclear Information System (INIS)

    Dietrich, Christoph F.

    2004-01-01

    Ultrasound contrast agents (USCA) have improved the detection rate of liver tumours in recent years. Conventional ultrasound has been reported to be relatively unreliable in the characterisation of liver tumours. SonoVue [reg] (Bracco Imaging Spa) has been shown to be particularly advantageous in the differentiation of benign and malignant liver tumours and, therefore, possibly represents a new cost-effective competitive alternative to other liver imaging modalities (e.g. computed tomography and magnetic resonance imaging), thus allowing these important technologies to be available for other indications (e.g. brain, thorax). More detailed and specific liver tumour characterisation is possible in about 80% of liver tumours due to typical vascularity and perfusion patterns. The role of USCA for better characterisation, which is possible through the analysis of flow characteristics in real time, places a particular emphasis on agent use. Contrast enhanced real-time imaging techniques with SonoVue [reg] allow real-time analysis of tumour perfusion in patients with liver lesions. Liver tumours known to be hyperperfused in the arterial phase (e.g. focal nodular hyperplasia, hepatocellular adenoma and carcinoma, and hyperperfused metastases) can be better detected and characterised. Hypoperfused tumours (e.g. liver metastases of the gastrointestinal tract) can be recognised in the portal venous phase as less perfused 'black spots'. In this article we discuss liver tumour characterisation by contrast enhanced ultrasonography

  12. SiteChar. Characterisation of European CO2 storage. Deliverable D8.1. Qualitative and quantitative social site characterisations

    Energy Technology Data Exchange (ETDEWEB)

    Brunsting, S.; Pol, M.; Paukovic, M. [ECN Policy Studies, Energy research Centre of the Netherlands ECN, Amsterdam (Netherlands); Kaiser, M.; Zimmer, R. [Unabhaengiges Institut fuer Umweltfragen UfU, Berlin (Germany); Shackley, S.; Mabon, L. [Scottish Carbon Capture and Storage SCCS, Edinburg, Scotland (United Kingdom); Hepplewhite, F.; Loveridge, R. [Energy Markets Unit, Scottish Government, Edinburg, Scotland (United Kingdom); Mazurowski, M.; Polak-Osiniak, D. [Polish Oil and Gas Company PGNiG, Warszawa (Poland); Rybicki, C. [AGH University of Science and Technology, Krakow (Poland)

    2012-10-15

    At local level, public support has proven crucial to the implementation of CO2 capture and storage (CCS) demonstration projects. Whereas no method exists to guarantee public acceptability of any project, a constructive stakeholder engagement process does increase the likelihood thereof. Social site characterisation can be used as an instrument to explore, plan and evaluate a process of active and constructive local stakeholder engagement in a prospective CCS project as a parallel activity to technical site characterisation. It roughly consists of a formative research phase to get acquainted with the area followed by a series of public information and engagement activities. This deliverable presents results from the first phase for the social site characterisations of a prospective CCS site in Poland (onshore) and the UK (offshore), using qualitative as well as quantitative research methods, as a first step to planning of local public engagement activities and evaluation of these activities that will be undertaken by this consortium at both sites in the near future. Although the term social site characterisation actually refers to the entire process of formative research and subsequent public outreach, and hence to the complete package of awareness work undertaken as part of SiteChar, in the present deliverable the term only refers to the formative research activities as undertaken up to now and as described in this deliverable. The qualitative part of the social site characterisation consisted of (1) a description of relevant social site characteristics such as local history; (2) interviews with relevant local stakeholders; (3) a media analysis of local newspapers. The quantitative part of the social site characterisation consisted of surveys using representative samples to characterise the local population in terms of awareness, knowledge and perceptions of CCS, felt involvement in decision making, extent of local activism, level of trust in representatives and

  13. Applying Freeze Technology for Characterisation of Liquids, Sludge and Sediment

    International Nuclear Information System (INIS)

    Eriksson, Jens; Foster, Adam; Lindberg, Maria

    2016-01-01

    Full text of publication follows: Contaminated solids below a water table or solids in a water saturated environment can be major cost drivers and have a massive impact on the overall schedule and scope for a decommissioning project if not managed properly. One well recognized key activity in the preparation for decommissioning is to perform a proper characterisation covering all objects and areas which have been affected or potentially affected by contamination. Characterization of potentially contaminated material located below water or in water saturated environments can be difficult to perform accurately. Furthermore, traditional sampling techniques typically result in the disturbance or spreading of the contamination during sample collection. Sampling programs should be done in such a way that the radioactivity is contained (to avoid further spread of contamination), and in a way that the risk for cross contamination is minimised. Studsvik's Freeze Technology has been used to develop the necessary sampling techniques to meet these objectives. This technology is proven and frequently used for environmental characterization and remediation applications. The design of the sampling tools for radiological characterisation allows for samples to be taken at specific depths and at specific locations within the contaminated area without disturbing the contaminated material around the sample location. In addition to the sampling technique described above, a modified freeze sampling design has proven to be very useful in collecting frozen core samples that provide an accurate profile of the contamination and chemical and physical characteristics of the sediment or sludge as a function of depth into the sludge or sediment. Ultimately, this technique is used to develop a 3-D map of the physical characteristics and the chemical and radiological composition of the contaminated area. For many projects, this type of information will allow for a large reduction in the

  14. Wastes Characterisation from Foundry Activities on European Level

    International Nuclear Information System (INIS)

    Andres, I.; Ruiz, C.; Ibanez, R.; Viguri, J.; Irabien, A.

    1999-01-01

    This work presents The results of the eco toxicological characterisation of 22 defined wastes from steel foundry activities. The wastes have been selected from three processes, steel mill (smelting). sand casting and cleaning and finishing of steel products,with the common characteristics of represent an important industrial activity in the area and generated the wastes considered in this study. The eco toxicological characterisation obtained applying the Spanish regulations on hazardous waste is compared to the hazardous attributions considered by the European Union in order to characterise a waste as hazardous (non hazardous). The results allow to conclude that a acceptable concordance between both methodologies is reached and remark the need to split the broad generic types of wastes given by the Spanish regulation (Eco toxic / non eco toxic) into clearly identifiable specific types of waste

  15. Physico-chemical characterisation of Indian biomass ashes

    Energy Technology Data Exchange (ETDEWEB)

    K. Umamaheswaran; Vidya S. Batra [Energy and Resources Institute (TERI), New Delhi (India)

    2008-05-15

    India stands fourth in biomass utilisation for various purposes like domestic, commercial and industrial applications. While extensive studies have been made for coal ash characterisation and utilisation, studies on characterisation of biomass ash and its utilisation has not been addressed. In this paper, biomass ash from five sources i.e. rice husk, bagasse, groundnut shell, cashewnut shell, and arecanut shell have been characterised. Chemical composition analysis, particle size analysis, thermal analysis, and microstructure analysis were carried out. Results show that in all ashes silica is the major compound with particle size ranging from 15 to 30 {mu}m and having irregular shape. Ash powders originating from cashewnut shell, arecanut shell and groundnut shell also have compounds of calcium, magnesium and potassium. Bagasse and cashewnut shell ashes have high LOI due to presence of unburnt carbon, P{sub 2}O{sub 5} and other volatiles. 16 refs., 22 figs., 3 tabs.

  16. Ferrite nanoparticles: Synthesis, characterisation and applications in electronic device

    Energy Technology Data Exchange (ETDEWEB)

    Kefeni, Kebede K., E-mail: kkefeni@gmail.com; Msagati, Titus A.M.; Mamba, Bhekie B.

    2017-01-15

    Highlights: • Available synthesis methods of ferrite nanoparticles (FNPs) are briefly reviewed. • Summary of the advantage and limitation of FNPs synthesis techniques are presented. • The existing most common FNPs characterisation techniques are briefly reviewed. • Major application areas of FNPs in electronic materials are reviewed. - Abstract: Ferrite nanoparticles (FNPs) have attracted a great interest due to their wide applications in several areas such as biomedical, wastewater treatment, catalyst and electronic device. This review focuses on the synthesis, characterisation and application of FNPs in electronic device with more emphasis on the recently published works. The most commonly used synthesis techniques along with their advantages and limitations are discussed. The available characterisation techniques and their application in electronic materials such as sensors and biosensors, energy storage, microwave device, electromagnetic interference shielding and high-density recording media are briefly reviewed.

  17. Different Approach to the Aluminium Oxide Topography Characterisation

    International Nuclear Information System (INIS)

    Poljacek, Sanja Mahovic; Gojo, Miroslav; Raos, Pero; Stoic, Antun

    2007-01-01

    Different surface topographic techniques are being widely used for quantitative measurements of typical industrial aluminium oxide surfaces. In this research, specific surface of aluminium oxide layer on the offset printing plate has been investigated by using measuring methods which have previously not been used for characterisation of such surfaces. By using two contact instruments and non-contact laser profilometer (LPM) 2D and 3D roughness parameters have been defined. SEM micrographs of the samples were made. Results have shown that aluminium oxide surfaces with the same average roughness value (Ra) and mean roughness depth (Rz) typically used in the printing plate surface characterisation, have dramatically different surface topographies. According to the type of instrument specific roughness parameters should be used for defining the printing plate surfaces. New surface roughness parameters were defined in order to insure detailed characterisation of the printing plates in graphic reproduction process

  18. De novo design, synthesis and characterisation of MP3, a new catalytic four-helix bundle hemeprotein.

    Science.gov (United States)

    Faiella, Marina; Maglio, Ornella; Nastri, Flavia; Lombardi, Angela; Lista, Liliana; Hagen, Wilfred R; Pavone, Vincenzo

    2012-12-07

    A new artificial metalloenzyme, MP3 (MiniPeroxidase 3), designed by combining the excellent structural properties of four-helix bundle protein scaffolds with the activity of natural peroxidases, was synthesised and characterised. This new hemeprotein model was developed by covalently linking the deuteroporphyrin to two peptide chains of different compositions to obtain an asymmetric helix-loop-helix/heme/helix-loop-helix sandwich arrangement, characterised by 1) a His residue on one chain that acts as an axial ligand to the iron ion; 2) a vacant distal site that is able to accommodate exogenous ligands or substrates; and 3) an Arg residue in the distal site that should assist in hydrogen peroxide activation to give an HRP-like catalytic process. MP3 was synthesised and characterised as its iron complex. CD measurements revealed the high helix-forming propensity of the peptide, confirming the appropriateness of the model procedure; UV/Vis, MCD and EPR experiments gave insights into the coordination geometry and the spin state of the metal. Kinetic experiments showed that Fe(III)-MP3 possesses peroxidase-like activity comparable to R38A-hHRP, highlighting the possibility of mimicking the functional features of natural enzymes. The synergistic application of de novo design methods, synthetic procedures, and spectroscopic characterisation, described herein, demonstrates a method by which to implement and optimise catalytic activity for an enzyme mimetic. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Optical characterisation of cubic silicon carbide

    International Nuclear Information System (INIS)

    Jackson, S.M.

    1998-09-01

    The varied properties of Silicon Carbide (SiC) are helping to launch the material into many new applications, particularly in the field of novel semiconductor devices. In this work, the cubic form of SiC is of interest as a basis for developing integrated optical components. Here, the formation of a suitable SiO 2 buried cladding layer has been achieved by high dose oxygen ion implantation. This layer is necessary for the optical confinement of propagating light, and hence optical waveguide fabrication. Results have shown that optical propagation losses of the order of 20 dB/cm are obtainable. Much of this loss can be attributed to mode leakage and volume scattering. Mode leakage is a function of the effective oxide thickness, and volume scattering related to the surface layer damage. These parameters have been shown to be controllable and so suggests that further reduction in the waveguide loss is feasible. Analysis of the layer growth mechanism by RBS, XTEM and XPS proves that SiO 2 is formed, and that the extent, of formation depends on implant dose and temperature. The excess carbon generated is believed to exit the oxide layer by a number of varying mechanisms. The result of this appears to be a number of stable Si-C-O intermediaries that, form regions to either depth extreme of the SiO 2 layer. Early furnace tests suggest a need to anneal at, temperatures approaching the melting point of the silicon substrate, and that the quality of the virgin material is crucial in controlling the resulting oxide growth. (author)

  20. Killing spinors as a characterisation of rotating black hole spacetimes

    International Nuclear Information System (INIS)

    Cole, Michael J; Kroon, Juan A Valiente

    2016-01-01

    We investigate the implications of the existence of Killing spinors in a spacetime. In particular, we show that in vacuum and electrovacuum a Killing spinor, along with some assumptions on the associated Killing vector in an asymptotic region, guarantees that the spacetime is locally isometric to the Kerr or Kerr–Newman solutions. We show that the characterisation of these spacetimes in terms of Killing spinors is an alternative expression of characterisation results of Mars (Kerr) and Wong (Kerr–Newman) involving restrictions on the Weyl curvature and matter content. (paper)

  1. Further training in the fields of radiological characterisation and clearance

    International Nuclear Information System (INIS)

    Bothe, M.; Feinhals, J.; Neukaeter, E.

    2016-01-01

    Radiological characterisation and clearance require specific knowledge and skills. Targeted further training of the staff is one possibility to get this knowledge and skills. A modular concept was established, which allows adaption to specific requests of the institution and state of knowledge and skills of participants. The modules have following focuses: ''radiological characterisation and clearance'', ''sampling'' and ''measurement and sampling plans'' and consist half-and-half of lectures and group works. In group works participants apply new knowledge to examples of the installation or simulated scenarios and afterwards they present and discuss the results. This concept was carried out for different institutions and is planned for some more.

  2. The synthesis and characterisation of some aliphatic monoamides and diamides

    International Nuclear Information System (INIS)

    Ruikar, P.B.; Prabhu, D.R.; Mahajan, G.R.; Nagar, M.S.; Nair, G.M.; Subramanian, M.S.

    1992-01-01

    This report summarises the synthesis and characterisation of several symmetrical, unsymmetrical and branched chain amides which have potential application as alternate extractants to TBP in the Purex Process. Some substituted diamides which have importance in the removal of actinides from transuranium waste have also been synthesised and characterised. The amides contents determined by nonaqueous potentiometric titration indicate a purity of 97-100%. The relative basicity of these amides and diamides have been determined by measuring the equilibrium constants for the uptake of nitric acid by them. The streching frequency of their carbonyl bond has also been listed. (author). 26 refs., 3 tabs

  3. KKS:The new power plant characterisation system in practice

    International Nuclear Information System (INIS)

    Becker, G.; Bohr, E.; Wildberg, D.

    1982-01-01

    These use of the new power plant characterisation system (KKS) in power plant operation is discussed. KKS intends to ensure reliable characterisation of plant components. It must be read, interpreted, communicated directly or by telephone and written down. An analysis under the aspects of information psychology and ergonomy has shown that the findings of ergonomy and information psychology have hardly been considerd in the design of KKS. The conclusions of this analysis are investigated with regard to their consequences for KKS application in power plant operation. Possibilities of improvement are discussed. (orig./HP) [de

  4. Characterisation of ferroelectric bulk materials and thin films

    CERN Document Server

    Cain, Markys G

    2014-01-01

    This book presents a comprehensive review of the most important methods used in the characterisation of piezoelectric, ferroelectric and pyroelectric materials. It covers techniques for the analysis of bulk materials and thick and thin film materials and devices. There is a growing demand by industry to adapt and integrate piezoelectric materials into ever smaller devices and structures. Such applications development requires the joint development of reliable, robust, accurate and - most importantly - relevant and applicable measurement and characterisation methods and models. In the past f

  5. Characterisation of a Sr-90 based electron monochromator

    CERN Document Server

    Arfaoui, S; CERN; Casella, C; ETH Zurich

    2015-01-01

    This note describes the characterisation of an energy filtered Sr-90 source to be used in laboratory studies that require Minimum Ionising Particles (MIP) with a kinetic energy of up to approx. 2 MeV. The energy calibration was performed with a LYSO scintillation crystal read out by a digital Silicon Photomultiplier (dSiPM). The LYSO/dSiPM set-up was pre-calibrated using a Na-22 source. After introducing the motivation behind the usage of such a device, this note presents the principle and design of the electron monochromator as well as its energy and momentum characterisation.

  6. Characterisation of contaminated metals using an advanced statistical toolbox - Geostatistical characterisation of contaminated metals: methodology and illustrations

    International Nuclear Information System (INIS)

    Larsson, Arne; Lidar, Per; Desnoyers, Yvon

    2014-01-01

    Radiological characterisation plays an important role in the process to recycle contaminated or potentially contaminated metals. It is a platform for planning, identification of the extent and nature of contamination, assessing potential risk impacts, cost estimation, radiation protection, management of material arising from decommissioning as well as for the release of the materials as well as the disposal of the generated secondary waste as radioactive waste. Key issues in radiological characterisation are identification of objectives, development of a measurement and sampling strategy (probabilistic, judgmental or a combination thereof), knowledge management, traceability, recording and processing of obtained information. By applying advanced combination of statistical and geostatistical in the concept better performance can be achieved at a lower cost. This paper will describe the benefits with the usage of the available methods in the different stages of the characterisation, treatment and clearance processes aiming for reliable results in line with the data quality objectives. (authors)

  7. Electrochemical characterisation of a martensitic stainless steel in a neutral chloride solution

    International Nuclear Information System (INIS)

    Marcelin, Sabrina; Pébère, Nadine; Régnier, Sophie

    2013-01-01

    Highlights: ► A better knowledge of the electrochemical behaviour of a martensitic stainless steel in bulk electrolyte was obtained. ► Quantitative parameters were obtained from impedance measurements. ► The study will be used as reference to investigate crevice corrosion using a thin layer cell. - Abstract: This paper focuses on the characterisation of the electrochemical behaviour of a martensitic stainless steel in 0.1 M NaCl + 0.04 M Na 2 SO 4 solution and is a part of a study devoted to crevice corrosion resistance of stainless steels. Polarisation curves and electrochemical impedance measurements were obtained for different experimental conditions in bulk electrolyte. X-ray photoelectron spectroscopy (XPS) was used to analyse the passive films. At the corrosion potential, the stainless steel was in the passive state and the corrosion process was controlled by the properties of the passive film formed during air exposure. During immersion in the deaerated solution, the passive film was only slightly modified, whereas it was altered both in composition and thickness during immersion in the aerated solution. After cathodic polarisation of the stainless steel electrode surface, the oxide film was almost totally removed and the surface appeared to be uniformly active for oxygen reduction. The new passive film, formed at the corrosion potential, was enriched with iron species and less protective. Impedance diagrams allowed the characterisation of both the oxide film (high-frequency range) and the charge transfer process (low-frequency range).

  8. Identification and Characterisation of a Proteasome -

    DEFF Research Database (Denmark)

    Andersen, Katrine Mølgaard

    this domain. A txl1 yeast knockout mutant displays a synthetic growth defect with a cut8 knockout, whereas the txc1 knockout does not. In fission yeast, Cut8 is a nuclear protein that tethers the 26S proteasome to the nuclear membrane. In both wild type cells and in a cut8 null mutant Txl1 co......-down of Txnl1 in HeLa cells, whereas no stabilisation was detected in txl1¿ cells in S. pombe. In human cells, an active site Txnl1 mutant formed a mixed disulfide intermediate with eEF1A1, a reported substrate-recruiting factor of the 26S proteasome. Fission yeast Txl1 can reduce an oxidised proteasomal model...

  9. Densified waste form and method for forming

    Science.gov (United States)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina

    2015-08-25

    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  10. CO2 Storage Feasibility: A Workflow for Site Characterisation

    Directory of Open Access Journals (Sweden)

    Nepveu Manuel

    2015-04-01

    Full Text Available In this paper, we present an overview of the SiteChar workflow model for site characterisation and assessment for CO2 storage. Site characterisation and assessment is required when permits are requested from the legal authorities in the process of starting a CO2 storage process at a given site. The goal is to assess whether a proposed CO2 storage site can indeed be used for permanent storage while meeting the safety requirements demanded by the European Commission (EC Storage Directive (9, Storage Directive 2009/31/EC. Many issues have to be scrutinised, and the workflow presented here is put forward to help efficiently organise this complex task. Three issues are highlighted: communication within the working team and with the authorities; interdependencies in the workflow and feedback loops; and the risk-based character of the workflow. A general overview (helicopter view of the workflow is given; the issues involved in communication and the risk assessment process are described in more detail. The workflow as described has been tested within the SiteChar project on five potential storage sites throughout Europe. This resulted in a list of key aspects of site characterisation which can help prepare and focus new site characterisation studies.

  11. Characterisation of the inorganic chemistry of surface waters in ...

    African Journals Online (AJOL)

    The main purpose of this study was to determine a simple inorganic chemistry index that can be used for all surface waters in South Africa, in order to characterise the inorganic chemistry of surface waters. Water quality data collected up until 1999 from all sample monitoring stations (2 068 monitoring stations, 364 659 ...

  12. Location and characterisation of pollution sites by principal ...

    African Journals Online (AJOL)

    Location and characterisation of pollution sites by principal component analysis of trace contaminants in a slightly polluted seasonal river: a case study of the Arenales River (Salta, Argentina) ... Keywords: trace element contamination, water quality, principal component analysis, Arenales River, Salta, Argentina ...

  13. Characterisation of South African coals using instrumental neutron activation analysis

    International Nuclear Information System (INIS)

    Hart, R.J.

    1985-01-01

    This report includes the establishment of the major minor and trace element compositions of South African coals with the aim of characterising the different coal seams within a basin, defining regions of similar compositions and obtaining an overall view of the geochemistry of coals in this country. The results of 40 coal samples analysed by neutron activation analysis

  14. Characterising and comparing the spawning habitats of anchovy ...

    African Journals Online (AJOL)

    The spawning habitats of anchovy Engraulis encrasicolus and sardine Sardinops sagax in the southern Benguela upwelling ecosystem were characterised by comparing their egg abundances with environmental variables measured concomitantly during two different survey programmes: the South African Sardine and ...

  15. Biological characterisation of Haliclona (?gellius) sp.: sponge and associated microorganisms.

    NARCIS (Netherlands)

    Sipkema, D.; Holmes, B.; Nichols, S.A.; Blanch, H.W.

    2009-01-01

    We have characterised the northern Pacific undescribed sponge Haliclona (?gellius) sp. based on rDNA of the sponge and its associated microorganisms. The sponge is closely related to Amphimedon queenslandica from the Great Barrier Reef as the near-complete 18S rDNA sequences of both sponges were

  16. Characterisation of a novel Mannheimia sp from Australian feedlot cattle

    DEFF Research Database (Denmark)

    Blackall, P.J.; Angen, Øystein; Fegan, N.

    2001-01-01

    glucosida, M granulomatis, M ruminalis and M varigena - using a range of phenotypic and genotypic methods. Results Phenotypic characterisation indicated that the isolates belonged to the trehalose-negative [Pasteurella] haemolytica complex. This complex has recently been reorganised into five species within...

  17. Analytical Characterisation of Nanoscale Zero-Valent Iron: A ...

    Science.gov (United States)

    Zero-valent iron nanoparticles (nZVI) have been widely tested as they are showing significant promise for environmental remediation. However, many recent studies have demonstrated that their mobility and reactivity in subsurface environments are significantly affected by their tendency to aggregate. Both the mobility and reactivity of nZVI mainly depends on properties such as particle size, surface chemistry and bulk composition. In order to ensure efficient remediation, it is crucial to accurately assess and understand the implications of these properties before deploying these materials into contaminated environments. Many analytical techniques are now available to determine these parameters and this paper provides a critical review of their usefulness and limitations for nZVI characterisation. These analytical techniques include microscopy and light scattering techniques for the determination of particle size, size distribution and aggregation state, and X-ray techniques for the characterisation of surface chemistry and bulk composition. Example characterisation data derived from commercial nZVI materials is used to further illustrate method strengths and limitations. Finally, some important challenges with respect to the characterisation of nZVI in groundwater samples are discussed. In recent years, manufactured nanoparticles (MNPs) have attracted increasing interest for their potential applications in the treatment of contaminated soil and water. In compar

  18. Characterisation of Oil-Gas Mixtures by Raman Spectroscopy

    DEFF Research Database (Denmark)

    Hansen, Susanne Brunsgaard; Berg, Rolf W.; Stenby, Erling Halfdan

    2004-01-01

    . The present project deals with development of a technique for quick analysis of oil-gas mixtures. The main emphasis is laid on characterisation of gas phases in equilibrium with oil at high pressures and high temperatures by Raman spectroscopy. The Raman technique has a great potential of being useful, due...

  19. Characterisation of Gliclazide-PEG 8000 Solid Dispersions

    African Journals Online (AJOL)

    Erah

    Purpose: The aim of the present study was to characterise gliclazide solid dispersions (SDs) ... Results: The solubility of gliclazide increased with increasing amount of PEG 8000 in aqueous medium. ... FTIR analysis demonstrated the absence of well-defined gliclazide - PEG 8000 .... voltage of 35 kV and 20 mA current. The.

  20. Characterisation of a CMOS charge transfer device for TDI imaging

    International Nuclear Information System (INIS)

    Rushton, J.; Holland, A.; Stefanov, K.; Mayer, F.

    2015-01-01

    The performance of a prototype true charge transfer imaging sensor in CMOS is investigated. The finished device is destined for use in TDI applications, especially Earth-observation, and to this end radiation tolerance must be investigated. Before this, complete characterisation is required. This work starts by looking at charge transfer inefficiency and then investigates responsivity using mean-variance techniques

  1. Spatial distribution and habitat characterisation of mosquito species ...

    African Journals Online (AJOL)

    Background: Infections with mosquito-borne parasites are common in human populations inhabiting tropical regions of the world. Malaria is endemic along Kenyan Lake Victoria basin and its vectors are fresh water breeders. However, much less is known about the current spatial distribution and habitat characterisation of ...

  2. Characterising atmospheric optical turbulence using stereo-SCIDAR

    Science.gov (United States)

    Osborn, James; Butterley, Tim; Föhring, Dora; Wilson, Richard

    2015-04-01

    Stereo-SCIDAR (SCIntillation Detection and Ranging) is a development to the well known SCIDAR method for characterisation of the Earth's atmospheric optical turbulence. Here we present some interesting capabilities, comparisons and results from a recent campaign on the 2.5 m Isaac Newton Telescope on La Palma.

  3. Characterisation of tectonic lineaments in the Central Equatorial ...

    African Journals Online (AJOL)

    Characterisation of tectonic lineaments in the Central Equatorial Atlantic region of Africa using Bouguer anomaly gravity data. ... Ife Journal of Science ... 3-D standard Euler deconvolution analysis was carried out on Bouguer anomaly gravity data for configuration definition and approximate depth estimate of tectonic ...

  4. The spatial and temporal characterisation of flooding within the ...

    African Journals Online (AJOL)

    The inundated area of a wetland is characterised by annual and interannual variability. This paper presents remotely-sensed imagery in order to better understand the spatial and temporal patterns of flooding within the floodplain wetland of the Nyl River, Limpopo Province. A detailed understanding of the hydrological ...

  5. Physicochemical characterisation of hexanic seed oil extract from ...

    African Journals Online (AJOL)

    The physicochemical characterisation of oil extracts from Schinus molle seeds collected in South Africa was performed. The oils were extracted in hexane, physicochemical parameters determined and lipids profiled by gas chromatography, in order to determine its potential for use in industry, ethnomedicine and its ...

  6. On the fate of carbon nanotubes : morphological characterisations

    NARCIS (Netherlands)

    Loos, J.; Grossiord, N.; Koning, C.E.; Regev, O.

    2007-01-01

    Single-walled and multi-walled carbon nanotubes (SWNTs and MWNTs) were characterised as-produced, after exfoliation and purification, and imbedded in the polymer matrix of nanocomposites by using various microscopic techniques. Transmission electron microscopy (TEM) shows thickness distribution as

  7. Microscopic characterisation of suspended graphene grown by chemical vapour deposition

    NARCIS (Netherlands)

    Bignardi, L.; Dorp, W.F. van; Gottardi, S.; Ivashenko, O.; Dudin, P.; Barinov, A.; de Hosson, J.T.M.; Stöhr, M.; Rudolf, P.

    2013-01-01

    We present a multi-technique characterisation of graphene grown by chemical vapour deposition (CVD) and thereafter transferred to and suspended on a grid for transmission electron microscopy (TEM). The properties of the electronic band structure are investigated by angle-resolved photoelectron

  8. Synthesis and characterisation of doxorubicin-loaded functionalised ...

    African Journals Online (AJOL)

    The synthesised cobalt ferrite nanoparticles (CFNPs) were functionalised with xanthine gum (XG) and subsequently characterised by Fourier transform-infrared spectroscopy (FT-IR), thermogravimetric analysis (TGA) and contact angle studies. Vibrating sample magnetometry (VSM) was used for magnetic measurements of ...

  9. Characterisation of bovine epiblast-derived outgrowth colonies

    DEFF Research Database (Denmark)

    Østrup, Esben; Gjørret, Jakob; Schauser, Kirsten Hallundbæk

    2010-01-01

    The aim of the present study was to characterise bovine epiblast-derived outgrowth colonies (OCs) with respect to the embryonic origin of their cellular components. Epiblasts were isolated mechanically from bovine Day 12 embryos. Epiblasts were cultured on feeder layers of SNL cells (neomycin...

  10. Characterisation of bacterial brown spot pathogen from dry bean ...

    African Journals Online (AJOL)

    Pseudomonas syringae pv. syringae (Pss) causes bacterial brown spot (BBS) of beans (Phaseolus vulgaris L.), with yield losses of up to 55% in South Africa. Pss has a wide host range and for many of these, the pathogen has been biochemically and genetically characterised. However, few studies have been conducted on ...

  11. Characterisation of Oyster Shell for Neutralisation of Bio- Leached ...

    African Journals Online (AJOL)

    Michael

    2016-12-02

    Dec 2, 2016 ... (Goodall et al., 2005; O'Connor and Dunne, 1994;. Kydros et al. ... while the gold is concentrated in the iron oxide (hemaetite) residue ..... leaching in the characterisation of complex gold ores” ... Australia, 413 pp. O'Connor ...

  12. Hydrothermal synthesis and characterisation of amine-templated ...

    African Journals Online (AJOL)

    Hydrothermal synthesis and characterisation of amine-templated metal phosphate framework. ... The complexes were thermally stable up to 3000C, after which the organic components starts decomposing. The solubility test in a wide spectrum of solvents (at room temperature) showed that the complexes were insoluble in ...

  13. Grey water characterisation and pollutant loads in an urban slum

    International Nuclear Information System (INIS)

    Katukiza, A. Y.; Ronteltap, M.; Niwagaba, C. B.; Kansiime, F.; Lens, P. N. L.

    2015-01-01

    On-site sanitation provisions in urban slums rarely prioritise grey water management, yet it forms the largest fraction of wastewater. This study was carried out to characterise grey water and quantify its pollutant loads in Bwaise III (Uganda) and to provide data for grey water management in urban slums of developing countries. Samples were collected for analysis from ten representative households as well as from four tertiary drains and the main drainage channel for 7 months in two dry seasons. Grey water production was found to comprise 85 % of the domestic water consumption. The chemical oxygen demand concentration in the grey water generated by laundry, in the kitchen and in the bathroom was 9,225 ± 1,200 mg L-1, 71,250 ± 1,011 mg L-1 and 4,675 ± 750 mg L-1, while the BOD5 (biochemical oxygen demand) to COD ratio was 0.24 ± 0.05, 0.33 ± 0.08 and 0.31 ± 0.07, respectively. The maximum concentration of Escherichia coli and total coliforms was 2.05 9 107 cfu (100 mL)-1 and 1.75 9 108 cfu (100 mL)-1, respectively, in grey water from the bathroom, while that of Salmonella spp. was 7.32 9 106 cfu (100 mL)-1 from laundry. Analysis of variance (ANOVA) showed a significant difference in the concentration of COD, total suspended solids, total organic carbon, dissolved organic carbon, total phosphorus, sodium adsorption ratio, oil and grease, and Salmonella spp. in grey water from laundry, bathroom and kitchen (p/0.05). The high loads of COD ([500 kg day-1), total suspended solids ([200 kg day-1), nutrients (8.3 kg TKN day-1 and 1.4 kg total phosphorus day-1) and microorganisms (106 to 109 cfu c-1 day-1) originating from grey water in Bwaise III show that grey water poses a threat to the environment and a risk to human health in urban slums. Therefore, there is a need to prioritise grey water treatment in urban slums of developing countries to achieve adequate sanitation.

  14. Characterisation of a candidate dual AGN

    Science.gov (United States)

    Lena, D.; Panizo-Espinar, G.; Jonker, P. G.; Torres, M.; Heida, M.

    2018-05-01

    We present Chandra and optical observations of a candidate dual AGN discovered serendipitously while searching for recoiling black holes via a cross-correlation between the serendipitous XMM source catalog (2XMMi) and SDSS-DR7 galaxies with a separation no larger than ten times the sum of their Petrosian radii. The system has a stellar mass ratio M1/M2 ≈ 0.7. One of the galaxies (Source 1) shows clear evidence for AGN activity in the form of hard X-ray emission and optical emission-line diagnostics typical of AGN ionisation. The nucleus of the other galaxy (Source 2) has a soft X-ray spectrum, bluer colours, and optical emission line ratios dominated by stellar photoionisation with a "composite" signature, which might indicate the presence of a weak AGN. When plotted on a diagram with X-ray luminosity vs [OIII] luminosity both nuclei fall within the locus defined by local Seyfert galaxies. From the optical spectrum we estimate the electron densities finding n1 active nature of Source 1 can be established with confidence, whether the nucleus of Source 2 is active remains a matter of debate. Evidence that a faint AGN might reside in its nucleus is, however, tantalising.

  15. Characterising a historical bridge’s bricks in Popayán (Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Galindo Díaz

    2008-05-01

    Full Text Available This article presents the procedures and results of studying the physical-mechanical and chemical-mineralogical cha-racterisation of the bricks originally used in a masonry arch bridge; the bridge was built in the first half of the 18th century in the city of Popayán, Colombia. Core-samples were thus extracted from the bridge’s lower area and sub-jected to different laboratory tests. Physical-mechanical characterisation quantified values related to dry weight, sus-pended weight, saturated weight, porosity, apparent gravity, apparent density and maximum load values, cold com-pression resistance and elasticity modulus. The results revealed the bricks’ high porosity and their low resistance to compression stress. Chemical-mineralogical characterisation involved a combination of tests including X-ray diffract-tion (XRD, X-ray photoelectron spectroscopy (XPS and Fourier transformed infra-red spectroscopy (FTIR. Several mi-nerals found led to deducting the source of the raw material, as well as verifying some brick production characteris-tics of the time in the said region. Tridimite, cristobalite, magnetite and calcium carbonate were some of the phases formed by the temperatures reached while firing the bricks, while potassium sulphate presence in one of the samples conveyed the nature of the construction materials’ production characteristics. Combining XRD and XPS analysis pro-vided information about firing temperature and the new mineralogical phases appearing at the end of this process; FTIR proved functional OH and Si-O-Si group presence. These bricks’ characteristics provided valuable data for res-toration purposes, formulating a new brick from raw material complying with reconstruction requirements.

  16. Microdosimetric characterisation of radiation fields for modelling tissue response in radiotherapy

    Directory of Open Access Journals (Sweden)

    He Wang

    2014-02-01

    Full Text Available Purpose: Our overall goal is the development of an approach to model tissue response to radiotherapy in which a tissue is viewed as a statistical ensemble of interacting cells. This involves characterisation of radiation fields on the spatial scale of subcellular structures. On this scale, the spatial distribution of radiation energy imparted to tissue is highly non-uniform and should be characterised in statistical terms. Microdosimetry provides a formalism developed for that purpose. This study addresses limitations of the standard microdosimetric approach to modelling tissue response by introducing two new characteristics that include additional information in a form convenient for this application.Methods: The standard microdosimetric approach is based on the concept of a sensitive volume (SV representing a target volume in the cell. It is considered in isolation from other SVs, implying that energy depositions in different SVs are statistically independent and that individual cells respond to radiation independent of each other. In this study, we examined the latter approximation through analysis of correlation functions. All calculations were performed with Geant4-DNA Monte Carlo code. Results: We found that for some realistic scenarios, spatial correlations of deposited energy can be significant. Two new characteristics of radiation fields are proposed. The first is the specific energy-volume histogram (zVH, which is a microscopic analogue of the dose-volume histogram. The second describes the probability distribution of deposited energies in two SVs without assuming statistical independence between the SVs. Numerical examples for protons and carbon ions of therapeutic energies are presented and discussed.Conclusion: We extended the microdosimetric approach to modelling tissue response by including additional important characteristics and presented them in a more conventional radiotherapy format

  17. Indoor atmospheric corrosion of historical ferrous alloys. System characterisation, mechanisms and modelling discussion

    International Nuclear Information System (INIS)

    Monnier, J.

    2008-12-01

    Understanding the mechanisms of indoor atmospheric corrosion in iron alloys is of primary importance in several fields, including for the conservation of Middle Ages monuments or the long term storage of nuclear waste. In this research, a double approach was developed, combining fine characterisation of corrosion systems and design of experiments to answers specific questions related to mechanisms understanding. Iron indoor atmospheric corrosion was investigated on samples coming from the reinforcing chain of the Amiens cathedral (15. century). In the first stage, the corrosion system has been extensively characterised from the macroscopic to the nano-metric scale. In particular, structural micro-analysis (μ-Raman, μ-XRD, μ-XAS) has been used to locate, identify and quantify the oxidised phases. Rust layers are composed of a matrix of nano-metric goethite, with low quantities of lepidocrocite and akaganeite mostly located in the extern part of the corrosion system. In addition, clear marblings are dispersed in the matrix, which are sometimes connected with the metal core. Although these may contain maghemite, these marblings are generally made of ferri-hydrite/feroxyhite phases. In the second stage, specific experiments have been carried out in an unsaturated marked medium to locate oxygen reduction sites in the rust layers. Several cases were evidenced, depending on the rust layer morphology. In addition, reduction processes of model phases have been studied in situ, using an electrochemical cell coupled with structural characterisation techniques. This combination highlighted the influence of reduction mode and pH on the type of reduced phase formed. From the obtained results, several mechanisms are proposed to explain the long term indoor atmospheric corrosion of iron, including rust layers morphology and phases properties. The different hypotheses have been integrated in a proposed method to diagnosis ancient ferrous systems stability. These hypotheses also

  18. Human orexin/hypocretin receptors form constitutive homo- and heteromeric complexes with each other and with human CB1 cannabinoid receptors

    International Nuclear Information System (INIS)

    Jäntti, Maria H.; Mandrika, Ilona; Kukkonen, Jyrki P.

    2014-01-01

    Highlights: • OX 1 and OX 2 orexin and CB 1 cannabinoid receptor dimerization was investigated. • Bioluminescence resonance energy transfer method was used. • All receptors readily formed constitutive homo- and heteromeric complexes. - Abstract: Human OX 1 orexin receptors have been shown to homodimerize and they have also been suggested to heterodimerize with CB 1 cannabinoid receptors. The latter has been suggested to be important for orexin receptor responses and trafficking. In this study, we wanted to assess the ability of the other combinations of receptors to also form similar complexes. Vectors for expression of human OX 1 , OX 2 and CB 1 receptors, C-terminally fused with either Renilla luciferase or GFP 2 green fluorescent protein variant, were generated. The constructs were transiently expressed in Chinese hamster ovary cells, and constitutive dimerization between the receptors was assessed by bioluminescence energy transfer (BRET). Orexin receptor subtypes readily formed homo- and hetero(di)mers, as suggested by significant BRET signals. CB 1 receptors formed homodimers, and they also heterodimerized with both orexin receptors. Interestingly, BRET efficiency was higher for homodimers than for almost all heterodimers. This is likely to be due to the geometry of the interaction; the putatively symmetric dimers may place the C-termini in a more suitable orientation in homomers. Fusion of luciferase to an orexin receptor and GFP 2 to CB 1 produced more effective BRET than the opposite fusions, also suggesting differences in geometry. Similar was seen for the OX 1 –OX 2 interaction. In conclusion, orexin receptors have a significant propensity to make homo- and heterodi-/oligomeric complexes. However, it is unclear whether this affects their signaling. As orexin receptors efficiently signal via endocannabinoid production to CB 1 receptors, dimerization could be an effective way of forming signal complexes with optimal cannabinoid concentrations

  19. Materials Characterisation of Glass/epoxy Composites - Focusing on Process Conditions

    DEFF Research Database (Denmark)

    Jakobsen, Johnny; Lyckegaard, Anders; Jensen, Erik Appel

    2013-01-01

    Predicting the behaviour of fibre reinforced polymer composites taking the process conditions into account involves advanced modelling techniques and an extensive materials characterisation. The materials characterisation of a chopped strand mat glass/epoxy composite has been the focus...

  20. Geological formation characterisation by acoustic waves

    International Nuclear Information System (INIS)

    Mari, J.L.; Gaudiani, P.; Delay, J.

    2010-01-01

    Document available in extended abstract form only. For many years, the transmission of a sonic wave through formations has been used for drilling measurements. The tools used are of monopole or dipole type. Monopole-type tools are the most commonly used. Sources and receivers are multidirectional. In the fluid, sources generate a compression wave which creates in the formation a compression wave (P wave) and a shear wave (S wave) at the refraction limit angles. In a vertical well, such tools permit the recording of five propagation modes: the refracted compression wave, the refracted shear wave (only in fast formations), the fluid wave, two dispersive guided modes which are the pseudo Rayleigh waves (only in fast formations) and the Stoneley waves. Full waveform acoustic measurements are represented as constant-offset sections or as common source point gathers, similar to those used in seismic operations. For the different modes, the acoustic parameters which are usually measured are: picked time, amplitude and frequency. The acoustic parameters allow one to determine the propagation velocities of the various modes and some petro-physical parameters and to obtain lithologic and mechanical information if the shear velocity of the formation has been measured. Usually the picking of the refracted S wave is difficult due to the interferences of different wave trains such as leaky modes associated with the refracted P waves and the pseudo Rayleigh. To compute a continuous log of shear velocity, we propose an hybrid method based on the local measurement of the shear velocity (picking of the arrival time of the refracted S wave) and on the analysis of the dispersion curve of the Stoneley modes ( Biot 1956, White 1965). We also show the benefit of using a shape index parameter named Ic, computed from the amplitudes (A1, A2 and A3) of the first refracted P wave to detect acoustic anomalies specially in fractured formation. The Ic parameter is independent of the energy of

  1. Electrical impedance tomography spectroscopy method for characterising particles in solid-liquid phase

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanlin [Department of Thermal Energy Engineering, College of Mechanical and Transportation Engineering, China University of Petroleum, Beijing, 102249 (China); Wang, Mi [Institute of Particle Science and Engineering, School of Process, Environmental and Materials Engineering, University of Leeds, Leeds LS2 9JT (China); Yao, Jun [School of Energy Research, Xiamen University, Xiamen 361005 (China)

    2014-04-11

    Electrical impedance tomography (EIT) is one of the process tomography techniques to provide an on-line non-invasive imaging for multiphase flow measurement. With EIT measurements, the images of impedance real part, impedance imaginary part, phase angle, and magnitude can be obtained. However, most of the applications of EIT in the process industries rely on the conductivity difference between two phases in fluids to obtain the concentration profiles. It is not common to use the imaginary part or phase angle due to the dominant change in conductivity or complication in the use of other impedance information. In a solid-liquid two phases system involving nano- or submicro-particles, characterisation of particles (e.g. particle size and concentration) have to rely on the measurement of impedance phase angle or imaginary part. Particles in a solution usually have an electrical double layer associated with their surfaces and can form an induced electrical dipole moment due to the polarization of the electrical double layer under the influence of an alternating electric field. Similar to EIT, electrical impedance spectroscopy (EIS) measurement can record the electrical impedance data, including impedance real part, imaginary part and phase angle (θ), which are caused by the polarization of the electrical double layer. These impedance data are related to the particle characteristics e.g. particle size, particle and ionic concentrations in the aqueous medium, therefore EIS method provides a capability for characterising the particles in suspensions. Electrical impedance tomography based on EIS measurement or namely, electrical impedance tomography spectroscopy (EITS) could image the spatial distribution of particle characteristics. In this paper, a new method, including test set-up and data analysis, for characterisation of particles in suspensions are developed through the experimental approach. The experimental results on tomographic imaging of colloidal particles

  2. The Swedish nuclear industry way to approach higher demands on characterisation prior to clearance

    International Nuclear Information System (INIS)

    Larsson, Arne; Hellsten, Erik; Berglund, Malin; Larsson, Lars

    2012-01-01

    The Swedish Radiation Safety Authority (SSM) has introduced new regulations for clearance SSMFS 2011:2 'Regulations concerning clearance of material, rooms, buildings and soil from activities with ionizing radiation'. The new regulations came into force January 1, 2012. Compared to the previous regulations these new regulations have a broader scope and have introduced new conditions such as nuclide specific clearance levels. Clearance is practiced to reduce the amount of radioactive waste generated. Cleared material can be reused, recycled or if these two possibilities are not available, disposed of as conventional waste. To be able to meet the requirements for clearance the Swedish nuclear industry has jointly developed guidance for clearance in the form of a handbook and a training course covering the competence requirements in the new regulations. The handbook was developed by a team of representatives from the Swedish nuclear license holders managed by Studsvik on behalf of Swedish Nuclear Fuel and Waste Management Company (SKB). The training program was developed in co-operation between Nuclear Safety and training Company (KSU) and Studsvik on behalf of the Swedish nuclear license holders. A major challenge in the adoption to the new regulations is how to provide robust yet cost effective characterisation data. This is especially difficult for mobile materials and equipment which cannot be fully tracked but also for other materials and areas where the nuclide fingerprint has varied over the years. To be able to deal with these issues a lot of attention has to be paid to the historical inventory records and traceability in the clearance process. Materials, rooms and buildings have been divided in four categories with different requirements on frequency and requirements of measurements. The categories are named 'extremely small risk', 'small risk', 'risk' and 'known contamination above clearance levels'. The two day training course is dived into seven parts

  3. The Scandinavian baltic pancreatic club (SBPC) database: design, rationale and characterisation of the study cohort.

    Science.gov (United States)

    Olesen, Søren S; Poulsen, Jakob L; Drewes, Asbjørn M; Frøkjær, Jens B; Laukkarinen, Johanna; Parhiala, Mikael; Rix, Iben; Novovic, Srdan; Lindkvist, Björn; Bexander, Louise; Dimcevski, Georg; Engjom, Trond; Erchinger, Friedemann; Haldorsen, Ingfrid S; Pukitis, Aldis; Ozola-Zālīte, Imanta; Haas, Stephan; Vujasinovic, Miroslav; Löhr, J Matthias; Gulbinas, Antanas; Jensen, Nanna M; Jørgensen, Maiken T; Nøjgaard, Camilla

    2017-08-01

    Chronic pancreatitis (CP) is a multifaceted disease associated with several risk factors and a complex clinical presentation. We established the Scandinavian Baltic Pancreatic Club (SBPC) Database to characterise and study the natural history of CP in a Northern European cohort. Here, we describe the design of the database and characteristics of the study cohort. Nine centres from six different countries in the Scandinavian-Baltic region joined the database. Patients with definitive or probable CP (M-ANNHEIM diagnostic criteria) were included. Standardised case report forms were used to collect several assessment variables including disease aetiology, duration of CP, preceding acute pancreatitis, as well as symptoms, complications, and treatments. The clinical stage of CP was characterised according to M-ANNNHEIM. Yearly follow-up is planned for all patients. The study cohort comprised of 910 patients (608 men: 302 women; median age 58 (IQR: 48-67) years with definite 848 (93%) or probable CP 62 (7%). Nicotine (70%) and alcohol (59%) were the most frequent aetiologies and seen in combination in 44% of patients. A history of recurrent acute pancreatitis was seen in 49% prior to the development of CP. Pain (69%) and exocrine pancreatic insufficiency (68%) were the most common complications followed by diabetes (43%). Most patients (30%) were classified as clinical stage II (symptomatic CP with exocrine or endocrine insufficiency). Less than 10% of the patients had undergone pancreatic surgery. The SBPC database provides a mean for future prospective, observational studies of CP in the Northern European continent.

  4. The characterisation of vapour-phase alkali metal-tellurium-oxygen species

    International Nuclear Information System (INIS)

    Gomme, R.A.; Ogden, J.S.; Bowsher, B.R.

    1986-10-01

    Detailed assessments of hypothetical severe accidents in light water reactors require the identification of the chemical forms of the radionuclides in order to determine their transport characteristics. Caesium and tellurium are important volatile fission products in accident scenarios. This report describes detailed studies to characterise the chemical species that vaporise from heated mixtures of various alkali metal-tellurium-oxygen systems. The molecular species were characterised by a combination of quadrupole mass spectrometry and matrix isolation-infrared spectroscopy undertaken in conjunction with experiments involving oxygen-18 substitution. The resulting spectra were interpreted in terms of a vapour-phase molecule with the stoichiometry M 2 TeO 3 (M = K,Rb,Cs) for M/Te molecular ratios of ∼ 2, and polymeric species for ratios < 2. This work has demonstrated the stability of caesium tellurite. The formation of this relatively low-volatility, water-soluble species could significantly modify the transport and release of caesium and tellurium. The data presented in this report should allow more comprehensive thermodynamic calculations to be undertaken that assist in the quantification of fission product behaviour during severe reactor accidents. (author)

  5. Characterisation of silent and active genes for a variable large protein of Borrelia recurrentis

    Directory of Open Access Journals (Sweden)

    Scragg Ian G

    2002-10-01

    Full Text Available Abstract Background We report the characterisation of the variable large protein (vlp gene expressed by clinical isolate A1 of Borrelia recurrentis; the agent of the life-threatening disease louse-borne relapsing fever. Methods The major vlp protein of this isolate was characterised and a DNA probe created. Use of this together with standard molecular methods was used to determine the location of the vlp1B. recurrentis A1 gene in both this and other isolates. Results This isolate was found to carry silent and expressed copies of the vlp1B. recurrentis A1 gene on plasmids of 54 kbp and 24 kbp respectively, whereas a different isolate, A17, had only the silent vlp1B. recurrentis A17 on a 54 kbp plasmid. Silent and expressed vlp1 have identical mature protein coding regions but have different 5' regions, both containing different potential lipoprotein leader sequences. Only one form of vlp1 is transcribed in the A1 isolate of B. recurrentis, yet both 5' upstream sequences of this vlp1 gene possess features of bacterial promoters. Conclusion Taken together these results suggest that antigenic variation in B. recurrentis may result from recombination of variable large and small protein genes at the junction between lipoprotein leader sequence and mature protein coding region. However, this hypothetical model needs to be validated by further identification of expressed and silent variant protein genes in other B. recurrentis isolates.

  6. Microneedle characterisation: the need for universal acceptance criteria and GMP specifications when moving towards commercialisation.

    Science.gov (United States)

    Lutton, Rebecca E M; Moore, Jessica; Larrañeta, Eneko; Ligett, Stephen; Woolfson, A David; Donnelly, Ryan F

    2015-08-01

    With interest in microneedles as a novel drug transdermal delivery system increasing rapidly since the late 1990s (Margetts and Sawyer Contin Educ Anaesthesia Crit Care Pain. 7(5):171-76, 2007), a diverse range of microneedle systems have been fabricated with varying designs and dimensions. However, there are still very few commercially available microneedle products. One major issue regarding microneedle manufacture on an industrial scale is the lack of specific quality standards for this novel dosage form in the context of Good Manufacturing Practice (GMP). A range of mechanical characterisation tests and microneedle insertion analysis techniques are used by researchers working on microneedle systems to assess the safety and performance profiles of their various designs. The lack of standardised tests and equipment used to demonstrate microneedle mechanical properties and insertion capability makes it difficult to directly compare the in use performance of candidate systems. This review highlights the mechanical tests and insertion analytical techniques used by various groups to characterise microneedles. This in turn exposes the urgent need for consistency across the range of microneedle systems in order to promote innovation and the successful commercialisation of microneedle products.

  7. Physico-chemical characterisation of material fractions in household waste

    DEFF Research Database (Denmark)

    Götze, Ramona; Boldrin, Alessio; Scheutz, Charlotte

    2016-01-01

    State-of-the-art environmental assessment of waste management systems rely on data for the physico-chemical composition of individual material fractions comprising the waste in question. To derive the necessary inventory data for different scopes and systems, literature data from different sources...... and backgrounds are consulted and combined. This study provides an overview of physico-chemical waste characterisation data for individual waste material fractions available in literature and thereby aims to support the selection of data fitting to a specific scope and the selection of uncertainty ranges related...... to the data selection from literature. Overall, 97 publications were reviewed with respect to employed characterisation method, regional origin of the waste, number of investigated parameters and material fractions and other qualitative aspects. Descriptive statistical analysis of the reported physico...

  8. Thermoluminescence characterisation of chemical vapour deposited diamond films

    CERN Document Server

    Mazzocchi, S; Bucciolini, M; Cuttone, G; Pini, S; Sabini, M G; Sciortino, S

    2002-01-01

    The thermoluminescence (TL) characteristics of a set of six chemical vapour deposited diamond films have been studied with regard to their use as off-line dosimeters in radiotherapy. The structural characterisation has been performed by means of Raman spectroscopy. Their TL responses have been tested with radiotherapy beams ( sup 6 sup 0 Co photons, photons and electrons from a linear accelerator (Linac), 26 MeV protons from a TANDEM accelerator) in the dose range 0.1-7 Gy. The dosimetric characterisation has yielded a very good reproducibility, a very low dependence of the TL response on the type of particle and independence of the radiation energy. The TL signal is not influenced by the dose rate and exhibits a very low thermal fading. Moreover, the sensitivity of the diamond samples compares favourably with that of standard TLD100 dosimeters.

  9. Geochemical characterisation of Elbe river high flood sediments

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, F. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Falkenberg (Germany). Sektion Boden-/Gewaesserforschung]|[UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Magdeburg (Germany). Sektion Gewaesserforschung; Rupp, H.; Meissner, R. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Falkenberg (Germany). Sektion Boden-/Gewaesserforschung; Lohse, M.; Buettner, O.; Friese, K. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Magdeburg (Germany). Sektion Gewaesserforschung; Miehlich, G. [Hamburg Univ. (Germany). Inst. fuer Bodenkunde

    2001-07-01

    Quality aims for land usage in flood plains have to be worked out in the Russian-German research project 'Effects of floods on the pollution of agricultural used flood plain soils of the Oka River and the Elbe River'. It is financed by the Germany Ministry of Education and Research (FKZ 02 WT 9617/0). Beside the characterisation of the present pollution of soils for the middle Elbe, it is necessary to prognosticate the current pollutant input. At the examination site nearby Wittenberge, Elbe River kilometers 435 and 440, natural deposited flood sediments were sampled by artificial lawn mats. By the geochemical characterisation it is possible to record the metal input into the flood plain and to win knowledge about the sedimentation process. The results of sediment investigation of the high flood in spring 1997 are presented. (orig.)

  10. Chemical characterisation of zircon-cadmium sulfoselenide ceramic pigments

    International Nuclear Information System (INIS)

    Gazulla Barreda, M. F.; Rodrigo Edo, M.; Blasco Roca, E.; Orduna Cordero, M.

    2013-01-01

    The present paper addresses the development of a methodology that allows the complete chemical characterisation of zircon cadmium sulfoselenide ceramic pigments including minor and major elements. To develop the methodology, five zircon-cadmium sulfoselenide pigments with different hues were selected, studying the different measurement process steps, from sample preparation to the optimisation of the measurement of the different components of the pigments by spectroscopic techniques (WD-XRF and elemental analysis by combustion and IR detection). The chemical characterisation method developed was validated with synthetic standards prepared from the mixture of certified reference materials and pure oxides because no certified referenced materials of this type of pigments were commercially available. The developed method can be used for a complete chemical characterization of zircon-cadmium sulfoselenide ceramic pigments with a very low uncertainty for all the elements analysed. (Author)

  11. Characterising encapsulated nuclear waste using cosmic-ray muon tomography

    International Nuclear Information System (INIS)

    Clarkson, A.; Hamilton, D.J.; Hoek, M.; Ireland, D.G.; Kaiser, R.; Keri, T.; Lumsden, S.; Mahon, D.F.; McKinnon, B.; Murray, M.; Nutbeam-Tuffs, S.; Yang, G.; Johnstone, J.R.; Shearer, C.; Zimmerman, C.

    2015-01-01

    Tomographic imaging techniques using the Coulomb scattering of cosmic-ray muons have been shown previously to successfully identify and characterise low- and high-Z materials within an air matrix using a prototype scintillating-fibre tracker system. Those studies were performed as the first in a series to assess the feasibility of this technology and image reconstruction techniques in characterising the potential high-Z contents of legacy nuclear waste containers for the U.K. Nuclear Industry. The present work continues the feasibility study and presents the first images reconstructed from experimental data collected using this small-scale prototype system of low- and high-Z materials encapsulated within a concrete-filled stainless-steel container. Clear discrimination is observed between the thick steel casing, the concrete matrix and the sample materials assayed. These reconstructed objects are presented and discussed in detail alongside the implications for future industrial scenarios

  12. Detecting and characterising ramp events in wind power time series

    International Nuclear Information System (INIS)

    Gallego, Cristóbal; Cuerva, Álvaro; Costa, Alexandre

    2014-01-01

    In order to implement accurate models for wind power ramp forecasting, ramps need to be previously characterised. This issue has been typically addressed by performing binary ramp/non-ramp classifications based on ad-hoc assessed thresholds. However, recent works question this approach. This paper presents the ramp function, an innovative wavelet- based tool which detects and characterises ramp events in wind power time series. The underlying idea is to assess a continuous index related to the ramp intensity at each time step, which is obtained by considering large power output gradients evaluated under different time scales (up to typical ramp durations). The ramp function overcomes some of the drawbacks shown by the aforementioned binary classification and permits forecasters to easily reveal specific features of the ramp behaviour observed at a wind farm. As an example, the daily profile of the ramp-up and ramp-down intensities are obtained for the case of a wind farm located in Spain

  13. Characterisation of hydrides in a zirconium alloy, by EBSD

    International Nuclear Information System (INIS)

    Ubhi, H.S.; Larsen, K.

    2012-01-01

    Zirconium alloys are used in nuclear reactors owing to their low capture cross-section for thermal neutrons and good mechanical and corrosion properties. However, they do suffer from delayed hydrogen cracking (DHC) due to formation of hydride particles. This study shows how the electron back-scatter diffraction (EBSD) technique can be used to characterise hydrides and their orientation relationship with the matrix. Hydrided EB weld specimens were prepared by electro-polishing, characterised using Oxford instruments AZtecHKL EBSD apparatus and software attached to a FEG SEM. Hydrides were found to exist as fine intra granular plates and having the Blackburn orientation relationship, i.e. (0002)Zr//(111)hydride and (1120)Zr//(1-10)hydride. The hydrides were also found to contain sigma 3 boundaries as well as local misorientations. (author)

  14. Methodology for characterisation of glass fibre composite architecture

    DEFF Research Database (Denmark)

    Hansen, Jens Zangenberg; Larsen, J.B.; Østergaard, R.C.

    2012-01-01

    of the fibres. The information is used for different analyses to investigate and characterise the fibre architecture. As an example, the methodology is applied to glass fibre reinforced composites with varying fibre contents. The different fibre volume fractions (FVFs) affect the number of contact points per......The present study outlines a methodology for microstructural characterisation of fibre reinforced composites containing circular fibres. Digital micrographs of polished cross-sections are used as input to a numerical image processing tool that determines spatial mapping and radii detection...... fibre, the communal fibre distance and the local FVF. The fibre diameter distribution and packing pattern remain somewhat similar for the considered materials. The methodology is a step towards a better understanding of the composite microstructure and can be used to evaluate the interconnection between...

  15. Characterising the 750 GeV diphoton excess

    International Nuclear Information System (INIS)

    Bernon, Jérémy; Goudelis, Andreas; Kraml, Sabine; Mawatari, Kentarou; Sengupta, Dipan

    2016-01-01

    We study kinematic distributions that may help characterise the recently observed excess in diphoton events at 750 GeV at the LHC Run 2. Several scenarios are considered, including spin-0 and spin-2 750 GeV resonances that decay directly into photon pairs as well as heavier parent resonances that undergo three-body or cascade decays. We find that combinations of the distributions of the diphoton system and the leading photon can distinguish the topology and mass spectra of the different scenarios, while patterns of QCD radiation can help differentiate the production mechanisms. Moreover, missing energy is a powerful discriminator for the heavy parent scenarios if they involve (effectively) invisible particles. While our study concentrates on the current excess at 750 GeV, the analysis is general and can also be useful for characterising other potential diphoton signals in the future.

  16. Characterising encapsulated nuclear waste using cosmic-ray muon tomography

    Science.gov (United States)

    Clarkson, A.; Hamilton, D. J.; Hoek, M.; Ireland, D. G.; Johnstone, J. R.; Kaiser, R.; Keri, T.; Lumsden, S.; Mahon, D. F.; McKinnon, B.; Murray, M.; Nutbeam-Tuffs, S.; Shearer, C.; Yang, G.; Zimmerman, C.

    2015-03-01

    Tomographic imaging techniques using the Coulomb scattering of cosmic-ray muons have been shown previously to successfully identify and characterise low- and high-Z materials within an air matrix using a prototype scintillating-fibre tracker system. Those studies were performed as the first in a series to assess the feasibility of this technology and image reconstruction techniques in characterising the potential high-Z contents of legacy nuclear waste containers for the U.K. Nuclear Industry. The present work continues the feasibility study and presents the first images reconstructed from experimental data collected using this small-scale prototype system of low- and high-Z materials encapsulated within a concrete-filled stainless-steel container. Clear discrimination is observed between the thick steel casing, the concrete matrix and the sample materials assayed. These reconstructed objects are presented and discussed in detail alongside the implications for future industrial scenarios.

  17. Characterisation of InAs-based epilayers by FTIR spectroscopy

    International Nuclear Information System (INIS)

    Baisitse, T.R.; Forbes, A.; Katumba, G.; Botha, J.R.; Engelbrecht, J.A.A.

    2008-01-01

    In this paper, infrared reflectance spectroscopy was employed to extract information on the optical and electrical properties of metal organic vapour phase epitaxial (MOVPE) grown InAs and InAsSb epilayers. These epitaxial layers were grown on InAs and GaAs substrates and characterised by infrared reflectance spectroscopy and Hall measurements. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  18. Characterisation of the Ionian-Lucanian coastal plain aquifer

    OpenAIRE

    Polemio, M.; Limoni, P.P.; Mitolo, D.; Santaloia, F.

    2002-01-01

    This paper deals with a Southern Italy area, 40 km by 10 km wide, located where four river valleys anastomose themselves in the coastal plain. The geological and hydrogeological features of the study area and the chemical-physical groundwater characterisation have been inferred from the data analysis of 1130 boreholes. Some aquifers, connected among them, constituted by soils of different geological origin -marine terraces deposits, river valley alluvial deposits and alluvial and coastal depo...

  19. Characterisation and activation of catalysts for recombination of radiolysis gas

    International Nuclear Information System (INIS)

    Bolz, Michael; Koehler, Jan; Schorle, Rolf; Helf, Achim

    2011-01-01

    Radiolysis gas is produced by radiolysis of cooling water during the operation of boiling water reactors. Small amounts of radiolysis gas can accumulate at dead ends of pipes in the water-steam circuit. Under certain conditions, it can accumulate even to higher concentrations. To avoid these accumulations, small catalysts are built in. As part of a diploma thesis, the catalysts were analysed and characterised. (orig.)

  20. Outdoor thermal and electrical characterisation of photovoltaic modules and systems

    OpenAIRE

    Herteleer, Bert

    2016-01-01

    Current and future investors in photovoltaic systems are interested in how well the system performs, and how predictable this is over the expected lifetime. To do so, models have been developed and measurements of photovoltaic systems have been done. This dissertation presents the outdoor measurement set-up that has been developed for thermal and electrical characterisation of photovoltaic modules and systems, aimed at measuring transient effects and changes. The main design decisions and ...

  1. Characterisation, control, and energy management of electrified turbocharged diesel engines

    International Nuclear Information System (INIS)

    Zhao, Dezong; Winward, Edward; Yang, Zhijia; Stobart, Richard; Steffen, Thomas

    2017-01-01

    Highlights: • A real-time energy management framework for electrified engines is proposed. • A multi-variable robust controller is designed. • Characterisation on the air system of electrified diesel engines is given. • Reliable for engine downsizing because of the promising transient performance. - Abstract: The electrification of engine components offers significant opportunities for fuel efficiency improvements. The electrified turbocharger is one of the most attractive options since it recovers part of the engine exhaust gas mechanical energy to assist boosting. Therefore, the engine can be downsized through improved transient responsiveness. In the electrified turbocharger, an electric machine is mounted on the turbine shaft and changes the air system dynamics, so characterisation of the new layout is essential. A systematic control solution is required to manage energy flows in the hybrid system. In this paper, a framework for characterisation, control, and energy management for an electrified turbocharged diesel engine is proposed. The impacts of the electric machine on fuel economy and air system variables are analysed. Based on the characterisation, a two-level control structure is proposed. A real-time energy management strategy is employed as the supervisory level controller to generate the optimal values of critical variables, while a model-based multi-variable controller is designed as the low level controller to track the values. The two controllers work together in a cascade to address both fuel economy optimisation and battery state-of-charge maintenance. The proposed control strategy is validated on a high fidelity physical engine model. The tracking performance shows the proposed framework is a promising solution in regulating the behavior of electrified engines.

  2. Logical Characterisation of Ontology Construction using Fuzzy Description Logics

    DEFF Research Database (Denmark)

    Badie, Farshad; Götzsche, Hans

    had the extension of ontologies with Fuzzy Logic capabilities which plan to make proper backgrounds for ontology driven reasoning and argumentation on vague and imprecise domains. This presentation conceptualises learning from fuzzy classes using the Inductive Logic Programming framework. Then......, employs Description Logics in characterising and analysing fuzzy statements. And finally, provides a conceptual framework describing fuzzy concept learning in ontologies using the Inductive Logic Programming....

  3. Characterisation of contaminaiton in Maralinga and Emu soils

    International Nuclear Information System (INIS)

    Williams, G.A.; Wilks, M.J.; Burns, P.A.; Cooper, M.B.

    1990-01-01

    A range of Maralinga and Emu soils have been characterised by means of sieving and microparticle classification, yielding mass and activity distribution of plutonium and americium with respect to size. The activity distribution is quite different from the mass distribution and much more variable from sample to sample. While the 241 Am activities >0.1 Bq, extends at least 100 km from the firing sites at Taranaki. 19 refs., 17 tabs., 4 figs

  4. Vision based monitoring and characterisation of combustion flames

    International Nuclear Information System (INIS)

    Lu, G; Gilabert, G; Yan, Y

    2005-01-01

    With the advent of digital imaging and image processing techniques vision based monitoring and characterisation of combustion flames have developed rapidly in recent years. This paper presents a short review of the latest developments in this area. The techniques covered in this review are classified into two main categories: two-dimensional (2D) and 3D imaging techniques. Experimental results obtained on both laboratory- and industrial-scale combustion rigs are presented. Future developments in this area also included

  5. Rapporteur's Report of the Workshop on Radiological Characterisation for Decommissioning

    International Nuclear Information System (INIS)

    Thierfeldt, Stefan

    2012-01-01

    In April 2012, the Nuclear Energy Agency, in co-operation with Studsvik Nuclear AB, the Swedish Radiation Safety Authority (SSM), Swedish Nuclear Fuel and Waste Management Company (SKB) and AB SVAFO, held a Workshop on Radiological Characterisation in Decommissioning in Studsvik near Nykoeping (Sweden). During three days, a wide range of presentations, posters, discussions and site visits brought together over 120 participants from 23 countries and 4 international organisations, the IAEA, the WNA, the European Commission and the OECD/NEA. Members of the Task Group on Radiological Characterisation for Decommissioning (RCD) of the WPDD were involved in the preparation of the workshop. Many decommissioning projects of all types of nuclear installations have progressed substantially and/or have been completed to brown field or green field conditions, so that it was the right time to bring together operators, regulators, scientists, consultants and contractors to exchange information and views and to evaluate the information on radiological characterisation gained from this multitude of projects. The outcome will be valuable for the large number of decommissioning projects about to start in the near future. The Workshop consisted of 5 topical sessions and a poster session. The topical sessions were complemented by discussions in the plenary and in smaller groups. This report provides a short summary of the various presentations and discussions. It concentrates on the outcome of the presentations, posters and discussions than giving an account of the spoken word

  6. Characterisation of North American Brucella isolates from marine mammals.

    Directory of Open Access Journals (Sweden)

    Adrian M Whatmore

    Full Text Available Extension of known ecological niches of Brucella has included the description of two novel species from marine mammals. Brucella pinnipedialis is associated predominantly with seals, while two major Brucella ceti clades, most commonly associated with porpoises or dolphins respectively, have been identified. To date there has been limited characterisation of Brucella isolates obtained from marine mammals outside Northern European waters, including North American waters. To address this gap, and extend knowledge of the global population structure and host associations of these Brucella species, 61 isolates from marine mammals inhabiting North American waters were subject to molecular and phenotypic characterisation enabling comparison with existing European isolates. The majority of isolates represent genotypes previously described in Europe although novel genotypes were identified in both B. ceti clades. Harp seals were found to carry B. pinnipedialis genotypes previously confined to hooded seals among a diverse repertoire of sequence types (STs associated with this species. For the first time Brucella isolates were characterised from beluga whales and found to represent a number of distinct B. pinnipedialis genotypes. In addition the known host range of ST27 was extended with the identification of this ST from California sea lion samples. Finally the performance of the frequently used diagnostic tool Bruce-ladder, in differentiating B. ceti and B. pinnipedialis, was critically assessed based on improved knowledge of the global population structure of Brucella associated with marine mammals.

  7. Characterisation of radionuclide migration and plant uptake for performance assessment

    International Nuclear Information System (INIS)

    Mathias, S. A.; Ireson, A. M.; Butler, A. P.; Jackson, B. M.; Wheater, H. S.

    2008-01-01

    Unsaturated vegetated soils are an important component in performance assessment models used to quantify risks associated with deep engineered repositories for underground radioactive waste disposal. Therefore, experimental studies, funded by Nirex over nearly 20 years, have been undertaken at Imperial College to study the transfer of radionuclides (Cl-36, I-129, Tc-99) from contaminated groundwater into crops. In parallel to this has been a modelling programme to aid interpretation of the experimental data, obtain parameter values characterising transport in soil and plant uptake and provide new representations of near-surface processes for performance assessment. A particular challenge in achieving these objectives is that the scale of the experimental work (typically ≤1 m) is much smaller than that required in performance assessment. In this paper, a new methodology is developed for up-scaling model results obtained at the experimental scale for use in catchment scale models. The method is based on characterising soil heterogeneity using soil texture. This has the advantage of allowing hydrological and radionuclide transport parameters to be correlated in a consistent manner. An initial investigation into the calculation of effective (i.e. up-scaled) hydrological and transport parameters has been undertaken and shows the results to be potentially highly (and non-linearly) sensitive to soil properties. Consequently, they have important implications for future site characterisation programmes supporting a proposed underground waste repository. (authors)

  8. Preparation and characterisation of glass surfaces for experimental purposes

    International Nuclear Information System (INIS)

    Serruys, Y.

    1986-01-01

    Experimental investigation of glasses, applied especially to the prevision of the behaviour of vitrified nuclear wastes, requires the preparation of well-defined and reproducibles surfaces, in order to separate the investigated phenomena from artifacts due to surface anomalies and to allow a valuable comparison between results obtained in different laboratories. The aim of the present report is to determine which characters, both physical and chemical, of glass surfaces, have to be controlled, because of their influence upon the investigated phenomena or the experimental processes employed in the investigation. A method is then presented for a surface preparation giving good guaranties of quality and reproducibility. The physical and chemical aspects of surface characterisation are successively considered. The relevant characters and their importance are described, then the corresponding techniques of characterisation are reviewed and it has been attempted to propose a set of techniques allowing a characterisation as complete as possible for laboratory purposes. A preparation method for experimental sample, aiming to satisfy all the previously defined criteria, is then proposed, and present results obtained with this method are described [fr

  9. Characterisation of North American Brucella isolates from marine mammals.

    Science.gov (United States)

    Whatmore, Adrian M; Dawson, Claire; Muchowski, Jakub; Perrett, Lorraine L; Stubberfield, Emma; Koylass, Mark; Foster, Geoffrey; Davison, Nicholas J; Quance, Christine; Sidor, Inga F; Field, Cara L; St Leger, Judy

    2017-01-01

    Extension of known ecological niches of Brucella has included the description of two novel species from marine mammals. Brucella pinnipedialis is associated predominantly with seals, while two major Brucella ceti clades, most commonly associated with porpoises or dolphins respectively, have been identified. To date there has been limited characterisation of Brucella isolates obtained from marine mammals outside Northern European waters, including North American waters. To address this gap, and extend knowledge of the global population structure and host associations of these Brucella species, 61 isolates from marine mammals inhabiting North American waters were subject to molecular and phenotypic characterisation enabling comparison with existing European isolates. The majority of isolates represent genotypes previously described in Europe although novel genotypes were identified in both B. ceti clades. Harp seals were found to carry B. pinnipedialis genotypes previously confined to hooded seals among a diverse repertoire of sequence types (STs) associated with this species. For the first time Brucella isolates were characterised from beluga whales and found to represent a number of distinct B. pinnipedialis genotypes. In addition the known host range of ST27 was extended with the identification of this ST from California sea lion samples. Finally the performance of the frequently used diagnostic tool Bruce-ladder, in differentiating B. ceti and B. pinnipedialis, was critically assessed based on improved knowledge of the global population structure of Brucella associated with marine mammals.

  10. Haemonchus contortus: Characterization of the baculovirus expressed form of aminopeptidase H11

    NARCIS (Netherlands)

    Reszka, N.; Rijsewijk, F.A.M.; Zelnik, V.; Moskwa, B.; Bienkowska-Szewczyk, K.

    2007-01-01

    Recombinant form of Haemonchus contortus aminopeptidase H11, an intestinal membrane glycoprotein considered to be in its native form the most promising vaccine candidate, was produced in insect cells, characterised and tested in pilot vaccination-challenge trial on sheep. The sequence of the cloned

  11. Work Organisation, Forms of Employee Learning and National Systems of Education and Training

    Science.gov (United States)

    Lorenz, Edward; Lundvall, Bengt-Åke; Kraemer-Mbula, Erika; Rasmussen, Palle

    2016-01-01

    This article uses a multi-level framework to investigate for 17 European nations the links between forms of work organisation and style of employee learning at the workplace on the one hand, and the characteristics of national educational and training systems on the other. The analysis shows that forms of work organisation characterised by…

  12. Current limitations and challenges in nanowaste detection, characterisation and monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Part, Florian; Zecha, Gudrun [Department of Water-Atmosphere-Environment, University of Natural Resources and Life Sciences, Institute of Waste Management, Muthgasse 107, 1190 Vienna (Austria); Causon, Tim [Department of Chemistry, Division of Analytical Chemistry, University of Natural Resources and Life Sciences, Muthgasse 18, 1190 Vienna (Austria); Sinner, Eva-Kathrin [Department of Nanobiotechnology, Institute for Synthetic Bioarchitectures, University of Natural Resources and Life Sciences, Muthgasse 11/II, 1190 Vienna (Austria); Huber-Humer, Marion, E-mail: marion.huber-humer@boku.ac.at [Department of Water-Atmosphere-Environment, University of Natural Resources and Life Sciences, Institute of Waste Management, Muthgasse 107, 1190 Vienna (Austria)

    2015-09-15

    Highlights: • First review on detection of nanomaterials in complex waste samples. • Focus on nanoparticles in solid, liquid and gaseous waste samples. • Summary of current applicable methods for nanowaste detection and characterisation. • Limitations and challenges of characterisation of nanoparticles in waste. - Abstract: Engineered nanomaterials (ENMs) are already extensively used in diverse consumer products. Along the life cycle of a nano-enabled product, ENMs can be released and subsequently accumulate in the environment. Material flow models also indicate that a variety of ENMs may accumulate in waste streams. Therefore, a new type of waste, so-called nanowaste, is generated when end-of-life ENMs and nano-enabled products are disposed of. In terms of the precautionary principle, environmental monitoring of end-of-life ENMs is crucial to allow assessment of the potential impact of nanowaste on our ecosystem. Trace analysis and quantification of nanoparticulate species is very challenging because of the variety of ENM types that are used in products and low concentrations of nanowaste expected in complex environmental media. In the framework of this paper, challenges in nanowaste characterisation and appropriate analytical techniques which can be applied to nanowaste analysis are summarised. Recent case studies focussing on the characterisation of ENMs in waste streams are discussed. Most studies aim to investigate the fate of nanowaste during incineration, particularly considering aerosol measurements; whereas, detailed studies focusing on the potential release of nanowaste during waste recycling processes are currently not available. In terms of suitable analytical methods, separation techniques coupled to spectrometry-based methods are promising tools to detect nanowaste and determine particle size distribution in liquid waste samples. Standardised leaching protocols can be applied to generate soluble fractions stemming from solid wastes, while

  13. Data analysis for radiological characterisation: Geostatistical and statistical complementarity

    International Nuclear Information System (INIS)

    Desnoyers, Yvon; Dubot, Didier

    2012-01-01

    Radiological characterisation may cover a large range of evaluation objectives during a decommissioning and dismantling (D and D) project: removal of doubt, delineation of contaminated materials, monitoring of the decontamination work and final survey. At each stage, collecting relevant data to be able to draw the conclusions needed is quite a big challenge. In particular two radiological characterisation stages require an advanced sampling process and data analysis, namely the initial categorization and optimisation of the materials to be removed and the final survey to demonstrate compliance with clearance levels. On the one hand the latter is widely used and well developed in national guides and norms, using random sampling designs and statistical data analysis. On the other hand a more complex evaluation methodology has to be implemented for the initial radiological characterisation, both for sampling design and for data analysis. The geostatistical framework is an efficient way to satisfy the radiological characterisation requirements providing a sound decision-making approach for the decommissioning and dismantling of nuclear premises. The relevance of the geostatistical methodology relies on the presence of a spatial continuity for radiological contamination. Thus geo-statistics provides reliable methods for activity estimation, uncertainty quantification and risk analysis, leading to a sound classification of radiological waste (surfaces and volumes). This way, the radiological characterization of contaminated premises can be divided into three steps. First, the most exhaustive facility analysis provides historical and qualitative information. Then, a systematic (exhaustive or not) surface survey of the contamination is implemented on a regular grid. Finally, in order to assess activity levels and contamination depths, destructive samples are collected at several locations within the premises (based on the surface survey results) and analysed. Combined with

  14. Harmonic Maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken

    2017-01-01

    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  15. Hydro-mechanical characterisation of Vendian clay from Russia

    International Nuclear Information System (INIS)

    Tang, A.M.; Cui, Y.J.; Hong, P.Y.; Li, X.L.; Rumynin, V.G.

    2010-01-01

    Document available in extended abstract form only. In the context of the Belgian-Russian bilateral program for developing a repository concept for L/ILW disposal, with a long experience in studies on disposal in clays, SCK.CEN has been charged to assist LSK RADON in assessing disposal possibilities at the LSK RADON site. In the present work, the hydro-mechanical characterisation of Kotlin clay taken from the LSK RADON site is investigated using laboratory tests. Three drilled cores taken from the site of LSK RADON were provided for testing: - RUS-B1-23.1-MCH from 23.1-m depth; - RUS-B1-78.4-MCH from 78.4-m depth; - RUS-B1-126.6 M CH: from 126.6-m depth. The depth of the samples was measured from the surface. The surface elevation was about 24 m above the sea level and the depth of the ground water table from the surface was around 3.5 m. It is shown that the sample taken from 23.1 m depth was close to the limit between the Lomonosov aquifer stratum (Cambrian Sand) and the first Kotlin confining layer (Vendian clay, Vkt1). The sample taken from 78.4 m depth corresponds to the middle of the Vkt1. The third sample taken from 126.6 m depth corresponds to the bottom part of the Vkt1. Visual observations and particles size distribution analysis showed that the studied soil corresponds to a stiff clay. However, the sample from 23.1 m depth has lower fine grain content and, that from 126.6 m depth is similar to a clayey rock. Drained triaxial compression tests at various confining pressures (p' 0 ) under controlled strain condition were performed on Core No. 2 (middle of Vkt1). The Young's modulus determined from these tests ranges from 140 to 260 MPa. Failure was obtained at an axial strain (ε a ) of about 2% and the shear stress (q) decreases drastically after the failure. The peak shear strength obtained varied from 2.06 to 3.82 MPa. Regarding the volumetric behaviour upon shearing, the soil volume decreases firstly by 1.2% (contractant) and then increases

  16. Architectonic and constructive characterisation of the old urban centre of Seixal, Portugal

    Directory of Open Access Journals (Sweden)

    Tiago Miguel Ferreira

    2013-01-01

    Full Text Available This paper addresses the issue of the old urban centres from the perspective of the analysis and inventory of building features. The cataloguing process of the building typologies is presented herein as a synthesis of the main construction forms, with the old city centre of Seixal being used as a case study. Furthermore, and taking into account the relation between such two dimensions, a material and constructive characterisation of the buildings in the old urban centre of Seixal is presented. As marks of an historical and architectural heritage, old urban centres should be protected, safeguarded and potentiated. For such, it is fundamental to have a complete understanding of the genesis of both buildings and urban mesh. This fact is essential to the support of qualified, conscientious and sustainable rehabilitation interventions on the old building stock.

  17. Identification and clonal characterisation of a progenitor cell sub-population in normal human articular cartilage.

    Directory of Open Access Journals (Sweden)

    Rebecca Williams

    Full Text Available BACKGROUND: Articular cartilage displays a poor repair capacity. The aim of cell-based therapies for cartilage defects is to repair damaged joint surfaces with a functional replacement tissue. Currently, chondrocytes removed from a healthy region of the cartilage are used but they are unable to retain their phenotype in expanded culture. The resulting repair tissue is fibrocartilaginous rather than hyaline, potentially compromising long-term repair. Mesenchymal stem cells, particularly bone marrow stromal cells (BMSC, are of interest for cartilage repair due to their inherent replicative potential. However, chondrocyte differentiated BMSCs display an endochondral phenotype, that is, can terminally differentiate and form a calcified matrix, leading to failure in long-term defect repair. Here, we investigate the isolation and characterisation of a human cartilage progenitor population that is resident within permanent adult articular cartilage. METHODS AND FINDINGS: Human articular cartilage samples were digested and clonal populations isolated using a differential adhesion assay to fibronectin. Clonal cell lines were expanded in growth media to high population doublings and karyotype analysis performed. We present data to show that this cell population demonstrates a restricted differential potential during chondrogenic induction in a 3D pellet culture system. Furthermore, evidence of high telomerase activity and maintenance of telomere length, characteristic of a mesenchymal stem cell population, were observed in this clonal cell population. Lastly, as proof of principle, we carried out a pilot repair study in a goat in vivo model demonstrating the ability of goat cartilage progenitors to form a cartilage-like repair tissue in a chondral defect. CONCLUSIONS: In conclusion, we propose that we have identified and characterised a novel cartilage progenitor population resident in human articular cartilage which will greatly benefit future cell

  18. On good ETOL forms

    DEFF Research Database (Denmark)

    Skyum, Sven

    1978-01-01

    This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete.......This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete....

  19. Investigation of echo sounding parameters for the characterisation of bottom sediments in a sub-tropical reservoir

    Directory of Open Access Journals (Sweden)

    Stephan Hilgert

    2016-07-01

    Full Text Available The increasing number of reservoirs around the world today reaches a surface area of around 500,000 km², equaling one third of that of non-artificial surface water bodies. By impounding rivers through the construction of dams, riverine systems and biochemical cycles are disrupted. Different types of transported materials are trapped behind the dams and form layers of sediment. A method to characterise the spatially extensive sediment volumes with an EA 400 echo sounder was tested in the Vossoroca reservoir in the southeast of Brazil, Paraná State. A number of core and grab samples was taken and analysed for a variety of chemical and physical parameters. These data served as ground truthing for the hydro-acoustic assessment of the sediment. Eight hydro-acoustic parameters were derived from the echo signals using the Sonar5-Pro software. The major objective of defining the optimal survey parameters for the echo sounder as well as determining the difference between core and grab samples was reached by correlating the various single parameters and identifying the best combinations. Density and grain size distribution represented the best detectable sediment features with r-values of 0.94 and 0.95. The lower 38 kHz frequency generally had a better performance than the 200 kHz frequency. Results show that core samples reached a significantly higher quality of correlation for sediment characterisation. Additionally, it is was found that shorter pulse lengths yield a better characterisation. The results underline the potential of single beam echo sounders for extensive sediment characterisation. This methodology may be used for future mass balance estimations of large reservoirs.

  20. Characterisation of crude oil components, asphaltene aggregation and emulsion stability by means of near infrared spectroscopy and multivariate analysis

    Energy Technology Data Exchange (ETDEWEB)

    Aske, Narve

    2002-06-01

    Effective separation of water-in-crude oil emulsions is a central challenge for the oil industry on the Norwegian Continental Shelf, especially with the future increase in subsea and even down-hole processing of well fluids. The mechanisms and properties governing emulsion stability are far from fully understood but the indigenous surface active crude oil components are believed to play a major role. In this work a thorough physico-chemical characterisation of a set of crude oils originating from a variety of production fields has been performed. Crude oil properties responsible for emulsion stability were identified by use of multivariate analysis techniques like partial least squares regression (PLS) and principal component analysis (PCA). Interfacial elasticity along with both asphaltene content and asphaltene aggregation state were found to be main contributors to emulsion stability. Information on a crude oils ability to form elastic crude oil-water interfaces was found to be especially crucial when discussing emulsion stability. However, measured values of interfacial elasticity were highly dependent on asphaltene aggregation state. Several experimental techniques was utilised and partly developed for the crude oil characterisation. A high-pressure liquid chromatography (HPLC) scheme was developed for SARA-fractionation of crude oils and an oscillating pendant drop tensiometer was used for characterisation of interfacial rheological properties. For emulsion stability a cell for determining the stability as a function of applied electric fields was used. In addition, near infrared spectroscopy (NIR) was used throughout the work both for chemical and physical characterisation of crude oils and model systems. High pressure NIR was used to study the aggregation of asphaltenes by pressure depletion. A new technique for detection of asphaltene aggregation onset pressures based on NIR combined with PCA was developed. It was also found that asphaltene aggregation is

  1. Characterisation and genesis of the Singhbhum uranium province, India

    International Nuclear Information System (INIS)

    Mahadevan, T.M.

    1988-01-01

    The Singhbhum Uranium province is characterised by the late Archaean predominantly granitic Singhbhum Craton and the associated Proterozoic mobile belts, the boundaries of which are marked by major crustal dislocations. The Singhbhum craton had two-phase evolution during the time range 4000-2900 million years and its stabilisation around 2900 million years was marked by the emplacement of K-rich granitoids and the early crustal enrichment of uranium. Two distinctive types of uranium mineralisation occur in the Province - (i) the early Quartz Pebble Conglomerate (QPC) type and (ii) the later economically most significant shear-controlled hydrothermal type. The QPC type is confined to the cratonic volcano-sedimentary basins, characterised by basal fluvial high-energy deposits, near-continental volcanics and banded iron formations spanning the time band of 2900-2500 million years. The shear controlled hydrothermal mineralisation is predominantly developed in a 200 km-long arcuate zone of intense and deep tectonisation, acid-(?) alkaline-basic magmatism, hydrothermal activity and metallogenesis. This shear zone represents a belt of intense crust-mantle interaction. Uranium mineralisation is polyphasic, polymetallic. The mineralogy is complex and the chemistry of the ores is greatly influenced by the lithology of the host rocks involved in the shear. Part of the shear zone grazing the Dhanjori, predominantly volcanic supra-crustals is richer in U, Cu, Ni, Mo and also contains minor Bi, Au, Ag, Te and Se, while the western trans-Dhanjori sector of the shear zone characterised by schists and quartzites with lesser volcanic component is relatively poorer in these metals. The ore bodies in the trans-Dhanjori sector are more peneconcordant, gradational, stratabound and have spherical variograms, while those in the Dhanjori sector are transgressive, sharp, highly mobilised, vein type with Dewijsian variograms. A synthesis leads to the conclusion that uranium mineralisation is

  2. Characterisation of the ecotoxicity of hospital effluents: a review.

    Science.gov (United States)

    Orias, Frédéric; Perrodin, Yves

    2013-06-01

    The multiple activities that take place in hospitals (surgery, drug treatments, radiology, cleaning of premises and linen, chemical and biological analysis laboratories, etc.), are a major source of pollutant emissions into the environment (disinfectants, detergents, drug residues, etc.). Most of these pollutants can be found in hospital effluents (HWW), then in urban sewer networks and WWTP (weakly adapted for their treatment) and finally in aquatic environments. In view to evaluating the impact of these pollutants on aquatic ecosystems, it is necessary to characterise their ecotoxicity. Several reviews have focused on the quantitative and qualitative characterisation of pollutants present in HWW. However, none have focused specifically on the characterisation of their experimental ecotoxicity. We have evaluated this according to two complementary approaches: (i) a "substance" approach based on the identification of the experimental data in the literature for different substances found in hospital effluents, and on the calculation of their PNEC (Predicted Non Effect Concentration), (ii) a "matrix" approach for which we have synthesised ecotoxicity data obtained from the hospital effluents directly. This work first highlights the diversity of the substances present within hospital effluents, and the very high ecotoxicity of some of them (minimum PNEC observed close to 0,01 pg/L). We also observed that the consumption of drugs in hospitals was a predominant factor chosen by authors to prioritise the compounds to be sought. Other criteria such as biodegradability, excretion rate and the bioaccumulability of pollutants are considered, though more rarely. Studies of the ecotoxicity of the particulate phase of effluents must also be taken into account. It is also necessary to monitor the effluents of each of the specialised departments of the hospital studied. These steps is necessary to define realistic environmental management policies for hospitals (replacement of

  3. Workplace Field Characterisation at Chernobyl Unit 4 Shelter

    International Nuclear Information System (INIS)

    Chumak, V.; Bakhanova, E.; Volosky, V.; Shylo, S.; Chernyshov, G.; Dmitrienko, A.; Rozumny, V.

    2001-01-01

    Full text: When assessment of effective dose is required, radiation field needs to be characterised in terms of energy spectrum and geometry of exposure. Prior to application of pre-calculated (e.g. ICRP 74) or site-specific conversion coefficients, one need to demonstrate compliance with one of standard irradiation geometries and determine appropriate energy (or energy spectrum). Particular conditions of the entombment of Chernobyl Unit 4 (Object 'Shelter') high dose rate fields, complex source-target geometry, presence of heavy shielding structures and, as a result, significant scattered component in radiation field make application of conventional area monitoring instruments like in situ spectrometers complicated if possible at all. Unique techniques and devices were developed for workplace field characterisation at Object 'Shelter'. The set of devices includes passive spectrometric system, which makes use of simultaneous exposing several TLD detectors placed inside spherical attenuators (principle much similar to Bonner sphere neutron spectroscopy). Deconvolution of gamma spectra is performed through solving a system of simultaneous linear equations. Geometry of irradiation at given workplace is determined by TLD detectors placed in the six-vector collimator. This simple device allows determination of anisotropy of radiation field, both horizontal and vertical. Another design incorporates portable gamma spectrometer with 1'x2' NaI detector placed in the specially designed lead-copper collimator with aperture compatible with the one of the described above six-vector passive system. The discussed experimental set-up was extensively tested in various locations within Object 'Shelter'. Results of both energy spectrum and exposure geometry characterisation demonstrated feasibility of the proposed approach. (author)

  4. New characterisation method of electrical and electronic equipment wastes (WEEE)

    Energy Technology Data Exchange (ETDEWEB)

    Menad, N., E-mail: n.menad@brgm.fr [BRGM, 3 av. C. Guillemin, 45060 Orléans (France); Guignot, S. [BRGM, 3 av. C. Guillemin, 45060 Orléans (France); Houwelingen, J.A. van, E-mail: recy.cling@iae.nl [Recycling Consult, Eindhoven (Netherlands)

    2013-03-15

    Highlights: ► A novel method of characterisation of components contained in WEEE has been developed. ► This technique was applied on several samples generated from different recycling plants. ► Handheld NIR and XRF were used to determine types of plastics and flame retardants. ► WEEE processing flow-sheet was suggested. - Abstract: Innovative separation and beneficiation techniques of various materials encountered in electrical and electronic equipment wastes (WEEE) is a major improvement for its recycling. Mechanical separation-oriented characterisation of WEEE was conducted in an attempt to evaluate the amenability of mechanical separation processes. Properties such as liberation degree of fractions (plastics, metals ferrous and non-ferrous), which are essential for mechanical separation, are analysed by means of a grain counting approach. Two different samples from different recycling industries were characterised in this work. The first sample is a heterogeneous material containing different types of plastics, metals (ferrous and non-ferrous), printed circuit board (PCB), rubber and wood. The second sample contains a mixture of mainly plastics. It is found for the first sample that all aluminium particles are free (100%) in all investigated size fractions. Between 92% and 95% of plastics are present as free particles; however, 67% in average of ferromagnetic particles are liberated. It can be observed that only 42% of ferromagnetic particles are free in the size fraction larger than 20 mm. Particle shapes were also quantified manually particle by particle. The results show that the particle shapes as a result of shredding, turn out to be heterogeneous, thereby complicating mechanical separation processes. In addition, the separability of various materials was ascertained by a sink–float analysis and eddy current separation. The second sample was separated by automatic sensor sorting in four different products: ABS, PC–ABS, PS and rest product. The

  5. PNGMDR - Characterisation of intermediate-level long-lived wastes

    International Nuclear Information System (INIS)

    2014-12-01

    This document presents the status of the characterization of intermediate-level long-lived wastes which are warehoused on exploited EDF sites or which will be produced during the deconstruction of first-generation reactors. It addresses aspects related to characterisation and packaging of wastes produced before 2015. More specifically, it addresses aspects related to contamination and to activation. Contamination is assessed by measurements whereas activation assessment is based on numerical simulations associated with measurements performed during parcel production. After having mentioned the concerned reactors, the document presents the methodology adopted for these assessments, and reports the progress status of the characterization process for these intermediate-level long-lived wastes

  6. Electrochemical characterisation speeds up prediction of corrosion behaviour

    Energy Technology Data Exchange (ETDEWEB)

    Schuring, E.W.; Hooijmans, J.W. [ECN Environment and Energy Engineering, Petten (Netherlands)

    2013-04-15

    The contents of this presentation show the following elements: Introduction; Corrosion in real life; Why Electrochemical characterisation of corrosion; Applications (corrosion resistance coatings, corrosion behaviour (brazed) joints); Available electrochemical corrosion techniques; Standards; Conclusions. In the Conclusions the corrosion screening method is summarized: ECN method fast; within 1h -1 week results depending on test method; Fast pre-selection of promising materials/combinations (cost savings); Determining of corrosion initiation; Determination of corrosion mechanisms and propagation; Life time predictions possible; Strong combination with metallographic post-investigation; Ranking materials / constructions for corrosion performance.

  7. Characterisation of Silicon Timing Detectors for the RD50 Collaboration

    CERN Document Server

    Immig, David Maximilian

    2017-01-01

    Increasing pile-up and irradiation following with the high luminosity upgrade of the LHC, demands the development of improved semiconductor detectors. The former problem can be reduced by more precise time information, which can be obtained using a future detector based on the low gain avalanche diode (LGAD). LGADs are studied by the RD50-Collaboration, which studies the characteristics of semiconductor devices to improve these for future requirements of high energy physics. This reports is engaged with the process to characterise semiconductor detectors, specially LGADs, with capacitance-voltage and current-voltage measurements as well as transient current techniques of un- and irradiated semiconductor devices.

  8. CVD diamond coatings on titanium : Characterisation by XRD techniques

    Energy Technology Data Exchange (ETDEWEB)

    Cappuccio, G [CNR, Frascati, Rome (Italy). Istituto di Strutturistica Chimica; [INFN-LNF, Frascati, Rome (Italy). Laboratorio Dafne Luce

    1996-09-01

    Here, the authors report an analysis carried out on diamond coatings on titanium substrates to show the potentially of x-ray diffraction techniques in the structural characterisation both of diamond thin films and of the other phases (TiC and TiH{sub 2}) present in the interfacial layer. It should be noted that the composition and microstructure of the interface layers strongly affect the characteristics of the diamond films, particularly adhesion, which is one of the most important elements determining the final quality of the coating.

  9. The preparation and characterisation of reference fission foils

    International Nuclear Information System (INIS)

    Audenhove, J. van; Bievre, P. de; Pauwels, J.; Peetermans, F.; Gallet, M.; Verbruggen, A.

    1979-01-01

    Homogeneous and accurately defined uranium and plutonium reference fissionable deposits have been prepared by vacuum deposition of fluorides. The preparation of the fluorides as well as their vacuum deposition on planetary rotating multisubstrate holders are described. The characterisation of the deposits is obtained by relative α-counting and calibration using isotope dilution mass spectrometry. The mass per square centimeter of the deposits is corrected for the border effects and the homogeneity is determined by relative α-counting of small spots. The deposits show excellent adherence and resistance to different mediums. This makes their use as permanently available reference fission foils possible. (orig.)

  10. Characterisation of two AGATA asymmetric high purity germanium capsules

    International Nuclear Information System (INIS)

    Colosimo, S.J.; Moon, S.; Boston, A.J.; Boston, H.C.; Cresswell, J.R.; Harkness-Brennan, L.; Judson, D.S.; Lazarus, I.H.; Nolan, P.J.; Simpson, J.; Unsworth, C.

    2015-01-01

    The AGATA spectrometer is an array of highly segmented high purity germanium detectors. The spectrometer uses pulse shape analysis in order to track Compton scattered γ-rays to increase the efficiency of nuclear spectroscopy studies. The characterisation of two high purity germanium detector capsules for AGATA of the same A-type has been performed at the University of Liverpool. This work will examine the uniformity of performance of the two capsules, including a comparison of the resolution and efficiency as well as a study of charge collection. The performance of the capsules shows good agreement, which is essential for the efficient operation of the γ-ray tracking array

  11. Characterisation of Cdkl5transcript isoforms in rat

    OpenAIRE

    Hector, Ralph D.; Dando, Owen; Ritakari, Tuula E.; Kind, Peter C.; Bailey, Mark E.S.; Cobb, Stuart R.

    2017-01-01

    CDKL5 deficiency is a severe neurological disorder caused by mutations in the X-linked Cyclin-Dependent Kinase-Like 5 gene (CDKL5). The predominant human CDKL5 brain isoform is a 9.7kb transcript comprised of 18 exons with a large 6.6kb 3'-untranslated region (UTR). Mammalian models of CDKL5 disorder are currently limited to mouse, and little is known about Cdkl5 in other organisms used to model neurodevelopmental disorders, such as rat. In this study we characterise, both bioinformatically a...

  12. A demonstration of enhancements in interfacial rheological characterisations

    DEFF Research Database (Denmark)

    Hodder, Peter; Baldursdottir, Stefania G.

    It has been a number of years since the rotational rheometer have really become sensitive enough to provide a suitable platform to help characterise an interface, whether liquid / air or liquid /liquid. It has been a path to discovery all and many iterations of designs of the actual measuring...... we have compared the performance of two models of the new Discovery Hybrid Rheometer and the AR G2 rheometer when studying the interfacial adsorption of lysozyme (from hen egg white, Sigma-Aldrich, Denmark) using the double wall ring geometry. The results show great improvement in the detection limit...

  13. Characterisation of two AGATA asymmetric high purity germanium capsules

    Energy Technology Data Exchange (ETDEWEB)

    Colosimo, S.J., E-mail: sjc@ns.ph.liv.ac.uk [Department of Physics, Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 7ZE (United Kingdom); Moon, S.; Boston, A.J.; Boston, H.C.; Cresswell, J.R.; Harkness-Brennan, L.; Judson, D.S. [Department of Physics, Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 7ZE (United Kingdom); Lazarus, I.H. [STFC Daresbury, Daresbury, Warrington WA4 4AD (United Kingdom); Nolan, P.J. [Department of Physics, Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 7ZE (United Kingdom); Simpson, J. [STFC Daresbury, Daresbury, Warrington WA4 4AD (United Kingdom); Unsworth, C. [Department of Physics, Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 7ZE (United Kingdom)

    2015-02-11

    The AGATA spectrometer is an array of highly segmented high purity germanium detectors. The spectrometer uses pulse shape analysis in order to track Compton scattered γ-rays to increase the efficiency of nuclear spectroscopy studies. The characterisation of two high purity germanium detector capsules for AGATA of the same A-type has been performed at the University of Liverpool. This work will examine the uniformity of performance of the two capsules, including a comparison of the resolution and efficiency as well as a study of charge collection. The performance of the capsules shows good agreement, which is essential for the efficient operation of the γ-ray tracking array.

  14. Microscopic characterisation of TIG-deposition and -welding

    International Nuclear Information System (INIS)

    Groot, P.

    1992-11-01

    In the framework of the European Fusion Technology Programme austenitic RVS AISI 316LN is considered as candidate material for the First Wall. In this report, among others, tungsten-arc (TIG) welding connections are investigated as a part of the ECN project 1.653. It concerns respectively; the deposition of TIG-electrode-material and the welding connection. The connections are fabricated by the Danish Welding Institute Svejsecentrals in Broendby. This study is supposed to give a welding qualification by microscopic characterisation of a TIG-deposition and a TIG-weld. 3 refs., 33 figs., 5 tabs

  15. A hard X-ray laboratory for monochromator characterisation

    Energy Technology Data Exchange (ETDEWEB)

    Hamelin, B [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

    1997-04-01

    Since their installation at ILL during the 1970`s the ILL {gamma}-ray diffractometers have been intensively used in the development of neutron monochromators. However, the ageing of the sources and new developments in hard X-ray diffractometry lead to a decision at the end of 1995 to replace the existing {gamma}-ray laboratory with a hard X-ray laboratory, based on a 420 keV generator, making available in the long term several beam-lines for rapid characterisation of monochromator crystals. The facility is now installed and its characteristics and advantages are outlined. (author). 2 refs.

  16. Characterisation of neutron beam and gamma spectrometer for PGAA

    International Nuclear Information System (INIS)

    Revay, Zs.; Molnar, G.L.

    2001-01-01

    In the second project year great efforts have been devoted in Budapest to the development of methods and procedures for neutron beam characterisation and spectrometer calibration. These are described here to provide recipes for other laboratories. Some illustrative results obtained on the former thermal guide, and partly on the new cold neutron guide are also given. Preliminary results from the benchmark experiments on flux monitors titanium standard and an unknown sample are also reported. New k o factors for elements of highest priority will be measured on the cold beam only in the near future. (author)

  17. FlowCyl: one-parameter characterisation of matrix rheology

    DEFF Research Database (Denmark)

    Cepuritis, Rolands; Ramenskiy, Evgeny; Mørtsell, Ernst

    The FlowCyl is a simple flow viscometer – a modification of the Marsh Cone test apparatus developed to characterize cement pastes and grouts. The FlowCyl gives a one parameter characterisation of rheology called the flow resistance ratio or λQ for use in the Particle-Matrix concrete proportioning...... Model (PMM) as a description of the viscous phase of the concrete, while another parameter related to packing density is used to describe the particle phase. There have been numerous studies which have shown how the matrix λ Qvalues affect the rheological parameters of concretes with a given particle...

  18. Characterisation of Cs ion implanted GaN by DLTS

    Science.gov (United States)

    Ngoepe, P. N. M.; Meyer, W. E.; Auret, F. D.; Omotoso, E.; Hlatshwayo, T. T.; Diale, M.

    2018-04-01

    Deep level transient spectroscopy (DLTS) was used to characterise Cs implanted GaN grown by hydride vapour phase epitaxy (HVPE). This implantation was done at room temperature using energy of 360 keV to a fluence of 10-11 cm-2. A defect with activation energy of 0.19 eV below the conduction band and an apparent capture cross section of 1.1 × 10-15 cm2 was induced. This defect has previously been observed after rare earth element (Eu, Er and Pr) implantation. It has also been reported after electron, proton and He ion implantation.

  19. New characterisation method of electrical and electronic equipment wastes (WEEE)

    International Nuclear Information System (INIS)

    Menad, N.; Guignot, S.; Houwelingen, J.A. van

    2013-01-01

    Highlights: ► A novel method of characterisation of components contained in WEEE has been developed. ► This technique was applied on several samples generated from different recycling plants. ► Handheld NIR and XRF were used to determine types of plastics and flame retardants. ► WEEE processing flow-sheet was suggested. - Abstract: Innovative separation and beneficiation techniques of various materials encountered in electrical and electronic equipment wastes (WEEE) is a major improvement for its recycling. Mechanical separation-oriented characterisation of WEEE was conducted in an attempt to evaluate the amenability of mechanical separation processes. Properties such as liberation degree of fractions (plastics, metals ferrous and non-ferrous), which are essential for mechanical separation, are analysed by means of a grain counting approach. Two different samples from different recycling industries were characterised in this work. The first sample is a heterogeneous material containing different types of plastics, metals (ferrous and non-ferrous), printed circuit board (PCB), rubber and wood. The second sample contains a mixture of mainly plastics. It is found for the first sample that all aluminium particles are free (100%) in all investigated size fractions. Between 92% and 95% of plastics are present as free particles; however, 67% in average of ferromagnetic particles are liberated. It can be observed that only 42% of ferromagnetic particles are free in the size fraction larger than 20 mm. Particle shapes were also quantified manually particle by particle. The results show that the particle shapes as a result of shredding, turn out to be heterogeneous, thereby complicating mechanical separation processes. In addition, the separability of various materials was ascertained by a sink–float analysis and eddy current separation. The second sample was separated by automatic sensor sorting in four different products: ABS, PC–ABS, PS and rest product. The

  20. Synthesis and characterisation of dioxouranium(VI) and thorium(IV) complexes with 2(2'-pyridyl) 1-methyl benzimidazole

    International Nuclear Information System (INIS)

    Mohanty, R.R.; Rout, K.C.; Jena, S.; Dash, K.C.

    1995-01-01

    The ligand 2(2'-pyridyl) 1-methyl benzimidazole (MePB) forms a number of mononuclear complex of the type UO 2 (MePB)X 2 (X = Cl,I,NO 3 ,CH 3 COO,0.5 SO 4 ); UO 2 (MePB) 2 -(NCS) 2 and Th(MEPB) 2 X 4 (X = NO 3 ,NCS,I) and the biheteronuclear complex UO 2 (MePB)HgCl 4 . All these complexes were characterised by elemental analysis, conductivity measurements, thermogravimetric studies and IR, electronic, mass and NMR ( 1 H and 13 C) spectral studies. (author). 5 refs

  1. Structure of the Unbound Form of HIV-1 Subtype A Protease: Comparison with Unbound Forms of Proteases from other HIV Subtypes

    Energy Technology Data Exchange (ETDEWEB)

    Robbins, Arthur H.; Coman, Roxana M.; Bracho-Sanchez, Edith; Fernandez, Marty A.; Gilliland, C.Taylor; Li, Mi; Agbandje-McKenna, Mavis; Wlodawer, Alexander; Dunn, Ben M.; McKenna, Robert (NCI); (Florida)

    2010-03-12

    The crystal structure of the unbound form of HIV-1 subtype A protease (PR) has been determined to 1.7 {angstrom} resolution and refined as a homodimer in the hexagonal space group P6{sub 1} to an R{sub cryst} of 20.5%. The structure is similar in overall shape and fold to the previously determined subtype B, C and F PRs. The major differences lie in the conformation of the flap region. The flaps in the crystal structures of the unbound subtype B and C PRs, which were crystallized in tetragonal space groups, are either semi-open or wide open. In the present structure of subtype A PR the flaps are found in the closed position, a conformation that would be more anticipated in the structure of HIV protease complexed with an inhibitor. The amino-acid differences between the subtypes and their respective crystal space groups are discussed in terms of the differences in the flap conformations.

  2. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  3. Synthesis, characterisation and physicochemical properties of hydrophobically modified inulin using long-chain fatty acyl chlorides.

    Science.gov (United States)

    Han, Lingyu; Ratcliffe, I; Williams, P A

    2017-12-15

    A series of inulin derivatives were synthesized in aqueous solution using acyl chlorides with varying alkyl chain length (C10-C16). They were characterised using a number of techniques including MALDI TOF-MS, 1 H NMR and FTIR and their degree of substitution determined. The solution properties of the hydrophobically modified inulins were investigated using dye solubilisation and surface tension and it was confirmed that the molecules aggregated in solution above a critical concentration (critical aggregation concentration, CAC). The value of the CAC was found to be reasonably consistent between the different techniques and was shown to decrease with increasing hydrophobe chain length. It was found that the C10, C12 and C14 derivatives formed stable oil-in-water emulsions and the emulsion droplet size decreased with increasing alkyl chain length. The C16 derivative was not able to produce stable oil-in-water emulsions; however, it was able to form stable water-in-oil emulsions. The fact that the derivatives are able to form micellar-like aggregates and stabilise emulsions makes them suitable candidates for the encapsulation and delivery of active compounds with potential application in food, cosmetic, personal care and pharmaceutical formulations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Phosphorus Dendrimers as Carriers of siRNA—Characterisation of Dendriplexes

    Directory of Open Access Journals (Sweden)

    Jean-Pierre Majoral

    2013-04-01

    Full Text Available There are many types of dendrimers used as nanomolecules for gene delivery but there is still an ongoing search for ones that are able to effectively deliver drugs to cells. The possibility of gene silencing using siRNA gives hope for effective treatment of numerous diseases. The aim of this work was to investigate in vitro biophysical properties of dendriplexes formed by siRNA and cationic phosphorus dendrimers of 3rd and 4th generation. First, using the ethidium bromide intercalation method, it was examined whether dendrimers have an ability to form complexes with siRNA. Next, the characterisation of dendriplexes formed at different molar ratios was carried out using biophysical methods. The effects of zeta potential, size and changes of siRNA conformation on the complexation with dendrimers were examined. It was found that both phosphorus dendrimers interacted with siRNA. The zeta potential values of dendriplexes ranged from negative to positive and the hydrodynamic diameter depended on the number of dendrimer molecules in the complex. Furthermore, using circular dichroism spectroscopy it was found that cationic phosphorus dendrimers changed only slightly the shape of siRNA CD spectra, thus they did not induce significant changes in the nucleic acid secondary structure during complex formation.

  5. The Escherichia coli BolA Protein IbaG Forms a Histidine-Ligated [2Fe-2S]-Bridged Complex with Grx4.

    Science.gov (United States)

    Dlouhy, Adrienne C; Li, Haoran; Albetel, Angela-Nadia; Zhang, Bo; Mapolelo, Daphne T; Randeniya, Sajini; Holland, Ashley A; Johnson, Michael K; Outten, Caryn E

    2016-12-13

    Two ubiquitous protein families have emerged as key players in iron metabolism, the CGFS-type monothiol glutaredoxins (Grxs) and the BolA proteins. Monothiol Grxs and BolA proteins form heterocomplexes that have been implicated in Fe-S cluster assembly and trafficking. The Escherichia coli genome encodes members of both of these proteins families, namely, the monothiol glutaredoxin Grx4 and two BolA family proteins, BolA and IbaG. Previous work has demonstrated that E. coli Grx4 and BolA interact as both apo and [2Fe-2S]-bridged heterodimers that are spectroscopically distinct from [2Fe-2S]-bridged Grx4 homodimers. However, the physical and functional interactions between Grx4 and IbaG are uncharacterized. Here we show that co-expression of Grx4 with IbaG yields a [2Fe-2S]-bridged Grx4-IbaG heterodimer. In vitro interaction studies indicate that IbaG binds the [2Fe-2S] Grx4 homodimer to form apo Grx4-IbaG heterodimer as well as the [2Fe-2S] Grx4-IbaG heterodimer, altering the cluster stability and coordination environment. Additionally, spectroscopic and mutagenesis studies provide evidence that IbaG ligates the Fe-S cluster via the conserved histidine that is present in all BolA proteins and by a second conserved histidine that is present in the H/C loop of two of the four classes of BolA proteins. These results suggest that IbaG may function in Fe-S cluster assembly and trafficking in E. coli as demonstrated for other BolA homologues that interact with monothiol Grxs.

  6. Ash from a pulp mill boiler--characterisation and vitrification.

    Science.gov (United States)

    Ribeiro, Ana S M; Monteiro, Regina C C; Davim, Erika J R; Fernandes, M Helena V

    2010-07-15

    The physical, chemical and mineralogical characterisation of the ash resulting from a pulp mill boiler was performed in order to investigate the valorisation of this waste material through the production of added-value glassy materials. The ash had a particle size distribution in the range 0.06-53 microm, and a high amount of SiO(2) (approximately 82 wt%), which was present as quartz. To favour the vitrification of the ash and to obtain a melt with an adequate viscosity to cast into a mould, different amounts of Na(2)O were added to act as fluxing agent. A batch with 80 wt% waste load melted at 1350 degrees C resulting in a homogeneous transparent green-coloured glass with good workability. The characterisation of the produced glass by differential thermal analysis and dilatometry showed that this glass presents a stable thermal behaviour. Standard leaching tests revealed that the concentration of heavy metals in the leaching solution was lower than those allowed by the Normative. As a conclusion, by vitrification of batch compositions with adequate waste load and additive content it is possible to produce an ash-based glass that may be used in similar applications as a conventional silicate glass inclusively as a building ecomaterial. 2010 Elsevier B.V. All rights reserved.

  7. Furniture wood wastes: Experimental property characterisation and burning tests

    International Nuclear Information System (INIS)

    Tatano, Fabio; Barbadoro, Luca; Mangani, Giovanna; Pretelli, Silvia; Tombari, Lucia; Mangani, Filippo

    2009-01-01

    Referring to the industrial wood waste category (as dominant in the provincial district of Pesaro-Urbino, Marche Region, Italy), this paper deals with the experimental characterisation and the carrying out of non-controlled burning tests (at lab- and pilot-scale) for selected 'raw' and primarily 'engineered' ('composite') wood wastes. The property characterisation has primarily revealed the following aspects: potential influence on moisture content of local weather conditions at outdoor wood waste storage sites; generally, higher ash contents in 'engineered' wood wastes as compared with 'raw' wood wastes; and relatively high energy content values of 'engineered' wood wastes (ranging on the whole from 3675 to 5105 kcal kg -1 for HHV, and from 3304 to 4634 kcal kg -1 for LHV). The smoke qualitative analysis of non-controlled lab-scale burning tests has primarily revealed: the presence of specific organic compounds indicative of incomplete wood combustion; the presence exclusively in 'engineered' wood burning tests of pyrroles and amines, as well as the additional presence (as compared with 'raw' wood burning) of further phenolic and containing nitrogen compounds; and the potential environmental impact of incomplete industrial wood burning on the photochemical smog phenomenon. Finally, non-controlled pilot-scale burning tests have primarily given the following findings: emission presence of carbon monoxide indicative of incomplete wood combustion; higher nitrogen oxide emission values detected in 'engineered' wood burning tests as compared with 'raw' wood burning test; and considerable generation of the respirable PM 1 fraction during incomplete industrial wood burning.

  8. Recent advancements in mechanical characterisation of 3D woven composites

    Science.gov (United States)

    Saleh, Mohamed Nasr; Soutis, Constantinos

    2017-12-01

    Three dimensional (3D) woven composites have attracted the interest of academia and industry thanks to their damage tolerance characteristics and automated fabric manufacturing. Although much research has been conducted to investigate their out-of-plane "through thickness" properties, still their in-plane properties are not fully understood and rely on extensive experimentation. To date, the literature lacks an inclusive summary of the mechanical characterisation for 3D woven composites. Therefore, the objective of this paper is to provide a comprehensive review of the available research studies on 3D woven composites mechanical characterisation, with less emphasis on the out-of-plane response, but an in-depth review of the in-plane response "un-notched vs. notched". The paper highlights the knowledge gap in the literature of 3D woven composites, suggesting opportunities for future research in this field and a room for improvement in utilising Non-Destructive Techniques (NDT), such as Digital Image Correlation (DIC), Acoustic Emission (AE) and X-ray Computed Tomography (CT), for observing damage initiation and evolution in 3D woven composites that could be used to calibrate and evaluate analytical and numerical models.

  9. Geophysical characterisation of the groundwater-surface water interface

    Science.gov (United States)

    McLachlan, P. J.; Chambers, J. E.; Uhlemann, S. S.; Binley, A.

    2017-11-01

    Interactions between groundwater (GW) and surface water (SW) have important implications for water quantity, water quality, and ecological health. The subsurface region proximal to SW bodies, the GW-SW interface, is crucial as it actively regulates the transfer of nutrients, contaminants, and water between GW systems and SW environments. However, geological, hydrological, and biogeochemical heterogeneity in the GW-SW interface makes it difficult to characterise with direct observations. Over the past two decades geophysics has been increasingly used to characterise spatial and temporal variability throughout the GW-SW interface. Geophysics is a powerful tool in evaluating structural heterogeneity, revealing zones of GW discharge, and monitoring hydrological processes. Geophysics should be used alongside traditional hydrological and biogeochemical methods to provide additional information about the subsurface. Further integration of commonly used geophysical techniques, and adoption of emerging techniques, has the potential to improve understanding of the properties and processes of the GW-SW interface, and ultimately the implications for water quality and environmental health.

  10. Effect of image scaling and segmentation in digital rock characterisation

    Science.gov (United States)

    Jones, B. D.; Feng, Y. T.

    2016-04-01

    Digital material characterisation from microstructural geometry is an emerging field in computer simulation. For permeability characterisation, a variety of studies exist where the lattice Boltzmann method (LBM) has been used in conjunction with computed tomography (CT) imaging to simulate fluid flow through microscopic rock pores. While these previous works show that the technique is applicable, the use of binary image segmentation and the bounceback boundary condition results in a loss of grain surface definition when the modelled geometry is compared to the original CT image. We apply the immersed moving boundary (IMB) condition of Noble and Torczynski as a partial bounceback boundary condition which may be used to better represent the geometric definition provided by a CT image. The IMB condition is validated against published work on idealised porous geometries in both 2D and 3D. Following this, greyscale image segmentation is applied to a CT image of Diemelstadt sandstone. By varying the mapping of CT voxel densities to lattice sites, it is shown that binary image segmentation may underestimate the true permeability of the sample. A CUDA-C-based code, LBM-C, was developed specifically for this work and leverages GPU hardware in order to carry out computations.

  11. Identification and topographical characterisation of microbial nanowires in Nostoc punctiforme.

    Science.gov (United States)

    Sure, Sandeep; Torriero, Angel A J; Gaur, Aditya; Li, Lu Hua; Chen, Ying; Tripathi, Chandrakant; Adholeya, Alok; Ackland, M Leigh; Kochar, Mandira

    2016-03-01

    Extracellular pili-like structures (PLS) produced by cyanobacteria have been poorly explored. We have done detailed topographical and electrical characterisation of PLS in Nostoc punctiforme PCC 73120 using transmission electron microscopy (TEM) and conductive atomic force microscopy (CAFM). TEM analysis showed that N. punctiforme produces two separate types of PLS differing in their length and diameter. The first type of PLS are 6-7.5 nm in diameter and 0.5-2 µm in length (short/thin PLS) while the second type of PLS are ~20-40 nm in diameter and more than 10 µm long (long/thick PLS). This is the first study to report long/thick PLS in N. punctiforme. Electrical characterisation of these two different PLS by CAFM showed that both are electrically conductive and can act as microbial nanowires. This is the first report to show two distinct PLS and also identifies microbial nanowires in N. punctiforme. This study paves the way for more detailed investigation of N. punctiforme nanowires and their potential role in cell physiology and symbiosis with plants.

  12. Radar image and data fusion for natural hazards characterisation

    Science.gov (United States)

    Lu, Zhong; Dzurisin, Daniel; Jung, Hyung-Sup; Zhang, Jixian; Zhang, Yonghong

    2010-01-01

    Fusion of synthetic aperture radar (SAR) images through interferometric, polarimetric and tomographic processing provides an all - weather imaging capability to characterise and monitor various natural hazards. This article outlines interferometric synthetic aperture radar (InSAR) processing and products and their utility for natural hazards characterisation, provides an overview of the techniques and applications related to fusion of SAR/InSAR images with optical and other images and highlights the emerging SAR fusion technologies. In addition to providing precise land - surface digital elevation maps, SAR - derived imaging products can map millimetre - scale elevation changes driven by volcanic, seismic and hydrogeologic processes, by landslides and wildfires and other natural hazards. With products derived from the fusion of SAR and other images, scientists can monitor the progress of flooding, estimate water storage changes in wetlands for improved hydrological modelling predictions and assessments of future flood impacts and map vegetation structure on a global scale and monitor its changes due to such processes as fire, volcanic eruption and deforestation. With the availability of SAR images in near real - time from multiple satellites in the near future, the fusion of SAR images with other images and data is playing an increasingly important role in understanding and forecasting natural hazards.

  13. Development and characterisation of hybrid polysaccharide membranes for dehydration processes.

    Science.gov (United States)

    Meireles, Inês T; Huertas, Rosa M; Torres, Cristiana A V; Coelhoso, Isabel M; Crespo, João G

    2018-07-01

    The purpose of this work is the development and characterisation of new hybrid polysaccharide (FucoPol) membranes. These membranes were prepared by incorporation of a SiO 2 network homogeneously dispersed by using a sol-gel method with GPTMS as a crosslinker silica precursor. They were further crosslinked with CaCl 2 for reinforcement of mechanical properties and improvement of their permeation performance. They were characterised in terms of their structural, mechanical and thermal properties. They presented a dense and homogeneous structure, resistant to deformation, with a Tg of 43 °C and a thermal decomposition between 240 and 251 °C. The hybrid FucoPol membranes were tested for ethanol dehydration by pervaporation and also for nitrogen dehydration. They exhibited high water selectivity values, similar to PERVAP ® 4101, however they lost their stability when exposed to solutions of 10.0 wt.% water in ethanol. In contrast, these membranes were stable when applied in N 2 dehydration, leading to reproducible performance and very high water selectivities. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. A neutron source for IGISOL-JYFLTRAP: Design and characterisation

    Energy Technology Data Exchange (ETDEWEB)

    Mattera, A.; Pomp, S.; Lantz, M.; Rakopoulos, V.; Solders, A.; Al-Adili, A.; Passoth, E.; Prokofiev, A.V.; Andersson, P.; Hjalmarsson, A. [Uppsala University, BOX 516, Uppsala (Sweden); Bedogni, R.; Esposito, A.; Gentile, A. [INFN-LNF, Frascati (Italy); Bortot, D. [INFN-LNF, Frascati (Italy); Politecnico di Milano, Milano (Italy); Gomez-Ros, J.M. [INFN-LNF, Frascati (Italy); CIEMAT, Madrid (Spain); Introini, M.V.; Pola, A. [Politecnico di Milano, Milano (Italy); Gorelov, D.; Penttilae, H.; Moore, I.D.; Rinta-Antila, S.; Kolhinen, V.S.; Eronen, T. [University of Jyvaeskylae (Finland)

    2017-08-15

    A white neutron source based on the Be(p, nx) reaction for fission studies at the IGISOL-JYFLTRAP facility has been designed and tested. 30MeV protons impinge on a 5mm thick water-cooled beryllium disc. The source was designed to produce at least 10{sup 12} fast neutrons/s on a secondary fission target, in order to reach competitive production rates of fission products far from the valley of stability. The Monte Carlo codes MCNPX and FLUKA were used in the design phase to simulate the neutron energy spectra. Two experiments to characterise the neutron field were performed: the first was carried out at The Svedberg Laboratory in Uppsala (SE), using an Extended-Range Bonner Sphere Spectrometer and a liquid scintillator which used the time-of-flight (TOF) method to determine the energy of the neutrons; the second employed Thin-Film Breakdown Counters for the measurement of the TOF, and activation foils, at the IGISOL facility in Jyvaeskylae (FI). Design considerations and the results of the two characterisation measurements are presented, providing benchmarks for the simulations. (orig.)

  15. Characterisation of dust material emitted during harbour operations (HADA Project)

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, N.; Alastuey, A.; Querol, X.; Artinano, B.; Guerra, A.; Luaces, J.A.; Lorente, A.; Basora, J. [CSIC, Institute of Earth Science ' Jaume Almera' , Barcelona (Spain)

    2007-09-15

    The aim of this work is to compile an inventory of the main characteristics (chemical, morphological, mineralogical and grain size parameters) of the bulk cargo materials and of the material emitted during different port operations for possible use as tracers of the fugitive PM emission sources. For all cases, the tracer characteristics determined for each bulk material were also identified in the corresponding PM material emitted. This inventory could assist the harbour authorities to identify the origin of high PM events recorded by air quality monitoring networks in harbour areas, and could also help modellers to predict the impact of harbour activities on ambient PM levels. The harbour of Tarragona (north-east Spain) was selected for this study given the high volume of solids in bulk handled. To this end, 12 handling operations of selected materials (clinker, phosphate, pyrite ash, Mn mineral, fine Si-Mn, coke (coal), bituminous coal, tapioca, soybean, alfalfa, corn, andalusite) were selected for the characterisation of suspended and deposited PM. In spite of the coarse grain size distribution of these bulk cargo materials, with a very low % in the fraction {lt}10 {mu}m, manipulation of these materials during harbour operations may result in high emissions of PM 10 with relatively high levels of potential toxic elements. Furthermore, ambient PM 10 in the area with the highest traffic density of the harbour was also sampled and characterised.

  16. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  17. Valorisation of chicken feathers: Characterisation of chemical properties.

    Science.gov (United States)

    Tesfaye, Tamrat; Sithole, Bruce; Ramjugernath, Deresh; Chunilall, Viren

    2017-10-01

    The characterisation of the chemical properties of the whole chicken feather and its fractions (barb and rachis), was undertaken to identify opportunities for valorizing this waste product. The authors have described the physical, morphological, mechanical, electrical and thermal properties of the chicken feathers and related them to potential valorisation routes of the waste. However, identification of their chemical properties is necessary to complete a comprehensive description of chicken feather fractions. Hence, the chicken feathers were thoroughly characterised by proximate and ultimate analyses, elemental composition, spectroscopic analyses, durability in different solvents, burning test, and hydrophobicity. The proximate analysis of chicken feathers revealed the following compositions: crude lipid (0.83%), crude fibre (2.15%), crude protein (82.36%), ash (1.49%), NFE (1.02%) and moisture content (12.33%) whereas the ultimate analyses showed: carbon (64.47%), nitrogen (10.41%), oxygen (22.34%), and sulphur (2.64%). FTIR analysis revealed that the chicken feather fractions contain amide and carboxylic groups indicative of proteinious functional groups; XRD showed a crystallinity index of 22. Durability and burning tests confirmed that feathers behaved similarly to animal fibre. This reveals that chicken feather can be a valuable raw material in textile, plastic, cosmetics, pharmaceuticals, biomedical and bioenergy industries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Radiological Characterisation from a Waste and Materials End-State Perspective: Practices and Experience

    International Nuclear Information System (INIS)

    Mommaert, Chantal; Andrieu, Caroline; Desnoyers, Yvon; Denis Pombet; Salsac, Marie-Delphine; Knaack, Michael; Altavilla, Massimo; Manes, Daniela; Takahashi, Hiroaki; Ul Syed, Naeem; Palomo, Nieves Martin; Larsson, Arne; Dunlop, Alister; Susan Brown; Emptage, Matthew; Black, Greg; Abu-Eid, Rateb; Szilagyi, Andrew; Weber, Inge; )

    2017-01-01

    Radiological characterisation is a key enabling activity for the planning and implementation of nuclear facility decommissioning. Effective characterisation allows the extent, location and nature of contamination to be determined and provides crucial information for facility dismantling, the management of material and waste arisings, the protection of workers, the public and the environment, and associated cost estimations. This report will be useful for characterisation practitioners who carry out tactical planning, preparation, optimisation and implementation of characterisation to support the decommissioning of nuclear facilities and the management of associated materials and waste. It compiles recent experience from NEA member countries in radiological characterisation, including from international experts, international case studies, an international conference, and international standards and guidance. Using this comprehensive evidence base, the report identifies relevant good practice and provides practical advice covering all stages of the characterisation process

  19. Design and Characterisation of III-V Semiconductor Nanowire Lasers

    Science.gov (United States)

    Saxena, Dhruv

    The development of small, power-efficient lasers underpins many of the technologies that we utilise today. Semiconductor nanowires are promising for miniaturising lasers to even smaller dimensions. III-V semiconductors, such as Gallium Arsenide (GaAs) and Indium Phosphide (InP), are the most widely used materials for optoelectronic devices and so the development of nanowire lasers based on these materials is expected to have technologically significant outcomes. This PhD dissertation presents a comprehensive study of the design of III-V semiconductor nanowire lasers, with bulk and quantum confined active regions. Based on the design, various III-V semiconductor nanowire lasers are demonstrated, namely, GaAs nanowire lasers, GaAs/AlGaAs multi-quantum well (MQW) nanowire lasers and InP nanowire lasers. These nanowire lasers are shown to operate at room temperature, have low thresholds, and lase from different transverse modes. The structural and optoelectronic quality of nanowire lasers are characterised via electron microscopy and photoluminescence spectroscopic techniques. Lasing is characterised in all these devices by optical pumping. The lasing characteristics are analysed by rate equation modelling and the lasing mode(s) in these devices is characterised by threshold gain modelling, polarisation measurements and Fourier plane imaging. Firstly, GaAs nanowire lasers that operate at room temperature are demonstrated. This is achieved by determining the optimal nanowire diameter to reduce threshold gain and by passivating nanowires to improve their quantum efficiency (QE). High-quality surface passivated GaAs nanowires of suitable diameters are grown. The growth procedure is tailored to improve both QE and structural uniformity of nanowires. Room-temperature lasing is demonstrated from individual nanowires and lasing is characterised to be from TM01 mode by threshold gain modelling. To lower threshold even further, nanowire lasers with GaAs/AlGaAs coaxial multi

  20. Detection and characterisation of Complement protein activity in bovine milk by bactericidal sequestration assay.

    Science.gov (United States)

    Maye, Susan; Stanton, Catherine; Fitzgerald, Gerald F; Kelly, Philip M

    2015-08-01

    While the Complement protein system in human milk is well characterised, there is little information on its presence and activity in bovine milk. Complement forms part of the innate immune system, hence the importance of its contribution during milk ingestion to the overall defences of the neonate. A bactericidal sequestration assay, featuring a Complement sensitive strain, Escherichia coli 0111, originally used to characterise Complement activity in human milk was successfully applied to freshly drawn bovine milk samples, thus, providing an opportunity to compare Complement activities in both human and bovine milks. Although not identical in response, the levels of Complement activity in bovine milk were found to be closely comparable with that of human milk. Differential counts of Esch. coli 0111 after 2 h incubation were 6.20 and 6.06 log CFU/ml, for raw bovine and human milks, respectively - the lower value representing a stronger Complement response. Exposing bovine milk to a range of thermal treatments e.g. 42, 45, 65, 72, 85 or 95 °C for 10 min, progressively inhibited Complement activity by increasing temperature, thus confirming the heat labile nature of this immune protein system. Low level Complement activity was found, however, in 65 and 72 °C heat treated samples and in retailed pasteurised milk which highlights the outer limit to which high temperature, short time (HTST) industrial thermal processes should be applied if retention of activity is a priority. Concentration of Complement in the fat phase was evident following cream separation, and this was also reflected in the further loss of activity recorded in low fat variants of retailed pasteurised milk. Laboratory-based churning of the cream during simulated buttermaking generated an aqueous (buttermilk) phase with higher levels of Complement activity than the fat phase, thus pointing to a likely association with the milk fat globule membrane (MFGM) layer.

  1. Characterisation of long-lived low and intermediate-level radioactive wastes in the Nordic Countries

    International Nuclear Information System (INIS)

    Broden, K.; Carugati, S.; Brodersen, K.; Carlsson, T.; Viitanen, P.; Walderhaug, T.; Sneve, M.; Hornkjoel, S.; Backe, S.

    1997-11-01

    The present report is final report from a study on characterisation of radioactive waters in the Nordic countries. The study has mainly been focused on long-lived low and intermediate level radioactive waste. Methods to measure or estimate the activity content and the general composition are discussed. Recommendations are given regarding characterisation of waste under treatment and characterisation of already produced waste packages. (au)

  2. Characterisation of long-lived low and intermediate-level radioactive wastes in the Nordic Countries

    Energy Technology Data Exchange (ETDEWEB)

    Broden, K. [Studsvik RadWaste AB, (El Salvador); Carugati, S.; Brodersen, K. [Forskningscenter Risoe, (Denmark); Carlsson, T.; Viitanen, P. [VVT, (Finland); Walderhaug, T. [Icelandic Radiation Protection Institute (Iceland); Sneve, M.; Hornkjoel, S. [Norwegian Radiation Protection Authority (Norway); Backe, S. [Institute for Energy Technology (Norway)

    1997-11-01

    The present report is final report from a study on characterisation of radioactive waters in the Nordic countries. The study has mainly been focused on long-lived low and intermediate level radioactive waste. Methods to measure or estimate the activity content and the general composition are discussed. Recommendations are given regarding characterisation of waste under treatment and characterisation of already produced waste packages. (au).

  3. Adaptive municipal electronic forms

    NARCIS (Netherlands)

    Kuiper, Pieternel; van Dijk, Elisabeth M.A.G.; Bondarouk, Tatiana; Ruel, Hubertus Johannes Maria; Guiderdoni-Jourdain, Karine; Oiry, Ewan

    Adaptation of electronic forms (e-forms) seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer e-forms online that can be used by citizens to request a municipal product or service or by municipal employees to place a request on behalf of a

  4. SiteChar. Characterisation of European CO2 storage. Deliverable D8.2. Trust building and raising public awareness

    Energy Technology Data Exchange (ETDEWEB)

    Brunsting, S.; Pol, M.; Mastop, E.A. [ECN Policy Studies, Energy research Centre of the Netherlands ECN, Amsterdam (Netherlands); Kaiser, M.; Zimmer, R. [Unabhaengiges Institut fuer Umweltfragen UfU, Berlin (Germany); Shackley, S.; Mabon, L.; Howell, R. [Scottish Carbon Capture and Storage SCCS, Edinburg, Scotland (United Kingdom)

    2012-08-15

    At local level, public support has proven crucial to the implementation of CO2 capture and storage (CCS) demonstration projects. Whereas no method exists to guarantee public acceptability of any project, a constructive stakeholder and community engagement process does increase the likelihood thereof. This deliverable is a follow-up to deliverable D8.1 'Social site characterisation'. Social site characterisation can be used as an instrument to explore, plan and evaluate a process of active and constructive local stakeholder and citizen engagement in a prospective CCS project as a parallel activity to technical site characterisation. It serves as an analytical tool to describe the local social circumstances in the area and to design and evaluate stakeholder and community engagement efforts with the aims of building trust and raising public awareness. Using results from the social site characterisation of the area, the present deliverable focuses on the second purpose. It presents results from public engagement activities designed to raise public awareness and inform public opinion of a prospective CCS site in Poland (onshore) and the UK (offshore): focus conferences. Furthermore, by initiating an enhanced cooperation in planning of new storage sites between project developers, authorities and the local public, focus conferences aim to serve as a 'hinge' between social site characterisation as a research effort and application to real-life project settings. The focus conferences are part of a range of public engagement activities including the setup of public information websites on generic and site-specific CCS, information meetings. A second survey eventually shall evaluate the results of the public engagement activities. The aim of the focus conferences was to raise public awareness and assist public opinion forming processes of a prospective CCS site in Poland (onshore) and the UK (offshore). At the same time, it aimed to present and test a

  5. Elucidation of the Specific Formation of Homo- and Heterodimeric Forms of ThbZIP1 and Its Role in Stress

    Directory of Open Access Journals (Sweden)

    Xianguang Nie

    2014-06-01

    Full Text Available Protein–protein interactions are important for the molecular understanding of the biological processes of proteins. The dimerization of bZIPs (basic leucine zipper proteins is involved in modifying binding site specificities, altering dimer stability, and permitting a new set of specific protein-to-protein interactions to occur at the promoter. In the present study, we studied the whether ThbZIP1 form homo- and heterodimers using the yeast two-hybrid method. Five bZIP genes were cloned from Tamarix hispida to investigate their interaction with ThbZIP1. Our results showed that ThbZIP1 can form homodimers with itself, and three out of five bZIPs could interact with the ThbZIP1 protein to form heterodimers. Real-time RT-PCR results suggested that these ThbZIPs can all respond to abiotic stresses and abscisic acid (ABA, and shared very similar expression patterns in response to NaCl, ABA or PEG6000. Subcellular localization studies showed that all ThbZIPs are targeted to the nucleus. Our results showed that ThbZIP1 are dimeric proteins, which can form homo- or heterodimers.

  6. Current limitations and challenges in nanowaste detection, characterisation and monitoring.

    Science.gov (United States)

    Part, Florian; Zecha, Gudrun; Causon, Tim; Sinner, Eva-Kathrin; Huber-Humer, Marion

    2015-09-01

    Engineered nanomaterials (ENMs) are already extensively used in diverse consumer products. Along the life cycle of a nano-enabled product, ENMs can be released and subsequently accumulate in the environment. Material flow models also indicate that a variety of ENMs may accumulate in waste streams. Therefore, a new type of waste, so-called nanowaste, is generated when end-of-life ENMs and nano-enabled products are disposed of. In terms of the precautionary principle, environmental monitoring of end-of-life ENMs is crucial to allow assessment of the potential impact of nanowaste on our ecosystem. Trace analysis and quantification of nanoparticulate species is very challenging because of the variety of ENM types that are used in products and low concentrations of nanowaste expected in complex environmental media. In the framework of this paper, challenges in nanowaste characterisation and appropriate analytical techniques which can be applied to nanowaste analysis are summarised. Recent case studies focussing on the characterisation of ENMs in waste streams are discussed. Most studies aim to investigate the fate of nanowaste during incineration, particularly considering aerosol measurements; whereas, detailed studies focusing on the potential release of nanowaste during waste recycling processes are currently not available. In terms of suitable analytical methods, separation techniques coupled to spectrometry-based methods are promising tools to detect nanowaste and determine particle size distribution in liquid waste samples. Standardised leaching protocols can be applied to generate soluble fractions stemming from solid wastes, while micro- and ultrafiltration can be used to enrich nanoparticulate species. Imaging techniques combined with X-ray-based methods are powerful tools for determining particle size, morphology and screening elemental composition. However, quantification of nanowaste is currently hampered due to the problem to differentiate engineered from

  7. Characterisation of the ecotoxicity of hospital effluents: A review

    International Nuclear Information System (INIS)

    Orias, Frédéric; Perrodin, Yves

    2013-01-01

    The multiple activities that take place in hospitals (surgery, drug treatments, radiology, cleaning of premises and linen, chemical and biological analysis laboratories, etc.), are a major source of pollutant emissions into the environment (disinfectants, detergents, drug residues, etc.). Most of these pollutants can be found in hospital effluents (HWW), then in urban sewer networks and WWTP (weakly adapted for their treatment) and finally in aquatic environments. In view to evaluating the impact of these pollutants on aquatic ecosystems, it is necessary to characterise their ecotoxicity. Several reviews have focused on the quantitative and qualitative characterisation of pollutants present in HWW. However, none have focused specifically on the characterisation of their experimental ecotoxicity. We have evaluated this according to two complementary approaches: (i) a “substance” approach based on the identification of the experimental data in the literature for different substances found in hospital effluents, and on the calculation of their PNEC (Predicted Non Effect Concentration), (ii) a “matrix” approach for which we have synthesised ecotoxicity data obtained from the hospital effluents directly. This work first highlights the diversity of the substances present within hospital effluents, and the very high ecotoxicity of some of them (minimum PNEC observed close to 0,01 pg/L). We also observed that the consumption of drugs in hospitals was a predominant factor chosen by authors to prioritise the compounds to be sought. Other criteria such as biodegradability, excretion rate and the bioaccumulability of pollutants are considered, though more rarely. Studies of the ecotoxicity of the particulate phase of effluents must also be taken into account. It is also necessary to monitor the effluents of each of the specialised departments of the hospital studied. These steps is necessary to define realistic environmental management policies for hospitals

  8. Benzimidazole acrylonitriles as multifunctional push-pull chromophores: Spectral characterisation, protonation equilibria and nanoaggregation in aqueous solutions

    Science.gov (United States)

    Horak, Ema; Vianello, Robert; Hranjec, Marijana; Krištafor, Svjetlana; Zamola, Grace Karminski; Steinberg, Ivana Murković

    2017-05-01

    Heterocyclic donor-π-acceptor molecular systems based on an N,N-dimethylamino phenylacrylonitrile benzimidazole skeleton have been characterised and are proposed for potential use in sensing applications. The benzimidazole moiety introduces a broad spectrum of useful multifunctional properties to the system including electron accepting ability, pH sensitivity and compatibility with biomolecules. The photophysical characterisation of the prototropic forms of these chromophores has been carried out in both solution and on immobilisation in polymer films. The experimental results are further supported by computational determination of pKa values. It is noticed that compound 3 forms nanoaggregates in aqueous solutions with aggregation-induced emission (AIE) at 600 nm. All the systems demonstrate spectral pH sensitivity in acidic media which shifts towards near-neutral values upon immobilisation in polymer films or upon aggregation in an aqueous environment (compound 3). The structure-property relationships of these functional chromophores, involving their spectral characteristics, acid-base equilibria, pKa values and aggregation effects have been determined. Potential applications of the molecules as pH and biomolecular sensors are proposed based on their pH sensitivity and AIE properties.

  9. Multiple-Use Services as an Alternative to Rural Water Supply Services: A Characterisation of the Approach

    Directory of Open Access Journals (Sweden)

    Stef Smits

    2010-02-01

    Full Text Available Multiple-use services (MUS have recently gained increased attention as an alternative form of providing rural water services in an integrated manner. This stems from the growing recognition that users anyway tend to use water systems for multiple purposes. This paper aims to characterise this practice on the basis of case evidence collected in eight countries in Africa, Asia and Latin America. The cases show that people almost universally use water for both domestic and productive activities at and around the homestead. Although seldom the main source of people’s income or food production, these activities are of considerable importance for people’s livelihoods. The extent to which people use water for multiple purposes is closely related to the level of access to water expressed in the form of a water ladder in this paper. The case studies presented demonstrate how access is created by different types and combinations of well-known technologies. Additional financial and management measures are required to ensure sustainability of services. Despite the practical feasibility of the MUS approach, it is not yet widely applied by service providers and sector agencies due to observed barriers in institutional uptake. A better characterisation of MUS, alongside a learning-driven stakeholder process was able to overcome some of these barriers and improve the consideration of multiple uses of water in policy and practice.

  10. The glasses of the transept’s rosette of the cathedral of Tarragona: characterisation, classification and decay

    Directory of Open Access Journals (Sweden)

    García-Vallès, M.

    2002-04-01

    Full Text Available The glasses of the rosette forming the main window of the transept of the Gothic Cathedral of Tarragona have been characterised by means of SEM/EDS, XRD, FTIR and electronic microprobe. The multivariate statistical treatment of these data allow to establish a classification of the samples forming groups having an historical significance and reflecting ancient restorations. Furthermore, the decay patterns and mechanisms have been determined and the weathering by-products characterised. It has been demonstrated a clear influence of the bioactivity in the decay of these glasses, which activity is partially controlled by the chemical composition of the glasses.

    Se han caracterizado numerosas muestras de los vidrios que forman el rosetón del transepto de la catedral de Tarragona mediante SEM/EDS, XRD, FTIR y microsonda electrónica. La aplicación de análisis estadístico multivariante permite establecer una clasificación de las muestras que refleja anteriores intervenciones de restauración. Además, se han estudiado los mecanismos y procesos de degradación, y se han determinado los productos de alteración. Ha quedado demostrada una clara ifluencia biológica en la alteración de estos vidrios, cuya actividad es parcialmente controlada por su composición química.

  11. Laser Raman microprobe spectroscopy as a diagnostic for the characterisation of diamond and diamond like carbon (DLC) thin films

    International Nuclear Information System (INIS)

    Johnston, C.

    1990-10-01

    Invariably when manufacturing an artificial diamond film a mixture of carbon is deposited - tetragonally bonded (diamond), trigonally bonded (graphite) and other allotropic crystalline forms and amorphous carbons. This imposes a need for careful analysis to determine exactly what carbon types constitute the films. Raman spectroscopy is particularly sensitive to crystal and atomic structure and has a number of advantages which make it one of the most useful techniques for interrogating diamond and DLC thin films. Although Raman spectroscopy alone cannot fully characterise the film, it can give more information than simply what particular form of carbon or other impurities are present in the film. It can be used to determine the ratio of sp 2 to sp 3 bonding within the film, and to some extent the crystallite or domain size and the internal stress of the film. The use of laser Raman microprobe spectroscopy as a diagnostic tool in the analysis of diamond and DLC thin films is demonstrated for a variety of carbon films on various substrates and the characterisation of these films is discussed. (author)

  12. Dielectric Properties and Characterisation of Titanium Dioxide Obtained by Different Chemistry Methods

    Directory of Open Access Journals (Sweden)

    Aleksandra Wypych

    2014-01-01

    Full Text Available We made comparison of titanium dioxide powders obtained from three syntheses including sol-gel and precipitation methods as well as using layered (tetramethylammonium titanate as a source of TiO2. The obtained precursors were subjected to step annealing at elevated temperatures to transform into rutile form. The transformation was determined by Raman measurements in each case. The resulting products were characterised using Raman spectroscopy and dynamic light scattering. The main goal of the studies performed was to compare the temperature of the transformation in three titania precursors obtained by different methods of soft chemistry routes and to evaluate dielectric properties of rutile products by means of broadband dielectric spectroscopy. Different factors affecting the electrical properties of calcinated products were discussed. It was found that sol-gel synthesis provided rutile form after annealing at 850°C with the smallest particles size about 20 nm, the highest value of dielectric permittivity equal to 63.7, and loss tangent equal to 0.051 at MHz frequencies. The other powders transformed to rutile at higher temperature, that is, 900°C, exhibit lower value of dielectric permittivity and had a higher value of particles size. The correlation between the anatase-rutile transformation temperature and the size of annealed particles was proposed.

  13. Characterisation of Roseomonas mucosa isolated from the root canal of an infected tooth.

    Science.gov (United States)

    Diesendorf, Nina; Köhler, Stefanie; Geißdörfer, Walter; Grobecker-Karl, Tanja; Karl, Matthias; Burkovski, Andreas

    2017-06-14

    The genus Roseomonas comprises a group of pink-pigmented, slow-growing, aerobic, non-fermentative Gram-negative bacteria, which have been isolated from environmental sources such as water and soil, but are also associated with human infections. In the study presented here, Roseomonas mucosa was identified for the first time as part of the endodontic microbiota of an infected root canal and characterised in respect to growth, antibiotic susceptibility and biofilm formation. The isolated R. mucosa strain showed strong slime formation and was resistant to most β-lactam antibiotics, while it was susceptible to aminoglycosides, carbapenemes, fluorochinolones, polymyxines, sulfonamides and tetracyclines. Biofilm formation on artificial surfaces (glass, polystyrene, gutta-percha) and on teeth was tested using colorimetric and fluorescence microscopic assays. While solid biofilms were formed on glass surfaces, on the hydrophobic surface of gutta-percha points, no confluent but localised, spotty biofilms were observed. Furthermore, R. mucosa was able form biofilms on dentin. The data obtained indicate that R. mucosa can support establishment of endodontic biofilms and furthermore, infected root canals might serve as an entrance pathway for blood stream infections by this emerging pathogen.

  14. Characterisation of Catfish (Clarias Batrachus) Oil: β-Cyclodextrin Inclusion Complex

    International Nuclear Information System (INIS)

    Zaibunnisa Abdul Haiyee; Nor Izzatul Adyani Yahya; Norizzah Abd Rashid; Dzulkifly Mat Hashim

    2016-01-01

    Catfish is a cheap source of essential omega-3 fatty acids especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Catfish oil was extracted and clean-up using pressurised liquid extraction (PLE) from the viscera of catfish (Clarias batrachus). However, the characteristics of catfish oils are sticky, strong fishy odour and can easily be oxidised with short shelf-life. In this study, catfish oil was converted into powder by formation of inclusion complex with β-cyclodextrin. Inclusion complex was prepared by using co-precipitation and kneading methods and compared with physical mixture. The inclusion complex formed were characterised by using field emission scanning electron microscopy (FESEM), differential scanning calorimeter (DSC) and fourier transform infrared spectroscopy (FTIR). FESEM images revealed that inclusion complex using co-precipitation and kneading methods has smaller in crystal sizes and appeared as different morphology compared to physical mixture. DSC proved that co-precipitation method was able to form new solid phase due to shifting of melting point to higher temperature (145.22 degree Celcius). FTIR supported the result by proving strengthening of carbonyl group (C=O). Therefore, co-precipitation method was able to successfully produce inclusion complex of catfish oil, β-cyclodextrin. (author)

  15. Some antarctic soil cores from Wood Bay characterised by Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Bertelle, M.; Leotta, G.; Calogero, S.; Constantinescu, S.; Oddone, M.

    1999-01-01

    Marine, lacustrine and terrestrial soil cores, sampled in a restricted area of Wood Bay in Antarctica, were characterised by 57 Fe Moessbauer spectroscopy. The results of X-ray diffraction and instrumental neutron activation analysis are shortly discussed too. The soils, formed by mechanical disaggregation and weathering of rocks of volcanic origin from Mt. Melbourne, consist of alkaline feldspars, olivines, augitic clinopyroxenes, and iron oxides such as haematite, goethite, and magnetite. Lacustrine and terrestrial soils are richer in clinopyroxenes whereas marine soils are richer in olivines. This finding shows that the soils retain a content in olivines and clinopyroxenes comparable to that found in the parent lava outcropped from Mt. Melbourne volcano. The soils appear at the initial stage of weathering. Two main weathering effects are observed: 1. atmospheric oxygen determines the oxidation of the iron(II) present in olivines and clinopyroxenes and the neo-formed iron(III) is mainly retained in silicate sites as structural iron(III); 2. a part of magnetite, present as a primary constituent of the volcanic rocks, is oxidised to bulk haematite and goethite. (authors)

  16. Characterisation of mobile radio channels for small multiantenna terminals

    DEFF Research Database (Denmark)

    Kotterman, Wim Anton Theo

    The Ph.D. thesis "Characterisation of mobile radio channels for small multiantenna terminals" discusses the work on and presents the results of the Ph.D. project "Smart antennas for small terminals". The scope of the project was to determine whether the use of multiple antennas on small handheld...... mobile terminals could improve the transmission quality and throughput of mobile communication links under typical usage conditions. That is, using multiple antennas of typical design, handled by users in typical ways in typical environments as handling by users has a strong influence on channel...... for multiantenna operation, and user influences. Additionally, the reduction of rank of narrow band channels on small observation intervals is discussed. One of the consequences is that fading prediction is limited to about less than a wavelength ahead in practical circumstances....

  17. Ion beam induced luminescence characterisation of CVD diamond films

    Energy Technology Data Exchange (ETDEWEB)

    Bettiol, A A; Gonon, P; Jamieson, D N [Melbourne Univ., Parkville, VIC (Australia). School of Physics

    1997-12-31

    The characterisation of the band structure properties of materials and devices by ion microprobe techniques has been made possible at the Melbourne MeV ion microprobe facility with the development of Ion Beam Induced Luminescence (IBIL). A number of diamond films grown by Microwave Plasma Chemical Vapour Deposition (MPCVD) on silicon substrates are analysed. A preliminary study of the luminescence properties of these samples has revealed information not previously obtainable via traditional microprobe techniques. The optical effects of incorporating dopants during the deposition process is determined using IBIL. The presence of trace element impurities introduced during growth is examined by Particle Induced X-ray Emission (PIXE), and a measurement of the film thickness is made using Rutherford Backscattering Spectrometry (RBS). 7 refs., 2 figs.

  18. Ion beam induced luminescence characterisation of CVD diamond films

    Energy Technology Data Exchange (ETDEWEB)

    Bettiol, A.A.; Gonon, P.; Jamieson, D.N. [Melbourne Univ., Parkville, VIC (Australia). School of Physics

    1996-12-31

    The characterisation of the band structure properties of materials and devices by ion microprobe techniques has been made possible at the Melbourne MeV ion microprobe facility with the development of Ion Beam Induced Luminescence (IBIL). A number of diamond films grown by Microwave Plasma Chemical Vapour Deposition (MPCVD) on silicon substrates are analysed. A preliminary study of the luminescence properties of these samples has revealed information not previously obtainable via traditional microprobe techniques. The optical effects of incorporating dopants during the deposition process is determined using IBIL. The presence of trace element impurities introduced during growth is examined by Particle Induced X-ray Emission (PIXE), and a measurement of the film thickness is made using Rutherford Backscattering Spectrometry (RBS). 7 refs., 2 figs.

  19. Characterisation of estuarine intertidal macroalgae by laser-induced fluorescence

    DEFF Research Database (Denmark)

    Gameiro, Carla; Utkin, Andrei B.; Sousa Dias Cartaxana, Paulo Jorge

    2015-01-01

    The article reports the application of laser-induced fluorescence (LIF) for the assessment of macroalgae communities of estuarine intertidal areas. The method was applied for the characterisation of fifteen intertidal macroalgae species of the Tagus estuary, Portugal, and adjacent coastal area...... spectra were determined by differences in the main fluorescing pigments: phycoerythrin, phycocyanin and chlorophyll a (Chl a). In the green and brown macroalgae groups, the relative significance of the two emission maxima seems to be related to the thickness of the photosynthetic layer. In thick...... macroalgae, like Codium tomentosum or Fucus vesiculosus, the contribution of the far-red emission fluorescence peak was more significant, most probably due to re-absorption of the emitted red Chl a fluorescence within the dense photosynthetic layer. Similarly, an increase in the number of layers of the thin...

  20. Freeform surface measurement and characterisation using a toolmakers microscope

    International Nuclear Information System (INIS)

    Wong, Francis Seung-yin; Chauh, Kong-Bieng; Venuvinod, Patri K

    2014-01-01

    Current freeform surface (FFS) characterization systems mainly cover aspects related to computer-aided design/manufacture (CAD/CAM). This paper describes a new approach that extends into computer-aided inspection (CAI).The following novel features are addressed: - ◼ Feature recognition and extraction from surface data; - ◼ Characterisation of properties of the surface's M and N vectors at individual vertex; - ◼ Development of a measuring plan using a toolmakers microscope for the inspection of the FFS; - ◼ Inspection of the actual FFS produced by CNC milling; - ◼ Verification of the measurement results and comparison with the CAD design data; Tests have shown that the deviations between the CAI and CAD data were within the estimated uncertainty limits

  1. Characterisation of vortex flow inside an entrained cavity

    Energy Technology Data Exchange (ETDEWEB)

    Rambert, A.; Elcafsi, A.; Gougat, P. [Centre National de la Recherche Scientifique, 91 - Orsay (France). Lab. d' Informatique pour la Mecanique et les Sciences de l' Ingenieur

    2000-07-01

    A number of studies have referred to the existence of a vortex cell within an urban street canyon when ambient winds aloft are perpendicular to the street. The understanding of vortex dynamics or vorticity distribution in a such configuration is of great interest. Vortex structures play an important role in the dynamics of pollutant dispersion. This configuration was simulated by the interaction between a boundary layer and a cavity. Experimental characterisation of the vortex structures evolution was developed by flow velocity measurements inside and out of the cavity. Classical methods like hot wire and laser Doppler velocimetry (LDV) display only local measurements. Particle image velocimetry (PIV) method based on the optical flow technique permitted global velocity measurements. This technique emphasis the vortex structures inside the cavity which present small scales as well as large scales related to the cavity geometry. These vortices are usually non-stationary. (orig.)

  2. Characterisation of surface roughness for ultra-precision freeform surfaces

    International Nuclear Information System (INIS)

    Li Huifen; Cheung, C F; Lee, W B; To, S; Jiang, X Q

    2005-01-01

    Ultra-precision freeform surfaces are widely used in many advanced optics applications which demand for having surface roughness down to nanometer range. Although a lot of research work has been reported on the study of surface generation, reconstruction and surface characterization such as MOTIF and fractal analysis, most of them are focused on axial symmetric surfaces such as aspheric surfaces. Relative little research work has been found in the characterization of surface roughness in ultra-precision freeform surfaces. In this paper, a novel Robust Gaussian Filtering (RGF) method is proposed for the characterisation of surface roughness for ultra-precision freeform surfaces with known mathematic model or a cloud of discrete points. A series of computer simulation and measurement experiments were conducted to verify the capability of the proposed method. The experimental results were found to agree well with the theoretical results

  3. Characterisation of carbon nanotubes in the context of toxicity studies

    Science.gov (United States)

    Berhanu, D.; Dybowska, A.; Misra, S.K.; Stanley, C.J.; Ruenraroengsak, P.; Boccaccini, A.R.; Tetley, T.D.; Luoma, S.N.; Plant, J.A.; Valsami-Jones, E.

    2009-01-01

    Nanotechnology has the potential to revolutionise our futures, but has also prompted concerns about the possibility that nanomaterials may harm humans or the biosphere. The unique properties of nanoparticles, that give them novel size dependent functionalities, may also have the potential to cause harm. Discrepancies in existing human health and environmental studies have shown the importance of good quality, well-characterized reference nanomaterials for toxicological studies. Here we make a case for the importance of the detailed characterization of nanoparticles, using several methods, particularly to allow the recognition of impurities and the presence of chemically identical but structurally distinct phases. Methods to characterise fully, commercially available multi-wall carbon nanotubes at different scales, are presented. ?? 2009 Berhanu et al; licensee BioMed Central Ltd.

  4. Characterisation, quantity and sorptive properties of microplastics extracted from cosmetics.

    Science.gov (United States)

    Napper, Imogen E; Bakir, Adil; Rowland, Steven J; Thompson, Richard C

    2015-10-15

    Cosmetic products, such as facial scrubs, have been identified as potentially important primary sources of microplastics to the marine environment. This study characterises, quantifies and then investigates the sorptive properties of plastic microbeads that are used as exfoliants in cosmetics. Polyethylene microbeads were extracted from several products, and shown to have a wide size range (mean diameters between 164 and 327 μm). We estimated that between 4594 and 94,500 microbeads could be released in a single use. To examine the potential for microbeads to accumulate and transport chemicals they were exposed to a binary mixture of (3)H-phenanthrene and (14)C-DDT in seawater. The potential for transport of sorbed chemicals by microbeads was broadly similar to that of polythene (PE) particles used in previous sorption studies. In conclusion, cosmetic exfoliants are a potentially important, yet preventable source of microplastic contamination in the marine environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Characterisation of the horse transcriptome from immunologically active tissues

    Directory of Open Access Journals (Sweden)

    Joanna Moreton

    2014-05-01

    Full Text Available The immune system of the horse has not been well studied, despite the fact that the horse displays several features such as sensitivity to bacterial lipopolysaccharide that make them in many ways a more suitable model of some human disorders than the current rodent models. The difficulty of working with large animal models has however limited characterisation of gene expression in the horse immune system with current annotations for the equine genome restricted to predictions from other mammals and the few described horse proteins. This paper outlines sequencing of 184 million transcriptome short reads from immunologically active tissues of three horses including the genome reference “Twilight”. In a comparison with the Ensembl horse genome annotation, we found 8,763 potentially novel isoforms.

  6. Chemical bath ZnSe thin films: deposition and characterisation

    Science.gov (United States)

    Lokhande, C. D.; Patil, P. S.; Ennaoui, A.; Tributsch, H.

    1998-01-01

    The zinc selenide (ZnSe) thin films have been deposited by a simple and inexpensive chemical bath deposition (CBD) method. The selenourea was used as a selenide ion source. The ZnSe films have been characterised by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDAX), Rutherford back scattering (RBS), and optical absorption. The as-deposited ZnSe films on various substrates are found to be amorphous and contain O2 and N2 in addition to Zn and Se. The optical band gap of the film is estimated to be 2.9 eV. The films are photoactive as evidenced by time resolved microwave conductivity (TRMC).

  7. Fabrication and Mechanical Characterisation of Titanium Lattices with Graded Porosity

    Directory of Open Access Journals (Sweden)

    William van Grunsven

    2014-08-01

    Full Text Available Electron Beam Melting (EBM is an Additive Manufacturing technique which can be used to fabricate complex structures from alloys such as Ti6Al4V, for example for orthopaedic applications. Here we describe the use of EBM for the fabrication of a novel Ti6Al4V structure of a regular diamond lattice incorporating graded porosity, achieved via changes in the strut cross section thickness. Scanning Electron Microscopy and micro computed tomography analysis confirmed that generally EBM reproduced the CAD design of the lattice well, although at smaller strut sizes the fabricated lattice produced thicker struts than the model. Mechanical characterisation of the lattice in uniaxial compression showed that its behaviour under compression along the direction of gradation can be predicted to good accuracy with a simple rule of mixtures approach, knowing the properties and the behaviour of its constituent layers.

  8. Geometrical Characterisation of Individual Fibres From X-Ray Tomograms

    DEFF Research Database (Denmark)

    Emerson, Monica Jane; Dahl, Vedrana Andersen; Mikkelsen, Lars Pilgaard

    2017-01-01

    We have developed an image analysis pipeline1 that can extract individual fibre tracksfrom low contrast X-ray tomograms of unidirectional composites with high fibre volumefraction. Measuring individual fibre tracks opens up the possibility of modelling thisempirical data in a statistical manner....... Thus, allowing to analyse the spatial distributionsof the parameters characterising the orientation and curvature of these individual fibres,which can also provide insights on the interactions amongst the individual fibres.Finite element models (FEMs) can be built from the extracted geometry...... to simulatethe performance of the scanned fibre structure under realistic conditions. Moreover, as-pects of the fibre architecture that inuence the macroscopic behaviour of the compositecan be quantified. Examples are 2D FEMs to predict the transverse stifiness or the quantification of fibre orientations...

  9. Characterisation of pixel sensor prototypes for the ALICE ITS upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Reidt, Felix [CERN (Switzerland); Physikalisches Institut, Universitaet Heidelberg (Germany); Collaboration: ALICE-Collaboration

    2014-07-01

    ALICE is preparing a major upgrade of its experimental apparatus to be installed in the second long LHC shutdown (LS2) in the years 2018-2019. A key element of the upgrade is the replacement of the Inner Tracking System (ITS) deploying Monolithic Active Pixel Sensors (MAPS). The upgraded ITS will have a reduced material budget while increasing the pixel density and readout rate capabilities. The novel design leads to higher pointing and momentum resolution as well as a p{sub T} acceptance extended to lower values. The corresponding sensor prototypes were qualified in laboratory measurements and beam tests with respect to their radiation tolerance and detection efficiency. This talk summarises recent results on the characterisation of prototypes belonging to the ALPIDE family.

  10. Characterisation of a fuel cell based uninteruptable power supply

    Energy Technology Data Exchange (ETDEWEB)

    Aklil, D.; Gazey, R.; McGrath, D.

    2004-07-01

    This report presents the findings of tests carried out to determine if a fuel cell (FC) could be used instead of external batteries in UPS systems. Details are given of the configuration of the 1kW fuel cell based test UPS system (FC-UPS), fuel cell suitability for UPS, the start-up conditions, the on-load dynamic response, comparative weight/space savings of FC-UPS, lifetime costs compared to battery installations, and market readiness of FC systems for UPS deployment. The importance of the collaboration between the FC manufacturers and system integrator for the implementation of the project and of the testing and characterisation of FC products is stressed.

  11. Methods for High-throughput Characterisation of Environmental DNA

    DEFF Research Database (Denmark)

    Andersen, Kenneth

    This PhD thesis examines the potential of describing biodiversity of green plants (Viridiplantae), birds (Aves) and mammals (Mammalia), in the context of next-generation sequencing, from the DNA that all organisms segregate into the environment (eDNA). The research is based on case studies...... of species assemblages described by eDNA recovered from contemporary surface soil and Holocene sediment sequences, to assess the accuracy and limitations of the approach. Biodiversity incorporates two aspects of ecological communities, including both the taxonomic richness and abundance of individual taxa...... inhibition. In chapter four, alternative DNA extraction protocols and pipelines for characterising plant eDNA are tested on samples from contrasting environments including modern, Holocene and Pleistocene sediment samples. These results are compared to pollen and macrofossil records described from earlier...

  12. Microstructural characterisation of Inconel 718 gas tungsten arc welds

    International Nuclear Information System (INIS)

    Ram, G.D.J.; Reddy, A.V.; Rao, K.P.

    2005-01-01

    The presence of Nb-rich, brittle, intermetallic Laves phase in Inconel 718 weld fusion zones is detrimental to weld mechanical properties. In the current work, autogenous bead-on-plate gas tungsten-arc welds were deposited in 2 mm thick IN 718 sheets. The welds were subjected to the following heat treatments: i) direct aging, ii) solution treatment at 980 C followed by aging, and iii) solution treatment at 1080 C followed by aging. Detailed microstructural characterisation was carried out using optical, scanning electron and transmission electron microscopes and electron probe microanalysis. The microstructural features in as-welded and post-weld heat treated conditions are discussed. The results show that post-weld heat treatments alone cannot provide satisfactory solution to the Laves problem in Inconel 718 gas tungsten-arc welds

  13. Spectroscopic characterisation of an atmospheric pressure glow discharge

    International Nuclear Information System (INIS)

    Gomez, S.; Steen, P.G.; Morrow, T.; Graham, W.G.

    2001-01-01

    Recently there has been considerable interest in atmospheric discharges operating in a glow discharge mode i.e. with a spatial and sheath structure similar to that of low pressure glow discharges. Here spectroscopy has been used to characterise an atmospheric pressure glow discharge (APGD), operating with either dry air, argon or helium gas flowing through the inter-electrode space and with the inter-electrode gap either free or with woven polypropylene or polyester samples present. Emission spectroscopy is used to determine the rotational and vibrational temperature of the nitrogen gas, while electron temperatures are determined from the relative intensities of Ar emission lines. Ozone production is monitored by a simple absorption technique to evaluate its potential in process control

  14. Design and characterisation of a pulsed neutron interrogation facility

    International Nuclear Information System (INIS)

    Favalli, A.; Pedersen, B.

    2007-01-01

    The Joint Research Centre recently obtained a license to operate a new experimental device intended for research in the field of nuclear safeguards. The research projects currently being planned for the new device includes mass determination of fissile materials in matrices and detection of contraband non-nuclear materials. The device incorporates a commercial pulsed neutron generator and a large graphite mantle surrounding the sample cavity. In this configuration, a relatively high thermal neutron flux with a long lifetime is achieved inside the sample cavity. By pulsing the neutron generator, a sample may be interrogated by a pure thermal neutron flux during repeated time periods. The paper reports on the design of the new device and the pulsed fast and thermal neutron source. The thermal neutron flux caused by the neutron generator and the graphite structure has been characterised by foil activation, fission chamber and 3 He proportional counter measurements. (authors)

  15. Biophysical characterisation of GlycoPEGylated recombinant human factor VIIa

    DEFF Research Database (Denmark)

    Plesner, Bitten; Westh, Peter; Nielsen, Anders D.

    2011-01-01

    The effects of GlycoPEGylation on the structural, kinetic and thermal stability of recombinant human FVIIa were investigated using rFVIIa and linear 10 kDa and branched 40 kDa GlycoPEGylated® recombinant human FVIIa derivatives. The secondary and tertiary structure of rFVIIa measured by circular...... dichroism (CD) was maintained upon PEGylation. In contrast, the thermal and kinetic stability of rFVIIa was affected by GlycoPEGylation, as the apparent unfolding temperature Tm measured by differential scanning calorimetry (DSC) and the temperature of aggregation, Tagg, measured by light scattering (LS......) both increased with GlycoPEGylation. Both Tm and Tagg were independent of the molecular weight and the shape of the PEG chain. From the present biophysical characterisation it is concluded that after GlycoPEGylation, rFVIIa appears to be unaffected structurally (secondary and tertiary structure...

  16. Molecular characterisation of sinonasal carcinomas and their clinical implications.

    Science.gov (United States)

    López, Fernando; Llorente, José Luis; Costales, María; García-Inclán, Cristina; Pérez-Escuredo, Jhudit; Alvarez-Marcos, César; Hermsen, Mario; Suárez, Carlos

    2013-01-01

    Sinonasal carcinomas are rare tumours with an unfavourable prognosis whose management is difficult and complex, leading to high morbidity and mortality despite improvements in the field of surgery and radiotherapy. An elevated number of these tumours can be attributed to occupational exposure. In comparison with other head and neck malignancies, studies of molecular changes in these tumours are infrequent. This review was focused on findings about the epidemiology and molecular and phenotypic characterisation of sinonasal carcinomas, which can potentially be useful for diagnosis and treatment. The increasing knowledge about the molecular biology that underlies their carcinogenesis may help to identify precursor lesions, prognostic markers and markers that predict chemoradiotherapy response and, finally, to identify potential molecular targets that will expand treatment options. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  17. Hydraulic characterisation of karst systems with man-made tracers

    International Nuclear Information System (INIS)

    Werner, A.

    1998-01-01

    Tracer experiments using man-made tracers are common in hydrogeological exploration of groundwater aquifers in karst systems. In the present investigation, a convection-dispersion model (multidispersion model with consideration of several flow paths) and a single-cleft model (consideration of the diffusion between the cleft and the surrounding rock matrix) were used for evaluating tracer experiments in the main hydrological system of the saturated zone of karst systems. In addition to these extended analytical solutions, a numerical transport model was developed for investigating the influence of the transient flow rate on the flow and transport parameters. Comparative evaluations of the model approaches for the evaluation of tracer experiments were made in four different karst systems: Danube-Aach, Paderborn, Slowenia and Lurbach, of which the Danube-Aach system was considered as the most important. The investigation also comprised three supplementary experiments in order to enable a complete hydraulic characterisation of the system. (orig./SR) [de

  18. A chemometric approach to the characterisation of historical mortars

    International Nuclear Information System (INIS)

    Rampazzi, L.; Pozzi, A.; Sansonetti, A.; Toniolo, L.; Giussani, B.

    2006-01-01

    The compositional knowledge of historical mortars is of great concern in case of provenance and dating investigations and of conservation works since the nature of the raw materials suggests the most compatible conservation products. The classic characterisation usually goes through various analytical determinations, while conservation laboratories call for simple and quick analyses able to enlighten the nature of mortars, usually in terms of the binder fraction. A chemometric approach to the matter is here undertaken. Specimens of mortars were prepared with calcitic and dolomitic binders and analysed by Atomic Spectroscopy. Principal Components Analysis (PCA) was used to investigate the features of specimens and samples. A Partial Least Square (PLS1) regression was done in order to predict the binder/aggregate ratio. The model was applied to historical mortars from the churches of St. Lorenzo (Milan) and St. Abbondio (Como). The accordance between the predictive model and the real samples is discussed

  19. A mechanical characterisation on multiple timescales of electroconductive magnetorheological elastomers

    Science.gov (United States)

    Schümann, M.; Morich, J.; Kaufhold, T.; Böhm, V.; Zimmermann, K.; Odenbach, S.

    2018-05-01

    Magnetorheological elastomers are a type of smart hybrid material which combines elastic properties of a soft elastomer matrix with magnetic properties of magnetic micro particles. This leads to a material with magnetically controllable mechanical properties of which the magnetorheological effect is the best known. The addition of electroconductive particles to the polymer mix adds electrical properties to the material behaviour. The resulting electrical resistance of the sample can be manipulated by external magnetic fields and mechanical loads. This results in a distinct interplay of mechanical, electrical and magnetic effects with a highly complex time behaviour. In this paper a mechanical characterisation on multiple time scales was conducted to get an insight on the short and long-term electrical and mechanical behaviour of this novel material. The results show a complex resistivity behaviour on several timescales, sensitive to magnetic fields and strain velocity. The observed material exhibits fatigue and relaxation behaviour, whereas the magnetorheological effect appears not to interfere with the piezoresistive properties.

  20. Drought Characterisation Using Ground and Remote Sensing Data

    Science.gov (United States)

    Hore, Sudipta Kumar; Werner, Micha; Maskey, Shreedhar

    2016-04-01

    The North-West of Bangladesh is frequently affected by drought, which may have profound impacts to different water related sectors. The characterisation and identification of drought is, however, challenging. Despite several standard drought indices being available it is important that indicators proposed in support of an effective drought management are related to the impacts drought may have. In this study we present the characterisation of drought in the districts of Rajshahi and Rangpur in North-Western Bangladesh. Drought indicators were developed using available temperature, precipitation, river discharge and groundwater level data, as well as from remotely sensed NDVI data. We compare these indicators to records of drought impacts to agriculture, fisheries and migration collected from relevant organisations, as well as through interviews with key stakeholders, key informants, and community leaders. The analysis shows that droughts occur frequently, with nine occurrences in the last 42 years, as found using common meteorological drought indicators. NDVI data corroborated these events, despite being only available from 2001. The agricultural sector was adversely impacted in all events, with impacts correlated to drought severity. Impacts to the fisheries sector were, however, reported only three times, though impacts to fisheries are less well recorded. Interestingly, the good relationship between meteorological drought indicators and agricultural impacts weakens in the last decade. This appears to be due to the intensification of irrigation using groundwater, with the declining groundwater levels found in Rajshahi district suggesting overexploitation of the resource, and the increasing importance of groundwater drought indicators. The study reveals the drought indicators that are important to the agriculture and fisheries sectors, and also tentative threshold values at which drought start to impact these sectors. Such sector relevant drought indicators, as

  1. Characterisation of the hydrology of an estuarine wetland

    Science.gov (United States)

    Hughes, Catherine E.; Binning, Philip; Willgoose, Garry R.

    1998-11-01

    The intertidal zone of estuarine wetlands is characterised by a transition from a saline marine environment to a freshwater environment with increasing distance from tidal streams. An experimental site has been established in an area of mangrove and salt marsh wetland in the Hunter River estuary, Australia, to characterise and provide data for a model of intertidal zone hydrology. The experimental site is designed to monitor water fluxes at a small scale (36 m). A weather station and groundwater monitoring wells have been installed and hydraulic head and tidal levels are monitored over a 10-week period along a short one-dimensional transect covering the transition between the tidal and freshwater systems. Soil properties have been determined in the laboratory and the field. A two-dimensional finite element model of the site was developed using SEEP/W to analyse saturated and unsaturated pore water movement. Modification of the water retention function to model crab hole macropores was found necessary to reproduce the observed aquifer response. Groundwater response to tidal fluctuations was observed to be almost uniform beyond the intertidal zone, due to the presence of highly permeable subsurface sediments below the less permeable surface sediments. Over the 36 m transect, tidal forcing was found to generate incoming fluxes in the order of 0.22 m 3/day per metre width of creek bank during dry periods, partially balanced by evaporative fluxes of about 0.13 m 3/day per metre width. During heavy rainfall periods, rainfall fluxes were about 0.61 m 3/day per metre width, dominating the water balance. Evapotranspiration rates were greater for the salt marsh dominated intertidal zone than the non-tidal zone. Hypersalinity and salt encrustation observed show that evapotranspiration fluxes are very important during non-rainfall periods and are believed to significantly influence salt concentration both in the surface soil matrix and the underlying aquifer.

  2. Fertiliser characterisation: Major, trace and rare earth elements

    International Nuclear Information System (INIS)

    Otero, N.; Vitoria, L.; Soler, A.; Canals, A.

    2005-01-01

    In recent years, there has been increasing concern regarding the chemical impact of agricultural activities on the environment so it is necessary to identify contaminants, and/or characterise the sources of contamination. In this study, a comprehensive chemical characterisation of 27 fertilisers of different types used in Spain has been conducted; major, minor and trace elements were determined, including rare earth elements. Results show that compound fertilisers used for fertigation or foliar application have low content of heavy metals, whereas fertilisers used for basal and top dressing have the highest content of both REE and other heavy metals. REE patterns of fertilisers have been determined in order for them to be used as tracers of fertilisers in future environmental studies. Furthermore in this work REE patterns of fertilisers are used as tracers of the source of phosphate in compound fertilisers, distinguishing between phosphorite and carbonatite derived fertilisers. Fertilisers from carbonatites have higher contents of REE, Sr, Ba and Th whereas fertilisers from phosphorites have higher contents of metals of environmental concern, such as Cd, U and As; and the sum of the heavy metals is higher. Some of the analysed fertilisers have Cd concentrations that exceed maximum values established in some countries and can be expected to produce long-term soil accumulation. Furthermore, other elements such as U, As and Cr are 10-50 times higher in concentration than those of Cd, but there is no legislation regarding them, therefore it is necessary to regulate fertiliser compositions in order to achieve environmental protection of soils and waters

  3. Biochemical and biomechanical characterisation of equine cervical facet joint cartilage.

    Science.gov (United States)

    O'Leary, S A; White, J L; Hu, J C; Athanasiou, K A

    2018-04-15

    The equine cervical facet joint is a site of significant pathology. Located bilaterally on the dorsal spine, these diarthrodial joints work in conjunction with the intervertebral disc to facilitate appropriate spinal motion. Despite the high prevalence of pathology in this joint, the facet joint is understudied and thus lacking in viable treatment options. The goal of this study was to characterise equine facet joint cartilage and provide a comprehensive database describing the morphological, histological, biochemical and biomechanical properties of this tissue. Descriptive cadaver studies. A total of 132 facet joint surfaces were harvested from the cervical spines of six skeletally mature horses (11 surfaces per animal) for compiling biomechanical and biochemical properties of hyaline cartilage of the equine cervical facet joints. Gross morphometric measurements and histological staining were performed on facet joint cartilage. Creep indentation and uniaxial strain-to-failure testing were used to determine the biomechanical compressive and tensile properties. Biochemical assays included quantification of total collagen, sulfated glycosaminoglycan and DNA content. The facet joint surfaces were ovoid in shape with a flat articular surface. Histological analyses highlighted structures akin to articular cartilage of other synovial joints. In general, biomechanical and biochemical properties did not differ significantly between the inferior and superior joint surfaces as well as among spinal levels. Interestingly, compressive and tensile properties of cervical facet articular cartilage were lower than those of articular cartilage from other previously characterised equine joints. Removal of the superficial zone reduced the tissue's tensile strength, suggesting that this zone is important for the tensile integrity of the tissue. Facet surfaces were sampled at a single, central location and do not capture the potential topographic variation in cartilage properties. This

  4. Characterising Wildlife Trade Market Supply-Demand Dynamics

    Science.gov (United States)

    Rowcliffe, M.; Cowlishaw, G.; Alexander, J. S.; Ntiamoa-Baidu, Y.; Brenya, A.; Milner-Gulland, E. J.

    2016-01-01

    The trade in wildlife products can represent an important source of income for poor people, but also threaten wildlife locally, regionally and internationally. Bushmeat provides livelihoods for hunters, traders and sellers, protein to rural and urban consumers, and has depleted the populations of many tropical forest species. Management interventions can be targeted towards the consumers or suppliers of wildlife products. There has been a general assumption in the bushmeat literature that the urban trade is driven by consumer demand with hunters simply fulfilling this demand. Using the urban bushmeat trade in the city of Kumasi, Ghana, as a case study, we use a range of datasets to explore the processes driving the urban bushmeat trade. We characterise the nature of supply and demand by explicitly considering three market attributes: resource condition, hunter behaviour, and consumer behaviour. Our results suggest that bushmeat resources around Kumasi are becoming increasingly depleted and are unable to meet demand, that hunters move in and out of the trade independently of price signals generated by the market, and that, for the Kumasi bushmeat system, consumption levels are driven not by consumer choice but by shortfalls in supply and consequent price responses. Together, these results indicate that supply-side processes dominate the urban bushmeat trade in Kumasi. This suggests that future management interventions should focus on changing hunter behaviour, although complementary interventions targeting consumer demand are also likely to be necessary in the long term. Our approach represents a structured and repeatable method to assessing market dynamics in information-poor systems. The findings serve as a caution against assuming that wildlife markets are demand driven, and highlight the value of characterising market dynamics to inform appropriate management. PMID:27632169

  5. CHARACTERISING VEGETATED SURFACES USING MODIS MULTIANGULAR SATELLITE DATA

    Directory of Open Access Journals (Sweden)

    G. McCamley

    2012-07-01

    Full Text Available Bidirectional Reflectance Distribution Functions (BRDF seek to represent variations in surface reflectance resulting from changes in a satellite's view and solar illumination angles. BRDF representations have been widely used to assist in the characterisation of vegetation. However BRDF effects are often noisy, difficult to interpret and are the spatial integral of all the individual surface features present in a pixel. This paper describes the results of an approach to understanding how BRDF effects can be used to characterise vegetation. The implementation of the Ross Thick Li Sparse BRDF model using MODIS is a stable, mature data product with a 10 year history and is a ready data source. Using this dataset, a geometric optical model is proposed that seeks to interpret the BRDF effects in terms of Normalised Difference Vegetation Index (NDVI and a height-to-width ratio of the vegetation components. The height-to-width ratio derived from this model seeks to represent the dependence of NDVI to changes in view zenith angle as a single numeric value. The model proposed within this paper has been applied to MODIS pixels in central Australia for areas in excess of 18,000 km2. The study area is predominantly arid and sparsely vegetated which provides a level of temporal and spatial homogeneity. The selected study area also minimises the effects associated with mutual obscuration of vegetation which is not considered by the model. The results are represented as a map and compared to NDVI derived from MODIS and NDVI derived from Landsat mosaics developed for Australia's National Carbon Accounting System (NCAS. The model reveals additional information not obvious in reflectance data. For example, the height-to-width ratio is able to reveal vegetation features in arid areas that do not have an accompanying significant increase in NDVI derived from MODIS, i.e. the height-to-width ratio reveals vegetation which is otherwise only apparent in NDVI derived

  6. Dynamic characterisation of the specific surface area for fracture networks

    Science.gov (United States)

    Cvetkovic, V.

    2017-12-01

    One important application of chemical transport is geological disposal of high-level nuclear waste for which crystalline rock is a prime candidate for instance in Scandinavia. Interconnected heterogeneous fractures of sparsely fractured rock such as granite, act as conduits for transport of dissolved tracers. Fluid flow is known to be highly channelized in such rocks. Channels imply narrow flow paths, adjacent to essentially stagnant water in the fracture and/or the rock matrix. Tracers are transported along channelised flow paths and retained by minerals and/or stagnant water, depending on their sorption properties; this mechanism is critical for rocks to act as a barrier and ultimately provide safety for a geological repository. The sorbing tracers are retained by diffusion and sorption on mineral surfaces, whereas non-sorbing tracers can be retained only by diffusion into stagnant water of fractures. The retention and transport properties of a sparsely fractured rock will primarily depend on the specific surface area (SSA) of the fracture network which is determined by the heterogeneous structure and flow. The main challenge when characterising SSA on the field-scale is its dependence on the flow dynamics. We first define SSA as a physical quantity and clarify its importance for chemical transport. A methodology for dynamic characterisation of SSA in fracture networks is proposed that relies on three sets of data: i) Flow rate data as obtained by a flow logging procedure; ii) transmissivity data as obtained by pumping tests; iii) fracture network data as obtained from outcrop and geophysical observations. The proposed methodology utilises these data directly as well as indirectly through flow and particle tracking simulations in three-dimensional discrete fracture networks. The methodology is exemplified using specific data from the Swedish site Laxemar. The potential impact of uncertainties is of particular significance and is illustrated for radionuclide

  7. X-rays characterisation of thermal sprayed bioceramics and composites

    International Nuclear Information System (INIS)

    Khor, K.A.; Cheang, P.; White, T.

    2000-01-01

    Materials characterization using x-rays plays an important role in the ongoing endeavour to develop superior materials for biomedical devices. Current emphasis on biomaterials worldwide has highlighted the prominence of materials in successful implementation of implants to improve the quality of human lives. A clear example can be seen in the artificial hip implant where a layer of bioactive material, hydroxyapatite (HA), drastically aids the pain during the post-operation recovery process. Thermal spray is a process whereby powders are injected into a high temperature flame. Instantaneous melting takes place and the molten droplets are projected at a very high velocities onto a suitably prepared substrate. The adoption of this process by most biomedical companies manufacturing artificial hip implants is based on the efficacy of the process and the economic benefits such as high production rate and relatively low installation cost. However, material decomposition often occurs in the high temperature environment of thermal spray. Subsequent development of proper process parameters, customised powder characteristics and better process control nonetheless help mitigate this effect. A constant demand in the escalating usage of biomaterials in human body is reliability. Implants should preferably remain in the body for at least 5-10 years with minimal occurrences of revision. To ensure an acceptable level of reliability, materials characterisation is needed at practically every stage of its development and manufacture. The role that x-rays play in biomaterials development can be categorised as: (1) phase identification and structural determination and (2) chemical analysis. This paper will present the characterisation of biomaterials using x-rays in the development of new generation of biomaterials and composites that posses superior properties than the present group of materials. Specifically, this paper will highlight the problems encountered in phase identification

  8. A distinctive patchy osteomalacia characterises Phospho1-deficient mice.

    Science.gov (United States)

    Boyde, Alan; Staines, Katherine A; Javaheri, Behzad; Millan, Jose Luis; Pitsillides, Andrew A; Farquharson, Colin

    2017-08-01

    The phosphatase PHOSPHO1 is involved in the initiation of biomineralisation. Bones in Phospho1 knockout (KO) mice show histological osteomalacia with frequent bowing of long bones and spontaneous fractures: they contain less mineral, with smaller mineral crystals. However, the consequences of Phospho1 ablation on the microscale structure of bone are not yet fully elucidated. Tibias and femurs obtained from wild-type and Phospho1 null (KO) mice (25-32 weeks old) were embedded in PMMA, cut and polished to produce near longitudinal sections. Block surfaces were studied using 20 kV backscattered-electron (BSE) imaging, and again after iodine staining to reveal non-mineralised matrix and cellular components. For 3D characterisation, we used X-ray micro-tomography. Bones opened with carbide milling tools to expose endosteal surfaces were macerated using an alkaline bacterial pronase enzyme detergent, 5% hydrogen peroxide and 7% sodium hypochlorite solutions to produce 3D surfaces for study with 3D BSE scanning electron microscopy (SEM). Extensive regions of both compact cortical and trabecular bone matrix in Phospho1 KO mice contained no significant mineral and/or showed arrested mineralisation fronts, characterised by a failure in the fusion of the calcospherite-like, separately mineralising, individual micro-volumes within bone. Osteoclastic resorption of the uncalcified matrix in Phospho1 KO mice was attenuated compared with surrounding normally mineralised bone. The extent and position of this aberrant biomineralisation varied considerably between animals, contralateral limbs and anatomical sites. The most frequent manifestation lay, however, in the nearly complete failure of mineralisation in the bone surrounding the numerous transverse blood vessel canals in the cortices. In conclusion, SEM disclosed defective mineralising fronts and extensive patchy osteomalacia, which has previously not been recognised. These data further confirm the role of this phosphatase

  9. Against Logical Form

    Directory of Open Access Journals (Sweden)

    P N Johnson-Laird

    2010-10-01

    Full Text Available An old view in logic going back to Aristotle is that an inference is valid in virtue of its logical form. Many psychologists have adopted the same point of view about human reasoning: the first step is to recover the logical form of an inference, and the second step is to apply rules of inference that match these forms in order to prove that the conclusion follows from the premises. The present paper argues against this idea. The logical form of an inference transcends the grammatical forms of the sentences used to express it, because logical form also depends on context. Context is not readily expressed in additional premises. And the recovery of logical form leads ineluctably to the need for infinitely many axioms to capture the logical properties of relations. An alternative theory is that reasoning depends on mental models, and this theory obviates the need to recover logical form.

  10. Forms of Arthritis

    Science.gov (United States)

    ... this page please turn Javascript on. Forms of Arthritis Past Issues / Fall 2006 Table of Contents Today, ... of Linda Saisselin Osteoarthritis (OA) — the form of arthritis typically occurring during middle or old age, this ...

  11. Forms Management Policy

    Science.gov (United States)

    To establish EPA’s Forms Management Program; to describe the requisite roles, responsibilities, and procedures necessary for the successful management of EPA forms; and to more clearly fulfill EPA’s obligations in this regard.

  12. The human dopamine transporter forms a tetramer in the plasma membrane: cross-linking of a cysteine in the fourth transmembrane segment is sensitive to cocaine analogs.

    Science.gov (United States)

    Hastrup, Hanne; Sen, Namita; Javitch, Jonathan A

    2003-11-14

    Using cysteine cross-linking, we demonstrated previously that the dopamine transporter (DAT) is at least a homodimer, with the extracellular end of transmembrane segment (TM) 6 at a symmetrical dimer interface. We have now explored the possibility that DAT exists as a higher order oligomer in the plasma membrane. Cysteine cross-linking of wild type DAT resulted in bands on SDS-PAGE consistent with dimer, trimer, and tetramer, suggesting that DAT forms a tetramer in the plasma membrane. A cysteine-depleted DAT (CD-DAT) into which only Cys243 or Cys306 was reintroduced was cross-linked to dimer, suggesting that these endogenous cysteines in TM4 and TM6, respectively, were cross-linked at a symmetrical dimer interface. Reintroduction of both Cys243 and Cys306 into CD-DAT led to a pattern of cross-linking indistinguishable from that of wild type, with dimer, trimer, and tetramer bands. This indicated that the TM4 interface and the TM6 interface are distinct and further suggested that DAT may exist in the plasma membrane as a dimer of dimers, with two symmetrical homodimer interfaces. The cocaine analog MFZ 2-12 and other DAT inhibitors, including benztropine and mazindol, protected Cys243 against cross-linking. In contrast, two substrates of DAT, dopamine and tyramine, did not significantly impact cross-linking. We propose that the impairment of cross-linking produced by the inhibitors results from a conformational change at the TM4 interface, further demonstrating that these compounds are not neutral blockers but by themselves have effects on the structure of the transporter.

  13. FORMS OF YOUTH TRAVEL

    OpenAIRE

    Moisã Claudia Olimpia; Moisã Claudia Olimpia

    2011-01-01

    Taking into account the suite of motivation that youth has when practicing tourism, it can be said that the youth travel takes highly diverse forms. These forms are educational tourism, volunteer programs and “work and travel”, cultural exchanges or sports tourism and adventure travel. In this article, we identified and analyzed in detail the main forms of youth travel both internationally and in Romania. We also illustrated for each form of tourism the specific tourism products targeting you...

  14. Unified form language

    DEFF Research Database (Denmark)

    Alnæs, Martin S.; Logg, Anders; Ølgaard, Kristian Breum

    2014-01-01

    We present the Unied Form Language (UFL), which is a domain-specic language for representing weak formulations of partial dierential equations with a view to numerical approximation. Features of UFL include support for variational forms and functionals, automatic dierentiation of forms and expres...... libraries to generate concrete low-level implementations. Some application examples are presented and libraries that support UFL are highlighted....

  15. Method for forming ammonia

    Science.gov (United States)

    Kong, Peter C.; Pink, Robert J.; Zuck, Larry D.

    2008-08-19

    A method for forming ammonia is disclosed and which includes the steps of forming a plasma; providing a source of metal particles, and supplying the metal particles to the plasma to form metal nitride particles; and providing a substance, and reacting the metal nitride particles with the substance to produce ammonia, and an oxide byproduct.

  16. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  17. Characterisation of bacteria by matrix-assisted laser desorption/ionisation and electrospray mass spectrometry

    NARCIS (Netherlands)

    Baar, B.L.M. van

    2000-01-01

    Chemical analysis for the characterisation of micro-organisms is rapidly evolving, after the recent advent of new ionisation methods in mass spectrometry (MS): electrospray (ES) and matrix-assisted laser desorption/ionisation (MALDI). These methods allow quick characterisation of micro-organisms,

  18. Combined rock-physical modelling and seismic inversion techniques for characterisation of stacked sandstone reservoir

    NARCIS (Netherlands)

    Justiniano, A.; Jaya, Y.; Diephuis, G.; Veenhof, R.; Pringle, T.

    2015-01-01

    The objective of the study is to characterise the Triassic massive stacked sandstone deposits of the Main Buntsandstein Subgroup at Block Q16 located in the West Netherlands Basin. The characterisation was carried out through combining rock-physics modelling and seismic inversion techniques. The

  19. Derivation and characterisation of hESC lines from supernumerary embryos, experience from Odense, Denmark

    DEFF Research Database (Denmark)

    Harkness, Linda; Rasmussen, Iben Anne; Erb, Karin

    2010-01-01

    The derivation and characterisation of human embryonic stem cells provides a source of pluripotent stem cells with potential for clinical applications. Utilising locally sourced embryos from two IVF clinics, we derived and characterised five new cell lines for use in a non-clinical setting. Analy...

  20. Characterising the disintegration properties of tablets in opaque media using texture analysis

    OpenAIRE

    Scheuerle, Rebekah L.; Gerrard, Stephen E.; Kendall, Richard A.; Tuleu, Catherine; Slater, Nigel K.H.; Mahbubani, Krishnaa T.

    2015-01-01

    Tablet disintegration characterisation is used in pharmaceutical research, development, and quality control. Standard methods used to characterise tablet disintegration are often dependent on visual observation in measurement of disintegration times. This presents a challenge for disintegration studies of tablets in opaque, physiologically relevant media that could be useful for tablet formulation optimisation. In this study is explored an application of texture analysis disintegration testin...

  1. Size characterisation of noble-metal nano-crystals formed in sapphire by ion irradiation and subsequent thermal annealing

    Energy Technology Data Exchange (ETDEWEB)

    Mota-Santiago, Pablo-Ernesto [Instituto de Fisica, Universidad Nacional Autonoma de Mexico A.P. 20-364 01000 Mexico D.F. (Mexico); Crespo-Sosa, Alejandro, E-mail: crespo@fisica.unam.mx [Instituto de Fisica, Universidad Nacional Autonoma de Mexico A.P. 20-364 01000 Mexico D.F. (Mexico); Jimenez-Hernandez, Jose-Luis; Silva-Pereyra, Hector-Gabriel; Reyes-Esqueda, Jorge-Alejandro; Oliver, Alicia [Instituto de Fisica, Universidad Nacional Autonoma de Mexico A.P. 20-364 01000 Mexico D.F. (Mexico)

    2012-10-15

    Highlights: Black-Right-Pointing-Pointer Systematic study on the formation of Ag and Au nano-particles in Al{sub 2}O{sub 3}. Black-Right-Pointing-Pointer Annealing in a reducing atmosphere, below the metal melting point is more suitable. Black-Right-Pointing-Pointer Au nano-particles grow up to 15 nm and Ag nano-particles up to 45 nm in radius. Black-Right-Pointing-Pointer Ostwald ripening is the mechanism responsible for the formation of large nanoparticles. Black-Right-Pointing-Pointer Optical properties of metallic nano-particles in Al{sub 2}O{sub 3} can be related to their size. - Abstract: Metallic nano-particles embedded in transparent dielectrics are very important for new technological applications because of their unique optical properties. These properties depend strongly on the size and shape of the nano-particles. In order to achieve the synthesis of metallic nano-particles it has been used the technique of ion implantation. This is a very common technique because it allows the control of the depth and concentration of the metallic ions inside the sample, limited mostly by straggling, without introducing other contaminant agents. The purpose of this work was to measure the size of the nano-particles grown under different conditions in Sapphire and its size evolution during the growth process. To achieve this goal, {alpha}-Al{sub 2}O{sub 3} single crystals were implanted with Ag or Au ions at room temperature with different fluences (from 2 Multiplication-Sign 10{sup 16} ions/cm{sup 2} to 8 Multiplication-Sign 10{sup 16} ions/cm{sup 2}). Afterwards, the samples were annealed at different temperatures (from 600 Degree-Sign C to 1100 Degree-Sign C) in oxidising, reducing, Ar or N{sub 2} atmospheres. We measured the ion depth profile by Rutherford Backscattering Spectroscopy (RBS) and the nano-crystals size distribution by using two methods, the surface plasmon resonance in the optical extinction spectrum and the Transmission Electron Microscopy (TEM).

  2. Readout and characterisation of new silicon pixel photodiode array for use in PET

    International Nuclear Information System (INIS)

    Hooper, P.; Ward, G.; Lerch, R.; Rozenfeld, A.

    2002-01-01

    Full text: Positron emission tomography (PET) is a functional imaging tool, which is able to quantify physiological, and biochemical processes in vivo using short-lived cyclotron-produced radiotracers. The main physical principle of PET is the simultaneous measurement of two 511 keV photons which are emitted in opposite directions following the annihilation of a positron in tissue. The accuracy of tracking these photons determines the accuracy of localising the radiotracer in the body, which is referred to as the spatial resolution of the system. Compared with conventional single photon imaging with gamma cameras, PET provides superior spatial resolution and sensitivity. However, compared with anatomical imaging techniques, the spatial resolution remains relatively poor at approximately 4-6 mm full width at half maximum (FWHM), compared with 1 mm FWHM for MRI. The Centre for Medical Radiation Physics at the University of Wollongong is developing a new Positron Emission Tomography (PET) detection sub-module that will significantly improve the spatial resolution of PET. The new sub-module design is simple and robust to minimise module assembly complications and is completely independent of photomultiplier tubes. The new sub-module has also been designed to maximise its flexibility for easy sub-module coupling so as to form a complete, customised, detection module to be used in PET scanners dedicated to human brain and breast, and small animal studies. A new computer controlled gantry allows the system to be used for PET and SPECT applications. Silicon 8x8 detector arrays have been developed by CMRP and will be optically coupled scintillation crystals and readout using the VIKING tM hybrid preamplifier chip to form the basis of the new module Characterisation of the pixel photodiode array has been performed to check the uniformity of the response of the array. This characterisation has been done using a pulsed, near infra-red laser diode system and alpha particles

  3. Simplified fate modelling in respect to ecotoxicological and human toxicological characterisation of emissions of chemical compounds

    DEFF Research Database (Denmark)

    Birkved, Morten; Heijungs, Reinout

    2011-01-01

    The impact assessment of chemical compounds in Life Cycle Impact Assessment (LCIA) and Environmental Risk Assessment (ERA) requires a vast amount of data on the properties of the chemical compounds being assessed. The purpose of the present study is to explore statistical options for reduction...... of the data demand associated with characterisation of chemical emissions in LCIA and ERA.Based on a USEtox™ characterisation factor set consisting of 3,073 data records, multi-dimensional bilinear models for emission compartment specific fate characterisation of chemical emissions were derived by application...... the independent chemical input parameters from the minimum data set, needed for characterisation in USEtox™, according to general availability, importance and relevance for fate factor prediction.Each approach (63% and 75% of the minimum data set needed for characterisation in USEtox™) yielded 66 meta...

  4. The functionalities of the Darwin radioactivity calculation form and the radiation protection studies

    International Nuclear Information System (INIS)

    Tsilanizara, A.; Huynh, T.D.; Luneville, L.; Diop, C.M.; Eid, M.

    2003-01-01

    The characterisation of the radioactive sources relative to the evolution of nuclear fuels or to the activation under particles flux (generally neutrons) of structures of a nuclear equipment or a simple isotope decay is a step in the radiation protection studies. This characterisation needs to know a fundamental knowledge: the radionuclides concentration. This one changes with time, and follows the coupled differential equations of first order in time, the generalised Bateman equations. The objective of this paper is to present the functionalities of the Darwin form, developed by the Cea and dedicated to the study of radioactivity. (N.C.)

  5. Three molecular forms of atrial natriuretic peptides: quantitative analysis and biological characterization.

    Science.gov (United States)

    Nagai-Okatani, Chiaki; Kangawa, Kenji; Minamino, Naoto

    2017-07-01

    Atrial natriuretic peptide (ANP) is primarily produced in the heart tissue and plays a pivotal role in maintaining cardiovascular homeostasis in endocrine and autocrine/paracrine systems and has clinical applications as a biomarker and a therapeutic agent for cardiac diseases. ANP is synthesized by atrial cardiomyocytes as a preprohormone that is processed by a signal peptidase and stored in secretory granules as a prohormone. Subsequent proteolytic processing of ANP by corin during the secretion process results in a bioactive form consisting of 28 amino acid residues. Mechanical stretch of the atrial wall and multiple humoral factors directly stimulates the transcription and secretion of ANP. Secreted ANP elicits natriuretic and diuretic effects via cyclic guanosine monophosphate produced through binding to the guanylyl cyclase-A/natriuretic peptide receptor-A. Circulating ANP is subjected to rapid clearance by a natriuretic peptide receptor-C-mediated mechanism and proteolytic degradation by neutral endopeptidase. In humans, ANP is present as three endogenous molecular forms: bioactive α-ANP, a homodimer of α-ANP designated as β-ANP, and an ANP precursor designated as proANP (also referred to as γ-ANP). The proANP and especially β-ANP, as minor forms in circulation, are notably increased in patients with cardiac diseases, suggesting the utility of monitoring the pathophysiological conditions that result in abnormal proANP processing that cannot be monitored by inactive N-terminal proANP-related fragments. Emerging plate-based sandwich immunoassays for individual quantitation of the three ANP forms enables evaluation of diagnostic implications and net ANP bioactivity. This new tool may provide further understanding in the pathophysiology of cardiac diseases. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd.

  6. Characterisation of the aqueous corrosion process in NdFeB melt spun ribbon and MQI bonded magnets

    Science.gov (United States)

    McCain, Stephen

    A major factor limiting the use and longevity of rare earth based magnetic materials is their susceptibility to aqueous corrosion and associated detrimental effects upon the magnetic properties of the material. This process was investigated through a combination of exposure to simulated environmental conditions and hydrogen absorption/desorption studies (HADS) in conjunction with magnetic characterisation. This study utilises NdFeB MQP-B melt-spun ribbon manufactured by Magnequench, in the form of MQI bonded magnets and also in its unbonded state as MQ powder. Specifically, it was concerned with how effective a variety of bonding media (epoxy resin,PTFE, zinc) and surface coatings (PTFE, Qsil, zinc LPPS, Dex-Cool) were at limiting the impact of aqueous corrosion in MQI bonded magnets. To characterise the effect of hydrogen absorption upon the magnetic properties of the MQP-B, hydrogen uptake was induced followed by a series of outgassing heat treatments with subsequent magnetic characterisation accompanied by HADS techniques performed after each outgas. This allowed comparisons to be made between the effects of aqueous corrosion process and hydrogen absorption upon the magnetic properties of the alloy.. This study has clearly demonstrated the link between the abundance of environmental moisture and rate of Hci losses in MQI bonded magnets. In addition to this the key mechanism responsible for the degradation of magnetic properties has been identified. These losses have been attributed to the absorption of hydrogen generated by the dissociation of water in the presence of NdFeB during the aqueous corrosion process. It has been shown that the use of a bonding media that is impermeable to water can limit the effects of aqueous corrosion by limiting water access to the Magnequench particles (MQP) and also the positive effects of the use of suitable surface coatings has been shown to be effective for the same reason..

  7. Comparison of validation methods for forming simulations

    Science.gov (United States)

    Schug, Alexander; Kapphan, Gabriel; Bardl, Georg; Hinterhölzl, Roland; Drechsler, Klaus

    2018-05-01

    The forming simulation of fibre reinforced thermoplastics could reduce the development time and improve the forming results. But to take advantage of the full potential of the simulations it has to be ensured that the predictions for material behaviour are correct. For that reason, a thorough validation of the material model has to be conducted after characterising the material. Relevant aspects for the validation of the simulation are for example the outer contour, the occurrence of defects and the fibre paths. To measure these features various methods are available. Most relevant and also most difficult to measure are the emerging fibre orientations. For that reason, the focus of this study was on measuring this feature. The aim was to give an overview of the properties of different measuring systems and select the most promising systems for a comparison survey. Selected were an optical, an eddy current and a computer-assisted tomography system with the focus on measuring the fibre orientations. Different formed 3D parts made of unidirectional glass fibre and carbon fibre reinforced thermoplastics were measured. Advantages and disadvantages of the tested systems were revealed. Optical measurement systems are easy to use, but are limited to the surface plies. With an eddy current system also lower plies can be measured, but it is only suitable for carbon fibres. Using a computer-assisted tomography system all plies can be measured, but the system is limited to small parts and challenging to evaluate.

  8. Characterising and modelling regolith stratigraphy using multiple geophysical techniques

    Science.gov (United States)

    Thomas, M.; Cremasco, D.; Fotheringham, T.; Hatch, M. A.; Triantifillis, J.; Wilford, J.

    2013-12-01

    Regolith is the weathered, typically mineral-rich layer from fresh bedrock to land surface. It encompasses soil (A, E and B horizons) that has undergone pedogenesis. Below is the weathered C horizon that retains at least some of the original rocky fabric and structure. At the base of this is the lower regolith boundary of continuous hard bedrock (the R horizon). Regolith may be absent, e.g. at rocky outcrops, or may be many 10's of metres deep. Comparatively little is known about regolith, and critical questions remain regarding composition and characteristics - especially deeper where the challenge of collecting reliable data increases with depth. In Australia research is underway to characterise and map regolith using consistent methods at scales ranging from local (e.g. hillslope) to continental scales. These efforts are driven by many research needs, including Critical Zone modelling and simulation. Pilot research in South Australia using digitally-based environmental correlation techniques modelled the depth to bedrock to 9 m for an upland area of 128 000 ha. One finding was the inability to reliably model local scale depth variations over horizontal distances of 2 - 3 m and vertical distances of 1 - 2 m. The need to better characterise variations in regolith to strengthen models at these fine scales was discussed. Addressing this need, we describe high intensity, ground-based multi-sensor geophysical profiling of three hillslope transects in different regolith-landscape settings to characterise fine resolution (i.e. a number of frequencies; multiple frequency, multiple coil electromagnetic induction; and high resolution resistivity. These were accompanied by georeferenced, closely spaced deep cores to 9 m - or to core refusal. The intact cores were sub-sampled to standard depths and analysed for regolith properties to compile core datasets consisting of: water content; texture; electrical conductivity; and weathered state. After preprocessing (filtering, geo

  9. Forms of Life, Forms of Reality

    Directory of Open Access Journals (Sweden)

    Piergiorgio Donatelli

    2015-10-01

    Full Text Available The article explores aspects of the notion of forms of life in the Wittgensteinian tradition especially following Iris Murdoch’s lead. On the one hand, the notion signals the hardness and inexhaustible character of reality, as the background needed in order to make sense of our lives in various ways. On the other, the hardness of reality is the object of a moral work of apprehension and deepening to the point at which its distinctive character dissolves into the family of connections we have gained for ourselves. The two movements of thought are connected and necessary.

  10. Vibrational spectroscopic characterisation of salmeterol xinafoate polymorphs and a preliminary investigation of their transformation using simultaneous in situ portable Raman spectroscopy and differential scanning calorimetry

    Energy Technology Data Exchange (ETDEWEB)

    Ali, Hassan Refat H. [Chemical and Forensic Sciences/University Analytical Centre, School of Life Sciences, University of Bradford, Richmond Road, Bradford BD7 1DP (United Kingdom); Edwards, Howell G.M. [Chemical and Forensic Sciences/University Analytical Centre, School of Life Sciences, University of Bradford, Richmond Road, Bradford BD7 1DP (United Kingdom)], E-mail: H.G.M.Edwards@bradford.ac.uk; Hargreaves, Michael D.; Munshi, Tasnim; Scowen, Ian J.; Telford, Richard J. [Chemical and Forensic Sciences/University Analytical Centre, School of Life Sciences, University of Bradford, Richmond Road, Bradford BD7 1DP (United Kingdom)

    2008-07-14

    Knowledge and control of the polymorphic phases of chemical compounds are important aspects of drug development in the pharmaceutical industry. Salmeterol xinafoate, a long acting {beta}-adrenergic receptor agonist, exists in two polymorphic Forms, I and II. Raman and near infrared spectra were obtained of these polymorphs at selected wavelengths in the range of 488-1064 nm; significant differences in the Raman and near-infrared spectra were apparent and key spectral marker bands have been identified for the vibrational spectroscopic characterisation of the individual polymorphs which were also characterised with X ray diffractometry. The solid-state transition of salmeterol xinafoate polymorphs was studied using simultaneous in situ portable Raman spectroscopy and differential scanning calorimetry isothermally between transitions. This method assisted in the unambiguous characterisation of the two polymorphic forms by providing a simultaneous probe of both the thermal and vibrational data. The study demonstrates the value of a rapid in situ analysis of a drug polymorph which can be of potential value for at-line in-process control.

  11. Vibrational spectroscopic characterisation of salmeterol xinafoate polymorphs and a preliminary investigation of their transformation using simultaneous in situ portable Raman spectroscopy and differential scanning calorimetry

    International Nuclear Information System (INIS)

    Ali, Hassan Refat H.; Edwards, Howell G.M.; Hargreaves, Michael D.; Munshi, Tasnim; Scowen, Ian J.; Telford, Richard J.

    2008-01-01

    Knowledge and control of the polymorphic phases of chemical compounds are important aspects of drug development in the pharmaceutical industry. Salmeterol xinafoate, a long acting β-adrenergic receptor agonist, exists in two polymorphic Forms, I and II. Raman and near infrared spectra were obtained of these polymorphs at selected wavelengths in the range of 488-1064 nm; significant differences in the Raman and near-infrared spectra were apparent and key spectral marker bands have been identified for the vibrational spectroscopic characterisation of the individual polymorphs which were also characterised with X ray diffractometry. The solid-state transition of salmeterol xinafoate polymorphs was studied using simultaneous in situ portable Raman spectroscopy and differential scanning calorimetry isothermally between transitions. This method assisted in the unambiguous characterisation of the two polymorphic forms by providing a simultaneous probe of both the thermal and vibrational data. The study demonstrates the value of a rapid in situ analysis of a drug polymorph which can be of potential value for at-line in-process control

  12. Micro metal forming

    CERN Document Server

    2013-01-01

    Micro Metal Forming, i. e. forming of parts and features with dimensions below 1 mm, is a young area of research in the wide field of metal forming technologies, expanding the limits for applying metal forming towards micro technology. The essential challenges arise from the reduced geometrical size and the increased lot size. In order to enable potential users to apply micro metal forming in production, information about the following topics are given: tribological behavior: friction between tool and work piece as well as tool wear mechanical behavior: strength and formability of the work piece material, durability of the work pieces size effects: basic description of effects occurring due to the fact, that the quantitative relation between different features changes with decreasing size process windows and limits for forming processes tool making methods numerical modeling of processes and process chains quality assurance and metrology All topics are discussed with respect to the questions relevant to micro...

  13. Calibrated atomic force microscope measurements of vickers hardness indentations and tip production and characterisation for scanning tunelling microscope

    DEFF Research Database (Denmark)

    Jensen, Carsten P.

    Calibrated atomic force microscope measurements of vickers hardness indentations and tip production and characterisation for scanning tunelling microscope......Calibrated atomic force microscope measurements of vickers hardness indentations and tip production and characterisation for scanning tunelling microscope...

  14. A systematic planning tool for environmental characterisation - 16010

    International Nuclear Information System (INIS)

    Wilcox, Steven; Wilkins, Richard; Lyons, Martin

    2009-01-01

    Many organisations are currently dealing with long standing legacy issues in clean up, decommissioning and demolition projects. Industry is required to ensure that all bulk articles, substances and waste arisings are adequately characterised and assigned to the correct disposal routes in compliance with UK legislation and best practice. It is essential that data used to support waste sentencing is of the correct type, quality and quantity, and that it is appropriately assessed in order to support defensible, confident decisions that account for inherent uncertainties. AMEC has adopted the Data Quality Objectives (DQO) based methodology and the software package Visual Sample Plan (VSP) to provide a better, faster, and more cost effective approach to meeting regulatory and client requirements, whilst minimising the time spent gathering data and assessing the information. The DQO methodology is based on a scientific approach that requires clear objectives to be established from the outset of a project and that there is a demonstration of acceptability of the results. Through systematic planning, the team develops acceptance or performance criteria for the quality of the data collected and for the confidence in the final decision. The systematic planning process promotes communication between all departments and individuals involved in the decision-making process thus the planning phase gives an open and unambiguous method to support the decisions and enables the decision-makers (technical authorities on the materials of concern) to document all assumptions. The DQO process allows better planning, control and understanding of all the issues. All types of waste can be sentenced under one controllable system providing a more defensible position. This paper will explain that the DQO process consists of seven main steps that lead to a detailed Sampling and Analysis Plan (SAP). The process gives transparency to any assumptions made about the site or material being

  15. Identification and Characterisation of Wetlands For A Correct Basin Management

    Science.gov (United States)

    Quadrado, F.; Gomes, F.

    The effects of human activities on water resources have great conse- quences for water users. Some of the problems affecting water resources arise from conflicting uses, including discharge of untreated industrial and domestic wastewater and inadequate agricultural practices on the watersheds. The knowledge of hydrologic and water quality characteristics and behaviour of the system will provide the basis for action to prevent the degradation of water resources. So comprehensive and ratio- nal water management is a necessary condition for social and economic development. The Water Framework Directive defines a good status for all waters all types of waters to be achieved in 15 years. To wetlands the Directive purpose the prevention of their degradation and the protection of those wetlands directly depending on aquatic sys- tems. The sensitiveness of wetlands leads to a difficult management of this resources where it is necessary to know the dynamic of the system and the pressures that can change the ecosystem equilibrium. In spite of the critical role of wetlands, there is a lack of information related with these areas, many times not included in the monitor- ing activity routines. A water quality-monitoring network is an essential instrument of water management. Portugal is now redesigning their freshwater network monitoring in a watershed basis, to provide the necessary data to preserve and control the water quality of the rivers and reservoirs. The combined approach principle to the protec- tion of water that is defended in the Water Framework Directive, was adopted. One of the criterion used to the localisation of sampling stations were characterisation of protected areas. Portugal due to his natural and climate conditions have some impor- tant and unique ecosystems, sometimes being considered as protected areas. Their characteristics must be studied and their equilibrium preserved. Anyhow a little at- tention had been provided to these zones and the actual

  16. a New Framework for Characterising Simulated Droughts for Future Climates

    Science.gov (United States)

    Sharma, A.; Rashid, M.; Johnson, F.

    2017-12-01

    Significant attention has been focussed on metrics for quantifying drought. Lesser attention has been given to the unsuitability of current metrics in quantifying drought in a changing climate due to the clear non-stationarity in potential and actual evapotranspiration well into the future (Asadi-Zarch et al, 2015). This talk presents a new basis for simulating drought designed specifically for use with climate model simulations. Given the known uncertainty of climate model rainfall simulations, along with their inability to represent low-frequency variability attributes, the approach here adopts a predictive model for drought using selected atmospheric indicators. This model is based on a wavelet decomposition of relevant atmospheric predictors to filter out less relevant frequencies and formulate a better characterisation of the drought metric chosen as response. Once ascertained using observed precipication and associated atmospheric variables, these can be formulated from GCM simulations using a multivariate bias correction tool (Mehrotra and Sharma, 2016) that accounts for low-frequency variability, and a regression tool that accounts for nonlinear dependence (Sharma and Mehrotra, 2014). Use of only the relevant frequencies, as well as the corrected representation of cross-variable dependence, allows greater accuracy in characterising observed drought, from GCM simulations. Using simulations from a range of GCMs across Australia, we show here that this new method offers considerable advantages in representing drought compared to traditionally followed alternatives that rely on modelled rainfall instead. Reference:Asadi Zarch, M. A., B. Sivakumar, and A. Sharma (2015), Droughts in a warming climate: A global assessment of Standardized precipitation index (SPI) and Reconnaissance drought index (RDI), Journal of Hydrology, 526, 183-195. Mehrotra, R., and A. Sharma (2016), A Multivariate Quantile-Matching Bias Correction Approach with Auto- and Cross

  17. Characterisation of an urban bus network for environmental purposes.

    Science.gov (United States)

    André, Michel; Villanova, André

    2004-12-01

    Since pollutant emissions are closely related to the operating conditions of vehicles, their evaluation usually involves studying these operating conditions (through bus instrumentation and monitoring under actual operation), the design of representative driving or engine test cycles and the measurement of pollutant emissions. A preliminary characterisation of the routes on a bus network should make it possible to identify typical routes, the driving conditions and pollutant emissions of which are then studied. Two approaches are envisaged and applied to the Paris area, for which a wealth of information is available, which should be transferable to other bus networks. Both approaches are based on factorial analysis and automatic clustering, to allow optimum description and the identification of a pertinent typology of the bus routes in several classes. The first attempt at characterisation is based on statistics relating to bus operations: route characteristics (length, dedicated bus lanes, number of stops, location of stops: schools, tourist sites, hospitals, railways or underground stations), travel time, commercial speed, annual statistics (number of passengers, number of vehicles per hour, total kilometres), the irregularity of travel (variation of travel times, injuries, congestion.), as well as information on the problems encountered (congestion, distribution of the passenger load, junctions, bends). A second approach is based on the analysis of the "urban context" in which buses are driven. Population, employment, housing, road network, traffic and places that generate or disturb traffic (schools, railway stations, shopping areas, etc.) are calculated for the Ile de France region, by cells of 100 x 100 m, and collected in a geographical information system (GIS). Statistical analyses enable a typology of these urban cells to be established, the main parameters being density, type of housing, road types and traffic levels. The bus routes are then analysed

  18. Growth and characterisation of lead iodide single crystals

    International Nuclear Information System (INIS)

    Tonn, Justus

    2012-01-01

    The work in hand deals with the growth and characterisation of lead iodide (PbI 2 ) single crystals. PbI 2 is regarded as a promising candidate for low-noise X- and gamma ray detection at room temperature. Its benefits if compared to conventional materials like HgI 2 , CdTe, Si, or GaAs lie in a band gap energy of 2.32 eV, an excellent ability to absorb radiation, and a high electrical resistivity. For an application of PbI 2 as detector material the growth and characterisation of crystals with high chemical and structural quality is extremely challenging. In light of this, the effectiveness of zone purification of the PbI 2 used for crystal growth was confirmed by spectroscopic analysis. Furthermore, technological aspects during processing of purified PbI 2 were investigated. With the help of thermal analysis, a correlation was found between the degree of exposing the source material to oxygen from the air and the structural quality of the resulting crystals. A hydrogen treatment was applied to PbI 2 as an effective method for the removal of oxidic pollutions, which resulted in a significant reduction of structural defects like polytypic growth and stress-induced cracking. The growth of PbI 2 single crystals was, among others, carried out by the Bridgman-Stockbarger method. In this context, much effort was put on the investigation of influences resulting from the design and preparation of ampoules. For the first time, crystal growth of PbI 2 was also carried out by the Czochralski method. If compared to the Bridgman-Stockbarger method, the Czochralski technique allowed a significantly faster growth of nearly crack-free crystals with a reproducible predetermination of crystallographic orientation. By an optimised sample preparation of PbI 2 , surface orientations perpendicular to the usually cleaved (0001) plane were realised. It is now possible to determine the material properties along directions which were so far not accessible. Thus, for example, the ratio of

  19. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  20. Gravitation and quadratic forms

    International Nuclear Information System (INIS)

    Ananth, Sudarshan; Brink, Lars; Majumdar, Sucheta; Mali, Mahendra; Shah, Nabha

    2017-01-01

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  1. Three forms of relativity

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1992-01-01

    The physical sense of three forms of the relativity is discussed. The first - instant from - respects in fact the traditional approach based on the concept of instant distance. The normal form corresponds the radar formulation which is based on the light or retarded distances. The front form in the special case is characterized by 'observable' variables, and the known method of k-coefficient is its obvious expression. 16 refs

  2. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  3. Gravitation and quadratic forms

    Energy Technology Data Exchange (ETDEWEB)

    Ananth, Sudarshan [Indian Institute of Science Education and Research,Pune 411008 (India); Brink, Lars [Department of Physics, Chalmers University of Technology,S-41296 Göteborg (Sweden); Institute of Advanced Studies and Department of Physics & Applied Physics,Nanyang Technological University,Singapore 637371 (Singapore); Majumdar, Sucheta [Indian Institute of Science Education and Research,Pune 411008 (India); Mali, Mahendra [School of Physics, Indian Institute of Science Education and Research,Thiruvananthapuram, Trivandrum 695016 (India); Shah, Nabha [Indian Institute of Science Education and Research,Pune 411008 (India)

    2017-03-31

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  4. Electronic Capitalization Asset Form -

    Data.gov (United States)

    Department of Transportation — National Automated Capitalization Authorization Form used by ATO Engineering Services, Logistics, Accounting for the purpose of identifying and capturing FAA project...

  5. Forming of superplastic ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Lesuer, D.R.; Wadsworth, J.; Nieh, T.G.

    1994-05-01

    Superplasticity in ceramics has now advanced to the stage that technologically viable superplastic deformation processing can be performed. In this paper, examples of superplastic forming and diffusion bonding of ceramic components are given. Recent work in biaxial gas-pressure forming of several ceramics is provided. These include yttria-stabilized, tetragonal zirconia (YTZP), a 20% alumina/YTZP composite, and silicon. In addition, the concurrent superplastic forming and diffusion bonding of a hybrid ceramic-metal structure are presented. These forming processes offer technological advantages of greater dimensional control and increased variety and complexity of shapes than is possible with conventional ceramic shaping technology.

  6. Cooperative Station History Forms

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Various forms, photographs and correspondence documenting the history of Cooperative station instrumentation, location changes, inspections, and...

  7. Histochemical characterisation of oocytes of the swordfish Xiphias gladius

    Directory of Open Access Journals (Sweden)

    Juan B. Ortiz-Delgado

    2008-09-01

    Full Text Available This paper reports a histological, histochemical and immunohistochemical characterisation of growing oocytes of the swordfish Xiphias gladius. The presence and distribution of carbohydrates, proteins, lipids, calcium, iron, vitellogenin/Vg, zona radiata protein/Zrp, metallothionein/Mt, and thyroid hormones/T3-T4 were studied during oogenesis (cortical alveoli, globules, yolk-granules, cytoplasm, follicular and radiata envelopes. During the initial vitellogenic phase, the oocytes showed cortical alveoli and oil globules containing neutral lipids exclusively. During this phase, small yolk granules appeared around the peripheral cytoplasm, and they increased through exogenous vitellogenesis. Yolk granules were composed of glycoproteins, calcium, iron, and proteins rich in lysine, arginine, tyrosine, tryptophan, cysteine and cystine. Vg and Mt were immunohistochemically detected in yolk. The follicular envelope contained proteins rich in amino acids. Moreover, calcium and thyroid hormones (triiodotyronine and thyroxine/T3, T4 were detected in this cell envelope. Cortical alveoli, which contained carboxylated and neutral glycoconjugates, were especially rich in N-acetyl-D-galactosamine, N-acetyl-D-glucosamine, galactose and sialic acid. Finally, the zona radiata was mainly proteinaceous in nature and was composed of calcium and neutral glycoproteins. The egg envelope or chorion and the liver showed specific immunoreactivities by using anti-salmon Zrp as the primary antiserum.

  8. Characterisation of a phenomenological model for commercial pneumatic muscle actuators.

    Science.gov (United States)

    Serres, J L; Reynolds, D B; Phillips, C A; Gerschutz, M J; Repperger, D W

    2009-08-01

    This study focuses on the parameter characterisation of a three-element phenomenological model for commercially available pneumatic muscle actuators (PMAs). This model consists of a spring, damping and contractile element arranged in parallel. Data collected from static loading, contraction and relaxation experiments were fitted to theoretical solutions of the governing equation for the three-element model resulting in prediction profiles for the spring, damping and contractile force coefficient. For the spring coefficient, K N/mm, the following relationships were found: K = 32.7 - 0.0321P for 150 < or = P < or = 314 kPa and K = 17 + 0.0179P for 314 < or = P < or = 550 kPa. For the damping coefficient, B Ns/mm, the following relationship was found during contraction: B = 2.90 for 150 < or = P < or = 550 kPa. During relaxation, B = 1.57 for 150 < or = P < or = 372 kPa and B = 0.311 + 0.00338P for 372 < or = P < or = 550. The following relationship for the contractile force coefficient, F(ce) N, was also determined: F(ce) = 2.91P+44.6 for 150 < or = P < or = 550 kPa. The model was then validated by reasonably predicting the response of the PMA to a triangular wave input in pressure under a constant load on a dynamic test station.

  9. Characterisation of GERDA Phase-I detectors in liquid argon

    Energy Technology Data Exchange (ETDEWEB)

    Barnabe Heider, Marik; Schoenert, Stefan [Max-Planck-Institut fuer Kernphysik (Germany); Gusev, Konstantin [Russian Research Center, Kurchatov Institute (Russian Federation); Joint Institute for Nuclear Research (Russian Federation)

    2009-07-01

    GERDA will search for neutrinoless double beta decay in {sup 76}Ge by submerging bare enriched HPGe detectors in liquid argon. In GERDA Phase-I, reprocessed enriched-Ge detectors, which were previously operated by the Heidelberg-Moscow and IGEX collaborations, and reprocessed natural-Ge detectors from Genius-TF, will be redeployed. We have tested the operation and performance of bare HPGe detectors in liquid nitrogen and in liquid argon over more than three years with three non-enriched p-type prototype detectors. The detector handling and mounting procedures have been defined and the Phase-I detector technology, the low-mass assembly and the long-term stability in liquid argon have been tested successfully. The Phase-I detectors were reprocessed by Canberra Semiconductor NV, Olen, according to their standard technology but without the evaporation of a passivation layer. After their reprocessing, the detectors have been mounted in their low-mass holders and their characterisation in liquid argon performed. The leakage current, the counting characteristics and the efficiency of the detectors have been measured. The testing of the detectors was carried out in the liquid argon test stand of the GERDA underground Detector Laboratory (GDL) at LNGS. The detectors are now stored underground under vacuum until their operation in GERDA.

  10. Development of an automatic characterisation system for silicon detectors

    CERN Document Server

    Hacker, J; Krammer, M; Wedenig, R

    2002-01-01

    The CMS experiment will be equipped with the largest silicon tracker in the world. The tracker will consist of about 25,000 silicon sensors which will cover an area of more than 200 m sup 2. Four quality test centres will carry out various checks on a representative sample of sensors to assure a homogeneous quality throughout the 2((1)/(2)) years of production. One of these centres is based in Vienna. To cope with the large number of sensors a fast and fully automatic characterisation system has been realised. We developed the software in LabView and built a cost-efficient probe station in house by assembling individual components and commercial instruments. Both the global properties of a sensor and the characteristic quantities of the individual strips can be measured. The measured data are immediately analysed and sent to a central database. The mechanical and electrical set-up will be explained and results from CMS prototype sensors are presented.

  11. Characterisation of insulin analogues therapeutically available to patients

    KAUST Repository

    Adams, Gary G.

    2018-03-29

    The structure and function of clinical dosage insulin and its analogues were assessed. This included \\'native insulins\\' (human recombinant, bovine, porcine), \\'fast-acting analogues\\' (aspart, glulisine, lispro) and \\'slow-acting analogues\\' (glargine, detemir, degludec). Analytical ultracentrifugation, both sedimentation velocity and equilibrium experiments, were employed to yield distributions of both molar mass and sedimentation coefficient of all nine insulins. Size exclusion chromatography, coupled to multi-angle light scattering, was also used to explore the function of these analogues. On ultracentrifugation analysis, the insulins under investigation were found to be in numerous conformational states, however the majority of insulins were present in a primarily hexameric conformation. This was true for all native insulins and two fast-acting analogues. However, glargine was present as a dimer, detemir was a multi-hexameric system, degludec was a dodecamer (di-hexamer) and glulisine was present as a dimer-hexamer-dihexamer system. However, size-exclusion chromatography showed that the two hexameric fast-acting analogues (aspart and lispro) dissociated into monomers and dimers due to the lack of zinc in the mobile phase. This comprehensive study is the first time all nine insulins have been characterised in this way, the first time that insulin detemir have been studied using analytical ultracentrifugation and the first time that insulins aspart and glulisine have been studied using sedimentation equilibrium. The structure and function of these clinically administered insulins is of critical importance and this research adds novel data to an otherwise complex functional physiological protein.

  12. Synthesis, Characterisation and DFT Calculations of Azo-Imine Dyes

    Directory of Open Access Journals (Sweden)

    Sevil Özkınalı

    2017-11-01

    Full Text Available In this study, azo dyes containing an imine group were synthesised by coupling p-hydroxybenzylidene aniline with the diazonium salts of p-toluidine, 4-aminophenol, aniline, p-chloroaniline, p-fluoroaniline, and p-nitroaniline. The compounds were characterised by melting point, elemental, UV-Vis and IR analyses as well as 1H-NMR and 13C-NMR spectroscopies. Moreover, the experimental data were supplemented with density functional theory (DFT calculations. The experimental data on FT-IR and UV–Vis spectra of the compounds were compared with theoretical results. The DFT calculations were performed to obtain the ground state geometries of the compounds using the B3LYP hybrid functional level with 6-311++g(2d,2p basis set. Frontier molecular orbital energies, band gap energies and some chemical reactivity parameters, such as chemical hardness and electronegativity, were calculated and compared with experimental values. A significant correlation was observed between the dipole moment and polarities of the solvents and the absorption wavelength of the compounds.

  13. Nutrition economics - characterising the economic and health impact of nutrition.

    Science.gov (United States)

    Lenoir-Wijnkoop, I; Dapoigny, M; Dubois, D; van Ganse, E; Gutiérrez-Ibarluzea, I; Hutton, J; Jones, P; Mittendorf, T; Poley, M J; Salminen, S; Nuijten, M J C

    2011-01-01

    There is a new merging of health economics and nutrition disciplines to assess the impact of diet on health and disease prevention and to characterise the health and economic aspects of specific changes in nutritional behaviour and nutrition recommendations. A rationale exists for developing the field of nutrition economics which could offer a better understanding of both nutrition, in the context of having a significant influence on health outcomes, and economics, in order to estimate the absolute and relative monetary impact of health measures. For this purpose, an expert meeting assessed questions aimed at clarifying the scope and identifying the key issues that should be taken into consideration in developing nutrition economics as a discipline that could potentially address important questions. We propose a first multidisciplinary outline for understanding the principles and particular characteristics of this emerging field. We summarise here the concepts and the observations of workshop participants and propose a basic setting for nutrition economics and health outcomes research as a novel discipline to support nutrition, health economics and health policy development in an evidence and health-benefit-based manner.

  14. Spectroscopic characterisation of the stellar content of ultra diffuse galaxies

    Science.gov (United States)

    Ruiz-Lara, T.; Beasley, M. A.; Falcón-Barroso, J.; Román, J.; Pinna, F.; Brook, C.; Di Cintio, A.; Martín-Navarro, I.; Trujillo, I.; Vazdekis, A.

    2018-05-01

    Understanding the peculiar properties of Ultra Diffuse Galaxies (UDGs) via spectroscopic analysis is a challenging task requiring very deep observations and exquisite data reduction. In this work we perform one of the most complete characterisations of the stellar component of UDGs to date using deep optical spectroscopic data from OSIRIS at GTC. We measure radial and rotation velocities, star formation histories (SFH) and mean population parameters, such as ages and metallicities, for a sample of five UDG candidates in the Coma cluster. From the radial velocities, we confirm the Coma membership of these galaxies. We find that their rotation properties, if detected at all, are compatible with dwarf-like galaxies. The SFHs of the UDG are dominated by old (˜ 7 Gyr), metal-poor ([M/H] ˜ -1.1) and α-enhanced ([Mg/Fe] ˜ 0.4) populations followed by a smooth or episodic decline which halted ˜ 2 Gyr ago, possibly a sign of cluster-induced quenching. We find no obvious correlation between individual SFH shapes and any UDG morphological properties. The recovered stellar properties for UDGs are similar to those found for DDO 44, a local UDG analogue resolved into stars. We conclude that the UDGs in our sample are extended dwarfs whose properties are likely the outcome of both internal processes, such as bursty SFHs and/or high-spin haloes, as well as environmental effects within the Coma cluster.

  15. Characterisation of temperature gradient driven turbulence and transport

    International Nuclear Information System (INIS)

    Ottaviani, M.A.

    2002-01-01

    We report on extensive numerical studies aimed at characterising various aspects of temperature gradient driven turbulence. We specifically discuss results from 3D fluid models of ETG and of ITG turbulence, and results from a 2D+2D gyrokinetic model of trapped ion turbulence. Global transport exhibits gyro-Bohm scaling in both the ETG and the ITG model. The conductivity of the ETG model decreases weakly with beta. The heat transport is due to the EXB advection, the effect of the magnetic flutter is negligible. However the transport level is much lower than experimentally observed. In both 3D models the correlation lengths scale with the gyroradius, but they are typically a factor 10 larger. Vortices are elongated but their aspect ratio is independent of the gyroradius. Their radial size is limited by LD. The trapped ion model gives larger vortices due to the absence of LD from passing ions. Avalanches are observed in all the models, the weakest occurring in the ITG system. Their range increases with gyroradius, but more weakly than linearly. Finally, ZFs can limit the range of the avalanches, which explains why avalanches are weaker in the ITG model which is more sensitive to ZFs. (author)

  16. Fluorescent nanosensors for intracellular measurements: synthesis, characterisation, calibration and measurement

    Directory of Open Access Journals (Sweden)

    Arpan Shailesh Desai

    2014-01-01

    Full Text Available Measurement of intracellular acidification is important for understanding fundamental biological pathways as well as developing effective therapeutic strategies. Fluorescent pH nanosensors are an enabling technology for real-time monitoring of intracellular acidification. The physicochemical characteristics of nanosensors can be engineered to target specific cellular compartments and respond to external stimuli. Therefore nanosensors represent a versatile approach for probing biological pathways inside cells. The fundamental components of nanosensors comprise a pH-sensitive fluorophore (signal transducer and a pH-insensitive reference fluorophore (internal standard immobilised in an inert non-toxic matrix. The inert matrix prevents interference of cellular components with the sensing elements as well as minimizing potentially harmful effects of some fluorophores on cell function. Fluorescent nanosensors are synthesised using standard laboratory equipment and are detectable by non-invasive widely accessibly imaging techniques. The outcomes of studies employing this technology are dependent on reliable methodology for performing measurements. In particular special consideration must be given to conditions for sensor calibration, uptake conditions and parameters for image analysis. We describe procedures for: 1 synthesis and characterisation of polyacrylamide and silica based nanosensors 2 nanosensor calibration and 3 performing measurements using fluorescence microscopy.

  17. Characterisation of thin films by phase modulated spectroscopic ellipsometry

    International Nuclear Information System (INIS)

    Bhattacharyya, D.; Das, N.C.

    1998-07-01

    A wide variety of thin film coatings, deposited by different techniques and with potential applications in various important areas, have been characterised by the Phase Modulated Spectroscopic Ellipsometer, installed recently in the Spectroscopy Division, B.A.R.C. The Phase Modulated technique provides a faster and more accurate data acquisition process than the conventional ellipsometry. The measured Ellipsometry spectra are fitted with theoretical spectra generated assuming an appropriate model regarding the sample. The fittings have been done objectively by minimising the squared difference (χ 2 ) between the measured and calculated values of the ellipsometric parameters and thus accurate information have been derived regarding the thickness and optical constants (viz, the refractive index and extinction coefficient) of the different layers, the surface roughness and the inhomogeneities present in the layers. Measurements have been done on (i) ion-implanted Si-wafers to investigate the formation of SiC layers, (ii) phenyl- silane coating on glass to investigate the surface modifications achieved for better adsorption of rhodamine dye on glass, (iii) GaN films on quartz to investigate the formation of high quality GaN layers by sputtering of GaAs targets, (iv) Diamond-like-coating (DLC) samples prepared by Chemical Vapour Deposition (CVD) to investigate the optical properties which would ultimately lead to an accurate estimation of the ratio of sp 3 and sp 2 bonded carbon atoms in the films and (v) SS 304 under different surface treatments to investigate the growth of different passive films. (author)

  18. Genetic characterisation of Taenia multiceps cysts from ruminants in Greece.

    Science.gov (United States)

    Al-Riyami, Shumoos; Ioannidou, Evi; Koehler, Anson V; Hussain, Muhammad H; Al-Rawahi, Abdulmajeed H; Giadinis, Nektarios D; Lafi, Shawkat Q; Papadopoulos, Elias; Jabbar, Abdul

    2016-03-01

    This study was designed to genetically characterise the larval stage (coenurus) of Taenia multiceps from ruminants in Greece, utilising DNA regions within the cytochrome c oxidase subunit 1 (partial cox1) and NADH dehydrogenase 1 (pnad1) mitochondrial (mt) genes, respectively. A molecular-phylogenetic approach was used to analyse the pcox1 and pnad1 amplicons derived from genomic DNA samples from individual cysts (n=105) from cattle (n=3), goats (n=5) and sheep (n=97). Results revealed five and six distinct electrophoretic profiles for pcox1 and pnad1, respectively, using single-strand conformation polymorphism. Direct sequencing of selected amplicons representing each of these profiles defined five haplotypes each for pcox1 and pnad1, among all 105 isolates. Phylogenetic analysis of individual sequence data for each locus, including a range of well-defined reference sequences, inferred that all isolates of T. multiceps cysts from ruminants in Greece clustered with previously published sequences from different continents. The present study provides a foundation for future large-scale studies on the epidemiology of T. multiceps in ruminants as well as dogs in Greece. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Synthesis, characterisation and biomedical applications of curcumin conjugated chitosan microspheres.

    Science.gov (United States)

    Saranya, T S; Rajan, V K; Biswas, Raja; Jayakumar, R; Sathianarayanan, S

    2018-04-15

    Curcumin is a diaryl heptanoid of curcuminoids class obtained from Curcuma longa. It possesses various biological activities like anti-inflammatory, hypoglycemic, antioxidant, wound-healing, and antimicrobial activities. Chitosan is a biocompatible, biodegradable and non-toxic natural polymer which enhances the adhesive property of the skin. Chemical conjugation will leads to sustained release action and to enhance the bioavailability. This study aims to synthesis and characterize biocompatible curcumin conjugated chitosan microspheres for bio-medical applications. The Schiff base reaction was carried out for the preparation of curcumin conjugated chitosan by microwave method and it was characterised using FTIR and NMR. Curcumin conjugated chitosan microspheres (CCCMs) were prepared by wet milling solvent evaporation method. SEM analysis showed these CCCMs were 2-5μm spherical particles. The antibacterial activities of the prepared CCCMs were studied against Staphylococcus aureus and Escherichia coli, the zone of inhibition was 28mm and 23mm respectively. Antioxidant activity of the prepared CCCMs was also studied by DPPH and H 2 O 2 method it showed IC 50 esteem value of 216μg/ml and 228μg/ml, and anti-inflammatory activity results showed that CCCMs having IC 50 value of 45μg/ml. The results conclude that the CCCMs having a good antibacterial, antioxidant and anti-inflammatory activities. This, the prepared CCCMs have potential application in preventing skin infections. Copyright © 2017. Published by Elsevier B.V.

  20. Assessment and Characterisation of Ireland's Green Tides (Ulva Species).

    Science.gov (United States)

    Wan, Alex H L; Wilkes, Robert J; Heesch, Svenja; Bermejo, Ricardo; Johnson, Mark P; Morrison, Liam

    2017-01-01

    Enrichment of nutrients and metals in seawater associated with anthropogenic activities can threaten aquatic ecosystems. Consequently, nutrient and metal concentrations are parameters used to define water quality. The European Union's Water Framework Directive (WFD) goes further than a contaminant-based approach and utilises indices to assess the Ecological Status (ES) of transitional water bodies (e.g. estuaries and lagoons). One assessment is based upon the abundance of opportunistic Ulva species, as an indication of eutrophication. The objective of this study was to characterise Ireland's Ulva blooms through the use of WFD assessment, metal concentrations and taxonomic identity. Furthermore, the study assessed whether the ecological assessment is related to the metal composition in the Ulva. WFD algal bloom assessment revealed that the largest surveyed blooms had an estimated biomass of 2164 metric tonnes (w/w). DNA sequences identified biomass from all locations as Ulva rigida, with the exception of New Quay, which was Ulva rotundata. Some blooms contained significant amounts of As, Cu, Cr, Pb and Sn. The results showed that all metal concentrations had a negative relationship (except Se) with the Ecological Quality Ratio (EQR). However, only in the case of Mn were these differences significant (p = 0.038). Overall, the metal composition and concentrations found in Ulva were site dependent, and not clearly related to the ES. Nevertheless, sites with a moderate or poor ES had a higher variability in the metals levels than in estuaries with a high ES.

  1. Surface characterisation of synthetic coal chars made from model compounds

    Energy Technology Data Exchange (ETDEWEB)

    Arenillas, A.; Pevida, C.; Rubiera, F.; Palacios, J.M.; Navarrete, R.; Denoyel, R.; Rouquerol, J.; Pis, J.J. [Instituto Nacional del Carbon, CSIC, Oviedo (Spain)

    2004-07-01

    Knowledge of surface properties is essential for understanding the reaction mechanisms involved in several coal conversion processes. However, due to the complexity and heterogeneity of coal this is rather difficult and the use of known model compounds could be a valuable tool. Single model compounds have been widely used, but they give a quite simplified picture. In this work a mixture of model compounds in a phenol-formaldehyde matrix was cured in order to create cross-linked structures. The obtained synthetic coal was pyrolysed in a fixed bed reactor, under helium atmosphere. The surface composition of the chars was evaluated by XPS, adsorption gravimetry of water vapour, temperature-programmed desorption and potentiometric titration. Texture was characterised by N{sub 2} and CO{sub 2} adsorption isotherms at 77 and 273 K, respectively, and immersion calorimetry in benzene. The results obtained from the different techniques were contrasted in order to give an overview of the surface properties (chemical and physical) of the samples studied. Chars obtained under the same operating conditions from a high volatile bituminous coal were used as a reference.

  2. Rheumatoid arthritis: identifying and characterising polymorphisms using rat models

    Science.gov (United States)

    2016-01-01

    ABSTRACT Rheumatoid arthritis is a chronic inflammatory joint disorder characterised by erosive inflammation of the articular cartilage and by destruction of the synovial joints. It is regulated by both genetic and environmental factors, and, currently, there is no preventative treatment or cure for this disease. Genome-wide association studies have identified ∼100 new loci associated with rheumatoid arthritis, in addition to the already known locus within the major histocompatibility complex II region. However, together, these loci account for only a modest fraction of the genetic variance associated with this disease and very little is known about the pathogenic roles of most of the risk loci identified. Here, we discuss how rat models of rheumatoid arthritis are being used to detect quantitative trait loci that regulate different arthritic traits by genetic linkage analysis and to positionally clone the underlying causative genes using congenic strains. By isolating specific loci on a fixed genetic background, congenic strains overcome the challenges of genetic heterogeneity and environmental interactions associated with human studies. Most importantly, congenic strains allow functional experimental studies be performed to investigate the pathological consequences of natural genetic polymorphisms, as illustrated by the discovery of several major disease genes that contribute to arthritis in rats. We discuss how these advances have provided new biological insights into arthritis in humans. PMID:27736747

  3. Quantification and characterisation of Trichoderma spp. from different ecosystems.

    Science.gov (United States)

    Sariah, M; Choo, C W; Zakaria, H; Norihan, M S

    2005-01-01

    Basal stem rot of oil palm caused by Ganoderma boninense is of major economic importance. Observations of the low incidence of disease due to Ganoderma species in natural stands, suggest that the disease is kept under control by some biological means. Trichoderma spp. are saprophytic fungi with high antagonistic activities against soil-borne pathogens. However, their abundance and distribution are soil and crop specific. Trichoderma species have been found to be concentrated in the A1 (0-30 cm) and Be soil horizons (30-60 cm), although the abundance of Trichoderma was not significantly different between the oil palm and non-oil palm ecosystems. Characterisation of Trichoderma isolates based on cultural, morphological and DNA polymorphism showed that T. harzianum, T. virens, T. koningii and T. longibrachiatum made up 72, 14, 10 and 4% of the total Trichoderma isolates isolated. As Trichoderma species are present in the oil palm ecosystem, but at lower numbers and in locations different from those desired, soil augmentation with antagonistic Trichoderma spp. can be developed as a strategy towards integrated management of basal stem rot of oil palm.

  4. Characterisation of CDKL5 Transcript Isoforms in Human and Mouse.

    Science.gov (United States)

    Hector, Ralph D; Dando, Owen; Landsberger, Nicoletta; Kilstrup-Nielsen, Charlotte; Kind, Peter C; Bailey, Mark E S; Cobb, Stuart R

    2016-01-01

    Mutations in the X-linked Cyclin-Dependent Kinase-Like 5 gene (CDKL5) cause early onset infantile spasms and subsequent severe developmental delay in affected children. Deleterious mutations have been reported to occur throughout the CDKL5 coding region. Several studies point to a complex CDKL5 gene structure in terms of exon usage and transcript expression. Improvements in molecular diagnosis and more extensive research into the neurobiology of CDKL5 and pathophysiology of CDKL5 disorders necessitate an updated analysis of the gene. In this study, we have analysed human and mouse CDKL5 transcript patterns both bioinformatically and experimentally. We have characterised the predominant brain isoform of CDKL5, a 9.7 kb transcript comprised of 18 exons with a large 6.6 kb 3'-untranslated region (UTR), which we name hCDKL5_1. In addition we describe new exonic regions and a range of novel splice and UTR isoforms. This has enabled the description of an updated gene model in both species and a standardised nomenclature system for CDKL5 transcripts. Profiling revealed tissue- and brain development stage-specific differences in expression between transcript isoforms. These findings provide an essential backdrop for the diagnosis of CDKL5-related disorders, for investigations into the basic biology of this gene and its protein products, and for the rational design of gene-based and molecular therapies for these disorders.

  5. Characterisation of Cdkl5 transcript isoforms in rat.

    Science.gov (United States)

    Hector, Ralph D; Dando, Owen; Ritakari, Tuula E; Kind, Peter C; Bailey, Mark E S; Cobb, Stuart R

    2017-03-01

    CDKL5 deficiency is a severe neurological disorder caused by mutations in the X-linked Cyclin-Dependent Kinase-Like 5 gene (CDKL5). The predominant human CDKL5 brain isoform is a 9.7kb transcript comprised of 18 exons with a large 6.6kb 3'-untranslated region (UTR). Mammalian models of CDKL5 disorder are currently limited to mouse, and little is known about Cdkl5 in other organisms used to model neurodevelopmental disorders, such as rat. In this study we characterise, both bioinformatically and experimentally, the rat Cdkl5 gene structure and its associated transcript isoforms. New exonic regions, splice sites and UTRs are described, confirming the presence of four distinct transcript isoforms. The predominant isoform in the brain, which we name rCdkl5_1, is orthologous to the human hCDKL5_1 and mouse mCdkl5_1 isoforms and is the most highly expressed isoform across all brain regions tested. This updated gene model of Cdkl5 in rat provides a framework for studies into its protein products and provides a reference for the development of molecular therapies for testing in rat models of CDKL5 disorder. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Characterisation of CDKL5 Transcript Isoforms in Human and Mouse.

    Directory of Open Access Journals (Sweden)

    Ralph D Hector

    Full Text Available Mutations in the X-linked Cyclin-Dependent Kinase-Like 5 gene (CDKL5 cause early onset infantile spasms and subsequent severe developmental delay in affected children. Deleterious mutations have been reported to occur throughout the CDKL5 coding region. Several studies point to a complex CDKL5 gene structure in terms of exon usage and transcript expression. Improvements in molecular diagnosis and more extensive research into the neurobiology of CDKL5 and pathophysiology of CDKL5 disorders necessitate an updated analysis of the gene. In this study, we have analysed human and mouse CDKL5 transcript patterns both bioinformatically and experimentally. We have characterised the predominant brain isoform of CDKL5, a 9.7 kb transcript comprised of 18 exons with a large 6.6 kb 3'-untranslated region (UTR, which we name hCDKL5_1. In addition we describe new exonic regions and a range of novel splice and UTR isoforms. This has enabled the description of an updated gene model in both species and a standardised nomenclature system for CDKL5 transcripts. Profiling revealed tissue- and brain development stage-specific differences in expression between transcript isoforms. These findings provide an essential backdrop for the diagnosis of CDKL5-related disorders, for investigations into the basic biology of this gene and its protein products, and for the rational design of gene-based and molecular therapies for these disorders.

  7. Systematic approach to characterisation of NORM in Thailand

    International Nuclear Information System (INIS)

    Chanyotha, S.; Kranrod, C.; Pengvanich, P.

    2015-01-01

    The aim of this article is to provide information on the systematic approach that has been developed for the measurement of natural radiation exposure and the characterisation of naturally occurring radioactive materials (NORM) in terms of occurrence and distribution in various industrial processes, including the produced waste from the mineral industries in Thailand. The approach can be adapted for various types of study areas. The importance of collaboration among research institutions is discussed. Some developments include 25 documents; the redesign of the field equipment, such as the gamma survey meter, for convenient access to conduct measurement in various study areas; the method to collect and analyse radon gas from a natural gas pipeline and the manganese dioxide fibre to adsorb radium on-site for laboratory analysis. The NORM project in Thailand has been carried out for more than 10 y to support the development of NORM regulation in Thailand. In the previous studies as well as current, international standards for action levels have been adopted for safety purpose. (authors)

  8. Characterisation and optical vapour sensing properties of PMMA thin films

    Energy Technology Data Exchange (ETDEWEB)

    Capan, I. [Balikesir University, Science and Arts Faculty, Physics Department, 10100 Balikesir (Turkey)], E-mail: inci.capan@gmail.com; Tarimci, C. [Ankara University, Faculty of Engineering, Department of Engineering Physics, 06100, Tandogan, Ankara (Turkey); Hassan, A.K. [Sheffield Hallam University, Materials and Engineering Research Institute, City Campus, Pond Street, Sheffield S1 1WB (United Kingdom); Tanrisever, T. [Balikesir University, Science and Arts Faculty, Chemistry Department, 10100 Balikesir (Turkey)

    2009-01-01

    The present article reports on the characterisation of spin coated thin films of poly (methyl methacrylate) (PMMA) for their use in organic vapour sensing application. Thin film properties of PMMA are studied by UV-visible spectroscopy, atomic force microscopy and surface plasmon resonance (SPR) technique. Results obtained show that homogeneous thin films with thickness in the range between 6 and 15 nm have been successfully prepared when films were spun at speeds between 1000-5000 rpm. Using SPR technique, the sensing properties of the spun films were studied on exposures to several halohydrocarbons including chloroform, dichloromethane and trichloroethylene. Data from measured kinetic response have been used to evaluate the sensitivity of the studied films to the various analyte molecules in terms of normalised response (%) per unit concentration (ppm). The highest PMMA film sensitivity of 0.067 normalised response per ppm was observed for chloroform vapour, for films spun at 1000 rpm. The high film's sensitivity to chloroform vapour was ascribed mainly to its solubility parameter and molar volume values. Effect of film thickness on the vapour sensing properties is also discussed.

  9. Non-Destructive Radiological Characterisation Of Contaminated And Activated Concrete

    International Nuclear Information System (INIS)

    Cantrel, E.

    2005-01-01

    The decommissioning of nuclear facilities leads to large quantities of concrete and building material wastes. Radioactivity in building structures arise from very different physical processes such as neutron activation (bioshield), diffusion of the contaminants in the material (primary coolant leakage, maintenance and fuel loading) or aerosol deposition. The variety of the building material also extends the range of faced radiological characteristics. Therefore the minimization of concrete waste generation requires extensive characterisations and the availability of different measurement tools and methods. Up to now, these measurements came from the coring and the radiological analysis of the concrete, which is a destructive, long and costly technique. Looking for alternative solutions, SCK-CEN has started to investigate in collaboration with EDF -research and development and CEA (France) several non destructive methods based on gamma spectroscopy and different spectral examinations using mathematical calibration and modelling tools available on the market. Information on in-depth activity distribution can be derived from in situ gamma spectra by modelling absorption laws (peak to peak ratios) and photons interactions (Compton front) in the bulk of the concrete. As they combine modelling and measurement, the different methodologies being evaluated involve a lot of uncertainty sources linked to the measurement environment, to the knowledge available on site (historical background, material composition), to the operator responsible for the data acquisition and to the performance of the equipment. Therefore a detailed sensitivity analysis is required to define the range of applicability and the performances of the different methods

  10. Characterisation of the SmartPET planar Germanium detectors

    Energy Technology Data Exchange (ETDEWEB)

    Boston, H.C. [Department of Physics, University of Liverpool, Oliver Lodge Laboratory, Liverpool L69 7ZE (United Kingdom)], E-mail: H.C.Boston@liverpool.ac.uk; Boston, A.J.; Cooper, R.J.; Cresswell, J.; Grint, A.N.; Mather, A.R.; Nolan, P.J.; Scraggs, D.P.; Turk, G. [Department of Physics, University of Liverpool, Oliver Lodge Laboratory, Liverpool L69 7ZE (United Kingdom); Hall, C.J.; Lazarus, I. [CCLRC Daresbury Laboratory, Warrington WA4 4AD (United Kingdom); Berry, A.; Beveridge, T.; Gillam, J.; Lewis, R. [School of Physics and Materials Engineering, Monash University, Melbourne (Australia)

    2007-08-21

    Small Animal Reconstruction PET (SmartPET) is a project funded by the UK medical research council (MRC) to demonstrate proof of principle that Germanium can be utilised in Positron Emission Tomography (PET). The SmartPET demonstrator consists of two orthogonal strip High Purity Germanium (HPGe) planar detectors manufactured by ORTEC. The aim of the project is to produce images of an internal source with sub mm{sup 3} spatial resolution. Before this image can be achieved the detectors have to be fully characterised to understand the response at any given location to a {gamma}-ray interaction. This has been achieved by probing the two detectors at a number of specified points with collimated sources of various energies and strengths. A 1 mm diameter collimated beam of photons was raster scanned in 1 mm steps across the detector. Digital pulse shape data were recorded from all the detector channels and the performance of the detector for energy and position determination has been assessed. Data will be presented for the first SmartPET detector.

  11. A dimensionless criterion for characterising internal transport barriers in tokamaks

    International Nuclear Information System (INIS)

    Tresset, G.; Litaudon, X.; Moreau, D.

    2000-07-01

    A simple criterion, based on a dimensionless parameter (ρ T * =ρ s /L T ) related to drift wave turbulence stabilisation and anomalous transport theory, is proposed in order to characterise the emergence and the space-time evolution of internal transport barriers (ITB's) during a tokamak discharge. The underlying physics which led us to consider the possible relevance of this parameter as a local indicator of a bifurcated plasma state is the breaking of the gyro-Bohm turbulence scaling by the diamagnetic velocity shear, which has been observed in various numerical simulations [e.g. X. Garbet and R.E. Waltz, Phys. Plasmas 3(1996) 1898]. The presence of an ITB is inferred when ρ T * exceeds a threshold value. The main features like the emergence time, location and even dynamics of ITB's can then be summarized on a single graphical representation consistent with measurement uncertainties. The validity of such a criterion is demonstrated on the Optimized Shear (OS) database of JET in several experimental configurations. Large database analysis and realtime control of OS discharges are envisaged as the most attractive applications. (author)

  12. Systematic approach to characterisation of NORM in Thailand.

    Science.gov (United States)

    Chanyotha, S; Kranrod, C; Pengvanich, P

    2015-11-01

    The aim of this article is to provide information on the systematic approach that has been developed for the measurement of natural radiation exposure and the characterisation of naturally occurring radioactive materials (NORM) in terms of occurrence and distribution in various industrial processes, including the produced waste from the mineral industries in Thailand. The approach can be adapted for various types of study areas. The importance of collaboration among research institutions is discussed. Some developments include 25 documents; the redesign of the field equipment, such as the gamma survey meter, for convenient access to conduct measurement in various study areas; the method to collect and analyse radon gas from a natural gas pipeline and the manganese dioxide fibre to adsorb radium on-site for laboratory analysis. The NORM project in Thailand has been carried out for more than 10 y to support the development of NORM regulation in Thailand. In the previous studies as well as current, international standards for action levels have been adopted for safety purpose. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Atmospheric aerosol characterisation at Cape Grim and Global Warming

    International Nuclear Information System (INIS)

    Cohen, D.D.; Garton, D.

    1998-01-01

    The Australia Global Baseline monitoring station at Cape Grim in north western Tasmania is operated by the Australian Bureau of Meteorology. ANSTO has been sampling, measuring and characterising fine particles of 2.5 μm diameters and less (PM2.5) at Cape Grim since the middle of 1992. Accelerator based ion beam analysis (IBA) techniques [2-41 have been used to identify over 25 different elemental species present in over 500 filters collected to date. The elements measured by PIXE, PIGME, ERDA and RBS include, H, C, N, O, F, Na, Al, Si, P, S, Cl, K, Ca, Ti, V, Mn, Fe, Co, Ni, Cu, Zn, Br and Pb. Of the measured elements not listed the majority occurred at concentrations below 10 ng/m 3 . The average monthly mass variations over the 5 year period from 1992 to 1997 are given. The average non-soil potassium was 92% of the total potassium, showing that the vast majority of fine potassium was associated with smoke from biomass burning. The highest lead value of 542 ng/m 3 occurred on 21 June 1992 and was associated with 337 ng/m 3 of bromine which, after correction for bromine in sea salt (Na was 3 ), was about the correct ratio to be associated with combustion of leaded petrol in motor vehicles

  14. Characterisation of advanced windows. Determination of thermal properties by measurements

    Energy Technology Data Exchange (ETDEWEB)

    Duer, K.

    2001-04-01

    This report describes work carried out with the aim of facilitating a full energy performance characterisation of advanced windows and glazings by means of measurements. The energy performance of windows and glazings are characterised by two parameters: The thermal transmittance (U-value) and the total solar energy transmittance (g-value) and methods to determine these two parameters by measurements have been investigated. This process has included the improvement of existing equipment and existing measuring methods as well as the development of new measuring equipment and new methods of measuring and data treatment. Measurements of the thermal transmittance of windows and glazings in a guarded hot box have been investigated. The calibration and measuring procedures for determining the U-values of facade windows were analysed and a suggestion for a new calibration and measuring procedure for determining the U-values of roof windows in a guarded hot box was elaborated. The accuracy of the guarded hot box measurements was examined by comparisons to measurements in a hot-plate device and excellent agreement between the results was obtained. Analysis showed that the expected uncertainty in the U-value measurement is about 5% for a specimen with a U-value of 1.75 W/m{sup 2}K. The U-values of three different windows were measured in two separate round robin tests applying two different calibration procedures. The windows U-values where ranging from 1.1 to 2.5 W/m{sup 2}K and all measured results were within the expected uncertainties of the measurements. On the basis of the investigations on hot box measurements a high degree of confidence in the measurement accuracy and the measuring procedure of the guarded hot box at the Department of Buildings and Energy has been obtained. Indoor g-value measurements in a calorimetric test facility (the METSET) mounted in a solar simulator have been investigated and a number of problems regarding these measurements have been

  15. The RCF [Rock Characterisation Facility]: engineering issues. Proof of evidence

    International Nuclear Information System (INIS)

    Allison, J.A.

    1996-01-01

    Proof of Evidence by an expert witness is presented in support of the case by Friends of the Earth (FOE) against the proposed construction by UK Nirex Ltd of an underground Rock Characterisation Facility (RCF) at a site in the Sellafield area. The RCF is part of an investigation by Nirex into a suitable site for an underground repository for the disposal of radioactive waste. The objections were raised at a Planning Inquiry in 1995. The evidence focuses on the engineering issues in key areas of uncertainty which Nirex claim can only be resolved through the construction of an RCF. These are: groundwater flow and radionuclide transport; natural and induced changes in the geological barrier; the design and construction of the repository. Particular attention is drawn to the uncertainties regarding the groundwater pathway due to the dominant influence of fractures and variability in the host rock. Significant uncertainties about the host rock performance will remain after the construction of the RCF and associated tests are complete. (5 figures; 28 references). (UK)

  16. Biosorption of mercury from aqueous solutions using highly characterised peats

    Directory of Open Access Journals (Sweden)

    A.M. Rizzuti

    2015-02-01

    Full Text Available This research investigated the biosorption of mercury from aqueous solutions by six highly characterised peats. Samples of the peats were tested both in unaltered condition and after being treated with hydrochloric acid (HCl to free up any occupied exchange sites. Other variables tested were sample dose, contact time, mixing temperature, and the concentration and pH of the mercury solution. Desorption studies were also performed, and tests were done to determine whether the peats could be re-used for mercury biosorption. The results indicate that all six peat types biosorb mercury from aqueous solutions extremely well (92−100 % removal and that their mercury removal capacities are not significantly affected by manipulation of the various factors tested. The factor that had the greatest impact on the mercury removal capacities of the peats was the pH of the mercury solution. The optimal mercury solution pH for mercury removal was in the range 5−7 for four of the peats and in the range 2−3 for the other two. The desorption results indicate that it may be possible to recover up to 41 % of the removed mercury. All of the peat types tested can be repeatedly re-used for additional mercury biosorption cycles. Hence, their disposal should not become a hazardous waste problem.

  17. Development and characterisation of injection moulded, all-polypropylene composites

    Directory of Open Access Journals (Sweden)

    A. Kmetty

    2013-02-01

    Full Text Available In this work, all-polypropylene composites (all-PP composites were manufactured by injection moulding. Prior to injection moulding, pre-impregnated pellets were prepared by a three-step process (filament winding, compression moulding and pelletizing. A highly oriented polypropylene multifilament was used as the reinforcement material, and a random polypropylene copolymer (with ethylene was used as the matrix material. Plaque specimens were injection moulded from the pellets with either a film gate or a fan gate. The compression moulded sheets and injection moulding plaques were characterised by shrinkage tests, static tensile tests, dynamic mechanical analysis and falling weight impact tests; the fibre distribution and fibre/matrix adhesion were analysed with light microscopy and scanning electron microscopy. The results showed that with increasing fibre content, both the yield stress and the perforation energy significantly increased. Of the two types of gates used, the fan gate caused the mechanical properties of the plaque specimens to become more homogeneous (i.e., the differences in behaviour parallel and perpendicular to the flow direction became negligible.

  18. Extraction and characterisation of cellulose nanocrystals from pineapple peel

    Directory of Open Access Journals (Sweden)

    Ana Raquel Madureira

    2018-04-01

    Full Text Available The potential of pineapple peel as a source of cellulose nanocrystals was evaluated. Peels skin from fresh-cut fruit was used as raw material. These residues were purified to remove pigments, lipids and hemicellulose, and a bleaching process for delignification was carried out for 4-6 h. All resulting products were characterised for their lignin, hemicellulose, cellulose and ash contents using standard techniques. Dry matter at the end was low (ca. 50% compared with the raw material (ca. 90%. The process applied resulted in ca. 20% (m/m of purified cellulose (ca. 80% purity, with ineligible levels of lignin and hemicellulose present, especially when using 6h of bleaching. The purified cellulose was subject to acid hydrolysis for nanocrystal extraction with two testing times, 30 and 60 minutes. These cellulose nanocrystals had small sizes (< 1000 nm, with high variability and negative zeta potential values. The time of extraction did not affect the nanocrystals’ chemical and physical properties. The use of 6 h of bleaching treatment during purification was shown to be more effective than 4 h. Pineapple peel was demonstrated to be a good source of cellulose for the production of cellulose nanocrystals.

  19. Characterisation of the core poloidal flow at ASDEX upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Lebschy, Alexander [Max-Planck-Institut fuer Plasmaphysik, Boltzmannstr. 2, D-85748 Garching (Germany); Physik-Department E28, Technische Universitaet Muenchen, D-85748 Garching (Germany); McDermott, Rachael M.; Geiger, Benedikt; Cavedon, Marco; Dunne, Michael G.; Dux, Ralph; Fischer, Rainer; Kappatou, Athina; McCarthy, Patrick J.; Viezzer, Eleonora [Max-Planck-Institut fuer Plasmaphysik, Boltzmannstr. 2, D-85748 Garching (Germany); Collaboration: the ASDEX Upgrade Team

    2016-07-01

    Plasma rotation has a strong influence on the transport of heat, particles, and momentum in fusion plasmas via a variety of mechanisms, for example, by the stabilization of modes and the suppression of plasma turbulence. In tokamaks, the toroidal rotation (u{sub tor}) is essentially a free parameter that is usually dominated by the external momentum input from neutral beams used to heat the plasma. The poloidal rotation (u{sub pol}), on the other hand, is strongly damped and is predicted to remain at Neoclassical (NC) levels of a few km/s. Measuring the inboard-outboard asymmetry of u{sub tor} with charge exchange recombination spectroscopy enables an indirect measurement of u{sub pol} and, hence, the measurement of the complete plasma flow on a flux surface. In order to characterise the nature of u{sub pol} at ASDEX Upgrade a poloidal rotation database has been built that contains a large variation in the parameters that, according to NC theory, drive u{sub pol}; namely, the main ion temperature and density gradients and collisionality. Initial results from this database and a detailed comparison of u{sub pol} to NC theory in interesting plasma scenarios, are presented in this poster.

  20. Anthropometric characterisation of elbow angles and lines among Indian children

    Directory of Open Access Journals (Sweden)

    Bhanu Awasthi

    2017-01-01

    Full Text Available Background: For understanding injuries in paediatric elbow and checking the degree of reduction after manipulation, various radiological criteria using anthropometric parameters are used. Since anthropometric parameters of Caucasians are different from European and Mongoloids, their parameters cannot be applied on our population. Hence, there is a need to characterise anthropometric parameters of elbow among children in the Indian population. Materials and Methods: The study population comprised all cases of injury to the elbow joint between 3 and 13 years of age reporting to the Department of Orthopaedics during the study. The X-rays films were preserved, and the angles and lines (as anthropometric parameters were drawn on the radiographs. Results: Mean ± (standard deviation [SD] for Baumann angle in children included in this study was 75° ± 4.70°. Mean ± (SD of Baumann angle in males was 76° ± 4.44° and females was 74° ± 5.37°. Mean ± (SD for lateral capitellohumeral angle in children from 3 to 13 years of age was 49 ± 5.75. Conclusions: As the values of normal side have been found to affect the functional and cosmetic outcome of the affected extremity, slight changes in values of our population in comparison to that of the Western population can significantly affect the outcome.

  1. Characterisation of COPD heterogeneity in the ECLIPSE cohort

    Directory of Open Access Journals (Sweden)

    Agusti Alvar

    2010-09-01

    Full Text Available Abstract Background Chronic obstructive pulmonary disease (COPD is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE. Methods We studied 2164 clinically stable COPD patients, 337 smokers with normal lung function and 245 never smokers. In these individuals, we measured clinical parameters, nutritional status, spirometry, exercise tolerance, and amount of emphysema by computed tomography. Results COPD patients were slightly older than controls and had more pack years of smoking than smokers with normal lung function. Co-morbidities were more prevalent in COPD patients than in controls, and occurred to the same extent irrespective of the GOLD stage. The severity of airflow limitation in COPD patients was poorly related to the degree of breathlessness, health status, presence of co-morbidity, exercise capacity and number of exacerbations reported in the year before the study. The distribution of these variables within each GOLD stage was wide. Even in subjects with severe airflow obstruction, a substantial proportion did not report symptoms, exacerbations or exercise limitation. The amount of emphysema increased with GOLD severity. The prevalence of bronchiectasis was low (4% but also increased with GOLD stage. Some gender differences were also identified. Conclusions The clinical manifestations of COPD are highly variable and the degree of airflow limitation does not capture the heterogeneity of the disease.

  2. Practical application of the KMS: 2) site characterisation - 16355

    International Nuclear Information System (INIS)

    Semba, Takeshi; Osawa, Hideaki; Hioki, Kazumasa; Tachibana, Shoko; Takase, Hiroyasu; McKinley, Ian

    2009-01-01

    The characterisation of potential repository sites will produce huge volumes of information, which must be correlated, quality assured, integrated, analysed, documented and archived in a rigorous and efficient manner. While some of this work involves rather routine data handling that may be easily automated, much of it requires input of tacit knowledge which involves the experience of expert staff. To provide support for the Japanese implementer and also the regulator, a JAEA team is attempting to capture both Japanese and international geo-synthesis experience within a Knowledge Management System (KMS) framework, which is termed ISIS. This is a hybrid system that combines 'smart' software with human experts, although an aim is to capture tacit knowledge within expert systems to the maximum extent practicable. Initial tests, based mainly on field work carried out by JAEA at the sites of the Mizunami and Horonobe underground research laboratories, have utilised expert systems as modules in a 'blackboard system' approach to planning or implementing the processing of field data. Examples are presented of sub-systems where this approach has already been demonstrated and perspectives for more extensive application to integrated geo-synthesis management are discussed. (authors)

  3. Characterisation of gaharu hydrosol: Physical, chemical and microbiological properties

    International Nuclear Information System (INIS)

    Nur Humaira Lau Abdullah; Salmah Moosa

    2010-01-01

    Gaharu hydrosol is produced during the hydro distillation of resinous wood part of Aquilaria sp. This aromatic water is being considered as a by-product in the industry. There is interest to turn this aromatic by-product into aroma therapy products. The present study is carried out in order to understand the properties of gaharu hydrosol, physically, chemically and microbiologically. Gaharu hydrosol from two different extraction facilities for example at Kedaik Agar wood Sdn. Bhd. and Malaysian Nuclear Agency were characterised in this study. All the gaharu hydrosol samples displayed acidic nature, with pH in the range of 3.62 - 4.53. Four antioxidant assays were carried out to ascertain the antioxidant capabilities of two gaharu hydrosol samples through the total phenolic content assay, ABTS + radical scavenging activity, DPPH· radical scavenging activity and ferric reducing activity (FRAP). The results revealed that the samples exhibited lower antioxidant capabilities as compared to the positive control. For microbial population study, fungi was not present in the samples as there was no growth observed on the Plate Sabouraud Dextrose Agar (SDA) using membrane filtration technique. The antibacterial activity of the gaharu hydrosol against Staphylococcus aureus and Pseudomonas aeruginosa was determined using agar dilution method and disk diffusion method. The results showed that the gaharu hydrosol did not inhibit the growth of both the bacteria. The results obtained from this study will be further evaluated for the development of new products using this aromatic gaharu by-product. (author)

  4. Assessment and Characterisation of Ireland's Green Tides (Ulva Species)

    Science.gov (United States)

    Wilkes, Robert J.; Heesch, Svenja; Bermejo, Ricardo; Johnson, Mark P.; Morrison, Liam

    2017-01-01

    Enrichment of nutrients and metals in seawater associated with anthropogenic activities can threaten aquatic ecosystems. Consequently, nutrient and metal concentrations are parameters used to define water quality. The European Union’s Water Framework Directive (WFD) goes further than a contaminant-based approach and utilises indices to assess the Ecological Status (ES) of transitional water bodies (e.g. estuaries and lagoons). One assessment is based upon the abundance of opportunistic Ulva species, as an indication of eutrophication. The objective of this study was to characterise Ireland’s Ulva blooms through the use of WFD assessment, metal concentrations and taxonomic identity. Furthermore, the study assessed whether the ecological assessment is related to the metal composition in the Ulva. WFD algal bloom assessment revealed that the largest surveyed blooms had an estimated biomass of 2164 metric tonnes (w/w). DNA sequences identified biomass from all locations as Ulva rigida, with the exception of New Quay, which was Ulva rotundata. Some blooms contained significant amounts of As, Cu, Cr, Pb and Sn. The results showed that all metal concentrations had a negative relationship (except Se) with the Ecological Quality Ratio (EQR). However, only in the case of Mn were these differences significant (p = 0.038). Overall, the metal composition and concentrations found in Ulva were site dependent, and not clearly related to the ES. Nevertheless, sites with a moderate or poor ES had a higher variability in the metals levels than in estuaries with a high ES. PMID:28045947

  5. Development of an automatic characterisation system for silicon detectors

    International Nuclear Information System (INIS)

    Hacker, J.; Bergauer, T.; Krammer, M.; Wedenig, R.

    2002-01-01

    The CMS experiment will be equipped with the largest silicon tracker in the world. The tracker will consist of about 25,000 silicon sensors which will cover an area of more than 200 m 2 . Four quality test centres will carry out various checks on a representative sample of sensors to assure a homogeneous quality throughout the 2((1)/(2)) years of production. One of these centres is based in Vienna. To cope with the large number of sensors a fast and fully automatic characterisation system has been realised. We developed the software in LabView and built a cost-efficient probe station in house by assembling individual components and commercial instruments. Both the global properties of a sensor and the characteristic quantities of the individual strips can be measured. The measured data are immediately analysed and sent to a central database. The mechanical and electrical set-up will be explained and results from CMS prototype sensors are presented

  6. Characterisation of polyhydroxyalkanoate copolymers with controllable four-monomer composition.

    Science.gov (United States)

    Dai, Yu; Lambert, Lynette; Yuan, Zhiguo; Keller, Jurg

    2008-03-20

    Polyhydroxyalkanoate (PHA) copolymers comprising the four monomers 3-hydroxybutyrate (3HB), 3-hydroxyvalerate (3HV), 3-hydroxy-2-methylvalerate (3HMV) and 3-hydroxy-2-methylbutyrate (3HMB) were generated using the recently discovered Defluviicoccus vanus-related glycogen accumulating organisms (DvGAOs) under anaerobic conditions without applying any nutrient limitations. The composition could be manipulated in a defined range by modifying the ratio of propionate and acetate provided in the feed stream. The PHAs produced were characterised as random copolymers (from propionate alone) or a mixture of random copolymers (from mixture of propionate and acetate) through microstructure analysis using 13C NMR spectroscopy. The sequence distribution of all eight comonomer pairs in the carbonyl region of 3HB and 3HV was identified and assigned with confidence utilising two-dimensional heteronuclear multiple bond coherence (HMBC) spectroscopy. Weight average molecular weights were in the range 390-560 kg/mol. Differential scanning calorimetry (DSC) traces showed that the melting temperature (Tm) varied between 70 and 161 degrees C and glass transition temperature (Tg) ranged from -8 to 0 degrees C. The incorporation of considerable amounts of 3HMV and 3HMB monomer units introduced additional "defects" into the PHBV copolymer structure and hence greatly lowered the crystallinity. The data indicate the potential of these four-monomer PHAs to be employed for practical applications, considering their favourable properties and the cost-effective production process using a mixed culture and simple carbon sources.

  7. Functional characterisation of filamentous actin probe expression in neuronal cells.

    Directory of Open Access Journals (Sweden)

    Shrujna Patel

    Full Text Available Genetically encoded filamentous actin probes, Lifeact, Utrophin and F-tractin, are used as tools to label the actin cytoskeleton. Recent evidence in several different cell types indicates that these probes can cause changes in filamentous actin dynamics, altering cell morphology and function. Although these probes are commonly used to visualise actin dynamics in neurons, their effects on axonal and dendritic morphology has not been systematically characterised. In this study, we quantitatively analysed the effect of Lifeact, Utrophin and F-tractin on neuronal morphogenesis in primary hippocampal neurons. Our data show that the expression of actin-tracking probes significantly impacts on axonal and dendrite growth these neurons. Lifeact-GFP expression, under the control of a pBABE promoter, caused a significant decrease in total axon length, while another Lifeact-GFP expression, under the control of a CAG promoter, decreased the length and complexity of dendritic trees. Utr261-EGFP resulted in increased dendritic branching but Utr230-EGFP only accumulated in cell soma, without labelling any neurites. Lifeact-7-mEGFP and F-tractin-EGFP in a pEGFP-C1 vector, under the control of a CMV promoter, caused only minor changes in neuronal morphology as detected by Sholl analysis. The results of this study demonstrate the effects that filamentous actin tracking probes can have on the axonal and dendritic compartments of neuronal cells and emphasise the care that must be taken when interpreting data from experiments using these probes.

  8. Characterising aquifer treatment for pathogens in managed aquifer recharge.

    Science.gov (United States)

    Page, D; Dillon, P; Toze, S; Sidhu, J P S

    2010-01-01

    In this study the value of subsurface treatment of urban stormwater during Aquifer Storage Transfer Recovery (ASTR) is characterised using quantitative microbial risk assessment (QMRA) methodology. The ASTR project utilizes a multi-barrier treatment train to treat urban stormwater but to date the role of the aquifer has not been quantified. In this study it was estimated that the aquifer barrier provided 1.4, 2.6, >6.0 log(10) removals for rotavirus, Cryptosporidium and Campylobacter respectively based on pathogen diffusion chamber results. The aquifer treatment barrier was found to vary in importance vis-à-vis the pre-treatment via a constructed wetland and potential post-treatment options of UV-disinfection and chlorination for the reference pathogens. The risk assessment demonstrated that the human health risk associated with potable reuse of stormwater can be mitigated (disability adjusted life years, DALYs aquifer is integrated with suitable post treatment options into a treatment train to attenuate pathogens and protect human health.

  9. Characterisation of fucoidan extracted from Malaysian Sargassum binderi.

    Science.gov (United States)

    Lim, Seng Joe; Wan Aida, Wan Mustapha; Maskat, Mohamad Yusof; Latip, Jalifah; Badri, Khairiah Haji; Hassan, Osman; Yamin, Bohari M

    2016-10-15

    Fucoidan is a sulphated polysaccharide that consists mainly of fucose, normally found in brown seaweeds. In this study, fucoidan was extracted from Sargassum binderi (Fsar) from Malaysia and subsequently characterised. The chemical characteristics of Fsar were found to be different than those of commercial food grade fucoidan (Fysk) and those of previously studied fucoidans. NMR analysis proposed that the main structure of Fsar is →3)fuc-2-OSO3(-)(1→3)fuc(1→. The molecular weight (47.87kDa) and degree of sulphation (0.20) of Fsar were higher than those of Fysk, at 27.98kDa and 0.15, respectively. However, Fsar's polydispersity index (1.12) and fucose content (34.50%) were lower than those of Fysk, at 1.88 and 43.30%, respectively. Both Fsar and Fysk showed similar thermo-gravimetric properties with four mass losses, amorphous in nature and negative optical rotations. Results show that Fsar has fundamental characteristics of fucoidan with different structural conformation i.e. variation in glycosidic linkages and sulphate group orientation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Polyferric sulphate: preparation, characterisation and application in coagulation experiments.

    Science.gov (United States)

    Zouboulis, A I; Moussas, P A; Vasilakou, F

    2008-07-15

    The process of coagulation is a core environmental protection technology, which is mainly used in the water or wastewater treatment facilities. Research is now focused on the development of inorganic pre-polymerised coagulants. A characteristic example is PFS (polyferric sulphate), a relatively new pre-polymerised inorganic coagulant with high cationic charge. In this paper, the role of major parameters, including temperature, types of chemical reagents, ratio r=[OH]/[Fe], rate of base addition in the preparation stages of PFS were investigated. Furthermore, the prepared PFS was characterised based on typical properties, such as the percentage of the polymerised iron present in the compound, z-potential, pH, etc. Moreover, dynamics of coagulation process were examined by means of the Photometric Dispersion Analyzer (PDA). Finally, the coagulation efficiency of PFS in treating kaolin suspension and biologically pre-treated wastewater was evaluated in comparison with the respective conventional coagulant agent. The results indicate that certain parameters, such as the r value, the rate of base addition and the duration and temperature of the polymerisation stage, significantly affected the properties of the PFS. Additionally, the prepared PFS polymerised coagulants exhibit a significantly better coagulation performance than the respective non-polymerised one, i.e. ferric sulphate.

  11. Characterisation of phosphate rocks at kurun mountain, Sudan

    International Nuclear Information System (INIS)

    Abdelgader, G. A. M.

    2014-08-01

    This main objective of this study was to characterise some Sudanese phosphate raw materials collected from Jebel Kurun, located in the eastern part of Nuba Mountain, Western Sudan. The study also aimed to investigate the association between uranium and phosphate and to determine the concentration of some essential elements and trace elements in the phosphate rock. A total of 30 samples were collected from Karun's eastran mountains, near Abujibiha City and have been analyzed for the selected elements using x-ray fluorescence. The obtained results showed that the average concentration of elements was Ca (11.3) and Fe (1.7) as a percentage, while it was Cu (1617.7), Ni (258.4), Pb (185.9), Ti (27.62), V (3779.9), U (160.9), Zn (152.8) and Mn (776.3) in ppm. The average total phosphorus content (analyzed as P O5 %) using UV-visible spectrometer was found to be 30.54%. This could be considered is acceptable percentage for phosphate to be 30.54%. This could be considered is acceptable percentage for phosphate to be used in industrial fertilizers and phosphoric acid production. The average total calcium carbonate was 15.7%. For the elements distribution, uranium found to be more concentrated in the summit of Jebel Kurun, and it displayed a correlation with lead. Furthermore, four groups of association have been noticed, based on elements concentrations.(Author)

  12. Electrical Characterisation of electron beam exposure induced Defects in silicon

    Energy Technology Data Exchange (ETDEWEB)

    Danga, Helga T., E-mail: helga.danga@up.ac.za; Auret, Francois D.; Coelho, Sergio M.M.; Diale, Mmantsae

    2016-01-01

    The defects introduced in epitaxially grown p-type silicon (Si) during electron beam exposure were electrically characterised using deep level transient spectroscopy (DLTS) and high resolution Laplace-DLTS. In this process, Si samples were first exposed to the conditions of electron beam deposition (EBD) without metal deposition. This is called electron beam exposure (EBE) herein. After 50 minutes of EBE, nickel (Ni) Schottky contacts were fabricated using the resistive deposition method. The defect level observed using the Ni contacts had an activation energy of H(0.55). This defect has an activation energy similar to that of the I-defect. The defect level is similar to that of the HB4, a boron related defect. DLTS depth profiling revealed that H(0.55) could be detected up to a depth of 0.8 μm below the junction. We found that exposing the samples to EBD conditions without metal deposition introduced a defect which was not introduced by the EBD method. We also observed that the damage caused by EBE extended deeper into the material compared to that caused by EBD.

  13. Nuclear Energy Agency task group on Radiological Characterisation for Decommissioning of Nuclear Installations

    International Nuclear Information System (INIS)

    Larsson, Arne; Weber, Inge

    2016-01-01

    Radiological characterisation plays a significant role in the process of decommissioning of shut-down nuclear facilities in order to ensure the protection of the environment and radiation safety. At all stages of a decommissioning programme or project, adequate radiological characterisation is of crucial importance, not least from a material and waste perspective. The radiological characterisation is a key element for planning, controlling and optimising decommissioning and dismantling activities. Experience has shown that data and information from the operation of a facility can - supplemented by recently collected and analysed data and information - be of crucial importance for decisions on waste management and for characterisation of radioactive waste. Once the dismantling has been done, some information may be hard, costly or even impossible to obtain later in the waste management process. This was the reason why the Working Party on Decommissioning and Dismantling (WPDD) of the OECD Nuclear Energy Agency (NEA) decided in late 2013 to extend the mandate of the Task Group on Radiological Characterisation and Decommissioning (TGRCD) for a second phase focusing on nuclear facility characterisation from a waste and material end-state perspective whereas the first phase focused on overall strategies of radiological characterisation. This paper gives an overview of the activities and findings within both phases up to now. (authors)

  14. Synthesis and structural characterisation using Rietveld and pair distribution function analysis of layered mixed titanium-zirconium phosphates

    International Nuclear Information System (INIS)

    Burnell, Victoria A.; Readman, Jennifer E.; Tang, Chiu C.; Parker, Julia E.; Thompson, Stephen P.; Hriljac, Joseph A.

    2010-01-01

    Crystalline metal (IV) phosphates with variable zirconium-to-titanium molar ratios of general formula (Ti 1-x Zr x )(HPO 4 ) 2 .H 2 O have been prepared by precipitation of soluble salts of the metals with phosphoric acid and heating the amorphous solids in 12 M H 3 PO 4 in an autoclave. The new materials are structurally characterised by Rietveld analysis of synchrotron X-ray powder diffraction data and pair distribution function (PDF) analysis of high energy synchrotron X-ray total scattering data. A broad range of zirconium-titanium phosphate solid solutions were formed showing isomorphous substitution of titanium by zirconium in the α-titanium phosphate lattice and vice versa for titanium substitution into the α-zirconium phosphate lattice. In both cases the solubility is partial with the coexistence of two substituted phases observed in samples with nominal compositions between the solubility limits. - Graphical abstract: Layered phosphates of general formula (Ti 1-x Zr x )(HPO 4 ).H 2 O have been prepared by the hydrothermal treatment of amorphous gels in phosphoric acid and characterised by Rietveld analysis of high resolution synchrotron X-ray powder diffraction data and pair distribution function analysis of high energy synchrotron X-ray total scattering data.

  15. Giro form reading machine

    Science.gov (United States)

    Minh Ha, Thien; Niggeler, Dieter; Bunke, Horst; Clarinval, Jose

    1995-08-01

    Although giro forms are used by many people in daily life for money remittance in Switzerland, the processing of these forms at banks and post offices is only partly automated. We describe an ongoing project for building an automatic system that is able to recognize various items printed or written on a giro form. The system comprises three main components, namely, an automatic form feeder, a camera system, and a computer. These components are connected in such a way that the system is able to process a bunch of forms without any human interactions. We present two real applications of our system in the field of payment services, which require the reading of both machine printed and handwritten information that may appear on a giro form. One particular feature of giro forms is their flexible layout, i.e., information items are located differently from one form to another, thus requiring an additional analysis step to localize them before recognition. A commercial optical character recognition software package is used for recognition of machine-printed information, whereas handwritten information is read by our own algorithms, the details of which are presented. The system is implemented by using a client/server architecture providing a high degree of flexibility to change. Preliminary results are reported supporting our claim that the system is usable in practice.

  16. PowerForms

    DEFF Research Database (Denmark)

    Brabrand, Claus; Møller, Anders; Ricky, Mikkel

    2000-01-01

    All uses of HTML forms may benefit from validation of the specified input field values. Simple validation matches individual values against specified formats, while more advanced validation may involve interdependencies of form fields. There is currently no standard for specifying or implementing...

  17. Mastering HTML5 forms

    CERN Document Server

    Gupta, Gaurav

    2013-01-01

    This tutorial will show you how to create stylish forms, not only visually appealing, but interactive and customized, in order to gather valuable user inputs and information.Enhance your skills in building responsive and dynamic web forms using HTML5, CSS3, and related technologies. All you need is a basic understanding of HTML and PHP.

  18. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  19. Characterisation of Bergeyella spp. isolated from the nasal cavities of piglets.

    Science.gov (United States)

    Lorenzo de Arriba, M; Lopez-Serrano, S; Galofre-Mila, N; Aragon, V

    2018-04-01

    The aim of this study was to characterise bacteria in the genus Bergeyella isolated from the nasal passages of healthy piglets. Nasal swabs from 3 to 4 week-old piglets from eight commercial domestic pig farms and one wild boar farm were cultured under aerobic conditions. Twenty-nine Bergeyella spp. isolates were identified by partial 16S rRNA gene sequencing and 11 genotypes were discriminated by enterobacterial repetitive intergenic consensus (ERIC)-PCR. Bergeyella zoohelcum and Bergeyella porcorum were identified within the 11 genotypes. Bergeyella spp. isolates exhibited resistance to serum complement and phagocytosis, poor capacity to form biofilms and were able to adhere to epithelial cells. Maneval staining was consistent with the presence of a capsule. Multiple drug resistance (resistance to three or more classes of antimicrobial agents) was present in 9/11 genotypes, including one genotype isolated from wild boar with no history of antimicrobial use. In conclusion, Bergeyella spp. isolates from the nasal cavities of piglets showed some in vitro features indicative of a potential for virulence. Further studies are necessary to identify the role of Bergeyella spp. in disease and within the nasal microbiota of pigs. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  20. Characterisation of transparent exopolymer particles (TEP) produced during algal bloom: A membrane treatment perspective

    KAUST Repository

    Villacorte, Loreen O.

    2013-01-01

    Algal blooms are currently a major concern of the membrane industry as it generates massive concentrations of organic matter (e.g. transparent exopolymer particles [TEP]), which can adversely affect the operation of membrane filtration systems. The goal of this study is to understand the production, composition and membrane rejection of these organic materials using different characterisation techniques. Two common species of bloom-forming freshwater and marine algae were cultivated in batch cultures for 30days and the productions of TEP and other organic matter were monitored at different growth phases. TEP production of the marine diatom, Chaetoceros affinis, produced 6-9 times more TEP than the freshwater blue-green algae, Microcystis. The organic substances produced by both algal species were dominated by biopolymeric substances such as polysaccharides (45-64%) and proteins (2-17%) while the remaining fraction comprises of low molecular weight refractory (humic-like) and/ or biogenic organic substances. MF/UF membranes mainly rejected the biopolymers but not the low molecular weight organic materials. MF membranes (0.1-0.4 lm) rejected 42-56% of biopolymers, while UF membranes (10-100 kDa) rejected 65-95% of these materials. Further analysis of rejected organic materials on the surface of the membranes revealed that polysac-charides and proteins are likely responsible for the fouling of MF/UF systems during an algal bloom situation. © 2013 Desalination Publications.