WorldWideScience

Sample records for forming region iras

  1. Far-infrared investigation of the Taurus star-forming region using the IRAS database

    International Nuclear Information System (INIS)

    Hughes, J.D.

    1986-01-01

    The Taurus-Auriga complex was selected as the first molecular cloud to be investigated in this study. The Taurus clouds were defined as lying between 04h and 05h in R.A. and +16 to +31 degrees in Dec., then the IRAS point-source catalogue was searched for sources with good or moderate quality fluxes in all three of the shortest IRAS bands. The sources selected were then classified into subgroups according to their IRAS colors. Taurus is generally believed to be an area of low-mass star formation, having no luminous O-B associations within or near to the cloud complex. Once field stars, galaxies and planetary nebulae had been removed from the sample only the molecular cloud cores, T Tauri stars and a few emission-line A and B stars remained. The great majority of these objects are pre-main sequence in nature and, as stated by Chester (1985), main sequence stars without excess far-infrared emission would only be seen in Taurus if their spectral types were earlier than about A5 and then not 25 microns. By choosing our sample in this way we are naturally selecting the hotter and thus more evolved sources. To counteract this, the molecular cloud core-criterion was applied to soruces with good or moderate quality flux at 25, 60 and 100 microns, increasing the core sample by about one third. The candidate protostar B335 is only detected by IRAS at 60 and 100 microns while Taurus is heavily contaminated by cirrus at 100 microns. This means that detection at 25 microns is also required with those at 60 and 100 microns to avoid confusing a ridge of cirrus with a genuine protostar. The far-infrared luminosity function of these sources is then calculated and converted to the visual band by a standard method to compare with the field star luminosity function of Miller and Scalo

  2. X-RAY AND RADIO OBSERVATIONS OF THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    Energy Technology Data Exchange (ETDEWEB)

    Montes, V. A.; Hofner, P.; Anderson, C.; Rosero, V. [Physics Department, New Mexico Tech, 801 Leroy Place, Socorro, NM 87801 (United States)

    2015-08-15

    We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-ray sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.

  3. X-RAY EMISSION FROM YOUNG STARS IN THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    International Nuclear Information System (INIS)

    Anderson, C. N.; Hofner, P.; Creech-Eakman, M.; Shepherd, D.

    2011-01-01

    We present a 40 ks Chandra observation of the IRAS 20126+4104 core region. In the inner 6'' two X-ray sources were detected, which are coincident with the radio jet source I20S and the variable radio source I20Var. No X-ray emission was detected from the nearby massive protostar I20N. The spectra of both detected sources are hard and highly absorbed, with no emission below 3 keV. For I20S, the measured 0.5-8 keV count rate was 4.3 counts ks -1 . The X-ray spectrum was fitted with an absorbed 1T APEC model with an energy of kT =10 keV and an absorbing column of N H = 1.2 x 10 23 cm -2 . An unabsorbed X-ray luminosity of about 1.4 x 10 32 erg s -1 was estimated. The spectrum shows broad line emission between 6.4 and 6.7 keV, indicative of emission from both neutral and highly ionized iron. The X-ray light curve indicates that I20S is marginally variable; however, no flare emission was observed. The variable radio source I20Var was detected with a count rate of 0.9 counts ks -1 but there was no evidence of X-ray variability. The best-fit spectral model is a 1T APEC model with an absorbing hydrogen column of N H = 1.1 x 10 23 cm -2 and a plasma energy of kT = 6.0 keV. The unabsorbed X-ray luminosity is about 3 x 10 31 erg s -1 .

  4. STAR-FORMING ACTIVITY IN THE H ii REGIONS ASSOCIATED WITH THE IRAS 17160–3707 COMPLEX

    Energy Technology Data Exchange (ETDEWEB)

    Nandakumar, G.; Veena, V. S.; Vig, S.; Tej, A. [Indian Institute of Space Science and Technology, Thiruvananthapuram 695 547 (India); Ghosh, S. K.; Ojha, D. K. [Tata Institute of Fundamental Research, Mumbai (Bombay) 400 005 (India)

    2016-11-01

    We present a multiwavelength investigation of star formation activity toward the southern H ii regions associated with IRAS 17160–3707, located at a distance of 6.2 kpc with a bolometric luminosity of 8.3 × 10{sup 5} L {sub ⊙}. The ionized gas distribution and dust clumps in the parental molecular cloud are examined in detail using measurements at infrared, submillimeter and radio wavelengths. The radio continuum images at 1280 and 610 MHz obtained using the Giant Metrewave Radio Telescope reveal the presence of multiple compact sources as well as nebulous emission. At submillimeter wavelengths, we identify seven dust clumps and estimate their physical properties such as temperature: 24–30 K, mass: 300–4800 M {sub ⊙} and luminosity: 9–317 × 10{sup 2} L {sub ⊙} using modified blackbody fits to the spectral energy distributions (SEDs) between 70 and 870 μ m. We find 24 young stellar objects (YSOs) in the mid-infrared, with a few of them coincident with the compact radio sources. The SEDs of the YSOs have been fitted by the Robitaille models and the results indicate that those having radio compact sources as counterparts host massive objects in early evolutionary stages with best fit age ≤0.2 Myr. We compare the relative evolutionary stages of clumps using various signposts such as masers, ionized gas, presence of YSOs and infrared nebulosity, and find six massive star-forming clumps and one quiescent clump. Of the former, five are in a relatively advanced stage and one in an earlier stage.

  5. Observation of the HH 1 and 2 region with IRAS

    International Nuclear Information System (INIS)

    Pravdo, S.H.; Chester, T.J.

    1987-01-01

    Infrared Astronomical Satellite (IRAS) observations of the region in Orion containing HH 1 and 2 reveal for the first time the large-scale distribution of newly formed stars. New infrared sources discovered in these observations are discussed, and attempts are made to untangle the complex infrared morphology of this field. A major finding of this study is that HH 1 is near the peak of an intense and broad plateau of 60 and 100 micron emission that spatially corresponds well with the boundaries of a previously detected molecular cloud. Other findings include the detection of an emitting circum-HH object dust complex around HH 2, 25 micron emission associated with the putative HH 1 and 2 exciting source discovered with the VLA, a new luminous far-infrared source, and numerous infrared source complexes, some in blank optical fields and others in fields containing optical emission-line stars. 37 references

  6. Improved selection criteria for H II regions, based on IRAS sources

    Science.gov (United States)

    Yan, Qing-Zeng; Xu, Ye; Walsh, A. J.; Macquart, J. P.; MacLeod, G. C.; Zhang, Bo; Hancock, P. J.; Chen, Xi; Tang, Zheng-Hong

    2018-05-01

    We present new criteria for selecting H II regions from the Infrared Astronomical Satellite (IRAS) Point Source Catalogue (PSC), based on an H II region catalogue derived manually from the all-sky Wide-field Infrared Survey Explorer (WISE). The criteria are used to augment the number of H II region candidates in the Milky Way. The criteria are defined by the linear decision boundary of two samples: IRAS point sources associated with known H II regions, which serve as the H II region sample, and IRAS point sources at high Galactic latitudes, which serve as the non-H II region sample. A machine learning classifier, specifically a support vector machine, is used to determine the decision boundary. We investigate all combinations of four IRAS bands and suggest that the optimal criterion is log(F_{60}/F_{12})≥ ( -0.19 × log(F_{100}/F_{25})+ 1.52), with detections at 60 and 100 {μ}m. This selects 3041 H II region candidates from the IRAS PSC. We find that IRAS H II region candidates show evidence of evolution on the two-colour diagram. Merging the WISE H II catalogue with IRAS H II region candidates, we estimate a lower limit of approximately 10 200 for the number of H II regions in the Milky Way.

  7. Multi-wavelength study of two possible cloud-cloud collision regions: IRAS 02459+6029 and IRAS 22528+5936

    International Nuclear Information System (INIS)

    Li Nan; Wang Junjie

    2012-01-01

    Based on observations of 12 CO (J=2–1), we select targets from archived Infrared Astronomical Satellite (IRAS) data of IRAS 02459+6029 and IRAS 22528+5936 as samples of cloud-cloud collision, according to the criteria given by Vallee. Then we use the Midcourse Space Experiment (MSX) A band (8.28 μm) images and the NRAO VLA Sky Survey (NVSS) (1.4 GHz) continuum images to investigate the association between molecular clouds traced by the CO contour maps. The distribution of dust and ionized hydrogen shows an obvious association with the CO contour maps toward IRAS 02459+6029. However, in the possible collision region of IRAS 22528+5936, NVSS continuum radiation is not detected and the MSX sources are merely associated with the central star. The velocity fields of the two regions indicate the direction of the pressure and interaction. In addition, we have identified candidates of young stellar objects (YSOs) by using data from the Two Micron All Sky Survey (2MASS) in JHK bands expressed in a color-color diagram. The distribution of YSOs shows that the possible collision region is denser than other regions. All the evidence suggests that IRAS 02459+6029 could be an example of cloud-cloud collision, and that IRAS 22528+5936 could be two separate non-colliding clouds. (research papers)

  8. OBSERVATIONAL STUDY OF THE CONTINUUM AND WATER MASER EMISSION IN THE IRAS 19217+1651 REGION

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Esnard, T.; Trinidad, M. A. [Departamento de Astronomia, Universidad de Guanajuato, Apdo Postal 144, Guanajuato, GTO, Mexico CP 36000 (Mexico); Migenes, V., E-mail: tatiana@iga.cu, E-mail: trinidad@astro.ugto.mx, E-mail: vmigenes@byu.edu [Department of Physics and Astronomy, Brigham Young University, ESC-N145, Provo, UT 84602 (United States)

    2012-12-20

    We report interferometric observations of the high-mass star-forming region IRAS 19217+1651. We observed the radio continuum (1.3 cm and 3.6 cm) and water maser emission using the Very Large Array (VLA-EVLA) in transition mode (configuration A). Two radio continuum sources were detected at both wavelengths, I19217-A and I19217-B. In addition, 17 maser spots were observed distributed mainly in two groups, M1 and M2, and one isolated maser. This latter could be indicating the relative position of another continuum source which we did not detect. The results indicate that I19217-A appears to be consistent with an ultracompact H II region associated with a zero-age main-sequence B0-type star. Furthermore, the 1.3 cm continuum emission of this source suggests a cometary morphology. In addition, I19217-B appears to be an H II region consisting of at least two stars, which may be contributing to its complex structure. It was also found that the H{sub 2}O masers of the group M1 are apparently associated with the continuum source I19217-A. These are tracing motions which are not gravitationally bound according to their spatial distribution and kinematics. They also seem to be describing outflows in the direction of the elongated cometary region. On the other hand, the second maser group, M2, could be tracing the base of a jet. Finally, infrared data from Spitzer, Midcourse Space Experiment, and IRIS show that IRAS 19217+1651 is embedded inside a large open bubble, like a broken ring, which possibly has affected the morphology of the cometary H II region observed at 1.3 cm.

  9. WIDE FIELD CO MAPPING IN THE REGION OF IRAS 19312+1950

    Energy Technology Data Exchange (ETDEWEB)

    Nakashima, Jun-ichi [Department of Astronomy and Geodesy, Ural Federal University, Lenin Avenue 51, 620000, Ekaterinburg (Russian Federation); Ladeyschikov, Dmitry A.; Sobolev, Andrej M. [Astronomical Observatory, Ural Federal University, Lenin Avenue 51, 620000, Ekaterinburg (Russian Federation); Zhang, Yong; Hsia, Chih-Hao [Department of Physics, University of Hong Kong, Pokfulam Road, Hong Kong (China); Yung, Bosco H. K., E-mail: nakashima.junichi@gmail.com [N. Copernicus Astronomical Center, Rabiańska 8, 87-100 Toruń (Poland)

    2016-07-01

    We report the results of wide field CO mapping in the region of IRAS 19312+1950. This Infrared Astronomical Satellite ( IRAS ) object exhibits SiO/H{sub 2}O/OH maser emission, and is embedded in a chemically rich molecular component, the origin of which is still unknown. In order to reveal the entire structure and gas mass of the surrounding molecular component for the first time, we have mapped a wide region around IRAS 19312+1950 in the {sup 12}CO J = 1–0, {sup 13}CO J = 1–0 and C{sup 18}O J = 1–0 lines using the Nobeyama 45 m telescope. In conjunction with archival CO maps, we investigated a region up to 20′ × 20′ in size around this IRAS object. We calculated the CO gas mass assuming local thermal equilibrium, the stellar velocity through the interstellar medium assuming an analytic model of bow shock, and the absolute luminosity, using the latest archival data and trigonometric parallax distance. The derived gas mass (225 M {sub ⊙}–478 M {sub ⊙}) of the molecular component and the relatively large luminosity (2.63 × 10{sup 4} L {sub ☉}) suggest that the central SiO/H{sub 2}O/OH maser source is a red supergiant rather than an asymptotic giant branch (AGB) star or post-AGB star.

  10. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  11. EXTINCTION AND POLYCYCLIC AROMATIC HYDROCARBON INTENSITY VARIATIONS ACROSS THE H II REGION IRAS 12063-6259

    Energy Technology Data Exchange (ETDEWEB)

    Stock, D. J.; Peeters, E.; Otaguro, J. N. [Department of Physics and Astronomy, University of Western Ontario, London, ON N6A 3K7 (Canada); Tielens, A. G. G. M. [Leiden Observatory, Leiden University, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Bik, A. [Max-Planck-Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany)

    2013-07-01

    The spatial variations in polycyclic aromatic hydrocarbon (PAH) band intensities are normally attributed to the physical conditions of the emitting PAHs, however in recent years it has been suggested that such variations are caused mainly by extinction. To resolve this question, we have obtained near-infrared (NIR), mid-infrared (MIR), and radio observations of the compact H II region IRAS 12063-6259. We use these data to construct multiple independent extinction maps and also to measure the main PAH features (6.2, 7.7, 8.6, and 11.2 {mu}m) in the MIR. Three extinction maps are derived: the first using the NIR hydrogen lines and case B recombination theory; the second combining the NIR data with radio data; and the third making use of the Spitzer/IRS MIR observations to measure the 9.8 {mu}m silicate absorption feature using the Spoon method and PAHFIT (as the depth of this feature can be related to overall extinction). The silicate absorption over the bright, southern component of IRAS 12063-6259 is almost absent while the other methods find significant extinction. While such breakdowns of the relationship between the NIR extinction and the 9.8 {mu}m absorption have been observed in molecular clouds, they have never been observed for H II regions. We then compare the PAH intensity variations in the Spitzer/IRS data after dereddening to those found in the original data. It was found that in most cases, the PAH band intensity variations persist even after dereddening, implying that extinction is not the main cause of the PAH band intensity variations.

  12. EXTINCTION AND POLYCYCLIC AROMATIC HYDROCARBON INTENSITY VARIATIONS ACROSS THE H II REGION IRAS 12063–6259

    International Nuclear Information System (INIS)

    Stock, D. J.; Peeters, E.; Otaguro, J. N.; Tielens, A. G. G. M.; Bik, A.

    2013-01-01

    The spatial variations in polycyclic aromatic hydrocarbon (PAH) band intensities are normally attributed to the physical conditions of the emitting PAHs, however in recent years it has been suggested that such variations are caused mainly by extinction. To resolve this question, we have obtained near-infrared (NIR), mid-infrared (MIR), and radio observations of the compact H II region IRAS 12063–6259. We use these data to construct multiple independent extinction maps and also to measure the main PAH features (6.2, 7.7, 8.6, and 11.2 μm) in the MIR. Three extinction maps are derived: the first using the NIR hydrogen lines and case B recombination theory; the second combining the NIR data with radio data; and the third making use of the Spitzer/IRS MIR observations to measure the 9.8 μm silicate absorption feature using the Spoon method and PAHFIT (as the depth of this feature can be related to overall extinction). The silicate absorption over the bright, southern component of IRAS 12063–6259 is almost absent while the other methods find significant extinction. While such breakdowns of the relationship between the NIR extinction and the 9.8 μm absorption have been observed in molecular clouds, they have never been observed for H II regions. We then compare the PAH intensity variations in the Spitzer/IRS data after dereddening to those found in the original data. It was found that in most cases, the PAH band intensity variations persist even after dereddening, implying that extinction is not the main cause of the PAH band intensity variations.

  13. Water distribution in shocked regions of the NGC 1333-IRAS 4A protostellar outflow

    Science.gov (United States)

    Santangelo, G.; Nisini, B.; Codella, C.; Lorenzani, A.; Yıldız, U. A.; Antoniucci, S.; Bjerkeli, P.; Cabrit, S.; Giannini, T.; Kristensen, L. E.; Liseau, R.; Mottram, J. C.; Tafalla, M.; van Dishoeck, E. F.

    2014-08-01

    Context. Water is a key molecule in protostellar environments because its line emission is very sensitive to both the chemistry and the physical conditions of the gas. Observations of H2O line emission from low-mass protostars and their associated outflows performed with HIFI onboard the Herschel Space Observatory have highlighted the complexity of H2O line profiles, in which different kinematic components can be distinguished. Aims: The goal is to study the spatial distribution of H2O, in particular of the different kinematic components detected in H2O emission, at two bright shocked regions along IRAS 4A, one of the strongest H2O emitters among the Class 0 outflows. Methods: We obtained Herschel-PACS maps of the IRAS 4A outflow and HIFI observations of two shocked positions. The largest HIFI beam of 38'' at 557 GHz was mapped in several key water lines with different upper energy levels, to reveal possible spatial variations of the line profiles. A large velocity gradient (LVG) analysis was performed to determine the excitation conditions of the gas. Results: We detect four H2O lines and CO (16-15) at the two selected shocked positions. In addition, transitions from related outflow and envelope tracers are detected. Different gas components associated with the shock are identified in the H2O emission. In particular, at the head of the red lobe of the outflow, two distinct gas components with different excitation conditions are distinguished in the HIFI emission maps: a compact component, detected in the ground-state water lines, and a more extended one. Assuming that these two components correspond to two different temperature components observed in previous H2O and CO studies, the LVG analysis of the H2O emission suggests that the compact (about 3'', corresponding to about 700 AU) component is associated with a hot (T ~ 1000 K) gas with densities nH2 ~ (1-4) × 105 cm-3, whereas the extended (10''-17'', corresponding to 2400-4000 AU) one traces a warm (T ~ 300

  14. IRAS 20050+2720: ANATOMY OF A YOUNG STELLAR CLUSTER

    International Nuclear Information System (INIS)

    Günther, H. M.; Wolk, S. J.; Spitzbart, B.; Forbrich, J.; Wright, N. J.; Bourke, T. L.; Gutermuth, R. A.; Allen, L.; Megeath, S. T.; Pipher, J. L.

    2012-01-01

    IRAS 20050+2720 is young star-forming region at a distance of 700 pc without apparent high-mass stars. We present results of our multi-wavelength study of IRAS 20050+2720 which includes observations by Chandra and Spitzer, and Two Micron All Sky Survey and UBVRI photometry. In total, about 300 young stellar objects (YSOs) in different evolutionary stages are found. We characterize the distribution of YSOs in this region using a minimum spanning tree analysis. We newly identify a second cluster core, which consists mostly of class II objects, about 10' from the center of the cloud. YSOs of earlier evolutionary stages are more clustered than more evolved objects. The X-ray luminosity function (XLF) of IRAS 20050+2720 is roughly lognormal, but steeper than the XLF of the more massive Orion Nebula complex. IRAS 20050+2720 shows a lower N H /A K ratio compared with the diffuse interstellar medium.

  15. Starbursts and IRAS galaxies

    International Nuclear Information System (INIS)

    Belfort, P.

    1987-01-01

    Several observational hints suggest that most of the IRAS galaxies are undergoing bursts of star formation. A simple photometric model of starburst galaxy was developed in order to check whether starburst events are really able to account for the far-infrared and optical properties of all the IRAS galaxies with HII region-like spectra. FIR activities up to a few hundred are actually easily reached with rather small bursts in red host-galaxies, and L IR /L B , EW(Hα) and U-B) versus (B-V) diagrams can be used to estimate burst strength and extinction. But more observations are required to conclude about the most extreme cases. Four typical infrared-selected IRAS galaxies are presented and their burst strength and extinction estimated

  16. IRAS colors of VLA identified objects in the galaxy

    International Nuclear Information System (INIS)

    Fich, M.; Terebey, S.

    1987-01-01

    Infrared Astronomy Satellite (IRAS) sources found within 4 degrees of l = 125 deg, b = 2 deg on the 3rd HCON 60 micron Sky Brightness Images were observed at the Very Large Array (VLA). Regions were to be identified where massive stars are forming by looking for small areas of radio continuum emissions. The IRAS sources could be divided into three groups by their IRAS 12 micron/25 micron and 60 micron/100 micron color. The group identified with star forming regions contained essentially all of the objects with extended radio emission. In all of these cases the extended radio emission showed a morphology consistent with the identification of these objects as HII regions. The conclusion drawn is that star formation regions can be distinguished from other objects by their infrared colors

  17. IRAS low-resolution spectra of galaxies

    International Nuclear Information System (INIS)

    Cohen, M.; Volk, K.

    1989-01-01

    The spectra of external galaxies are selected and extracted from the IRAS LRS database. Twenty-one objects present viable spectra. One is a peculiar star-forming E-S0 galaxy. The remainder are all starburst or H II region galaxies. Their average spectrum demonstrates the importance of the PAH emission bands in the 8-23-micron region and reinforces the conclusion reached from ground-based spectra, that there is a strong correlation between the PAH bands and the starburst or H II region character of a galaxy. 32 refs

  18. Herschel/HIFI observations of high-J CO lines in the NGC 1333 low-mass star-forming region

    DEFF Research Database (Denmark)

    Yildiz, U. A.; van Dishoeck, E. F.; Kristensen, L. E.

    2010-01-01

    Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally-resolved......Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally....... Their intensities require a jump in the CO abundance at an evaporation temperature around 25 K, thus providing new direct evidence for a CO ice evaporation zone around low-mass protostars. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia...... and with important participation from NASA.Appendices and acknowledgements (pages 5 to 7) are only available in electronic form at http://www.aanda.org...

  19. IRAS 20050+2720: ANATOMY OF A YOUNG STELLAR CLUSTER

    Energy Technology Data Exchange (ETDEWEB)

    Guenther, H. M.; Wolk, S. J.; Spitzbart, B.; Forbrich, J.; Wright, N. J.; Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Allen, L. [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Megeath, S. T. [Department of Physics and Astronomy, MS-113, University of Toledo, 2801 W. Bancroft St., Toledo, OH 43606 (United States); Pipher, J. L., E-mail: hguenther@cfa.harvard.edu [Department of Physics and Astronomy, University of Rochester, 500 Wilson Boulevard, Rochester, NY 14627 (United States)

    2012-10-01

    IRAS 20050+2720 is young star-forming region at a distance of 700 pc without apparent high-mass stars. We present results of our multi-wavelength study of IRAS 20050+2720 which includes observations by Chandra and Spitzer, and Two Micron All Sky Survey and UBVRI photometry. In total, about 300 young stellar objects (YSOs) in different evolutionary stages are found. We characterize the distribution of YSOs in this region using a minimum spanning tree analysis. We newly identify a second cluster core, which consists mostly of class II objects, about 10' from the center of the cloud. YSOs of earlier evolutionary stages are more clustered than more evolved objects. The X-ray luminosity function (XLF) of IRAS 20050+2720 is roughly lognormal, but steeper than the XLF of the more massive Orion Nebula complex. IRAS 20050+2720 shows a lower N{sub H}/A{sub K} ratio compared with the diffuse interstellar medium.

  20. IRAS observations of the Pleiades

    Science.gov (United States)

    Cox, P.; he ultraviolet.

    1987-01-01

    The Infrared Astronomy Satellite (IRAS) observations of the Pleiades region are reported. The data show large flux densities at 12 and 25 microns, extended over the optical nebulosity. This strong excess emission, implying temperatures of a few hundred degrees Kelvin, indicates a population of very small grains in the Pleiades. It is suggested that these grains are similar to the small grains needed to explain the surface brightness measurements made in the ultraviolet.

  1. IRAS observations of the Pleiades

    International Nuclear Information System (INIS)

    Cox, P.; Leene, A.

    1987-01-01

    The Infrared Astronomy Satellite (IRAS) observations of the Pleiades region are reported. The data show large flux densities at 12 and 25 microns, extended over the optical nebulosity. This strong excess emission, implying temperatures of a few hundred degrees Kelvin, indicates a population of very small grains in the Pleiades. It is suggested that these grains are similar to the small grains needed to explain the surface brightness measurements made in the ultraviolet

  2. Classification of IRAS asteroids

    International Nuclear Information System (INIS)

    Tedesco, E.F.; Matson, D.L.; Veeder, G.J.

    1989-01-01

    Albedos and spectral reflectances are essential for classifying asteroids. For example, classes E, M and P are indistinguishable without albedo data. Colorometric data are available for about 1000 asteroids but, prior to IRAS, albedo data was available for only about 200. IRAS broke this bottleneck by providing albedo data on nearly 2000 asteroids. Hence, excepting absolute magnitudes, the albedo and size are now the most common asteroid physical parameters known. In this chapter the authors present the results of analyses of IRAS-derived asteroid albedos, discuss their application to asteroid classification, and mention several studies which might be done to exploit further this data set

  3. T Tauri stars in Taurus - the IRAS view

    International Nuclear Information System (INIS)

    Harris, Stella; Clegg, Peter; Hughes, Joanne

    1988-01-01

    Statistical studies of star-formation have traditionally been beset with selection effects. We have developed a technique, using the completeness of the IRAS catalogue, which circumvents these effects. We have taken the properties of known T Tau stars within Taurus as a template to establish a purely IRAS-based definition of such sources. We then use this definition to extract, from the IRAS catalogue, all sources within a specific region of Taurus having those same IRAS properties. This wider class of source is examined and discussed. (author)

  4. Water deuteration in star-forming regions: Contribution of Herschel/HIFI spectroscopic data

    International Nuclear Information System (INIS)

    Coutens, Audrey

    2012-01-01

    cloud. The HDO/H_2O ratios as well as the D_2O/HDO ratios determined in IRAS 16293-2422 enable to constrain the conditions of water formation in this kind of objects and in particular suggest that water would be formed before the gravitational collapse of the cloud. This study was then extended to other solar-type protostars NGC1333 IRAS4A and NGC1333 IRAS4B, for which I estimated the abundances of deuterated water and noticed that an extended absorbing layer also surrounds these sources. The high HDO/H_2O ratios determined in IRAS 16293-2422 suggest that mechanisms are required between the Class 0 stage and the comets formation to decrease these isotopic ratios. It is however necessary to study a larger sample of protostars to know if this trend is observed in most of the sources. The HDO abundances obtained in NGC1333 IRAS4A and NGC1333 IRAS4B will consequently be useful to estimate their HDO/H_2O ratios. Finally, I also studied deuterated water in protostellar objects more massive and more luminous than solar-type protostars and show here the case of the ultra-compact HII region G34.26+0.15. (author) [fr

  5. Generation and Characterization of Novel Human IRAS Monoclonal Antibodies

    Directory of Open Access Journals (Sweden)

    Bo Wang

    2009-01-01

    Full Text Available Imidazoline receptors were first proposed by Bousquet et al., when they studied antihypertensive effect of clonidine. A strong candidate for I1R, known as imidazoline receptor antisera-selected protein (IRAS, has been cloned from human hippocampus. We reported that IRAS mediated agmatine-induced inhibition of opioid dependence in morphine-dependent cells. To elucidate the functional and structure properties of I1R, we developed the newly monoclonal antibody against the N-terminal hIRAS region including the PX domain (10–120aa through immunization of BALB/c mice with the NusA-IRAS fusion protein containing an IRAS N-terminal (10–120aa. Stable hybridoma cell lines were established and monoclonal antibodies specifically recognized full-length IRAS proteins in their native state by immunoblotting and immunoprecipitation. Monoclonal antibodies stained in a predominantly punctate cytoplasmic pattern when applied to IRAS-transfected HEK293 cells by indirect immunofluorescence assays and demonstrated excellent reactivity in flow immunocytometry. These monoclonal antibodies will provide powerful reagents for the further investigation of hIRAS protein functions.

  6. EXTERNALLY HEATED PROTOSTELLAR CORES IN THE OPHIUCHUS STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A. [NASA Goddard Space Flight Center, Astrochemistry Laboratory, Mail Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Jørgensen, Jes K.; Bjerkeli, Per, E-mail: johan.lindberg@nasa.gov [Centre for Star and Planet Formation, Niels Bohr Institute and Natural History Museum of Denmark, University of Copenhagen, Øster Voldgade 5-7, DK-1350 Copenhagen K (Denmark)

    2017-01-20

    We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbig Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

  7. IRAS Colors of the Pleiades

    Science.gov (United States)

    Carey, Sean J.; Shipman, R. F.; Clark, F. O.

    1996-01-01

    We present large scale images of the infrared emission of the region around the Pleiades using the ISSA data product from the IRAS mission. Residual Zodiacal background and a discontinuity in the image due to the scanning strategy of the satellite necessitated special background subtraction methods. The 60/100 color image clearly shows the heating of the ambient interstellar medium by the cluster. The 12/100 and 25/100 images peak on the cluster as expected for exposure of small dust grains to an enhanced UV radiation field; however, the 25/100 color declines to below the average interstellar value at the periphery of the cluster. Potential causes of the color deficit are discussed. A new method of identifying dense molecular material through infrared emission properties is presented. The difference between the 100 micron flux density and the 60 micron flux density scaled by the average interstellar 60/100 color ratio (Delta I(sub 100) is a sensitive diagnostic of material with embedded heating sources (Delta I(sub 100) less than 0) and cold, dense cores (Delta I(sub 100) greater than 0). The dense cores of the Taurus cloud complex as well as Lynds 1457 are clearly identified by this method, while the IR bright but diffuse Pleiades molecular cloud is virtually indistinguishable from the nearby infrared cirrus.

  8. OH outflows in star-forming regions

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Ruiz, A.; Rodriguez, L.F.; Canto, J.; Universidad de Puer; Universidad de Puerto Rico, Rio Piedras; Universidad Nacional Autonoma de Mexico, Mexico City)

    1987-01-01

    The results from a survey for high-velocity OH in molecular outflows in star-forming regions are reported. High-velocity OH was detected in absorption in nine of these regions. When the telescope beam can resolve the outflows, they show similar anisotropic angular distribution as the redshifted and blueshifted CO. The OH transitions are markedly subthermal since for several sources it is found that the radiation that is being absorbed is a background continuum constituted by the cosmic component plus a small Galactic contribution. The absorbing OH appears to trace gas with higher velocities and lower densities than does the CO and, in some cases, provides information on the structure of the outflows at larger distances from the central source. At scales of 0.1 pc, the outflows are elongated in the direction of the steepest density gradient of the ambient cloud, suggesting that the large-scale collimation of the outflow is produced by the density structure of the ambient cloud. 29 references

  9. IRAS 18113-2503: THE WATER FOUNTAIN WITH THE FASTEST JET?

    International Nuclear Information System (INIS)

    Gomez, Jose F.; Guerrero, MartIn A.; Ricardo Rizzo, J.; Suarez, Olga; Miranda, Luis F.; Ramos-Larios, Gerardo

    2011-01-01

    We present Expanded Very Large Array water maser observations at 22 GHz toward the source IRAS 18113-2503. Maser components span over a very high velocity range of ≅ 500 km s -1 , the second largest found in a Galactic maser, only surpassed by the high-mass star-forming region W49N. Maser components are grouped into a blueshifted and a redshifted cluster, separated by 0.''12. Further mid-IR and radio data suggest that IRAS 18113-2503 is a post-asymptotic giant branch star, thus a new bona fide member of the rare class of 'water fountains' (WFs). It is the evolved object with the largest total velocity spread in its water masers and with the highest velocity dispersion within its redshifted and blueshifted lobes (≅ 170 km s -1 ). The large total velocity range of emission probably indicates that IRAS 18113-2503 has the fastest jet among the known WF stars. On the other hand, the remarkably high velocity dispersion within each lobe may be interpreted in terms of shocks produced by an episode of mass ejection whose velocity increased up to very high values or, alternatively, by projection effects in a jet with a large opening angle and/or precessing motions.

  10. Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions

    Science.gov (United States)

    Povich, Matthew Samuel; Binder, Breanna Arlene

    2018-01-01

    We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

  11. Problems of regional innovation strategy forming

    Directory of Open Access Journals (Sweden)

    I. M. Golova

    2010-09-01

    Full Text Available The author considered problems and contradictions of modern innovation policy in Russia. It is shown, that at present time regions are removed from management of science-technical complex and spatial priorities are not produced. It is a serious factor of risk for conservation perspectives of innovation development for Russia. With taking into account of world experience main districts of rise effects regional police were formulated. It is underlined, that creation conditions for transformation of regional authorities in active subjects of innovation policy is necessary condition for building vital innovation system. It is shown, that state innovation policy must be constructed at combination of next principles: a support science-technical potential of regions — generators of innovation and creation conditions for its realization; b using of innovations for evening-out disproportions of social-economic development between regions; c widening powers and financial possibilities of regions at management of innovation climate. Methodical approaches for making effective mechanisms of management of innovation processes of territory are opened. Typology of Russian regions with high and middle degree of innovation climate is proposed, which takes level of science and innovation potential of territory and also degree of comfort of social-economic conditions for development of innovation activity are offered. Peculiarities of innovation strategy for different types of regions are defined. This typology may be used for substantiation spatial priorities of innovation strategy of Russia.

  12. IRAS 10479 - 2808: a quasar

    International Nuclear Information System (INIS)

    Clowes, R.G.; Leggett, S.K.; Savage, A.

    1991-01-01

    The IRAS point source 10479-2808 is a quasar with B J ∼ 16 and z = 0.190. It is not in the Parkes and Molonglo radio catalogues. At the resolution of the UK and ESO Schmidt telescopes it appears to be star-like, with no sign of surrounding fuzz or interactions; it is probably optically variable. (author)

  13. IRAS galaxies and the large-scale structure in the CfA slice

    Science.gov (United States)

    Babul, Arif; Postman, Marc

    1990-01-01

    The spatial distributions of the IRAS and the optical galaxies in the first CfA slice are compared. The IRAS galaxies are generally less clustered than optical ones, but their distribution is essentially identical to that of late-type optical galaxies. The discrepancy between the clustering properties of the IRAS and optical samples in the CfA slice region is found to be entirely due to the paucity of IRAS galaxies in the core of the Coma cluster. The spatial distributions of the IRAS and the optical galaxies, both late and early types, outside the dense core of the Coma cluster are entirely consistent with each other. This conflicts with the prediction of the linear biasing scenario.

  14. Extreme Variables in Star Forming Regions

    Science.gov (United States)

    Contreras Peña, Carlos Eduardo

    2015-01-01

    in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

  15. Optical polarimetry of star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Gledhill, T M

    1987-01-01

    The polarimetric investigation of nebulosity associated with loss-mass pre-main sequence (PMS) stellar objects is detailed. Three regions of on-going star formation are considered, specifically, the Haro 6-5 and the HL/XZ Tau systems - both associated with dark clouds in the Taurus complex - and the PV Cephei nebulosity near NGC7023. In each region the imaging observations suggest bipolarity in the optical structure of the nebulosity, and the polarimetric data are used to determine the locations of the illuminating sources. Evidence is found for the association of circumstellar discs of obscuration with the PMS objects Haro 6-5A (FS Tau), Haro 6-5B, HL Tau, and PV Cephei. In each case the polarimetric data suggest that the local magnetic field has played an important role in the evolution of the star and the circumstellar material. Examination of the source-region polarization maps suggests that at least one of the objects considered is surrounded by a dust grain-aligning magnetic field with a predominantly toroidal geometry in the plane of the circumstellar disc. Implications for current theories of outflow acceleration and cloud evolution are discussed.

  16. Forming controlled inset regions by ion implantation and laser bombardment

    International Nuclear Information System (INIS)

    Gibbons, J.F.

    1981-01-01

    A semiconductor integrated circuit structure in which the inset regions are ion implanted and laser annealed to maintain substantially the dimensions of the implantation and the method of forming inset implanted regions having controlled dimensions

  17. Complex molecules in the hot core of the low-mass protostar NGC 1333 IRAS 4A

    NARCIS (Netherlands)

    Bottinelli, S; Ceccarelli, C; Lefloch, B; Williams, JP; Castets, A; Caux, E; Cazaux, S; Maret, S; Parise, B; Tielens, AGGM

    2004-01-01

    We report the detection of complex molecules (HCOOCH3, HCOOH, and CH3CN), signposts of a hot core like region, toward the low-mass Class 0 source NGC 1333 IRAS 4A. This is the second low-mass protostar in which such complex molecules have been searched for and reported, the other source being IRAS

  18. Investigation of conspicuous infrared star cluster and star-forming region RCW 38 IR Cluster

    International Nuclear Information System (INIS)

    Gyulbudaghian, A.L.; May, J.

    2008-01-01

    An infrared star cluster RCW 38 IR Cluster, which is also a massive star-forming region, is investigated. The results of observations with SEST (Cerro is Silla, Chile) telescope on 2.6-mm 12 CO spectral line and with SIMBA on 1.2-mm continuum are given. The 12 CO observations revealed the existence of several molecular clouds, two of which (clouds I and 2) are connected with the object RCW 38 IR Cluster. Cloud 1 is a massive cloud, which has a depression in which the investigated object is embedded. It is not excluded that the depression was formed by the wind and/or emission from the young bright stars belonging to the star cluster. Rotation of cloud 2, around the axis having SE-NW direction, with an angular velocity ω 4.6 · 10 -14 s -1 is also found. A red-shifted outflow with velocity ∼+5.6 km/s, in the SE direction and perpendicular to the elongation of cloud 2 has been also found. The investigated cluster is associated with an IR point source IRAS 08573-4718, which has IR colours typical for a, non-evolved embedded (in the cloud) stellar object. The cluster is also connected with a water maser. The SIMBA image shoves the existence of a central bright condensation, coinciding with the cluster itself, and two extensions. One of these extensions (the one with SW-NE direction) coincides, both in place and shape, with cloud 2, so that it is not excluded the possibility that this extension might be also rotating like cloud 2. In the vicinity of these extensions there are condensations resembling HH objects

  19. Chemistry of the High-mass Protostellar Molecular Clump IRAS 16562–3959

    Science.gov (United States)

    Guzmán, Andrés E.; Guzmán, Viviana V.; Garay, Guido; Bronfman, Leonardo; Hechenleitner, Federico

    2018-06-01

    We present molecular line observations of the high-mass molecular clump IRAS 16562‑3959 taken at 3 mm using the Atacama Large Millimeter/submillimeter Array at 1.″7 angular resolution (0.014 pc spatial resolution). This clump hosts the actively accreting high-mass young stellar object (HMYSO) G345.4938+01.4677, which is associated with a hypercompact H II region. We identify and analyze emission lines from 22 molecular species (encompassing 34 isomers) and classify them into two groups, depending on their spatial distribution within the clump. One of these groups gathers shock tracers (e.g., SiO, SO, HNCO) and species formed in dust grains like methanol (CH3OH), ethenone or ketene (H2CCO), and acetaldehyde (CH3CHO). The second group collects species closely resembling the dust continuum emission morphology and are formed mainly in the gas phase, like hydrocarbons (CCH, c-C3H2, CH3CCH), cyanopolyynes (HC3N and HC5N), and cyanides (HCN and CH3C3N). Emission from complex organic molecules (COMs) like CH3OH, propanenitrile (CH3CH2CN), and methoxymethane (CH3OCH3) arise from gas in the vicinity of a hot molecular core (T ≳ 100 K) associated with the HMYSO. Other COMs such as propyne (CH3CCH), acrylonitrile (CH2CHCN), and acetaldehyde seem to better trace warm (T ≲ 80 K) dense gas. In addition, deuterated ammonia (NH2D) is detected mostly in the outskirts of IRAS 16562‑3959 and associated with near-infrared dark globules, probably gaseous remnants of the clump’s prestellar phase. The spatial distribution of molecules in IRAS 16562‑3959 supports the view that in protostellar clumps, chemical tracers associated with different evolutionary stages—starless to hot cores/H II regions—exist coevally.

  20. Warm water deuterium fractionation in IRAS 16293-2422

    DEFF Research Database (Denmark)

    Persson, Magnus Vilhelm; Jørgensen, Jes Kristian; van Dishoeck, E. F.

    2013-01-01

    observations reveal the physical and chemical structure of water vapor close to the protostars on solar-system scales. The red-shifted absorption detected toward source B is indicative of infall. The excitation temperature is consistent with the picture of water ice evaporation close to the protostar. The low......Context. Measuring the water deuterium fractionation in the inner warm regions of low-mass protostars has so far been hampered by poor angular resolution obtainable with single-dish ground- and space-based telescopes. Observations of water isotopologues using (sub)millimeter wavelength...... interferometers have the potential to shed light on this matter. Aims: To measure the water deuterium fractionation in the warm gas of the deeply-embedded protostellar binary IRAS 16293-2422. Methods: Observations toward IRAS 16293-2422 of the 53,2 - 44,1 transition of H218O at 692.07914 GHz from Atacama Large...

  1. IRAS observations of starburst galaxies

    International Nuclear Information System (INIS)

    Sekiguchi, K.

    1987-01-01

    Far infrared properties of Starburst galaxies were analyzed using IRAS observations at 25, 60, and 100 micrometers. Seventy-nine of 102 Starburst galaxies from the list of Balzano were detected. These galaxies have high IR luminosities of up to a few 10 to the 12th power L sub 0 and concentrate in a small area of the IR color - color diagram. The IR power law spectral indices, alpha, lie within the ranges -2.5 < alpha(60,25)< -1.5 and -1.5 < alpha(100,60)< 0. These observed indices can be interpreted in terms of a cold disk component and a warm component. More than 80% of the 60 micrometer emission comes from the warm component. The fraction of the 60 micrometer emission attributable to the warm component can be used as an activity indicator

  2. The Herschel/HIFI unbiased spectral survey of the solar-mass protostar IRAS16293

    Science.gov (United States)

    Bottinelli, S.; Caux, E.; Cecarelli, C.; Kahane, C.

    2012-03-01

    Unbiased spectral surveys are powerful tools to study the chemistry and the physics of star forming regions, because they can provide a complete census of the molecular content and the observed lines probe the physical structure of the source. While unbiased surveys at the millimeter and sub-millimeter wavelengths observable from ground-based telescopes have previously been performed towards several high-mass protostars, very little data exist on low-mass protostars, with only one such ground-based survey carried out towards this kind of object. However, since low-mass protostars are believed to resemble our own Sun's progenitor, the information provided by spectral surveys is crucial in order to uncover the birth mechanisms of low-mass stars and hence of our Sun. To help fill up this gap in our understanding, we carried out an almost complete spectral survey towards the solar-type protostar IRAS16293-2422 with the HIFI instrument onboard Herschel. The observations covered a range of about 700 GHz, in which a few hundreds lines were detected with more than 3σ confidence interval certainty and identified. All the detected lines which were free from obvious blending effects were fitted with Gaussians to estimate their basic kinematic properties. Contrarily to what is observed in the millimeter range, no lines from complex organic molecules have been observed. In this work, we characterize the different components of IRAS16293-2422 (a known binary at least) by analyzing the numerous emission and absorption lines identified.

  3. Spatial and kinematic structure of Monoceros star-forming region

    Science.gov (United States)

    Costado, M. T.; Alfaro, E. J.

    2018-05-01

    The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

  4. The High-Resolution IRAS Galaxy Atlas

    Science.gov (United States)

    Cao, Yu; Terebey, Susan; Prince, Thomas A.; Beichman, Charles A.; Oliversen, R. (Technical Monitor)

    1997-01-01

    An atlas of the Galactic plane (-4.7 deg is less than b is less than 4.7 deg), along with the molecular clouds in Orion, rho Oph, and Taurus-Auriga, has been produced at 60 and 100 microns from IRAS data. The atlas consists of resolution-enhanced co-added images with 1 min - 2 min resolution and co-added images at the native IRAS resolution. The IRAS Galaxy Atlas, together with the Dominion Radio Astrophysical Observatory H(sub I) line/21 cm continuum and FCRAO CO (1-0) Galactic plane surveys, which both have similar (approx. 1 min) resolution to the IRAS atlas, provides a powerful tool for studying the interstellar medium, star formation, and large-scale structure in our Galaxy. This paper documents the production and characteristics of the atlas.

  5. Asteroid results from the IRAS survey

    International Nuclear Information System (INIS)

    Veeder, G.J.; Tedesco, E.F.; Matson, D.L.

    1989-01-01

    This paper reports that the IRAS Asteroid and Comet Survey yield a data base of infrared flux densities for 1811 individual asteroids. Albedos and diameters for these have been derived via a standard thermal model. IRAS sampled a large number of small asteroids and detected many dark asteroids in the outer belt. High-albedo asteroids remain rare. Observations of the brighter asteroids at multiple wavelengths shows the expected range of color temperatures through the main belt

  6. Radio and optical studies of high luminosity Iras galaxies

    International Nuclear Information System (INIS)

    Wolstencroft, R.D.; Parker, Q.A.; Savage, A.; MacGillivray, H.T.; Leggett, S.K.; Clowes, R.G.; Unger, S.W.; Pedlar, A.; Heasley, J.N.; Menzies, J.W.

    1987-01-01

    Follow-up observations of a complete sample of 154 IRAS galaxies, optically identified down to B=21, indicate that between 3 and 9% of the sample are ultraluminous depending on the choice of H 0 . VLA observations at 20 cm of the complete sample indicate that 85% are detected above 1mJy and for the most part the radio emission is centrally concentrated. The tight linear relation between radio and infrared luminosities is valid at the highest luminosities. Of the 11 most luminous objects one is a quasar: it fits the radio infrared relation very well which suggests that the infrared and radio emission has the same origin as in the other IRAS galaxies, ie. it probably originates primarily in regions of star formation in the host galaxy. The other 10 very luminous galaxies are either close but resolved mergers or double galaxies, presumably interacting. Radio observations of the 10 original empty field sources in our sample with no optical counterpart (B ≤ 21) allow us to conclude that 4 of these are fainter galaxies just outside the IRAS error ellipse with high values of L IR /L B . One other object, with a radio source at the edge of the error ellipse but no optical counterpart brighter than B = 23, may prove to be a highly luminous galaxy with L IR /L B > ∼ 1250

  7. THE PHYSICAL ENVIRONMENT AROUND IRAS 17599–2148: INFRARED DARK CLOUD AND BIPOLAR NEBULA

    Energy Technology Data Exchange (ETDEWEB)

    Dewangan, L. K.; Janardhan, P. [Physical Research Laboratory, Navrangpura, Ahmedabad 380 009 (India); Ojha, D. K. [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400 005 (India); Zinchenko, I. [Institute of Applied Physics of the Russian Academy of Sciences, 46 Ulyanov st., Nizhny Novgorod 603950 (Russian Federation); Ghosh, S. K. [National Centre for Radio Astrophysics, Ganeshkhind, Pune 411 007 (India); Luna, A., E-mail: lokeshd@prl.res.in [Instituto Nacional de Astrofísica, Óptica y Electrónica, Luis Enrique Erro # 1, Tonantzintla, Puebla, C.P. 72840 (Mexico)

    2016-12-20

    We present a multiscale and multiwavelength study to investigate the star formation process around IRAS 17599–2148, which is part of an elongated filamentary structure (EFS) (extension ∼21 pc) seen in the Herschel maps. Using the Herschel data analysis, at least six massive clumps (M {sub clump} ∼ 777–7024 M {sub ⊙}) are found in the EFS with a range of temperature and column density of ∼16–39 K and ∼(0.6–11) × 10{sup 22} cm{sup −2} (A {sub V}  ∼ 7–117 mag), respectively. The EFS hosts cold gas regions (i.e., infrared dark cloud) without any radio detection and a bipolar nebula (BN) linked with the H ii region IRAS 17599–2148, tracing two distinct environments inferred through the temperature distribution and ionized emission. Based on virial analysis and higher values of self-gravitating pressure, the clumps are found unstable against gravitational collapse. We find 474 young stellar objects (YSOs) in the selected region, and ∼72% of these YSOs are found in the clusters distributed mainly toward the clumps in the EFS. These YSOs might have spontaneously formed due to processes not related to the expanding H ii region. At the edges of BN, four additional clumps are also associated with YSO clusters, which appear to be influenced by the expanding H ii region. The most massive clump in the EFS contains two compact radio sources traced in the Giant Metre-wave Radio Telescope 1.28 GHz map and a massive protostar candidate, IRS 1, prior to an ultracompact H ii phase. Using the Very Large Telescope/NACO near-infrared images, IRS 1 is resolved with a jet-like feature within a 4200 au scale.

  8. The Small Magellanic Cloud in the far infrared. I. ISO's 170 mu m map and revisit of the IRAS 12-100 mu m data

    Science.gov (United States)

    Wilke, K.; Stickel, M.; Haas, M.; Herbstmeier, U.; Klaas, U.; Lemke, D.

    2003-04-01

    The ISOPHOT experiment onboard the ISO satellite generated a complete view of the Small Magellanic Cloud (SMC) at 170 mu m with 1.5 arcmin resolution. The map is analysed using an automated photometry program enabling accurate photometric characterization of the far infrared (FIR) emitting regions. An integrated FIR luminosity of 8.5x 107 Lsun is obtained, leading to a star formation rate of SFRFIR=0.015 Msun/yr. With an average dust temperature of TD, 170/100}=20.5 K>, the total dust mass follows to MD=3.7x105 Msun. In this paper, the sources detected at 170 mu m are compared with those obtainable from the IRAS satellite data. For this purpose, the 12 mu m, 25 mu m, 60 mu m, and 100 mu m IRAS high resolution (HiRes) maps of the SMC are re-examined using the same method. In contrast to former studies, this provides an all-band ISO/IRAS source catalog which is no longer based on eyeball classification, but relies on an algorithm which is capable of automated, repeatable photometry, even for irregular sources. In the mid infrared IRAS bands numerous bright FIR emitting regions in the SMC are detected and classified: 73 sources are found at 12 mu m, 135 at 25 mu m (most of them with Fnu =2.0 Jy. Comparable numbers are found for the two FIR IRAS maps at 60 mu m (384) and 100 mu m (338) with fluxes up to 450 Jy. 70 of the 243 170 mu m sources are assigned a general SED type (``cold'', ``warm'', i.e., 30 K) for the first time. A comparison with earlier IRAS results suggests that many source flux densities in those studies have been under- or overestimated because of non-standardized fitting methods. Many sources with flux densities up to 40 Jy listed in former catalogs cannot be identified in our data. Based on observations with ISO, an ESA project with instruments funded by ESA Member States (especially the PI countries: France, Germany, The Netherlands and the UK) and with the participation of ISAS and NASA. The tables in Appendices A to E are only available in

  9. Optical identifications of IRAS point sources: the Fornax, Hydra I and Coma clusters

    International Nuclear Information System (INIS)

    Wang, G.; Leggett, S.K.; Savage, A.

    1991-01-01

    We present optical identifications for 66 IRAS point sources in the region of the Fornax cluster of galaxies, 106 IRAS point sources in the region of the Hydra I cluster of galaxies (Abell 1060) and 59 IRAS point sources in the region of the Coma cluster of galaxies (Abell 1656). Eight other sources in Hydra I do not have optical counterparts and are very probably due to infrared cirrus. Twenty-three (35 per cent) of the Fornax sources are associated with stars and 43 (65 per cent) with galaxies; 48 (42 per cent) of the Hydra I sources are associated with stars and 58 (51 per cent) with galaxies; 18 (31 per cent) of the Coma sources are associated with stars and 41 (69 per cent) with galaxies. The stellar and infrared cirrus surface density is consistent with the galactic latitude of each field. (author)

  10. Multimolecular studies of Galactic star-forming regions

    NARCIS (Netherlands)

    Baan, W. A.; Loenen, A. F.; Spaans, M.

    2014-01-01

    Molecular emission-line observations of isolated Galactic star-forming regions are used to model the physical properties of the molecular interstellar medium in these systems. Observed line ratios are compared with the results predicted by models that incorporate gas-phase chemistry and the heating

  11. Forming the development program of industrial cooperation in the region

    Directory of Open Access Journals (Sweden)

    Aleksandr Viktorovich Makarov

    2011-09-01

    Full Text Available The paper defines the role of industrial cooperation in the process of ensuring the competitiveness of the Russian economy. Economic nature of this form of long-term cooperation specified subjects and objects of cooperatives, the effects of its introduction is disclosed. Formed concept of the Programme of development of industrial cooperation in the region, taking into account the state gained in building industrial complex and the differentiation of state support measures at various stages of development cooperation. Forecast parameters on implementation of cooperation development in Sverdlovsk region for the period up to 2020 are formed. According to the reported characteristics and conducted author's calculations, based on realistic projections of engineering enterprises of Sverdlovsk region, a four-indicator sectorgram for the performance evaluation of the program for the development of industrial and technological cooperation in the field of engineering is presented. The described approach to the establishment of a development program for the industrial cooperation in the region can monitor the situation, timely adjust regional performance standards and policies in this field

  12. SPECTROSCOPIC VARIABILITY OF IRAS 22272+5435

    International Nuclear Information System (INIS)

    Začs, Laimons; Grankina, Aija; Musaev, Faig; Kaminsky, Bogdan; Pavlenko, Yakiv; Sperauskas, Julius; Hrivnak, Bruce J.

    2016-01-01

    A time series of high-resolution spectra was observed in the optical wavelength region for the bright proto-planetary nebula IRAS 22272+5435 (HD 235858), along with a simultaneous monitoring of its radial velocity and BV R C magnitudes. The object is known to vary in light, color, and velocity owing to pulsation with a period of 132 days. The light and color variations are accompanied by significant changes in spectral features, most of which are identified as lines of carbon-bearing molecules. According to the observations, the C 2 Swan system and CN Red system lines are stronger near the light minimum. A photospheric spectrum of the central star was calculated using new self-consistent atmospheric models. The observed intensity variations in the C 2 Swan system and CN Red system lines were found to be much larger than expected if due solely to the temperature variation in the atmosphere of the pulsating star. In addition, the molecular lines are blueshifted relative to the photospheric velocity. The site of formation of the strong molecular features appears to be a cool outflow triggered by the pulsation. The variability in atomic lines seems to be mostly due variations of the effective temperature during the pulsation cycle. The profiles of strong atomic lines are split, and some of them are variable in a timescale of a week or so, probably because of shock waves in the outer atmosphere

  13. Form factors and QCD in spacelike and timelike region

    International Nuclear Information System (INIS)

    A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

    2000-01-01

    The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  14. Form factors and QCD in spacelike and timelike regions

    International Nuclear Information System (INIS)

    Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

    2000-01-01

    We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  15. Areas and forms of regional cooperation in multi-structured (matreshka-style) regions (Tyumen region, Russia)

    OpenAIRE

    LARIONOV ANDREY V.

    2015-01-01

    The problem of the administrative, economic and social sustainability of a group consisting of neighboring regions with close ties has no clear solution yet. Should closely-tied regions in the long run form a centralized system of administrative bodies, compress their budgets into one, and construct unified social programs, or not? To answer this question, in the article we describe a case that represents the paramount form of cooperation amongst closely-tied regions. It is the case of the so...

  16. Detection of OH radicals from IRAS sources

    International Nuclear Information System (INIS)

    Lewis, B.M.; Eder, J.; Terzian, Y.

    1985-01-01

    An efficient method for detecting new OH/infrared stars is to begin with IRAS source positions, selected for appropriate infrared colours, and using radio-line observations to confirm the OH properties. The authors demonstrate the validity of this approach here, using the Arecibo 305 m radio-telescope to confirm the 1,612 MHz line observations of sources in IRAS Circulars 8 and 9; the present observations identify 21 new OH/infrared stars. The new sources have weaker 1,612 MHz fluxes, bluer (60-25) μm colours and a smaller mean separation between the principal emission peaks than previous samples. (author)

  17. Photodynamic therapy (PDT and waterfiltered infrared A (wIRA in patients with recalcitrant common hand and foot warts

    Directory of Open Access Journals (Sweden)

    Hoffmann, Gerd

    2004-10-01

    Full Text Available Background: Common warts (verrucae vulgares are human papilloma virus (HPV infections with a high incidence and prevalence, most often affecting hands and feet, being able to impair quality of life. About 30 different therapeutic regimens described in literature reveal a lack of a single striking strategy. Recent publications showed positive results of photodynamic therapy (PDT with 5-aminolevulinic acid (5-ALA in the treatment of HPV-induced skin diseases, especially warts, using visible light (VIS to stimulate an absorption band of endogenously formed protoporphyrin IX. Additional experiences adding waterfiltered infrared A (wIRA during 5-ALA-PDT revealed positive effects. Aim of the study: First prospective randomised controlled blind study including PDT and wIRA in the treatment of recalcitrant common hand and foot warts. Comparison of "5-ALA cream (ALA vs. placebo cream (PLC" and "irradiation with visible light and wIRA (VIS+wIRA vs. irradiation with visible light alone (VIS". Methods: Pre-treatment with keratolysis (salicylic acid and curettage. PDT treatment: topical application of 5-ALA (Medac in "unguentum emulsificans aquosum" vs. placebo; irradiation: combination of VIS and a large amount of wIRA (Hydrosun® radiator type 501, 4 mm water cuvette, waterfiltered spectrum 590-1400 nm, contact-free, typically painless vs. VIS alone. Post-treatment with retinoic acid ointment. One to three therapy cycles every 3 weeks. Main variable of interest: "Percent change of total wart area of each patient over the time" (18 weeks. Global judgement by patient and by physician and subjective rating of feeling/pain (visual analogue scales. 80 patients with therapy-resistant common hand and foot warts were assigned randomly into one of the four therapy groups with comparable numbers of warts at comparable sites in all groups. Results: The individual total wart area decreased during 18 weeks in group 1 (ALA+VIS+wIRA and in group 2 (PLC+VIS+wIRA

  18. Dynamical evolution of star-forming regions - II. Basic kinematics

    Science.gov (United States)

    Parker, Richard J.; Wright, Nicholas J.

    2016-04-01

    We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

  19. New Herbig-Haro objects in star-forming regions

    Science.gov (United States)

    Reipurth, BO; Graham, J. A.

    1988-01-01

    A list of 25 new Herbig-Haro objects, HH 58 to HH 82, in the Orion molecular clouds and in southern molecular cloud complexes has been compiled. CCD images in the S II 6717, 6731 forbidden lines are presented for the objects, together with a few spectra and some IR observations. The individual objects and, when identified, their energy sources are discussed. HH 65 is located in the red lobe of the bipolar outflow associated with the highly variable reflection nebula Re 50. HH 67 is a 22-arcsec long sinusoidal jet. HH 68/69 consists of a long, linear chain of four HH knots. HH 72 emerges from a 120-solar luminosity IRAS source embedded in a Bok globule. HH 79 is the first HH object discovered in the Ophiuchus clouds. HH 80/81 in Sagittarius are among the brightest HH objects known, have complex velocities, high excitation conditions and emerge from a 6000-solar luminosity young B-star. HH 82 is associated with the bright variable star S Coronae Australis.

  20. IRAS variables as galactic structure tracers - Classification of the bright variables

    Science.gov (United States)

    Allen, L. E.; Kleinmann, S. G.; Weinberg, M. D.

    1993-01-01

    The characteristics of the 'bright infrared variables' (BIRVs), a sample consisting of the 300 brightest stars in the IRAS Point Source Catalog with IRAS variability index VAR of 98 or greater, are investigated with the purpose of establishing which of IRAS variables are AGB stars (e.g., oxygen-rich Miras and carbon stars, as was assumed by Weinberg (1992)). Results of the analysis of optical, infrared, and microwave spectroscopy of these stars indicate that, out of 88 stars in the BIRV sample identified with cataloged variables, 86 can be classified as Miras. Results of a similar analysis performed for a color-selected sample of stars, using the color limits employed by Habing (1988) to select AGB stars, showed that, out of 52 percent of classified stars, 38 percent are non-AGB stars, including H II regions, planetary nebulae, supergiants, and young stellar objects, indicating that studies using color-selected samples are subject to misinterpretation.

  1. Academy panel proposes new form of regional institution

    International Nuclear Information System (INIS)

    Kloman, E.H.

    1977-01-01

    A panel of the National Academy of Public Administration has proposed development of a new form of interstate regional institution as an instrument for the siting, licensing, and regulating of nuclear facilities. Noting the danger that the nation's energy supplies may prove inadequate to meet basic needs of the economy despite increasing emphasis on greater use of coal and energy conservation, the panel pointed to the virtual stalemate in the national decision-making process for siting and licensing nuclear plants. A basic cause of the logjam is the growing conflict and overlap between federal and state agencies for authorizing nuclear development. The panel recommended setting up a new form of regional organization to fill an institutional void between federal and state levels of government. The proposed regional organizations would be established through federal legislation preempting to the Federal Government the regulation of siting, licensing, and construction of nuclear facilities. They would have jurisdiction over all matters in the operation of nuclear plants relating to public health and safety including those environmental factors and socio-economic factors covered in the preparation of environmental impact statements

  2. Gemini IFU, VLA, and HST observations of the OH megamaser galaxy IRAS F23199+0123: the hidden monster and its outflow

    Science.gov (United States)

    Hekatelyne, C.; Riffel, Rogemar A.; Sales, Dinalva; Robinson, Andrew; Gallimore, Jack; Storchi-Bergmann, Thaisa; Kharb, Preeti; O'Dea, Christopher; Baum, Stefi

    2018-03-01

    We present Gemini Multi-Object Spectrograph (GMOS) Integral field Unit (IFU), Very Large Array (VLA), and Hubble Space Telescope (HST) observations of the OH megamaser (OHM) galaxy IRAS F23199+0123. Our observations show that this system is an interacting pair, with two OHM sources associated with the eastern (IRAS 23199E) member. The two members of the pair present somewhat extended radio emission at 3 and 20 cm, with flux peaks at each nucleus. The GMOS-IFU observations cover the inner ˜6 kpc of IRAS 23199E at a spatial resolution of 2.3 kpc. The GMOS-IFU flux distributions in Hα and [N II] λ6583 are similar to that of an HST [N II]+Hα narrow-band image, being more extended along the north-east-south-west direction, as also observed in the continuum HST F814W image. The GMOS-IFU Hα flux map of IRAS 23199E shows three extranuclear knots attributed to star-forming complexes. We have discovered a Seyfert 1 nucleus in this galaxy, as its nuclear spectrum shows an unresolved broad (full width at half-maximum ≈2170 km s-1) double-peaked Hα component, from which we derive a black hole mass of M_{BH} = 3.8^{+0.3}_{-0.2}× 106 M⊙. The gas kinematics shows low velocity dispersions (σ) and low [N II]/Hα ratios for the star-forming complexes and higher σ and [N II]/Hα surrounding the radio emission region, supporting interaction between the radio plasma and ambient gas. The two OH masers detected in IRAS F23199E are observed in the vicinity of these enhanced σ regions, supporting their association with the active nucleus and its interaction with the surrounding gas. The gas velocity field can be partially reproduced by rotation in a disc, with residuals along the north-south direction being tentatively attributed to emission from the front walls of a bipolar outflow.

  3. OH masers associated with IRAS point sources

    NARCIS (Netherlands)

    Masheder, MRW; Cohen, RJ; Martin-Hernandez, NL; Migenes,; Reid, MJ

    2002-01-01

    We report a search for masers from the Lambda-doublet of the ground-state of OH at 18cm, carried out with the Jodrell Bank Lovell Telescope and with the 25m Dwingeloo telescope. All objects north of delta = -20degrees which appear in the IRAS Point Source Catalog with fluxes > 1000 Jy at 60mum and

  4. IMAGE CONSTRUCTION FROM THE IRAS SURVEY

    NARCIS (Netherlands)

    BONTEKOE, TR; KESTER, DJM; PRICE, SD; DEJONGE, ARW; WESSELIUS, PR

    IRAS survery data can be used successfully to produce images of extended objects. The major difficulties, viz. non-uniform sampling, different response functions for each detector, and varying signal-to-noise levels for each detector for each scan, have been resolved. The results of three different

  5. Unidentified point sources in the IRAS minisurvey

    Science.gov (United States)

    Houck, J. R.; Soifer, B. T.; Neugebauer, G.; Beichman, C. A.; Aumann, H. H.; Clegg, P. E.; Gillett, F. C.; Habing, H. J.; Hauser, M. G.; Low, F. J.

    1984-01-01

    Nine bright, point-like 60 micron sources have been selected from the sample of 8709 sources in the IRAS minisurvey. These sources have no counterparts in a variety of catalogs of nonstellar objects. Four objects have no visible counterparts, while five have faint stellar objects visible in the error ellipse. These sources do not resemble objects previously known to be bright infrared sources.

  6. Stellar Feedback in Massive Star-Forming Regions

    Science.gov (United States)

    Baldwin, Jack; Pellegrini, Eric; Ferland, Gary; Murray, Norm; Hanson, Margaret

    2008-02-01

    Star formation rates and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study in the two nearest giant star-forming regions to nail down the physics that produces the 10-20 parsec bubbles seen to surround young massive clusters in the Milky Way. This will determine if and how the clusters disrupt their natal giant molecular clouds (GMCs). Here we request 4 nights on the Blanco telescope to obtain dense grids of optical long-slit spectra criss-crossing each nebula. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3000 different spots in each nebula. From this we can determine a number of dynamically important quantities, such as the gas density and temperature, hence pressure in and around these bubbles. These quantities can be compared to the dynamical (gravitationally induced) pressure, and the radiation pressure. All can be employed in dynamical models for the evolution of a GMC under the influence of an embedded massive star cluster. This research will elucidate the detailed workings of the star-forming regions which dominate the star formation rate in the Milky Way, and also will steadily improve our calibration and understanding of more distant, less well-resolved objects such as ULIRGS, Lyman break, and submillimeter galaxies.

  7. VLBA Changes Picture of Famous Star-Forming Region

    Science.gov (United States)

    2007-10-01

    Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is

  8. THE DISK POPULATION OF THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.

    2010-01-01

    We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 μm that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg 2 ) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Through these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is ∼75% for solar-mass stars and declines to ∼45% for low-mass stars and brown dwarfs (0.01-0.3 M sun ). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower (∼20%) in IC 348 and σ Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for ∼200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks. The ratio of the number of evolved and

  9. The census of complex organic molecules in the solar-type protostar IRAS16293-2422

    Energy Technology Data Exchange (ETDEWEB)

    Jaber, Ali A.; Ceccarelli, C.; Kahane, C. [Université Grenoble Alpes, IPAG, F-38000 Grenoble (France); Caux, E. [Université de Toulouse, UPS-OMP, IRAP, F-31400 Toulouse (France)

    2014-08-10

    Complex organic molecules (COMs) are considered to be crucial molecules, since they are connected with organic chemistry, at the basis of terrestrial life. More pragmatically, they are molecules which in principle are difficult to synthesize in harsh interstellar environments and, therefore, are a crucial test for astrochemical models. Current models assume that several COMs are synthesized on lukewarm grain surfaces (≳30-40 K) and released in the gas phase at dust temperatures of ≳100 K. However, recent detections of COMs in ≲20 K gas demonstrate that we still need important pieces to complete the puzzle of COMs formation. Here, we present a complete census of the oxygen- and nitrogen-bearing COMs, previously detected in different Interstellar Medium (ISM) regions, toward the solar-type protostar IRAS16293-2422. The census was obtained from the millimeter-submillimeter unbiased spectral survey TIMASSS. Of the 29 COMs searched for, 6 were detected: methyl cyanide, ketene, acetaldehyde, formamide, dimethyl ether, and methyl formate. Multifrequency analysis of the last five COMs provides clear evidence that they are present in the cold (≲30 K) envelope of IRAS16293-2422, with abundances of 0.03-2 × 10{sup –10}. Our data do not allow us to support the hypothesis that the COMs abundance increases with increasing dust temperature in the cold envelope, as expected if COMs were predominately formed on lukewarm grain surfaces. Finally, when also considering other ISM sources, we find a strong correlation over five orders of magnitude between methyl formate and dimethyl ether, and methyl formate and formamide abundances, which may point to a link between these two couples of species in cold and warm gas.

  10. H2O masers in star-forming regions

    International Nuclear Information System (INIS)

    Downes, D.

    1985-01-01

    Water vapour near star forming regions was first detected by Cheung et al. (1969) and shortly thereafter was recognised to be maser emission. In spite of this 15 year history of H 2 O observations, the problem of interpreting such strong H 2 O masers as W49 and Orion is still very acute. Not one of the models now available can explain in an unconstrained fashion why a very large maser flux can emanate from clouds of such small size. Whereas some models proposed to explain OH masers have retained their plausibility under the pressure of new observations, H 2 O models have not. The author outlines the background of the H 2 O problem, stating that the strongest of the masers discovered are still not satisfactorily explained today. (Auth.)

  11. HUBBLE'S PANORAMIC PORTRAIT OF A VAST STAR-FORMING REGION

    Science.gov (United States)

    2002-01-01

    NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

  12. Star formation and gas inflows in the OH Megamaser galaxy IRAS03056+2034

    Science.gov (United States)

    Hekatelyne, C.; Riffel, Rogemar A.; Sales, Dinalva; Robinson, Andrew; Storchi-Bergmann, Thaisa; Kharb, Preeti; Gallimore, Jack; Baum, Stefi; O'Dea, Christopher

    2018-06-01

    We have obtained observations of the OH Megamaser galaxy IRAS03056+0234 using Gemini Multi-Object Spectrograph (GMOS) Integral Field Unit (IFU), Very Large Array (VLA) and Hubble Space Telescope (HST). The HST data reveals spiral arms containing knots of emission associated to star forming regions. The GMOS-IFU data cover the spectral range of 4500 to 7500 Å at a velocity resolution of 90 km s-1 and spatial resolution of 506 pc. The emission-line flux distributions reveal a ring of star forming regions with radius of 786 pc centred at the nucleus of the galaxy, with an ionized gas mass of 1.2× 108M⊙, an ionizing photon luminosity of log Q[H+]=53.8 and a star formation rate of 4.9 M⊙ yr-1. The emission-line ratios and radio emission suggest that the gas at the nuclear region is excited by both starburst activity and an active galactic nucleus. The gas velocity fields are partially reproduced by rotation in the galactic plane, but show, in addition, excess redshifts to the east of the nucleus, consistent with gas inflows towards the nucleus, with velocity of ˜45 km s-1 and a mass inflow rate of ˜7.7 × 10-3 M⊙ yr-1.

  13. Symbiotic stars observed from the IRAS satellite

    International Nuclear Information System (INIS)

    Luud, L.; Tuvikene, T.

    1987-01-01

    Symbiotic stars according to Alfven's catalogue have been checked for coincidence with the IRAS-observed for-infrared sources. 72 symbiotic and possible symbiotic stars have been identified with the IRAS-observed sources. A catalogue of identified stars and energy distributions of representative stars are given. It turns out that the dust in symbiotic stars is a more widespread phenomenon than that it was believed before. Almost 40% of systems are the dusty ones. Among objects with dust temperature some tens of K have been found. It is shown that the only useful two-color diagram is (K-m 12 )-(m 12 -m 25 ). Attention is paid to a type of symbiotic stars with G spectral class cold component which needs special investigation

  14. Far Infrared Mapping of Three Galactic Star Forming Regions: W3 ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging Solutions)

    - nyk 1990). Although extensions are seen in many IRAS bands, the TIFR maps show superior angular resolution as a result of their smaller and circular beam. Discrete sources have been extracted from the TIFR and HIRES maps using a.

  15. Finding charts for southern IRAS galaxies

    International Nuclear Information System (INIS)

    Sutherland, W.J.; Maddox, S.J.; Saunders, W.

    1991-01-01

    Using the APM Galaxy Survey, we have generated a collection of finding charts for 4614 sources with non-stellar colours in the IRAS Faint Source Catalogue south of δ= -17.5 o . Over 90 per cent of the sources are reliably identified with an optical object, and we provide 1-arcsec positions and B J magnitudes for these. We will provide paper copies of the charts on request, at a small charge to cover photocopying costs. (author)

  16. Preferential Pathway for Glycine Formation in Star-Forming Regions

    Science.gov (United States)

    Pilling, S.; Boechat-Roberty, H. M.; Baptista, L.; Santos A. C., F.

    Interstellar clouds, similar to that from which the solar system was formed, contain many organic molecules including aldehydes, acids, ketones, and sugars Ehrenfreund & Charnley (2000). Those organic compounds have important functions in terrestrial biochemistry and could also have been important in prebiotic synthesis. The simplest amino acid, glycine (NH2CH2COOH), was recently detected in the hot molecular cores Sgr B2(N-LMH), Orion KL, and W51 e1/e2 Kuan et al. (2003). The formic acid (HCOOH) and acetic acid(CH3COOH) have also been detected in those regions Liu et al. (2002), Remijan et al. (2004). The goal of this work is to study experimentally photoionization and photodissociation processes of glycine precursor molecules, acetic acid and formic acid to elucidate a possible preferentially in the glycine synthesis between ice and gas phase. The measurements were taken at the Brazilian Synchrotron Light Laboratory (LNLS), employing soft X-ray photons from a toroidal grating monochromator TGM) beamline (100 - 310 eV). The experimental set up consists of a high vacuum chamber with a Time-Of-Flight Mass Spectrometer (TOF-MS). Mass spectra were obtained using PhotoElectron PhotoIon Coincidence (PEPICO) technique. Kinetic energy distributions and abundances for each ionic fragment have been obtained from the analysis of the corresponding peak shapes in the mass spectra. Dissociative and non-dissociative photoionization cross sections for both molecules were also determined Boechat-Roberty, Pilling & Santos (2005). Due to the high photodissociation cross section of formic acid it is possible that in PDRs regions, just after molecules evaporation from the grains surface, it is almost destructed by soft X-rays, justifying the observed low abundance of HCOOH in gaseous phase Ehrenfreund et al. (2001). Acetic acid have shown to be more stable to the ionizing field, and its main outcomes from dissociation process were the reactive ionic fragments COOH+ and CH3CO+. To

  17. A young bipolar outflow from IRAS 15398-3359

    DEFF Research Database (Denmark)

    Bjerkeli, Per; Jørgensen, Jes Kristian; Brinch, Christian

    2016-01-01

    emission towards IRAS 15398-3359. The lineradiative transfer code LIME is used to construct a full 3D model of thesystem taking all relevant components and scales into account. Results: CO, HCO+, and N2H+ aredetected and shown to trace the motions of the outflow. For CO, thecircumstellar envelope...... and the surrounding cloud also have a profoundimpact on the observed line profiles. N2H+ isdetected in the outflow, but is suppressed towards the central region,perhaps because of the competing reaction between CO andH3+ in the densest regions as well as thedestruction of N2H+ by CO.N2D+ is detected in a ridge south...

  18. Water-filtered infrared-A (wIRA overcomes swallowing disorders and hypersalivation – a case report

    Directory of Open Access Journals (Sweden)

    Hoffmann, Gerd

    2017-08-01

    Full Text Available Case description: A patient with a Barrett oesophageal carcinoma and a resection of the oesophagus with gastric pull-up developed swallowing disorders 6 years and 2 months after the operation. Within 1 year and 7 months two recurrences of the tumor at the anastomosis were found and treated with combined chemoradiotherapy or chemotherapy respectively. 7 years and 9 months after the operation local tumor masses and destruction were present with no ability to orally drink or eat (full feeding by jejunal PEG tube: quality of life was poor, as saliva and mucus were very viscous (pulling filaments and could not be swallowed and had to be spat out throughout the day and night resulting in short periods of sleep (awaking from the necessity to spit out. In total the situation was interpreted more as a problem related to a feeling of choking (with food or fluid in the sense of a functional dysphagia rather than as a swallowing disorder from a structural stenosis. At that time acetylcysteine (2 times 200 mg per day, given via the PEG tube and irradiation with water-filtered infrared-A (wIRA, a special form of heat radiation, of the ventral part of the neck and the thorax were added to the therapy. Within 1 day with acetylcysteine saliva and mucus became less viscous. Within 2 days with wIRA (one day with 4 to 5 hours with irradiation with wIRA at home salivation decreased markedly and quality of life clearly improved: For the first time the patient slept without interruption and without the need for sleep-inducing medication. After 5 days with wIRA the patient could eat his first soft dumpling although drinking of fluids was still not possible. After 2½ weeks with wIRA the patient could eat his first minced schnitzel (escalope. Following the commencement of wIRA (with typically approximately 90–150 minutes irradiation with wIRA per day the patient had 8 months with good quality of life with only small amounts of liquid saliva and mucus and without the

  19. Millimetre wavelength methanol masers survey towards massive star forming regions

    Science.gov (United States)

    Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.

    2007-03-01

    We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

  20. A ROTATING MOLECULAR DISK TOWARD IRAS 18162-2048, THE EXCITING SOURCE OF HH 80-81

    International Nuclear Information System (INIS)

    Fernandez-Lopez, M.; Curiel, S.; Girart, J. M.; Gomez, Y.; Ho, P. T. P.; Patel, N.

    2011-01-01

    We present several molecular line emission arcsecond and subarcsecond observations obtained with the Submillimeter Array in the direction of the massive protostar IRAS 18162-2048, the exciting source of HH 80-81. The data clearly indicate the presence of a compact (radius ∼425-850 AU) SO 2 structure, enveloping the more compact (radius ∼ sun . The SO 2 spectral line data also allow us to constrain the structure temperature between 120 and 160 K and the volume density ∼> 2 x 10 9 cm -3 . We also find that such a rotating flattened system could be unstable due to gravitational disturbances. The data from C 17 O line emission show a dense core within this star-forming region. Additionally, the H 2 CO and SO emissions appear clumpy and trace the disk-like structure, a possible interaction between a molecular core and the outflows, and in part, the cavity walls excavated by the thermal radio jet.

  1. A highly embedded protostar in SFO 18: IRAS 05417+0907

    Science.gov (United States)

    Saha, Piyali; Gopinathan, Maheswar; Puravankara, Manoj; Sharma, Neha; Soam, Archana

    2018-04-01

    Bright-rimmed clouds, located at the periphery of relatively evolved HIT regions, are considered to be the sites of star formation possibly triggered by the implosion caused due to the ionizing radiation from nearby massive stars. SFO 18 is one such region showing a bright-rim on the side facing the 0-type star, A Ori. A point source, IRAS 05417+0907, is detected towards the high density region of the cloud. A molecular outflow has been found to be associated with the source. The outflow is directed towards a Herbig-Haro object, HH 175. From the Spitzer and WISE observations, we show evidence of a physical connection between the molecular outflow, IRAS 05417+0907 and the HH object. The spectral energy distribution constructed using multi-wavelength data shows that the point source is most likely a highly embedded protostar.

  2. CRYSTALLINE SILICATES IN EVOLVED STARS. I. SPITZER/INFRARED SPECTROGRAPH SPECTROSCOPY OF IRAS 16456-3542, 18354-0638, AND 23239+5754

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, B. W.; Zhang, Ke [Department of Astronomy, Beijing Normal University, Beijing 100875 (China); Li, Aigen [Department of Physics and Astronomy, University of Missouri, Columbia, MO 65211 (United States); Lisse, C. M., E-mail: bjiang@bnu.edu.cn, E-mail: kzhang@caltech.edu, E-mail: lia@missouri.edu, E-mail: carey.lisse@jhuapl.edu [Johns Hopkins University, Applied Physics Laboratory, Laurel, MD 20723 (United States)

    2013-03-01

    We report the Spitzer Infrared Spectrograph (IRS) observations of three evolved stars: IRAS 16456-3542, 18354-0638, and 23239+5754. The 9.9-37.2 {mu}m Spitzer/IRS high-resolution spectra of these three sources exhibit rich sets of enstatite-dominated crystalline silicate emission features. IRAS 16456-3542 is extremely rich in crystalline silicates, with >90% of its silicate mass in crystalline form, the highest to date ever reported for crystalline silicate sources.

  3. Infrared Astronomical Satellite (IRAS) Catalogs and Atlases. Explanatory Supplement

    Science.gov (United States)

    Beichman, C. A. (Editor); Neugebauer, G. (Editor); Habing, H. J. (Editor); Clegg, P. E. (Editor); Chester, T. J. (Editor)

    1985-01-01

    The Infrared Astronomical Satellite (IRAS) mission is described. An overview of the mission, a description of the satellite and its telescope system, and a discussion of the mission design, requirements, and inflight modifications are given. Data reduction, flight tests, flux reconstruction and calibration, data processing, and the formats of the IRAS catalogs and atlases are also considered.

  4. Multiple monopolar outflows driven by massive protostars in IRAS 18162-2048

    Energy Technology Data Exchange (ETDEWEB)

    Fernández-López, M. [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States); Girart, J. M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB, Facultat de Ciencies, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Curiel, S.; Fonfría, J. P. [Instituto de Astronomía, Universidad Nacional Autónoma de México (UNAM), Apartado Postal 70-264, 04510 México, DF (Mexico); Zapata, L. A. [Centro de Radioastronomía y Astrofísica, UNAM, Apartado Postal 3-72, Morelia, Michoacán 58089 (Mexico); Qiu, K., E-mail: manferna@illinois.edu, E-mail: girart@ieec.cat [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China)

    2013-11-20

    In this article, we present Combined Array for Research in Millimeter-wave Astronomy (CARMA) 3.5 mm observations and SubMillimeter Array (SMA) 870 μm observations toward the high-mass star-forming region IRAS 18162-2048, which is the core of the HH 80/81/80N system. Molecular emission from HCN, HCO{sup +}, and SiO traces two molecular outflows (the so-called northeast and northwest outflows). These outflows have their origin in a region close to the position of MM2, a millimeter source known to harbor two protostars. For the first time we estimate the physical characteristics of these molecular outflows, which are similar to those of 10{sup 3}-5 × 10{sup 3} L {sub ☉} protostars, and suggest that MM2 harbors high-mass protostars. High-angular resolution CO observations show an additional outflow due southeast. Also for the first time, we identify its driving source, MM2(E), and see evidence of precession. All three outflows have a monopolar appearance, but we link the NW and SE lobes, and explain their asymmetric shape as being a consequence of possible deflection.

  5. Radiation effects in IRAS extrinsic infrared detectors

    Science.gov (United States)

    Varnell, L.; Langford, D. E.

    1982-01-01

    During the calibration and testing of the Infrared Astronomy Satellite (IRAS) focal plane, it was observed that the extrinsic photoconductor detectors were affected by gamma radiation at dose levels of the order of one rad. Since the flight environment will subject the focal plane to dose levels of this order from protons in single pass through the South Atlantic Anomaly, an extensive program of radiation tests was carried out to measure the radiation effects and to devise a method to counteract these effects. The effects observed after irradiation are increased responsivity, noise, and rate of spiking of the detectors after gamma-ray doses of less than 0.1 rad. The detectors can be returned almost to pre-irradiation performance by increasing the detector bias to breakdown and allowing a large current to flow for several minutes. No adverse effects on the detectors have been observed from this bias boost, and this technique will be used for IRAS with frequent calibration to ensure the accuracy of observations made with the instrument.

  6. Travel and urban form in the Greater Copenhagen region

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    of the economic upturn – with a later point in time where the financial crisis had radically changed the economic climate. It follows from the specificity of the historical events that an analysis of what happened to urban form and transport over the financial crisis is to be seen as a case study......Research into the associations between urban form and travel in the capital areal has focussed on subcenters and the stability of urban form correlates over time. A trend towards de-concentration and formation of subcenters in metropolitan areas has been acknowledged for decades. Studies have...... analyzed the new urban structure by identifying subcenters and their land value impacts. Others have focused on subcenters as a location attribute or ‘intervention’ that affects travel patterns and therefore may be employed in the context of urban and transportation demand management. The research has...

  7. Gemini Spectroscopic Survey of Young Intermediate-Mass Star-Forming Regions

    Science.gov (United States)

    Lundquist, Michael; Kobulnicky, Henry

    2018-01-01

    The majority of stars form in embedded clusters. Current research into star formation has focused on either high-mass star-forming regions or low-mass star-forming regions. We present the results from a Gemini spectroscopic survey of young intermediate-mass star-forming regions. These are star forming regions selected to produce stars up to but not exceeding 8 solar masses. We obtained spectra of these regions with GNIRS on Gemini North and Flamingos-2 on Gemini South. We also combine this with near-infrared imaging from 2MASS, UKIDSS, and VVV to study the stellar content.

  8. Atomic hydrogen in the Orion star-forming region

    International Nuclear Information System (INIS)

    Chromey, F.R.; Elmegreen, B.G.; Elmegreen, D.M.

    1989-01-01

    A large-scale survey of atomic hydrogen in Orion reveals low-density material with a total mass comparable to that in dense molecular clouds. The atomic gas is sufficiently dense that it can shield the molecular material from photodissociative radiation and provide a pressure link to the low-density intercloud medium. An excess of H I emission comes from photodissociation fronts near the bright stars and from a giant shell in the Orion Belt region. This shell may have caused the apparent bifurcation between the Orion A and B clouds, and the associated pressures may have induced peculiar motions and star formation in NGC 2023 and 2024. 49 refs

  9. Measurement of weak meson form factors in spacelike regions

    CERN Document Server

    Brene, N

    1973-01-01

    With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

  10. Study of deuterated water in the low-mass protostar IRAS16293-2422

    Science.gov (United States)

    Coutens, A.; Vastel, C.; Caux, E.; Ceccarelli, C.; Herschel Chess Team

    2011-05-01

    Observations of deuterated water are an important complement for studies of H2O, since they give strong constraints on the formation processes: grain surfaces versus gas-phase chemistry through energetic process as shocks. The CHESS (Chemical HErschel Surveys of Star forming regions) Key Program has allowed to detect a lot of transitions of HDO (8) and H2O (16) as well as its isotopes H_218O and H_217O towards the low-mass protostar IRAS16293-2422 thanks to the unbiaised spectral survey carried out with the HIFI instrument on board the Herschel Space Observatory. Complementary data of HDO from the ground-based telescopes IRAM and JCMT are also available, allowing a precise determination of the abundance of deuterated water through the protostar envelope. In order to reproduce the observed line profiles, we have performed a modeling of HDO from the hot corino through the envelope using the physical structure of the protostar (Crimier et al. 2010) and the spherical Monte Carlo radiative transfer code RATRAN, which takes also into account radiative pumping by continuum emission from dust. We have used new HDO collision rates with H_2, recently computed by Wiesenfeld, Scribano and Faure (2011, PCCP). The same method has been applied to model H_2O and its isotopes H_218O and H_217O. We will present the results of this analysis and discuss the determined abundances.

  11. Molecular Diagnostics of the Interstellar Medium and Star Forming Regions

    Science.gov (United States)

    Hartquist, T. W.; Dalgarno, A.

    1996-03-01

    Selected examples of the use of observationally inferred molecular level populations and chemical compositions in the diagnosis of interstellar sources and processes important in them (and in other diffuse astrophysical sources) are given. The sources considered include the interclump medium of a giant molecular cloud, dark cores which are the progenitors of star formation, material responding to recent star formation and which may form further stars, and stellar ejecta (including those of supernovae) about to merge with the interstellar medium. The measurement of the microwave background, mixing of material between different nuclear burning zones in evolved stars and turbulent boundary layers (which are present in and influence the structures and evolution of all diffuse astrophysical sources) are treated.

  12. Current correlators and form factors in the resonance region

    Energy Technology Data Exchange (ETDEWEB)

    Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)

    2009-01-15

    Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

  13. Symbiotic stars according to IRAS observations

    International Nuclear Information System (INIS)

    Luud, L.; Tuvikene, T.

    1987-01-01

    Symbiotic stars contained in Allen's catalog are examined with a view to establishing their coincidence with sources of far infrared radiation in the catalog of point sources observed with the IRAS satellite. Altogether, 72 symbiotic or suspected symbiotic objects have been identified. A list of the identified stars has been compiled, and the energy distributions in the infrared spectra of selected stars are given. It has been found that the presence of dust in symbiotic systems is a more widespread phenomenon than hitherto believed. Almost 40% of them are dust systems. Among them, objects with dust temperature of several tens of degrees kelvin have been found. It is shown that the only useful two-color diagram is the (K - m 12 )-(m 12 - m 25 ) diagram. Finally, attention is drawn to a type of symbiotic stars having cold components of the spectral class G; these require a special investigation

  14. The Infrared Astronomical Satellite (IRAS) mission

    Science.gov (United States)

    Neugebauer, G.; Habing, H. J.; Van Duinen, R.; Aumann, H. H.; Beichman, C. A.; Baud, B.; Beintema, D. A.; Boggess, N.; Clegg, P. E.; De Jong, T.

    1984-01-01

    The Infrared Astronomical Satellite (IRAS) consists of a spacecraft and a liquid helium cryostat that contains a cooled IR telescope. The telescope's focal plane assembly is cooled to less than 3 K, and contains 62 IR detectors in the survey array which are arranged so that every source crossing the field of view can be seen by at least two detectors in each of four wavelength bands. The satellite was launched into a 900 km-altitude near-polar orbit, and its cryogenic helium supply was exhausted on November 22, 1983. By mission's end, 72 percent of the sky had been observed with three or more hours-confirming scans, and 95 percent with two or more hours-confirming scans. About 2000 stars detected at 12 and 25 microns early in the mission, and identified in the SAO (1966) catalog, have a positional uncertainty ellipse whose axes are 45 x 9 arcsec for an hours-confirmed source.

  15. Infrared galaxies in the IRAS minisurvey

    Science.gov (United States)

    Soifer, B. T.; Neugebauer, G.; Rowan-Robinson, M.; Clegg, P. E.; Emerson, J. P.; Houck, J. R.; De Jong, T.; Aumann, H. H.; Beichman, C. A.; Boggess, N.

    1984-01-01

    A total of 86 galaxies have been detected at 60 microns in the high galactic latitude portion of the IRAS minisurvey. The surface density of detected galaxies with flux densities greater than 0.5 Jy is 0.25 sq deg. Virtually all the galaxies detected are spiral galaxies and have an infrared to blue luminosity ratio ranging from 50 to 0.5. For the infrared-selected sample, no obvious correlation exists between infrared excess and color temperature. The infrared flux from 10 to 100 microns contributes approximately 5 percent of the blue luminosity for galaxies in the magnitude range 14 less than m(pg) less than 18 mag. The fraction of interacting galaxies is between one-eighth and one-fourth of the sample.

  16. The distribution of warm gas in the G327.3-0.6 star forming region

    NARCIS (Netherlands)

    Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

    Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

  17. Problems forming innovative-technological image of russian regions

    Directory of Open Access Journals (Sweden)

    Irina Markovna Golova

    2012-06-01

    Full Text Available In this paper, actual problems of innovative-technological image as a key element of the mechanism of the healing sources of socioeconomic development of the Russian regionsare considered. The author gives an assessment of the level of differentiation of subjects of the Russian Federation on the potential for innovative development. Trends in spatial transformations of thescientific and technical and innovation capacities of the country are analyzedand reasons of low innovational activity of Russian enterprises are disclosed. Basic conditions for the success of actions to create an attractive image of innovative-technological territory are formulated. Special attention is paid to the position of regions as participants in the innovational processes, creating preconditions for creativity, harmonization of spatial priorities of innovation, technological and socio-economic development, support for the development of new high-tech industries, improvement of inter-budgetary relations. There are proved priority areas of state policy to reduce barriers to the realization of an innovative paradigm for development of Russian society and effective inclusion of local communities in the implementation of innovative changes.

  18. A redshift survey of IRAS galaxies. I. Sample selection

    International Nuclear Information System (INIS)

    Strauss, M.A.; Davis, M.; Yahil, A.; Huchra, J.P.

    1990-01-01

    A complete all-sky sample of objects, flux-limited at 60 microns, has been extracted from the data base of the IRAS. The sample consists of 5014 objects, of which 2649 are galaxies and 13 are not yet identified. In order to study large-scale structure with this sample, it must be free of systematic biases. Corrections are applied for a major systematic effect in the flux densities listed in the IRAS Point Source Catalog: sources resolved by the IRAS beam have flux densities systematically underestimated. In addition, accurate flux densities are obtained for sources flagged as variable, or of moderate flux quality at 60 microns. The IRAS detectors suffered radiation-induced responsivity enhancement (hysteresis) due to crossings of the satellite scans across the Galactic plane; this effect is measured and is shown to be negligible. 53 refs

  19. Application of MCM image construction to IRAS comet observations

    Science.gov (United States)

    Schlapfer, Martin F.; Walker, Russell G.

    1994-01-01

    There is a wealth of IRAS comet data, obtained in both the survey and pointed observations modes. However, these measurements have remained largely untouched due to difficulties in removing instrumental effects from the data. We have developed a version of the Maximum Correlation Method for Image Construction algorithm (MCM) which operates in the moving coordinate system of the comet and properly treats both real cometary motion and apparent motion due to spacecraft parallax. This algorithm has been implemented on a 486/33 PC in FORTRAN and IDL codes. Preprocessing of the IRAS CRDD includes baseline removal, deglitching, and removal of long tails due to dielectric time constants of the detectors. The resulting images are virtually free from instrumental effects and have the highest possible spatial resolution consistent with the data sampling. We present examples of high resolution IRAS images constructed from survey observations of Comets P/Tempel 1 and P/Tempel 2, and pointed observations of IRAS-Araki-Alcock.

  20. IRAS associations with dark clouds of opacity class 6

    International Nuclear Information System (INIS)

    Parker, N.D.

    1988-01-01

    Accurate positions of the opacity class 6 clouds from the Lynds Catalog of Dark Nebulae have been measured on blue and red prints from the Polomar Observatory Sky Survey (POSS) plates. These revised positions and the dimensions of ellipses fitted to the clouds are listed. The IRAS point source catalog has been searched for sources lying within the boundaries of the 147 clouds in the sample. The distribution and properties of these IRAS sources are discussed briefly. (author)

  1. ALMA 690 GHz OBSERVATIONS OF IRAS 16293–2422B: INFALL IN A HIGHLY OPTICALLY THICK DISK

    International Nuclear Information System (INIS)

    Zapata, Luis A.; Loinard, Laurent; Rodríguez, Luis F.; Hernández-Hernández, Vicente; Takahashi, Satoko; Trejo, Alfonso; Parise, Bérengère

    2013-01-01

    We present sensitive, high angular resolution (∼0.''2) submillimeter continuum and line observations of IRAS 16293–2422B made with the Atacama Large Millimeter/Submillimeter Array. The 0.45 mm continuum observations reveal a single and very compact source associated with IRAS 16293–2422B. This submillimeter source has a deconvolved angular size of about 400 mas (50 AU) and does not show any inner structure inside of this diameter. The H 13 CN, HC 15 N, and CH 3 OH line emission regions are about twice as large as the continuum emission and reveal a pronounced inner depression or ''hole'' with a size comparable to that estimated for the submillimeter continuum. We suggest that the presence of this inner depression and the fact that we do not see an inner structure (or a flat structure) in the continuum are produced by very optically thick dust located in the innermost parts of IRAS 16293–2422B. All three lines also show pronounced inverse P-Cygni profiles with infall and dispersion velocities larger than those recently reported from observations at lower frequencies, suggesting that we are detecting faster and more turbulent gas located closer to the central object. Finally, we report a small east-west velocity gradient in IRAS 16293–2422B that suggests that its disk plane is likely located very close to the plane of the sky.

  2. IRAS surface brightness maps of reflection nebulae in the Pleiades

    Science.gov (United States)

    Castelaz, Michael W.; Werner, M. W.; Sellgren, K.

    1987-01-01

    Surface brightness maps at 12, 25, 60, and 100 microns were made of a 2.5 deg x 2.5 deg area of the reflection nebulae in the Pleiades by coadding IRAS scans of this region. Emission is seen surrounding 17 Tau, 20 Tau, 23 Tau, and 25 Tau in all four bands, coextensive with the visible reflection nebulosity, and extending as far as 30 arcminutes from the illuminating stars. The infrared energy distributions of the nebulae peak in the 100 micron band, but up to 40 percent of the total infrared power lies in the 12 and 25 micron bands. The brightness of the 12 and 25 micron emission and the absence of temperature gradients at these wavelengths are inconsistent with the predictions of equilibrium thermal emission models. The emission at these wavelengths appears to be the result of micron nonequilibrium emission from very small grains, or from molecules consisting of 10-100 carbon atoms, which have been excited by ultraviolet radiation from the illuminating stars.

  3. 77 FR 67792 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms

    Science.gov (United States)

    2012-11-14

    ... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... offered in the Northeast region. Exemption programs may allow a vessel to fish in an area that is limited.... Vessels are also required to request gillnet and lobster tags through the Northeast region permit office...

  4. 76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms

    Science.gov (United States)

    2011-07-15

    ... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

  5. Determination of GMPE functional form for an active region with limited strong motion data: application to the Himalayan region

    Science.gov (United States)

    Bajaj, Ketan; Anbazhagan, P.

    2018-01-01

    Advancement in the seismic networks results in formulation of different functional forms for developing any new ground motion prediction equation (GMPE) for a region. Till date, various guidelines and tools are available for selecting a suitable GMPE for any seismic study area. However, these methods are efficient in quantifying the GMPE but not for determining a proper functional form and capturing the epistemic uncertainty associated with selection of GMPE. In this study, the compatibility of the recent available functional forms for the active region is tested for distance and magnitude scaling. Analysis is carried out by determining the residuals using the recorded and the predicted spectral acceleration values at different periods. Mixed effect regressions are performed on the calculated residuals for determining the intra- and interevent residuals. Additionally, spatial correlation is used in mixed effect regression by changing its likelihood function. Distance scaling and magnitude scaling are respectively examined by studying the trends of intraevent residuals with distance and the trend of the event term with magnitude. Further, these trends are statistically studied for a respective functional form of a ground motion. Additionally, genetic algorithm and Monte Carlo method are used respectively for calculating the hinge point and standard error for magnitude and distance scaling for a newly determined functional form. The whole procedure is applied and tested for the available strong motion data for the Himalayan region. The functional form used for testing are five Himalayan GMPEs, five GMPEs developed under NGA-West 2 project, two from Pan-European, and one from Japan region. It is observed that bilinear functional form with magnitude and distance hinged at 6.5 M w and 300 km respectively is suitable for the Himalayan region. Finally, a new regression coefficient for peak ground acceleration for a suitable functional form that governs the attenuation

  6. IRAS 17423-1755 (HEN 3-1475) REVISITED: AN O-RICH HIGH-MASS POST-ASYMPTOTIC GIANT BRANCH STAR

    International Nuclear Information System (INIS)

    Manteiga, M.; GarcIa-Hernandez, D. A.; Manchado, A.; Ulla, A.; GarcIa-Lario, P.

    2011-01-01

    The high-resolution (R ∼ 600) Spitzer/IRS spectrum of the bipolar protoplanetary nebula (PN) IRAS 17423-1755 is presented in order to clarify the dominant chemistry (C-rich versus O-rich) of its circumstellar envelope as well as to constrain its evolutionary stage. The high-quality Spitzer/IRS spectrum shows weak 9.7 μm absorption from amorphous silicates. This confirms for the first time the O-rich nature of IRAS 17423-1755 in contradiction to a previous C-rich classification, which was based on the wrong identification of the strong 3.1 μm absorption feature seen in the Infrared Space Observatory spectrum as due to acetylene (C 2 H 2 ). The high-resolution Spitzer/IRS spectrum displays a complete lack of C-rich mid-IR features such as molecular absorption features (e.g., 13.7 μm C 2 H 2 , 14.0 μm HCN, etc.) or the classical polycyclic aromatic hydrocarbon infrared emission bands. Thus, the strong 3.1 μm absorption band toward IRAS 17423-1755 has to be identified as water ice. In addition, an [Ne II] nebular emission line at 12.8 μm is clearly detected, indicating that the ionization of its central region may be already started. The spectral energy distribution in the infrared (∼2-200 μm) and other observational properties of IRAS 17423-1755 are discussed in comparison with the similar post-asymptotic giant branch (AGB) objects IRAS 19343+2926 and IRAS 17393-2727. We conclude that IRAS 17423-1755 is an O-rich high-mass post-AGB object that represents a link between OH/IR stars with extreme outflows and highly bipolar PN.

  7. Molecular jet of IRAS 04166+2706

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Liang-Yao [Graduate Institute of Astronomy and Astrophysics, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China); Shang, Hsien; Su, Yu-Nung; Hirano, Naomi; Lee, Chin-Fei [Academia Sinica, Institute of Astrophysics (ASIAA), P.O. Box 23141, Taipei 106, Taiwan (China); Santiago-García, Joaquín [Instituto de Radioastronomía Milimétrica (IRAM), Avenida Divina Pastora 7, Núcleo Central, E-18012 Granada (Spain); Tafalla, Mario [Observatorio Astronómico Nacional (IGN), Alfonso XII 3, E-28014 Madrid (Spain); Zhang, Qizhou, E-mail: lywang@asiaa.sinica.edu.tw [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2014-01-01

    The molecular outflow from IRAS 04166+2706 was mapped with the Submillimeter Array at a 350 GHz continuum and CO J = 3-2 at an angular resolution of ∼1''. The field of view covers the central arcminute, which contains the inner four pairs of knots of the molecular jet. On the channel map, conical structures are clearly present in the low-velocity range (|V – V {sub 0}| < 10 km s{sup –1}), and the highly collimated knots appear in the extremely high velocity range (50 >|V – V {sub 0}| > 30 km s{sup –1}). The higher angular resolution of ∼1'' reveals the first blue-shifted knot (B1) that was missing in previous Plateau de Bure Interferometer observation of Santiago-García et al. at an offset of ∼6'' to the northeast of the central source. This identification completes the symmetric sequence of knots in both the blue- and red-shifted lobes of the outflow. The innermost knots R1 and B1 have the highest velocities within the sequence. Although the general features appear to be similar to previous CO J = 2-1 images in Santiago-García et al., the emission in CO J = 3-2 almost always peaks further away from the central source than that of CO J = 2-1 in the red-shifted lobe of the channel maps. This gives rise to a gradient in the line-ratio map of CO J = 3-2/J = 2-1 from head to tail within a knot. A large velocity gradient analysis suggests that the differences may reflect a higher gas kinetic temperature at the head. We also explore possible constraints imposed by the nondetection of SiO J = 8-7.

  8. Impact of Tax Reform Act of 1986 on IRA's Investment Value

    OpenAIRE

    William Reichenstein; Mark L. Cross

    1989-01-01

    The purpose of this study is to present an economic analysis of the tax advantages of deductible and nondeductible IRAs under the 1986 Tax Reform Act. These advantages are compared to those offered by other pension plans. The results show that the tax advantages of deductible IRAs allow for substantially higher values than the value of a similar investment held outside a pension account. The nondeductible IRA does not provide tax advantages over non-IRA investments if investors expect to with...

  9. 78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms

    Science.gov (United States)

    2013-04-02

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

  10. 77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms

    Science.gov (United States)

    2012-08-08

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

  11. Application of radioactive tracers in upgradation of industrial grade ion exchange resin (Amberlite IRA-400)

    International Nuclear Information System (INIS)

    Lokhande, R.S.; Singare, P.U.

    1998-01-01

    The exchange rates of ion exchange are determined by application of 131 I as a tracer isotope. The exchange study carried out in this investigation deals with understanding the effectiveness of ion exchange resin (in iodide form) Amberlite IRA-400 at different concentrations of potassium iodide solution (electrolyte) with temperature of solution varying from 27-48 degC by keeping amount of ion exchange resin constant (1.0 g). The exchange study is also carried out by varying amount of ion exchange resins, for fixed temperature (27.0 degC) and for fixed concentration of potassium iodide solution (0.005 M). (author)

  12. MILLIMETRIC AND SUBMILLIMETRIC OBSERVATIONS OF IRAS 05327+3404 ''HOLOEA'' IN M36

    International Nuclear Information System (INIS)

    Morata, O.; Ho, P. T. P.; Kuan, Y.-J.; Huang, H.-C.; Zhao-Geisler, R.; Magnier, E. A.

    2013-01-01

    The transition between the protostar, Class I, and the pre-main-sequence star, Class II, phases is still one of the most uncertain, and important, stages in the knowledge of the process of formation of an individual star because it is the stage that determines the final mass of the star. We observed the young stellar object ''Holoea'', associated with IRAS 05327+3404, which was classified as an object in the transition between the Class I and Class II phases with several unusual properties, and appears to be surrounded by large amounts of circumstellar material. We used the SMA and BIMA telescopes at millimeter and submillimeter (submm) wavelengths to observe the dust continuum emission and the CO (1-0) and (2-1), HCO + (1-0) and (3-2), and HCN (1-0) transitions in the region around IRAS 05327+3404. We detected two continuum emission peaks at 1.1 mm: SMM 1, the submm counterpart of IRAS 05327+3404, and SMM 2, ∼6 arcsec to the west. The emissions of the three molecules show marked differences. The CO emission near the systemic velocity is filtered out by the telescopes, and CO mostly traces the high-velocity gas. The HCO + and HCN emissions are more concentrated around the central parts of the region, and show several intensity peaks coincident with the submm continuum peaks. We identify two main molecular outflows: a bipolar outflow in an E-W direction that would be powered by SMM 1 and the other in a NE direction, which we associate with SMM 2. We propose that the SMM sources are probably Class I objects, with SMM 1 in an earlier evolutionary stage

  13. Dynamical structure of the inner 100 AU of the deeply embedded protostar IRAS 16293–2422

    Energy Technology Data Exchange (ETDEWEB)

    Favre, Cécile; Field, David [Department of Physics and Astronomy, University of Aarhus, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Jørgensen, Jes K.; Brinch, Christian; Bisschop, Suzanne E. [Centre for Star and Planet Formation, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø (Denmark); Bourke, Tyler L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street MS42, Cambridge, MA 02138 (United States); Hogerheijde, Michiel R. [Leiden Observatory, Leiden University, P.O. Box 9513, 2300-RA Leiden (Netherlands); Frieswijk, Wilfred W. F., E-mail: cfavre@umich.edu [Netherlands Institute for Radio Astronomy, Postbus 2, 7990-AA Dwingeloo (Netherlands)

    2014-07-20

    A fundamental question about the early evolution of low-mass protostars is when circumstellar disks may form. High angular resolution observations of molecular transitions in the (sub)millimeter wavelength windows make it possible to investigate the kinematics of the gas around newly formed stars, for example, to identify the presence of rotation and infall. IRAS 16293–2422 was observed with the extended Submillimeter Array (eSMA) resulting in subarcsecond resolution (0.''46 × 0.''29, i.e., ∼55 × 35 AU) images of compact emission from the C{sup 17}O (3-2) and C{sup 34}S (7-6) transitions at 337 GHz (0.89 mm). To recover the more extended emission we have combined the eSMA data with SMA observations of the same molecules. The emission of C{sup 17}O (3-2) and C{sup 34}S (7-6) both show a velocity gradient oriented along a northeast-southwest direction with respect to the continuum marking the location of one of the components of the binary, IRAS 16293A. Our combined eSMA and SMA observations show that the velocity field on the 50-400 AU scales is consistent with a rotating structure. It cannot be explained by simple Keplerian rotation around a single point mass but rather needs to take into account the enclosed envelope mass at the radii where the observed lines are excited. We suggest that IRAS 16293–2422 could be among the best candidates to observe a pseudo-disk with future high angular resolution observations.

  14. The Tully-Fisher relation of the IRAS minisurvey galaxies

    Science.gov (United States)

    Van Driel, W.; Van Den Broek, A. C.; Baan, W. A.

    1995-01-01

    We investigated the possible influence on the Tully-Fisher relation of active massive star formation in IRAS galaxies, in order to estimate the contribution of star formation to their near-infrared luminosity. We observed 60 galaxies from the infrared complete so-called IRAS Minisurvey sample in the 21 cm H1 line at Arecibo, determined the near-infrared (H-band) Tully-Fisher relation for the 36 objects in the sample we judged to be usable for this purpose, and compared this relation with that of optically selected normal galaxies. The results show no significant enhancement of the near-infrared luminosities of the IRAS Minisurvey galaxies compared to those of the optically selected normal glaxies. From these results we inferred that in the minisurvey galaxies the average contribution of the active massive star formation to the total near-infrared luminosity is less and that exponential decay times for the starbursts occurring in the Minisurvey galaxies are of the order of 10 Myr. The Tully-Fisher relation shows one exceptional galaxy (IRAS 03565+2139) with an about 25 times higher luminosity than average for its rotational velocity.

  15. NEBULAR EMISSION-LINES IN IRAS 10215-5916

    NARCIS (Netherlands)

    GARCIALARIO, P; MANCHADO, A; PARTHASARATHY, M; POTTASCH, [No Value

    From low and high resolution spectroscopic observations of IRAS 10215 - 5916 we have discovered the presence of nebular emission lines in this G-type supergiant star in the post-AGB stage. From its high resolution spectrum we derived an expansion velocity of 17 km s-1 for the shell, similar to the

  16. Search for brown dwarfs in the IRAS data bases

    International Nuclear Information System (INIS)

    Low, F.J.

    1986-01-01

    A report is given on the initial searches for brown dwarf stars in the IRAS data bases. The paper was presented to the workshop on 'Astrophysics of brown dwarfs', Virginia, USA, 1985. To date no brown dwarfs have been discovered in the solar neighbourhood. Opportunities for future searches with greater sensitivity and different wavelengths are outlined. (U.K.)

  17. Dialogic & Critical Pedagogies: An Interview with Ira Shor

    Science.gov (United States)

    Shor, Ira; Matusov, Eugene; Marjanovic-Shane, Ana; Cresswel, lJames

    2017-01-01

    In 2016, the Main Editors of "Dialogic Pedagogy Journal" issued a call for papers and contributions to a wide range of dialogic pedagogy scholars and practitioners. One of the scholars who responded to our call is famous American educator Ira Shor, a professor at the College of Staten Island, City University of New York. Shor has been…

  18. Search for near-infrared counterparts of IRAS embedded sources in the M17 SW giant molecular cloud

    International Nuclear Information System (INIS)

    Elmegreen, D.M.; Phillips, J.; Beck, K.; Thomas, H.; Howard, J.

    1988-01-01

    Wide-field near-infrared and blue band plates of the region containing the M17 giant molecular cloud complex have been blinked to locate bright near-infrared stars that may be embedded in the M17 SW giant molecular cloud. Twenty such stars coincided with the positions of IRAS point sources that appeared embedded based on color-color diagrams. Some of these stars may be the sources of the infrared luminosities. Of the 20 stars, seven were too faint to appear on the B band plate. The optical magnitudes and colors determined from the plate image diameters were measured for the other 13 coincident stars; they are most likely upper main-sequence or pre-main-sequence stars with extinctions of 7 mag. The IRAS luminosity-temperature diagram indicates that the embedded sources in M17 are more massive than those in the Orion cloud. 35 references

  19. Commuting behaviour and urban form: a longitudinal study of a polycentric urban region in Denmark

    DEFF Research Database (Denmark)

    Grunfelder, Julien; Nielsen, Thomas Alexander Sick

    2012-01-01

    is a polycentric urban region in Denmark. Data from the National Transport Survey of Denmark were used for this quantitative analysis and two time periods were selected to highlight any potential changes over time. Empirical findings indicate that urban form and location variables help to explain the three......This paper is an empirical investigation of the relation between urban form and commuting behaviour in a polycentric urban region. It explores to what extent urban form and location variables help to explain commuting time, distance and mode based on an empirical case, East Jutland, which...... selected aspects of commuting. However, urban form variables have greater explanatory power in explaining commuting modes than commuting time and commuting distance. No general trends in commuting were detectable from the data. Finally, the empirical findings revealed specificities of the case study...

  20. Wide-field Infrared Survey Explorer Observations of the Evolution of Massive Star-forming Regions

    OpenAIRE

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from th...

  1. Probing the water and CO snow lines in the young protostar NGC 1333-IRAS4B

    Science.gov (United States)

    Anderl, Sibylle; Maret, Sébastien; André, Philippe; Maury, Anaëlle; Belloche, Arnaud; Cabrit, Sylvie; Codella, Claudio; Lefloch, Bertrand

    2015-08-01

    Today, we believe that the onset of life requires free energy, water, and complex, probably carbon-based chemistry. In the interstellar medium, complex organic molecules seem to mostly form in reactions happening on the icy surface of dust grains, such that they are released into the gas phase when the dust is heated. The resulting “snow lines”, marking regions where ices start to sublimate, play an important role for planet growth and bulk composition in protoplanetary disks. However, they can already be observed in the envelopes of the much younger, low-mass Class 0 protostars that are still in their early phase of heavy accretion. The information on the sublimation regions of different kinds of ices can be used to understand the chemistry of the envelope, its temperature and density structure, and may even hint at the history of the accretion process. Accordingly, it is a crucial piece of information in order to get the full picture of how organic chemistry evolves already at the earliest stages of the formation of sun-like stars. As part of the CALYPSO Large Program (http://irfu.cea.fr/Projets/Calypso/), we have obtained observations of C18O, N2H+ and CH3OH towards the Class 0 protostar NGC 1333-IRAS4B with the IRAM Plateau de Bure interferometer at sub-arcsecond resolution. Of these we use the methanol observations as a proxy for the water snow line, assuming methanol is trapped in water ice. The observed anti-correlation of C18O and N2H+, with N2H+ forming a ring around the centrally peaked C18O emission, reveals for the first time the CO snow line in this protostellar envelope, with a radius of ~300 AU. The methanol emission is much more compact than that of C18O, and traces the water snow line with a radius of ~40 AU. We have modeled the emission using a chemical model coupled with a radiative transfer module. We find that the CO snow line appears further inwards than expected from the binding energy of pure CO ices. This may hint at CO being frozen out

  2. Form Characteristics of Regional Security Organizations - The Missing Link in the Explanation of the Democratic Peace

    OpenAIRE

    Dembinski, Matthias; Freistein, Katja; Weiffen, Brigitte

    2006-01-01

    This paper contributes both to the debate on the effects of regional security organizations and to the debate on democratic peace. It argues that even if international organizations as such may not be able to influence the conflict behavior of their member states, the subgroup of interdemocratic institutions is well suited to do so. The form of interdemocratic institutions differs in two significant respects from the form of traditional institutions: they are more densely connected via transn...

  3. A young bipolar outflow from IRAS 15398-3359

    Science.gov (United States)

    Bjerkeli, P.; Jørgensen, J. K.; Brinch, C.

    2016-03-01

    Context. Changing physical conditions in the vicinity of protostars allow for a rich and interesting chemistry to occur. Heating and cooling of the gas allows molecules to be released from and frozen out on dust grains. These changes in physics, traced by chemistry as well as the kinematical information, allows us to distinguish between different scenarios describing the infall of matter and the launching of molecular outflows and jets. Aims: We aim to determine the spatial distribution of different species that are of different chemical origin. This is to examine the physical processes in play in the observed region. From the kinematical information of the emission lines we aim to determine the nature of the infalling and outflowing gas in the system. We also aim to determine the physical properties of the outflow. Methods: Maps from the Submillimeter Array (SMA) reveal the spatial distribution of the gaseous emission towards IRAS 15398-3359. The line radiative transfer code LIME is used to construct a full 3D model of the system taking all relevant components and scales into account. Results: CO, HCO+, and N2H+ are detected and shown to trace the motions of the outflow. For CO, the circumstellar envelope and the surrounding cloud also have a profound impact on the observed line profiles. N2H+ is detected in the outflow, but is suppressed towards the central region, perhaps because of the competing reaction between CO and H3+ in the densest regions as well as the destruction of N2H+ by CO. N2D+ is detected in a ridge south-west of the protostellar condensation and is not associated with the outflow. The morphology and kinematics of the CO emission suggests that the source is younger than ~1000 years. The mass, momentum, momentum rate, mechanical luminosity, kinetic energy, and mass-loss rate are also all estimated to be low. A full 3D radiative transfer model of the system can explain all the kinematical and morphological features in the system.

  4. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    Science.gov (United States)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  5. Water in low-mass star-forming regions with Herschel

    DEFF Research Database (Denmark)

    Kristensen, L. E.; Visser, R.; Van Dishoeck, E. F.

    2010-01-01

    "Water In Star-forming regions with Herschel" (WISH) is a key programme dedicated to studying the role of water and related species during the star-formation process and constraining the physical and chemical properties of young stellar objects. The Heterodyne Instrument for the Far-Infrared (HIF...

  6. YOUNG STELLAR OBJECTS IN THE MASSIVE STAR-FORMING REGION W49

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Hora, J. L.; Willis, S. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Gutermuth, R. A. [University of Massachusetts, Department of Astronomy, Amherst, MA 01003 (United States); Saygac, A. T., E-mail: gsaral@cfa.harvard.edu [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

    2015-11-01

    We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the young stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.

  7. Anomalou OH emission in galactic star-forming regions - A clue to the megamaser phenomenon?

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Rodriguez, L.F.; Ruiz, A.

    1989-01-01

    The detection of spatially extended, anomalous OH emission in galactic star-forming regions is reported. This OH emission is similar to, although much weaker than, that produced by extragalactic megamasers. This new type of galactic emission may provide clues to elucidate the nature of the extragalactic OH megamaser phenomenon observed in luminous IR galaxies. 10 refs

  8. Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI

    DEFF Research Database (Denmark)

    O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine

    2013-01-01

    of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...

  9. WIDE-FIELD INFRARED SURVEY EXPLORER OBSERVATIONS OF THE EVOLUTION OF MASSIVE STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Padgett, D. L.; Rebull, L. M.; Assef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworks hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  10. Orion star-forming region - far-infrared and radio molecular observations

    International Nuclear Information System (INIS)

    Thronson, H.A. Jr.; Harper, D.A.; Bally, J.; Dragovan, M.; Mozurkewich, D.; Yerkes Observatory, Williams Bay, WI; ATandT Bell Labs., Holmdel, NJ; Chicago Uni., IL; E. O. Hulburt Center for Space Research, Washington, DC)

    1986-01-01

    New J = 1-0 CO and far-infrared maps of the Orion star-forming region are presented and discussed. The total infrared luminosity of the Orion star-forming ridge is 250,000 solar luminosities. The material that is emitting strongly at 60 microns is traced and found to be highly centrally concentrated. However, the majority of the extended emission from this region comes from dust that is ultimately heated by the visible Trapezium cluster stars. The luminosity of IRc 2, the most luminous member of the infrared cluster, is estimated to be 40,000-50,000 solar luminosities. A schematic drawing of the Ori MC 1 region is presented. 30 references

  11. IRAS 03063+5735: A BOWSHOCK NEBULA POWERED BY AN EARLY B STAR

    Energy Technology Data Exchange (ETDEWEB)

    Kobulnicky, Henry A.; Lundquist, Michael J.; Bhattacharjee, Anirban [Department of Physics and Astronomy, 1000 E. University Avenue, University of Wyoming Laramie, WY 82071 (United States); Kerton, C. R., E-mail: chipk@uwyo.edu, E-mail: mlundqui@uwyo.edu, E-mail: abhattac@uwyo.edu, E-mail: kerton@iastate.edu [Department of Physics and Astronomy, Iowa State University Ames, IA 50011 (United States)

    2012-03-15

    Mid-infrared images from the Spitzer Space Telescope Galactic Legacy Infrared MidPlane Survey Extraordinaire program reveal that the infrared source IRAS 03063+5735 is a bowshock nebula produced by an early B star, 2MASS 03101044+5747035. We present new optical spectra of this star, classify it as a B1.5 V, and determine a probable association with a molecular cloud complex at V{sub LSR} = -38 to -42 km s{sup -1} in the outer Galaxy near l = 140.{sup 0}59, b = -0.{sup 0}250. On the basis of spectroscopic parallax, we estimate a distance of 4.0 {+-} 1 kpc to both the bowshock nebula and the molecular complex. One plausible scenario is that this is a high-velocity runaway star impinging upon a molecular cloud. We identify the H II region and stellar cluster associated with IRAS 03064+5638 at a projected distance of 64 pc as one plausible birth site. The spectrophotometric distance and linkage to a molecular feature provides another piece of data helping to secure the ill-determined rotation curve in the outer Galaxy. As a by-product of spectral typing this star, we present empirical spectral diagnostic diagrams suitable for approximate spectral classification of O and B stars using He lines in the little-used yellow-red portion of the optical spectrum.

  12. IRaPPA: information retrieval based integration of biophysical models for protein assembly selection.

    Science.gov (United States)

    Moal, Iain H; Barradas-Bautista, Didier; Jiménez-García, Brian; Torchala, Mieczyslaw; van der Velde, Arjan; Vreven, Thom; Weng, Zhiping; Bates, Paul A; Fernández-Recio, Juan

    2017-06-15

    In order to function, proteins frequently bind to one another and form 3D assemblies. Knowledge of the atomic details of these structures helps our understanding of how proteins work together, how mutations can lead to disease, and facilitates the designing of drugs which prevent or mimic the interaction. Atomic modeling of protein-protein interactions requires the selection of near-native structures from a set of docked poses based on their calculable properties. By considering this as an information retrieval problem, we have adapted methods developed for Internet search ranking and electoral voting into IRaPPA, a pipeline integrating biophysical properties. The approach enhances the identification of near-native structures when applied to four docking methods, resulting in a near-native appearing in the top 10 solutions for up to 50% of complexes benchmarked, and up to 70% in the top 100. IRaPPA has been implemented in the SwarmDock server ( http://bmm.crick.ac.uk/∼SwarmDock/ ), pyDock server ( http://life.bsc.es/pid/pydockrescoring/ ) and ZDOCK server ( http://zdock.umassmed.edu/ ), with code available on request. moal@ebi.ac.uk. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  13. NGVLA Observations of Dense Gas Filaments in Star-Forming Regions

    Science.gov (United States)

    Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team

    2018-01-01

    Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

  14. A study of the stellar population in the Lynds 1641 dark cloud. I. The IRAS catalog sources

    International Nuclear Information System (INIS)

    Strom, K.M.; Newton, G.; Strom, S.E.; Seaman, R.L.; Carrasco, L.

    1989-01-01

    The character of the sources identified in the IRAS Point Source Catalog and located within the boundaries of the nearest giant molecular cloud, Lynds 1641 is discussed. New optical and near-infrared photometry are combined to provide spectral energy distributions (SEDs) for these objects divided into three classes: class I objects with flat or rising spectra, class II objects with spectra intermediate in slope between a flat and blackbody spectrum, and class III objects with spectra similar to those of blackbodies. It is found that L1641 contains a much larger percentage of class I sources than does the nearby Taurus-Auriga star-forming complex. Spectral energy distributions for the IRAS-selected sample are examined and compared with SEDs for young stellar objects (YSOs) located in Taurus-Auriga. The IRAS-selected sources having optical counterparts in the H-R diagram are identified and discussed along with the distribution of masses and ages for these YSOs. 86 refs

  15. New CO and HCN sources associated with IRAS carbon stars

    Science.gov (United States)

    NGUYEN-Q-RIEU; Epchtein, N.; TRUONG-BACH; Cohen, M.

    1987-01-01

    Emission of CO and HCN was detected in 22 out of a sample of 53 IRAS sources classified as unidentified carbon-rich objects. The sample was selected according to the presence of the silicon carbide feature as revealed by low-resolution spectra. The molecular line widths indicate that the CO and HCN emission arises from the circumstellar envelopes of very highly evolved stars undergoing mass loss. The visible stars tend to be deficient in CO as compared with unidentified sources. Most the detected CO and HCN IRAS stars are distinct and thick-shelled objects, but their infrared and CO luminosities are similar to those of IRC + 102156 AFGL and IRC-CO evolved stars. The 12 micron flux seems to be a good indicator of the distance, hence a guide for molecular searches.

  16. IRAS constraints on a cold cloud around the solar system

    International Nuclear Information System (INIS)

    Aumann, H.H.; Good, J.C.

    1990-01-01

    IRAS 60- and 100-micron observations of G-stars in the solar neighborhood indicate that the typical G star is surrounded by a cold cloud. The assumption that the sun is archetypical requires that a cloud of typical G star extent and temperature surrounds our solar system. IRAS ecliptic plane scans, which are dominated by a 40-deg wide band of zodiacal dust, asteroid debris trails, and the Galactic plane, are consistent with a larger than typical G star cold cloud. Consistency with the typical G star and the direct observations constrain the width of the cold cloud perpendicular to the ecliptic plane to be larger than 5 deg. The 100-150 AU radius of this cloud is larger, but not inconsistent with the inner boundary of a cloud of comets, postulated previously at a radius of 50 AU based on Neptune orbital perturbations and models of short period comets. 17 refs

  17. IRAS colors of carbon stars - An optical spectroscopic test

    International Nuclear Information System (INIS)

    Cohen, M.; Wainscoat, R.J.; Walker, H.J.; Volk, K.; Schwartz, D.E.

    1989-01-01

    Optical spectra are obtained of 57 photographic counterparts to IRAS sources not previously studied spectroscopically, and expected on the basis of their IRAS colors to be M or C type stars. Confirmed carbon stars are found only in a restricted range of 12-25 index, and constitute a striking vertical sequence in the 12-25-60 micron color-color diagram. This sequence is in accord with evolutionary models for AGB stars that convert M into C stars by dredge-up, and follow loops in the color-color plane. Optically visible and optically invisible carbon stars occupy different color-color locations consistent with their representations of different evolutionary states in the life of relatively low-mass stars. 16 refs

  18. Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Natsuko; Yasui, Chikako; Saito, Masao [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kobayashi, Naoto; Hamano, Satoshi, E-mail: natsuko.izumi@nao.ac.jp [Laboratory of Infrared High-resolution spectroscopy (LIH), Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan)

    2017-10-01

    The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions in the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.

  19. IRAS far-infrared colours of normal stars

    Science.gov (United States)

    Waters, L. B. F. M.; Cote, J.; Aumann, H. H.

    1987-01-01

    The analysis of IRAS observations at 12, 25, 60 and 100 microns of bright stars of spectral type O to M is presented. The objective is to identify the 'normal' stellar population and to characterize it in terms of the relationships between (B-V) and (V-/12/), between (R-I) and (V-/12/), and as a function of spectral type and luminosity class. A well-defined relation is found between the color of normal stars in the visual (B-V), (R-I) and in the IR, which does not depend on luminosity class. Using the (B-V), (V-/12/) relation for normal stars, it is found that B and M type stars show a large fraction of deviating stars, mostly with IR excess that is probably caused by circumstellar material. A comparison of IRAS colors with the Johnson colors as a function of spectral type shows good agreement except for the K0 to M5 type stars. The results will be useful in identifying the deviating stars detected with IRAS.

  20. New far infrared images of bright, nearby, star-forming regions

    Science.gov (United States)

    Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.

    1995-01-01

    Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

  1. Observations of star-forming regions with the Midcourse Space Experiment

    NARCIS (Netherlands)

    Kraemer, KE; Shipman, RF; Price, SD; Mizuno, DR; Kuchar, T; Carey, SJ

    We have imaged seven nearby star-forming regions, the Rosette Nebula, the Orion Nebula, W3, the Pleiades, G300.2-16.8, S263, and G159.6-18.5, with the Spatial Infrared Imaging Telescope on the Midcourse Space Experiment (MSX) satellite at 1800 resolution at 8.3, 12.1, 14.7, and 21.3 mum. The large

  2. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    Energy Technology Data Exchange (ETDEWEB)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Kuhn, Michael A. [Millennium Institute of Astrophysics, Camino El Observatorio 1515, Las Condes, Santiago (Chile); Povich, Matthew S., E-mail: edf@astro.psu.edu [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Ave., Pomona, CA 91768 (United States)

    2016-12-20

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  3. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    International Nuclear Information System (INIS)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.; Kuhn, Michael A.; Povich, Matthew S.

    2016-01-01

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  4. A laboratory analog for the carrier of the 3 micron emission of the protoplanetary nebula IRAS 05341+0852.

    Science.gov (United States)

    Beegle, L W; Wdowiak, T J; Arnoult, K M

    1997-09-10

    A mixture of the polycyclic aromatic hydrocarbons (PAHs), acenaphthylene and acenaphthene, when subjected to the energetic environment of a hydrogen plasma, is transformed into a material that exhibits an infrared absorption profile in the 3 micron region that is an excellent match of the protoplanetary nebula IRAS 05341+0852 emission profile in the same wavelength region. Acenaphthylene and acenaphthene were chosen as precursors in the experiment because these molecules have a structure that can be described as a keystone in a process in which carbon atoms in a stellar wind condense into PAH species. The spectral match between experiment and observations appears to validate that scenario.

  5. Molecular line study of massive star-forming regions from the Red MSX Source survey

    Science.gov (United States)

    Yu, Naiping; Wang, Jun-Jie

    2014-05-01

    In this paper, we have selected a sample of massive star-forming regions from the Red MSX Source survey, in order to study star formation activities (mainly outflow and inflow signatures). We have focused on three molecular lines from the Millimeter Astronomy Legacy Team Survey at 90 GHz: HCO+(1-0), H13CO+(1-0) and SiO(2-1). According to previous observations, our sources can be divided into two groups: nine massive young stellar object candidates (radio-quiet) and 10 H II regions (which have spherical or unresolved radio emissions). Outflow activities have been found in 11 sources, while only three show inflow signatures in all. The high outflow detection rate means that outflows are common in massive star-forming regions. The inflow detection rate was relatively low. We suggest that this was because of the beam dilution of the telescope. All three inflow candidates have outflow(s). The outward radiation and thermal pressure from the central massive star(s) do not seem to be strong enough to halt accretion in G345.0034-00.2240. Our simple model of G318.9480-00.1969 shows that it has an infall velocity of about 1.8 km s-1. The spectral energy distribution analysis agrees our sources are massive and intermediate-massive star formation regions.

  6. The Structure of the Nearby Giant Star-Forming Region 30 Doradus

    Science.gov (United States)

    Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

    2007-08-01

    The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

  7. Modelling the IRAS colors of galaxies

    International Nuclear Information System (INIS)

    Helou, G.

    1987-01-01

    A physical interpretation is proposed for the color-color diagram of galaxies which are powered only by star formation. The colors of each galaxy result from the combination of two components: cirrus-like emission from the neutral disk, and warmer emission from regions directly involved in on-going star formation. This approach to modelling the emission is based on dust properties, but independent evidence for it is found in the relation between the color sequence and the luminosity sequence. Implications of data and interpretations are discussed and possible tests mentioned for the model

  8. Broca's region and Visual Word Form Area activation differ during a predictive Stroop task

    DEFF Research Database (Denmark)

    Wallentin, Mikkel; Gravholt, Claus Højbjerg; Skakkebæk, Anne

    2015-01-01

    displayed in green or red (incongruent vs congruent colors). One of the colors, however, was presented three times as often as the other, making it possible to study both congruency and frequency effects independently. Auditory stimuli saying “GREEN” or “RED” had the same distribution, making it possible...... to study frequency effects across modalities. We found significant behavioral effects of both incongruency and frequency. A significant effect (p effect of frequency was observed and no interaction. Conjoined effects of incongruency...... and frequency were found in parietal regions as well as in the Visual Word Form Area (VWFA). No interaction between perceptual modality and frequency was found in VWFA suggesting that the region is not strictly visual. These findings speak against a strong version of the prediction error processing hypothesis...

  9. Radiocarbon ages of pedogenic calcic nodules formed within vertisols, Coimbatore region, Tamil Nadu, India

    International Nuclear Information System (INIS)

    Achyuthan, H.; Flora, O.; Braida, M.; Stenni, B.; Shankar, N.

    2009-05-01

    In this paper we discuss the limitation of radiocarbon dates on the pedogenic calcic nodules formed in situ within the vertisols in the upland region of Coimbatore, Tamil Nadu. The radiocarbon ages were obtained using low level scintillation counters and the ages range from ∼24 Ka to ∼31 Ka. The ages correlate well with the marine isotope stage of Late MIS3. Since the calcic nodules are pedogenised and formed in a terrestrial open system we express caution in the interpretation of the radiocarbon ages obtained on pedogenic carbonate nodules. The radiocarbon dates represent maximum ages and hence the ages measured should only be considered as age estimates and not absolute geologic ages. Multiple sub-mm size subsamples could provide more reliable estimates of soil chronology. (author)

  10. Diffuse Matter from Star Forming Regions to Active Galaxies A Volume Honouring John Dyson

    CERN Document Server

    Hartquist, T W

    2006-01-01

    John Dyson has contributed to the study of the hydrodynamic processes that govern a wide variety of astrophysical sources which he has helped explain. In this volume dedicated to him, introductory reviews to a number of the key processes and to the sources themselves are given by leading experts. The mechanisms in which the multi-component natures of media affect their dynamics receive particular attention, but the roles of hydromagnetic effects are also highlighted. The importance of cosmic ray moderation and mass transfer between different thermal phases for cosmic ray moderation and mass transfer between different thermal phases for the evolution of flows are amongst the topics treated. The main types of regions considered include those where stars form, the circumstellar environments of evolved stars, the larger scale interstellar structures caused by the mass loss of stars, and those where the lines of AGNs form. The reviews complement one another and together provide a coherent introduction to the astro...

  11. Complex organic molecules toward low-mass and high-mass star forming regions

    Science.gov (United States)

    Favre, C.; Ceccarelli, C.; Lefloch, B.; Bergin, E.; Carvajal, M.; Brouillet, N.; Despois, D.; Jørgensen, J.; Kleiner, I.

    2016-12-01

    One of the most important questions in molecular astrophysics is how, when, and where complex organic molecules, COMs (≥ 6 atoms) are formed. In the Interstellar-Earth connection context, could this have a bearing on the origin of life on Earth? Formation mechanisms of COMs, which include potentially prebiotic molecules, are still debated and may include grain-mantle and/or gas-phase chemistry. Understanding the mechanisms that lead to the interstellar molecular complexification, along with the involved physicochemical processes, is mandatory to answer the above questions. In that context, active researches are ongoing in theory, laboratory experiment, chemical modeling and observations. Thanks to recent progress in radioastronomy instrumentation for both single-dish and millimeter array (e.g. Herschel, NOEMA, ALMA), new results have been obtained. I will review some notable results on the detection of COMs, including prebiotic molecules, towards star forming regions.

  12. Water in Star-forming Regions with Herschel (WISH): recent results and trends

    Science.gov (United States)

    van Dishoeck, E. F.

    2012-03-01

    Water is a key molecule in the physics and chemistry of star- and planet-forming regions. In the `Water in Star-forming Regions with Herschel' (WISH) Key Program, we have obtained a comprehensive set of water data toward a large sample of well-characterized protostars, covering a wide range of masses and luminosities --from the lowest to the highest mass protostars--, as well as evolutionary stages --from pre-stellar cores to disks. Lines of both ortho- and para-H_2O and their isotopologues, as well as chemically related hydrides, are observed with the HIFI and PACS instruments. The data elucidate the physical processes responsible for the warm gas, probe dynamical processes associated with forming stars and planets (outflow, infall, expansion), test basic chemical processes and reveal the chemical evolution of water and the oxygen-reservoir into planet-forming disks. In this brief talk a few recent WISH highlights will be presented, including determinations of the water abundance in each of the different physical components (inner and outer envelope, outflow) and constraints on the ortho/para ratio. Special attention will be given to trends found across the sample, especially the similarity in profiles from low to high-mass protostars and the evolution of the gas-phase water abundance from prestellar cores to disks. More details can be found at http://www.strw.leidenuniv.nl/WISH, whereas overviews are given in van Dishoeck et al. (2011, PASP 123, 138), Kristensen & van Dishoeck (2011, Astronomische Nachrichten 332, 475) and Bergin & van Dishoeck (2012, Phil. Trans. Royal Soc. A).

  13. La ira en la primera tradición cidiana

    Directory of Open Access Journals (Sweden)

    Oscar Martín

    2007-11-01

    Full Text Available The expressions of the wrath in the Cantar de Mio Cid include a group of traditions of different nature, which constitute a point of departure for the proper interpretation of the text. On the one hand, the ira regia ('regal wrath' is related to the emotional medieval theory on wrath, and, on the other hand, the analysis of the political dimension of wrath in the Cantar and in the preceding Cidian tradition, contributes with new aspects on cultural practices and legal systems in the Middle Ages.

  14. Radar observations of Comet IRAS-Araki-Alcock 1983d

    International Nuclear Information System (INIS)

    Harmon, J.K.; Hine, A.A.; Campbell, D.B.; Shapiro, I.I.; Marsden, B.G.

    1989-01-01

    A detailed analysis and interpretation of the Arecibo S-band radar observations of Comet IRAS-Araki-Alcock 1983d are presented. The very high signal strengths are used to make an accurate determination of the shape of the echo spectrum in the two orthogonal senses of circular polarization. The narrow-band component is used to place constraints on the size, rotation, period, reflectivity, and roughness of the nucleus. Detailed analysis of the broadband component yields estimates of, or bounds on, the spatial extent, position, and mass of the particle cloud, as well as the effective size of the constituent particles. 41 references

  15. Stray radiation and the Infrared Astronomical Satellite /IRAS/ telescope

    Science.gov (United States)

    Noll, R. J.; Harned, R.; Breault, R. P.; Malugin, R.

    1981-01-01

    Stray light control is a major consideration in the design of infrared cryogenically cooled telescopes such as the Infrared Astronomical Satellite (IRAS). The basic design of the baffle system, and the placement, shape, and coating of the secondary support struts for the telescope subsystem are described. The intent of this paper is to highlight the stray light problems encountered while designing the system, and to illustrate how computer analysis can be a useful design aid. Scattering measurements of the primary mirror, and a full system level scatter measurement are presented. Comparisons of predicted performance with the measured results are also presented.

  16. Luminosity function of the brightest galaxies in the IRAS survey

    International Nuclear Information System (INIS)

    Soifer, B.T.; Sanders, D.B.; Madore, B.F.; Neugebauer, G.; Persson, C.J.; Persson, S.E.; Rice, W.L.

    1987-01-01

    Results from a study of the far infrared properties of the brightest galaxies in the IRAS survey are described. There is a correlation between the infrared luminosity and the infrared to optical luminosity ratio and between the infrared luminosity and the far infrared color temperature in these galaxies. The infrared bright galaxies represent a significant component of extragalactic objects in the local universe, being comparable in space density to the Seyferts, optically identified starburst galaxies, and more numerous than quasars at the same bolometric luminosity. The far infrared luminosity in the local universe is approximately 25% of the starlight output in the same volume

  17. 29 CFR 2509.99-1 - Interpretive Bulletin Relating to Payroll Deduction IRAs.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Interpretive Bulletin Relating to Payroll Deduction IRAs... SECURITY ACT OF 1974 § 2509.99-1 Interpretive Bulletin Relating to Payroll Deduction IRAs. (a) Scope. This...), as applied to payroll deduction programs established by employers 1 for the purpose of enabling...

  18. IRAS IDENTIFICATION OF PRE-MAIN-SEQUENCE STARS IN THE CHAMELEON-II ASSOCIATION

    NARCIS (Netherlands)

    PRUSTI, T; WHITTET, DCB; ASSENDORP, R; WESSELIUS, PR

    We report the results of a search for new pre-main sequence candidates in the Chamaeleon II dark cloud based on three IRAS catalogues (the Point Source Catalog, the Serendipitous Survey Catalog and the Faint Source Survey). A total of 30 sources were selected. Twelve of these display IRAS colours

  19. A search for hot post-AGE stars in the IRAS Point Source Catalog

    NARCIS (Netherlands)

    Oudmaijer, RD

    In this paper a first step is made to search for hot post-AGB stars in the IRAS Point Source Catalog. In order to find objects that evolved off the AGE a longer time ago than post-AGB objects discussed in the literature, objects that were not detected at 12 mu m by IRAS were selected. The selection

  20. Infrared astronomical satellite (IRAS) catalogs and atlases. Volume 1: Explanatory supplement

    Science.gov (United States)

    Beichman, C. A. (Editor); Neugebauer, G. (Editor); Habing, H. J. (Editor); Clegg, P. E. (Editor); Chester, Thomas J. (Editor)

    1988-01-01

    The Infrared Astronomical Satellite (IRAS) was launched on January 26, 1983. During its 300-day mission, IRAS surveyed over 96 pct of the celestial sphere at four infrared wavelengths, centered approximately at 12, 25, 60, and 100 microns. Volume 1 describes the instrument, the mission, and data reduction.

  1. Young Stellar Objects in the Massive Star-forming Regions W51 and W43

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Audard, M. [Department of Astronomy, University of Geneva, Ch. d’Ecogia 16, 1290 Versoix (Switzerland); Hora, J. L.; Martínez-Galarza, J. R.; Smith, H. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Motte, F. [Institut de Plantologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes—CNRS-INSU, BP 53, F-38041 Grenoble Cedex 9 (France); Nguyen-Luong, Q. [National Astronomical Observatory of Japan, Chile Observatory, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Saygac, A. T. [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

    2017-04-20

    We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities in both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.

  2. Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions

    Science.gov (United States)

    Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina

    2017-09-01

    Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http

  3. AN INFRARED/X-RAY SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Mamajek, E. E.; Cruz, K. L.

    2009-01-01

    We present the results of a search for new members of the Taurus star-forming region using data from the Spitzer Space Telescope and the XMM-Newton Observatory. We have obtained optical and near-infrared spectra of 44 sources that exhibit red Spitzer colors that are indicative of stars with circumstellar disks and 51 candidate young stars that were identified by Scelsi and coworkers using XMM-Newton. We also performed spectroscopy on four possible companions to members of Taurus that were reported by Kraus and Hillenbrand. Through these spectra, we have demonstrated the youth and membership of 41 sources, 10 of which were independently confirmed as young stars by Scelsi and coworkers. Five of the new Taurus members are likely to be brown dwarfs based on their late spectral types (>M6). One of the brown dwarfs has a spectral type of L0, making it the first known L-type member of Taurus and the least massive known member of the region (M ∼ 4-7 M Jup ). Another brown dwarf exhibits a flat infrared spectral energy distribution, which indicates that it could be in the protostellar class I stage (star+disk+envelope). Upon inspection of archival images from various observatories, we find that one of the new young stars has a large edge-on disk (r = 2.''5 = 350 AU). The scattered light from this disk has undergone significant variability on a timescale of days in optical images from the Canada-France-Hawaii Telescope. Using the updated census of Taurus, we have measured the initial mass function for the fields observed by XMM-Newton. The resulting mass function is similar to previous ones that we have reported for Taurus, showing a surplus of stars at spectral types of K7-M1 (0.6-0.8 M sun ) relative to other nearby star-forming regions, such as IC 348, Chamaeleon I, and the Orion Nebula Cluster.

  4. VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

    Energy Technology Data Exchange (ETDEWEB)

    Sarma, A. P.; Eftimova, M. [Physics Department, DePaul University, 2219 N. Kenmore Ave., Byrne Hall 211, Chicago, IL 60614 (United States); Brogan, C. L. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Troland, T. H., E-mail: asarma@depaul.edu [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)

    2013-04-10

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 {mu}G, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  5. VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

    International Nuclear Information System (INIS)

    Sarma, A. P.; Eftimova, M.; Brogan, C. L.; Bourke, T. L.; Troland, T. H.

    2013-01-01

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  6. TIMASSS: the IRAS 16293-2422 millimeter and submillimeter spectral survey. I. Observations, calibration, and analysis of the line kinematics

    Science.gov (United States)

    Caux, E.; Kahane, C.; Castets, A.; Coutens, A.; Ceccarelli, C.; Bacmann, A.; Bisschop, S.; Bottinelli, S.; Comito, C.; Helmich, F. P.; Lefloch, B.; Parise, B.; Schilke, P.; Tielens, A. G. G. M.; van Dishoeck, E.; Vastel, C.; Wakelam, V.; Walters, A.

    2011-08-01

    Context. Unbiased spectral surveys are powerful tools to study the chemistry and the physics of star forming regions, because they can provide a complete census of the molecular content and the observed lines probe the physical structure of the source. Aims: While unbiased surveys at the millimeter and sub-millimeter wavelengths observable from ground-based telescopes have previously been performed towards several high mass protostars, very little exists on low mass protostars, which are believed to resemble our own Sun's progenitor. To help fill up this gap in our understanding, we carried out a complete spectral survey of the bands at 3, 2, 1, and 0.9 mm towards the solar type protostar IRAS 16293-2422. Methods: The observations covered a range of about 200 GHz and were obtained with the IRAM-30 m and JCMT-15 m telescopes during about 300 h of observations. Particular attention was devoted to the inter-calibration of the acquired spectra with previous observations. All the lines detected with more than 3σ confidence-interval certainty and free from obvious blending effects were fitted with Gaussians to estimate their basic kinematic properties. Results: More than 4000 lines were detected (with σ ≥ 3) and identified, yielding a line density of approximatively 20 lines per GHz, comparable to previous surveys in massive hot cores. The vast majority (about two-thirds) of the lines are weak and produced by complex organic molecules. The analysis of the profiles of more than 1000 lines belonging to 70 species firmly establishes the presence of two distinct velocity components associated with the two objects, A and B, forming the IRAS 16293-2422 binary system. In the source A, the line widths of several species increase with the upper level energy of the transition, a behavior compatible with gas infalling towards a ~1 M⊙ object. The source B, which does not show this effect, might have a much lower central mass of ~0.1 M⊙. The difference in the rest velocities

  7. Shear viscosity of glass-forming melts in the liquid-glass transition region

    International Nuclear Information System (INIS)

    Sanditov, D. S.

    2010-01-01

    A new approach to interpreting the hole-activation model of a viscous flow of glass-forming liquids is proposed. This model underlies the development of the concept on the exponential temperature dependence of the free energy of activation of a flow within the range of the liquid-glass transition in complete agreement with available experimental data. The 'formation of a fluctuation hole' in high-heat glass-forming melts is considered as a small-scale low-activation local deformation of a structural network, i.e., the quasi-lattice necessary for the switching of the valence bond, which is the main elementary event of viscous flow of glasses and their melts. In this sense, the hole formation is a conditioned process. A drastic increase in the activation free energy of viscous flow in the liquid-glass transition region is explained by a structural transformation that is reduced to a limiting local elastic deformation of the structural network, which, in turn, originates from the excitation (critical displacement) of a bridging atom like the oxygen atom in the Si-O-Si bridge. At elevated temperatures, as a rule, a necessary amount of excited bridging atoms (locally deformed regions of the structural network) always exists, and the activation free energy of viscous flow is almost independent of temperature. The hole-activation model is closely connected with a number of well-known models describing the viscous flow of glass-forming liquids (the Avramov-Milchev, Nemilov, Ojovan, and other models).

  8. Periodic auroral forms and geomagnetic field oscillations in the 1400 MLT region

    International Nuclear Information System (INIS)

    Potemra, T.A.; Vo, H.; Venkatesan, D.; Cogger, L.L.; Erlandson, R.E.; Zanetti, L.J.; Bythrow, P.F.; Anderson, B.J.

    1990-01-01

    The UV images obtained with the Viking satellite often show bright features which resemble beads or pearls aligned in the east-west direction between noon and 1800 MLT. Viking acquired a series of 25 UV images during a 28-min period on July 29, 1986, which showed a distinct series of periodic bright features in this region. Magnetic field and hot plasma measurements obtained by Viking confirm that the UV emissions are colocated with the field line projection of an upward-flowing region 1 Birkeland current and precipitating energetic (∼200 eV) electrons. The magnetic field and electric field measurements show transverse oscillations with a nearly constant period of about 3.5 min from 67 degree invariant latitude equatorward up to the location of the large-scale Birkeland current system near 76 degree invariant latitude. The electric field oscillations lead the magnetic field oscillations by about a quarter-period. The authors interpret the observed oscillations as standing Alfven waves driven at a frequency near the local resonance frequency by a large-scale wave in the boundary layer. They propose that the energy flux of the precipitating low-energy electrons in this afternoon region is modulated by this boundary wave and produces the periodic UV emission features. The results of this study support the view that large-scale oscillations of magnetospheric boundaries, possibly associated with the Kelvin-Helmholtz instability, can modulate currents, particles, and auroral forms

  9. Functional modulation of cardiac form through regionally confined cell shape changes.

    Directory of Open Access Journals (Sweden)

    Heidi J Auman

    2007-03-01

    Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.

  10. MIDCOURSE SPACE EXPERIMENT VERSUS IRAS TWO-COLOR DIAGRAMS AND THE CIRCUMSTELLAR ENVELOPE-SEQUENCE OF OXYGEN-RICH LATE-TYPE STARS

    International Nuclear Information System (INIS)

    Sjouwerman, Lorant O.; Capen, Stephanie M.; Claussen, Mark J.

    2009-01-01

    We present Midcourse Space Experiment (MSX) two-color diagrams that can be used to characterize circumstellar environments of sources with good quality MSX colors in terms of IRAS color regions for oxygen-rich stars. With these diagrams, we aim to provide a new tool that can be used to study circumstellar environments and to improve detection rates for targeted surveys for circumstellar maser emission similar to the IRAS two-color diagram. This new tool is especially useful for regions in the sky where IRAS was confused, in particular in the Galactic plane and bulge region. Unfortunately, using MSX colors alone does not allow one to distinguish between carbon-rich and oxygen-rich objects. An application of this tool on 86 GHz SiO masers shows that for this type of masers an instantaneous detection rate of 60% to 80% can be achieved if target sources are selected according to MSX color (region). Our investigations may have revealed an error in the MSX point source catalog version 2.3. That is, the photometry of the 21.3 μm (MSX E filter) band for most weak 8.28 μm (or MSX A filter) band sources seems off by about a factor 2 (0.5-1 mag too bright).

  11. MILLIMETRIC AND SUBMILLIMETRIC OBSERVATIONS OF IRAS 05327+3404 ''HOLOEA'' IN M36

    Energy Technology Data Exchange (ETDEWEB)

    Morata, O.; Ho, P. T. P. [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, Taipei 106, Taiwan (China); Kuan, Y.-J.; Huang, H.-C.; Zhao-Geisler, R. [Department of Earth Sciences, National Taiwan Normal University, 88 Section 4, Ting Chou Road, Taipei 116, Taiwan (China); Magnier, E. A., E-mail: omorata@asiaa.sinica.edu.tw [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

    2013-09-15

    The transition between the protostar, Class I, and the pre-main-sequence star, Class II, phases is still one of the most uncertain, and important, stages in the knowledge of the process of formation of an individual star because it is the stage that determines the final mass of the star. We observed the young stellar object ''Holoea'', associated with IRAS 05327+3404, which was classified as an object in the transition between the Class I and Class II phases with several unusual properties, and appears to be surrounded by large amounts of circumstellar material. We used the SMA and BIMA telescopes at millimeter and submillimeter (submm) wavelengths to observe the dust continuum emission and the CO (1-0) and (2-1), HCO{sup +} (1-0) and (3-2), and HCN (1-0) transitions in the region around IRAS 05327+3404. We detected two continuum emission peaks at 1.1 mm: SMM 1, the submm counterpart of IRAS 05327+3404, and SMM 2, {approx}6 arcsec to the west. The emissions of the three molecules show marked differences. The CO emission near the systemic velocity is filtered out by the telescopes, and CO mostly traces the high-velocity gas. The HCO{sup +} and HCN emissions are more concentrated around the central parts of the region, and show several intensity peaks coincident with the submm continuum peaks. We identify two main molecular outflows: a bipolar outflow in an E-W direction that would be powered by SMM 1 and the other in a NE direction, which we associate with SMM 2. We propose that the SMM sources are probably Class I objects, with SMM 1 in an earlier evolutionary stage.

  12. DISK EVOLUTION IN THE THREE NEARBY STAR-FORMING REGIONS OF TAURUS, CHAMAELEON, AND OPHIUCHUS

    International Nuclear Information System (INIS)

    Furlan, E.; Watson, Dan M.; McClure, M. K.

    2009-01-01

    We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

  13. Long-term Variability of H2CO Masers in Star-forming Regions

    Science.gov (United States)

    Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

    2017-10-01

    We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

  14. TRIGONOMETRIC PARALLAXES OF MASSIVE STAR-FORMING REGIONS. II. CEP A AND NGC 7538

    International Nuclear Information System (INIS)

    Moscadelli, L.; Reid, M. J.; Menten, K. M.; Brunthaler, A.; Xu, Y.; Zheng, X. W.

    2009-01-01

    We report trigonometric parallaxes for the sources NGC 7538 and Cep A, corresponding to distances of 2.65 +0.12 -0.11 and 0.70 +0.04 -0.04 kpc, respectively. The distance to NGC 7538 is considerably smaller than its kinematic distance and places it in the Perseus spiral arm. The distance to Cep A is also smaller than its kinematic distance and places it in the L ocalarm or spur. Combining the distance and proper motions with observed radial velocities gives the location and full space motion of the star-forming regions. We find significant deviations from circular galactic orbits for these sources: both sources show large peculiar motions (greater than 10 km s -1 ) counter to galactic rotation and NGC 7538 has a comparable peculiar motion toward the Galactic center.

  15. Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds

    Science.gov (United States)

    Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.

    2011-01-01

    The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

  16. Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring

    Science.gov (United States)

    Giroux, Mark; Smith, B.; Struck, C.

    2011-05-01

    Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.

  17. CHEMICAL EVOLUTION IN HIGH-MASS STAR-FORMING REGIONS: RESULTS FROM THE MALT90 SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Hoq, Sadia; Jackson, James M.; Foster, Jonathan B.; Sanhueza, Patricio; Claysmith, Christopher [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Guzmán, Andrés [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Whitaker, J. Scott [Physics Department, Boston University, Boston, MA 02215 (United States); Rathborne, Jill M. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Epping, NSW (Australia); Vasyunina, Tatiana; Vasyunin, Anton, E-mail: shoq@bu.edu, E-mail: jackson@bu.edu, E-mail: patricio@bu.edu, E-mail: claysmit@bu.edu, E-mail: jonathan.b.foster@yale.edu, E-mail: aguzmanf@cfa.harvard.edu, E-mail: scott@bu.edu, E-mail: rathborne@csiro.au, E-mail: tv3h@virginia.edu, E-mail: aiv3f@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2013-11-10

    The chemical changes of high-mass star-forming regions provide a potential method for classifying their evolutionary stages and, ultimately, ages. In this study, we search for correlations between molecular abundances and the evolutionary stages of dense molecular clumps associated with high-mass star formation. We use the molecular line maps from Year 1 of the Millimetre Astronomy Legacy Team 90 GHz (MALT90) Survey. The survey mapped several hundred individual star-forming clumps chosen from the ATLASGAL survey to span the complete range of evolution, from prestellar to protostellar to H II regions. The evolutionary stage of each clump is classified using the Spitzer GLIMPSE/MIPSGAL mid-IR surveys. Where possible, we determine the dust temperatures and H{sub 2} column densities for each clump from Herschel/Hi-GAL continuum data. From MALT90 data, we measure the integrated intensities of the N{sub 2}H{sup +}, HCO{sup +}, HCN and HNC (1-0) lines, and derive the column densities and abundances of N{sub 2}H{sup +} and HCO{sup +}. The Herschel dust temperatures increase as a function of the IR-based Spitzer evolutionary classification scheme, with the youngest clumps being the coldest, which gives confidence that this classification method provides a reliable way to assign evolutionary stages to clumps. Both N{sub 2}H{sup +} and HCO{sup +} abundances increase as a function of evolutionary stage, whereas the N{sub 2}H{sup +} (1-0) to HCO{sup +} (1-0) integrated intensity ratios show no discernable trend. The HCN (1-0) to HNC(1-0) integrated intensity ratios show marginal evidence of an increase as the clumps evolve.

  18. HIGH-VELOCITY LINE FORMING REGIONS IN THE TYPE Ia SUPERNOVA 2009ig

    International Nuclear Information System (INIS)

    Marion, G. H.; Foley, Ryan J.; Challis, Peter; Kirshner, Robert P.; Vinko, Jozsef; Wheeler, J. Craig; Silverman, Jeffrey M.; Hsiao, Eric Y.; Brown, Peter J.; Filippenko, Alexei V.; Garnavich, Peter; Landsman, Wayne B.; Parrent, Jerod T.; Pritchard, Tyler A.; Roming, Peter W. A.; Wang, Xiaofeng

    2013-01-01

    We report measurements and analysis of high-velocity (HVF) (>20,000 km s –1 ) and photospheric absorption features in a series of spectra of the Type Ia supernova (SN) 2009ig obtained between –14 days and +13 days with respect to the time of maximum B-band luminosity (B-max). We identify lines of Si II, Si III, S II, Ca II, and Fe II that produce both HVF and photospheric-velocity (PVF) absorption features. SN 2009ig is unusual for the large number of lines with detectable HVF in the spectra, but the light-curve parameters correspond to a slightly overluminous but unexceptional SN Ia (M B = –19.46 mag and Δm 15 (B) = 0.90 mag). Similarly, the Si II λ6355 velocity at the time of B-max is greater than 'normal' for an SN Ia, but it is not extreme (v Si = 13,400 km s –1 ). The –14 days and –13 days spectra clearly resolve HVF from Si II λ6355 as separate absorptions from a detached line forming region. At these very early phases, detached HVF are prevalent in all lines. From –12 days to –6 days, HVF and PVF are detected simultaneously, and the two line forming regions maintain a constant separation of about 8000 km s –1 . After –6 days all absorption features are PVF. The observations of SN 2009ig provide a complete picture of the transition from HVF to PVF. Most SNe Ia show evidence for HVF from multiple lines in spectra obtained before –10 days, and we compare the spectra of SN 2009ig to observations of other SNe. We show that each of the unusual line profiles for Si II λ6355 found in early-time spectra of SNe Ia correlate to a specific phase in a common development sequence from HVF to PVF

  19. CHEMICAL SEGREGATION TOWARD MASSIVE HOT CORES: THE AFGL2591 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Serra, I.; Zhang, Q. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Viti, S. [Department of Physics and Astronomy, University College London, Gower Place, London WC1E 6BT (United Kingdom); Martin-Pintado, J. [Centro de Astrobiologia (CSIC/INTA), Ctra. de Torrejon a Ajalvir km 4, E-28850 Torrejon de Ardoz, Madrid (Spain); De Wit, W.-J., E-mail: ijimenez-serra@cfa.harvard.edu, E-mail: qzhang@cfa.harvard.edu, E-mail: sv@star.ucl.ac.uk, E-mail: jmartin@cab.inta-csic.es, E-mail: wdewit@eso.org [European Southern Observatory, Alonso de Cordova 3107, Vitacura, Santiago (Chile)

    2012-07-01

    We present high angular resolution observations (0.''5 Multiplication-Sign 0.''3) carried out with the Submillimeter Array (SMA) toward the AFGL2591 high-mass star-forming region. Our SMA images reveal a clear chemical segregation within the AFGL2591 VLA 3 hot core, where different molecular species (Types I, II, and III) appear distributed in three concentric shells. This is the first time that such a chemical segregation is ever reported at linear scales {<=}3000 AU within a hot core. While Type I species (H{sub 2}S and {sup 13}CS) peak at the AFGL2591 VLA 3 protostar, Type II molecules (HC{sub 3}N, OCS, SO, and SO{sub 2}) show a double-peaked structure circumventing the continuum peak. Type III species, represented by CH{sub 3}OH, form a ring-like structure surrounding the continuum emission. The excitation temperatures of SO{sub 2}, HC{sub 3}N, and CH{sub 3}OH (185 {+-} 11 K, 150 {+-} 20 K, and 124 {+-} 12 K, respectively) show a temperature gradient within the AFGL2591 VLA 3 envelope, consistent with previous observations and modeling of the source. By combining the H{sub 2}S, SO{sub 2}, and CH{sub 3}OH images, representative of the three concentric shells, we find that the global kinematics of the molecular gas follow Keplerian-like rotation around a 40 M{sub Sun} star. The chemical segregation observed toward AFGL2591 VLA 3 is explained by the combination of molecular UV photodissociation and a high-temperature ({approx}1000 K) gas-phase chemistry within the low extinction innermost region in the AFGL2591 VLA 3 hot core.

  20. Influence of water-filtered infrared-A (wIRA on reduction of local fat and body weight by physical exercise

    Directory of Open Access Journals (Sweden)

    Schmitz, Gerd

    2006-07-01

    treatment were not seen. Discussion: The results of the study suggest, that wIRA – during moderate bicycle ergometer endurance exercise as lipolytic stimulus – increases local lipolysis with a local fat reduction (thighs in the otherwise bradytrophic fatty tissue. The presumably underlying mechanisms of wIRA have already been proven: wIRA acts both by thermal effects and by non-thermal effects. Thermal effects of wIRA are the generation of a therapeutic field of warmth with the increase of tissue temperature, tissue oxygen partial pressure, and tissue blood flow, and by this regional metabolism. As fatty tissue normally has a slow metabolism (bradytrophic and hypothermic tissue with a low rate of lipolysis, wIRA can increase lipolysis in fatty tissue and the mobilized fats are burned in musculature during the ergometer exercise. Conclusion: The results of the study indicate, that wIRA irradiation during moderate ergometer endurance exercise can be used – in combination with an appropriate nutrition – to improve body composition, especially local fat distribution, and the reduction of fat and body weight in obese persons.

  1. Ligand binding affinity at the insulin receptor isoform A (IR-A and subsequent IR-A tyrosine phosphorylation kinetics are important determinants of mitogenic biological outcomes.

    Directory of Open Access Journals (Sweden)

    Harinda eRajapaksha

    2015-07-01

    Full Text Available The insulin receptor (IR is a tyrosine kinase receptor that can mediate both metabolic and mitogenic biological actions. The IR isoform-A (IR-A arises from alternative splicing of exon 11 and has different ligand binding and signalling properties compared to the IR isoform-B. The IR-A not only binds insulin but also insulin-like growth factor-II (IGF-II with high affinity. IGF-II acting through the IR-A promotes cancer cell proliferation, survival and migration by activating some unique signalling molecules compared to those activated by insulin. This observation led us to investigate whether the different IR-A signalling outcomes in response to IGF-II and insulin could be attributed to phosphorylation of a different subset of IR-A tyrosine residues or to the phosphorylation kinetics. We correlated IR-A phosphorylation to activation of molecules involved in mitogenic and metabolic signalling (MAPK and Akt and receptor internalisation rates (related to mitogenic signalling. We also extended this study to incorporate two ligands that are known to promote predominantly mitogenic ([His4, Tyr15, Thr49, Ile51] IGF-I, qIGF-I or metabolic (S597 peptide biological actions, to see if common mechanisms can be used to define mitogenic or metabolic signalling through the IR-A. The 3-fold lower mitogenic action of IGF-II compared to insulin was associated with a decreased potency in activation of Y960, Y1146, Y1150, Y1151, Y1316 and Y1322, in MAPK phosphorylation and in IR-A internalization. With the poorly mitogenic S597 peptide it was a decreased rate of tyrosine phosphorylation rather than potency that was associated with a low mitogenic potential. We conclude that both decreased affinity of IR-A binding and the kinetics of IR-A phosphorylation can independently lead to a lower mitogenic activity. None of the studied parameters could account for the lower metabolic activity of qIGF-I.

  2. A Study of THT Cold Cores Population in the Star-Forming Region in Serpens

    Science.gov (United States)

    Fiorellino, Eleonora

    2017-11-01

    The purpose of this work is to produce the Core Mass Function (CMF) of the Serpens star-forming region and confront it with the Initial Mass Function (IMF), the statistical distribution of initial star mass. As Testi & Sergent (1998) discovered, the power-law index of the slope of the CMF is very close to the one of the Salpeter's IMF (Salpeter, 1955): dN/dM / M2.35. This strongly suggests that the stellar IMF results from the fragmentation process in turbulent cloud cores rather than from stellar accretion mechanisms and gives a huge contribute to undestanding the star formation. For this work, we started from the data delivered by the European satellite Herschel and produced the maps of the Serpens with Unimap code (Piazzo et al, 2015). Hence we obtained a core catalogue with two different softwares getsources (Men'shchikov et al, 2012) and CuTEx (Molinari et al, 2011) and we eliminated from it any source that is not a core. A full discussion of the cores physical propreties as well as the whole region is under preparation.

  3. Optical polarization maps of star-forming regions in Perseus, Taurus, and Ophiuchus

    International Nuclear Information System (INIS)

    Goodman, A.A.; Bastien, P.; Menard, F.; Myers, P.C.

    1990-01-01

    New optical linear polarization maps are presented of the star-forming regions near L1506 in Taurus, L1755 in Ophiuchus, and the complex of dark cloud which extends from L1448 in B5 in Perseus. The former two show a well-defined peak magnetic field direction in the plane of the sky with a finite dispersion about that peak which is smaller than would be expected for a random distribution of field distributions. The dispersion in the position angle of filamentary clouds within these complexes implies that clouds which appear elongated on the plane of the sky are not all associated with a pattern of polarization vectors particularly parallel or perpendicular to their geometry. Instead, clouds tend to be oriented at the angle formed by their axis and the mean direction of the local large-scale field. For the dark cloud complex, a bimodal distribution of the polarization vector angle is taken to result from at least two distributions of gas along the line of sight which appear as a complex in projection. 55 refs

  4. B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

    2013-01-01

    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

  5. Poblacion estelar joven embebida en la nube molecular galactica asociada a la fuente IRAS 18236-1205

    Science.gov (United States)

    Romero, Ricardo Retes

    2008-06-01

    En esta tesis presento una metodología de seleccion y estudio de la población estelar embebida en la nube molecular galactica asociada a la fuente IRAS 18236-1205. La fuente IRAS posee colores de region Ultra Compacta HII (UCHII) y tiene deteccióon en monosulfuro de carbono (CS), trazador molecular de alta densidad, lo cual da la posibilidad de definir la nube molecular asociada hacia esta region. Lo anterior muestra que esta es buena candidata a región de formación estelar masiva. La metodología de seleccion de la población embebida, est à basada por una parte, en la distribución del gas molecular monoxido de carbono (13CO) asociado a la fuente IRAS, nube molecular seleccionada del mapeo Galactic Ring Survey (GRS) realizado en 13CO. Otros pasos de la seleccion, se basan en los diagramas color-color y color-magnitud con datos del cercano infrarrrojo de 2MASS. Para el estudio de la componente estelar se usaron los catalogos de fuentes puntuales en el cercano, medio y lejano infrarrojo de 2MASS, SPITZER e IRAS, respectivamente. De los diagramas color-color y color-magnitud, usando datos de 2MASS, se construyo un criterio fotométrico para identificar los objetos estelares j ovenes embebidos en la region molecular. Aplicando modelos a la distribución espectral de energía (SED) de algunos ellos, se encontraron parametros estelares de objetos estelares j ovenes embebidos de masa intermedia y alta. Adicionalmente, se encontro un objeto de masa ´ intermedia no identifiado por el catalogo de 2MASS y su efecto sobre el medio interestelar, emision en la banda de [4.5] μm de IRAC-Spitzer asociado a un outflow. Dos de los objetos seleccionados por el criterio fotometrico resultaron ser objetos estelares jovenes de alta e intermedia masa (B1V/B2V y B8V/A0V respectivamente), los cuales deben estar asociados a la emision radiativa responsable de los colores de región UC HII. Otro objeto estelar joven de baja masa (F0V/F5V) fue encontrado en la region de estudio

  6. Escape of ionizing radiation from star-forming regions in Young galaxies

    DEFF Research Database (Denmark)

    Razoumov, A; Sommer-Larsen, Jesper

    2006-01-01

    Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10......Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10...

  7. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    International Nuclear Information System (INIS)

    Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.; McLeod, K. K.; Apai, D.; Pascucci, I.; Ghez, A. M.; Robberto, M.

    2014-01-01

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M ☉ ). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15 −0.03 +0.05 for M4-M6 (M ∼ 0.1-0.3 M ☉ ) and 4/108 = 0.04 −0.01 +0.03 for >M6 (M ≲ 0.1 M ☉ ) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  8. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Todorov, K. O.; Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Konopacky, Q. M. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); McLeod, K. K. [Whitin Observatory, Wellesley College, Wellesley, MA 02481 (United States); Apai, D.; Pascucci, I. [Department of Astronomy, University of Arizona, 933 N. Cherry Avenue, Tucson, AZ 85721 (United States); Ghez, A. M. [Division of Astronomy and Astrophysics, University of California, Los Angeles, CA 90095 (United States); Robberto, M., E-mail: todorovk@phys.ethz.ch [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2014-06-10

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  9. Water in massive star-forming regions with Herschel Space Observatory

    Science.gov (United States)

    Chavarria, L.; Herpin, F.; Bontemps, S.; Jacq, T.; Baudry, A.; Braine, J.; van der Tak, F.; Wyrowski, F.; van Dishoeck, E. F.

    2011-05-01

    High-mass stars formation process is much less understood than the low-mass case: short timescales, high opacities and long distance to the sources challenge the study of young massive stars. The instruments on board the Heschel Space Observatory permit us to investigate molecular species at high spectral resolution in the sub-milimeter wavelengths. Water, one of the most abundant molecules in the Universe, might elucidate key episodes in the process of stellar birth and it may play a major role in the formation of high-mass stars. This contribution presents the first results of the Heschel Space Observatory key-program WISH (Water In Star forming regions with Herschel) concerning high-mass protostars. The program main purpose is to follow the process of star formation during the various stages using the water molecule as a physical diagnostic throughout the evolution. In general, we aim to adress the following questions: How does protostars interact with their environment ? How and where water is formed ? How is it transported from cloud to disk ? When and where water becomes a dominant cooling or heating agent ? We use the HIFI and PACS instruments to obtain maps and spectra of ~20 water lines in ~20 massive protostars spanning a large range in physical parameters, from pre-stellar cores to UCHII regions. I will review the status of the program and focus specifically on the spectroscopic results. I will show how powerful are the HIFI high-resolution spectral observations to resolve different physical source components such as the dense core, the outflows and the extended cold cloud around the high-mass object. We derive water abundances between 10-7 and 10-9 in the outer envelope. The abundance variations derived from our models suggest that different chemical mechanisms are at work on these scales (e.g. evaporation of water-rich icy grain mantles). The detection and derived abundance ratios for rare isotopologues will be discussed. Finally, a comparison in tems

  10. The Depletion of Water During Dispersal of Planet-forming Disk Regions

    Science.gov (United States)

    Banzatti, A.; Pontoppidan, K. M.; Salyk, C.; Herczeg, G. J.; van Dishoeck, E. F.; Blake, G. A.

    2017-01-01

    We present a new velocity-resolved survey of 2.9 μm spectra of hot H2O and OH gas emission from protoplanetary disks, obtained with the Cryogenic Infrared Echelle Spectrometer at the VLT (R ˜ 96,000). With the addition of archival Spitzer-IRS spectra, this is the most comprehensive spectral data set of water vapor emission from disks ever assembled. We provide line fluxes at 2.9-33 μm that probe from the dust sublimation radius at ˜0.05 au out to the region of the water snow line. With a combined data set for 55 disks, we find a new correlation between H2O line fluxes and the radius of CO gas emission, as measured in velocity-resolved 4.7 μm spectra (R {}{co}), which probes molecular gaps in inner disks. We find that H2O emission disappears from 2.9 μm (hotter water) to 33 μm (colder water) as {R}{co} increases and expands out to the snow line radius. These results suggest that the infrared water spectrum is a tracer of inside-out water depletion within the snow line. It also helps clarify an unsolved discrepancy between water observations and models by finding that disks around stars of {M}\\star > 1.5 {M}⊙ generally have inner gaps with depleted molecular gas content. We measure radial trends in H2O, OH, and CO line fluxes that can be used as benchmarks for models to study the chemical composition and evolution of planet-forming disk regions at 0.05-20 au. We propose that JWST spectroscopy of molecular gas may be used as a probe of inner disk gas depletion, complementary to the larger gaps and holes detected by direct imaging and by ALMA.

  11. Nucleus of Comet IRAS-Araki-Alcock (1983 VII)

    International Nuclear Information System (INIS)

    Sekanina, Z.

    1988-01-01

    Optical, radar, infrared, UV, and microwave-continuum observations of Comet IRAS-Araki-Alcok were obtained in May 1983, the week of the comet's close approach to earth. The comet has a nucleus dimension and a rotation period which are similar to those of Comet Halley, but a different morphological signature (a persisting sunward fan-shaped coma). Time variations are noted in the projected nucleus cross section. Results suggest significant limb-darkening effects in the relevant domains of radio waves, and that the comet's interior must be extremely cold. It is found that the thermal-infrared fluxes from the inner coma of the comet are dominated by the nucleus. 63 references

  12. Newly discovered IRAS QSO close to the Galactic plane

    International Nuclear Information System (INIS)

    Strauss, M.A.; Kirhakos, S.D.; Yahil, A.

    1988-01-01

    CCD observations of the IRAS QSO candidate I09149-6206 performed at CTIO during December 1987 are reported, including 564-806-nm spectroscopy obtained with the 1.5-m telescope and direct UVBRI imaging obtained with the 0.91-m telescope. The data are presented in tables and graphs and characterized in detail. It is found that the source is surrounded by a faint fuzz with low surface brightness and strong forbidden O III lines. Parameters determined include redshift z = 0.0571, Galactic latitude -9.2 deg, V magnitude 13.55, Galactic reddening E(B-V) = about 0.23, and absolute V magnitude about -24.87. 33 references

  13. IRAS bright galaxy sample. II. The sample and luminosity function

    International Nuclear Information System (INIS)

    Soifer, B.T.; Sanders, D.B.; Neugebauer, G.; Madore, B.F.; Danielson, G.E.; David Dunlap Observatory, Richmond Hill, Canada; Palomar Observatory; California Institute of Technology, Pasadena)

    1987-01-01

    A statistically complete sample of 324 of the brightest infrared galaxies discovered at 60 microns in the IRAS all-sky survey is described. The results show that far-infrared emission is a significant luminosity component in the local universe, representing 25 percent of the luminosity emitted by stars in the same volume. Above 10 to the 11th solar luminosities, the infrared luminous galaxies are the dominant population of objects in the universe, being as numerous as the Seyfert galaxies and more numerous than quasars at higher luminosities. The infrared luminosity appears to be independent of the optical luminosity of galaxies. Most infrared bright galaxies appear to require much of the interstellar matter to be contributing to the observed infrared luminosity. Approximately 60-80 percent of the far-infrared luminosity of the local universe can be attributed, directly or indirectly, to recent or ongoing star formation. 67 references

  14. Near-infrared observations of IRAS minisurvey galaxies

    International Nuclear Information System (INIS)

    Carico, D.P.; Soifer, B.T.; Elias, J.H.; Matthews, K.; Neugebauer, G.; Beichman, C.; Persson, C.J.; Persson, S.E.

    1987-01-01

    Near infrared photometry at J, H, and K was obtained for 82 galaxies from the IRAS minisurvey. The near infrared colors of these galaxies cover a larger range in J-H and H-K than do normal field spiral galaxies, and evidence is presented of a tighter correlation between the near and far infrared emission in far infrared bright galaxies than exists between the far infrared and the visible emission. These results suggest the presence of dust in the far infrared bright galaxies, with hot dust emission contributing to the 2.2 micron emission, and extinction by dust affecting both the near infrared colors and the visible luminosities. In addition, there is some indication that the infrared emission in many of the minisurvey galaxies is coming from a strong nuclear component

  15. CO and IRAS detection of an intermediate-velocity cloud

    International Nuclear Information System (INIS)

    Desert, F.X.; Bazell, D.; Blitz, L.

    1990-01-01

    In the course of a radio survey of high-Galactic-latitude clouds, CO emission was detected at the position l = 210.8 deg and b = 63.1 deg with an LSR velocity of -39 km/sec. This molecular cloud constitutes the third one with an unusually large absolute velocity at these latitudes, as compared with the 5.4-km/sec cloud-to-cloud velocity dispersion of the high-latitude molecular clouds. The position is coincident with an H I intermediate-velocity cloud (GHL 11, Verschuur H, OLM 268) and the IR-excess cloud 306 in the list by Desert et al. (1988). This cloud is clearly detected at all four IRAS wavelengths and has warmer colors than the local ISM. 27 refs

  16. The infrared emission bands. III. Southern IRAS sources.

    Science.gov (United States)

    Cohen, M; Tielens, A G; Bregman, J; Witteborn, F C; Rank, D M; Allamandola, L J; Wooden, D H; de Muizon, M

    1989-06-01

    We present airborne 5-8 micrometers spectra of southern IRAS sources which reveal strong polycyclic aromatic hydrocarbon (PAH) emission features. The good correlation between the bands, in particular the dominant 6.2 and "7.7" micrometers features, strongly imply a common carrier, reinforcing the PAH hypothesis. However, small but detectable spectral variations exist. Planetaries have a distinctly different ratio of I(6.2)/I(7.7) than other nebulae, accompanied by a redward shift in the actual wavelength of the "7.7" micrometers peak. Further, we have detected a new feature, previously predicted from laboratory spectra of PAH molecules, at 5.2 micrometers in many of these sources. Spectra of two rare [WC 10] planetary nebular nuclei indicate a very prominent plateau of emission, linking the 6.2 and 7.7 micrometers bands. Several of our sources show definite evidence for emission structure between 14 and 23 micrometers in their IRAS Low-Resolution Spectral Atlas spectra: we attribute this structure to PAH bands. too. We have defined the "generic" spectrum of emission bands relating the mean intensities of each band to that of the strongest, near 7.7 micrometers. We have added three more planetary or protoplanetary nebulae to our correlation between 7.7 micrometers band intensity and nebular gas phase C/O ratio, namely NGC 6302, HR 4049, and the highly carbon-rich [WC 10] nucleus, CPD--56 degrees 8032. For the latter we have determined a ratio for C/O of approximately 4.8 from IUE observations. The good correlation between the intensity ratio of the "7.7" micrometers feature relative to the far-infrared dust continuum and nebular C/O also supports a carbonaceous carrier for these emission features.

  17. Dante, i diavoli e l'ira di Virgilio

    Directory of Open Access Journals (Sweden)

    Federico Saviotti

    2014-07-01

    Full Text Available Riassunto: Numerosi interventi critici hanno analizzato ad ogni livello la diablerie che Dante mette in scena in If. XXI-XXIII; tuttavia, la sua eccentricità formale e contenutistica rispetto al resto del poema sembra ancora imbarazzare gli esegeti. In questo articolo si cerca di giustificarne la coerenza nel quadro della poetica della comedìa dantesca, concentrandosi su alcuni aspetti di particolare interesse: tra questi, l’opportunità di una lettura carnevalesca – in senso bachtiniano – della diablerie e il senso del “riso” di cui questa è portatrice; la presenza di un rovesciamento intra-testuale definibile come “auto-parodico” rispetto alla scena di If. VIII-IX e apprezzabile a partire dalla rappresentazione dei diversi personaggi; la “sconfitta” due volte patita da Virgilio nei confronti dei diavoli e la definizione, in entrambi ed altri casi, della sua ira. Abstract: Many scholars have analyzed at any level the diablerie Dante puts on stage in If. XXI-XXIII; nevertheless, its formal and substantial eccentricity compared with the rest of the poem still seems to puzzle the commentators. In this paper I will try to demonstrate its coherence with the poetics of Dante’s comedìa, by focusing on some very interesting elements: the opportunity of a bachtinian interpretation of the diablerie as a carnival expression and the meaning of the “laughter” it conveys; the presence of an intra-textual reversal which may be defined as “auto-parodic” in respect to the scene in If. VIII-IX and appreciated through the poetic representation of the different characters; the “defeat” which Virgilio undergoes twice against the devils and the definition, in both and other cases, of its ira.  

  18. Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

    Energy Technology Data Exchange (ETDEWEB)

    Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, K. M.; Brunthaler, A.; Wu, Y.; Zhang, B.; Sanna, A.; Sato, M.; Choi, Y. K.; Immer, K. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Zheng, X. W. [Department of Astronomy, Nanjing University Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Hachisuka, K. [Shanghai Astronomical Observatory, 80 Nandan Rd., Shanghai (China); Moscadelli, L. [Arcetri Observatory, Firenze (Italy); Rygl, K. L. J. [European Space Agency (ESA-ESTEC), Keplerlaan 1, P.O. Box 299, 2200 AG, Noordwijk (Netherlands); Bartkiewicz, A. [Centre for Astronomy, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland)

    2014-03-10

    Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensional position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

  19. Citizenship and the Forms of Political Support: A Case-Study of the Croatian Adriatic Regions

    Directory of Open Access Journals (Sweden)

    Zoran Radman

    2010-01-01

    Full Text Available The article is dealing with the issue of political support in Croatia, related to the issues of trust and legitimacy towards authority and institutions, as the elements of the political system. Previous research conducted in Croatia evidences a relatively low level of trust in the political authorities and institutions. In this paper we go by Easton’s dimensions of political support: authority support, support to institutions, support to democracy and support to community. All these forms of political support represent the subjective orientations of citizens towards the units of the political system. On the other hand, orientation and relationship of citizens towards the units of the political systems poses the question of citizenship. The paper is exploring the relation of subjective orientations of citizens towards the political systems units and different dimensions of political support in the specific context of Adriatic regions of Croatia, on the basis of the established models of citizenship developed by various authors. The results point out that the level of support rises as we go from the lower, specific types of support (support to authorities and support to institutions towards higher, diffuse modes of support (support to community. In the background of the political support, especially “support to democracy”, there are performances of the political system. In other words, political support is more instrumentally then intrinsically founded.

  20. Trigonometric parallaxes of star forming regions in the Scutum spiral arm

    International Nuclear Information System (INIS)

    Sato, M.; Wu, Y. W.; Immer, K.; Zhang, B.; Sanna, A.; Brunthaler, A.; Menten, K. M.; Reid, M. J.; Dame, T. M.

    2014-01-01

    We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due to the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s –1 slower than the Galactic rotation and 8 km s –1 toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.

  1. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.

  2. YOUNG STELLAR OBJECTS IN THE LARGE MAGELLANIC CLOUD STAR-FORMING REGION N206

    International Nuclear Information System (INIS)

    Romita, Krista Alexandra; Meixner, M.; Sewilo, M.; Shiao, B.; Carlson, Lynn Redding; Whitney, B.; Babler, B.; Meade, M.; Indebetouw, R.; Hora, J. L.

    2010-01-01

    We present analysis of the energetic star-forming region Henize 206 (N206) located near the southern edge of the Large Magellanic Cloud (LMC) based on photometric data from the Spitzer Surveying the Agents of Galaxy Evolution (SAGE-LMC; IRAC 3.6, 4.5, 5.8, 8.0 μm and MIPS 24 μm), Infrared Survey Facility near-infrared survey (J, H, K s ), and the Magellanic Clouds Photometric Survey (MCPS UBVI) covering a wavelength range of 0.36-24 μm. Young stellar object (YSO) candidates are identified based upon their location in infrared color-magnitude space and classified by the shapes of their spectral energy distributions in comparison with a pre-computed grid of YSO models. We identify 116 YSO candidates: 102 are well characterized by the YSO models, predominately Stage I, and 14 may be multiple sources or young sources with transition disks. Careful examination of the individual sources and their surrounding environment allows us to identify a factor of ∼14.5 more YSO candidates than have already been identified. The total mass of these well-fit YSO candidates is ∼520 M sun . We calculate a current star formation rate of 0.27 x 10 -1 M sun yr -1 kpc -2 . The distribution of YSO candidates appears to follow shells of neutral material in the interstellar medium.

  3. YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

    Energy Technology Data Exchange (ETDEWEB)

    Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

    2014-12-01

    The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

  4. Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions

    Science.gov (United States)

    Kulesa, Craig A.

    Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us

  5. MANAGEMENT OF THE INTERNAL LABOR MARKET (BASING ON CASES OF THE SVERDLOVSK REGION CITY-FORMING ENTERPRISES

    Directory of Open Access Journals (Sweden)

    S.V. Orekhova

    2008-12-01

    Full Text Available This paper presents an estimation procedure of regional labor market influence on sustainability of internal labor market institutions. The paper refines the categories of regional and internal labor market. Internal labor market institutions have been classified and evaluated regarding the level of their sustainability (basing on cases of the Sverdlovsk region city-forming enterprises. As a result the model of labor expenses evaluation is elaborated for enterprises concerned.

  6. An atlas of high-resolution IRAS maps on nearby galaxies

    Science.gov (United States)

    Rice, Walter

    1993-01-01

    An atlas of far-infrared IRAS maps with near 1 arcmin angular resolution of 30 optically large galaxies is presented. The high-resolution IRAS maps were produced with the Maximum Correlation Method (MCM) image construction and enhancement technique developed at IPAC. The MCM technique, which recovers the spatial information contained in the overlapping detector data samples of the IRAS all-sky survey scans, is outlined and tests to verify the structural reliability and photometric integrity of the high-resolution maps are presented. The infrared structure revealed in individual galaxies is discussed. The atlas complements the IRAS Nearby Galaxy High-Resolution Image Atlas, the high-resolution galaxy images encoded in FITS format, which is provided to the astronomical community as an IPAC product.

  7. Brief description of the programmes of the Institut fuer Reaktordynamik und Anlagensicherheit (IRA)

    International Nuclear Information System (INIS)

    1977-01-01

    All programmes used by the IRA are presented, giving name and abbreviation, field of application, purpose and solution method, requirements made on the computer, necessary auxiliary programmes, and machine time for typical examples. (RW) [de

  8. Radio identifications of IRAS point sources with b greater than 30 deg

    International Nuclear Information System (INIS)

    Condon, J.J.; Broderick, J.J.; Virginia Polytechnic Institute and State Univ., Blacksburg)

    1986-01-01

    The present radio identifications of IRAS point sources on the basis of Green Bank 1400 MHz survey maps notes that 365 hot IR sources are not detectable radio sources, and that nearly all cool high latitude IRAS sources are extragalactic. The fainter IR-source identifications encompass optically bright quasars, BL Lac objects, Seyfert galaxies, and elliptical galaxies. No IRAS sources could be identified with distant elliptical radio galaxies, so that although the radio and IR fluxes of most IRAS extragalactic sources are tightly correlated, complete samples of strong radio and IR sources are almost completely disjoint; no more than 1 percent of the IR sources are radio sources and less than 1 percent of the radio sources are IR ones. 35 references

  9. Estrategias terapéuticas e intelectualismo en el De ira de Séneca

    Directory of Open Access Journals (Sweden)

    Rodrigo Sebastián Braicovich

    2015-01-01

    Full Text Available Pretendo demostrar que a el tratado De IRA de Séneca incluye no una sino dos estrategias terapéuticas diseñadas para evitar la ira, y que b que la segunda de estasestrategiasla cual ha sido desatendida en la literatura secundaria– presenta problemas irresolubles cuando la contrastamos contra la teoría estoica de la acción, lacual se funda en premisas intelectualistas.

  10. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray; Lafrenière, David; Janson, Markus

    2015-01-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M ☉ and low-mass stars at ∼0.2 M ☉ . We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M Jup . The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3 −4.9 +6.6 %. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M ☉ appear to be multiple. Higher order multiples were found in 1.8 −1.5 +4.2 % of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively

  11. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: daemgen@astro.utoronto.ca [Department of Astronomy, Stockholm University, Stockholm (Sweden)

    2015-02-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.

  12. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco-Gonzalez, Carlos [Max-Planck-Institut fuer Radioastronomie (MPIfR), Auf dem Huegel 69, 53121 Bonn (Germany); Osorio, Mayra; Anglada, Guillem; Gomez, Jose F. [Instituto de Astrofisica de Andalucia, CSIC, Camino Bajo de Huetor 50, E-18008 Granada (Spain); D' Alessio, Paola; Rodriguez, Luis F. [Centro de Radioastronomia y Astrofisica UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacan (Mexico); Torrelles, Jose M., E-mail: carrasco@mpifr-bonn.mpg.de [Instituto de Ciencias del Espacio (CSIC)-UB/IEEC, Universitat de Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain)

    2012-02-10

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  13. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Carrasco-González, Carlos; Osorio, Mayra; Anglada, Guillem; Gómez, José F.; D'Alessio, Paola; Rodríguez, Luis F.; Torrelles, José M.

    2012-01-01

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of ∼120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  14. ALMA Observations of the Water Fountain Pre-Planetary Nebula IRAS 16342-3814: High-Velocity Bipolar Jets and an Expanding Torus.

    Science.gov (United States)

    Sahai, R; Vlemmings, W H T; Gledhill, T; Sánchez Contreras, C; Lagadec, E; Nyman, L-Å; Quintana-Lacaci, G

    2017-01-20

    We have mapped 12 CO J=3-2 and other molecular lines from the "water-fountain" bipolar pre-planetary nebula (PPN) IRAS 16342-3814 with [Formula: see text] resolution using ALMA. We find (i) two very high-speed knotty, jet-like molecular outflows, (ii) a central high-density (> few × 10 6 cm -3 ), expanding torus of diameter 1300 AU, and (iii) the circumstellar envelope of the progenitor AGB, generated by a sudden, very large increase in the mass-loss rate to > 3.5 × 10 -4 M ⊙ yr -1 in the past ~455 yr. Strong continuum emission at 0.89 mm from a central source (690 mJy), if due to thermally-emitting dust, implies a substantial mass (0.017 M ⊙ ) of very large (~mm-sized) grains. The measured expansion ages of the above structural components imply that the torus (age~160 yr) and the younger high-velocity outflow (age~110 yr) were formed soon after the sharp increase in the AGB mass-loss rate. Assuming a binary model for the jets in IRAS 16342, the high momentum rate for the dominant jet-outflow in IRAS 16342 implies a high minimum accretion rate, ruling out standard Bondi-Hoyle-Lyttleton wind accretion and wind Roche lobe overflow (RLOF) models with white-dwarf or main-sequence companions. Most likely, enhanced RLOF from the primary or accretion modes operating within common envelope evolution are needed.

  15. Antimicrobial Photoinactivation Using Visible Light Plus Water-Filtered Infrared-A (VIS + wIRA Alters In Situ Oral Biofilms.

    Directory of Open Access Journals (Sweden)

    A Al-Ahmad

    Full Text Available Recently, growing attention has been paid to antimicrobial photodynamic therapy (aPDT in dentistry. Changing the microbial composition of initial and mature oral biofilm by aPDT using visible light plus water-filtered infrared-A wavelengths (VIS + wIRA has not yet been investigated. Moreover, most aPDT studies have been conducted on planktonic bacterial cultures. Therefore, in the present clinical study we cultivated initial and mature oral biofilms in six healthy volunteers for 2 hours or 3 days, respectively. The biofilms were treated with aPDT using VIS+wIRA (200 mW cm(-2, toluidine blue (TB and chlorine e6 (Ce6 for 5 minutes. Chlorhexidine treated biofilm samples served as positive controls, while untreated biofilms served as negative controls. After aPDT treatment the colony forming units (CFU of the biofilm samples were quantified, and the surviving bacteria were isolated in pure cultures and identified using MALDI-TOF, biochemical tests and 16S rDNA-sequencing. aPDT killed more than 99.9% of the initial viable bacterial count and 95% of the mature oral biofilm in situ, independent of the photosensitizer. The number of surviving bacterial species was highly reduced to 6 (TB and 4 (Ce6 in the treated initial oral biofilm compared to the 20 different species of the untreated biofilm. The proportions of surviving bacterial species were also changed after TB- and Ce6-mediated aPDT of the mature oral biofilm, resulting in a shift in the microbial composition of the treated biofilm compared to that of the control biofilm. In conclusion, aPDT using VIS + wIRA showed a remarkable potential to eradicate both initial and mature oral biofilms, and also to markedly alter the remaining biofilm. This encourages the clinical use of aPDT with VIS + wIRA for the treatment of periimplantitis and periodontitis.

  16. Simulation study of the chemical forms of neptunium and plutonium in groundwater from a borehole in the northwest region

    International Nuclear Information System (INIS)

    Ma Yingming; Jin Yuren; Wang Zhiqiang; Liu Dongxu; Liu Wei; Liu Yan

    2009-01-01

    According to physics-chymistry characteristic of groundwater from a borehole in the northwest region, we performed simulation study of the chemical forms of neptunium and plutonium by the geochemistry modeling program EQ3/6. The main conclusions are as follows: the main chemical form of neptunium in the groundwater is Np(V)'s NpO 2 + , subordination chemical forms are NpO 2 Cl, NpO 2 CO 3 - , NpO 2 OH, NpO 2 SO 4 - ; the main existing form of plutonium in the groundwater is Pu(IV)'s Pu(OH)5-and subordination chemical form is Pu(V)'s PuO 2 + . In addition,the temperature, pH and Eh also have different impacts on the chemical form of neptunium and plutonium. (authors)

  17. A Comparative Observational Study of YSO Classification in Four Small Star-forming H ii Regions

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Sung-Ju; Choi, Minho; Kang, Miju [Korea Astronomy and Space Science Institute, 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 34055 (Korea, Republic of); Kerton, C. R., E-mail: sjkang@kasi.re.kr, E-mail: kerton@iastate.edu [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)

    2017-08-10

    We have developed a new young stellar object (YSO) identification and classification technique using mid-infrared Wide-field Infrared Survey Explorer (WISE) data. We compare this new technique with previous WISE YSO detection and classification methods that used either infrared colors or spectral energy distribution slopes. In this study, we also use the new technique to detect and examine the YSO population associated with four small H ii regions: KR 7, KR 81, KR 120, and KR 140. The relatively simple structure of these regions allows us to effectively use both spatial and temporal constraints to identify YSOs that are potential products of triggered star formation. We are also able to identify regions of active star formation around these H ii regions that are clearly not influenced by the H ii region expansion, and thus demonstrate that star formation is on-going on megayear timescales in some of these molecular clouds.

  18. The chemical structure of the Class 0 protostellar envelope NGC 1333 IRAS 4A⋆⋆

    Science.gov (United States)

    Koumpia, E.; Semenov, D. A.; van der Tak, F. F. S.; Boogert, A. C. A.; Caux, E.

    2017-07-01

    Context. It is not well known what drives the chemistry of a protostellar envelope, in particular the role of the stellar mass and the protostellar outflows on the chemical enrichment of such environments. Aims: We study the chemical structure of the Class 0 protostellar envelope NGC 1333 IRAS 4A in order to (I) investigate the influence of the outflows on the chemistry; (II) constrain the age of our studied object; (III) compare it with a typical high-mass protostellar envelope. Methods: In our analysis we use JCMT line mapping (360-373 GHz) and HIFI pointed spectra (626.01-721.48 GHz). To study the influence of the outflow on the degree of deuteration, we compare JCMT maps of HCO+ and DCO+ with non-LTE (RADEX) models in a region that spatially covers the outflow activity of IRAS 4A. To study the envelope chemistry, we derive empirical molecular abundance profiles for the observed species using the Monte Carlo radiative transfer code (RATRAN) and adopting a 1D dust density/temperature profile from the literature. We use a combination of constant abundance profiles and abundance profiles that include jumps at two radii (T 100 K or T 30 K) to fit our observations. We compare our best-fit observed abundance profiles with the predictions from the time dependent gas grain chemical code (ALCHEMIC). Results: We detect CO, 13CO, C18O, CS, HCN, HCO+, N2H+, H2CO, CH3OH, H2O, H2S, DCO+, HDCO, D2CO, SO, SO2, SiO, HNC, CN, C2H and OCS. We divide the detected lines in three groups based on their line profiles: a) broad emission (FWHM = 4-11 km s-1), b) narrow emission (FWHMtime-dependent gas-grain chemical model for the outer envelope, with the exceptions of HCN, HNC, CN. These species along with the CO abundance require an enhanced UV field which points towards an outflow cavity. The abundances with respect to H2 are 1 to 2 orders of magnitude lower than those observed in the high mass protostellar envelope (AFGL 2591), while they are found to be similar within factors of a

  19. Radio continuum interferometry of dark clouds: A search for newly formed HII regions

    International Nuclear Information System (INIS)

    Gilmore, W.S.

    1978-01-01

    A search for compact HII regions embedded in dark clouds has been carried out in an effort to study local massive star formation. Approximately 20% of the total area of opaque dark cloud material in the sky with Av greater than or equal to 6 mag was surveyed with the NRAO three-element interferometer at 2695 MHz, and at least 5% more was surveyed with the NRAO 300-foot telescope at 4750 MHz. The regions surveyed include the dark cloud complexes in Perseus, Taurus, Orion, and Ophiuchus, as well as several smaller cloud complexes and individual clouds. No hidden compact HII regions embedded inside dark clouds were detected with certainty in the radio continuum. However, eleven HII regions with associated visible emission and eighteen other possible HII regions were detected. Five infrared sources thought to have the luminosities of early B stars were not detected in the radio continuum. These five sources showed high correlation with the presence of CO self-absorption, CO emission over a wide range of velocities, and type I OH masers, but an absence of coincident visible nebulosity and detectable radio continuum emission. Therefore, it is suggested that they represent an earlier evolutionary stage than those HII region detected in the radio continuum. This first evolutionary state marks the presence of ''pre-emergent'' (with respect to the molecular cloud) cocoon stars. HII regions in the second evolutionary state are marked by the presence of detectable radio continuum emission, i.e., they are stronger than 10 mJy at 2695 MHz. They have associated visible nebulosity, are relatively large, and appear to be located at the edges of molecular clouds. These are designated as ''emergent edge'' HII regions. The fact that many young HII regions are edge HII regions implies that massive stars are born near the edges of clouds, a phenomenon previously suggested by several other investigators

  20. Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

    International Nuclear Information System (INIS)

    De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.

    2000-01-01

    Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

  1. The life forms of lichens on different substrates in Yelanetsko-Ingulskiy region (Mikolayivska and Kirovogradska oblast, Ukraine

    Directory of Open Access Journals (Sweden)

    Tatyana O. Boiko

    2012-03-01

    Full Text Available The article reveals the issue of distribution of lichens life forms on different substrates, which are present in the Yelanetsko- Ingulskiy region. The largest number of life forms of the lichens is characteristic for granite outcrops, and the lowest – for gneisses. This fact is associated with features of substrate morphostructure and density, microclimatic conditions of different ecotopes in which lichens grow.

  2. Studies of IRAS sources at high galactic latitudes

    International Nuclear Information System (INIS)

    Rowan-Robinson, M.; Helou, G.; Walker, D.

    1987-01-01

    A detailed study has been carried out of a complete sample of IRAS 25-, 60- and 100-μm sources identified with galaxies brighter than 14.5 mag at b > 60 0 . Redshifts are available for virtually all these galaxies. The 60- and 100-μm luminosities are well correlated with the corrected absolute magnitude Msub(B), the 25-μm luminosity less well so. There is a clear correlation of the ratio of far-infrared luminosity to optical luminosity, Lsub(FIR)/Lsub(B), with 100 μm/60 μm colour, in the sense that the more luminous infrared galaxies are warmer. This behaviour can be modelled as a mixture of a normal 'disc' component and a starburst component. There is no significant difference in the distribution of Lsub(FIR)/Lsub(B) versus 100 μm/60 μm colour for edge-on and face-on spirals, showing that the adopted internal extinction correction is a good approximation. (author)

  3. Planetary transit candidates in Corot-IRa01 field

    Science.gov (United States)

    Carpano, S.; Cabrera, J.; Alonso, R.; Barge, P.; Aigrain, S.; Almenara, J.-M.; Bordé, P.; Bouchy, F.; Carone, L.; Deeg, H. J.; de La Reza, R.; Deleuil, M.; Dvorak, R.; Erikson, A.; Fressin, F.; Fridlund, M.; Gondoin, P.; Guillot, T.; Hatzes, A.; Jorda, L.; Lammer, H.; Léger, A.; Llebaria, A.; Magain, P.; Moutou, C.; Ofir, A.; Ollivier, M.; Janot-Pacheco, E.; Pätzold, M.; Pont, F.; Queloz, D.; Rauer, H.; Régulo, C.; Renner, S.; Rouan, D.; Samuel, B.; Schneider, J.; Wuchterl, G.

    2009-10-01

    Context: CoRoT is a pioneering space mission devoted to the analysis of stellar variability and the photometric detection of extrasolar planets. Aims: We present the list of planetary transit candidates detected in the first field observed by CoRoT, IRa01, the initial run toward the Galactic anticenter, which lasted for 60 days. Methods: We analysed 3898 sources in the coloured bands and 5974 in the monochromatic band. Instrumental noise and stellar variability were taken into account using detrending tools before applying various transit search algorithms. Results: Fifty sources were classified as planetary transit candidates and the most reliable 40 detections were declared targets for follow-up ground-based observations. Two of these targets have so far been confirmed as planets, CoRoT-1b and CoRoT-4b, for which a complete characterization and specific studies were performed. The CoRoT space mission, launched on December 27th 2006, has been developed and is operated by CNES, with contributions from Austria, Belgium, Brazil, ESA, Germany, and Spain. Four French laboratories associated with the CNRS (LESIA, LAM, IAS ,OMP) collaborate with CNES on the satellite development. First CoRoT data are available to the public from the CoRoT archive: http://idoc-corot.ias.u-psud.fr.

  4. Acceptance of alternative forms of family life by students of the Bialskie region [Akceptacja alternatywnych form życia rodzinnego przez studentów powiatu bialskiego

    Directory of Open Access Journals (Sweden)

    Marzena RUSZKOWSKA

    2017-11-01

    Full Text Available The article describes the popularity of alternative forms of family life among young people living in urban and rural settings of the Bialski region. It contains a discussion of the results of a survey conducted at the turn of 2013/2014, and an attempt to answer the question whether and, if so how, informal relationships are an alternative to marriage and family, whether young people are aware of the legal consequences of staying in socalled free relationships, and whether they have an impact on a child if it results from such a relationship.

  5. Conceptual Approach to Forming the Basic Code of Neo-Industrial Development of a Region

    Directory of Open Access Journals (Sweden)

    Elena Leonidovna Andreeva

    2017-09-01

    Full Text Available In the article, the authors propose the conceptual fundamentals of the “code approach” to the regional neo-industrial development. The purpose of the research is to reveal the essence of the transition to a new type of industrial and economic relations through a prism of “genetic codes” of the region. We consider these codes as a system of the “racial memory” of a territory, which determines the specificity and features of neo-industrialization realization. We substantiated the hypothesis about the influence of the “genetic codes” of the region on the effectiveness of the neo-industrialization. We have defined the participants, or else the carriers of the codes in the transformation of regional inheritance for the stimulation of the neoindustrial development of region’s economy. The subject matter of the research is the distinctive features of the functioning of the determinative region’s codes. Their content determines the socio-economic specificity of the region and the features of innovative, informational, value-based and competence-based development of the territory. The determinative codes generate the dynamic codes of the region, which are understood as their derivatives. They have a high probability of occurrence, higher speed of development and distribution, internal forces that make possible the self-development of the region. The scientific contribution is the substantiation of the basic code of the regional neo-industrial development. It represents the evolutionary accumulation of the rapid changes of its innovative, informational, value-based and competence-based codes stimulating the generation and implementation of new ideas regarding to economic entities adapted to the historical and cultural conditions. The article presents the code model of neo-industrial development of the region described by formulas. We applied the system analysis methods, historical and civilization approaches, evolutionary and

  6. On Issue of Algorithm Forming for Assessing Investment Attractiveness of Region Through Its Technospheric Security

    Science.gov (United States)

    Filimonova, L. A.; Skvortsova, N. K.

    2017-11-01

    The article examines the problematic aspects of assessing the investment attractiveness of a region associated with the consideration of methodological issues that require refinement from the point of view of its technospheric security. Such issues include the formation of a sound system of indicators for the assessment of man-made risk which has a particular impact on the level of investment attractiveness of the region. In the context of the instability of the economic situation in Russia, the problem of man-made risks assessing in the context of the regional investment attractiveness based on an integrated approach and taking into account such principles as flexibility, adaptability, innovative orientation has not only lost its relevance but was also transformed into one of the most important conditions for ensuring the effective management of all spheres of the regional activities. The article poses the classical problem of making decisions on the results of the assessment of the investment attractiveness of the region in a matrix format evaluating the utility function. The authors of the article recommended a universal risk assessment model with its subsequent synthesis into technospheric security for the comprehensive assessment of regional investment attractiveness. The principal distinguishing feature of the study results are the schemes for manipulation in the evaluation activity associated with the selection of the optimality criteria groups and models for their study. These iterations make it possible to substantiate the choice of the solution for preserving the technospheric security of the region, a field of compromises or an “ideal” solution to the problem of the regional investment attractiveness loss.

  7. An IRAS-Based Search for New Dusty Late-Type WC Wolf-Rayet Stars

    Science.gov (United States)

    Cohen, Martin

    1995-01-01

    I have examined all Infrared Astronomical Satellite (IRAS) data relevant to the 173 Galactic Wolf-Rayet (W-R) stars in an updated catalog, including the 13 stars newly discovered by Shara and coworkers. Using the W-R coordinates in these lists, I have examined the IRAS Point Source Catalog (PSC), the Faint Source Catalog, and the Faint Source Reject Catalog, and have generated one-dimensional spatial profiles, 'ADDSCANs', and two-dimensional full-resolution images, 'FRESCOS'. The goal was to assemble the best set of observed IRAS color indices for different W-R types, in particular for known dusty late-type WC Wolf-Rayet (WCL) objects. I have also unsuccessfully sought differences in IRAS colors and absolute magnitudes between single and binary W-R stars. The color indices for the entire ensemble of W-R stars define zones in the IRAS color-color ([12] - [25], [25] - [60])-plane. By searching the PSC for otherwise unassociated sources that satisfy these colors, I have identified potential new W-R candidates, perhaps too faint to have been recognized in previous optical searches. I have extracted these candidates' IRAS low-resolution spectrometer (LRS) data and compared the spectra with the highly characteristic LRS shape for known dusty WCL stars. The 13 surviving candidates must now be ex amined by optical spectroscopy. This work represents a much more rigorous and exhaustive version of the LRS study that identified IRAS 17380 - 3031 (WR98a) as the first new W-R (WC9) star discovered by IPAS. This search should have detected dusty WCL stars to a distance of 7.0 kpc from the Sun, for l is greater than 30 degrees, and to 2.9 kpc even in the innermost galaxy. For free-free-dominated W-R stars the corresponding distances are 2.5 and 1.0 kpc, respectively.

  8. The Topology of Large-Scale Structure in the 1.2 Jy IRAS Redshift Survey

    Science.gov (United States)

    Protogeros, Zacharias A. M.; Weinberg, David H.

    1997-11-01

    We measure the topology (genus) of isodensity contour surfaces in volume-limited subsets of the 1.2 Jy IRAS redshift survey, for smoothing scales λ = 4, 7, and 12 h-1 Mpc. At 12 h-1 Mpc, the observed genus curve has a symmetric form similar to that predicted for a Gaussian random field. At the shorter smoothing lengths, the observed genus curve shows a modest shift in the direction of an isolated cluster or ``meatball'' topology. We use mock catalogs drawn from cosmological N-body simulations to investigate the systematic biases that affect topology measurements in samples of this size and to determine the full covariance matrix of the expected random errors. We incorporate the error correlations into our evaluations of theoretical models, obtaining both frequentist assessments of absolute goodness of fit and Bayesian assessments of models' relative likelihoods. We compare the observed topology of the 1.2 Jy survey to the predictions of dynamically evolved, unbiased, gravitational instability models that have Gaussian initial conditions. The model with an n = -1 power-law initial power spectrum achieves the best overall agreement with the data, though models with a low-density cold dark matter power spectrum and an n = 0 power-law spectrum are also consistent. The observed topology is inconsistent with an initially Gaussian model that has n = -2, and it is strongly inconsistent with a Voronoi foam model, which has a non-Gaussian, bubble topology.

  9. Lower solar chromosphere-corona transition region. II - Wave pressure effects for a specific form of the heating function

    Science.gov (United States)

    Woods, D. Tod; Holzer, Thomas E.; Macgregor, Keith B.

    1990-01-01

    Lower transition region models with a balance between mechanical heating and radiative losses are expanded to include wave pressure effects. The models are used to study the simple damping length form of the heating function. The results are compared to the results obtained by Woods et al. (1990) for solutions in the lower transition region. The results suggest that a mixture of fast-mode and slow-mode waves may provide the appropriate heating mechanism in the lower transition region, with the decline in effective vertical wave speed caused by the refraction and eventual total reflection of the fast-mode wave resulting from the decreasing atmospheric density.

  10. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization.

    Science.gov (United States)

    Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João

    2013-04-11

    Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

  11. Delineating Partnerships from other Forms of Collaboration in Regional Development Planning

    DEFF Research Database (Denmark)

    Larsen, Peter Wilgaard

    2017-01-01

    The idea of an all-encompassing partnership has vindicated all sorts of collaboration models to be articulated as partnerships although not occurring as ones, leaving practitioners and politicians of regional development planning with suboptimal ways of collaborating. Reviewing the partnership...... of regional planning and development, this paper defines a partnership to be a promise of a promise denoting other collaborative models such as network, cluster and governance-partnership as a promise only. Based on qualitative interviews, discursive analyses and strategic documents, the comparative case...... analysis of two Danish regional development agencies shows how one remained as a governance-partnership while the other turned into a partnership by continuously creating possibilities for the groups of actors involved. This transformation from a promise only into a promise of a promise displays how...

  12. Investigation on the geographical distribution and life form of plant species in sub alpine zone Karsanak region, Shahrekord

    Directory of Open Access Journals (Sweden)

    Jahanbakhsh Pairanj

    2011-09-01

    Full Text Available This study was carried out in rangelands of Karsanak, Chaharmahal and Bakhtiari province, which is regarded as one of the rich rangelands. Phytogeographically, this region is located in Irano-Turanian (zone of sub alpine. Endemic and rare plants were identified and geographical distribution and life form of identified plant species were investigated as well. Overall, 100 species from 17 families were identified from which 20 percent of identified species was endemic element of Irano-Turanian region. Results indicated that 75.7 percent of identified plants belonged to the Irano-Turanian and only 3 and 2 percent belonged to Euro-Siberian and Mediterranean regions respectively. The reason of high percentage of Irano-Turanian elements is probably the long distance of this region from other regions. Similarities of Irano-Turanian and Mediterranean were included 6.1 percent of identified plants and Irano-Turanian and Euro-Siberian included 2 percent. Results of life forms showed hemichryptophytes including 60 percent of life forms which indicate the cold and mountainous weather.

  13. Changes to urban form and commuting patterns: trends in two Danish city regions

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    2015-01-01

    This paper compares indicators of polycentricity in a monocentric (MUR) and a polycentric urban region (PUR) in Denmark at two points in time (1982 and 2002). It describes how population, jobs and commuting indicators of polycentricity develop and interact over time. Both the MUR and the PUR tend...

  14. Innovative Forms of Regional Structural Policy in Europe: the Role of Dominant Concepts and Knowledge Flows

    NARCIS (Netherlands)

    Lagendijk, A.

    1999-01-01

    The last decade has witnessed a revival of regional structural policy in the Western world. The new style of policy-making which has emerged differs markedly from the top-down distributional models that dominated the post-war period, but is also more pro-active than the hands-off approach of the

  15. The peculiar acceleration of the Local Group as deduced from the optical and IRAS flux dipoles

    International Nuclear Information System (INIS)

    Lahav, O.; Lynden-Bell, D.

    1988-01-01

    The relation between the peculiar acceleration of the Local Group and the surface brightness dipole moments of all-sky optical and IRAS samples is studied. Our revised optical dipole lies within 7 0 of the direction of the Local Group's motion through the Microwave Background Radiation (MBR). The directions of the optical, IRAS and MBR dipoles are all consistent with each other. To analyse the optical dipole we have calculated diameter functions for the UGC and ESO galaxy catalogues from redshift surveys. Most of the optical dipole arises from the Centaurus-Virgo direction and from the 'Local Void' on the opposite side of the sky. The sources of the IRAS dipole are more evenly distributed around the sky. A simple 'shell model', fitted to the variation of the dipoles as a function of flux, suggests that the dipoles arise from galaxies whose recession velocities are smaller than 4000 kms -1 . We find a high Ω 0 value for the IRAS sample and a low one for the optical sample. These results may be reconciled if the optical galaxy distribution is more biased relative to the matter distribution than the IRAS galaxy distribution. (author)

  16. Distribution of various forms of Cd, Pb and Cu in the Wadge Bank region (Arabian Sea)

    Digital Repository Service at National Institute of Oceanography (India)

    George, M.D.

    Labile, nonlabile and particulate forms of Cd,Pb and Cu were determined in 29 water samples collected from a depth of 5 m, from the Wadge Bank area. Labile Cd varied from 0.1 to 0.2 mu g.l-1 while nonlabile fraction was in the range 0.1 to 0.3 mu gl...

  17. SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexíco, Unidad Académica en Ensenada, Km 103 Carr. Tijuana-Ensenada, 22860 Ensenada BC (Mexico); Lada, Elizabeth A., E-mail: jybarra@astro.unam.mx [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States)

    2014-10-20

    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H{sub 2} and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H{sub 2} emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster.

  18. SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G.; Lada, Elizabeth A.

    2014-01-01

    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H 2 and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H 2 emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster

  19. Does the Functional Form of the Association Between Education and Mortality Differ by U.S. Region?

    Science.gov (United States)

    Sheehan, Connor; Montez, Jennifer Karas; Sasson, Isaac

    2018-01-01

    To understand the education-mortality association among U.S. adults, recent studies have documented its national functional form. However, the functional form of education-mortality relationship may vary across geographic contexts. The four U.S. Census regions differ considerably in their social and economic policies, employment opportunities, income levels, and other factors that may affect how education lowers the risk of mortality. Thus, we documented regional differences in the functional form of the education-mortality association and examined the role of employment and income in accounting for regional differences. We used data on non-Hispanic white adults (2,981,672, person years) aged 45-84 in the 2000-2009 National Health Interview Survey, with Linked Mortality File through 2011 (37,598 deaths) and estimated discrete-time hazard models. The functional form of education and adult mortality was best characterized by credentialism in the Midwest, Northeast, and for Western men. For Western women, the association was linear, consistent with the human capital model. In the South, we observed a combination of mechanisms, with mortality risk declining with each year of schooling and a step change with high school graduation, followed by steeper decline thereafter. Our work adds to the increasing body of research that stresses the importance of contexts in shaping the education-mortality relationship.

  20. Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated for global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.

  1. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  2. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

    2014-01-01

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  3. «Goroda-bliznecy»: novaja forma prigranichnogo sotrudnichestva v Baltijskom regione? [Twin cities: a new form of cross-border cooperation in the Baltic Sea Region?

    Directory of Open Access Journals (Sweden)

    Anishenko Anatoly

    2012-01-01

    Full Text Available The paper demonstrates the first attempt in Russian political studies to conduct a comprehensive analysis of the “twin city” movement as a form of cross-border cooperation in the Baltic region. This phenomenon emerged as a result of a global tendency towards more active involvement of municipal units in international cooperation, on the one hand, and aspirations of frontier cities and towns in the Baltic region to solve common problems together, on the other hand. This work is based on a comparative analysis method and a case study methodology. The authors consider four examples (city pairs: Tornio — Haparanda, Valga — Valka, Narva — Ivangorod and Imatra — Svetogorsk. The article specifies the terminological framework used in this field of research. The authors analyse achievements and failures of this type of international inter-municipal cooperation and emphasise that for twin cities it served not only as a means of survival in the difficult situation of the 1990s, but also as an experimental ground for new forms of crossborder cooperation. The authors arrive at the conclusion that this model proves to be promising for further development of integration processes in the Baltic region. This practice can be applied by Russian municipal, regional and federal authorities in promotion of cross-border cooperation not only in the Baltic region, but also in other regions of the country. Thus, influenced by the successful experience of Baltic frontier cities and towns, the Russian city of Nikel and the Norwegian city of Kirkenes decided to adopt this model for further development of their cooperation.

  4. Study of diffuse H II regions potentially forming part of the gas streams around Sgr A*

    Science.gov (United States)

    Armijos-Abendaño, J.; López, E.; Martín-Pintado, J.; Báez-Rubio, A.; Aravena, M.; Requena-Torres, M. A.; Martín, S.; Llerena, M.; Aldás, F.; Logan, C.; Rodríguez-Franco, A.

    2018-05-01

    We present a study of diffuse extended ionized gas towards three clouds located in the Galactic Centre (GC). One line of sight (LOS) is towards the 20 km s-1 cloud (LOS-0.11) in the Sgr A region, another LOS is towards the 50 km s-1 cloud (LOS-0.02), also in Sgr A, while the third is towards the Sgr B2 cloud (LOS+0.693). The emission from the ionized gas is detected from Hnα and Hmβ radio recombination lines (RRLs). Henα and Hemβ RRL emission is detected with the same n and m as those from the hydrogen RRLs only towards LOS+0.693. RRLs probe gas with positive and negative velocities towards the two Sgr A sources. The Hmβ to Hnα ratios reveal that the ionized gas is emitted under local thermodynamic equilibrium conditions in these regions. We find a He to H mass fraction of 0.29±0.01 consistent with the typical GC value, supporting the idea that massive stars have increased the He abundance compared to its primordial value. Physical properties are derived for the studied sources. We propose that the negative velocity component of both Sgr A sources is part of gas streams considered previously to model the GC cloud kinematics. Associated massive stars with what are presumably the closest H II regions to LOS-0.11 (positive velocity gas), LOS-0.02, and LOS+0.693 could be the main sources of ultraviolet photons ionizing the gas. The negative velocity components of both Sgr A sources might be ionized by the same massive stars, but only if they are in the same gas stream.

  5. Dynamic positional fate map of the primary heart-forming region.

    Science.gov (United States)

    Cui, Cheng; Cheuvront, Tracey J; Lansford, Rusty D; Moreno-Rodriguez, Ricardo A; Schultheiss, Thomas M; Rongish, Brenda J

    2009-08-15

    Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate mapping data regarding the primary heart-forming field(s). We determined the positional fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a "continuous" circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH Stages 5-7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate - i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to "migration" (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals.

  6. TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions

    OpenAIRE

    Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

  7. Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

    International Nuclear Information System (INIS)

    Kim, Kyungsik

    2011-01-01

    We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

  8. The ALMA Protostellar Interferometric Line Survey (PILS). First results from an unbiased submillimeter wavelength line survey of the Class 0 protostellar binary IRAS 16293-2422 with ALMA

    Science.gov (United States)

    Jørgensen, J. K.; van der Wiel, M. H. D.; Coutens, A.; Lykke, J. M.; Müller, H. S. P.; van Dishoeck, E. F.; Calcutt, H.; Bjerkeli, P.; Bourke, T. L.; Drozdovskaya, M. N.; Favre, C.; Fayolle, E. C.; Garrod, R. T.; Jacobsen, S. K.; Öberg, K. I.; Persson, M. V.; Wampfler, S. F.

    2016-11-01

    Context. The inner regions of the envelopes surrounding young protostars are characterized by a complex chemistry, with prebiotic molecules present on the scales where protoplanetary disks eventually may form. The Atacama Large Millimeter/submillimeter Array (ALMA) provides an unprecedented view of these regions zooming in on solar system scales of nearby protostars and mapping the emission from rare species. Aims: The goal is to introduce a systematic survey, the Protostellar Interferometric Line Survey (PILS), of the chemical complexity of one of the nearby astrochemical templates, the Class 0 protostellar binary IRAS 16293-2422, using ALMA in order to understand the origin of the complex molecules formed in its vicinity. In addition to presenting the overall survey, the analysis in this paper focuses on new results for the prebiotic molecule glycolaldehyde, its isomers, and rarer isotopologues and other related molecules. Methods: An unbiased spectral survey of IRAS 16293-2422 covering the full frequency range from 329 to 363 GHz (0.8 mm) has been obtained with ALMA, in addition to a few targeted observations at 3.0 and 1.3 mm. The data consist of full maps of the protostellar binary system with an angular resolution of 0.5'' (60 AU diameter), a spectral resolution of 0.2 km s-1, and a sensitivity of 4-5 mJy beam-1 km s-1, which is approximately two orders of magnitude better than any previous studies. Results: More than 10 000 features are detected toward one component in the protostellar binary, corresponding to an average line density of approximately one line per 3 km s-1. Glycolaldehyde; its isomers, methyl formate and acetic acid; and its reduced alcohol, ethylene glycol, are clearly detected and their emission well-modeled with an excitation temperature of 300 K. For ethylene glycol both lowest state conformers, aGg' and gGg', are detected, the latter for the first time in the interstellar medium (ISM). The abundance of glycolaldehyde is comparable to or

  9. Digitisation Project Planning in the Maribor City Library as a Form of Regional Cross Institutional Cooperation

    Directory of Open Access Journals (Sweden)

    Nina Hriberšek Vuk

    2013-09-01

    Full Text Available EXTENDED ABSTRACT:More and more Slovenian public libraries have been facing the question of selection criteria for digitisation of library materials as well as the issue of financial resources, copyright permission and the promotion of digitised materials. Libraries having long tradition of collecting valuable local history resources are more convinced about the selection criteria. Digitisation is, in spite of being expensive, time consuming and labour intensive, an easy method to enable quick access to library materials, to promote and preserve library collections. The mission of the central regional public library (cofinanced by the Ministry of Culture is not only to coordinate the collection, cataloguing and storage of local history resources but also to coordinate local history digital projects. Due to historical circumstances, the local history resources were first collected by the Maribor University Library. It is only in the recent past that the Maribor City Library has started to systematically collect these materials. Due to this fact, the Maribor City Library does not hold an extensive collection of rare and valuable local history items. It was initially faced with the problem of selection criteria for digitisation. However, it soon succeeded to establish the strategy to promote the local history collections in the region, regardless of their location. Thus the library started to cooperate with different regional institutions and the first partner projects were designed. In the year 2007 the library collaborated with the elementary school at Lovrenc na Pohorju and decided to digitise research papers of ex-pupils of the school. The first part of the project was accomplished in 2007 when 72 research papers were digitised, in the next two years their number was increased as the second part of the project was concluded. The papers were published on the KAMRA portal and the project was promoted at the summer annual meeting at Lovrenc na

  10. Characterization of Nitride Layers Formed by Nitrogen Ion Implantation into Surface Region of Iron

    International Nuclear Information System (INIS)

    Sudjatmoko; Subki, M. Iyos R.

    2000-01-01

    Ion implantation is a convenient means of modifying the physical and chemical properties of the near-surface region of materials. The nitrogen implantation into pure iron has been performed at room temperature with ion dose of 1.310 17 to 1.310 18 ions/cm 2 and ion energy of 20 to 100 keV. The optimum dose of nitrogen ions implanted into pure iron was around 2.2310 17 ions/cm 2 in order to get the maximum wear resistant. SEM micrographs and EDX show that the nitride layers were found on the surface of substrate. The nitrogen concentration profile was measured using EDX in combination with spot technique, and it can be shown that the depth profile of nitrogen implanted into substrate was nearly Gaussian. (author)

  11. The pion-nucleon form factor in space- and time-like regions

    International Nuclear Information System (INIS)

    Speth, J.; Tegen, R.

    1990-01-01

    We investigate the pion-nucleon vertex function in space- and time-like regions; these vertex functions appear as internal vertices in nucleon-antinucleon annihilations into n pions (n=2, 3, ..., 6). It is emphasised that only relativistic quark models can account for these vertices where one of the baryons/antibaryons is far off-shell with total energy close to zero. Using a novel 4-momentum projection technique we obtain results which generalize the usual (Breit frame) calculation of G πNN (k 2 ) (space-like) thereby removing completely the discrepancy in the Goldberger-Treiman relation. Our relativistic quark model calculation also explains the empirical suppression of antibaryonic contributions to the vertex functions Gsub(πNanti B) and Gsub(πBanti N) which enter in processes like Nanti N→ππ. (orig.)

  12. The infrared emission of carbonaceous particles around C-rich IRAS sources

    International Nuclear Information System (INIS)

    Blanco, A.; Borghesi, A.; Fonti, S.; Orofino, V.; Strafella, F.

    1997-01-01

    The IRAS spectra of 23 carbon-rich sources have been fitted by means of an improved theoretical model based on the Leung-Spagna radiative transfer code and using extinction data obtained in their laboratory for different types of amorphous carbon and silicon carbide submicron particles. The agreement between observations and theoretical spectra is rather good. A comparison between the IRAS spectrum of the object 12447 + 0425 (RU Vir) and that recently obtained at UKIRT, for the same object but with higher resolution, seems to open new problems

  13. Observations of 40-70 micron bands of ice in IRAS 09371 + 1212 and other stars

    Science.gov (United States)

    Omont, A.; Forveille, T.; Moseley, S. H.; Glaccum, W. J.; Harvey, P. M.; Likkel, L.; Loewenstein, R. F.; Lisse, C. M.

    1990-01-01

    IRAS 09371 + 1212 is still an absolutely unique object. This M giant star, with circumstellar CO and a spectacular bipolar nebula, displays unique IRAS FIR colors which had been attributed to strong emission in the 40-70-micron bands of ice, as subsequently supported by the observation of a strong 3.1-micron absorption band. The results of the KAO observations have confirmed its unusual nature: the far-infrared bands of ice are by far the strongest known. Its dust temperature, 50 K or less, is by far the lowest known for a late-type circumstellar envelope.

  14. IRAS observations of the ISM in the gamma CAS reflection nebula

    Science.gov (United States)

    Buss, Richard H., Jr.; Werner, Michael W.

    1990-01-01

    Mid-infrared emission from other galaxies originates both from interstellar grains heated by diffuse starlight and local excitation of grains by hot OB stars. Thus, a detailed examination of the Infrared Astronomy Satellite (IRAS) data from a B star interacting with the interstellar medium (ISM) could provide insight into infrared (IR) emission processes in external galaxies. Researchers have therefore used IRAS data to study the B0 IVe star gamma Cas and its surroundings, which they find to exhibit evidence of grain heating, destruction, and possible star formation.

  15. BRDF measurements of sunshield and baffle materials for the IRAS telescope

    Science.gov (United States)

    Smith, S. M.

    1982-01-01

    Measurements of the far-infrared bidirectional reflectance distribution functions (BRDF) of four samples of Martin Black coating and one sample of gold coated aluminum from the telescope to be flown on the Infrared Astronomy Satellite (IRAS) are presented. At incidence angles near 35 deg Martin Black is a diffuse reflector at wavelengths as long as 36 microns. The gold coated aluminum sample from the IRAS sunshield has a visible grain which causes a strong diffraction enhancement of the BRDF at large nonspecular angles. This enhancement from the sunshield will increase the stray light level inside the telescope.

  16. The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region

    Science.gov (United States)

    Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia

    2016-04-01

    The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by

  17. COMPETITION AS A FORM OF ORGANIZING CULTURAL ACTIVITIES OF THE KRASNOYARSK REGION POPULATION IN THE 1960-1980S

    Directory of Open Access Journals (Sweden)

    Ekaterina Ivanovna Lobyneva

    2014-08-01

    Full Text Available In the article the author deals with the socialist completion as demonstration of huge enthusiasm and creative initiative of the Krasnoyarsk region population in the 1960s. There were more than twenty shock Komsomol construction sites, which became an effective form of youth participating in the economy development.The aim of the work is to find out in what way socialist completion influences on developing different personal features, like abilities, knowledge, erudition, skills, experience, needs, call of duty, responsibility, etc.The methods of historical approach and objectivism are used in the article.The results of work are to considerate problems concerning with organization of the socialist competition in the Krasnoyarsk region. New materials and some documents of local archives are introduced during the research.The study of the socialist competition in the Krasnoyarsk region enables to make a conclusion that the socialist competition is a form of organizing cultural activities of the Krasnoyarsk region population in the 1960s.

  18. On the origin of phosphorus nitride in star-forming regions

    Science.gov (United States)

    Mininni, C.; Fontani, F.; Rivilla, V. M.; Beltrán, M. T.; Caselli, P.; Vasyunin, A.

    2018-05-01

    We present multitransition observations of phosphorus nitride (PN) towards a sample of nine massive dense cores in different evolutionary stages. Using transitions with different excitation conditions, we have found for the first time that the excitation temperatures of PN are in the range ˜5-30 K. To investigate the main chemical route for the PN formation (surface-chemistry versus gas-phase chemistry), and the dominant desorption mechanism (thermal versus shock), we have compared our results with those obtained from molecules tracing different chemical and physical conditions (SiO, SO, CH3OH, and N2H+). We have found that the PN line profiles are very well correlated with those of SiO and SO in six out of the nine targets, which indicate that PN may be released by sputtering of dust grains due to shocks. This finding is corroborated by a faint but statistically significant positive trend between the PN abundance and those of SiO and SO. However, in three objects the PN lines have no hints of high-velocity wings, which indicates an alternative origin of PN. Overall, our results indicate that the origin of PN is not unique, as it can be formed not only in protostellar shocks, but also in colder and more quiescent gas through alternative pathways.

  19. THE EFFECTS OF EPISODIC STAR FORMATION ON THE FUV-NUV COLORS OF STAR FORMING REGIONS IN OUTER DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Dowell, Jayce D., E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: jdowell@unm.edu [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States)

    2013-09-20

    We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersion in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling chemical

  20. New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region

    Science.gov (United States)

    van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.

    2018-02-01

    Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

  1. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    Energy Technology Data Exchange (ETDEWEB)

    Juárez, Carmen; Girart, Josep M. [Institut de Ciències de l’Espai, (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193 Cerdanyola del Vallès, Catalonia (Spain); Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090, Morelia, Michoacán (Mexico); Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei, 10617, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping, E-mail: juarez@ice.cat [School of Astronomy and Space Science, Nanjing University, 163 Xianlin Avenue, Nanjing 210023 (China)

    2017-07-20

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  2. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    International Nuclear Information System (INIS)

    Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier; Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab; Zhang, Qizhou; Qiu, Keping

    2017-01-01

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s −1 , converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  3. 26 CFR 1.408(q)-1 - Deemed IRAs in qualified employer plans.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.408(q)-1... restrictions that a trustee, custodian, or insurance company is permitted to impose on distributions from... accounts of any of the deemed IRAs is invested in life insurance contracts, regardless of whether the...

  4. IRAS surface brightness maps of visible reflection nebulae: evidence for non-equilibrium infrared emission

    International Nuclear Information System (INIS)

    Castelaz, M.W.; Werner, M.W.; Sellgren, K.

    1986-01-01

    Surface brightness maps at 12, 25, 60, and 100 microns of 16 visible reflection nebulae were extracted from the Infrared Astronomy Satellite (IRAS) database. The maps were produced by coadding IRAS survey scans over areas centered on the illuminating stars, and have spatial resolutions of 0.9' x 4' at 12 and 25 microns, 1.8' x 4.5' at 60 microns, and 3.6' x 5' at 100 microns. Extended emission in the four IRAS bandpasses was detected in fourteen of the reflection nebulae. The IRAS data were used to measure the flux of the infrared emission associated with each source. The energy distributions show that the 12 micron flux is greater than the 25 micron flux in 11 of the nebulae, and the peak flux occurs in the 60 or 100 micron bandpass in all 16 nebular. The 60 and 100 micron flux can be approximated by blackbodies with temperatures between 30 and 50 K, consistent with temperatures expected from extrapolation of greybody fits to the 60 and 100 micron data. The excess 12 and 25 micron emission is attributed to a nonequilibrium process such as emission from thermal fluctuations of very small grains excited by single ultraviolet photons, or emission from polycyclic aromatic hydrocarbons (PAHs) excited by ultraviolet radiation. The common features of the energy distributions of the 16 reflection nebulae, also seen in the reflection nebulae associated with the Pleiades, suggest that PAHs or very small grains may be found in most reflection nebulae

  5. IRAS 06562-0337, The Ironclad Nebula: A New Young Star Cluster

    International Nuclear Information System (INIS)

    Alves, D.R.; Hoard, D.W.; Rodgers, B.

    1998-01-01

    IRAS 06562-0337 has been the recent subject of a classic debate: is it a proto endash planetary nebula or a young stellar object? We present the first 2 μm image of IRAS 06562-0337, which reveals an extended diffuse nebula containing approximately 70 stars inside a 30 double-prime radius around a bright, possibly resolved, central object. The derived stellar luminosity function is consistent with that expected from a single coeval population, and the brightness of the nebulosity is consistent with the predicted flux of unresolved low-mass stars. The stars and nebulosity are spatially coincident with strong CO line emission. We therefore identify IRAS 06562-0337 as a new young star cluster embedded in its placental molecular cloud. The central object is likely a Herbig Be star, M ∼ 20 M circle-dot , which may be seen in reflection. We present medium-resolution high signal-to-noise ratio 1997 epoch optical spectra of the central object. Comparison with previously published spectra shows new evidence for time-variable permitted and forbidden line emission, including Si ii, Fe ii, [Fe ii], and [O i]. We suggest that the origin is a dynamic stellar wind in the extended stratified atmosphere of the massive central star in IRAS 06562-0337. copyright copyright 1998. The American Astronomical Society

  6. Chemistry of Carbon Rich Star IRAS 15194–5115 A. Ali

    Indian Academy of Sciences (India)

    We have constructed two gas-phase models to study the chem- ... 1. Introduction. IRAS 15194–5115 is the third brightest carbon star at 12 µm and the brightest one ..... The main formation routes of CN, HCN and HNC in the inner part are.

  7. A practical approach to the classification of IRAS sources using infrared colors alone

    International Nuclear Information System (INIS)

    Walker, H.J.; Volk, K.; Wainscoat, R.J.; Schwartz, D.E.; Cohen, M.

    1989-01-01

    Zones of the IRAS color-color planes in which a variety of different types of known source occur, have been defined for the purpose of obtaining representative IRAS colors for them. There is considerable overlap between many of these zones, rendering a unique classification difficult on the basis of IRAS colors alone, although galactic latitude can resolve ambiguities between galactic and extragalactic populations. The color dependence of these zones on the presence of spectral emission/absorption features and on the spatial extent of the sources has been investigated. It is found that silicate emission features do not significantly influence the IRAS colors. Planetary nebulae may show a dependence of color on the presence of atomic or molecular features in emission, although the dominant cause of this effect may be the underlying red continua of nebulae with strong atomic lines. Only small shifts are detected in the colors of individual spatially extended sources when total flux measurements are substituted for point-source measurements. 36 refs

  8. Detection of glycolaldehyde toward the solar-type protostar NGC 1333 IRAS2A

    DEFF Research Database (Denmark)

    Coutens, Audrey; Persson, M. V.; Jørgensen, J. K.

    2015-01-01

    Glycolaldehyde is a key molecule in the formation of biologically relevant molecules such as ribose. We report its detection with the Plateau de Bure interferometer toward the Class 0 young stellar object NGC 1333 IRAS2A, which is only the second solar-type protostar for which this prebiotic mole...

  9. Changes of MMP-1 and collagen type Ialpha1 by UVA, UVB and IRA are differentially regulated by Trx-1.

    Science.gov (United States)

    Buechner, Nicole; Schroeder, Peter; Jakob, Sascha; Kunze, Kerstin; Maresch, Tanja; Calles, Christian; Krutmann, Jean; Haendeler, Judith

    2008-07-01

    Exposure of human skin to solar radiation, which includes ultraviolet (UV) radiation (UVA and UVB) visible light and infrared radiation, induces skin aging. The effects of light have been attributed to irradiation-induced reactive oxygen species (ROS) formation, but the specific signaling pathways are not well understood. Detrimental effects of solar radiation are dermal diseases and photoaging. Exposure of cultured human dermal fibroblasts to UVA, UVB or IRA increased ROS formation in vitro. One important redox regulator is the oxidoreductase thioredoxin-1 (Trx). Trx is ubiquitously expressed and has anti-oxidative and anti-apoptotic properties. Besides its function to reduce H(2)O(2), Trx binds to and regulates transcription factors. The aim of this study was to investigate whether Trx influences the regulation of MMP-1 and collagen Ialpha1 by UVA, UVB and IRA. We irradiated human dermal fibroblasts with UVA, UVB and IRA. UVA, UVB and IRA upregulated MMP-1 expression. Trx inhibited UVA-induced MMP-1 upregulation in a NFkappaB dependent manner. UVA, UVB and IRA reduced collagen Ialpha1 expression. Incubation with Trx inhibited the effects of UVB and IRA on collagen Ialpha1 expression. In conclusion, MMP-1 and collagen Ialpha1, which play important roles in aging processes, seems to be regulated by different transcriptional mechanisms and Trx can only influence distinct signaling pathways induced by UVA, UVB and probably IRA. Thus, Trx may serve as an important contributor to an "anti-aging therapeutic cocktail".

  10. Infall and outflow motions towards a sample of massive star-forming regions from the RMS survey

    Science.gov (United States)

    Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.

    2018-06-01

    We present the results of an outflow and infall survey towards a distance-limited sample of 31 massive star-forming regions drawn from the Red MSX source (RMS) survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum-driven, `fossil' outflows. SiO emission is detected towards approximately 46 per cent of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows, respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22 μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.

  11. NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

    2009-01-01

    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  12. Análisis factorial confirmatorio del inventario multicultural de la expresión de la ira y hostilidad

    Directory of Open Access Journals (Sweden)

    Manolete S. Moscoso

    2016-12-01

    Full Text Available El propósito principal del presente estudio fue verificar la estructura factorial de las dos escalas que componen el Inventario Multicultural de la Expresión de la Ira y Hostilidad desde una perspectiva confirmatoria. Se utilizó el Análisis Factorial Confirmatorio en una muestra de 264 participantes provenientes de una universidad privada de Lima, Perú. El muestreo fue no probabilístico e incluyó estudiantes (25%, personal docente (17.8% y personal administrativo (57.2%. La confiabilidad del instrumento fue evaluada mediante los modelos congenérico, tau-equivalente y paralelo para cada una de las seis subescalas del instrumento, así como también calculada en base al coeficiente alfa de Cronbach con intervalos de confianza. Resultados: El análisis factorial realizado en la presente muestra peruana identificó cuatro dimensiones para la Escala de la Ira (ira manifiesta, ira contenida, control de la ira manifiesta y control de la ira contenida y dos factores para la Escala de la Hostilidad (reacción impulsiva a la ira; y temperamento, lo cual replica sustancialmente los resultados de estudios previos realizados en América Latina con muestras hispanoparlantes. El modelo congenérico nos indica un ajuste adecuado para cada una de las subescalas de la ira y hostilidad. En base a los resultados del Análisis Factorial Confirmatorio realizado en el presente estudio, la estructura factorial de ambas escalas del Inventario Multicultural de la Ira y Hostilidad es robusta y demuestra sustancial evidencia empírica de validez de construcción y consistencia interna del instrumento.

  13. FAR-INFRARED OBSERVATIONS OF THE VERY LOW LUMINOSITY EMBEDDED SOURCE L1521F-IRS IN THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Terebey, Susan; Fich, Michel; Noriega-Crespo, Alberto; Padgett, Deborah L.; Brooke, Tim; Carey, Sean; McCabe, Caer-Eve; Rebull, Luisa; Fukagawa, Misato; Audard, Marc; Evans, Neal J.; Guedel, Manuel; Hines, Dean; Huard, Tracy; Knapp, Gillian R.; Menard, Francois; Monin, Jean-Louis

    2009-01-01

    We investigate the environment of the very low luminosity object L1521F-IRS using data from the Taurus Spitzer Legacy Survey. The MIPS 160 μm image shows both extended emission from the Taurus cloud and emission from multiple cold cores over a 1 0 x 2 0 region. Analysis shows that the cloud dust temperature is 14.2 ± 0.4 K and the extinction ratio is A 160 /A K = 0.010 ± 0.001 up to A V ∼ 4 mag. We find κ 160 = 0.23 ± 0.046 cm 2 g -1 for the specific opacity of the gas-dust mixture. Therefore, for dust in the Taurus cloud we find that the 160 μm opacity is significantly higher than that measured for the diffuse interstellar medium, but not too different from dense cores, even at modest extinction values. Furthermore, the 160 μm image shows features that do not appear in the IRAS 100 μm image. We identify six regions as cold cores, i.e., colder than 14.2 K, all of which have counterparts in extinction maps or C 18 O maps. Three of the six cores contain embedded young stellar objects, which demonstrates the cores are sites of current star formation. We compare the effects of L1521F-IRS on its natal core and find there is no evidence for dust heating at 160 or 100 μm by the embedded source. From the infrared luminosity L TIR = 0.024 L sun we find L bol-int =0.034-0.046 L odot , thus confirming the source's low luminosity. Comparison of L1521F-IRS with theoretical simulations for the very early phases of star formation appears to rule out the first core collapse phase. The evolutionary state appears similar to or younger than the class 0 phase, and the estimated mass is likely to be substellar.

  14. Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: katsuta@hep01.hepl.hiroshima-u.ac.jp [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)

    2017-04-20

    We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.

  15. High resolution radio observations of nuclear and circumnuclear regions of luminous infrared galaxies (LIRGs)

    Energy Technology Data Exchange (ETDEWEB)

    Alberdi, A; Perez-Torres, M A [Instituto de Astrofisica de Andalucia (IAA, CSIC), PO Box 3004, 18080-Granada (Spain); Colina, L [Instituto de Estructura de la Materia - IEM, CSIC, C, Serrano 115, 28005 Madrid (Spain); Torrelles, J M [Instituto de Ciencias del Espacio (ICE, CSIC) and IEEC, Gran Capita 2-4, 08034 Barcelona (Spain)], E-mail: antxon@iaa.es, E-mail: torres@iaa.es, E-mail: colina@damir.iem.csic.es, E-mail: torrelle@ieec.fcr.es

    2008-10-15

    High-resolution radio observations of the nuclear region of Luminous and Ultraluminous Infrared Galaxies (ULIRGs) have shown that its radio structure consists of a compact high surface-brightness central radio source immersed in a diffuse low brightness circumnuclear halo. While the central component could be associated with an AGN or compact star-forming regions where radio supernovae are exploding, it is well known that the circumnuclear regions host bursts of star-formation. The studies of radio supernovae can provide essential information about stellar evolution and CSM/ISM properties in regions hidden by dust at optical and IR wavelengths. In this contribution, we show results from radio interferometric observations from NGC 7469, IRAS 18293-3413 and IRAS 17138-1017 where three extremely bright radio supernovae have been found. High-resolution radio observations of these and other LIRGs would allow us to determine the core-collapse supernova rate in them as well as their star-formation rate.

  16. Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA

    Science.gov (United States)

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa

    2018-03-01

    We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

  17. Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

    International Nuclear Information System (INIS)

    Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

    2015-01-01

    Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

  18. Análisis de la ira en pacientes con cardiopatía isquémica de la ciudad de Medellín (Colombia

    Directory of Open Access Journals (Sweden)

    Andrea Ochoa Ochoa

    2010-01-01

    Full Text Available Este estudio tuvo como objetivo comparar los niveles de ira, y sus componentes, entre un grupo de personas con Cardiopatía Isquémica y un grupo control sin esta enfermedad. Participaron 90 pacientes con cardiopatía isquémica de la Clínica Cardiovascular en Medellín y 78 controles sin la enfermedad. A cada uno de los participantes de les administró la prueba del STAXI- 2. Los resultados muestran que, comparado con los controles, los pacientes con cardiopatía isquémica tuvieron niveles significativamente más altos de ira como rasgo (p < 0.01, específicamente en la subescala reacción de ira (p < 0.05, y expresión interna de ira (p < 0.05. Los pacientes con cardiopatía isquémica experimentan más frecuentemente sentimientos de ira (ira rasgo, aparentemente debido a que son más sensibles a las críticas de los demás (reacción de ira, pero tienden a suprimir la expresión de esta emoción (expresión de ira interna. Estos datos confirman la necesidad de implementar programas dirigidos al manejo adecuado de la ira en estos pacientes y entender mejor las implicaciones que pueda tener la ira en la progresión de su enfermedad.

  19. Insights into the working mechanism of water filtered infrared A (wIRA) irradiation on Chlamydia trachomatis serovar E

    Science.gov (United States)

    Kuratli, Jasmin; Pesch, Theresa; Marti, Hanna; Blenn, Christian; Borel, Nicole

    2018-02-01

    Infections with Chlamydia trachomatis are the major cause for infectious blindness and still represent the most common bacterial sexually transmitted disease worldwide. Considering the possible side effects of antibiotic therapy and the increasing threat of antibiotic resistance, alternative therapeutic strategies are needed. Previous studies showed a reduction of C. trachomatis infectivity after irradiation with water filtered infrared A alone (wIRA) or in combination with visible light (wIRA/VIS). In this study, we aimed to gain further insight into the working mechanism of wIRA/VIS by analyzing cytokine and chemokine levels of infected and non-infected HeLa cells following triple dose irradiation at 24, 36 and 40 hours post infection. Subsequently, we examined the influence of cytokines on irradiation and chlamydial infection using a cytokine/chemokine inhibitor (Azelastine) and by IL-6 and IL-8 gene silencing. A triple dose irradiation significantly reduced chlamydial infectivity in HeLa cells without inducing the chlamydial stress response. The reducing effect was present regardless of the addition of cycloheximide (CHX), a host protein synthesis inhibitor. Chlamydial infection, wIRA/VIS treatment and the combination of both revealed a similar release pattern of a subset of pro-inflammatory cytokines (IL-6, IL-8, RANTES, Serpin E1). The addition of Azelastine induced the chlamydial stress response in non-irradiated samples. This effect was even more pronounced in wIRA/VIS-treated conditions. Silencing of IL-6 and IL-8 resulted in a lower chlamydial infectivity. However, wIRA/VIS treatment of infected and silenced cells reduced the chlamydial infectivity similar to wIRA/VIS treated control cells. Further studies are needed to elucidate the working mechanism of wIRA/VIS.

  20. Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

    International Nuclear Information System (INIS)

    Kobushkin, A.P.; Syamtomov, A.I.

    1994-01-01

    Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

  1. Age gradients in the stellar populations of massive star forming regions based on a new stellar chronometer

    Energy Technology Data Exchange (ETDEWEB)

    Getman, Konstantin V.; Feigelson, Eric D.; Kuhn, Michael A.; Broos, Patrick S.; Townsley, Leisa K.; Luhman, Kevin L. [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Naylor, Tim [School of Physics and Astronomy, University of Exeter, Stocker Road, Exeter, EX4 4QL (United Kingdom); Povich, Matthew S. [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Avenue, Pomona, CA 91768 (United States); Garmire, Gordon P. [Huntingdon Institute for X-ray Astronomy, LLC, 10677 Franks Road, Huntingdon, PA 16652 (United States)

    2014-06-01

    A major impediment to understanding star formation in massive star-forming regions (MSFRs) is the absence of a reliable stellar chronometer to unravel their complex star formation histories. We present a new estimation of stellar ages using a new method that employs near-infrared (NIR) and X-ray photometry, Age {sub JX} . Stellar masses are derived from X-ray luminosities using the L{sub X} -M relation from the Taurus cloud. J-band luminosities are compared to mass-dependent pre-main-sequence (PMS) evolutionary models to estimate ages. Age {sub JX} is sensitive to a wide range of evolutionary stages, from disk-bearing stars embedded in a cloud to widely dispersed older PMS stars. The Massive Young Star-Forming Complex Study in Infrared and X-ray (MYStIX) project characterizes 20 OB-dominated MSFRs using X-ray, mid-infrared, and NIR catalogs. The Age {sub JX} method has been applied to 5525 out of 31,784 MYStIX Probable Complex Members. We provide a homogeneous set of median ages for over 100 subclusters in 15 MSFRs; median subcluster ages range between 0.5 Myr and 5 Myr. The important science result is the discovery of age gradients across MYStIX regions. The wide MSFR age distribution appears as spatially segregated structures with different ages. The Age {sub JX} ages are youngest in obscured locations in molecular clouds, intermediate in revealed stellar clusters, and oldest in distributed populations. The NIR color index J – H, a surrogate measure of extinction, can serve as an approximate age predictor for young embedded clusters.

  2. 76 FR 37194 - Proposed Collection; Comment Request for Form 1099-R.

    Science.gov (United States)

    2011-06-24

    ... 1099-R. AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... Form 1099-R, Distributions From Pensions, Annuities, Retirement or Profit-Sharing Plans, IRAs..., Insurance Contracts, etc. OMB Number: 1545-0119. Form Number: 1099-R. Abstract: Form 1099-R is used to...

  3. ESTUDIO DESCRIPTIVO CORRELACIONAL ENTRE IRA Y PERSONALIDAD A LA LUZ DE LA TEORÍA DE HANS EYSENCK

    Directory of Open Access Journals (Sweden)

    Clemencia Montaña de Barragán

    2002-07-01

    Full Text Available Este trabajo presenta una cuidadosa revisión teórica sobre el tema de la ira, su evaluación e intervención, relacionada muy directamente con la agresividad y teorías importantes de la personalidad, enfocándose principalmente a la teoría de H. Eysenck. Se aplicaron dos instrumentos, uno para medir ira (escala MAG de Ira y otro para medir dimensiones de personalidad Extroversión – Neuroticismo – Psicoticismo (EPQ-J, a 200 niños de ambos sexos, con edades comprendidas entre 9 y 11 años, en tres colegios de Santafé de Bogotá. Se realizó una aplicación piloto y validación por jueces para la Escala MAG de ira con el objetivo de verificar su efectividad, mostrando unos buenos resultados mediante una consistencia interna de 0.8236. Al relacionar esta dos pruebas se encontró que hay niveles muy significativos de correlación entre personalidad e ira, a la vez que hay buenas intercorrelaciones entre las dimensiones del EPQ-J. Se encontraron correlaciones significativas entre ira y conducta antisocial. El aporte del trabajo es la presentación de la escala MAG para aplicarla en población infantil.

  4. Estudio descriptivo correlacional entre ira y personalidad, a la luz de la teoría de Hans Eysenck

    Directory of Open Access Journals (Sweden)

    Clemencia Montaña de Barragán

    2002-01-01

    Full Text Available Este trabajo presenta una cuidadosa revisión teórica sobre el tema de la ira, su evaluación e intervención, relacionada muy directamente con la agresividad y teorías importantes de la personalidad, enfocándose principalmente a la teoría de H. Eysenck. Se aplicaron dos instrumentos, uno para medir ira (escala MAG de Ira y otro para medir dimensiones de personalidad Extroversión – Neuroticismo – Psicoticismo (EPQ-J, a 200 niños de ambos sexos, con edades comprendidas entre 9 y 11 años, en tres colegios de Santafé de Bogotá. Se realizó una aplicación piloto y validación por jueces para la Escala MAG de ira con el objetivo de verificar su efectividad, mostrando unos buenos resultados mediante una consistencia interna de 0.8236. Al relacionar esta dos pruebas se encontró que hay niveles muy significativos de correlación entre personalidad e ira, a la vez que hay buenas intercorrelaciones entre las dimensiones del EPQ-J. Se encontraron correlaciones significativas entre ira y conducta antisocial. El aporte del trabajo es la presentación de la escala MAG para aplicarla en población infantil

  5. Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

    CERN Multimedia

    2002-01-01

    The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

  6. Modelling the impact of urban form on household energy demand and related CO2 emissions in the Greater Dublin Region

    International Nuclear Information System (INIS)

    Liu Xiaochen; Sweeney, John

    2012-01-01

    This study aims to investigate the relationship between household space heating energy use and urban form (land use characteristics) for the Greater Dublin Region. The geographical distributions of household energy use are evaluated at the Enumeration Districts (ED) level based on the building thermal balance model. Moreover, it estimates the impact of possible factors on the household space heating consumption. Results illustrate that the distribution profile of dwellings is a significant factor related to overall heating energy demand and individual dwelling energy consumption for space heating. Residents living in compact dwellings with small floor areas consume less energy for space heating than residents living in dwellings with big floor areas. Moreover, domestic heating energy demand per household was also estimated for two extreme urban development scenarios: the compact city scenario and the dispersed scenario. The results illustrate that the compact city scenario is likely to decrease the domestic heating energy consumption per household by 16.2% compared with the dispersed city scenario. Correspondingly, the energy-related CO 2 emissions could be significantly decreased by compact city scenario compared with the dispersed city scenario. - Highlights: ► A method was developed to investigate urban form impacts on energy demand. ► This study estimates impacts of possible factors on the household energy consumption. ► Household heating energy demand is sensitive to dwelling distribution profile. ► The compact case could reduce domestic energy demand compared with the dispersed case.

  7. A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

    International Nuclear Information System (INIS)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez; De Castro, Elisa; Cornide, Manuel

    2015-01-01

    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions

  8. A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)

    2015-02-01

    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

  9. Percolation Analysis of a Wiener Reconstruction of the IRAS 1.2 Jy Redshift Catalog

    Science.gov (United States)

    Yess, Capp; Shandarin, Sergei F.; Fisher, Karl B.

    1997-01-01

    We present percolation analyses of Wiener reconstructions of the IRAS 1.2 Jy redshift survey. There are 10 reconstructions of galaxy density fields in real space spanning the range β = 0.1-1.0, where β = Ω0.6/b, Ω is the present dimensionless density, and b is the bias factor. Our method uses the growth of the largest cluster statistic to characterize the topology of a density field, where Gaussian randomized versions of the reconstructions are used as standards for analysis. For the reconstruction volume of radius R ~ 100 h-1 Mpc, percolation analysis reveals a slight ``meatball'' topology for the real space, galaxy distribution of the IRAS survey.

  10. Circumstellar envelopes seen in radio (OH masers) and in the infrared observations (IRAS)

    International Nuclear Information System (INIS)

    David, Pedro-Correia-de-Matos

    1992-01-01

    Intermediate mass stars, namely from one to nine solar masses, eject mass into the surrounding interstellar medium at high rates (up to 1/10000 solar masses per year) in their late stages of evolution on the so called asymptotic giant branch (AGB). Indeed, the presence of a circumstellar envelope (CSE) composed of dust and gas is one of the principal features of the objects on the AGB. Because of the high opacity at visible wavelength of the CSE, most of these objects can only be observed at infrared and radio frequencies. This study was undertaken using infrared and radio data from a large sample of CSE sources. The infrared data was obtained from the infrared astronomical satellite (IRAS) data base. For a selection of IRAS objects, radio observations were made of the OH maser at 1612 and 1667 MHz at the Nancay radio telescope, France. This work consists in two parts, one is theoretical in nature, the other observational. The theoretical part is concerned with the modeling of IRAS low resolution spectra (LRS catalog) and IRAS photometry through the use of a radiative transfer code. Confrontation between models and data has yielded such results as a better definition of the grain optical properties and the behavior of the CSE as it evolves. A model of a shock wave (a possible lifting engine of the CSE) propagating in the atmosphere of Mira stars (AGB) is described. On the observational side, a large number of objects has been surveyed for the presence of OH masers at 1612 and 1667 MHz. A statistical analysis has established more clearly the evolutionary status of CSE and the OH maser characteristics. A compiling of detection rates for the occurrence of masers, average location of these masing CSEs in the Galaxy, and OH maser characteristics is reported for use in future work. (author) [fr

  11. Galaxy evolution and large-scale structure in the far-infrared. I. IRAS pointed observations

    International Nuclear Information System (INIS)

    Lonsdale, C.J.; Hacking, P.B.

    1989-01-01

    Redshifts for 66 galaxies were obtained from a sample of 93 60-micron sources detected serendipitously in 22 IRAS deep pointed observations, covering a total area of 18.4 sq deg. The flux density limit of this survey is 150 mJy, 4 times fainter than the IRAS Point Source Catalog (PSC). The luminosity function is similar in shape with those previously published for samples selected from the PSC, with a median redshift of 0.048 for the fainter sample, but shifted to higher space densities. There is evidence that some of the excess number counts in the deeper sample can be explained in terms of a large-scale density enhancement beyond the Pavo-Indus supercluster. In addition, the faintest counts in the new sample confirm the result of Hacking et al. (1989) that faint IRAS 60-micron source counts lie significantly in excess of an extrapolation of the PSC counts assuming no luminosity or density evolution. 81 refs

  12. Expresión de la ira y autoconcepto en adolescentes tempranos

    Directory of Open Access Journals (Sweden)

    Yuri Arsenio Sanz-Martínez

    2012-01-01

    Full Text Available Abordó la exploración de las implicaciones de las modalidades de expresión de la ira entre adolescentes tempranos de la zona oriental de Cuba. La muestra estuvo compuesta por 498 adolescentes tempranos de Holguín y Santiago de Cuba respectivamente. Se obtuvo que la expresión abierta, y destructiva de la ira correlacionó negativamente con el autoconcepto en dominios de la escuela y las relaciones con el sexo opuesto. La expresión inhibida o interiorizada de esta emoción predijo fuertemente aspectos del autoconcepto relacionados con el dominio de la escuela. La ira expresada de forma controlada, calmada y asertiva se relacionó fuertemente con el autoconcepto en dimensiones generales, del ámbito escolar, de las relaciones interpersonales y de cualidades de honestidad y seguridad. Se recomienda realizar estudios paralelos para obtener información en otras etapas del desarrollo humano.

  13. ANOMALOUSLY STEEP REDDENING LAW IN QUASARS: AN EXCEPTIONAL EXAMPLE OBSERVED IN IRAS 14026+4341

    International Nuclear Information System (INIS)

    Jiang Peng; Zhou Hongyan; Ji Tuo; Shu Xinwen; Liu Wenjuan; Dong Xiaobo; Wang Huiyuan; Wang Tinggui; Wang Jianguo; Bai Jinming

    2013-01-01

    A fraction of the heavily reddened quasars require a reddening curve that is even steeper than that of the Small Magellanic Cloud. In this paper, we thoroughly characterize the anomalously steep reddening law in quasars via an exceptional example observed in IRAS 14026+4341. By comparing the observed spectrum to the quasar composite spectrum, we derive a reddening curve in the rest-frame wavelength range of 1200-10000 Å. It has a steep rise at wavelengths shorter than 3000 Å, but no significant reddening at longer wavelengths. The absence of dust reddening in the optical continuum is confirmed by the normal broad-line Balmer decrement (the Hα/Hβ ratio) in IRAS 14026+4341. The anomalous reddening curve can be satisfactorily reproduced with a dust model containing silicate grains in a power-law size distribution, dn(a)/da∝a –1.4 , truncated at a maximum size of a max = 70 nm. The unusual size distribution may be caused by the destruction of large 'stardust' grains by quasar activities or a different dust formation mechanism (i.e., the in situ formation of dust grains in quasar outflows). It is also possible that the analogies of the dust grains observed near the Galactic center are responsible for the steep reddening curve. In addition, we find that IRAS 14026+4341 is a weak emission-line quasar (i.e., PHL 1811 analogies) with heavy dust reddening and blueshifted broad absorption lines.

  14. A catalog of pre-main-sequence emission-line stars with IRAS source associations

    International Nuclear Information System (INIS)

    Weintraub, D.A.

    1990-01-01

    To aid in finding premain-sequence (PMS) emission-line stars that might have dusty circumstellar environments, 361 PMS stars that are associated with 304 separate IRAS sources were identified. These stars include 200 classical T Tauri stars, 25 weak-lined (naked) T Tauri stars, 56 Herbig Ae/Be stars, six FU Orionis stars, and two SU Aurigae stars. All six of the FU Orionis stars surveyed by IRAS were detected. Of the PMS-IRAS Point Source Catalog (PSC) associations, 90 are new and are not noted in the PSC. The other 271 entries include 104 that are correctly identified in the PSC but have not yet appeared in the literature, 56 more that can be found in both the PSC and in the published and unpublished iterature, and 111 that are in the literature but not in the PSC. Spectral slope diagrams constructed from the 12-, 25-, and 60-micron flux densities reveal unique distributions for the different PMS subclasses; these diagrams may help identify the best candidate PMS stars for observations of circumstellar dust. 30 refs

  15. CSO BOLOCAM 1.1 mm CONTINUUM MAPPING OF THE BRAID NEBULA STAR FORMATION REGION IN CYGNUS OB7

    International Nuclear Information System (INIS)

    Aspin, Colin; Beck, Tracy L.; Davis, Chris J.

    2011-01-01

    We present a 1.1 mm map of the Braid Nebula star formation region in Cygnus OB7 taken using Bolocam on the Caltech Submillimeter Observatory. Within the 1 deg 2 covered by the map, we have detected 55 cold dust clumps all of which are new detections. A number of these clumps are coincident with IRAS point sources although the majority are not. Some of the previously studied optical/near-IR sources are detected at 1.1 mm. We estimate total dust/gas masses for the 55 clumps together with peak visual extinctions. We conclude that over the whole region, approximately 20% of the clumps are associated with IRAS sources suggesting that these are protostellar objects. The remaining 80% are classed as starless clumps. In addition, both FU Orionis (FUor) like objects in the field, the Braid Star and HH 381 IRS, are associated with strong millimeter emission. This implies that FUor eruptions can occur at very early stages of pre-main-sequence life. Finally, we determine that the cumulative clump mass function for the region is very similar to that found in both the Perseus and ρ Ophiuchus star-forming regions.

  16. The ALMA-PILS survey: 3D modeling of the envelope, disks and dust filament of IRAS 16293-2422

    Science.gov (United States)

    Jacobsen, S. K.; Jørgensen, J. K.; van der Wiel, M. H. D.; Calcutt, H.; Bourke, T. L.; Brinch, C.; Coutens, A.; Drozdovskaya, M. N.; Kristensen, L. E.; Müller, H. S. P.; Wampfler, S. F.

    2018-04-01

    Context. The Class 0 protostellar binary IRAS 16293-2422 is an interesting target for (sub)millimeter observations due to, both, the rich chemistry toward the two main components of the binary and its complex morphology. Its proximity to Earth allows the study of its physical and chemical structure on solar system scales using high angular resolution observations. Such data reveal a complex morphology that cannot be accounted for in traditional, spherical 1D models of the envelope. Aims: The purpose of this paper is to study the environment of the two components of the binary through 3D radiative transfer modeling and to compare with data from the Atacama Large Millimeter/submillimeter Array. Such comparisons can be used to constrain the protoplanetary disk structures, the luminosities of the two components of the binary and the chemistry of simple species. Methods: We present 13CO, C17O and C18O J = 3-2 observations from the ALMA Protostellar Interferometric Line Survey (PILS), together with a qualitative study of the dust and gas density distribution of IRAS 16293-2422. A 3D dust and gas model including disks and a dust filament between the two protostars is constructed which qualitatively reproduces the dust continuum and gas line emission. Results: Radiative transfer modeling in our sampled parameter space suggests that, while the disk around source A could not be constrained, the disk around source B has to be vertically extended. This puffed-up structure can be obtained with both a protoplanetary disk model with an unexpectedly high scale-height and with the density solution from an infalling, rotating collapse. Combined constraints on our 3D model, from observed dust continuum and CO isotopologue emission between the sources, corroborate that source A should be at least six times more luminous than source B. We also demonstrate that the volume of high-temperature regions where complex organic molecules arise is sensitive to whether or not the total

  17. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Martínez-Delgado, David [Max Planck Institut fur Astronomie, D-69117 Heidelberg (Germany); D' Onghia, Elena [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States); Zibetti, Stefano [INAF-Osservatorio Astrofisico di Arcetri, I-50125 Firenze (Italy); Gabany, R. Jay [Black Bird II Observatory, Alder Springs, CA 93602 (United States); Blanton, Michael, E-mail: rbeaton@virginia.edu [Department of Physics, New York University, New York, NY 10003 (United States)

    2014-08-01

    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10{sup 8} M{sub ☉}, which implies a 1:50 merger ratio, has a circular radius, R{sub circ} ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10{sup 10} M{sub ☉}. Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M{sub ☉} yr{sup –1}). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  18. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    International Nuclear Information System (INIS)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne; Martínez-Delgado, David; D'Onghia, Elena; Zibetti, Stefano; Gabany, R. Jay; Blanton, Michael

    2014-01-01

    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10 8 M ☉ , which implies a 1:50 merger ratio, has a circular radius, R circ ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10 10 M ☉ . Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M ☉ yr –1 ). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  19. TADPOL: A 1.3 mm SURVEY OF DUST POLARIZATION IN STAR-FORMING CORES AND REGIONS

    International Nuclear Information System (INIS)

    Hull, Charles L. H.; Plambeck, Richard L.; Bower, Geoffrey C.; Heiles, Carl; Kwon, Woojin; Carpenter, John M.; Lamb, James W.; Pillai, Thushara; Crutcher, Richard M.; Hakobian, Nicholas S.; Looney, Leslie W.; Fiege, Jason D.; Franzmann, Erica; Houde, Martin; Hughes, A. Meredith; Marrone, Daniel P.; Matthews, Brenda C.; Pound, Marc W.; Rahman, Nurur; Sandell, Göran

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ∼2.''5 resolution TADPOL maps with ∼20'' resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusions in a statistical sense from the ensemble of sources, bearing in mind that these average orientations can be quite uncertain. We discuss three main findings. (1) A subset of the sources have consistent magnetic field (B-field) orientations between large (∼20'') and small (∼2.''5) scales. Those same sources also tend to have higher fractional polarizations than the sources with inconsistent large-to-small-scale fields. We interpret this to mean that in at least some cases B-fields play a role in regulating the infall of material all the way down to the ∼1000 AU scales of protostellar envelopes. (2) Outflows appear to be randomly aligned with B-fields; although, in sources with low polarization fractions there is a hint that outflows are preferentially perpendicular to small-scale B-fields, which suggests that in these sources the fields have been wrapped up by envelope rotation. (3) Finally, even at ∼2.''5 resolution we see the so-called polarization hole effect, where the fractional polarization drops significantly near the total intensity peak. All data are publicly available in the electronic edition of this article

  20. DECONVOLUTION OF IMAGES FROM BLAST 2005: INSIGHT INTO THE K3-50 AND IC 5146 STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Roy, Arabindo; Netterfield, Calvin B.; Ade, Peter A. R.; Griffin, Matthew; Hargrave, Peter C.; Mauskopf, Philip; Bock, James J.; Brunt, Christopher M.; Chapin, Edward L.; Gibb, Andrew G.; Halpern, Mark; Marsden, Gaelen; Devlin, Mark J.; Dicker, Simon R.; Klein, Jeff; France, Kevin; Gundersen, Joshua O.; Hughes, David H.; Martin, Peter G.; Olmi, Luca

    2011-01-01

    We present an implementation of the iterative flux-conserving Lucy-Richardson (L-R) deconvolution method of image restoration for maps produced by the Balloon-borne Large Aperture Submillimeter Telescope (BLAST). Compared to the direct Fourier transform method of deconvolution, the L-R operation restores images with better-controlled background noise and increases source detectability. Intermediate iterated images are useful for studying extended diffuse structures, while the later iterations truly enhance point sources to near the designed diffraction limit of the telescope. The L-R method of deconvolution is efficient in resolving compact sources in crowded regions while simultaneously conserving their respective flux densities. We have analyzed its performance and convergence extensively through simulations and cross-correlations of the deconvolved images with available high-resolution maps. We present new science results from two BLAST surveys, in the Galactic regions K3-50 and IC 5146, further demonstrating the benefits of performing this deconvolution. We have resolved three clumps within a radius of 4.'5 inside the star-forming molecular cloud containing K3-50. Combining the well-resolved dust emission map with available multi-wavelength data, we have constrained the spectral energy distributions (SEDs) of five clumps to obtain masses (M), bolometric luminosities (L), and dust temperatures (T). The L-M diagram has been used as a diagnostic tool to estimate the evolutionary stages of the clumps. There are close relationships between dust continuum emission and both 21 cm radio continuum and 12 CO molecular line emission. The restored extended large-scale structures in the Northern Streamer of IC 5146 have a strong spatial correlation with both SCUBA and high-resolution extinction images. A dust temperature of 12 K has been obtained for the central filament. We report physical properties of ten compact sources, including six associated protostars, by fitting

  1. AN EXTREME HIGH-VELOCITY BIPOLAR OUTFLOW IN THE PRE-PLANETARY NEBULA IRAS 08005-2356

    Energy Technology Data Exchange (ETDEWEB)

    Sahai, R. [Jet Propulsion Laboratory, California Institute of Technology, MS 183-900, Pasadena, CA 91109 (United States); Patel, N. A., E-mail: raghvendra.sahai@jpl.nasa.gov [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States)

    2015-09-01

    We report interferometric mapping of the bipolar pre-planetary nebula IRAS 08005-2356 (I 08005) with an angular resolution of ∼1″–5″, using the Submillimeter Array, in the {sup 12}CO J = 2–1, 3–2, {sup 13}CO J = 2–1, and SiO J = 5–4 (v = 0) lines. Single-dish observations, using the SMT 10 m, were made in these lines as well as in the CO J = 4–3 and SiO J = 6–5 (v = 0) lines. The line profiles are very broad, showing the presence of a massive (>0.1 M{sub ⊙}), extreme high velocity outflow (V ∼ 200 km s{sup −1}) directed along the nebular symmetry axis derived from the Hubble Space Telescope imaging of this object. The outflow's scalar momentum far exceeds that available from radiation pressure of the central post-AGB star, and it may be launched from an accretion disk around a main-sequence companion. We provide indirect evidence for such a disk from its previously published, broad Hα emission profile, which we propose results from Lyβ emission generated in the disk followed by Raman-scattering in the innermost regions of a fast, neutral wind.

  2. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Esplin, T. L.; Luhman, K. L., E-mail: taran.esplin@psu.edu [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States)

    2017-10-01

    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K{sub s}, which should have masses as low as ∼4–5 M {sub Jup} according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M{sub Jup}).

  3. A SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION WITH THE SLOAN DIGITAL SKY SURVEY

    International Nuclear Information System (INIS)

    Luhman, K. L.; Mamajek, E. E.; Shukla, S. J.; Loutrel, N. P.

    2017-01-01

    Previous studies have found that ∼1 deg 2 fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg 2 ) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  4. The Tarantula Nebula as a template for extragalactic star forming regions from VLT/MUSE and HST/STIS

    Science.gov (United States)

    Crowther, Paul A.; Caballero-Nieves, Saida M.; Castro, Norberto; Evans, Christopher J.

    2017-11-01

    We present VLT/MUSE observations of NGC 2070, the dominant ionizing nebula of 30 Doradus in the LMC, plus HST/STIS spectroscopy of its central star cluster R136. Integral Field Spectroscopy (MUSE) and pseudo IFS (STIS) together provides a complete census of all massive stars within the central 30×30 parsec2 of the Tarantula. We discuss the integrated far-UV spectrum of R136, of particular interest for UV studies of young extragalactic star clusters. Strong He iiλ1640 emission at very early ages (1-2 Myr) from very massive stars cannot be reproduced by current population synthesis models, even those incorporating binary evolution and very massive stars. A nebular analysis of the integrated MUSE dataset implies an age of ~4.5 Myr for NGC 2070. Wolf-Rayet features provide alternative age diagnostics, with the primary contribution to the integrated Wolf-Rayet bumps arising from R140 rather than the more numerous H-rich WN stars in R136. Caution should be used when interpreting spatially extended observations of extragalactic star-forming regions.

  5. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ming [Los Alamos National Laboratory; Letiner, Thomas K [Los Alamos National Laboratory; Korber, Bette T [Los Alamos National Laboratory; Foley, Brian [Los Alamos National Laboratory

    2009-01-01

    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, result from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.

  6. A structural model of the pore-forming region of the skeletal muscle ryanodine receptor (RyR1.

    Directory of Open Access Journals (Sweden)

    Srinivas Ramachandran

    2009-04-01

    Full Text Available Ryanodine receptors (RyRs are ion channels that regulate muscle contraction by releasing calcium ions from intracellular stores into the cytoplasm. Mutations in skeletal muscle RyR (RyR1 give rise to congenital diseases such as central core disease. The absence of high-resolution structures of RyR1 has limited our understanding of channel function and disease mechanisms at the molecular level. Here, we report a structural model of the pore-forming region of RyR1. Molecular dynamics simulations show high ion binding to putative pore residues D4899, E4900, D4938, and D4945, which are experimentally known to be critical for channel conductance and selectivity. We also observe preferential localization of Ca(2+ over K(+ in the selectivity filter of RyR1. Simulations of RyR1-D4899Q mutant show a loss of preference to Ca(2+ in the selectivity filter as seen experimentally. Electrophysiological experiments on a central core disease mutant, RyR1-G4898R, show constitutively open channels that conduct K(+ but not Ca(2+. Our simulations with G4898R likewise show a decrease in the preference of Ca(2+ over K(+ in the selectivity filter. Together, the computational and experimental results shed light on ion conductance and selectivity of RyR1 at an atomistic level.

  7. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    International Nuclear Information System (INIS)

    Esplin, T. L.; Luhman, K. L.

    2017-01-01

    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K s , which should have masses as low as ∼4–5 M Jup according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M Jup ).

  8. A SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION WITH THE SLOAN DIGITAL SKY SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Mamajek, E. E. [Department of Physics and Astronomy, The University of Rochester, Rochester, NY 14627 (United States); Shukla, S. J. [Institute of Astronomy, Madingley Road, Cambridge CB3 0HA (United Kingdom); Loutrel, N. P., E-mail: kluhman@astro.psu.edu [eXtreme Gravity Institute, Department of Physics, Montana State University, Bozeman, MT 59715 (United States)

    2017-01-01

    Previous studies have found that ∼1 deg{sup 2} fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg{sup 2}) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  9. Community-led local development approach principles implementation when forming a regional local development projects support system in Ukraine

    Directory of Open Access Journals (Sweden)

    Y. G. Udod

    2017-03-01

    Full Text Available The article contains a brief description of the Community-led local development approach (local development under the leadership of the community, CLLD and the main purpose of its use in the European Union. The study indicated periods of the major initiatives to support local development in EU. Moreover the article posted CLLD approach principles’ evolution and the basic principles of the LEADER method and its application in CLLD, which can be applied in Ukraine. Subject to the provisions of the European Economic and Social Committee (EESC for further CLLD-approach distribution the five trends were identified that must be considered when forming a Regional local development projects support system in Ukraine: Multi-fund financing; Unification; Networking and collaboration; Extending the approach; Simplifying the process. The characteristic of the present phase of CLLD-approach, in particular, of the European Network for Rural Development (ENRD, which attaches great importance to the dissemination of the most effective CLLD practices and establish partnerships between communities and territories where the approach is implemented. The study found out the relationship between Community-led local development and Community-driven development (CDD supported by the World Bank.

  10. TOWARD UNDERSTANDING THE B[e] PHENOMENON. III. PROPERTIES OF THE OPTICAL COUNTERPART OF IRAS 00470+6429

    International Nuclear Information System (INIS)

    Miroshnichenko, A. S.; Chentsov, E. L.; Klochkova, V. G.; Zharikov, S. V.; Grankin, K. N.; Kusakin, A. V.; Gandet, T. L.; Klingenberg, G.; Kildahl, S.; Rudy, R. J.; Lynch, D. K.; Venturini, C. C.; Mazuk, S.; Puetter, R. C.; Perry, R. B.; Carciofi, A. C.; Bjorkman, K. S.; Gray, R. O.; Bernabei, S.; Polcaro, V. F.

    2009-01-01

    FS CMa type stars are a group of Galactic objects with the B[e] phenomenon. They exhibit strong emission-line spectra and infrared excesses, which are most likely due to recently formed circumstellar dust. The group content and identification criteria were described in the first two papers of the series. In this paper we report our spectroscopic and photometric observations of the optical counterpart of IRAS 00470+6429 obtained in 2003-2008. The optical spectrum is dominated by emission lines, most of which have P Cyg type profiles. We detected significant brightness variations, which may include a regular component, and variable spectral line profiles in both shape and position. The presence of a weak Li I 6708 A line in the spectrum suggests that the object is most likely a binary system with a B2-B3 spectral-type primary companion of a luminosity log L/L sun = 3.9 ± 0.3 and a late-type secondary companion. We estimate a distance toward the object to be 2.0 ± 0.3 kpc from the Sun.

  11. Water in star-forming regions with Herschel (WISH) : IV. A survey of low-J H2O line profiles toward high-mass protostars

    NARCIS (Netherlands)

    van der Tak, F. F. S.; Chavarria, L.; Herpin, F.; Wyrowski, F.; Walmsley, C. M.; van Dishoeck, E. F.; Benz, A. O.; Bergin, E. A.; Caselli, P.; Hogerheijde, M. R.; Johnstone, D.; Kristensen, L. E.; Liseau, R.; Nisini, B.; Tafalla, M.

    Context. Water is a key constituent of star-forming matter, but the origin of its line emission and absorption during high-mass star formation is not well understood. Aims. We study the velocity profiles of low-excitation H2O lines toward 19 high-mass star-forming regions and search for trends with

  12. Photoinactivation Using Visible Light Plus Water-Filtered Infrared-A (vis+wIRA and Chlorine e6 (Ce6 eradicates Planktonic Periodontal Pathogens and Subgingival Biofilms

    Directory of Open Access Journals (Sweden)

    Ali Al-Ahmad

    2016-11-01

    Full Text Available Alternative treatment methods for pathogens and microbial biofilms are required due to the widespread rise in antibiotic resistance. Antimicrobial photodynamic therapy (aPDT has recently gained attention as a novel method to eradicate pathogens. The aim of this study was to evaluate the antimicrobial effects of a novel aPDT method using visible light (vis and water infiltrated infrared A (wIRA in combination with chlorine e6 (Ce6 against different periodontal pathogens in planktonic form and within in situ subgingival oral biofilms. Eight different periodontal pathogens were exposed to aPDT using vis+wIRA and 100 µg/ml Ce6 in planktonic culture. Additionally, pooled subgingival dental biofilm was also treated by aPDT and the number of viable cells determined as colony forming units (CFU. Live/dead staining was used in combination with confocal laser scanning microscopy (CLSM to visualize and quantify antimicrobial effects within the biofilm samples. Untreated negative controls as well as 0.2 % chlorhexidine (CHX-treated positive controls were used. All eight tested periodontal pathogens including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Eikenella corrodens, Actinomyces odontolyticus, Fusobacterium nucleatum, Parvimonas micra, Slackia exigua and Atopopium rimae and the aPDT-treated subgingival biofilm were eliminated over the ranges of 3.43 - 8.34 and 3.91 - 4.28 log10 CFU in the log10 scale, respectively. Thus, aPDT showed bactericidal effects on the representative pathogens as well as on the in situ subgingival biofilm. The live/dead staining also revealed a significant reduction (33.45 % of active cells within the aPDT-treated subgingival biofilm. Taking the favorable tissue healing effects of vis+wIRA into consideration, the significant antimicrobial effects revealed in this study highlight the potential of aPDT using this light source in combination with Ce6 as an adjunctive method to treat periodontitis as well as

  13. VizieR Online Data Catalog: Galactic HII region IRAS 16148-5011 content (Mallick+, 2015)

    Science.gov (United States)

    Mallick, K. K.; Ojha, D. K.; Tamura, M.; Linz, H.; Samal, M. R.; Ghosh, S. K.

    2015-11-01

    NIR photometric observations in J (1.25um), H (1.63um), and Ks (2.14um) bands (centred on RA=16:18:31, DE=-50:17:32 (2000)) were carried out on 2004 July 29 using the 1.4m Infrared Survey Facility (IRSF) telescope, South Africa. The observations were taken with the help of the Simultaneous InfraRed Imager for Unbiased Survey (SIRIUS) instrument, a three colour simultaneous camera mounted at the f/10 Cassegrain focus of the telescope. Radio continuum observations at 1280MHz were obtained on 2012 November 09 using the Giant Metrewave Radio Telescope (GMRT) array. The GMRT array consists of 30 antennas arranged in an approximate Y-shaped configuration, with each antenna having a diameter of 45m. This translates to a primary beam-size of 26.2-arcmin at 1280MHz. (2 data files).

  14. THE MASSIVE STAR-FORMING REGION CYGNUS OB2. II. INTEGRATED STELLAR PROPERTIES AND THE STAR FORMATION HISTORY

    International Nuclear Information System (INIS)

    Wright, N. J.; Drake, J. J.; Drew, J. E.; Vink, J. S.

    2010-01-01

    Cygnus OB2 is the nearest example of a massive star-forming region (SFR), containing over 50 O-type stars and hundreds of B-type stars. We have analyzed the properties of young stars in two fields in Cyg OB2 using the recently published deep catalog of Chandra X-ray point sources with complementary optical and near-IR photometry. Our sample is complete to ∼1 M sun (excluding A- and B-type stars that do not emit X-rays), making this the deepest study of the stellar properties and star formation history in Cyg OB2 to date. From Siess et al. isochrone fits to the near-IR color-magnitude diagram, we derive ages of 3.5 +0.75 -1.0 and 5.25 +1.5 -1.0 Myr for sources in the two fields, both with considerable spreads around the pre-main-sequence isochrones. The presence of a stellar population somewhat older than the present-day O-type stars, also fits in with the low fraction of sources with inner circumstellar disks (as traced by the K-band excess) that we find to be very low, but appropriate for a population of age ∼5 Myr. We also find that the region lacks a population of highly embedded sources that is often observed in young SFRs, suggesting star formation in the vicinity has declined. We measure the stellar mass functions (MFs) in this limit and find a power-law slope of Γ = -1.09 ± 0.13, in good agreement with the global mean value estimated by Kroupa. A steepening of the slope at higher masses is observed and suggested as due to the presence of the previous generation of stars that have lost their most massive members. Finally, combining our MF and an estimate of the radial density profile of the association suggests a total mass of Cyg OB2 of ∼3 x 10 4 M sun , similar to that of many of our Galaxy's most massive SFRs.

  15. WEAK AND COMPACT RADIO EMISSION IN EARLY HIGH-MASS STAR-FORMING REGIONS. I. VLA OBSERVATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Rosero, V.; Hofner, P. [Physics Department, New Mexico Tech, 801 Leroy Pl., Socorro, NM 87801 (United States); Claussen, M. [National Radio Astronomy Observatory, 1003 Lopezville Rd., Socorro, NM 87801 (United States); Kurtz, S.; Carrasco-González, C.; Rodríguez, L. F.; Loinard, L. [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, Morelia 58090, México (Mexico); Cesaroni, R. [INAF, Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125 Firenze (Italy); Araya, E. D. [Physics Department, Western Illinois University, 1 University Circle, Macomb, IL 61455 (United States); Menten, K. M.; Wyrowski, F. [Max-Planck-Institute für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Ellingsen, S. P. [School of Physical Sciences, University of Tasmania, Private Bag 37, Hobart, Tasmania 7001 (Australia)

    2016-12-01

    We present a high-sensitivity radio continuum survey at 6 and 1.3 cm using the Karl G. Jansky Very Large Array toward a sample of 58 high-mass star-forming regions. Our sample was chosen from dust clumps within infrared dark clouds with and without IR sources (CMC–IRs and CMCs, respectively), and hot molecular cores (HMCs), with no previous, or relatively weak radio continuum detection at the 1 mJy level. Due to the improvement in the continuum sensitivity of the Very Large Array, this survey achieved map rms levels of ∼3–10  μ Jy beam{sup −1} at sub-arcsecond angular resolution. We extracted 70 continuum sources associated with 1.2 mm dust clumps. Most sources are weak, compact, and prime candidates for high-mass protostars. Detection rates of radio sources associated with the millimeter dust clumps for CMCs, CMC–IRs, and HMCs are 6%, 53%, and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. The radio sources located within HMCs and CMC–IRs occur close to the dust clump centers, with a median offset from it of 12,000 au and 4000 au, respectively. We calculated 5–25 GHz spectral indices using power-law fits and obtained a median value of 0.5 (i.e., flux increasing with frequency), suggestive of thermal emission from ionized jets. In this paper we describe the sample, observations, and detections. The analysis and discussion will be presented in Paper II.

  16. The Dense Molecular Gas and Nuclear Activity in the ULIRG IRAS 13120–5453

    Energy Technology Data Exchange (ETDEWEB)

    Privon, G. C.; Treister, E. [Instituto de Astrofśica, Facultad de Física, Pontificia Universidad Católica de Chile, Casilla 306, Santiago 22 (Chile); Aalto, S.; Falstad, N.; Muller, S.; Costagliola, F. [Department of Earth and Space Sciences, Chalmers University of Technology, Onsala Space Observatory, SE-439 94 Onsala (Sweden); González-Alfonso, E. [Universidad de Alcalá, Departamento de Física y Matemáticas, Campus Universitario, E-28871 Alcalá de Henares, Madrid (Spain); Sliwa, K. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Armus, L. [Spitzer Science Center, California Institute of Technology, MS 220-6, Pasadena, CA, 91125 (United States); Evans, A. S. [Department of Astronomy, University of Virginia, Charlottesville, VA 22903 (United States); Garcia-Burillo, S. [Observatorio de Madrid, OAN-IGN, Alfonso XII, 3, E-28014-Madrid (Spain); Izumi, T. [Institute of Astronomy, School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Sakamoto, K. [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, 10617, Taipei, Taiwan (China); Werf, P. van der [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Chu, J. K. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

    2017-02-01

    We present new Atacama Large Millimeter/submillimeter Array Band 7 (∼340 GHz) observations of the dense gas tracers HCN, HCO{sup +}, and CS in the local, single-nucleus, ultraluminous infrared galaxy IRAS 13120–5453. We find centrally enhanced HCN (4–3) emission, relative to HCO{sup +} (4–3), but do not find evidence for radiative pumping of HCN. Considering the size of the starburst (0.5 kpc) and the estimated supernovae rate of ∼1.2 yr{sup −1}, the high HCN/HCO{sup +} ratio can be explained by an enhanced HCN abundance as a result of mechanical heating by the supernovae, though the active galactic nucleus and winds may also contribute additional mechanical heating. The starburst size implies a high Σ{sub IR} of 4.7 × 10{sup 12} L {sub ⊙} kpc{sup −2}, slightly below predictions of radiation-pressure limited starbursts. The HCN line profile has low-level wings, which we tentatively interpret as evidence for outflowing dense molecular gas. However, the dense molecular outflow seen in the HCN line wings is unlikely to escape the Galaxy and is destined to return to the nucleus and fuel future star formation. We also present modeling of Herschel observations of the H{sub 2}O lines and find a nuclear dust temperature of ∼40 K. IRAS 13120–5453 has a lower dust temperature and Σ{sub IR} than is inferred for the systems termed “compact obscured nuclei (CONs)” (such as Arp 220 and Mrk 231). If IRAS 13120–5453 has undergone a CON phase, we are likely witnessing it at a time when the feedback has already inflated the nuclear ISM and diluted star formation in the starburst/active galactic nucleus core.

  17. Descoberta de um aglomerado estelar massivo associado a fonte IRAS 16177-5018

    Science.gov (United States)

    Roman Lopes, A.; Abraham, Z.; Lépine, J. R. D.

    2003-08-01

    Neste trabalho apresentamos a descoberta de um aglomerado de estrelas jovens e massivas embebido em uma região HII extensa associado com a fonte IRAS 16177-5018, que se apresenta invisível na faixa óptica do espectro eletromagnético, onde a extinção é da ordem de AV = 26 magnitudes. As observações foram feitas com a camera infravermelha (CamIV) do Laboratório Nacional de Astrofísica, Brasil, equipada com um detector Hawaii de HgCdTe de 1024´1024 pixel acoplada ao telescópio de 60 cm Boller & Chivens do IAG. A fotometria obtida a partir das imagens nas bandas J, H e K (filtro estreito) mostrou a presença de fontes com excesso de emissão no infravermelho em 2.2 mm, concentradas em uma área de aproximadamente um minuto de arco quadrado em torno da nebulosa na qual esta embebido o objeto identificado como a fonte IRAS. A fonte IRAS apresenta um índice espectral (entre 2.2 21.3 mm) a = d log(l Fl) / d log l = 4.78, característico de um objeto extremamente jovem com luminosidade bolométrica (obtida da integral da densidade de fluxo entre o infravermelho próximo (1.25mm) e o infravermelho distante (100mm)) de 2.8´105L¤, o qual corresponde a uma estrela da sequência principal de idade zero de cerca de 42 M¤. A partir do diagrama cor-magnitude foi possível classificar a maioria dos membros do aglomerado como estrelas massivas mais luminosas que tipo espectral B5.

  18. 8- to 13-micron spectrophotometry of Comet IRAS-Araki-Alcock

    Science.gov (United States)

    Feierberg, M. A.; Witteborn, F. C.; Johnson, J. R.; Campins, H.

    1984-01-01

    Spectrophotometry between 8.0 and 13.0 microns at 2 percent spectral resolution is presented for areas in and near the nuclear condensation of Comet IRAS-Araki-Alcock (1983d) on May 11 and 12, 1983. All the spectra can be fit very well by blackbody curves, and no 10-micron silicate emissions are seen. The temperature structure of the coma suggests the presence of small (radii less than 5 microns) dust particles within 150 km of the nucleus and larger ones further out. The change in the spatial distribution of the infrared flux between the two nights suggests that an outburst may have occurred sometime on May 11.

  19. Performance Comparisons of Improved Regular Repeat Accumulate (RA and Irregular Repeat Accumulate (IRA Turbo Decoding

    Directory of Open Access Journals (Sweden)

    Ahmed Abdulkadhim Hamad

    2017-08-01

    Full Text Available In this paper, different techniques are used to improve the turbo decoding of regular repeat accumulate (RA and irregular repeat accumulate (IRA codes. The adaptive scaling of a-posteriori information produced by Soft-output Viterbi decoder (SOVA is proposed. The encoded pilots are another scheme that applied for short length RA codes. This work also suggests a simple and a fast method to generate a random interleaver having a free 4 cycle Tanner graph. Progressive edge growth algorithm (PEG is also studied and simulated to create the Tanner graphs which have a great girth.

  20. Irrationality, barbarism and violence in the Seneca’s De Ira: a political reading

    Directory of Open Access Journals (Sweden)

    Ignacio Pajón Leyra

    2018-03-01

    Full Text Available Seneca’s philosophy dedicates a special attention to passions, regarded as the main obstacle to attaining wisdom, and in particular to anger, considered the most dreadful of them all. Scholars have usually interpreted his treaty On anger (De ira as a private handbook of ethics containing advice about how to become wise. However, this article explores a different approach to the text, placing it in the context of Seneca’s discussion about the virtue of courage. Thus, in Seneca’s thought anger appears as a social issue that affects both political communities and isolated individuals.

  1. Respuesta emocional de ira y alteraciones del lenguaje en pacientes con esquizofrenia

    OpenAIRE

    Herrero Sebastián, Neus

    2015-01-01

    Los pacientes con esquizofrenia presentan alteraciones en el procesamiento emocional especialmente en la expresión, y en el reconocimiento de emociones. Sin embargo, se ha investigado poco cómo experimentan las emociones los pacientes con esquizofrenia y en concreto existe una literatura muy escasa sobre la respuesta cardiovascular, hormonal o de la activación asimétrica cerebral. Por otro lado, la ira es clave en la conducta agresiva, y en el caso de la esquizofrenia parece estar mediada por...

  2. Warm absorber and truncated accretion disc in IRAS 05078+1626

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Jiří; Guainazzi, M.; Karas, Vladimír

    2010-01-01

    Roč. 512, Mar-Apr (2010), A62/1-A62/8 ISSN 0004-6361 R&D Projects: GA ČR GD205/09/H033; GA ČR GA205/07/0052 Grant - others:ESA(XE) ESA- PECS project No. 98040; Univerzita Karlova(CZ) GAUK 33308 Institutional research plan: CEZ:AV0Z10030501 Keywords : galaxies: active * galaxies: Seyfert * galaxies: individual: IRAS 05078+1626 Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010

  3. The identification of IRAS 15194-5115 with a bright extreme carbon star

    International Nuclear Information System (INIS)

    Meadows, P.J.

    1987-01-01

    The authors identify IRAS 15194-5115 with a previously unknown extreme carbon star which is the third brightest carbon star in the sky at 12 μm (1148 Jy). Results of optical and infrared photometry and spectroscopy are presented. The 3.03 μm absorption feature associated with C 2 H 2 and HCN is seen as well as SiC emission at 11.2 μm. A comparison with recent model calculations of other workers indicates that this star is very similar to IRC+10216 and that it lies at a distance of about 1.7 kpc. (author)

  4. Search for OB stars running away from young star clusters. II. The NGC 6357 star-forming region

    Science.gov (United States)

    Gvaramadze, V. V.; Kniazev, A. Y.; Kroupa, P.; Oh, S.

    2011-11-01

    Dynamical few-body encounters in the dense cores of young massive star clusters are responsible for the loss of a significant fraction of their massive stellar content. Some of the escaping (runaway) stars move through the ambient medium supersonically and can be revealed via detection of their bow shocks (visible in the infrared, optical or radio). In this paper, which is the second of a series of papers devoted to the search for OB stars running away from young ( ≲ several Myr) Galactic clusters and OB associations, we present the results of the search for bow shocks around the star-forming region NGC 6357. Using the archival data of the Midcourse Space Experiment (MSX) satellite and the Spitzer Space Telescope, and the preliminary data release of the Wide-Field Infrared Survey Explorer (WISE), we discovered seven bow shocks, whose geometry is consistent with the possibility that they are generated by stars expelled from the young (~1-2 Myr) star clusters, Pismis 24 and AH03 J1725-34.4, associated with NGC 6357. Two of the seven bow shocks are driven by the already known OB stars, HD 319881 and [N78] 34. Follow-up spectroscopy of three other bow-shock-producing stars showed that they are massive (O-type) stars as well, while the 2MASS photometry of the remaining two stars suggests that they could be B0 V stars, provided that both are located at the same distance as NGC 6357. Detection of numerous massive stars ejected from the very young clusters is consistent with the theoretical expectation that star clusters can effectively lose massive stars at the very beginning of their dynamical evolution (long before the second mechanism for production of runaway stars, based on a supernova explosion in a massive tight binary system, begins to operate) and lends strong support to the idea that probably all field OB stars have been dynamically ejected from their birth clusters. A by-product of our search for bow shocks around NGC 6357 is the detection of three circular

  5. THE SCHMIDT-KENNICUTT LAW OF MATCHED-AGE STAR-FORMING REGIONS; Paα OBSERVATIONS OF THE EARLY-PHASE INTERACTING GALAXY TAFFY I

    International Nuclear Information System (INIS)

    Komugi, S.; Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabé, T.; Yoshii, Y.; Takagi, T.; Iono, D.; Kaneko, H.; Ueda, J.; Saitoh, T. R.

    2012-01-01

    In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Paα image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M ☉ yr –1 , was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are ∼7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

  6. Monte Carlo calculations and experimental measurements of dosimetric parameters of the IRA-103Pd brachytherapy source

    International Nuclear Information System (INIS)

    Sadeghi, Mahdi; Raisali, Gholamreza; Hosseini, S. Hamed; Shavar, Arzhang

    2008-01-01

    This article presents a brachytherapy source having 103 Pd adsorbed onto a cylindrical silver rod that has been developed by the Agricultural, Medical, and Industrial Research School for permanent implant applications. Dosimetric characteristics (radial dose function, anisotropy function, and anisotropy factor) of this source were experimentally and theoretically determined in terms of the updated AAPM Task group 43 (TG-43U1) recommendations. Monte Carlo simulations were used to calculate the dose rate constant. Measurements were performed using TLD-GR200A circular chip dosimeters using standard methods employing thermoluminescent dosimeters in a Perspex phantom. Precision machined bores in the phantom located the dosimeters and the source in a reproducible fixed geometry, providing for transverse-axis and angular dose profiles over a range of distances from 0.5 to 5 cm. The Monte Carlo N-particle (MCNP) code, version 4C simulation techniques have been used to evaluate the dose-rate distributions around this model 103 Pd source in water and Perspex phantoms. The Monte Carlo calculated dose rate constant of the IRA- 103 Pd source in water was found to be 0.678 cGy h -1 U -1 with an approximate uncertainty of ±0.1%. The anisotropy function, F(r,θ), and the radial dose function, g(r), of the IRA- 103 Pd source were also measured in a Perspex phantom and calculated in both Perspex and liquid water phantoms

  7. Pathok Negoro mosque as the form of territorial defense region of Mataram Kingdom of Islam Java in Jogjakarta

    Science.gov (United States)

    Setyowati, E.; Hardiman, G.; Murtini, T. W.

    2018-01-01

    Territory is the space boundary of ownership. Defense concepts of an area also include territory. The defense concept of a territory of power or ownership is usually in the form of fortress, ditch, river, road, alley or gate. Many of these are seen in the forms of old city of Dutch’s inheritances. Javanese Islamic Kingdom in Yogyakarta has territory in the form of mosque. The mosque is called the Pathok Negoro as consists of 4 mosques. This territorial not same with another Islamic kingdoms. The research problem is why mosque used as a form of defense? What is the uniqueness?The purpose of the research is to reveal the form of territory of Javanese Islamic Kingdom. The benefit of this research is to get the characteristic form of territory of Javanese Islamic Kingdom in Yogyakarta. Their located in Ploso Kuning, Mlangi, babadan, Dongkelan, and Wonokromo. The research method that was used was qualitative method with grounded research, by using history and map search.In the analysis was carried out identification and comparison between mosques.The results show that there are characteristics on the location, the building orientation, the landscape, the area pattern and the shape of the building.

  8. Extended high circular polarization in the Orion massive star forming region: implications for the origin of homochirality in the solar system.

    Science.gov (United States)

    Fukue, Tsubasa; Tamura, Motohide; Kandori, Ryo; Kusakabe, Nobuhiko; Hough, James H; Bailey, Jeremy; Whittet, Douglas C B; Lucas, Philip W; Nakajima, Yasushi; Hashimoto, Jun

    2010-06-01

    We present a wide-field (approximately 6' x 6') and deep near-infrared (K(s) band: 2.14 mum) circular polarization image in the Orion nebula, where massive stars and many low-mass stars are forming. Our results reveal that a high circular polarization region is spatially extended (approximately 0.4 pc) around the massive star-forming region, the BN/KL nebula. However, other regions, including the linearly polarized Orion bar, show no significant circular polarization. Most of the low-mass young stars do not show detectable extended structure in either linear or circular polarization, in contrast to the BN/KL nebula. If our solar system formed in a massive star-forming region and was irradiated by net circularly polarized radiation, then enantiomeric excesses could have been induced, through asymmetric photochemistry, in the parent bodies of the meteorites and subsequently delivered to Earth. These could then have played a role in the development of biological homochirality on Earth.

  9. Water deuterium fractionation in the high-mass star-forming region G34.26+0.15 based on Herschel/HIFI data

    DEFF Research Database (Denmark)

    Coutens, Audrey; Vastel, C.; Hincelin, U.

    2014-01-01

    Understanding water deuterium fractionation is important for constraining the mechanisms of water formation in interstellar clouds. Observations of HDO and H_2^{18}O transitions were carried out towards the high-mass star-forming region G34.26+0.15 with the Heterodyne Instrument for the Far...... to an age of ˜105 yr after the infrared dark cloud stage....

  10. CH+(1-0) and 13CH+(1-0) absorption lines in the direction of massive star-forming regions

    NARCIS (Netherlands)

    Falgarone, E.; Godard, B.; Cernicharo, J.; de Luca, M.; Gerin, M.; Phillips, T. G.; Black, J. H.; Lis, D. C.; Bell, T. A.; Boulanger, F.; Coutens, A.; Dartois, E.; Encrenaz, P.; Giesen, T.; Goicoechea, J. R.; Goldsmith, P. F.; Gupta, H.; Gry, C.; Hennebelle, P.; Herbst, E.; Hily-Blant, P.; Joblin, C.; Kaźmierczak, M.; Kołos, R.; Krełowski, J.; Martin-Pintado, J.; Monje, R.; Mookerjea, B.; Neufeld, D. A.; Perault, M.; Pearson, J. C.; Persson, C.; Plume, R.; Salez, M.; Schmidt, M.; Sonnentrucker, P.; Stutzki, J.; Teyssier, D.; Vastel, C.; Yu, S.; Menten, K.; Geballe, T. R.; Schlemmer, S.; Shipman, R.; Tielens, A. G. G. M.; Philipp, S.; Cros, A.; Zmuidzinas, J.; Samoska, L. A.; Klein, K.; Lorenzani, A.; Szczerba, R.; Péron, I.; Cais, P.; Gaufre, P.; Ravera, L.; Morris, P.; Lord, S.; Planesas, P.

    2010-01-01

    We report the detection of the ground-state rotational transition of the methylidyne cation CH+ and its isotopologue 13CH+ toward the remote massive star-forming regions W33A, W49N, and W51 with the HIFI instrument onboard the Herschel satellite. Both lines are seen only in absorption against the

  11. The 1.5 Ms Observing Campaign on IRAS 13224-3809: X-ray Spectral Analysis I.

    Science.gov (United States)

    Jiang, J.; Parker, M. L.; Fabian, A. C.; Alston, W. N.; Buisson, D. J. K.; Cackett, E. M.; Chiang, C.-Y.; Dauser, T.; Gallo, L. C.; García, J. A.; Harrison, F. A.; Lohfink, A. M.; De Marco, B.; Kara, E.; Miller, J. M.; Miniutti, G.; Pinto, C.; Walton, D. J.; Wilkins, D. R.

    2018-03-01

    We present a detailed spectral analysis of the recent 1.5 Ms XMM-Newton observing campaign on the narrow line Seyfert 1 galaxy IRAS 13224-3809, taken simultaneously with 500 ks of NuSTAR data. The X-ray lightcurve shows three flux peaks, registering at about 100 times the minimum flux seen during the campaign, and rapid variability with a time scale of kiloseconds. The spectra are well fit with a primary powerlaw continuum, two relativistic-blurred reflection components from the inner accretion disk with very high iron abundance, and a simple blackbody-shaped model for the remaining soft excess. The spectral variability is dominated by the power law continuum from a corona region within a few gravitational radii from the black hole. Additionally, blueshifted Ne X, Mg XII, Si XIV and S XVI absorption lines are identified in the stacked low-flux spectrum, confirming the presence of a highly ionized outflow with velocity up to v = 0.263 and 0.229 c. We fit the absorption features with xstar models and find a relatively constant velocity outflow through the whole observation. Finally, we replace the bbody and supersolar abundance reflection models by fitting the soft excess successfully with the extended reflection model relxillD, which allows for higher densities than the standard relxill model. This returns a disk electron density ne > 1018.7 cm-3 and lowers the iron abundance from Z_Fe=24^{+3}_{-4}Z_⊙ with ne ≡ 1015 cm-3 to Z_Fe=6.6^{+0.8}_{-2.1}Z_⊙.

  12. The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form.

    Science.gov (United States)

    Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio

    2018-05-01

    Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  13. Searching for the UV counterpart of the extraordinary X-ray UFO in the NLSy1 IRAS17020+4544

    Science.gov (United States)

    Krongold, Yair

    2017-08-01

    We recently reported the first unambiguous discovery in high resolution X-ray data of an ultra fast outflow (UFO) with velocity .1c. This wind, in Narrow Line Seyfert 1 galaxy IRAS17020+4544, represents so far the most compelling detection of an UFO, with many different absorption lines that give rise to very high significance detections. The charge states that form the wind clearly indicate a large range of ionization states in the gas, and significant absorption by Ly alpha, C IV, Si IV and N V (among other ions) is expected in the UV band. The goal of our proposed program is to observe an characterize the best X-ray detected UFO in the UV. These observations are crucial to study in great detail the UFO phenomenon, and understand its nature and its relation to the narrow absorption line low velocity systems. Only through detection of Ly alpha absorption in the UV data, measurements of the metallicity of these winds will be possible. The proposed program will help guide new theoretical models of UFOs origins, beyond the simple actual picture that predicts only very high ionization Fe absorption. UV data are required to understand the wind nature and launching mechanism (whether due to radiation pressure via line or continuum opacity, or magnetic forces). Fully characterizing the wind properties will put stronger constraints in the mass outflow and kinetic outflow rates of these systems, as well as in their geometry. Such estimates will give a much clearer picture of UFOs feedback potential, and will provide clues on the feedback mode in action (e.g. energy conserving vs. momentum conserving).

  14. From Theory to Experiment: Hadron Electromagnetic Form Factors in Space-like and Time-like Regions

    International Nuclear Information System (INIS)

    Tomasi-Gustafsson, E.; Gakh, G.I.; Rekalo, A.P.

    2007-01-01

    Hadron electromagnetic form factors contain information on the intrinsic structure of the hadrons. The pioneering work developed at the Kharkov Physical-Technical Institute in the 60's on the relation between the polarized cross section and the proton form factors triggered a number of experiments. Such experiments could be performed only recently due to the progress in accelerator and polarimetry techniques. The principle of these measurements is recalled and surprise and very precise results obtained on proton are presented. The actual status of nucleon electromagnetic form factors is reviewed, with special attention to the basic work done in Kharkov Physical-Technical Institute. This Paper is devoted to the memory of Prof. M.P. Rekalo

  15. Indocyanine Green Angiographic and Multifocal Electroretinographic Features in the Diffuse and Regional Form of Bietti′s Crystalline Retinopathy

    Institute of Scientific and Technical Information of China (English)

    Libin Jiang; Feng Wen; Lezheng Wu; Hong Yan; Shixing Hu

    2002-01-01

    Prpose: To observe different features of indocyanine green angiography(ICGA) andtifocal electroretinography (ERG) in the diffuse and regional type of Bieti′sc stalline retinopathy (BCR). Thods: ICGA and the multifocal ERG were performed in two cases of the diffuse andregional type of BCR respectively. These data were compared with fluoresceinangiography (FA), standard Ganzfeld ERG, and visual field testing. Results: In the regional case, ICGA revealed reduced perfusion of the choroidalcirculation in the early phase and multiple hypofluorescent spots in the posterior pole in the late phase, due to choriocapillaris filling defect; the extent of choroiocapillaris losswas shown in early phase of ICGA and there were multifocal hyperfluorescent dotssurrounding hypofluorescent spots in late phase in the diffuse case. The multifocal ERGshowed that the central responses were markedly depressed, corresponding to the visualfield defects, while the findings of Ganzfeld ERG were normal in the regional BCR;however, both the multifocal ERG and Ganzfeld ERG were severely subnormal in thediffuse case.Conclusions: The features of ICGA and multifocal ERG are different between the diffuseand regional BCR. In the meantime, the two tools are also useful to differentiate the typeand assess the extentof evolution in BCR.

  16. Which visual functions depend on intermediate visual regions? Insights from a case of developmental visual form agnosia.

    Science.gov (United States)

    Gilaie-Dotan, Sharon

    2016-03-01

    A key question in visual neuroscience is the causal link between specific brain areas and perceptual functions; which regions are necessary for which visual functions? While the contribution of primary visual cortex and high-level visual regions to visual perception has been extensively investigated, the contribution of intermediate visual areas (e.g. V2/V3) to visual processes remains unclear. Here I review more than 20 visual functions (early, mid, and high-level) of LG, a developmental visual agnosic and prosopagnosic young adult, whose intermediate visual regions function in a significantly abnormal fashion as revealed through extensive fMRI and ERP investigations. While expectedly, some of LG's visual functions are significantly impaired, some of his visual functions are surprisingly normal (e.g. stereopsis, color, reading, biological motion). During the period of eight-year testing described here, LG trained on a perceptual learning paradigm that was successful in improving some but not all of his visual functions. Following LG's visual performance and taking into account additional findings in the field, I propose a framework for how different visual areas contribute to different visual functions, with an emphasis on intermediate visual regions. Thus, although rewiring and plasticity in the brain can occur during development to overcome and compensate for hindering developmental factors, LG's case seems to indicate that some visual functions are much less dependent on strict hierarchical flow than others, and can develop normally in spite of abnormal mid-level visual areas, thereby probably less dependent on intermediate visual regions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. A PHOTON-DOMINATED REGION MODEL FOR THE FIR MID-J CO LADDER WITH UNIVERSAL ROTATIONAL TEMPERATURE IN STAR FORMING REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seokho; Park, Yong-Sun [Astronomy Program, Department of Physics and Astronomy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Lee, Jeong-Eun [Department of Astronomy and Space Science, Kyung Hee University, Yongin-shi, Kyungki-do 449-701 (Korea, Republic of); Bergin, Edwin A., E-mail: shlee@astro.snu.ac.kr [Department of Astronomy, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States)

    2014-08-01

    A photon-dominated region (PDR) is one of the leading candidate mechanisms for the origin of warm CO gas with near universal ∼300 K rotational temperature inferred from the CO emission detected toward embedded protostars by Herschel/PACS. We have developed a PDR model in general coordinates, where we can use the most adequate coordinate system for an embedded protostar having outflow cavity walls, to solve chemistry and gas energetics self-consistently for given UV radiation fields with different spectral shapes. Simple one-dimensional tests and applications show that FIR mid-J (14 ≤ J ≤ 24) CO lines are emitted from close to the surface of a dense region exposed to high UV fluxes. We apply our model to HH46 and find that the UV-heated outflow cavity wall can reproduce the mid-J CO transitions observed by Herschel/PACS. A model with UV radiation corresponding to a blackbody of 10,000 K results in a rotational temperature lower than 300 K, while models with the Draine interstellar radiation field and the 15,000 K blackbody radiation field predict a rotational temperature similar to the observed one.

  18. Can regional strain and strain rate measurement be performed during both dobutamine and exercise echocardiography, and do regional deformation responses differ with different forms of stress testing?

    Science.gov (United States)

    Davidavicius, Giedrius; Kowalski, Miroslaw; Williams, R Ian; D'hooge, Jan; Di Salvo, Giovanni; Pierre-Justin, Gilbert; Claus, Piet; Rademakers, Frank; Herregods, Marie-Christine; Fraser, Alan G; Pierard, Luc A; Bijnens, Bart; Sutherland, George R

    2003-04-01

    Regional strain (epsilon) and strain rate (SR) measurement could be the optimal approach to quantifying stress echocardiography images. However, signal noise could preclude their use. Study aims Our aim was to compare the feasibility of regional peak systolic (p) velocity (Vel), pSR/epsilon measurement, and their normal responses during upright (group 1, n = 10) and supine (group 2, n = 10) bicycle exercise and (group 3, n = 10) dobutamine stress. For each type of stress study, pVel/pSR/epsilon data were acquired at baseline, low (100-120 bpm), and peak (140-160 bpm) heart rate (HR); and during recovery. During dobutamine pVel/pSR/epsilon were interpretable in >95% of segments at every stress stage, whereas in groups 1 and 2 pSR/epsilon responses were noninterpretable in >36% of segments (P pVel and SR values increased linearly and reached maximal value at peak HR (P pVel increased linearly, whereas pepsilon response was biphasic as a result of the reduced filling at higher HRs.

  19. Manejo de las infecciones respiratorias agudas (IRA en una comunidad kaqchiquel de Guatemala

    Directory of Open Access Journals (Sweden)

    Sáenz de Tejada Sandra

    1997-01-01

    Full Text Available Las infecciones respiratorias agudas (IRA figuran entre las principales causas de morbilidad y mortalidad infantiles en América Latina. En Guatemala, la neumonía es la primera causa de muerte en niños pequeños y ocasiona aproximadamente una tercera parte de las consultas ambulatorias a servicios pediátricos. Una buena proporción de estas muertes se deben a un manejo deficiente, atribuible a la falta de reconocimiento de los primeros signos de neumonía, a la presencia de barreras que impiden una búsqueda inmediata de atención, a la consulta a proveedores inapropiados o a recomendaciones terapéuticas inadecuadas. El propósito de esta breve investigación cualitativa fue estudiar las percepciones y los comportamientos de los habitantes de San Juan Comalapa, comunidad kaqchiquel en el altiplano central de Guatemala, en lo que respecta a las IRA. Se entrevistó a 32 madres en su domicilio con el fin de determinar cómo clasificaban las IRA y qué signos y síntomas las hacían buscar atención inmediata. Los resultados revelaron que las madres sabían reconocer la presencia de respiración rápida, pero no de tiraje respiratorio (dos signos importantes de neumonía. Cuando buscaban atención, solían acudir a médicos u otros proveedores en centros de salud y ocasionalmente en consultorios privados, pero la búsqueda raras veces era oportuna debido a la poca accesibilidad de los servicios y a la subestimación de la gravedad de los síntomas. Esta conducta podría modificarse por medio de una intervención educativa. Al final se hacen recomendaciones orientadas a mejorar la comunicación verbal entre los proveedores de atención de salud y las madres.

  20. Manejo de las infecciones respiratorias agudas (IRA en una comunidad kaqchiquel de Guatemala

    Directory of Open Access Journals (Sweden)

    Sandra Sáenz de Tejada

    1997-04-01

    Full Text Available Las infecciones respiratorias agudas (IRA figuran entre las principales causas de morbilidad y mortalidad infantiles en América Latina. En Guatemala, la neumonía es la primera causa de muerte en niños pequeños y ocasiona aproximadamente una tercera parte de las consultas ambulatorias a servicios pediátricos. Una buena proporción de estas muertes se deben a un manejo deficiente, atribuible a la falta de reconocimiento de los primeros signos de neumonía, a la presencia de barreras que impiden una búsqueda inmediata de atención, a la consulta a proveedores inapropiados o a recomendaciones terapéuticas inadecuadas. El propósito de esta breve investigación cualitativa fue estudiar las percepciones y los comportamientos de los habitantes de San Juan Comalapa, comunidad kaqchiquel en el altiplano central de Guatemala, en lo que respecta a las IRA. Se entrevistó a 32 madres en su domicilio con el fin de determinar cómo clasificaban las IRA y qué signos y síntomas las hacían buscar atención inmediata. Los resultados revelaron que las madres sabían reconocer la presencia de respiración rápida, pero no de tiraje respiratorio (dos signos importantes de neumonía. Cuando buscaban atención, solían acudir a médicos u otros proveedores en centros de salud y ocasionalmente en consultorios privados, pero la búsqueda raras veces era oportuna debido a la poca accesibilidad de los servicios y a la subestimación de la gravedad de los síntomas. Esta conducta podría modificarse por medio de una intervención educativa. Al final se hacen recomendaciones orientadas a mejorar la comunicación verbal entre los proveedores de atención de salud y las madres.

  1. Regions of existence of two forms of the critical void fraction dependence on heat flux density at burnout

    International Nuclear Information System (INIS)

    Smolin, V.N.

    1981-01-01

    On the basis of the available experimental data considered is the burnout during the movement of steam-water flow in vertical heated tubes with internal diameter from 8 to 40 mm. Critical steam content Xsub(cr) dependences on the critical heat flux qsub(cr) in different tubes and under different pressure are analyzed. Two main regions of the weak and strong dependences Xsub(cr)=f(qsub(cr)) at burnout are found out [ru

  2. Relación entre locus de control, ira y rendimiento deportivo en jugadores de tenis de mesa

    Directory of Open Access Journals (Sweden)

    Higinio González-García

    2017-01-01

    Full Text Available Los objetivos de este estudio fueron comprobar la relación entre el locus de control y el rendimiento de- portivo, y conocer la relación entre el locus de control y las variables de ira. La muestra de la investigación se compuso de 58 jugadores federados de tenis de mesa de toda la geografía española. Los participantes completa- ron un cuestionario sociodemográfico ad hoc , la Escala de Locus de Control (ELC y el Inventario de Expresión de la Ira Estado-Rasgo (STAXI-2. Los resultados revela- ron que no había diferencias de medias en los niveles de locus de control externo en función de la división de juego y del tipo de práctica deportiva (profesionales vs amateurs. Por otro lado, se confirmó la relación entre el locus de control externo y la expresión externa de la ira, encontrándose diferencias estadísticamente signifi- cativas entre la expresión externa de la ira y los grupos de locus de control externo alto y bajo. Finalmente, se concluyó que el nivel de rendimiento deportivo no in- terfería en los niveles de locus de control y, por otro lado, se confirma la relación del locus de control exter- no en la expresión externa de la ira de los jugadores de tenis de mesa. Por lo tanto, el locus de control interno se muestra como una variable protectora importante para intervenir con jugadores y entrenadores.

  3. Influence of university network structures on forming the network environment of regional economy (on the example of national research universities of Tatarstan Republic

    Directory of Open Access Journals (Sweden)

    Darya-Anna Alekseevna Kaibiyainen

    2015-03-01

    Full Text Available Objective to elaborate theoretical and applied aspects of the processes of forming the new network institutional environment of the Russian regional economy under the influence of the developing integral educational network structures basing on the study of the experience of national research universities of Tatarstan Republic Methods general scientific logical methods of analysis and synthesis induction and deduction scientific abstraction as well as the method of systemicfunctional analysis. Results the practical examples are revealed and analyzed of introducing the new network integral principles into the functioning of national research universities which have a real economic effect and influencing such indicators of regional economy as the growth of employment reduction of unemployment etc. Scientific novelty problems of network structures development in the Russian education have not been thoroughly studied yet. The article analyzes the experience reveals and describes the methods and techniques of forming the network educational structures in the functioning of national research universities in Tatarstan Republic Practical value the author shows the ability of network university structures not only to play a significant role forming the new institutional environment of the regional economy but also to influence the macro and microeconomic indicators of development of the region and the country. nbsp

  4. THE VLA NASCENT DISK AND MULTIPLICITY (VANDAM) SURVEY OF PERSEUS PROTOSTARS. RESOLVING THE SUB-ARCSECOND BINARY SYSTEM IN NGC 1333 IRAS2A

    International Nuclear Information System (INIS)

    Tobin, John J.; Looney, Leslie W.; Dunham, Michael M.; Li, Zhi-Yun; Chandler, Claire J.; Perez, Laura M.; Segura-Cox, Dominique; Harris, Robert J.; Hull, Charles L. H.; Sadavoy, Sarah I.; Melis, Carl; Kratter, Kaitlin; Jørgensen, Jes K.; Plunkett, Adele L.

    2015-01-01

    We are conducting a Jansky Very Large Array (VLA) Ka-band (8 mm and 1 cm) and C-band (4 cm and 6.4 cm) survey of all known protostars in the Perseus Molecular Cloud, providing resolution down to ∼0.''06 and ∼0.''35 in the Ka band and C band, respectively. Here we present first results from this survey that enable us to examine the source NGC 1333 IRAS2A in unprecedented detail and resolve it into a protobinary system separated by 0.''621 ± 0.''006 (∼143 AU) at 8 mm, 1 cm, and 4 cm. These two sources (IRAS2A VLA1 and VLA2) are likely driving the two orthogonal outflows known to originate from IRAS2A. The brighter source IRAS2A VLA1 is extended perpendicular to its outflow in the VLA data, with a deconvolved size of 0.''055 (∼13 AU), possibly tracing a protostellar disk. The recently reported candidate companions (IRAS2A MM2 and MM3) are not detected in either our VLA data, Combined Array for Research in Millimeter-wave Astronomy (CARMA) 1.3 mm data, or Submillimeter Array (SMA) 850 μm data. SMA CO (J = 3 → 2), CARMA CO (J = 2 → 1), and lower-resolution CARMA CO (J = 1 → 0) observations are used to examine the outflow origins and the nature of the candidate companions to IRAS2A VLA1. The CO (J = 3 → 2) and (J = 2 → 1) data show that IRAS2A MM2 is coincident with a bright CO emission spot in the east-west outflow, and IRAS2A MM3 is within the north-south outflow. In contrast, IRAS2A VLA2 lies at the east-west outflow symmetry point. We propose that IRAS2A VLA2 is the driving source of the east-west outflow and a true companion to IRAS2A VLA1, whereas IRAS2A MM2 and MM3 may not be protostellar

  5. THE VLA NASCENT DISK AND MULTIPLICITY (VANDAM) SURVEY OF PERSEUS PROTOSTARS. RESOLVING THE SUB-ARCSECOND BINARY SYSTEM IN NGC 1333 IRAS2A

    Energy Technology Data Exchange (ETDEWEB)

    Tobin, John J.; Looney, Leslie W. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Dunham, Michael M. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Li, Zhi-Yun [Department of Astronomy, University of Virginia, Charlottesville, VA 22903 (United States); Chandler, Claire J.; Perez, Laura M. [National Radio Astronomy Observatory, Socorro, NM 87801 (United States); Segura-Cox, Dominique; Harris, Robert J.; Hull, Charles L. H. [Department of Astronomy, University of Illinois, Urbana, IL 61801 (United States); Sadavoy, Sarah I. [Max-Planck-Institut für Astronomie, D-69117 Heidelberg (Germany); Melis, Carl [Center for Astrophysics and Space Sciences, University of California, San Diego, CA 92093 (United States); Kratter, Kaitlin [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Jørgensen, Jes K. [Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø. (Denmark); Plunkett, Adele L., E-mail: jtobin@nrao.edu, E-mail: jeskj@nbi.dk [Department of Astronomy, Yale University, New Haven, CT 06520 (United States)

    2015-01-01

    We are conducting a Jansky Very Large Array (VLA) Ka-band (8 mm and 1 cm) and C-band (4 cm and 6.4 cm) survey of all known protostars in the Perseus Molecular Cloud, providing resolution down to ∼0.''06 and ∼0.''35 in the Ka band and C band, respectively. Here we present first results from this survey that enable us to examine the source NGC 1333 IRAS2A in unprecedented detail and resolve it into a protobinary system separated by 0.''621 ± 0.''006 (∼143 AU) at 8 mm, 1 cm, and 4 cm. These two sources (IRAS2A VLA1 and VLA2) are likely driving the two orthogonal outflows known to originate from IRAS2A. The brighter source IRAS2A VLA1 is extended perpendicular to its outflow in the VLA data, with a deconvolved size of 0.''055 (∼13 AU), possibly tracing a protostellar disk. The recently reported candidate companions (IRAS2A MM2 and MM3) are not detected in either our VLA data, Combined Array for Research in Millimeter-wave Astronomy (CARMA) 1.3 mm data, or Submillimeter Array (SMA) 850 μm data. SMA CO (J = 3 → 2), CARMA CO (J = 2 → 1), and lower-resolution CARMA CO (J = 1 → 0) observations are used to examine the outflow origins and the nature of the candidate companions to IRAS2A VLA1. The CO (J = 3 → 2) and (J = 2 → 1) data show that IRAS2A MM2 is coincident with a bright CO emission spot in the east-west outflow, and IRAS2A MM3 is within the north-south outflow. In contrast, IRAS2A VLA2 lies at the east-west outflow symmetry point. We propose that IRAS2A VLA2 is the driving source of the east-west outflow and a true companion to IRAS2A VLA1, whereas IRAS2A MM2 and MM3 may not be protostellar.

  6. HIGHLY VARIABLE EXTINCTION AND ACCRETION IN THE JET-DRIVING CLASS I-TYPE YOUNG STAR PTF 10nvg (V2492 Cyg, IRAS 20496+4354)

    Energy Technology Data Exchange (ETDEWEB)

    Hillenbrand, Lynne A.; Carpenter, John M.; Muirhead, Philip S.; Crepp, Justin R. [Astronomy Department, California Institute of Technology, Pasadena, CA 91125 (United States); Miller, Adam A.; Cenko, S. Bradley; Silverman, Jeffrey M.; Bloom, Joshua S.; Filippenko, Alexei V. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Covey, Kevin R. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Fischer, William J. [Department of Physics and Astronomy, University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606 (United States)

    2013-03-15

    We report extensive new photometry and spectroscopy of the highly variable young stellar object PTF 10nvg (also known as IRAS 20496+4354 and V2492 Cyg), including optical and near-infrared time-series data as well as mid-infrared and millimeter data. Following the previously reported 2010 rise to R{sub PTF} {approx}<13.{sup m}5 and subsequent fade, during 2011 and 2012 the source underwent additional episodes of brightening, followed by several magnitude dimming events including prolonged faint states at R{sub PTF} {approx}> 20{sup m}. The observed high-amplitude variations are largely consistent with extinction changes ({Delta}A{sub V} up to 30 mag) having a {approx}220 day quasi-periodic signal. However, photometry measured when the source was near maximum brightness in mid-2010 as well as in late-2012 does not phase well to this period. Spectral evolution includes not only changes in the spectral slope but also correlated variation in the prominence of TiO/VO/CO bands and atomic line emission, as well as anti-correlated variation in forbidden line emission which, along with H{sub 2}, dominates optical and infrared spectra at faint epochs. Notably, night-to-night variations in several forbidden doublet strengths and ratios are observed. High-dispersion spectra were obtained in a variety of photometric states and reveal time-variable line profiles. Neutral and singly ionized atomic species are likely formed in an accretion flow and/or impact while the origin of zero-velocity atomic Li I {lambda}6707 in emission is unknown. Forbidden lines, including several rare species, exhibit blueshifted emission profiles and likely arise from an outflow/jet. Several of these lines are also seen spatially offset from the continuum source position, presumably in a shocked region of an extended jet. Blueshifted absorption components of the Na I D doublet, K I {lambda}{lambda}7665, 7669 doublet, and the O I 7774 triplet, as well as blueshifted absorption components seen against

  7. The carbonate mineralogy and distribution of habitat-forming deep-sea corals in the southwest pacific region

    Science.gov (United States)

    Bostock, Helen C.; Tracey, Dianne M.; Currie, Kim I.; Dunbar, Gavin B.; Handler, Monica R.; Mikaloff Fletcher, Sara E.; Smith, Abigail M.; Williams, Michael J. M.

    2015-06-01

    Habitat-forming deep-sea scleractinian and alcyonacean corals from around the southwest Pacific were analysed for their calcium carbonate mineralogy. Scleractinian coral species Solenosmilia variabilis, Enallopsammia rostrata, Goniocorella dumosa, Madrepora oculata and Oculina virgosa were all found to be 100% aragonitic, while some members of the alcyonacean taxa Keratoisis spp., Lepidisis spp., and Paragorgia spp. were determined to be high magnesium (Mg) calcite (with 8-11 mol% MgCO3) and Primnoa sp. is bimineralic with both aragonite and Mg calcite. The majority of these habitat-forming deep-sea corals are found at intermediate depths (800-1200 m) in the Antarctic Intermediate Waters (AAIW) with low salinities (~34.5), temperatures of 4-8 °C and high oxygen concentrations (>180 μmol/kg) and currently sitting above the aragonite saturation horizon (ASH). However, habitat-forming corals have been recorded from greater depths, in cooler waters (2-4 °C) that are undersaturated with respect to aragonite (Ωaragonite160 μmol/kg. To address the sampling depth bias the coral records were normalised by the number of benthic stations (sampling effort) in the same depth range. This shows that the highest number of corals per sampling effort is between 1000 and 1400 m with corals present in over 5% of the stations at these depths. The normalised records and Boot Strap analyses suggests that scleractinian corals, especially S. variabilis should be present in >1% of stations down to 1800 m water depth, with E. rostrata, M. oculata and G. dumosa slightly shallower. While alcyonacean corals are found in >1% down to 2600 m, with Keratoisis spp. the deepest down to 2600 m, while Lepidisis spp. and Paragorgia spp. found down to 1800 m. This suggests that most species can probably tolerate some undersaturation of aragonite (Ωaragonite=0.8-0.9), with several species/genera (S. variabilis; Keratoisis spp.) even more tolerant of lower carbonate concentrations ([CO3 2 -]), down

  8. Very deep IRAS survey - constraints on the evolution of starburst galaxies

    International Nuclear Information System (INIS)

    Hacking, P.; Houck, J.R.; Condon, J.J.; National Radio Astronomy Observatory, Charlottesville, VA)

    1987-01-01

    Counts of sources (primarily starburst galaxies) from a deep 60 microns IRAS survey published by Hacking and Houck (1987) are compared with four evolutionary models. The counts below 100 mJy are higher than expected if no evolution has taken place out to a redshift of approximately 0.2. Redshift measurements of the survey sources should be able to distinguish between luminosity-evolution and density-evolution models and detect as little as a 20 percent brightening or increase in density of infrared sources per billion years ago (H/0/ = 100 km/s per Mpc). Starburst galaxies cannot account for the reported 100 microns background without extreme evolution at high redshifts. 21 references

  9. Planck intermediate results XXIX. All-sky dust modelling with Planck, IRAS, and WISE observations

    DEFF Research Database (Denmark)

    Ade, P. A. R.; Aghanim, N.; Alves, M. I. R.

    2016-01-01

    We present all-sky modelling of the high resolution Planck, IRAS, andWISE infrared (IR) observations using the physical dust model presented by Draine & Li in 2007 (DL, ApJ, 657, 810). We study the performance and results of this model, and discuss implications for future dust modelling....... The present work extends the DL dust modelling carried out on nearby galaxies using Herschel and Spitzer data to Galactic dust emission. We employ the DL dust model to generate maps of the dust mass surface density Sigma(Md), the dust optical extinction A(V), and the starlight intensity heating the bulk...... of the dust, parametrized by U-min. The DL model reproduces the observed spectral energy distribution (SED) satisfactorily over most of the sky, with small deviations in the inner Galactic disk and in low ecliptic latitude areas, presumably due to zodiacal light contamination. In the Andromeda galaxy (M31...

  10. VLA Ammonia Observations of IRAS 16253-2429: A Very Young and Low Mass Protostellar System

    Science.gov (United States)

    Wiseman, Jennifer J.

    2011-01-01

    IRAS l6253-2429. the source of the Wasp-Waist Nebula seen in Spitzer IRAC images, is an isolated very low luminosity ("VeLLO") Class 0 protostar in the nearby rho Ophiuchi cloud. We present VLA ammonia mapping observations of the dense gas envelope feeding the central core accreting system. We find a flattened envelope perpendicular to the outflow axis, and gas cavities that appear to cradle the outflow lobes as though carved out by the flow and associated (apparently precessing) jet. Based on the NH3 (1,1) and (2,2) emission distribution, we derive the mass, velocity fields and temperature distribution for the envelope. We discuss the combined evidence for this source as possibly one of the youngest and lowest mass sources in formation yet known.

  11. Revealing the ultrafast outflow in IRAS 13224-3809 through spectral variability

    Science.gov (United States)

    Parker, M. L.; Alston, W. N.; Buisson, D. J. K.; Fabian, A. C.; Jiang, J.; Kara, E.; Lohfink, A.; Pinto, C.; Reynolds, C. S.

    2017-08-01

    We present an analysis of the long-term X-ray variability of the extreme narrow-line Seyfert 1 galaxy IRAS 13224-3809 using principal component analysis (PCA) and fractional excess variability (Fvar) spectra to identify model-independent spectral components. We identify a series of variability peaks in both the first PCA component and Fvar spectrum which correspond to the strongest predicted absorption lines from the ultrafast outflow (UFO) discovered by Parker et al. (2017). We also find higher order PCA components, which correspond to variability of the soft excess and reflection features. The subtle differences between RMS and PCA results argue that the observed flux-dependence of the absorption is due to increased ionization of the gas, rather than changes in column density or covering fraction. This result demonstrates that we can detect outflows from variability alone and that variability studies of UFOs are an extremely promising avenue for future research.

  12. IRAS observations of dust heating and energy balance in the Rho Ophiuchi dark cloud

    Science.gov (United States)

    Greene, Thomas P.; Young, Erick T.

    1989-01-01

    The equilibrium process dust emission in the Rho Ophiuchi dark cloud is studied. The luminosity of the cloud is found to closely match the luminosity of the clouds's known embedded and external radiation sources. There is no evidence for a large population of undetected low-luminosity sources within the cloud and unknown external heating is also only a minor source of energy. Most of the cloud's luminosity is emitted in the mid-to-far-IR. Dust temperature maps indicate that the dust is not hot enough to heat the gas to observed temperatures. A simple cloud model with a radiation field composed of flux HD 147889, S1, and Sco OB2 associations predicts the observed IRAS 60 to 100 micron in-band flux ratios for a mean cloud density n(H2) = 1400. Flattened 12 and 25 micron observations show much extended emission in these bands, suggesting stochastic heating of very small grains or large molecules.

  13. Implications of the IRAS data for galactic gamma-ray astronomy and EGRET

    International Nuclear Information System (INIS)

    Stecker, F.W.

    1990-01-01

    Using the results of gamma-ray, millimeter wave and far infrared surveys of the galaxy, one can derive a logically consistent picture of the large scale distribution of galactic gas and cosmic rays, one tied to the overall processes of stellar birth and destruction on a galactic scale. Using the results of the IRAS far-infrared survey of the galaxy, the large scale radial distributions of galactic far-infrared emission were obtained independently for both the northern and southern hemisphere sides of the Galaxy. It was found that the dominant feature in these distributions to be a broad peak coincident with the 5 kpc molecular gas cloud ring. Also found was evidence of spiral arm features. Strong correlations are evident between the large scale galactic distributions of far infrared emission, gamma-ray emission and total CO emission. There is a particularly tight correlation between the distribution of warm molecular clouds and far-infrared emission on a galactic scale

  14. The IRAS minisurvey. [Infra Red Astronomy Satellite study of selected sources

    Science.gov (United States)

    Rowan-Robinson, M.; Clegg, P. E.; Emerson, J. P.; Beichman, C. A.; Aumann, H. H.; Gautier, T. N.; Neugebauer, G.; Soifer, B. T.; Beintema, D. A.; Boggess, N.

    1984-01-01

    Before the main Infrared Astronomical Satellite (IRAS) all-sky survey was started, a preliminary survey of 900 sq deg was carried out. Some results from this 'minisurvey' are given here. The completeness of the minisurvey at galactic latitudes from 20 to 40 deg drops sharply at flux densities below 0.4, 0.4, 0.5, and 2.5 Jy at 12, 25, 60, and 100 microns, respectively. The corresponding surface densities of point sources brighter than these flux levels are 1.1, 0.4, 0.65, and 1.25/sq deg, respectively. Outside the galactic plane, the majority of the sources at 12 and 25 microns are stars, while galaxies make up a significant proportion of 60 micron sources. The 100 micron band is dominated by emission from interstellar dust over much of the minisurvey area.

  15. Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

    International Nuclear Information System (INIS)

    Quenzer, A.

    1977-01-01

    The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

  16. Rotation-Infall Motion around the Protostar IRAS 16293-2422 Traced by Water Maser Emission

    Science.gov (United States)

    Imai, Hiroshi; Iwata, Takahiro; Miyoshi, Makoto

    1999-08-01

    We made VLBI observations of the water maser emission associated with a protostar, IRAS 16293-2422, using the Kashima-Nobeyama Interferometer (KNIFE) and the Japanese domestic VLBI network (J-Net).\\footnote[2]. These distributions of water maser features showed the blue-shifted and red-shifted components separated in the north-south direction among three epochs spanning three years. The direction of the separation was perpendicular to the molecular outflow and parallel to the elongation of the molecular disk. These steady distributions were successfully modeled by a rotating-infalling disk with an outer radius of 100 AU around a central object with a mass of 0.3 MO . The local specific angular momentum of the disk was calculated to be 0.2-1.0times 10-3 km s-1 pc at a radius of 20-100 AU. This value is roughly equal to that of the disk of IRAS 00338+6312 in L1287 and those of the molecular disks around the protostars in the Taurus molecular cloud. The relatively large disk radius of about 100 AU traced by water maser emission suggests that impinging clumps onto the disk should be hotter than 200 K to excite the water maser emission. Mizusawa, Nobeyama, and Kagoshima stations are operated by staff members of National Astronomical Observatory of the Ministry of Education, Science, Sports and Culture. Kashima station is operated by staff members of Communications Research Laboratory of the Ministry of Posts and Telecomunications. The recent status of J-Net is seen in the WWW home page: http://www.nro.nao.ac.jp/\\ \\ miyaji/Jnet.

  17. A Molecular-line Study of the Interstellar Bullet Engine IRAS05506+2414

    Science.gov (United States)

    Sahai, Raghvendra; Lee, Chin-Fei; Sánchez Contreras, Carmen; Patel, Nimesh; Morris, Mark R.; Claussen, Mark

    2017-12-01

    We present interferometric and single-dish molecular line observations of the interstellar bullet-outflow source IRAS 05506+2414, whose wide-angle bullet spray is similar to the Orion BN/KL explosive outflow and likely arises from an entirely different mechanism than the classical accretion-disk-driven bipolar flows in young stellar objects. The bullet-outflow source is associated with a large pseudo-disk and three molecular outflows—a high-velocity outflow (HVO), a medium-velocity outflow (MVO), and a slow, extended outflow (SEO). The size (mass) of the pseudo-disk is 10,350 au × 6400 au (0.64-0.17 M ⊙) from a model-fit assuming infall and rotation, we derive a central stellar mass of 8-19 M ⊙. The HVO (MVO) has an angular size ˜5180 (˜3330) au and a projected outflow velocity of ˜140 km s-1 (˜30 km s-1). The SEO size (outflow speed) is ˜0.9 pc (˜6 km s-1). The HVO’s axis is aligned with (orthogonal to) that of the SEO (pseudo-disk). The velocity structure of the MVO is unresolved. The scalar momenta in the HVO and SEO are very similar, suggesting that the SEO has resulted from the HVO interacting with ambient-cloud material. The bullet spray shares a common axis with the pseudo-disk and has an age comparable to that of MVO (few hundred years), suggesting that these three structures are intimately linked. We discuss several models for the outflows in IRAS 05506+2414 (including dynamical decay of a stellar cluster, chance encounter of a runaway star with a dense cloud, and close passage of two protostars), and conclude that second-epoch imaging to derive proper motions of the bullets and nearby stars can help to discriminate between them.

  18. Forecasting how residential urban form affects the regional carbon savings and costs of retrofitting and decentralized energy supply

    International Nuclear Information System (INIS)

    Hargreaves, Anthony; Cheng, Vicky; Deshmukh, Sandip; Leach, Matthew; Steemers, Koen

    2017-01-01

    Highlights: • An innovative model for testing combinations of spatial planning and decentralised energy supply. • An improved method of modelling the spatial variability of energy consumption per dwelling type. • Shows how spatial planning would affect the future carbon reduction of decentralised supply. • Forecasts the future carbon reduction and costs of retrofitting and decentralised supply. • A method of forecasting how residential space would affect the suitability of decentralised supply. - Abstract: Low carbon energy supply technologies are increasingly used at the building and community scale and are an important part of the government decarbonisation strategy. However, with their present state of development and costs, many of these decentralised technologies rely on public subsidies to be financially viable. It is questionable whether they are cost effective compared to other ways of reducing carbon emissions, such as decarbonisation of conventional supply and improving the energy efficiency of dwellings. Previous studies have found it difficult to reliably estimate the future potential of decentralised supply because this depends on the available residential space which varies greatly within a city region. To address this problem, we used an integrated modelling framework that converted the residential density forecasts of a regional model into a representation of the building dimensions and land of the future housing stock. This included a method of estimating the variability of the dwellings and residential land. We present the findings of a case study of the wider south east regions of England that forecasted the impacts of energy efficiency and decentralised supply scenarios to year 2031. Our novel and innovative method substantially improves the spatial estimates of energy consumption compared to building energy models that only use standard dwelling typologies. We tested the impact of an alternative spatial planning policy on the future

  19. Reversible Stress Cardiomyopathy Presenting as Acute Coronary Syndrome with Elevated Troponin in the Absence of Regional Wall Motion Abnormalities: A Forme Fruste of Stress Cardiomyopathy?

    Directory of Open Access Journals (Sweden)

    Mahesh Anantha Narayanan

    2014-01-01

    Full Text Available We present a case of reversible stress cardiomyopathy in a surgical patient, described here as a forme fruste due to its atypical features. It is important to recognize such unusual presentation of stress cardiomyopathy that mimics acute coronary syndrome. Stress cardiomyopathy commonly presents as acute coronary syndrome and is characterized by typical or atypical variants of regional wall motion abnormalities. We report a 60-year-old Caucasian male with reversible stress cardiomyopathy following a sternal fracture fixation. Although the patient had several typical features of stress cardiomyopathy including physical stress, ST-segment elevation, elevated cardiac biomarkers and normal epicardial coronaries, there were few features that were atypical, including unusual age, gender, absence of regional wall motion abnormalities, high lateral ST elevation, and high troponin-ejection fraction product. In conclusion, this could represent a forme fruste of stress cardiomyopathy.

  20. CONDITION OF DECENTRALIZATION AND ORGANIZATIONAL LEGAL FORMS OF SUSTAINABLE DEVELOPMENT OF REGIONS OF UKRAINE IN THE CONTEXT OF THE GLOBAL EXPERIENCE

    Directory of Open Access Journals (Sweden)

    Nadiia Kulchytska

    2016-06-01

    Full Text Available In the article the modern condition of decentralization and organizational legal forms of sustainable development of regions of Ukraine in the context of the global experience are analyzed, possible ways to overcome regional disparities are proved. A special place in scientific research article takes a significant number of modern researchers analyzed the theoretical and methodological foundations of a system of financial support of local authorities in the transition to decentralization of public administration. In this regard, particular relevance is the problem of defining the role of decentralization principles in forming the financial support of local government. The importance of decentralization in the process of local government reform is proved. The ways implementing decentralization in modern Ukraine are shown. The scientific approaches to determining the meaning and role of decentralization in a market economy are analyzed and summarized. Key words: decentralization, deconcentration of power, the territorial organization of government, local communities, dotatsiynist, sustainable development. JEL: H 70, R 58

  1. Atomic motions in the αβ-region of glass-forming polymers: molecular versus mode coupling theory approach

    International Nuclear Information System (INIS)

    Colmenero, Juan; Narros, Arturo; Alvarez, Fernando; Arbe, Arantxa; Moreno, Angel J

    2007-01-01

    We present fully atomistic molecular dynamics simulation results on a main-chain polymer, 1,4-polybutadiene, in the merging region of the α- and β-relaxations. A real-space analysis reveals the occurrence of localized motions ('β-like') in addition to the diffusive structural relaxation. A molecular approach provides a direct connection between the local conformational changes reflected in the atomic motions and the secondary relaxations in this polymer. Such local processes occur just in the time window where the β-process of the mode coupling theory is expected. We show that the application of this theory is still possible and yields an unusually large value of the exponent parameter. This result might originate from the competition between two mechanisms for dynamic arrest: intermolecular packing and intramolecular barriers for local conformational changes ('β-like')

  2. Introduction of the flora, life forms and chorology of plants of some regions in western Chabahar (Sistan and Baluchestan Province

    Directory of Open Access Journals (Sweden)

    Somayeh Salimi

    2014-12-01

    Full Text Available This study focused on Zarabad, Cheraghabad and Nogombecom plants of sub-basin watershed city of Chabahar, Iran. The studied flora included 78 species which belonged to 66 genera and 29 families. Poaceae with 16 genera and 19 species, Asteraceae with 7 genera and 8 species, Chenopodiaceae with 5 genera and 4 species, Papilionaceae, with 5 genera and 6 species, constituted the largest plant families respectively. The largest genera of the region were: Salsola, Heliotropium and Plantago, respectively. 42% of the flora belonged to Nobo-Sindian elements, 35%to Irano-Turanian, 18%were bioregional elements and 5% of the species were cosmopolitan. Flora of the studied area, included therophytes (56%, chamaephytes (15%, phanerophytes (14%, geophytes (12% and hemicryptophytes (3%.

  3. [FEATURES OF THE CONTENT OF MOVABLE FORMS OF HEAVY METALS AND SELENIUM IN SOILS OF THE YAROSLAVL REGION].

    Science.gov (United States)

    Bakaeva, E A; Eremeyshvili, A V

    2016-01-01

    With the use of the method of inversion voltammetry there was analyzed the content of movableforms of trace elements: (selenium, zinc, copper lead, cadmium) in soils in the Yaroslavl district of the Yaroslavl region, and also content of zinc, copper lead, cadmium in soils and snow cover in the city of Yaroslavl. According to values of concentrations of movable compounds in soils determined trace elements can be ranked into the following row: zinc > lead > copper > selenium > cadmium. There was revealed insufficient if compared with literature data concentrations, content of movable compounds of selenium, copper and zinc in examined explored soils. The maximal concentrations of lead are revealed in the close proximity to both the city of Yaroslavl and large highways of the city. It indicates to the anthropogenic pollution of soils by this element.

  4. The Features of Forming and Using the Finansial and Material Resources of Socially Oriented Non-Profit Organizations of Volgograd Region

    Directory of Open Access Journals (Sweden)

    Oleynik Olga Stepanovna

    2014-12-01

    Full Text Available The article deals with the problem of interaction of regional authorities and the institute of socially oriented non-profit organizations that carry out the activity aimed at solving social problems, the development of civil society in Russia. The forms and activities of socially oriented non-profit organizations are systematically presented. The authors reveal the directions and tools for supporting the activities of socially oriented non-profit organizations by public authorities and local self-government bodies. The authors aimed at fixing the peculiarities of organization and conduct of statistical observation over the activity of socially-oriented organizations in Volgograd region. The organizational events were arranged. They were necessary for the conduct of qualitative statistical analysis of the activity of socially oriented organizations. For the first time the official data on the activity of socially oriented non-profit organizations in Volgograd region, including the information on formation and use of money and other property, was received as a result of the statistical observation. The authors focus on the analysis of the sources of money and other property, reveal the composition of income in non-profit organizations of various organizational and legal forms. The forms of work in socially oriented non-profit organizations of Volgograd region and its results as of 2013 are thoroughly studied. The conducted statistical analysis showed that the significant public sector has been established in the region. It provides the necessary public social services, financial or social assistance to the most vulnerable members of society.

  5. A UKIDSS-based search for low-mass stars and small stellar clumps in off-cloud parts of young star-forming regions* **

    Directory of Open Access Journals (Sweden)

    Barrado y Navascués D.

    2011-07-01

    Full Text Available The form and universality of the mass function of young and nearby star-forming regions is still under debate. Its relation to the stellar density, its mass peak and the dependency on most recent models shows significant differencies for the various regions and remains unclear up to date. We aim to get a more complete census of two of such regions. We investigate yet unexplored areas of Orion and Taurus-Auriga, observed by the UKIDSS survey. In the latter, we search for low-mass stars via photometric and proper motion criteria and signs for variability. In Orion, we search for small stellar clumps via nearest-neighbor methods. Highlights in Taurus would be the finding of the missing low-mass stars and the detection of a young cluster T dwarf. In Orion, we discovered small stellar associations of its OB1b and OB1c populations. Combined with what is known in literature, we will provide by this investigations a general picture of the results of the star-forming processes in large areas of Taurus and Orion and probe the most recent models.

  6. Influence of urban form on landscape pattern and connectivity in metropolitan regions: a comparative case study of Phoenix, AZ, USA, and Izmir, Turkey.

    Science.gov (United States)

    Park, Sohyun; Hepcan, Çiğdem C; Hepcan, Şerif; Cook, Edward A

    2014-10-01

    Although ecological connectivity conservation in urban areas has recently been recognized as an important issue, less is known about its relationship to urban form and landscape pattern. This study investigates how urban morphology influences regional ecosystem pattern and landscape connectivity. Two metropolitan landscapes, Phoenix, AZ, USA, and Izmir, Turkey, were compared, both of which are fast-growing regions in their national context. A wide range of variables were considered for identifying natural and urban properties. The natural characteristics include typology of urban ecosystems, urban to natural cover ratio, dominant habitat type, urban biodiversity, landscape context, and connectivity conservation efforts. Urban parameters examine urban form, urban extent, urban cover proportion, growth rate, populations, urban gradient, major drivers of urbanization, urban density, and mode/approach of urban development. Twelve landscape metrics were measured and compared across the natural patches. Results show that there is little difference in landscape connectivity in the rural zones of Phoenix and Izmir, although Phoenix has slightly higher connectivity values. The connectivity variance in urbanized areas, however, is significantly dependent on the region. For example, Phoenix urban zones have substantially lower connectivity than either urban or suburban zones in Izmir. Findings demonstrate that small and compact urban settlements with more dense populations are more likely to conserve landscape connectivity compared to multiple-concentric but amalgamated urban form spreading all over the landscape (aka urban sprawl).

  7. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  8. Short forms of the Utrecht-Management of Identity Commitments Scale (U-MICS) with the domains of job, romantic relationship, and region.

    Science.gov (United States)

    Schubach, Elisabeth; Zimmermann, Julia; Noack, Peter; Neyer, Franz J

    2017-01-01

    The U-MICS is a self-report questionnaire designed to assess the identity dimensions from a domain-specific perspective. The present study reports on the development of a short-form version for the domains of job and romantic relationship in young adults from Germany and extends this scale to include the domain of region (n Sample1  = 95, 84% female, mean age 22.45 years; n Sample2  = 1,795, 71% female, mean age 24.53 years). We found the short form to possess adequate psychometric properties and to demonstrate a factor structure congruent to the long-form version. Regarding validity, the small correlations across domains within dimensions support a domain-specific approach to identity. The associations between the different identity domains with personality traits are similar, indicating a consistent pattern of convergent validity for all domains. We conclude that "region" provides a valuable complement to the established domains that can all be reliably assessed with the U-MICS-Short Form. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  9. FORMING AN O STAR VIA DISK ACCRETION?

    International Nuclear Information System (INIS)

    Qiu Keping; Zhang Qizhou; Beuther, Henrik; Fallscheer, Cassandra

    2012-01-01

    We present a study of outflow, infall, and rotation in a ∼10 5 L ☉ star-forming region, IRAS 18360-0537, with Submillimeter Array and IRAM 30 m observations. The 1.3 mm continuum map shows a 0.5 pc dust ridge, of which the central compact part has a mass of ∼80 M ☉ and harbors two condensations, MM1 and MM2. The CO (2-1) and SiO (5-4) maps reveal a biconical outflow centered at MM1, which is a hot molecular core (HMC) with a gas temperature of 320 ± 50 K and a mass of ∼13 M ☉ . The outflow has a gas mass of 54 M ☉ and a dynamical timescale of 8 × 10 3 yr. The kinematics of the HMC are probed by high-excitation CH 3 OH and CH 3 CN lines, which are detected at subarcsecond resolution and unveil a velocity gradient perpendicular to the outflow axis, suggesting a disk-like rotation of the HMC. An infalling envelope around the HMC is evidenced by CN lines exhibiting a profound inverse P Cygni profile, and the estimated mass infall rate, 1.5 × 10 –3 M ☉ yr –1 , is well comparable to that inferred from the mass outflow rate. A more detailed investigation of the kinematics of the dense gas around the HMC is obtained from the 13 CO and C 18 O (2-1) lines; the position-velocity diagrams of the two lines are consistent with the model of a free-falling and Keplerian-like rotating envelope. The observations suggest that the protostar of a current mass ∼10 M ☉ embedded within MM1 will develop into an O star via disk accretion and envelope infall.

  10. The Gould's Belt Distances Survey (GOBELINS). IV. Distance, Depth, and Kinematics of the Taurus Star-forming Region

    Science.gov (United States)

    Galli, Phillip A. B.; Loinard, Laurent; Ortiz-Léon, Gisela N.; Kounkel, Marina; Dzib, Sergio A.; Mioduszewski, Amy J.; Rodríguez, Luis F.; Hartmann, Lee; Teixeira, Ramachrisna; Torres, Rosa M.; Rivera, Juana L.; Boden, Andrew F.; Evans, Neal J., II; Briceño, Cesar; Tobin, John J.; Heyer, Mark

    2018-05-01

    We present new trigonometric parallaxes and proper motions of young stellar objects in the Taurus molecular cloud complex from observations collected with the Very Long Baseline Array as part of the Gould’s Belt Distances Survey. We detected 26 young stellar objects and derived trigonometric parallaxes for 18 stars with an accuracy of 0.3% to a few percent. We modeled the orbits of six binaries and determined the dynamical masses of the individual components in four of these systems (V1023 Tau, T Tau S, V807 Tau, and V1000 Tau). Our results are consistent with the first trigonometric parallaxes delivered by the Gaia satellite and reveal the existence of significant depth effects. We find that the central portion of the dark cloud Lynds 1495 is located at d =129.5 ± 0.3 pc, while the B216 clump in the filamentary structure connected to it is at d = 158.1 ± 1.2 pc. The closest and remotest stars in our sample are located at d = 126.6 ± 1.7 pc and d = 162.7 ± 0.8 pc, yielding a distance difference of about 36 pc. We also provide a new distance estimate for HL Tau that was recently imaged. Finally, we compute the spatial velocity of the stars with published radial velocity and investigate the kinematic properties of the various clouds and gas structures in this region.

  11. Expresión de la ira en adolescentes holguineros. Repercusión psicológica y diferencias de género

    Directory of Open Access Journals (Sweden)

    Yuri Arsenio Sanz Martínez

    2006-01-01

    Full Text Available Aborda el proceso de validación de dos instrumentos diagnósticos: Escala Pediátrica de la Expresión de la Ira y Juego Clase, aplicados a un grupo de adolescentes tempranos. Se obtiene que ambos instrumentos poseen índices aceptables y altos de confiabilidad y se reporta validez de constructo. Se comprueba que los adolescentes que externalizan la ira emiten menos comportamientos prosociales que aquellos que la manejan de forma controlada, quienes son más sociables, aceptados, y tienen más amigos. Los adolescentes que reprimen su ira son los que menos comportamientos prosociales emiten. Los varones expresan de forma más abierta su ira que las hembras.

  12. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    Science.gov (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements With Modified Blackbody Fitting

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; −13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ {sup 2} values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; −7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect

  14. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting

    Science.gov (United States)

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

  15. Unequal-thickness billet optimization in transitional region during isothermal local loading forming of Ti-alloy rib-web component using response surface method

    Directory of Open Access Journals (Sweden)

    Ke WEI

    2018-04-01

    Full Text Available Avoiding the folding defect and improving the die filling capability in the transitional region are desired in isothermal local loading forming of a large-scale Ti-alloy rib-web component (LTRC. To achieve a high-precision LTRC, the folding evolution and die filling process in the transitional region were investigated by 3D finite element simulation and experiment using an equal-thickness billet (ETB. It is found that the initial volume distribution in the second-loading region can greatly affect the amount of material transferred into the first-loading region during the second-loading step, and thus lead to the folding defect. Besides, an improper initial volume distribution results in non-concurrent die filling in the cavities of ribs after the second-loading step, and then causes die underfilling. To this end, an unequal-thickness billet (UTB was employed with the initial volume distribution optimized by the response surface method (RSM. For a certain eigenstructure, the critical value of the percentage of transferred material determined by the ETB was taken as a constraint condition for avoiding the folding defect in the UTB optimization process, and the die underfilling rate was considered as the optimization objective. Then, based on the RSM models of the percentage of transferred material and the die underfilling rate, non-folding parameter combinations and optimum die filling were achieved. Lastly, an optimized UTB was obtained and verified by the simulation and experiment. Keywords: Die filling, Folding defect, Isothermal local loading forming, Transitional region, Unequal-thickness billet optimization

  16. HIGH-RESOLUTION 8 mm AND 1 cm POLARIZATION OF IRAS 4A FROM THE VLA NASCENT DISK AND MULTIPLICITY (VANDAM) SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Cox, Erin G.; Harris, Robert J.; Looney, Leslie W.; Segura-Cox, Dominique M. [Department of Astronomy, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Tobin, John [Leiden Observatory, Leiden University, P.O. Box 9513, 2000-RA Leiden (Netherlands); Li, Zhi-Yun [Department of Astronomy, University of Virginia, Charlottesville, VA 22903 (United States); Tychoniec, Łukasz [Astronomical Observatory Institute, Faculty of Physics, A. Mickiewicz University, Słoneczna 36, PL-60-268 Poznań (Poland); Chandler, Claire J.; Perez, Laura M. [National Radio Astronomy Observatory, Socorro, NM 87801 (United States); Dunham, Michael M. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Kratter, Kaitlin [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Melis, Carl [Center for Astrophysics and Space Sciences, University of California, San Diego, CA 92093 (United States); Sadavoy, Sarah I., E-mail: egcox2@illinois.edu [Max-Planck-Institut für Astronomie, D-69117 Heidelberg (Germany)

    2015-12-01

    Magnetic fields can regulate disk formation, accretion, and jet launching. Until recently, it has been difficult to obtain high-resolution observations of the magnetic fields of the youngest protostars in the critical region near the protostar. The VANDAM survey is observing all known protostars in the Perseus Molecular Cloud. Here we present the polarization data of IRAS 4A. We find that with ∼0.″2 (50 AU) resolution at λ = 8.1 and 10.3 mm, the inferred magnetic field is consistent with a circular morphology, in marked contrast with the hourglass morphology seen on larger scales. This morphology is consistent with frozen-in field lines that were dragged in by rotating material entering the infall region. The field morphology is reminiscent of rotating circumstellar material near the protostar. This is the first polarization detection of a protostar at these wavelengths. We conclude from our observations that the dust emission is optically thin with β ∼ 1.3, suggesting that millimeter-/centimeter-sized grains have grown and survived in the short lifetime of the protostar.

  17. SEQUENTIAL STAR FORMATION IN RCW 34: A SPECTROSCOPIC CENSUS OF THE STELLAR CONTENT OF HIGH-MASS STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Bik, A.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Puga, E.; Waters, L.B.F.M.; Waelkens, Ch.; Horrobin, M.; Kaper, L.; De Koter, A.; Van den Ancker, M.; Comeron, F.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; Thi, W. F.

    2010-01-01

    In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is found. At the northern edge of this bubble, an H II region is located, ionized by 3 OB stars, of which the most massive star has spectral type O8.5V. Intermediate-mass stars (2-3 M sun ) are detected of G- and K-spectral type. These stars are still in the pre-main-sequence (PMS) phase. North of the H II region, a photon-dominated region is present, marking the edge of a dense molecular cloud traced by H 2 emission. Several class 0/I objects are associated with this cloud, indicating that star formation is still taking place. The distance to RCW 34 is revised to 2.5 ± 0.2 kpc and an age estimate of 2 ± 1 Myr is derived from the properties of the PMS stars inside the H II region. Between the class II sources in the bubble and the PMS stars in the H II region, no age difference could be detected with the present data. The presence of the class 0/I sources in the molecular cloud, however, suggests that the objects inside the molecular cloud are significantly younger. The most likely scenario for the formation of the three regions is that star formation propagated from south to north. First the bubble is formed, produced by intermediate- and low-mass stars only, after that, the H II region is formed from a dense core at the edge of the molecular cloud, resulting in the expansion similar to a champagne flow. More recently, star formation occurred in the rest of the molecular cloud. Two different formation scenarios are possible. (1) The bubble with the cluster of low- and intermediate-mass stars triggered the formation of the O star at the edge of the molecular cloud, which in its turn induces the current star formation in the molecular cloud. (2) An external triggering is

  18. Optical polarimetric and near-infrared photometric study of the RCW95 Galactic H II region

    Science.gov (United States)

    Vargas-González, J.; Roman-Lopes, A.; Santos, F. P.; Franco, G. A. P.; Santos, J. F. C.; Maia, F. F. S.; Sanmartim, D.

    2018-02-01

    We carried out an optical polarimetric study in the direction of the RCW 95 star-forming region in order to probe the sky-projected magnetic field structure by using the distribution of linear polarization segments which seem to be well aligned with the more extended cloud component. A mean polarization angle of θ = 49.8° ± 7.7°7 was derived. Through the spectral dependence analysis of polarization it was possible to obtain the total-to-selective extinction ratio (RV) by fitting the Serkowski function, resulting in a mean value of RV = 2.93 ± 0.47. The foreground polarization component was estimated and is in agreement with previous studies in this direction of the Galaxy. Further, near-infrared (NIR) images from Vista Variables in the Via Láctea (VVV) survey were collected to improve the study of the stellar population associated with the H II region. The Automated Stellar Cluster Analysis algorithm was employed to derive structural parameters for two clusters in the region, and a set of PAdova and TRieste Stellar Evolution Code (PARSEC) isochrones was superimposed on the decontaminated colour-magnitude diagrams to estimate an age of about 3 Myr for both clusters. Finally, from the NIR photometry study combined with spectra obtained with the Ohio State Infrared Imager and Spectrometer mounted at the Southern Astrophysics Research Telescope we derived the spectral classification of the main ionizing sources in the clusters associated with IRAS 15408-5356 and IRAS 15412-5359, both objects classified as O4V stars.

  19. Recovery of carboxylic acids produced during dark fermentation of food waste by adsorption on Amberlite IRA-67 and activated carbon.

    Science.gov (United States)

    Yousuf, Ahasa; Bonk, Fabian; Bastidas-Oyanedel, Juan-Rodrigo; Schmidt, Jens Ejbye

    2016-10-01

    Amberlite IRA-67 and activated carbon were tested as promising candidates for carboxylic acid recovery by adsorption. Dark fermentation was performed without pH control and without addition of external inoculum at 37°C in batch mode. Lactic, acetic and butyric acids, were obtained, after 7days of fermentation. The maximum acid removal, 74%, from the Amberlite IRA-67 and 63% from activated carbon was obtained from clarified fermentation broth using 200gadsorbent/Lbroth at pH 3.3. The pH has significant effect and pH below the carboxylic acids pKa showed to be beneficial for both the adsorbents. The un-controlled pH fermentation creates acidic environment, aiding in adsorption by eliminating use of chemicals for efficient removal. This study proposes simple and easy valorization of waste to valuable chemicals. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Development and validation of a questionnaire (the IRA-AGHN to assess teachers' knowledge of Attention Deficit Hyperactivity Disorder

    Directory of Open Access Journals (Sweden)

    Marian Soroa

    2014-10-01

    Full Text Available The purpose of this study was to develop a questionnaire, called IRA-AGHN, to assess infant and primary school teachers' knowledge of Attention Deficit Hyperactivity Disorder. The psychometric properties of this questionnaire were examined in a sample of 752 teachers aged between 20 and 64 years (M = 41.57; SD = 9.69. These teachers were employed at 84 randomly selected schools in the Autonomous Community of the Basque Country and Navarre. The factor validity, internal consistency, temporal stability, convergent validity and external validity of the instrument were all analysed. The results suggest that the IRA-AGHN is a valid and reliable measure for assessing teachers' knowledge of ADHD.

  1. La ira de Dios: sobre ‘Relatos salvajes’ de Damián Szifrón

    Directory of Open Access Journals (Sweden)

    Gonzalo Aguilar

    2017-12-01

    Full Text Available “La ira de Dios (sobre ‘Relatos salvajes’ de Damián Szifrón” propone un debate sobre una de las películas argentinas más exitosas de todos los tiempos. En polémica con las lecturas que señalaban y cuestionaban el carácter prepolítico del film y su uso de las pasiones más bajas del público, este ensayo busca otro camino: por un lado, analizar la ira como uno de los capitales políticos más importantes y decisivos de la sociedad contemporánea. Por otro, investigar los vínculos entre la película Relatos salvajes y la pospolítica en la sociedad del espectáculo.

  2. The role of personality in the transmission of cultural forms an example of the bearer of regional traditions in central Moravia (the ethnographic area of Haná

    Directory of Open Access Journals (Sweden)

    Válka Miroslav

    2017-01-01

    Full Text Available The ethnographic area of Haná in Central Moravia (Czech Republic has been among distinctive ethnographic regions since the 16th century. Even though traditional regional forms had gradually disappeared as a consequence of the modernization of village life, these returned alongside new functions in terms of national consciousness from the late 19th century. It was the intelligentsia, mainly teachers, priests, physicians and artists, who contributed to the spread of these forms. The personalities´ activities did not stop even in the 20th century. The teacher Marie Pachtová (born 1932 is an example of one such person (in study by Miroslav Válka. She not only led a children´s folklore ensemble, moderated programmes aimed at presentation of folklore, and worked as a lector, but she also tries to involve older folk traditions of Haná in the present cultural calendar of the town where she lives. Among other things, she was instrumental in the preservation of the production of Easter eggs from Haná which are decorated with stuck-on straw. She paid similar attention to the ceremonial pastries. With the focus of this example, it is possible to prove the transformations of regional culture´s expression into the contemporary social life as well as the mechanism of the creation of a new tradition.

  3. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg

    2013-12-01

    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  4. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg

    2013-11-01

    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  5. ON THE NATURE OF THE ENIGMATIC OBJECT IRAS 19312+1950: A RARE PHASE OF MASSIVE STAR FORMATION?

    Energy Technology Data Exchange (ETDEWEB)

    Cordiner, M. A.; Charnley, S. B.; Milam, S. N. [Astrochemistry Laboratory, NASA Goddard Space Flight Center, Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Boogert, A. C. A. [Universities Space Research Association, Stratospheric Observatory for Infrared Astronomy, NASA Ames Research Center, MS 232-11, Moffett Field, CA 94035 (United States); Justtanont, K.; Wirström, E. S. [Department of Earth and Space Sciences, Chalmers University of Technology, Onsala Space Observatory, SE-439 92, Onsala (Sweden); Cox, N. L. J. [Instituut voor Sterrenkunde, KU Leuven, Celestijnenlaan 200D, bus 2401, B-3001, Leuven (Belgium); Smith, R. G. [School of Physical, Environmental and Mathematical Sciences, The University of New South Wales, Australian Defence Force Academy, Canberra ACT 2600 (Australia); Tielens, A. G. G. M. [Leiden Observatory, University of Leiden, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Keane, J. V., E-mail: martin.cordiner@nasa.gov [Institute for Astronomy, University of Hawaii, Honolulu, HI 96822 (United States)

    2016-09-01

    IRAS 19312+1950 is a peculiar object that has eluded firm characterization since its discovery, with combined maser properties similar to an evolved star and a young stellar object (YSO). To help determine its true nature, we obtained infrared spectra of IRAS 19312+1950 in the range 5–550 μ m using the Herschel and Spitzer space observatories. The Herschel PACS maps exhibit a compact, slightly asymmetric continuum source at 170 μ m, indicative of a large, dusty circumstellar envelope. The far-IR CO emission line spectrum reveals two gas temperature components: ≈0.22 M {sub ⊙} of material at 280 ± 18 K, and ≈1.6 M {sub ⊙} of material at 157 ± 3 K. The O i 63 μ m line is detected on-source but no significant emission from atomic ions was found. The HIFI observations display shocked, high-velocity gas with outflow speeds up to 90 km s{sup −1} along the line of sight. From Spitzer spectroscopy, we identify ice absorption bands due to H{sub 2}O at 5.8 μ m and CO{sub 2} at 15 μ m. The spectral energy distribution is consistent with a massive, luminous (∼2 × 10{sup 4} L {sub ⊙}) central source surrounded by a dense, warm circumstellar disk and envelope of total mass ∼500–700 M {sub ⊙}, with large bipolar outflow cavities. The combination of distinctive far-IR spectral features suggest that IRAS 19312+1950 should be classified as an accreting, high-mass YSO rather than an evolved star. In light of this reclassification, IRAS 19312+1950 becomes only the fifth high-mass protostar known to exhibit SiO maser activity, and demonstrates that 18 cm OH maser line ratios may not be reliable observational discriminators between evolved stars and YSOs.

  6. On the Nature of the Enigmatic Object IRAS 19312+1950: A Rare Phase of Massive Star Formation?

    Science.gov (United States)

    Cordiner, M. A.; Boogert, A. C. A.; Charnley, S. B.; Justtanont, K.; Cox, N. L. J.; Smith, R. G.; Tielens, A. G. G. M.; Wirstrom, E. S.; Milam, S. N.; Keane, J. V.

    2016-01-01

    IRAS?19312+1950 is a peculiar object that has eluded firm characterization since its discovery, with combined maser properties similar to an evolved star and a young stellar object (YSO). To help determine its true nature, we obtained infrared spectra of IRAS?19312+1950 in the range 5-550 microns using the Herschel and Spitzer space observatories. The Herschel PACS maps exhibit a compact, slightly asymmetric continuum source at 170 microns, indicative of a large, dusty circumstellar envelope. The far-IR CO emission line spectrum reveals two gas temperature components: approx. = 0.22 Stellar Mass of material at 280+/-18 K, and ˜1.6 Me of material at 157+/-3 K. The OI 63 micron line is detected on-source but no significant emission from atomic ions was found. The HIFI observations display shocked, high-velocity gas with outflow speeds up to 90 km/s along the line of sight. From Spitzer spectroscopy, we identify ice absorption bands due to H2O at 5.8 microns and CO2 at 15 microns. The spectral energy distribution is consistent with a massive, luminous (approx. 2 × 10(exp 4) Stellar Luminosity) central source surrounded by a dense, warm circumstellar disk and envelope of total mass approx. 500-700 Stellar Mass with large bipolar outflow cavities. The combination of distinctive far-IR spectral features suggest that IRAS19312+1950 should be classified as an accreting, high-mass YSO rather than an evolved star. In light of this reclassification, IRAS19312+1950 becomes only the fifth high-mass protostar known to exhibit SiO maser activity, and demonstrates that 18 cm OH maser line ratios may not be reliable observational discriminators between evolved stars and YSOs.

  7. Ira as a pioneer in audiology: His contributions to the clinical measurement of hearing and hearing impairment

    Science.gov (United States)

    Formby, C.; Gagne, J. P.

    2002-05-01

    Ira Hirsh's contributions to clinical science and research are diverse and significant. In fact, approximately one-third of the 100+ publications that Ira lists in his curriculum vitae (CV) are clinical in nature, dealing with various aspects of audiology, deafness, hearing aids, aural rehabilitation, and speech and language pathology. The majority of these citations, fully one-quarter of his publication list, addresses problems specific to the clinical measurement of hearing and hearing impairment. Undoubtedly, the most influential of these published works appears in his CV under the citation ``The Measurement of Hearing.'' The forward for this publication, his only textbook, was penned in June, 1952 (now precisely half a century past at the time of this session). The aims of this presentation are to (1) provide perspective on the fundamental importance of his virtually timeless text in shaping the fledgling discipline of audiology, and (2) celebrate Ira's many contributions to the profession and practice of audiology. [Preparation for this presentation was supported, in part, by a K24 career development award from NIDCD.

  8. Current Diagnosis and Management of Immune Related Adverse Events (irAEs Induced by Immune Checkpoint Inhibitor Therapy

    Directory of Open Access Journals (Sweden)

    Vivek Kumar

    2017-02-01

    Full Text Available The indications of immune checkpoint inhibitors (ICIs are set to rise further with the approval of newer agent like atezolimumab for use in patients with advanced stage urothelial carcinoma. More frequent use of ICIs has improved our understanding of their unique side effects, which are known as immune-related adverse events (irAEs. The spectrum of irAEs has expanded beyond more common manifestations such as dermatological, gastrointestinal and endocrine effects to rarer presentations involving nervous, hematopoietic and urinary systems. There are new safety data accumulating on ICIs in patients with previously diagnosed autoimmune conditions. It is challenging for clinicians to continuously update their working knowledge to diagnose and manage these events successfully. If diagnosed timely, the majority of events are completely reversible, and temporary immunosuppression with glucocorticoids, infliximab or other agents is warranted only in the most severe grade illnesses. The same principles of management will possibly apply as newer anti- cytotoxic T lymphocytes-associated antigen 4 (CTLA-4 and programmed cell death protein 1 (PD-1/PD-L1 antibodies are introduced. The current focus of research is for prophylaxis and for biomarkers to predict the onset of these toxicities. In this review we summarize the irAEs of ICIs and emphasize their growing spectrum and their management algorithms, to update oncology practitioners.

  9. IRAS 14348-1447, an Ultraluminous Pair of Colliding, Gas-Rich Galaxies: The Birth of a Quasar?

    Science.gov (United States)

    Sanders, D B; Scoville, N Z; Soifer, B T

    1988-02-05

    Ground-based observations of the object IRAS 14348-1447, which was discovered with the Infrared Astronomical Satellite, show that it is an extremely luminous colliding galaxy system that emits more than 95 percent of its energy at far-infrared wavelengths. IRAS 14348-1447, which is receeding from the sun at 8 percent of the speed of light, has a bolometric luminosity more than 100 times larger than that of our galaxy, and is therefore as luminous as optical quasars. New optical, infrared, and spectroscopic measurements suggest that the dominant luminosity source is a dustenshrouded quasar. The fuel for the intense activity is an enormous supply of molecular gas. Carbon monoxide emission has been detected at a wavelength of 2.6 millimeters by means of a new, more sensitive receiver recently installed on the 12-meter telescope of the National Radio Astronomy Observatory. IRAS 14348-1447 is the most distant and luminous source of carbon monoxide line emission yet detected. The derived mass of interstellar molecular hydrogen is 6 x 10(10) solar masses. This value is approximately 20 times that of the molecular gas content of the Milky Way and is similar to the largest masses of atomic hydrogen found in galaxies. A large mass of molecular gas may be a prerequisite for the formation of quasars during strong galactic collisions.

  10. Adsorption of uranium(VI) from sulphate solutions using Amberlite IRA-402 resin: Equilibrium, kinetics and thermodynamics study

    International Nuclear Information System (INIS)

    Solgy, Mostafa; Taghizadeh, Majid; Ghoddocynejad, Davood

    2015-01-01

    Highlights: • Adsorption of uranium from sulphate solutions by an anion exchange resin. • The effects of pH, contact time and adsorbent dosage were investigated. • The adsorption equilibrium is well described by the Freundlich isotherm model. • The adsorption kinetics can be predicted by the pseudo second-order model. • The adsorption is a physical, spontaneous and endothermic process. - Abstract: In the present study, adsorption of uranium from sulphate solutions was evaluated using Amberlite IRA-402 resin. The variation of adsorption process was investigated in batch sorption mode. The parameters studied were pH, contact time and adsorbent dosage. Langmuir and Freundlich isotherm models were used in order to present a mathematical description of the equilibrium data at three different temperatures (25 °C, 35 °C and 45 °C). The final results confirmed that the equilibrium data tend to follow Freundlich isotherm model. The maximum adsorption capacity of Amberlite IRA-402 for uranium(VI) was evaluated to be 213 mg/g for the Langmuir model at 25 °C. The adsorption of uranium on the mentioned anion exchange resin was found to follow the pseudo-second order kinetic model, indicating that chemical adsorption was the rate limiting-step. The values of thermodynamic parameters proved that adsorption process of uranium onto Amberlite IRA-402 resin could be considered endothermic (ΔH > 0) and spontaneous (ΔG < 0)

  11. Monte Carlo calculations and experimental measurements of dosimetric parameters of the IRA-103Pd source

    International Nuclear Information System (INIS)

    Sadeghi, Mahdi; Hosseini, Hamed; Raisali, Gholamreza

    2008-01-01

    Full text: The use of 103 Pd seed sources for permanent prostate implantation has become a popular brachytherapy application. As recommended by AAPM the dosimetric characteristics of the new source must be determined using experimental and Monte Carlo simulations, before its use in clinical applications thus The goal of this report is the experimental and theoretical determination of the dosimetric characteristics of this source following the recommendations in the AAPM TG-43U1 protocol. Figure 1 shows the geometry of the IRA- 103 Pd source. The source consists of a cylindrical silver core, 0.3 cm long x 0.05 cm in diameter, onto which 0.5 nm layer of 103 Pd has been uniformly adsorbed. The effective active length of source is 0.3 cm and the silver core encapsulated inside a hollow titanium tube with 0.45 cm long, 0.07 cm and 0.08 inner and outer diameters and two caps. The Monte Carlo N-Particle (MCNP) code, version 4C, was used to determine the relevant dosimetric parameters of the source. The geometry of the Monte Carlo simulation performed in this study consisted of a sphere with 30 cm diameter. Dose distributions around this source were measured in two Perspex phantom using enough TLD chips. For these measurements, slabs of Perspex material were machined to accommodate the source and TLD chips. A value of 0.67± 1% cGy.h -1 .U -1 for, Λ, was calculated as the ratio of d(r 0 ,θ 0 ) and s K , that may be compared with Λ values obtained for 103 Pd sources. Result of calculations and measurements values of dosimetric parameters of the source including radial dose function, g(r), and anisotropy function, F(r,θ), has been shown in separate figures. The radial dose function, g(r), for the IRA- 103 Pd source and other 103 Pd sources is included in Fig. 2. Comparison between measured and Monte Carlo simulated dose function, g(r), and anisotropy function, F(r,θ), of this source demonstrated that they are in good agreement with each other and The value of Λ is

  12. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  13. Spatially resolved chemistry in nearby galaxies. III. Dense molecular gas in the inner disk of the LIRG IRAS 04296+2923

    Energy Technology Data Exchange (ETDEWEB)

    Meier, David S. [Department of Physics, New Mexico Institute of Mining and Technology, 801 Leroy Place, Socorro, NM 87801 (United States); Turner, Jean L. [Department of Physics and Astronomy, UCLA, Los Angeles, CA 90095-1547 (United States); Beck, Sara C., E-mail: dmeier@nmt.edu, E-mail: turner@astro.ucla.edu, E-mail: sara@wise.tau.ac.il [Department of Physics and Astronomy, Tel Aviv University, 69978 Ramat Aviv (Israel)

    2014-11-10

    We present a survey of 3 mm molecular lines in IRAS 04296+2923, one of the brightest known molecular-line emitting galaxies, and one of the closest luminous infrared galaxies (LIRGs). Data are from the Owens Valley and CARMA millimeter interferometers. Species detected at ≲ 4'' resolution include C{sup 18}O, HCN, HCO{sup +}, HNC, CN, CH{sub 3}OH, and, tentatively, HNCO. Along with existing CO, {sup 13}CO, and radio continuum data, these lines constrain the chemical properties of the inner disk. Dense molecular gas in the nucleus fuels a star formation rate ≳10 M {sub ☉} yr{sup –1} and is traced by lines of HCN, HCO{sup +}, HNC, and CN. A correlation between HCN and star formation rate is observed on sub-kiloparsec scales, consistent with global relations. Toward the nucleus, CN abundances are similar to those of HCN, indicating emission comes from a collection (∼40-50) of moderate visual extinction, photon-dominated-region clouds. The CO isotopic line ratios are unusual: CO(1-0)/{sup 13}CO(1-0) and CO(1-0)/C{sup 18}O(1-0) line ratios are large toward the starburst, as is commonly observed in LIRGs, but farther out in the disk these ratios are remarkably low (≲ 3). {sup 13}CO/C{sup 18}O abundance ratios are lower than in Galactic clouds, possibly because the C{sup 18}O is enriched by massive star ejecta from the starburst. {sup 13}CO is underabundant relative to CO. Extended emission from CH{sub 3}OH indicates that dynamical shocks pervade both the nucleus and the inner disk. The unusual CO isotopologue ratios, the CO/HCN intensity ratio versus L {sub IR}, the HCN/CN abundance ratio, and the gas consumption time versus inflow rate all indicate that the starburst in IRAS 04296+2923 is in an early stage of development.

  14. High-resolution observations of IRAS 08544-4431. Detection of a disk orbiting a post-AGB star and of a slow disk wind

    Science.gov (United States)

    Bujarrabal, V.; Castro-Carrizo, A.; Winckel, H. Van; Alcolea, J.; Contreras, C. Sánchez; Santander-García, M.; Hillen, M.

    2018-06-01

    Context. Aims: In order to study the effects of rotating disks in the post-asymptotic giant branch (post-AGB) evolution, we observe a class of binary post-AGB stars that seem to be systematically surrounded by equatorial disks and slow outflows. Although the rotating dynamics had only been well identified in three cases, the study of such structures is thought to be fundamental to the understanding of the formation of disks in various phases of the late evolution of binary stars and the ejection of planetary nebulae from evolved stars. Methods: We present ALMA maps of 12CO and 13CO J = 3-2 lines in the source IRAS 08544-4431, which belongs to the above mentioned class of objects. We analyzed the data by means of nebula models, which account for the expectedly composite source and can reproduce the data. From our modeling, we estimated the main nebula parameters, including the structure and dynamics and the density and temperature distributions. We discuss the uncertainties of the derived values and, in particular, their dependence on the distance. Results: Our observations reveal the presence of an equatorial disk in rotation; a low-velocity outflow is also found, probably formed of gas expelled from the disk. The main characteristics of our observations and modeling of IRAS 08544-4431 are similar to those of better studied objects, confirming our interpretation. The disk rotation indicates a total central mass of about 1.8 M⊙, for a distance of 1100 pc. The disk is found to be relatively extended and has a typical diameter of 4 × 1016 cm. The total nebular mass is 2 × 10-2 M⊙, of which 90% corresponds to the disk. Assuming that the outflow is due to mass loss from the disk, we derive a disk lifetime of 10 000 yr. The disk angular momentum is found to be comparable to that of the binary system at present. Assuming that the disk angular momentum was transferred from the binary system, as expected, the high values of the disk angular momentum in this and other

  15. Infrared spectrophotometry of Comet IRAS-Araki-Alcock (1983d) - A bare nucleus revealed?

    Science.gov (United States)

    Hanner, M. S.; Aitken, D. K.; Knacke, R.; Mccorkle, S.; Roche, P. F.; Tokunaga, A. T.

    1985-01-01

    Spectra of the central core and surrounding coma of Comet IRAS-Araki-Alcock (1983d) were obtained at 8-13 microns on May 11 and 2-4 microns on May 12, 1983. Spatially resolved measurements at 10 microns with a 4-arcsec beam showed that the central core was more than 100 times brighter than the inner coma only 8 arcsec away; for radially outflowing dust, the brightness ratio would be a factor of 8. The observations of the central core are consistent with direct detection of a nucleus having a radius of approximately 5 km. The temperature of the sunlit hemisphere was greater than 300 K. Spectra of the core are featureless, while spectra of the coma suggest weak silicate emission. The spectra show no evidence for icy grains. The dust production rate on May 11.4 was about 100,000 g/sec, assuming that the gas flux from the dust-producing areas on the nucleus was about 0.00001 g/sq cm per sec.

  16. RECTIFIED ASTEROID ALBEDOS AND DIAMETERS FROM IRAS AND MSX PHOTOMETRY CATALOGS

    International Nuclear Information System (INIS)

    Ryan, Erin Lee; Woodward, Charles E.

    2010-01-01

    Rectified diameters and albedo estimates of 1517 main-belt asteroids selected from IRAS and the Mid-Course Space Experiment asteroid photometry catalogs are derived from updated infrared thermal models, the Standard Thermal Model and the Near-Earth Asteroid Thermal Model (NEATM), and Monte Carlo simulations, using new Minor Planet Center compilations of absolute magnitudes (H values) constrained by occultation- and radar-derived parameters. The NEATM approach produces a more robust estimate of albedos and diameters, yielding albedos of p v (NEATM mean) =0.081 ± 0.064. The asteroid beaming parameter (η) for the selected asteroids has a mean value of 1.07 ± 0.27, and the smooth distribution of η suggests that this parameter is independent of asteroid properties such as composition. No trends in η due to size-dependent rotation rates are evident. Comparison of derived values of η as a function of taxonomic type indicates that the beaming parameter values for S- and C-type asteroids are identical within the standard deviation of the population of beaming parameters.

  17. PHYSICAL CONDITIONS IN THE ULTRAVIOLET ABSORBERS OF IRAS F22456-5125

    International Nuclear Information System (INIS)

    Dunn, Jay P.; Crenshaw, D. Michael; Trippe, M. L.; Kraemer, S. B.

    2010-01-01

    We present the ultraviolet (UV) and X-ray spectra observed with the Far Ultraviolet Spectroscopic Explorer (FUSE) and the XMM-Newton satellite, respectively, of the low-z Seyfert 1 galaxy IRAS F22456 - 5125. This object shows absorption from five distinct, narrow kinematic components that span a significant range in velocity (∼0 to -700 km s -1 ) and ionization (Lyman series, C III, N III, and O VI). We also show that three of the five kinematic components in these lines appear to be saturated in Lyβ λ1026 and that all five components show evidence of saturation in the O VI doublet lines λλ1032, 1038. Further, all five components show evidence for partial covering due to the absorption seen in the O VI doublet. This object is peculiar because it shows no evidence for corresponding X-ray absorption to the UV absorption in the X-ray spectrum, which violates the 1:1 correlation known for low-z active galactic nuclei (AGNs). We perform photoionization modeling of the UV absorption lines and predict that the O VII column density should be small, which would produce little to no absorption in agreement with the X-ray observation. We also examine the UV variability of the continuum flux for this object (an increase of a factor of 6). As the absorption components lack variability, we find a lower limit of ∼20 kpc for the distance for the absorbers from the central AGN.

  18. Serendipitous discovery of warm absorbers in the Seyfert 2 galaxy IRAS 18325-5926

    International Nuclear Information System (INIS)

    Zhang Shuinai; Gu Qiusheng; Peng Zhixin; Ji Li

    2011-01-01

    Warm absorption is a common phenomenon in Seyfert 1s and quasars, but is rare in Seyfert 2s. We report the detection of warm absorbers with high energy resolution in the Seyfert 2 galaxy IRAS 18325-5926 for the first time with Chandra HETGS spectra. An intrinsic absorbing line system with an outflow velocity ∼ 400 km s -1 was found, which is contributed by two warm absorbers with FWHM of 570 km s -1 and 1360 km s -1 , respectively. The two absorbers were adjacent, and moving transversely across our line of sight. We constrained the distance between the center and the absorbers to be a small value, suggesting that the absorbers may originate from the highly ionized accretion disk wind ejected five years ago. The perspective of this type 2 Seyfert provides the best situation in which to investigate the vertical part of the funnel-like outflows. Another weak absorbing line system with zero redshift was also detected, which could be due to Galactic absorption with very high temperature or an intrinsic outflow with a very high velocity ∼ 6000 km s -1 . (research papers)

  19. Far-infrared data for symbiotic stars. II. The IRAS survey observations

    International Nuclear Information System (INIS)

    Kenyon, S.J.; Fernandez-Castro, T.; Stencel, R.E.

    1988-01-01

    IRAS survey data for all known symbiotic binaries are reported. S type systems have 25 micron excesses much larger than those of single red giant stars, suggesting that these objects lose mass more rapidly than do normal giants. D type objects have far-IR colors similar to those of Mira variables, implying mass-loss rate of about 10 to the -6th solar masses/yr. The near-IR extinctions of the D types indicate that their Mira components are enshrouded in optically thick dust shells, while their hot companions lie outside the shells. If this interpretation of the data is correct, then the very red near-IR colors of D type symbiotic stars are caused by extreme amounts of dust absorption rather than dust emission. The small group of D prime objects possesses far-IR colors resembling those of compact planetary nebulae or extreme OH/IR stars. It is speculated that these binaries are not symbiotic stars at all, but contain a hot compact star and an exasymptotic branch giant which is in the process of ejecting a planetary nebula shell. 42 references

  20. Local work-function changes of Pt(111) studied by STM and IRAS: coadsorption of Cl - with H 3O +, NO, and CO molecules

    Science.gov (United States)

    Fukushima, Takashi; Song, Moon-Bong; Ito, Masatoki

    2000-10-01

    The coadsorption of chloride anion (Cl -) with hydronium cation (H 3O +), nitrogen monoxide (NO), and carbon monoxide (CO) on Pt(111) was studied in an ultra-high-vacuum system using scanning tunneling microscopy (STM), infrared reflection absorption spectroscopy (IRAS), and low-energy electron diffraction (LEED). HCl molecules adsorbed on Pt(111) at 100 K form a (3×3) structure ( θCl -=0.44). Water adsorption on the 3×3 structure produces c(4×2)-(Cl -+H 3O +) coadsorption structures. The hydronium cation adsorbs through oxygen lone pair, and hydrogen bonding (OH…Cl) extends on the surface with these structures. Stretching absorption bands of NO (or CO) adsorbed on the 3×3-Cl - and c(4×2)-(Cl -+H 3O +) adlayers on Pt(111) show remarkably higher and lower frequency shifts, respectively. The frequency shifts can be explained by the local charge density states of platinum atoms derived from electron withdrawal or supply from the coadsorbates (Cl - or H 3O +) to platinum atoms.

  1. Substitutions in conserved regions preceding and within the linker affect activity and flexibility of tRNase ZL, the long form of tRNase Z.

    Directory of Open Access Journals (Sweden)

    Makenzie Saoura

    Full Text Available The enzyme tRNase Z, a member of the metallo-β-lactamase family, endonucleolytically removes 3' trailers from precursor tRNAs, preparing them for CCA addition and aminoacylation. The short form of tRNase Z, tRNase ZS, functions as a homodimer and is found in all prokaryotes and some eukaryotes. The long form, tRNase ZL, related to tRNase ZS through tandem duplication and found only in eukaryotes, possesses ~2,000-fold greater catalytic efficiency than tRNase ZS. tRNase ZL consists of related but diverged amino and carboxy domains connected by a flexible linker (also referred to as a flexible tether and functions as a monomer. The amino domain retains the flexible arm responsible for substrate recognition and binding while the carboxy domain retains the active site. The linker region was explored by Ala-scanning through two conserved regions of D. melanogaster tRNase Z: NdomTprox, located at the carboxy end of the amino domain proximal to the linker, and Tflex, a flexible site in the linker. Periodic substitutions in a hydrophobic patch (F329 and L332 at the carboxy end of NdomTprox show 2,700 and 670-fold impairment relative to wild type, respectively, accompanied by reduced linker flexibility at N-T inside the Ndom- linker boundary. The Ala substitution for N378 in the Tflex region has 10-fold higher catalytic efficiency than wild type and locally decreased flexibility, while the Ala substitution at R382 reduces catalytic efficiency ~50-fold. These changes in pre-tRNA processing kinetics and protein flexibility are interpreted in light of a recent crystal structure for S. cerevisiae tRNase Z, suggesting transmission of local changes in hydrophobicity into the skeleton of the amino domain.

  2. The Star Formation in Radio Survey: Jansky Very Large Array 33 GHz Observations of Nearby Galaxy Nuclei and Extranuclear Star-forming Regions

    Science.gov (United States)

    Murphy, E. J.; Dong, D.; Momjian, E.; Linden, S.; Kennicutt, R. C., Jr.; Meier, D. S.; Schinnerer, E.; Turner, J. L.

    2018-02-01

    We present 33 GHz imaging for 112 pointings toward galaxy nuclei and extranuclear star-forming regions at ≈2″ resolution using the Karl G. Jansky Very Large Array (VLA) as part of the Star Formation in Radio Survey. A comparison with 33 GHz Robert C. Byrd Green Bank Telescope single-dish observations indicates that the interferometric VLA observations recover 78% ± 4% of the total flux density over 25″ regions (≈kpc scales) among all fields. On these scales, the emission being resolved out is most likely diffuse non-thermal synchrotron emission. Consequently, on the ≈30–300 pc scales sampled by our VLA observations, the bulk of the 33 GHz emission is recovered and primarily powered by free–free emission from discrete H II regions, making it an excellent tracer of massive star formation. Of the 225 discrete regions used for aperture photometry, 162 are extranuclear (i.e., having galactocentric radii r G ≥ 250 pc) and detected at >3σ significance at 33 GHz and in Hα. Assuming a typical 33 GHz thermal fraction of 90%, the ratio of optically-thin 33 GHz to uncorrected Hα star formation rates indicates a median extinction value on ≈30–300 pc scales of A Hα ≈ 1.26 ± 0.09 mag, with an associated median absolute deviation of 0.87 mag. We find that 10% of these sources are “highly embedded” (i.e., A Hα ≳ 3.3 mag), suggesting that on average, H II regions remain embedded for ≲1 Myr. Finally, we find the median 33 GHz continuum-to-Hα line flux ratio to be statistically larger within r G < 250 pc relative to the outer disk regions by a factor of 1.82 ± 0.39, while the ratio of 33 GHz to 24 μm flux densities is lower by a factor of 0.45 ± 0.08, which may suggest increased extinction in the central regions.

  3. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  4. Rapid intranasal delivery of chloramphenicol acetyltransferase in the active form to different brain regions as a model for enzyme therapy in the CNS.

    Science.gov (United States)

    Appu, Abhilash P; Arun, Peethambaran; Krishnan, Jishnu K S; Moffett, John R; Namboodiri, Aryan M A

    2016-02-01

    The blood brain barrier (BBB) is critical for maintaining central nervous system (CNS) homeostasis by restricting entry of potentially toxic substances. However, the BBB is a major obstacle in the treatment of neurotoxicity and neurological disorders due to the restrictive nature of the barrier to many medications. Intranasal delivery of active enzymes to the brain has therapeutic potential for the treatment of numerous CNS enzyme deficiency disorders and CNS toxicity caused by chemical threat agents. The aim of this work is to provide a sensitive model system for analyzing the rapid delivery of active enzymes into various regions of the brain with therapeutic bioavailability. We tested intranasal delivery of chloramphenicol acetyltransferase (CAT), a relatively large (75kD) enzyme, in its active form into different regions of the brain. CAT was delivered intranasally to anaesthetized rats and enzyme activity was measured in different regions using a highly specific High Performance Thin Layer Chromatography (HP-TLC)-radiometry coupled assay. Active enzyme reached all examined areas of the brain within 15min (the earliest time point tested). In addition, the yield of enzyme activity in the brain was almost doubled in the brains of rats pre-treated with matrix metalloproteinase-9 (MMP-9). Intranasal administration of active enzymes in conjunction with MMP-9 to the CNS is both rapid and effective. The present results suggest that intranasal enzyme therapy is a promising method for counteracting CNS chemical threat poisoning, as well as for treating CNS enzyme deficiency disorders. Published by Elsevier B.V.

  5. Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

    International Nuclear Information System (INIS)

    Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.

    1995-01-01

    A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

  6. Physical and chemical differentiation of the luminous star-forming region W49A. Results from the JCMT Spectral Legacy Survey

    Science.gov (United States)

    Nagy, Z.; van der Tak, F. F. S.; Fuller, G. A.; Plume, R.

    2015-05-01

    Context. The massive and luminous star-forming region W49A is a well-known Galactic candidate to probe the physical conditions and chemistry similar to those expected in external starburst galaxies. Aims: We aim to probe the physical and chemical structure of W49A on a spatial scale of ~0.8 pc based on the JCMT Spectral Legacy Survey, which covers the frequency range between 330 and 373 GHz. Methods: The wide 2 × 2 arcmin field and the high spectral resolution of the HARP instrument on JCMT provides information on the spatial structure and kinematics of the cloud traced by the observed molecular lines. For species where multiple transitions are available, we estimate excitation temperatures and column densities using a population diagram method that takes beam dilution and optical depth corrections into account. Results: We detected 255 transitions corresponding to 63 species in the 330-373 GHz range at the center position of W49A. Excitation conditions can be probed for 14 molecules, including the complex organic molecules CH3CCH, CH3CN, and CH3OH. The chemical composition suggests the importance of shock, photon-dominated region (PDR), and hot core chemistry. Many molecular lines show a significant spatial extent across the maps including CO and its isotopologues, high density tracers (e.g., HCN, HNC, CS, HCO+), and tracers of UV irradiation (e.g., CN and C2H). The spatially extended species reveal a complex velocity-structure of W49A with possible infall and outflow motions. Large variations are seen between the subregions with mostly blue-shifted emission toward the eastern tail, mostly red-shifted emission toward the northern clump, and emission peaking around the expected source velocity toward the southwest clump. Conclusions: A comparison of column density ratios of characteristic species observed toward W49A to Galactic PDRs suggests that while the chemistry toward the W49A center is driven by a combination of UV irradiation and shocks, UV irradiation

  7. Discontinuous drainage systems formed by highland precipitation and ground-water outflow in the Navua Valles and southwest Hadriacus Mons regions, Mars

    Science.gov (United States)

    Hargitai, H. I.; Gulick, V. C.; Glines, N. H.

    2017-09-01

    The Navua Valles are systems of paleodrainages located north of Dao Vallis, which empty into Hellas Planitia, the largest impact basin on Mars. In this study, we mapped and characterized the Navua Valles Region's individual drainage systems, including drainages along the southwestern flank of Hadriacus Mons, and one valley network from the same source as Navua Valles but flowing in the opposite direction. The major drainage systems share morphological characteristics common to both outflow channels and valley networks. The slopes in this region are dissected by two major Navua drainage systems (here Navua A* and B*) and several shorter, sub-parallel valleys formed on the highest gradient (approximately 20 m/km [1.15°]) slopes, at the lowest part of Hellas Basin's rim. The two major drainage systems originate in the highlands, and empty into the basin. Our mapping suggests that water in Navua Valles reached the basin floor in a complicated descent and included several episodes of surface ponding, surface runoff, infiltration, subsurface flow and subsequent outflow. The most prominent channel system, Navua A, forms a repetitive sequence of deep incision into bedrock, followed by a transition into broad channels in erodible materials, and then into unconfined deposits. This successive erosion-transport-deposition sequence continues to repeat along the valley's entire length forming a discontinuous pattern that is consistent with classical fluvial process models. The channels cut into volcanic plains likely emplaced from the formation of Tyrrhenus and Hadriacus Montes. The dendritic source valleys of Navua A originate from the rim of a highland crater while the rest of this subsystem consists of a single, discontinuous channel which is consistent with a single water source zone that likely supplied water for all channels downslope. These drainages may have formed as discontinuous channels, revealing the potential existence of subsurface drainage pathways located

  8. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  9. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. III. HP TAU/G2 AND THE THREE-DIMENSIONAL STRUCTURE OF TAURUS

    International Nuclear Information System (INIS)

    Torres, Rosa M.; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.

    2009-01-01

    Using multiepoch Very Long Baseline Array (VLBA) observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 ± 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the south of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to study the kinematics of the young stars in Taurus. Combining the four observations available so far, we estimate the peculiar velocity of Taurus to be about 10.6 km s -1 almost completely in a direction parallel to the Galactic plane. Using our improved distance measurement, we have refined the determination of the position on the H-R diagram of HP Tau/G2, and of two other members of the HP Tau group (HP Tau itself and HP Tau/G3). Most pre-main-sequence evolutionary models predict significantly discrepant ages (by 5 Myr) for those three stars-expected to be coeval. Only in the models of Palla and Stahler do they fall on a single isochrone (at 3 Myr).

  10. The environment and star formation of H II region Sh2-163: a multi-wavelength study

    Science.gov (United States)

    Yu, Naiping; Wang, Jun-Jie; Li, Nan

    2014-12-01

    To investigate the environment of H II region Sh2-163 and search for evidence of triggered star formation in this region, we performed a multi-wavelength study of this H II region. Most of our data were taken from large-scale surveys: 2MASS, CGPS, MSX and SCUBA. We also made CO molecular line observations, using the 13.7-m telescope. The ionized region of Sh2-163 is detected by both the optical and radio continuum observations. Sh2-163 is partially bordered by an arc-like photodissociation region (PDR), which is coincident with the strongest optical and radio emissions, indicating interactions between the H II region and the surrounding interstellar medium. Two molecular clouds were discovered on the border of the PDR. The morphology of these two clouds suggests they are compressed by the expansion of Sh2-163. In cloud A, we found two molecular clumps. And it seems star formation in clump A2 is much more active than in clump A1. In cloud B, we found new outflow activities and massive star(s) are forming inside. Using 2MASS photometry, we tried to search for embedded young stellar object (YSO) candidates in this region. The very good agreement between CO emission, infrared shell and YSOs suggest that it is probably a star formation region triggered by the expansion of Sh2-163. We also found the most likely massive protostar related to IRAS 23314+6033.

  11. ON THE ORIGIN OF THE MOLECULAR OUTFLOWS IN IRAS 16293–2422

    Energy Technology Data Exchange (ETDEWEB)

    Girart, Josep M.; Palau, Aina; Torrelles, José M. [Institut de Ciències de l' Espai, (CSIC-IEEC), Campus UAB, Facultat de Ciències, C5p 2, E-08193 Bellaterra, Catalonia (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia, Institut de Ciències del Cosmos (UB-IEEC), Martí i Franquès, Universitat de Barcelona, E-08028 Barcelona, Catalonia (Spain); Rao, Ramprasad, E-mail: girart@ice.cat [Institute of Astronomy and Astrophysics, Academia Sinica, 645 N. Aohoku Pl., Hilo, HI 96720 (United States)

    2014-01-01

    We present CO 3-2, SiO 8-7, C{sup 34}S 7-6, and 878 μm dust continuum subarcsecond angular resolution observations with the Submillimeter Array (SMA) toward the IRAS 16293–2422 (I16293) multiple low-mass protostellar system. The C{sup 34}S emission traces the 878 μm dust continuum well, and in addition clearly shows a smooth velocity gradient along the major axis of component I16293A. CO shows emission at moderate high velocities arising from two bipolar outflows, which appear to be perpendicular with respect to each other. The high sensitivity and higher angular resolution of these observations allows us to pinpoint well the origin of these two outflows at the center of component I16293A. Interestingly, the most compact outflow appears to point toward I16293B. Our data show that the previously reported monopolar blueshifted CO outflow associated with component I16293B seems to be part of the compact outflow arising from component I16293A. In addition, the SiO emission is also tracing this compact outflow: on the one hand, the SiO emission appears to have a jet-like morphology along the southern redshifted lobe; on the other hand, the SiO emission associated with the blueshifted northern lobe traces a well-defined arc on the border of component I16293B facing I16293A. The blueshifted CO lobe of the compact outflow splits into two lobes around the position of this SiO arc. All these results lead us to propose that the compact outflow from component I16293A is impacting on the circumstellar gas around component I16293B, possibly being diverged as a consequence of the interaction.

  12. Innovative Model of Practice-Oriented Training of Employees of the Town-Forming Enterprise in the Mining Region (by the Example of JSC "SUEK-Kuzbass")

    Science.gov (United States)

    Kulay, Svetlana; Kayachev, Gennady

    2017-11-01

    The article proposes to improve the system of training of employees of joint-stock company SUEK-Kuzbass in the educational institutions of the Kemerovo region according to the requirements of the company using practice-oriented training technology. The aim of the work is to substantiate the effectiveness of implementing practice-oriented training, identify priority directions and ways of its development. The main objectives of the study are: to identify the main advantages for the company and students; determine the criteria for the success and practical value of applying practice-oriented training for the company; conduct a comparative analysis of the target and practice-oriented model of training for the company. The real needs of the employer through the dual form of training were taking into account. The expansion of positive experience in training engineering personnel in higher education in technology-based training with the involvement of specialists from other regions of the company and expanding training in mining was also included.

  13. Far-infrared to Millimeter Data of Protoplanetary Disks: Dust Growth in the Taurus, Ophiuchus, and Chamaeleon I Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Ribas, Álvaro; Espaillat, Catherine C.; Macías, Enrique [Department of Astronomy, Boston University, Boston, MA 02215 (United States); Bouy, Hervé [Laboratoire d’Astrophysique de Bordeaux, Univ. Bordeaux, CNRS, F-33615 Pessac (France); Andrews, Sean; Wilner, David [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 91023 (United States); Calvet, Nuria [Astronomy Department, University of Michigan, Ann Arbor, MI 48109 (United States); Naylor, David A.; Van der Wiel, Matthijs H. D. [Institute for Space Imaging Science, Department of Physics and Astronomy, University of Lethbridge (Canada); Riviere-Marichalar, Pablo, E-mail: aribas@bu.edu [Instituto de Ciencia de Materiales de Madrid (CSIC). Calle Sor Juana Inés de la Cruz 3, E-28049 Cantoblanco, Madrid (Spain)

    2017-11-01

    Far-infrared and (sub)millimeter fluxes can be used to study dust in protoplanetary disks, the building blocks of planets. Here, we combine observations from the Herschel Space Observatory with ancillary data of 284 protoplanetary disks in the Taurus, Chamaeleon I, and Ophiuchus star-forming regions, covering from the optical to mm/cm wavelengths. We analyze their spectral indices as a function of wavelength and determine their (sub)millimeter slopes when possible. Most disks display observational evidence of grain growth, in agreement with previous studies. No correlation is found between other tracers of disk evolution and the millimeter spectral indices. A simple disk model is used to fit these sources, and we derive posterior distributions for the optical depth at 1.3 mm and 10 au, the disk temperature at this same radius, and the dust opacity spectral index β . We find the fluxes at 70 μ m to correlate strongly with disk temperatures at 10 au, as derived from these simple models. We find tentative evidence for spectral indices in Chamaeleon I being steeper than those of disks in Taurus/Ophiuchus, although more millimeter observations are needed to confirm this trend and identify its possible origin. Additionally, we determine the median spectral energy distribution of each region and find them to be similar across the entire wavelength range studied, possibly due to the large scatter in disk properties and morphologies.

  14. Different regions of the immunoglobulin heavy-chain locus are involved in chromosomal translocations in distinct pathogenic forms of Burkitt lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Neri, A.; Barriga, F.; Knowles, D.M.; Magrath, I.T.; Dalla-Favera, R.

    1988-04-01

    The authors show that endemic (eBL), sporadic (sBL), and acquired immunodeficiency syndrome-associated (AIDS-BL) forms of Burkitt lymphoma (BL) carrying t(8; 14) chromosomal translocations display different breakpoints within the immunoglobulin heavy-chain locus (IGH) on chromosome 14. In sBL (7 out of 11) and AIDS-BL (5 out of 6), the breakpoints occurred within or near the IGH ..mu.. switch (S/sub mu/) region on chromosome 14 and within the c-myc locus (MYC) on chromosome 8. In most eBL (13 out of 16) the breakpoints were mapped within or 5' to the IGH joining J/sub H/ region on chromosome 14 and outside the MYC locus on chromosome 8. Cloning and sequencing of the (8; 14) chromosomal junctions from two eBL cell lines and one eBL biopsy sample show that the recombination do not involve IGH-specific recombination signals on chromosome 14 or homologous sequences on chromosome 8, suggesting that these events are not likely to be mediated by the same mechanisms or enzymes as in IGH rearrangements. In general, these data have implications for the timing of occurrence of chromosomal translocations during B-cell differentiation in different BL types.

  15. A new crystal form of human tear lipocalin reveals high flexibility in the loop region and induced fit in the ligand cavity

    International Nuclear Information System (INIS)

    Breustedt, Daniel A.; Chatwell, Lorenz; Skerra, Arne

    2009-01-01

    The crystal structure of tear lipocalin determined in space group P2 1 revealed large structural deviations from the previously solved X-ray structure in space group C2, especially in the loop region and adjoining parts of the β-barrel which give rise to the ligand-binding site. These findings illustrate a novel mechanism for promiscuity in ligand recognition by the lipocalin protein family. Tear lipocalin (TLC) with the bound artificial ligand 1,4-butanediol has been crystallized in space group P2 1 with four protein molecules in the asymmetric unit and its X-ray structure has been solved at 2.6 Å resolution. TLC is a member of the lipocalin family that binds ligands with diverse chemical structures, such as fatty acids, phospholipids and cholesterol as well as microbial siderophores and the antibiotic rifampin. Previous X-ray structural analysis of apo TLC crystallized in space group C2 revealed a rather large bifurcated ligand pocket and a partially disordered loop region at the entrace to the cavity. Analysis of the P2 1 crystal form uncovered major conformational changes (i) in β-strands B, C and D, (ii) in loops 1, 2 and 4 at the open end of the β-barrel and (iii) in the extended C-terminal segment, which is attached to the β-barrel via a disulfide bridge. The structural comparison indicates high conformational plasticity of the loop region as well as of deeper parts of the ligand pocket, thus allowing adaptation to ligands that differ vastly in size and shape. This illustrates a mechanism for promiscuity in ligand recognition which may also be relevant for some other physiologically important members of the lipocalin protein family

  16. Radiative transfer modelling of W33A MM1: 3-D structure and dynamics of a complex massive star forming region

    Science.gov (United States)

    Izquierdo, Andrés F.; Galván-Madrid, Roberto; Maud, Luke T.; Hoare, Melvin G.; Johnston, Katharine G.; Keto, Eric R.; Zhang, Qizhou; de Wit, Willem-Jan

    2018-05-01

    We present a composite model and radiative transfer simulations of the massive star forming core W33A MM1. The model was tailored to reproduce the complex features observed with ALMA at ≈0.2 arcsec resolution in CH3CN and dust emission. The MM1 core is fragmented into six compact sources coexisting within ˜1000 au. In our models, three of these compact sources are better represented as disc-envelope systems around a central (proto)star, two as envelopes with a central object, and one as a pure envelope. The model of the most prominent object (Main) contains the most massive (proto)star (M⋆ ≈ 7 M⊙) and disc+envelope (Mgas ≈ 0.4 M⊙), and is the most luminous (LMain ˜ 104 L⊙). The model discs are small (a few hundred au) for all sources. The composite model shows that the elongated spiral-like feature converging to the MM1 core can be convincingly interpreted as a filamentary accretion flow that feeds the rising stellar system. The kinematics of this filament is reproduced by a parabolic trajectory with focus at the center of mass of the region. Radial collapse and fragmentation within this filament, as well as smaller filamentary flows between pairs of sources are proposed to exist. Our modelling supports an interpretation where what was once considered as a single massive star with a ˜103 au disc and envelope, is instead a forming stellar association which appears to be virialized and to form several low-mass stars per high-mass object.

  17. Infrared studies of H II regions: the Sharpless regions S148, 184, 198, 206 and 269

    International Nuclear Information System (INIS)

    Pismis, Paris

    1991-01-01

    We present the results of a combined near-infrared and IRAS mapping study of five H II regions for which fairly complete information at optical and radio wavelengths previously existed. The near-infrared observations, carried out with the 2.1-m telescope at Observatorio de San Pedro Martir (Mexico), allowed us to study the the stellar content at the core of each nebula, while an analysis of extended near-infrared emission zones showed these to arise mainly from ionized gas (S148 and S206) or through scattering and thermal emission from dust grains surrounding a massive young star (S269-IRS2). The analysis of IRAS data, on the other hand, suggests that two different populations of grains contribute to the observed 12- to 100-μm fluxes. (author)

  18. Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.

    OpenAIRE

    Kato, J; Ito, K; Nakamura, A; Watanabe, H

    1989-01-01

    Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...

  19. Organic Chemistry of Southern Sources: Microwave Spectroscopy of Cha-MMS1 and IRAS 15194-5115

    Science.gov (United States)

    Cordiner, Martin; Charnley, Steven

    2011-01-01

    We report new spectra of molecule-rich sources in the southern hemisphere obtained using the 22-meter Mopra telescope. Spectra and maps are presented of organic molecules detected between 30 and 50 GHz in the young Class 0 protostar Chamaeleon MMS-1. The large abundances of polyynes, cyanopolyynes and methanol may be indicative of a warm carbon chemistry in the dense gas surrounding this protostar. Spectra are also presented from a 78-96 GHz scan of the carbon-rich AGB star IRAS 15194-5115, including new detections of HC5N, CCS and C13CH.

  20. EL CADÁVER DE LA IRA COMO EFECTO MARIPOSA: LA REALIZACIÓN DE UN RELATO DE FICCIÓN

    OpenAIRE

    VALERO MARCO, DANIEL

    2016-01-01

    [ES] El presente proyecto trata sobre la realización de un cortometraje de ficción con el tema de la ira y el efecto mariposa. En primer lugar se realiza un proceso de documentación teórica en el que se estudia el comportamiento de la ira y se relaciona con el efecto mariposa de la teoría del caos. Tras esto, se plantea la creación de un cortometraje de ficción que refleje las principales conclusiones de la investigación realizada. ...

  1. {sup 13}C-METHYL FORMATE: OBSERVATIONS OF A SAMPLE OF HIGH-MASS STAR-FORMING REGIONS INCLUDING ORION-KL AND SPECTROSCOPIC CHARACTERIZATION

    Energy Technology Data Exchange (ETDEWEB)

    Favre, Cécile; Bergin, Edwin A.; Crockett, Nathan R.; Neill, Justin L. [Department of Astronomy, University of Michigan, 500 Church Street, Ann Arbor, MI 48109 (United States); Carvajal, Miguel [Dpto. Física Aplicada, Unidad Asociada CSIC, Facultad de Ciencias Experimentales, Universidad de Huelva, E-21071 Huelva (Spain); Field, David [Department of Physics and Astronomy, University of Aarhus, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Jørgensen, Jes K.; Bisschop, Suzanne E. [Centre for Star and Planet Formation, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø (Denmark); Brouillet, Nathalie; Despois, Didier; Baudry, Alain [Univ. Bordeaux, LAB, UMR 5804, F-33270, Floirac (France); Kleiner, Isabelle [Laboratoire Interuniversitaire des Systèmes Atmosphériques (LISA), CNRS, UMR 7583, Université de Paris-Est et Paris Diderot, 61, Av. du Général de Gaulle, F-94010 Créteil Cedex (France); Margulès, Laurent; Huet, Thérèse R.; Demaison, Jean, E-mail: cfavre@umich.edu, E-mail: miguel.carvajal@dfa.uhu.es [Laboratoire de Physique des Lasers, Atomes et Molécules, UMR CNRS 8523, Université Lille I, F-59655 Villeneuve d' Ascq Cedex (France)

    2015-01-01

    We have surveyed a sample of massive star-forming regions located over a range of distances from the Galactic center for methyl formate, HCOOCH{sub 3}, and its isotopologues H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}. The observations were carried out with the APEX telescope in the frequency range 283.4-287.4 GHz. Based on the APEX observations, we report tentative detections of the {sup 13}C-methyl formate isotopologue HCOO{sup 13}CH{sub 3} toward the following four massive star-forming regions: Sgr B2(N-LMH), NGC 6334 IRS 1, W51 e2, and G19.61-0.23. In addition, we have used the 1 mm ALMA science verification observations of Orion-KL and confirm the detection of the {sup 13}C-methyl formate species in Orion-KL and image its spatial distribution. Our analysis shows that the {sup 12}C/{sup 13}C isotope ratio in methyl formate toward the Orion-KL Compact Ridge and Hot Core-SW components (68.4 ± 10.1 and 71.4 ± 7.8, respectively) are, for both the {sup 13}C-methyl formate isotopologues, commensurate with the average {sup 12}C/{sup 13}C ratio of CO derived toward Orion-KL. Likewise, regarding the other sources, our results are consistent with the {sup 12}C/{sup 13}C in CO. We also report the spectroscopic characterization, which includes a complete partition function, of the complex H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3} species. New spectroscopic data for both isotopomers H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}, presented in this study, have made it possible to measure this fundamentally important isotope ratio in a large organic molecule for the first time.

  2. Is liberal independent dental practice in danger? Assessing forms of dental practice in the European Regional Organization (ERO) zone of the FDI World Dental Federation.

    Science.gov (United States)

    Wolf, Thomas Gerhard; Seeberger, Gerhard Konrad; Callaway, Angelika; Briseño-Marroquín, Benjamín; Rusca, Philippe; Frank, Michael; Otterbach, Ernst-Jürgen

    2018-02-26

    A trend towards increasingly new forms of dental practice has been observed in the FDI World Dental Federation. Elementary foundations such as the free dentist and therapy choice, and independent, free, self-responsible professional practice may be undermined. The current study is aimed at analyzing the general training framework, organization, and professional types of dental practice in the European Regional Organization (ERO) zone and at critically discussing selected aspects of changes in the dental profession. A questionnaire was developed by the ERO Working-Group "Liberal Dental Practice." Information about dental schools, professional organizations, dental practice regulations, and ambulatory healthcare centers was analyzed. Self-employed dental practice is the most common type of practice (51.7%). Dentists are allowed to work independently immediately after graduation (72.7%). Approximately one-third are organized as compulsory members in chambers/corporations. The density of dentists has a mean of 1,570 inhabitants per dentist. In most countries, there are no special rules for founding dental ambulatory healthcare centers. In a total of 353 universities of the ERO countries surveyed, 16,619 dentists per year were trained, with a trend toward a higher percentage of female students (63%). Despite modern forms of dental practice, the charter of the individual liberal dental profession (CED et al, 2013) should be respected and taken into account on the basis of ethical principles. The commercialization of the dental profession can be neutralized only by establishing and following well-defined ethical principles; oral healthcare quality can thus be ensured without the influence of third parties.

  3. Origin of spinel lamella and/or inclusions in olivine of harzburgite form the Pauza ultramafic rocks from the Kurdistan region, northeastern Iraq

    Science.gov (United States)

    Mohammad, Y.; Maekawa, H.; Karim, K.

    2009-04-01

    Exsolution lamellae and octahedral inclusions of chromian spinel occur in olivine of harzburgite of the Pauza ultramafic rocks, Kurdistan region, northeastern Iraq. The lamella is up to 80μm long and up to 50 μm wide. The lamellae and octahedral inclusions of chromian spinel are distributed heterogeneously in the host olivine crystal. They are depleted in Al2O3 relative to the subhedral spinel grains in the matrix and spinel lamella in orthopyroxene. Olivine (Fo92 - 93) with spinel lamellae occurs as fine-grained crystals around orthopyroxene, whereas olivine (Fo90-91) free from spinel is found in matrix. Based on back-scattered images analyses, enrichments of both Cr # and Fe+3 in the chromian spinel lamella in olivine (replacive olivine) relative to that in adjacent orthopyroxene. As well as the compositions of chromian spinel lamellae host olivine are more Mg-rich than the matrix olivine. Furthermore the restriction of olivine with spinel lamellae and octahedral inclusions on around orthopyroxene, and the similarity of spinel lamella orientations in both olivine and adjacent orthopyroxene. This study concludes that the spinel inclusions in olivine are remnant (inherited from former orthopyroxene) spinel exsolution lamella in orthopyroxene, that has been formed in upper mantle conditions ( T = 1200 °C, P = 2.5 GPa ). Replacive olivine are formed by reaction of ascending silica poor melt and orthopyroxene in harzburgite as pressure decrease the solubility of silica-rich phase (orthopyroxene) in the system increase, therefore ascending melt dissolve pyroxene with spinel exsolution lamella and precipitate replacive olivine with spinel inclusions. We can conclude that the olivines with spinel lamella are not necessary to be original and presenting ultrahigh-pressure and/or ultra deep-mantle conditions as previously concluded. It has been formed by melting of orthopyroxene (orthopyroxene with spinel exsolution lamella = olivine with spinel lamellae and octahedral

  4. A dearth of short-period massive binaries in the young massive star forming region M 17. Evidence for a large orbital separation at birth?

    Science.gov (United States)

    Sana, H.; Ramírez-Tannus, M. C.; de Koter, A.; Kaper, L.; Tramper, F.; Bik, A.

    2017-03-01

    Aims: The formation of massive stars remains poorly understood and little is known about their birth multiplicity properties. Here, we aim to quantitatively investigate the strikingly low radial-velocity dispersion measured for a sample of 11 massive pre- and near-main-sequence stars (σ1D= 5.6 ± 0.2 km s-1) in the very young massive star forming region M 17, in order to obtain first constraints on the multiplicity properties of young massive stellar objects. Methods: We compute the radial-velocity dispersion of synthetic populations of massive stars for various multiplicity properties and we compare the obtained σ1D distributions to the observed value. We specifically investigate two scenarios: a low binary fraction and a dearth of short-period binary systems. Results: Simulated populations with low binary fractions () or with truncated period distributions (Pcutoff > 9 months) are able to reproduce the low σ1D observed within their 68%-confidence intervals. Furthermore, parent populations with fbin > 0.42 or Pcutoff < 47 d can be rejected at the 5%-significance level. Both constraints are in stark contrast with the high binary fraction and plethora of short-period systems in few Myr-old, well characterized OB-type populations. To explain the difference in the context of the first scenario would require a variation of the outcome of the massive star formation process. In the context of the second scenario, compact binaries must form later on, and the cut-off period may be related to physical length-scales representative of the bloated pre-main-sequence stellar radii or of their accretion disks. Conclusions: If the obtained constraints for the M 17's massive-star population are representative of the multiplicity properties of massive young stellar objects, our results may provide support to a massive star formation process in which binaries are initially formed at larger separations, then harden or migrate to produce the typical (untruncated) power-law period

  5. Characterization of the volatile components in green tea by IRAE-HS-SPME/GC-MS combined with multivariate analysis.

    Science.gov (United States)

    Yang, Yan-Qin; Yin, Hong-Xu; Yuan, Hai-Bo; Jiang, Yong-Wen; Dong, Chun-Wang; Deng, Yu-Liang

    2018-01-01

    In the present work, a novel infrared-assisted extraction coupled to headspace solid-phase microextraction (IRAE-HS-SPME) followed by gas chromatography-mass spectrometry (GC-MS) was developed for rapid determination of the volatile components in green tea. The extraction parameters such as fiber type, sample amount, infrared power, extraction time, and infrared lamp distance were optimized by orthogonal experimental design. Under optimum conditions, a total of 82 volatile compounds in 21 green tea samples from different geographical origins were identified. Compared with classical water-bath heating, the proposed technique has remarkable advantages of considerably reducing the analytical time and high efficiency. In addition, an effective classification of green teas based on their volatile profiles was achieved by partial least square-discriminant analysis (PLS-DA) and hierarchical clustering analysis (HCA). Furthermore, the application of a dual criterion based on the variable importance in the projection (VIP) values of the PLS-DA models and on the category from one-way univariate analysis (ANOVA) allowed the identification of 12 potential volatile markers, which were considered to make the most important contribution to the discrimination of the samples. The results suggest that IRAE-HS-SPME/GC-MS technique combined with multivariate analysis offers a valuable tool to assess geographical traceability of different tea varieties.

  6. Characterization of the volatile components in green tea by IRAE-HS-SPME/GC-MS combined with multivariate analysis.

    Directory of Open Access Journals (Sweden)

    Yan-Qin Yang

    Full Text Available In the present work, a novel infrared-assisted extraction coupled to headspace solid-phase microextraction (IRAE-HS-SPME followed by gas chromatography-mass spectrometry (GC-MS was developed for rapid determination of the volatile components in green tea. The extraction parameters such as fiber type, sample amount, infrared power, extraction time, and infrared lamp distance were optimized by orthogonal experimental design. Under optimum conditions, a total of 82 volatile compounds in 21 green tea samples from different geographical origins were identified. Compared with classical water-bath heating, the proposed technique has remarkable advantages of considerably reducing the analytical time and high efficiency. In addition, an effective classification of green teas based on their volatile profiles was achieved by partial least square-discriminant analysis (PLS-DA and hierarchical clustering analysis (HCA. Furthermore, the application of a dual criterion based on the variable importance in the projection (VIP values of the PLS-DA models and on the category from one-way univariate analysis (ANOVA allowed the identification of 12 potential volatile markers, which were considered to make the most important contribution to the discrimination of the samples. The results suggest that IRAE-HS-SPME/GC-MS technique combined with multivariate analysis offers a valuable tool to assess geographical traceability of different tea varieties.

  7. A RECENT ACCRETION BURST IN THE LOW-MASS PROTOSTAR IRAS 15398-3359: ALMA IMAGING OF ITS RELATED CHEMISTRY

    International Nuclear Information System (INIS)

    Jørgensen, Jes K.; Brinch, Christian; Lindberg, Johan E.; Bisschop, Suzanne E.; Visser, Ruud; Bergin, Edwin A.; Sakai, Nami; Yamamoto, Satoshi; Harsono, Daniel; Van Dishoeck, Ewine F.; Persson, Magnus V.

    2013-01-01

    Low-mass protostars have been suggested to show highly variable accretion rates throughout their evolution. Such changes in accretion, and related heating of their ambient envelopes, may trigger significant chemical variations on different spatial scales and from source-to-source. We present images of emission from C 17 O, H 13 CO + , CH 3 OH, C 34 S and C 2 H toward the low-mass protostar IRAS 15398-3359 on 0.''5 (75 AU diameter) scales with the Atacama Large Millimeter/submillimeter Array at 340 GHz. The resolved images show that the emission from H 13 CO + is only present in a ring-like structure with a radius of about 1-1.''5 (150-200 AU) whereas the CO and other high dipole moment molecules are centrally condensed toward the location of the central protostar. We propose that HCO + is destroyed by water vapor present on small scales. The origin of this water vapor is likely an accretion burst during the last 100-1000 yr increasing the luminosity of IRAS 15398-3359 by a factor of 100 above its current luminosity. Such a burst in luminosity can also explain the centrally condensed CH 3 OH and extended warm carbon-chain chemistry observed in this source and furthermore be reflected in the relative faintness of its compact continuum emission compared to other protostars

  8. NEAR-INFRARED PERIODIC AND OTHER VARIABLE FIELD STARS IN THE FIELD OF THE CYGNUS OB7 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Wolk, Scott J.; Rice, Thomas S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Aspin, Colin A. [Institute for Astronomy, University of Hawaii at Manoa, 640 North Aohoku Place, Hilo, HI 96720 (United States)

    2013-04-15

    We present a subset of the results of a three-season, 124 night, near-infrared monitoring campaign of the dark clouds Lynds 1003 and Lynds 1004 in the Cygnus OB7 star-forming region. In this paper, we focus on the field star population. Using three seasons of UKIRT J, H, and K-band observations spanning 1.5 years, we obtained high-quality photometry on 9200 stars down to J = 17 mag, with photometric uncertainty better than 0.04 mag. After excluding known disk-bearing stars we identify 149 variables-1.6% of the sample. Of these, about 60 are strictly periodic, with periods predominantly <2 days. We conclude this group is dominated by eclipsing binaries. A few stars have long period signals of between 20 and 60 days. About 25 stars have weak modulated signals, but it was not clear if these were periodic. Some of the stars in this group may be diskless young stellar objects with relatively large variability due to cool starspots. The remaining {approx}60 stars showed variations which appear to be purely stochastic.

  9. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  10. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. VI. THE DISTANCE TO THE YOUNG STELLAR OBJECT HW 9 IN CEPHEUS A

    International Nuclear Information System (INIS)

    Dzib, Sergio; Loinard, Laurent; RodrIguez, Luis F.; Mioduszewski, Amy J.; Torres, Rosa M.

    2011-01-01

    Using the Very Long Baseline Array (VLBA), we have observed the radio continuum emission from the young stellar object HW 9 in the Cepheus A star-forming region at 10 epochs between 2007 February and 2009 November. Due to its strong radio variability, the source was detected at only four of the ten epochs. From these observations, the trigonometric parallax of HW 9 was determined to be π = 1.43 ± 0.07 mas, in excellent agreement with a recent independent determination by Moscadelli et al. of the trigonometric parallax of a methanol maser associated with the nearby young stellar source HW 2 (π = 1.43 ± 0.08 mas). This concordance in results, obtained in one case from continuum and in the other from line observations, confirms the reliability of VLBA trigonometric parallax measurements. By combining the two results, we constrain the distance to Cepheus A to be 700 +31 - 28 pc, an uncertainty of 3.5%.

  11. Receptor tyrosine kinase-like orphan receptor 2 (ROR2) and Indian hedgehog regulate digit outgrowth mediated by the phalanx-forming region.

    Science.gov (United States)

    Witte, Florian; Chan, Danny; Economides, Aris N; Mundlos, Stefan; Stricker, Sigmar

    2010-08-10

    Elongation of the digit rays resulting in the formation of a defined number of phalanges is a process poorly understood in mammals, whereas in the chicken distal mesenchymal bone morphogenetic protein (BMP) signaling in the so-called phalanx-forming region (PFR) or digit crescent (DC) seems to be involved. The human brachydactylies (BDs) are inheritable conditions characterized by variable degrees of digit shortening, thus providing an ideal model to analyze the development and elongation of phalanges. We used a mouse model for BDB1 (Ror2(W749X/W749X)) lacking middle phalanges and show that a signaling center corresponding to the chick PFR exists in the mouse, which is diminished in BDB1 mice. This resulted in a strongly impaired elongation of the digit condensations due to reduced chondrogenic commitment of undifferentiated distal mesenchymal cells. We further show that a similar BMP-based mechanism accounts for digit shortening in a mouse model for the closely related condition BDA1 (Ihh(E95K/E95K)), altogether indicating the functional significance of the PFR in mammals. Genetic interaction experiments as well as pathway analysis in BDB1 mice suggest that Indian hedgehog and WNT/beta-catenin signaling, which we show is inhibited by receptor tyrosine kinase-like orphan receptor 2 (ROR2) in distal limb mesenchyme, are acting upstream of BMP signaling in the PFR.

  12. Pen Name as a Form of a Journalist’s Self-Presentation in the Late 19th — Early 20th Centuries Russian Regional Press

    Directory of Open Access Journals (Sweden)

    Tatiana A. Gridina

    2017-07-01

    Full Text Available The article investigates into the role of pen-names in the self-presentation of a regional newspaper’s journalist, the pen name being analyzed as a kind of micro-text that models the reporter’s image according to their position within the edition’s information field, its stylistic and generic strategies of presenting information. From the onomasiological point of view, the authors distinguish between four types of journalistic pseudonyms: 1 pen names intended to present the author as an unspecified individual; 2 pseudonyms patterned after speaking names whose internal form stresses the characteristics of the journalist’s image; 3 pen names based on the culturally specific associative meaning of the motivating name — such names impose cultural and historical presuppositions governing the perception of the journalist’s image; 4 pen names with various role specializations that manifest the journalist’s inclination to ludic self-presentation. Each type corresponds to several ways of name creation. The latter include abbreviation, onymization of common nouns, different techniques of language game. The authors also establish the generalized strategies of communicational interaction between journalists and their readers: strategy of distancing, strategy of adhesion, and strategy of game interaction. The paper argues that there is correlation between the choice of an interaction strategy and the journalist’s image reflected in their pen name.

  13. PARALLAXES FOR W49N AND G048.60+0.02: DISTANT STAR FORMING REGIONS IN THE PERSEUS SPIRAL ARM

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, B.; Menten, K. M.; Brunthaler, A. [Max-Plank-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Zheng, X. W. [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

    2013-09-20

    We report trigonometric parallax measurements of 22 GHz H{sub 2}O masers in two massive star-forming regions from Very Long Baseline Array observations as part of the Bar and Spiral Structure Legacy Survey. The distances of 11.11{sup +0.79}{sub -0.69} kpc to W49N (G043.16+0.01) and 10.75{sup +0.61}{sub -0.55} kpc to G048.60+0.02 locate them in a distant section of the Perseus arm near the solar circle in the first Galactic quadrant. This allows us to locate accurately the inner portion of the Perseus arm for the first time. Combining the present results with sources measured in the outer portion of the arm in the second and third quadrants yields a global pitch angle of 9.°5 ± 1.°3 for the Perseus arm. We have found almost no H{sub 2}O maser sources in the Perseus arm for 50°

  14. A novel chromosome region maintenance 1-independent nuclear export signal of the large form of hepatitis delta antigen that is required for the viral assembly.

    Science.gov (United States)

    Lee, C H; Chang, S C; Wu, C H; Chang, M F

    2001-03-16

    Hepatitis delta virus (HDV) is a satellite virus of hepatitis B virus, as it requires hepatitis B virus for virion production and transmission. We have previously demonstrated that sequences within the C-terminal 19-amino acid domain flanking the isoprenylation motif of the large hepatitis delta antigen (HDAg-L) are important for virion assembly. In this study, site-directed mutagenesis and immunofluorescence staining demonstrated that in the absence of hepatitis B virus surface antigen (HBsAg), the wild-type HDAg-L was localized in the nuclei of transfected COS7 cells. Nevertheless, in the presence of HBsAg, the HDAg-L became both nuclei- and cytoplasm-distributed in about half of the cells. An HDAg-L mutant with a substitution of Pro-205 to alanine could neither form HDV-like particles nor shift the subcellular localization in the presence of HBsAg. In addition, nuclear trafficking of HDAg-L in heterokaryons indicated that HDAg-L is a nucleocytoplasmic shuttling protein. A proline-rich HDAg peptide spanning amino acid residues 198 to 210, designated NES(HDAg-L), can function as a nuclear export signal (NES) in Xenopus oocytes. Pro-205 is critical for the NES function. Furthermore, assembly of HDV is insensitive to leptomycin B, indicating that the NES(HDAg-L) directs nuclear export of HDAg-L to the cytoplasm via a chromosome region maintenance 1-independent pathway.

  15. ALMA INVESTIGATION OF VIBRATIONALLY EXCITED HCN/HCO{sup +}/HNC EMISSION LINES IN THE AGN-HOSTING ULTRALUMINOUS INFRARED GALAXY IRAS 20551−4250

    Energy Technology Data Exchange (ETDEWEB)

    Imanishi, Masatoshi [Subaru Telescope, 650 North A’ohoku Place, Hilo, HI 96720 (United States); Nakanishi, Kouichiro [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Izumi, Takuma, E-mail: masa.imanishi@nao.ac.jp [Institute of Astronomy, School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan)

    2016-07-01

    We present the results of ALMA Cycle 2 observations of the ultraluminous infrared galaxy IRAS 20551−4250 at HCN/HCO{sup +}/HNC J = 3–2 lines at both vibrational ground ( v = 0) and vibrationally excited ( v {sub 2} = 1) levels. This galaxy contains a luminous buried active galactic nucleus (AGN), in addition to starburst activity, and our ALMA Cycle 0 data revealed a tentatively detected vibrationally excited HCN v {sub 2} = 1f J = 4–3 emission line. In our ALMA Cycle 2 data, the HCN/HCO{sup +}/HNC J = 3–2 emission lines at v = 0 are clearly detected. The HCN and HNC v {sub 2} = 1f J = 3–2 emission lines are also detected, but the HCO{sup +} v {sub 2} = 1f J = 3–2 emission line is not. Given the high energy level of v {sub 2} = 1 and the resulting difficulty of collisional excitation, we compared these results with those of the calculation of infrared radiative pumping, using the available infrared 5–35 μ m spectrum. We found that all of the observational results were reproduced if the HCN abundance was significantly higher than that of HCO{sup +} and HNC. The flux ratio and excitation temperature between v {sub 2} = 1f and v = 0, after correction for possible line opacity, suggests that infrared radiative pumping affects rotational ( J -level) excitation at v = 0 at least for HCN and HNC. The HCN-to-HCO{sup +} v = 0 flux ratio is higher than those of starburst-dominated regions, and will increase even more when the derived high HCN opacity is corrected. The enhanced HCN-to-HCO{sup +} flux ratio in this AGN-hosting galaxy can be explained by the high HCN-to-HCO{sup +} abundance ratio and sufficient HCN excitation at up to J = 4, rather than the significantly higher efficiency of infrared radiative pumping for HCN than HCO{sup +}.

  16. Shutting down or powering up a (U)LIRG? Merger components in distinctly different evolutionary states in IRAS 19115-2124 (the Bird)

    Science.gov (United States)

    Väisänen, Petri; Reunanen, Juha; Kotilainen, Jari; Mattila, Seppo; Johansson, Peter H.; Ramphul, Rajin; Romero-Cañizales, Cristina; Kuncarayakti, Hanindyo

    2017-10-01

    We present new SINFONI near-infrared (NIR) integral field unit (IFU) spectroscopy and Southern African Large Telescope (SALT) optical long-slit spectroscopy characterizing the history of a nearby merging luminous infrared galaxy, dubbed the Bird (IRAS19115-2124). The NIR line-ratio maps of the IFU data cubes and stellar population fitting of the SALT spectra now allow dating of the star formation (SF) over the triple system uncovered from our previous adaptive optics data. The distinct components separate clearly in line-ratio diagnostic diagrams, both thermal and non-thermal excitation is present. An off-nuclear starburst dominates the current SF of the Bird with 60-70 per cent of the total, with a 4-7 Myr age. The most massive nucleus, in contrast, is quenched with a starburst age of >40 Myr and shows hints of budding active galactic nucleus (AGN) activity. The secondary massive nucleus is at an intermediate stage. The two major components have signs of an older stellar population, consistent with a starburst triggered 1 Gyr ago in a first encounter. The simplest explanation of the history is that of a triple merger, where the strongly star-forming component has joined later. We detect multiple gas flows. The Bird offers an opportunity to witness multiple stages of galaxy evolution in the same system; triggering as well as very recent quenching of SF, and, perhaps, an early appearance of AGN activity. It also serves as a cautionary note on interpretations of observations with lower spatial resolution and/or without infrared data. At high redshift the system would look like a clumpy starburst with crucial pieces of its puzzle hidden in danger of misinterpretations.

  17. THE BOLOCAM GALACTIC PLANE SURVEY. III. CHARACTERIZING PHYSICAL PROPERTIES OF MASSIVE STAR-FORMING REGIONS IN THE GEMINI OB1 MOLECULAR CLOUD

    International Nuclear Information System (INIS)

    Dunham, Miranda K.; Evans, Neal J.; Harvey, Paul; Merello, Manuel; Rosolowsky, Erik; Cyganowski, Claudia J.; Aguirre, James; Bally, John; Battersby, Cara; Ginsburg, Adam; Glenn, Jason; Stringfellow, Guy S.; Bradley, Eric Todd; Dowell, Darren; Drosback, Meredith; Schlingman, Wayne; Shirley, Yancy L.; Walawender, Josh; Williams, Jonathan P.

    2010-01-01

    We present the 1.1 mm Bolocam Galactic Plane Survey (BGPS) observations of the Gemini OB1 molecular cloud complex, and targeted NH 3 observations of the BGPS sources. When paired with molecular spectroscopy of a dense gas tracer, millimeter observations yield physical properties such as masses, radii, mean densities, kinetic temperatures, and line widths. We detect 34 distinct BGPS sources above 5σ = 0.37 Jy beam -1 with corresponding 5σ detections in the NH 3 (1,1) transition. Eight of the objects show water maser emission (20%). We find a mean millimeter source FWHM of 1.12 pc and a mean gas kinetic temperature of 20 K for the sample of 34 BGPS sources with detections in the NH 3 (1,1) line. The observed NH 3 line widths are dominated by non-thermal motions, typically found to be a few times the thermal sound speed expected for the derived kinetic temperature. We calculate the mass for each source from the millimeter flux assuming the sources are isothermal and find a mean isothermal mass within a 120'' aperture of 230 ± 180 M sun . We find a total mass of 8400 M sun for all BGPS sources in the Gemini OB1 molecular cloud, representing 6.5% of the cloud mass. By comparing the millimeter isothermal mass to the virial mass calculated from the NH 3 line widths within a radius equal to the millimeter source size, we find a mean virial parameter (M vir /M iso ) of 1.0 ± 0.9 for the sample. We find mean values for the distributions of column densities of 1.0 x 10 22 cm -2 for H 2 , and 3.0 x 10 14 cm -2 for NH 3 , giving a mean NH 3 abundance of 3.0 x 10 -8 relative to H 2 . We find volume-averaged densities on the order of 10 3 -10 4 cm -3 . The sizes and densities suggest that in the Gem OB1 region the BGPS is detecting the clumps from which stellar clusters form, rather than smaller, higher density cores where single stars or small multiple systems form.

  18. Planck early results. XIX. All-sky temperature and dust optical depth from Planck and IRAS. Constraints on the "dark gas" in our Galaxy

    DEFF Research Database (Denmark)

    Poutanen, T.; Natoli, P.; Polenta, G.

    2011-01-01

    An all sky map of the apparent temperature and optical depth of thermal dust emission is constructed using the Planck-HFI (350μm to 2 mm) andIRAS(100μm) data. The optical depth maps are correlated with tracers of the atomic (Hi) and molecular gas traced by CO. The correlation with the column dens...

  19. Forming of the regional core transport network taking into account the allocation of alternative energy sources based on artificial intelligence methods

    OpenAIRE

    Marina ZHURAVSKAYA; Vladimir TARASYAN

    2014-01-01

    In the modern world the alternative energy sources, which considerably depend on a region, play more and more significant role. However, the transition of regions to new energy sources lead to the change of transport and logistic network configuration. The formation of optimal core transport network today is a guarantee of the successful economic development of a region tomorrow. The present article studies the issue of advanced core transport network development in a region based on the ...

  20. Fungal specificity and selectivity for algae play a major role in determining lichen partnerships across diverse ecogeographic regions in the lichen-forming family Parmeliaceae (Ascomycota).

    Science.gov (United States)

    Leavitt, Steven D; Kraichak, Ekaphan; Nelsen, Matthew P; Altermann, Susanne; Divakar, Pradeep K; Alors, David; Esslinger, Theodore L; Crespo, Ana; Lumbsch, Thorsten

    2015-07-01

    Microbial symbionts are instrumental to the ecological and long-term evolutionary success of their hosts, and the central role of symbiotic interactions is increasingly recognized across the vast majority of life. Lichens provide an iconic group for investigating patterns in species interactions; however, relationships among lichen symbionts are often masked by uncertain species boundaries or an inability to reliably identify symbionts. The species-rich lichen-forming fungal family Parmeliaceae provides a diverse group for assessing patterns of interactions of algal symbionts, and our study addresses patterns of lichen symbiont interactions at the largest geographic and taxonomic scales attempted to date. We analysed a total of 2356 algal internal transcribed spacer (ITS) region sequences collected from lichens representing ten mycobiont genera in Parmeliaceae, two genera in Lecanoraceae and 26 cultured Trebouxia strains. Algal ITS sequences were grouped into operational taxonomic units (OTUs); we attempted to validate the evolutionary independence of a subset of the inferred OTUs using chloroplast and mitochondrial loci. We explored the patterns of symbiont interactions in these lichens based on ecogeographic distributions and mycobiont taxonomy. We found high levels of undescribed diversity in Trebouxia, broad distributions across distinct ecoregions for many photobiont OTUs and varying levels of mycobiont selectivity and specificity towards the photobiont. Based on these results, we conclude that fungal specificity and selectivity for algal partners play a major role in determining lichen partnerships, potentially superseding ecology, at least at the ecogeographic scale investigated here. To facilitate effective communication and consistency across future studies, we propose a provisional naming system for Trebouxia photobionts and provide representative sequences for each OTU circumscribed in this study. © 2015 John Wiley & Sons Ltd.

  1. Observações espectroscópicas da candidata a pós-AGB IRAS 19386+0155

    Science.gov (United States)

    Lorenz-Martins, S.; Pereira, C. B.

    2003-08-01

    Nesse trabalho apresentamos a análise fotosférica da estrela candidata a pós-AGB IRAS 19386+0155. Com os dados obtidos no espectrógrafo FEROS foram determinados os parâmetros atmosféricos e abundâncias fotosféricas utilizando o código MOOG. A análise do espectro mostrou que IRAS 19386+0155 possui os seguintes parâmetros atmosféricos : Teff = 6800K, log g = 1.4, [M/H] = -1.5 e Vt = 8.4 km/s. O padrão de abundância obtido para os elementos mais leves (Carbono, Nitrogênio e Oxigênio) e elementos a (Magnésio, Silício e Cálcio) foi inferior ao solar (log C = 7.74, log N = 7.28, Log O = 8.43, log Mg = 7.14, log Si = 7.54 e log Ca = 5.91). Uma inspeção visual do espectro ISO deste objeto revela a presença de poeira fria na forma de silicatos cristalinos. Embora as bandas mais marcantes de silicatos amorfos (em 10 mm e 18mm) não sejam observadas, a emissão em 21 mm, presente em algumas pós-AGBs também não está presente. O espectro ISO parece revelar um meio rico em oxigênio, mas a forma da distribuição de energia no infravermelho não obedece ao padrão apresentado por outras pós-AGBs. Nossos resultados nos levam a sugerir que IRAS 19386+0155 talvez faça parte de um sistema binário, uma vez que outras pós-AGBs que são membros de sistemas binários apresentam padrão de abundância semelhante.

  2. TIMASSS: the IRAS 16293-2422 millimeter and submillimeter spectral survey. I. Observations, calibration, and analysis of the line kinematics

    NARCIS (Netherlands)

    Caux, E.; Kahane, C.; Castets, A.; Coutens, A.; Ceccarelli, C.; Bacmann, A.; Bisschop, S.; Bottinelli, S.; Comito, C.; Helmich, F. P.; Lefloch, B.; Parise, B.; Schilke, P.; Tielens, A. G. G. M.; van Dishoeck, E.; Vastel, C.; Wakelam, V.; Walters, A.

    Context. Unbiased spectral surveys are powerful tools to study the chemistry and the physics of star forming regions, because they can provide a complete census of the molecular content and the observed lines probe the physical structure of the source. Aims. While unbiased surveys at the millimeter

  3. Gas and dust in the star-forming region ρ Oph A. The dust opacity exponent β and the gas-to-dust mass ratio g2d

    Science.gov (United States)

    Liseau, R.; Larsson, B.; Lunttila, T.; Olberg, M.; Rydbeck, G.; Bergman, P.; Justtanont, K.; Olofsson, G.; de Vries, B. L.

    2015-06-01

    Aims: We aim at determining the spatial distribution of the gas and dust in star-forming regions and address their relative abundances in quantitative terms. We also examine the dust opacity exponent β for spatial and/or temporal variations. Methods: Using mapping observations of the very dense ρ Oph A core, we examined standard 1D and non-standard 3D methods to analyse data of far-infrared and submillimetre (submm) continuum radiation. The resulting dust surface density distribution can be compared to that of the gas. The latter was derived from the analysis of accompanying molecular line emission, observed with Herschel from space and with APEX from the ground. As a gas tracer we used N2H+, which is believed to be much less sensitive to freeze-out than CO and its isotopologues. Radiative transfer modelling of the N2H+ (J = 3-2) and (J = 6-5) lines with their hyperfine structure explicitly taken into account provides solutions for the spatial distribution of the column density N(H2), hence the surface density distribution of the gas. Results: The gas-to-dust mass ratio is varying across the map, with very low values in the central regions around the core SM 1. The global average, = 88, is not far from the canonical value of 100, however. In ρ Oph A, the exponent β of the power-law description for the dust opacity exhibits a clear dependence on time, with high values of 2 for the envelope-dominated emission in starless Class -1 sources to low values close to 0 for the disk-dominated emission in Class III objects. β assumes intermediate values for evolutionary classes in between. Conclusions: Since β is primarily controlled by grain size, grain growth mostly occurs in circumstellar disks. The spatial segregation of gas and dust, seen in projection toward the core centre, probably implies that, like C18O, also N2H+ is frozen onto the grains. Based on observations with APEX, which is a 12 m diameter submillimetre telescope at 5100 m altitude on Llano Chajnantor

  4. Tianma 65-m telescope detection of new OH maser features towards the water fountain source IRAS 18286-0959

    Science.gov (United States)

    Chen, Xi; Shen, Zhi-Qiang; Li, Xiao-Qiong; Yang, Kai; Nakashima, Jun-ichi; Wu, Ya-Jun; Zhao, Rong-Bin; Li, Juan; Wang, Jun-Zhi; Jiang, Dong-Rong; Wang, Jin-Qing; Li, Bin; Zhong, Wei-Ye; Yung, Bosco H. K.

    2017-07-01

    We report the results of the OH maser observation towards the water fountain source IRAS 18286-0959 using the newly built Shanghai Tianma 65-m Radio Telescope. We observed the three OH ground state transition lines at frequencies of 1612, 1665 and 1667 MHz. Comparing with the spectra of previous observations, we find new maser spectral components at velocity channels largely shifted from the systemic velocity: the velocity offsets of the newly found components lie in the range 20-40 km s-1 with respect to the systemic velocity. Besides maser variability, another possible interpretation for the newly detected maser features is that part of the molecular gas in the circumstellar envelope is accelerated. The acceleration is probably caused by the passage of a high-velocity molecular jet, which has been detected in previous Very Long Baseline Interferometry observations in the H2O maser line.

  5. Chandra X-ray observations of the hyper-luminous infrared galaxy IRAS F15307+3252

    Science.gov (United States)

    Hlavacek-Larrondo, J.; Gandhi, P.; Hogan, M. T.; Gendron-Marsolais, M.-L.; Edge, A. C.; Fabian, A. C.; Russell, H. R.; Iwasawa, K.; Mezcua, M.

    2017-01-01

    Hyper-luminous infrared galaxies (HyLIRGs) lie at the extreme luminosity end of the IR galaxy population with LIR > 1013 L⊙. They are thought to be closer counterparts of the more distant sub-millimeter galaxies, and should therefore be optimal targets to study the most massive systems in formation. We present deep Chandra observations of IRAS F15307+3252 (100 ks), a classical HyLIRG located at z = 0.93 and hosting a radio-loud AGN (L1.4 GHz ˜ 3.5 × 1025 W Hz-1). The Chandra images reveal the presence of extended (r = 160 kpc), asymmetric X-ray emission in the soft 0.3-2.0 keV band that has no radio counterpart. We therefore argue that the emission is of thermal origin originating from a hot intragroup or intracluster medium virializing in the potential. We find that the temperature (˜2 keV) and bolometric X-ray luminosity (˜3 × 1043 erg s-1) of the gas follow the expected LX-ray-T correlation for groups and clusters, and that the gas has a remarkably short cooling time of 1.2 Gyr. In addition, VLA radio observations reveal that the galaxy hosts an unresolved compact steep-spectrum (CSS) source, most likely indicating the presence of a young radio source similar to 3C186. We also confirm that the nucleus is dominated by a redshifted 6.4 keV Fe Kα line, strongly suggesting that the AGN is Compton-thick. Finally, Hubble images reveal an overdensity of galaxies and sub-structure in the galaxy that correlates with soft X-ray emission. This could be a snapshot view of on-going groupings expected in a growing cluster environment. IRAS F15307+3252 might therefore be a rare example of a group in the process of transforming into a cluster.

  6. Influence of the form of the magnetic axis on the regions of stability and their variations (1963); Influence de la forme de l'axe magnetique sur les plages de stabilite et leur variation (1963)

    Energy Technology Data Exchange (ETDEWEB)

    Mercier, C; Tasso, H [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

    1963-07-01

    We study many cases of plane and twisted magnetic axis and we show for a set of regular magnetic axis tending to racetrack limit, the stability regions tend rapidly to the racetrack stability. But, for the case at two axis apparently not very far, we find that the corresponding regions of stability may be sometimes sensibly different. (authors) [French] Nous etudions plusieurs exemples d'axes magnetiques plans et gauches et montrons que pour une suite d'axes magnetiques qui converge vers une limite du type hippodrome, les plages de stabilite convergent rapidement vers la plage limite. Mais, si on prend deux axes apparemment peu eloignes, on trouve que les plages correspondantes peuvent etre parfois sensiblement differentes. (auteurs)

  7. Forming of the regional core transport network taking into account the allocation of alternative energy sources based on artificial intelligence methods

    Directory of Open Access Journals (Sweden)

    Marina ZHURAVSKAYA

    2014-12-01

    Full Text Available In the modern world the alternative energy sources, which considerably depend on a region, play more and more significant role. However, the transition of regions to new energy sources lead to the change of transport and logistic network configuration. The formation of optimal core transport network today is a guarantee of the successful economic development of a region tomorrow. The present article studies the issue of advanced core transport network development in a region based on the experience of European and Asian countries and the opportunity to adapt the best foreign experience to Russian conditions. On the basis of artificial intelligence methods for forest industry complex of Sverdlovskaya Oblast the algorithm of problem solution of an optimal logistic infrastructure allocation is offered and some results of a regional transport network are presented. These methods allowed to solve the set task in the conditions of information uncertainty. There are suggestions on the improvement of transport and logistic network in the territory of Sverdlovskaya Oblast. Traditionally the logistics of mineral fuel plays main role in regions development. Actually it is required to develop logistic strategic plans to be able to provide different possibilities of power-supply, flexible enough to change with the population density, transport infrastructure and demographics of different regions. The problem of logistic centers allocation was studied by many authors. The approach, offered by the authors of this paper is to solve the set of tasks by applying artificial intelligence methods, such as fuzzy set theory and genetic algorithms.

  8. The ALMA-PILS survey: the sulphur connection between protostars and comets: IRAS 16293-2422 B and 67P/Churyumov-Gerasimenko

    Science.gov (United States)

    Drozdovskaya, Maria N.; van Dishoeck, Ewine F.; Jørgensen, Jes K.; Calmonte, Ursina; van der Wiel, Matthijs H. D.; Coutens, Audrey; Calcutt, Hannah; Müller, Holger S. P.; Bjerkeli, Per; Persson, Magnus V.; Wampfler, Susanne F.; Altwegg, Kathrin

    2018-06-01

    The evolutionary past of our Solar system can be pieced together by comparing analogous low-mass protostars with remnants of our Protosolar Nebula - comets. Sulphur-bearing molecules may be unique tracers of the joint evolution of the volatile and refractory components. ALMA Band 7 data from the large unbiased Protostellar Interferometric Line Survey are used to search for S-bearing molecules in the outer disc-like structure, ˜60 au from IRAS 16293-2422 B, and are compared with data on 67P/Churyumov-Gerasimenko (67P/C-G) stemming from the ROSINA (Rosetta Orbiter Spectrometer for Ion and Neutral Analysis) instrument aboard Rosetta. Species such as SO2, SO, OCS, CS, H2CS, H2S, and CH3SH are detected via at least one of their isotopologues towards IRAS 16293-2422 B. The search reveals a first-time detection of OC33S towards this source and a tentative first-time detection of C36S towards a low-mass protostar. The data show that IRAS 16293-2422 B contains much more OCS than H2S in comparison to 67P/C-G; meanwhile, the SO/SO2 ratio is in close agreement between the two targets. IRAS 16293-2422 B has a CH3SH/H2CS ratio in range of that of our Solar system (differences by a factor of 0.7-5.3). It is suggested that the levels of UV radiation during the initial collapse of the systems may have varied and have potentially been higher for IRAS 16293-2422 B due to its binary nature; thereby, converting more H2S into OCS. It remains to be conclusively tested if this also promotes the formation of S-bearing complex organics. Elevated UV levels of IRAS 16293-2422 B and a warmer birth cloud of our Solar system may jointly explain the variations between the two low-mass systems.

  9. Effects of Long-term and Continius Horticatural Practices on Distribution of Potassium Forms and their Adsorption Properties in Urmia Region

    Directory of Open Access Journals (Sweden)

    zahra amirpour

    2017-02-01

    Full Text Available Introduction: Multiple biological and physiological processes in the plant, including carbohydrates and proteins formation, activation of 50 enzymes for energy transmission as well as reducing water losses from leaf pores, are mostly affected by the presence of potassium in the plant. In order to test this hypothesis, five soil subgroups (TypicCalcixerepts, FluventicHaploxerepts, TypicEndoaquepts, TypicHalaquepts and VerticEndoaquepts belonging 15 series of gardened and adjoining virgin soils were described and sampled. The studied soils had been influenced under horticultural practices for over five decades. Materials and Methods: The soil samples were analyzed for different K forms, K adsorption and physico- chemical properties after air drying and grinding to pass through a 2 mm-sieve. The particle-size distribution was determined by the hydrometer method (Bouyoucos, 1962. The total carbonate in the soil expressed as the calcium carbonate equivalent (CCE was determined by a rapid titration method (Nelson, 1982. Organic matter (OM was measuredby the Walkley and Black (1934 dichromate oxidation method. The pH of the soil was analyzed in 2:1 CaCl2/soil suspension using glass electrode pH meter (Crockford and Norwell, 1956 and EC was detected in a saturated extract. The cation exchange capacity (CEC was measured using sodium acetate (1 M NaOAc at pH 8.2 (Chapman, 1965. Water soluble K was extracted with deionized water (1: 5 w/v after shaking for 30 minutes on a mechanical shaker and later contents were centrifuged to separate clear extract (Jackson 1973. Exchangeable K was determined by extracting the soil with neutral normal ammonium acetate, Non-exchangeable K was estimated as the difference between boiling 1N HNO3 –K and neutral normal ammonium acetate K (Thomas 1982. Results and Discussion: The result showed that for most of the studied soils, long-terms horticultural practices decreased the amount of different K forms as a result of

  10. Measurement of the pion form factor in the time-like region for q2 values between 0.1 (GeV/c)2 and 0.18 (GeV/c)2

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Bertolucci, E.; Bettoni, D.; Bizzeti, A.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Foa, L.; Focardi, E.; Giannetti, P.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Frank, S.G.F.; Harvey, J.; Menasce, D.; Meroni, E.; Moroni, L.; Milan Univ.

    1984-01-01

    The EM form factor of the pion has been studied in the time-like region by measuring sigma(e + e - ->π + π - ) normalization to sigma(e + e - ->μ + μ - ). Results have been obtained for q 2 down to the physical threshold. (orig.)

  11. IRAS observations of the exciting stars of Herbig-Haro objects. II. The Reipurth and Graham sample and low-resolution spectra

    International Nuclear Information System (INIS)

    Cohen, M.

    1990-01-01

    Using IRAS COADDed images, candidates are suggested for the exciting stars of Herbig-Haro objects from the Reipurth and Graham sample. The IRAS low-resolution spectrometer provides spectra for 20 of the 46 candidate stars so far identified as exciting young, unevolved H-H systems. These reveal 10-micron silicate absorption features, or are too red to show detectable flux near 10 microns. The histogram of bolometric luminosities for 46 young Herbig-Haro exciting stars has a median of 13 solar luminosities and a mode between 16 and 32 solar luminosities. Although the enlarged sample of known exciting stars has more of the higher luminosity objects than an earlier sample, the histogram still represents a generally low-luminosity distribution. 27 refs

  12. Evaluating Form and Function of Regional Partnerships: Applying Social Network Analysis to the "Network for a Healthy California", 2001-2007

    Science.gov (United States)

    Gregson, Jennifer; Sowa, Marcy; Flynn, Heather Kohler

    2011-01-01

    Objective: To evaluate the partnership structure of the "Network for a Healthy California" ("Network"), a social marketing program, from 2001-2007, to determine if California's program was able to establish and maintain partnerships that (1) provided access to a local audience, (2) facilitated regional collaboration, (3)…

  13. Sequential star formation in RCW 34: A spectroscopic census of the stellar content of high-mass star-forming regions

    NARCIS (Netherlands)

    Bik, A.; Puga, E.; Waters, L.B.F.M.; Horrobin, M.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Kaper, L.; Van Den Ancker, M.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; de Koter, A.; Thi, W. F.; Comerón, F.; Waelkens, Ch

    2010-01-01

    In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is

  14. The GABA[subscript A] Receptor Agonist Muscimol Induces an Age- and Region-Dependent Form of Long-Term Depression in the Mouse Striatum

    Science.gov (United States)

    Zhang, Xiaoqun; Yao, Ning; Chergui, Karima

    2016-01-01

    Several forms of long-term depression (LTD) of glutamatergic synaptic transmission have been identified in the dorsal striatum and in the nucleus accumbens (NAc). Such experience-dependent synaptic plasticity might play important roles in reward-related learning. The GABA[subscript A] receptor agonist muscimol was recently found to trigger a…

  15. A Biomarker to Differentiate between Primary and Cocaine-Induced Major Depression in Cocaine Use Disorder: The Role of Platelet IRAS/Nischarin (I1-Imidazoline Receptor

    Directory of Open Access Journals (Sweden)

    Benjamin Keller

    2017-12-01

    Full Text Available The association of cocaine use disorder (CUD and comorbid major depressive disorder (MDD; CUD/MDD is characterized by high prevalence and poor treatment outcomes. CUD/MDD may be primary (primary MDD or cocaine-induced (CUD-induced MDD. Specific biomarkers are needed to improve diagnoses and therapeutic approaches in this dual pathology. Platelet biomarkers [5-HT2A receptor and imidazoline receptor antisera selected (IRAS/nischarin] were assessed by Western blot in subjects with CUD and primary MDD (n = 16 or CUD-induced MDD (n = 9; antidepressant free, AD−; antidepressant treated, AD+ and controls (n = 10 at basal level and/or after acute tryptophan depletion (ATD. Basal platelet 5-HT2A receptor (monomer was reduced in comorbid CUD/MDD subjects (all patients: 43% compared to healthy controls, and this down-regulation was independent of AD medication (decreases in AD−: 47%, and in AD+: 40%. No basal differences were found for IRAS/nischarin contents in AD+ and AD− comorbid CUD/MDD subjects. The comparison of IRAS/nischarin in the different subject groups during/after ATD showed opposite modulations (i.e., increases and decreases in response to low plasma tryptophan levels with significant differences discriminating between the subgroups of CUD with primary MDD and CUD-induced MDD. These specific alterations suggested that platelet IRAS/nischarin might be useful as a biomarker to discriminate between primary and CUD-induced MDD in this dual pathology.

  16. The Evaluation of Cone Capsule as an Alternative Hull form for Portable Tsunami Lifeboat to Support Evacuation System in the Coastal Regions and Small Islands

    Science.gov (United States)

    Fauzan Zakki, Ahmad; Suharto; Windyandari, Aulia

    2018-03-01

    Several attempts have been made to reduce the risk of tsunami disasters such as the development of early warning systems, evacuation procedures training, coastal protection and coastal spatial planning. Although many efforts to mitigate the impact of the tsunami in Indonesia was made, no one has developed a portable disaster rescue vehicle/shelter as well as a lifeboat on ships and offshore building, which is always available when a disaster occurs. The aim of the paper is to evaluate the performance of cone capsule shaped hull form that would be used for the portable tsunami lifeboat. The investigation of the boat resistance, intact stability, and seakeeping characteristics was made. The numerical analysis results indicate that the cone capsule is reliable as an alternative hull form for the portable tsunami lifeboat.

  17. Small Galactic H II regions. II. The molecular clouds and star formation

    International Nuclear Information System (INIS)

    Hunter, D.A.; Thronson, H.A. Jr.; Wilton, C.

    1990-01-01

    CO maps of molecular clouds associated with 11 small Galactic H II regions are presented and compared with IR images obtained by IRAS. The molecular masses of the clouds are computed and compared with the masses of the stellar content. The mapped clouds have masses of 1000-60,000 solar and are typical of the more numerous, smaller Galactic molecular clouds. All of the clouds have recently made massive OB stars, and many have complex spatial and kinematic structures. The coincidence of IRAS sources and CO peaks suggests that many of the clouds have sites of star formation other than the optically visible H II region. Star-formation efficiencies are uncertain, with values for the clouds ranging from 0.02 to 0.6 with an average value of 0.2. There is no trend of the upper stellar mass limit with Galactic radius and with molecular cloud mass. 53 refs

  18. FOSTER FAMILY AS A FORM OF UNITS FOR ORPHANS AND CHILDREN WITHOUT PARENTAL CARE (CASE STUDY OF SARATOV AND BELGOROD REGIONS

    Directory of Open Access Journals (Sweden)

    Oksana Vladimirovna Besschetnova

    2013-09-01

    Full Text Available This paper discusses the development and functioning of foster families, one of the priority interventions for children without parental care in Russia and abroad. The paper analyzes the current official statistics on the problem of child abandonment in Russia as a whole and in the Saratov and Belgorod regions of Russia in particular. The mechanism of social adaptation of children in foster care is based on the qualitative and quantitative methods (surveys and interviews of foster parents and foster children. The author identifies obstacles to the development of social institutions in the regions and the necessity of its active implementation in domestic social practices. The study found that foster care has been successful in areas where accepted legal basis allowed the recruiting, selecting candidates for adoptive parents, and foster care maintenance are carried out by social services. In addition, in order to reduce risk factors such as the secondary abandonment of foster children it is necessarily to increase assistance from the social guardianship bodies and professionals as well as building trusting parent-child relationships that use the democratic parenting style by foster parents.DOI: http://dx.doi.org/10.12731/2218-7405-2013-8-8

  19. Hot water in the Inner 100 AU of the Class 0 protostar NGC 1333 IRAS2A

    DEFF Research Database (Denmark)

    Visser, Ruud; Jørgensen, Jes Kristian; Kristensen, Lars E.

    2013-01-01

    -303 lines of H_2^{16}O and H_2^{18}O (1097 GHz, E u/k = 249 K) in the low-mass Class 0 protostar NGC 1333 IRAS2A. A spherical radiative transfer model with a power-law density profile is unable to reproduce both the HIFI data and existing interferometric data on the H_2^{18}O 313-220 line (203 GHz, E u....../k = 204 K). Instead, the HIFI spectra likely show optically thick emission from a hot core with a radius of about 100 AU. The mass of the hot core is estimated from the C18O J = 9-8 and 10-9 lines. We derive a lower limit to the hot water abundance of 2 × 10-5, consistent with the theoretical predictions...... of ~10-4. The revised HDO/H2O abundance ratio is 1 × 10-3, an order of magnitude lower than previously estimated. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA....

  20. SUBARCSECOND ANALYSIS OF THE INFALLING–ROTATING ENVELOPE AROUND THE CLASS I PROTOSTAR IRAS 04365+2535

    Energy Technology Data Exchange (ETDEWEB)

    Sakai, Nami [The Institute of Physical and Chemical Research (RIKEN), 2-1, Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Oya, Yoko; López-Sepulcre, Ana; Watanabe, Yoshimasa; Yamamoto, Satoshi [Department of Physics, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sakai, Takeshi [Department of Communication Engineering and Informatics, Graduate School of Informatics and Engineering, The University of Electro-Communications, Chofugaoka, Chofu, Tokyo 182-8585 (Japan); Hirota, Tomoya [National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan); Aikawa, Yuri [Center for Computational Science, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Ceccarelli, Cecilia; Lefloch, Bertrand; Kahane, Claudine [Universite de Grenoble Alpes, IPAG, F-38000 Grenoble (France); Caux, Emmanuel; Vastel, Charlotte [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France)

    2016-04-01

    Subarcsecond images of the rotational line emission of CS and SO have been obtained toward the Class I protostar IRAS 04365+2535 in TMC-1A with ALMA. A compact component around the protostar is clearly detected in the CS and SO emission. The velocity structure of the compact component of CS reveals infalling–rotating motion conserving the angular momentum. It is well explained by a ballistic model of an infalling–rotating envelope with the radius of the centrifugal barrier (one-half of the centrifugal radius) of 50 au, although the distribution of the infalling gas is asymmetric around the protostar. The distribution of SO is mostly concentrated around the radius of the centrifugal barrier of the simple model. Thus, a drastic change in chemical composition of the gas infalling onto the protostar is found to occur at a 50 au scale probably due to accretion shocks, demonstrating that the infalling material is significantly processed before being delivered into the disk.

  1. Galaxy evolution and large-scale structure in the far-infrared. II. The IRAS faint source survey

    International Nuclear Information System (INIS)

    Lonsdale, C.J.; Hacking, P.B.; Conrow, T.P.; Rowan-Robinson, M.

    1990-01-01

    The new IRAS Faint Source Survey data base is used to confirm the conclusion of Hacking et al. (1987) that the 60 micron source counts fainter than about 0.5 Jy lie in excess of predictions based on nonevolving model populations. The existence of an anisotropy between the northern and southern Galactic caps discovered by Rowan-Robinson et al. (1986) and Needham and Rowan-Robinson (1988) is confirmed, and it is found to extend below their sensitivity limit to about 0.3 Jy in 60 micron flux density. The count anisotropy at f(60) greater than 0.3 can be interpreted reasonably as due to the Local Supercluster; however, no one structure accounting for the fainter anisotropy can be easily identified in either optical or far-IR two-dimensional sky distributions. The far-IR galaxy sky distributions are considerably smoother than distributions from the published optical galaxy catalogs. It is likely that structure of the large size discussed here have been discriminated against in earlier studies due to insufficient volume sampling. 105 refs

  2. Fast digital 4πβ-4πγ coincidence counting with offline analysis at IRA.

    Science.gov (United States)

    Teresa Durán, M; Nedjadi, Youcef; Juget, Frédéric; Bochud, François; Bailat, Claude

    2018-04-01

    IRA recently launched a project to digitize all the data acquisition systems it uses for primary radionuclide standardizations. It is well-known that the digital approach presents numerous advantages over the traditional analog electronics such as information losslessness, scalability, online and/or offline data processing, and it is also a solution to the growing difficulties to repair or renew ageing modules. As a first step in this wider program, our institute set-up a 4πβ-4πγ digital coincidence counting system, with FPGA (Field Programmable Gate Array)-based commercial boards from National Instruments (NI), to perform data acquisition and offline data analysis. Choosing all components and software from the same supplier provides a full compact and consistent electronic system. To demonstrate and validate the capacity of this system to standardize the activity of radioisotopes, we compare its predictions for the activity concentration of 133 Ba, 166m Ho and 18 F solutions with the results from a coincidence counting system with analog electronics, as well as with the results from other primary methods and a secondary measurement performed with an IG11 ionization chamber (CIR, chambre d'ionization de référence) with an equivalent activity traceable to the Système International de Référence. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Chemical and Physical Picture of IRAS 16293–2422 Source B at a Sub-arcsecond Scale Studied with ALMA

    Science.gov (United States)

    Oya, Yoko; Moriwaki, Kana; Onishi, Shusuke; Sakai, Nami; López–Sepulcre, Ana; Favre, Cécile; Watanabe, Yoshimasa; Ceccarelli, Cecilia; Lefloch, Bertrand; Yamamoto, Satoshi

    2018-02-01

    We have analyzed the OCS, H2CS, CH3OH, and HCOOCH3 data observed toward the low-mass protostar IRAS 16293–2422 Source B at a sub-arcsecond resolution with ALMA. A clear chemical differentiation is seen in their distributions; OCS and H2CS are extended with a slight rotation signature, while CH3OH and HCOOCH3 are concentrated near the protostar. Such a chemical change in the vicinity of the protostar is similar to the companion (Source A) case. The extended component is interpreted by the infalling-rotating envelope model with a nearly face-on configuration. The radius of the centrifugal barrier of the infalling-rotating envelope is roughly evaluated to be (30–50) au. The observed lines show the inverse P-Cygni profile, indicating the infall motion within a few 10 au from the protostar. The nearly pole-on geometry of the outflow lobes is inferred from the SiO distribution, and thus, the infalling and outflowing motions should coexist along the line of sight to the protostar. This implies that the infalling gas is localized near the protostar and the current launching points of the outflow have an offset from the protostar. A possible mechanism for this configuration is discussed.

  4. A high-significance measurement of correlation between unresolved IRAS sources and optically-selected galaxy clusters

    Energy Technology Data Exchange (ETDEWEB)

    Hincks, Adam D.; Hajian, Amir [Canadian Institute for Theoretical Astrophysics, University of Toronto, Toronto, ON M5S 3H8 (Canada); Addison, Graeme E., E-mail: hincks@cita.utoronto.ca, E-mail: ahajian@cita.utoronto.ca, E-mail: gaddison@phas.ubc.ca [Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)

    2013-05-01

    We cross-correlate the 100 μm Improved Reprocessing of the IRAS Survey (IRIS) map and galaxy clusters at 0.1 < z < 0.3 in the maxBCG catalogue taken from the Sloan Digital Sky Survey, measuring an angular cross-power spectrum over multipole moments 150 < l < 3000 at a total significance of over 40σ. The cross-spectrum, which arises from the spatial correlation between unresolved dusty galaxies that make up the cosmic infrared background (CIB) in the IRIS map and the galaxy clusters, is well-fit by a single power law with an index of −1.28±0.12, similar to the clustering of unresolved galaxies from cross-correlating far-infrared and submillimetre maps at longer wavelengths. Using a recent, phenomenological model for the spectral and clustering properties of the IRIS galaxies, we constrain the large-scale bias of the maxBCG clusters to be 2.6±1.4, consistent with existing analyses of the real-space cluster correlation function. The success of our method suggests that future CIB-optical cross-correlations using Planck and Herschel data will significantly improve our understanding of the clustering and redshift distribution of the faint CIB sources.

  5. (EOI) Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dorine Odongo

    COLLABORATING TECHNICAL AGENCIES: EXPRESSION OF INTEREST FORM. • Please read the information provided about the initiative and the eligibility requirements in the Prospectus before completing this application form. • Ensure all the sections of the form are accurately completed and saved in PDF format.

  6. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.

    2008-01-01

    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  7. Binding labour and capital: moral obligation and forms of regulation in a regional economy Ligando o trabalho e o capital: obrigação moral e formas de regulação numa economia regional

    Directory of Open Access Journals (Sweden)

    Susana Narotzky

    2006-11-01

    Full Text Available The article is a critique of models of successful economic development in Europe based on the "economic region" idea. These models stress the usefulness of embedding economic relations in the social fabric ("social capital". The ethnography reveals, however, a conflict-laden space where increased embeddedness produces increased tension within the family and the community. In this "modelic" regional economy in Southern Alicante (Spain, recent violent events have involved local actors in the shoe-wear industry, with resident Chinese entrepreneurs. I will show how this confrontation underlines the rise of local modalities of conflict that build upon the organic and culturally bounded elements of economic production that the model stresses: local homogeneity and common interest. The ethnographic evidence shows the complexity of a "regional economy" in a globalized context where appeals to the State to strengthen and enforce some regulations coexist with appeals to de-regulate other areas of the economy.Este artigo é uma crítica aos modelos de sucesso de desenvolvimento económico na Europa baseados na ideia de "região económica". Estes modelos acentuam a utilidade do encastramento das relações económicas no tecido social ("capital social". No entanto, a etnografia mostra-nos um espaço de conflito onde um crescente encastramento produz um aumento da tensão na família e na comunidade. Nesta economia regional "modelar" do sul de Alicante (Espanha, episódios recentes de violência envolveram actores locais da indústria do calçado com empresários chineses aí residentes. Mostrarei como este confronto ilustra o surgimento de modalidades locais de conflito que se exprimem na base dos elementos orgânicos e de enraizamento cultural da produção económica sublinhados pelo modelo: a homogeneidade local e o interesse comum. A investigação etnográfica mostra a complexidade da "economia regional" num contexto globalizado, onde apelos dirigidos

  8. Insulin-like growth factor II (IGF II) in human brain: regional distribution of IGF II and of higher molecular mass forms

    International Nuclear Information System (INIS)

    Haselbacher, G.K.; Schwab, M.E.; Pasi, A.; Humbel, R.E.

    1985-01-01

    Twenty-four distinct areas of human brain were analyzed for the presence of insulin-like growth factor (IGF). As reported for cerebrospinal fluid, only IGF II-like immunoreactivity, but no significant amounts of IGF I-like immunoreactivity, could be found. Upon gel permeation chromatography, two to five distinct size classes were separated on the basis of their immunoreactivity. Radioimmunoassays and a bioassay also gave results indistinguishable from those of serum IGF II. The highest amounts of IGF II-like immunoreactivity occur in the anterior pituitary. This is up to 100 times more than in most other brain regions analyzed. The higher molecular mass immunoreactive species were partially characterized. After immunoaffinity purification, the 38- and 26-kDa species are active in a bioassay. Specific IGF-binding protein activity could be shown after purification of the 38- and 26-kDa species on an IGF-affinity column. The 13-kDa species released significant amounts of 7.5-kDa material. The results are interpreted as evidence for the presence of IGF II synthesized locally in human brain

  9. Probing the End of the IMF in NGC 2024 with NIRCam on JWST: Assessing the Impact of Nebular Emission in Galactic Star Forming Regions

    Science.gov (United States)

    Suri, Veenu; Meyer, Michael; Greenbaum, Alexandra Z.; Bell, Cameron; Beichman, Charles; Gordon, Karl D.; Greene, Thomas P.; Hodapp, K.; Horner, Scott; Johnstone, Doug; Leisenring, Jarron; Manara, Carlos; Mann, Rita; Misselt, K.; Raileanu, Roberta; Rieke, Marcia; Roellig, Thomas

    2018-01-01

    We describe observations of the embedded young cluster associated with the HII region NGC 2024 planned as part of the guaranteed time observing program for the James Webb Space Telescope with the NIRCam (Near Infrared Camera) instrument. Our goal is to obtain a census of the cluster down to 2 Jupiter masses, viewed through 10-20 magnitudes of extinction, using multi-band filter photometry, both broadband filters and intermediate band filters that are expected to be sensitive to temperature and surface gravity. The cluster contains several bright point sources as well as extended emission due to reflected light, thermal emission from warm dust, as well as nebular line emission. We first developed techniques to better understand which point sources would saturate in our target fields when viewed through several JWST NIRCam filters. Using images of the field with the WISE satellite in filters W1 and W2, as well as 2MASS (J and H) bands, we devised an algorithm that takes the K-band magnitudes of point sources in the field, and the known saturation limits of several NIRCam filters to estimate the impact of the extended emission on survey sensitivity. We provide an overview of our anticipated results, detecting the low mass end of the IMF as well as planetary mass objects likely liberated through dynamical interactions.

  10. Floodplain inundation response to climate, valley form, and flow regulation on a gravel-bed river in a Mediterranean-climate region

    Science.gov (United States)

    Cienciala, P.; Pasternack, G. B.

    2017-04-01

    Floodplain inundation regime defines hydrological connectivity between river channel and floodplain and thus strongly controls structure and function of these highly diverse and productive ecosystems. We combined an extensive LiDAR data set on topography and vegetation, long-term hydrological records, as well as the outputs of hydrological and two-dimensional hydraulic models to examine how floodplain inundation regimes in a dynamic, regulated, gravel-cobble river in a Mediterranean-climate region are controlled by reach-scale valley morphology, hydroclimatic conditions, and flow regulation. Estimated relative differences in the extent, duration, and cumulative duration of inundation events were often as large as an order of magnitude and generally greatest for large and long duration events. The relative impact of flow regulation was greatest under dry hydroclimatic conditions. Although the effects of hydroclimate and flow impairment are larger than that of valley floor topography, the latter controls sensitivity of floodplain hydroperiod to flow regime changes and should not be ignored. These quantitative estimates of the relative importance of factors that control floodplain processes in Mediterranean, semiarid rivers contributes to better understanding of hydrology and geomorphology of this important class of channels. We also discuss implications of our findings for processes that shape floodplain habitat for riparian vegetation and salmonid fish, especially in the context of ecological restoration.

  11. Constraining the Molecular Complexity in the Interstellar Medium—The Formation of Ethyl Methyl Ether (CH3OCH2CH3) in Star-forming Regions

    Science.gov (United States)

    Bergantini, Alexandre; Frigge, Robert; Kaiser, Ralf I.

    2018-05-01

    We report the first confirmed synthesis of ethyl methyl ether (EME, CH3CH2OCH3) within astrophysical model ices containing water (H2O) and methane (CH4) exposed to ionizing radiation at ultra-low temperatures of 5 K. EME (also known as methoxyethane), was recently observed toward Orion KL and currently is the largest confirmed oxygen-bearing molecule found in the interstellar medium. Exploiting isomer-selective photoionization (PI) of the subliming molecules in the temperature-programmed desorption phase at 10.49, 9.92, and 9.70 eV, coupled with reflectron time-of-flight mass spectrometry and isotopic substitution experiments (H2 18O–CH4), the detection of fragment ions of EME at m/z = 45 (C2H5O+) and m/z = 59 (C3H7O+), and probing the proton transfer in subliming ethanol–EME complexes via m/z = 61 (C3H9O+), the present study reveals that EME can be formed from suprathermal reactions initiated by cosmic rays and secondary electrons generated within astrophysical ices. The detection of EME in our experiments represents a significant advance in the understanding of formation pathways of complex organic molecules present in hot cores and helps to constrain astrochemical models on the formation of such species within molecular clouds.

  12. Recovery of gold from ammonia-thiosulfate media with amberlite IRA-410 ionic exchange resin; Recuperacion de oro desde un medio amoniaco-tiosulfato con resina de intercambio ionico Amberlite IRA-410

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, P.; Vargas, C.; Reveco, V.; Orellana, J.

    2006-07-01

    The absorption and elution of gold in thiosulfate-ammonia media were studied at laboratory level using the Amberlite IRA-410 ionic exchange resin. Tests were carried out in a stirred reactor, maintaining constant temperature (25 degree centigree), with a volume of solution/mass of resin ratio of 833,3 ml/g and during 3 h. The variables tested were the following: pH (9-11), thio sufate concentration (0-0,5 M), ammonia concentration (0-0,5 M) and selectivity in the presence of cupric ion. The obtained results indicate that gold adsorption was quick; the presence of thiosulfate decreased strongly the adsorption; and the presence of ammonia did not affect the adsorption mostly. The copper was in a certain measure a competitor of the gold, but its biggest negative effect was that acted as catalyst of the oxidizing reaction of thiosulfate (S{sub 2}O{sub 3}''2-) to tetrathionate (S{sub 4}O{sub 6}''2), which can cause a partial elution of gold during the load stage. Also, the behavior of CLO-''-{sub 4}; SO{sub 3}''2- and CLO''- as effluents was studied in both gold and copper elution. These tests were also carried out in a stirred reactor, to constant temperature (25 degree centigree) with a volume of aqueous solution/mass of resin ratio of 200 ml/g and for 3 h. Results demonstrated that the copper was eluted more quickly that the gold in all the cases. (Author) 34 refs.

  13. Herschel HIFI GOT C+ Survey: CII, HI, and CO Emissions in a Sample of Transition Clouds and Star-Forming regions in the Inner Galaxy

    Science.gov (United States)

    Pineda, Jorge; Velusamy, Thangasamy; Langer, William D.; Goldsmith, Paul; Li, Di; Yorke, Harold

    The GOT C+ a HIFI Herschel Key Project, studies the diffuse ISM throughout the Galactic Plane, using C+ as cloud tracer. The C+ line at 1.9 THz traces a so-far poorly studied stage in ISM cloud evolution -the transitional clouds going from atomic HI to molecular H2. This transition cloud phase, which is difficult to observe in HI and CO alone, may be best characterized via CII emission or absorption. The C+ line is also an excellent tracer of the warm diffuse gas and the warm, dense gas in the Photon Dominated Regions (PDRs). We can, therefore, use the CII emission as a probe to understand the effects of star formation on their interstellar environment. We present our first results on the transition between dense and hot gas (traced by CII) and dense and cold gas (traced by 12CO and 13CO) along a few representative lines of sight in the inner Galaxy from longitude 325 degrees to 25 degrees, taken during the HIFI Priority Science Phase. Comparisons of the high spectral resolution ( 1 km/s) HIFI data on C+ with HI, 12CO, and 13CO spectra allow us to separate out the different ISM components along each line of sight. Our results provide detailed information about the transition of diffuse atomic to molecular gas clouds needed to understand star formation and the lifecycle of the interstellar gas. These observations are being carried out with the Herschel Space Observatory, which is an ESA cornerstone mission, with contributions from NASA. This research was conducted at the Jet Propulsion Laboratory, California Institute of Technology under contract with the National Aeronautics and Space Administration. JLP was supported under the NASA Postdoctoral Program at JPL, Caltech, administered by Oak Ridge Associated Universities through a contract with NASA, and is currently supported as a Caltech-JPL Postdoctoral associate.

  14. Exploring the role of cognitive and structural forms of social capital in HIV/AIDS trends in the Kagera region of Tanzania - a grounded theory study.

    Science.gov (United States)

    Frumence, Gasto; Eriksson, Malin; Nystrom, Lennarth; Killewo, Japhet; Emmelin, Maria

    2011-04-01

    The article presents a synthesis of data from three village case studies focusing on how structural and cognitive social capital may have influenced the progression of the HIV epidemic in the Kagera region of Tanzania. Grounded theory was used to develop a theoretical model describing the possible links between structural and cognitive social capital and the impact on sexual health behaviours. Focus group discussions and key informant interviews were carried out to represent the range of experiences of existing social capital. Both structural and cognitive social capital were active avenues for community members to come together, empower each other, and develop norms, values, trust and reciprocal relations. This empowerment created an enabling environment in which members could adopt protective behaviours against HIV infection. On the one hand, we observed that involvement in formal and informal organisations resulted in a reduction of numbers of sexual partners, led people to demand abstinence from sexual relations until marriage, caused fewer opportunities for casual sex, and gave individuals the agency to demand the use of condoms. On the other hand, strict membership rules and regulations excluded some members, particularly excessive alcohol drinkers and debtors, from becoming members of the social groups, which increased their vulnerability in terms of exposure to HIV. Social gatherings (especially those organised during the night) were also found to increase youths' risk of HIV infection through instances of unsafe sex. We conclude that even though social capital may at times have negative effects on individuals' HIV-prevention efforts, this study provides initial evidence that social capital is largely protective through empowering vulnerable groups such as women and the poor to protect against HIV infection and by promoting protective sexual behaviours.

  15. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. V. DYNAMICAL MASS, DISTANCE, AND RADIO STRUCTURE OF V773 Tau A

    Energy Technology Data Exchange (ETDEWEB)

    Torres, Rosa M.; Franco-Hernandez, Ramiro; Vlemmings, Wouter H. T. [Argelander-Institut fuer Astronomie, Universitaet Bonn, Auf dem Huegel 71, D-53121 Bonn (Germany); Loinard, Laurent [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, D-53121 Bonn (Germany); Mioduszewski, Amy J. [Dominici Science Operations Center, National Radio Astronomy Observatory, 1003 Lopezville Road, Socorro, NM 87801 (United States); Boden, Andrew F. [Division of Physics, Math, and Astronomy, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Rodriguez, Luis F., E-mail: rtorres@astro.uni-bonn.de [Centro de Radiostronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, Apartado Postal 72-3 (Xangari), 58089 Morelia, Michoacan (Mexico)

    2012-03-01

    We present multi-epoch Very Long Baseline Array (VLBA) observations of V773 Tau A, the 51 day binary subsystem in the multiple young stellar system V773 Tau. Combined with previous interferometric and radial velocity measurements, these new data enable us to improve the characterization of the physical orbit of the A subsystem. In particular, we infer updated dynamical masses for the primary and the secondary components of 1.55 {+-} 0.11 M{sub Sun} and 1.293 {+-} 0.068 M{sub Sun }, respectively, and an updated orbital parallax distance to the system of 135.7 {+-} 3.2 pc, all consistent with previous estimates. Using the improved orbit, we can calculate the absolute coordinates of the barycenter of V773 Tau A at each epoch of our VLBA observations, and fit for its trigonometric parallax and proper motion. This provides a direct measurement of the distance to the system almost entirely independent of the orbit modeling. The best fit yields a distance of 129.9 {+-} 3.2 pc, in good agreement (i.e., within 1{sigma}) with the distance estimate based on the orbital fit. Taking the mean value of the orbital and trigonometric parallaxes, we conclude that V773 Tau is located at d = 132.8 {+-} 2.3 pc. The accuracy of this determination is nearly one order of magnitude better than that of previous estimates. In projection, V773 Tau and two other young stars (Hubble 4 and HDE 283572) recently observed with the VLBA are located toward the dark cloud Lynds 1495, in the central region of Taurus. These three stars appear to have similar trigonometric parallaxes, radial velocities, and proper motions, and we argue that the weighted mean and dispersion of their distances (d = 131.4 pc and {sigma}{sub d} = 2.4 pc) provide a good estimate of the distance to and depth of Lynds 1495 and its associated stellar population. The radio emission from the two sources in V773 Tau A is largely of gyrosynchrotron origin. Interestingly, both sources are observed to become typically five times

  16. VizieR Online Data Catalog: SEAMBHs. I. Mrk 142, Mrk 335, and IRAS F12397+3333 (Du+, 2014)

    Science.gov (United States)

    Du, P.; Hu, C.; Lu, K.-X.; Wang, F.; Qiu, J.; Li, Y.-R.; Bai, J.-M.; Kaspi, S.; Netzer, H.; Wang, J.-M.; SEAMBH Collaboration

    2016-03-01

    All the spectroscopy and imaging observations reported here were obtained with the Shangri-La telescope (SLT: IAU site code O44) at the Lijiang Station of the Yunnan Observatory of the Chinese Academy of Sciences. The SLT started its operation in 2008. This is a 2.4m alt-azimuth mounted Ritchey-Chretien telescope. The rms pointing error is about 2arcsec rms, and the tracking accuracy with autoguiding is better than 0.5''/hr. The longitude of the station is 100°01'51''E, the latitude 26°42'32''N, and the altitude 3193m. The annually averaged seeing is ~1.5'' in terms of the FWHM of stars (measured with Yunnan Faint Object Spectrograph and Camera, YFOSC), ranging from 0.7'' to 2.0''. The YFOSC, built in 2010 by the astronomical instrumentation team at the Niels Bohr Institute, is similar to the ESO Faint Object Spectrograph and Camera, but with an additional focal reducer. It started its operation in 2011. YFOSC is a versatile instrument for low resolution spectroscopy and imaging, working at the Cassegrain focus. The CCD chip is an e2v CCD42-90 Back Illuminated Deep Depletion 2048*4608 pixel Scientific CCD Sensor whose pixel size is 13.5mm, pixel scale 0.283''/pixel, covering a 10'*10' field of view (FOV). Our Reverberation Mapping (RM) campaign started in 2012 October. All the spectra were obtained using YFOSC with Grism 14 which provides a resolution of 92Å/mm (1.8Å/pixel) and covers the wavelength range of 3800-7200Å. In this first paper of the series we report the observations of three objects: Mrk 142, Mrk 335, and IRAS F12397+3333. (3 data files).

  17. The Infrared Astronomical Satellite /IRAS/ Scientific Data Analysis System /SDAS/ sky flux subsystem

    Science.gov (United States)

    Stagner, J. R.; Girard, M. A.

    1980-01-01

    The sky flux subsystem of the Infrared Astronomical Satellite Scientific Data Analysis System is described. Its major output capabilities are (1) the all-sky lune maps (8-arcminute pixel size), (2) galactic plane maps (2-arcminute pixel size) and (3) regional maps of small areas such as extended sources greater than 1-degree in extent. The major processing functions are to (1) merge the CRDD and pointing data, (2) phase the detector streams, (3) compress the detector streams in the in-scan and cross-scan directions, and (4) extract data. Functional diagrams of the various capabilities of the subsystem are given. Although this device is inherently nonimaging, various calibrated and geometrically controlled imaging products are created, suitable for quantitative and qualitative scientific interpretation.

  18. Estudio clínico-epidemiológico y molecular de Metapneumovirus Humano en pacientes con Infecciones Respiratorias Agudas (IRA) en Venezuela

    OpenAIRE

    Tovar H, Cerraf E; Moncho S, Alessandra; Fernandez S, David; Aguilar M, Marwan S; Morón, Dulce

    2014-01-01

    El Metapneumovirus Humano (MPVh) ha sido asociado con Infecciones Respiratorias Agudas (IRA) en pacientes de todas las edades. Estudios epidemiológicos indican la prevalencia del MPVh alrededor del mundo, sin embargo, en Venezuela poco se conoce sobre su comportamiento en la población. Este estudio pretende describir el comportamiento epidemiológico de la infección por MPVh en pacientes venezolanos. Se evaluaron por RT-PCR multiplex 1812 hisopados nasales (HN) provenientes de pacientes con di...

  19. La Evoluci?n de la percepci?n del rol del IRA Provisional a partir de est?mulos generados por el Sistema Internacional

    OpenAIRE

    Cort?s Rojas, Mar?a Alejandra

    2017-01-01

    Esta investigaci?n tiene como objetivo explicar los cambios en la forma de lucha, tanto armada como pol?tica, del IRA Provisional a partir del surgimiento de movimientos por los derechos civiles en Estados Unidos, el fin de la Guerra Fr?a y la deslegitimaci?n de los movimientos anti-imperialistas, el auge econ?mico irland?s y la expansi?n de los valores de la Uni?n Europea. Estos cambios pueden verse explicados por la forma en la que el grupo cambia su percepci?n del rol que desarrolla dentro...

  20. Niveles de ira en deportistas: diferencias en función del grado de contacto y el género. [Anger intensity in sportspeople: differences based on contact and gender].

    Directory of Open Access Journals (Sweden)

    José Ignacio Menéndez-Santurio

    2017-10-01

    Full Text Available Los objetivos de este estudio fueron tres: (1 analizar los niveles de ira de las personas en función del grado de contacto en el deporte practicado, (2 examinar los niveles de ira en función del género, y (3 determinar posibles correlaciones entre la ira y la edad, los años, los días y las horas semanales de práctica. 398 personas (188 hombres y 210 mujeres entre 16 y 35 años accedieron a participar: 148 competidores de deportes de contacto, 138 de deportes sin contacto y 112 no practicantes. Se llevó a cabo una investigación cuantitativa de tipo comparativa transversal. Se utilizó el Inventario de la Expresión de la Ira Estado-Rasgo. Los resultados mostraron diferencias significativas (p < 0,05 en el sentimiento de ira entre no practicantes y practicantes de deportes sin contacto, en la expresión verbal de la ira entre practicantes de deportes de contacto y sin contacto y en la reacción a la ira entre no-practicantes y practicantes de deportes de contacto. Asimismo, se hallaron diferencias significativas (p < 0,05 en las variables rasgo de ira, control interno de ira y expresión física de la ira en función del género. También se encontraron correlaciones negativas significativas (p < 0,05 entre la edad, días y años de práctica y la ira. Estos hallazgos señalan que los niveles de ira se ven afectados por la cantidad, intensidad y grado de contacto de su práctica deportiva, así como por el género. Abstract The aims of this study were three: (1 to assess individuals’ anger levels based on the contact in the sport, (2 to examine anger levels based on gender, and (3 to determine possible correlations between anger and age, years, days, and hours of practice. 398 individuals (188 males and 210 females between 16 and 35 years agreed to participate: 148 contact-sport competitors, 138 contactless sport and 112 individuals who did not practice any sport. A comparative, transversal quantitative research design was carried out

  1. Discriminación en el trabajo y el vecindario hacia las mujeres que viven con VIH y su relación con la depresión y la ira

    Directory of Open Access Journals (Sweden)

    José Moral de la Rubia

    2015-01-01

    Full Text Available Se describe el nivel de discriminación percibida en el trabajo y el vecindario, y se estudia la relación que tiene con la depresión y la ira. La escala de Discriminación Temida y Percibida, el Inventario de Depresión de Beck y el Inventario de Rasgo- Estado-Expresión de Ira se aplicaron a una muestra no probabilística de 200 mujeres con VIH. Se percibe discriminación en el trabajo y el vecindario con mayor frecuencia que en la familia. La discriminación se relacionó más con depresión, no teniendo la ira un papel mediador. Se concluye que prevenir la discriminación podría ser un factor protector de depresión en mujeres que viven con VIH.

  2. Influencia de las Emociones Negativas (Ansiedad, Depresión e Ira sobre la Eficacia de un Programa de Tratamiento Cognitivo Conductual de Deshabituación al Tabaco

    Directory of Open Access Journals (Sweden)

    Francisco Javier Pérez-Pareja

    2010-01-01

    Full Text Available El objetivo de esta investigación es analizar la influencia de la ansiedad, la ira y la depresión, como emociones negativas, sobre el éxito en la aplicación de un tratamiento psicológico de carácter cognitivo-conductual para dejar de fumar. Estas tres respuestas emocionales fueron evaluadas en una muestra final de 180 personas antes de iniciar el tratamiento. Los resultados muestran que la depresión y la ira ejercen una importante influencia sobre el éxito terapéutico; es decir, habiendo dejado de fumar, mientras que la ansiedad no muestra efectos significativos. Sujetos con elevadas puntuaciones en depresión presentan importantes dificultades para finalizar el programa de manera exitosa, mientras que sujetos con puntuaciones elevadas en ira muestran una buena adherencia y un importante porcentaje de éxito en el tratamiento.

  3. Ira Hirsh and oral deaf education: The role of audition in language development

    Science.gov (United States)

    Geers, Ann

    2002-05-01

    Prior to the 1960s, the teaching of speech to deaf children consisted primarily of instruction in lip reading and tactile perception accompanied by imitative exercises in speech sound production. Hirsh came to Central Institute for the Deaf with an interest in discovering the auditory capabilities of normal-hearing listeners. This interest led him to speculate that more normal speech development could be encouraged in deaf children by maximizing use of their limited residual hearing. Following the tradition of Max Goldstein, Edith Whetnall, and Dennis Fry, Hirsh gave scientific validity to the use of amplified speech as the primary avenue to oral language development in prelingually deaf children. This ``auditory approach,'' combined with an emphasis on early intervention, formed the basis for auditory-oral education as we know it today. This presentation will examine how the speech perception, language, and reading skills of prelingually deaf children have changed as a result of improvements in auditory technology that have occurred over the past 30 years. Current data from children using cochlear implants will be compared with data collected earlier from children with profound hearing loss who used hearing aids. [Work supported by NIH.

  4. Influencia de las Emociones Negativas (Ansiedad, Depresión e Ira) sobre la Eficacia de un Programa de Tratamiento Cognitivo Conductual de Deshabituación al Tabaco

    OpenAIRE

    Francisco Javier Pérez-Pareja; Albert Sesé; Ana Filomena Romo; Alfonso Palmer; Manuel Tomás

    2010-01-01

    El objetivo de esta investigación es analizar la influencia de la ansiedad, la ira y la depresión, como emociones negativas, sobre el éxito en la aplicación de un tratamiento psicológico de carácter cognitivo-conductual para dejar de fumar. Estas tres respuestas emocionales fueron evaluadas en una muestra final de 180 personas antes de iniciar el tratamiento. Los resultados muestran que la depresión y la ira ejercen una importante influencia sobre el éxito terapéutico; es decir, habiendo deja...

  5. NuSTAR View of the Black Hole Wind in the Galaxy Merger IRAS F11119+3257

    Science.gov (United States)

    Tombesi, F.; Veilleux, S.; Meléndez, M.; Lohfink, A.; Reeves, J. N.; Piconcelli, E.; Fiore, F.; Feruglio, C.

    2017-12-01

    Galactic winds driven by active galactic nuclei (AGNs) have been invoked to play a fundamental role in the co-evolution between supermassive black holes and their host galaxies. Finding observational evidence of such feedback mechanisms is of crucial importance and it requires a multi-wavelength approach in order to compare winds at different scales and phases. In Tombesi et al., we reported the detection of a powerful ultra-fast outflow (UFO) in the Suzaku X-ray spectrum of the ultra-luminous infrared galaxy IRAS F11119+3257. The comparison with a galaxy-scale OH molecular outflow observed with Herschel in the same source supported the energy-conserving scenario for AGN feedback. The main objective of this work is to perform an independent check of the Suzaku results using the higher sensitivity and wider X-ray continuum coverage of NuSTAR. We clearly detect a highly ionized Fe K UFO in the 100 ks NuSTAR spectrum with parameters N H = (3.2 ± 1.5) × 1024 cm-2, log ξ = {4.0}-0.3+1.2 erg s-1 cm, and {v}{out}={0.253}-0.118+0.061c. The launching radius is likely at a distance of r ≥ 16r s from the black hole. The mass outflow rate is in the range of {\\dot{M}}{out} ≃ 0.5-2 M ⊙ yr-1. The UFO momentum rate and power are {\\dot{P}}{out} ≃ 0.5-2 L AGN/c and {\\dot{E}}{out} ≃ 7%-27% L AGN, respectively. The UFO parameters are consistent between the 2013 Suzaku and the 2015 NuSTAR observations. Only the column density is found to be variable, possibly suggesting a clumpy wind. The comparison with the energetics of molecular outflows estimated in infrared and millimeter wavelengths support a connection between the nuclear and galaxy-scale winds in luminous AGNs.

  6. WITNESSING THE KEY EARLY PHASE OF QUASAR EVOLUTION: AN OBSCURED ACTIVE GALACTIC NUCLEUS PAIR IN THE INTERACTING GALAXY IRAS 20210+1121

    International Nuclear Information System (INIS)

    Piconcelli, Enrico; Fiore, Fabrizio; Maiolino, Roberto; Nicastro, Fabrizio; Vignali, Cristian; Bianchi, Stefano; Mathur, Smita; Guainazzi, Matteo; Lanzuisi, Giorgio

    2010-01-01

    We report the discovery of an active galactic nucleus (AGN) pair in the interacting galaxy system IRAS 20210+1121 at z = 0.056. An XMM-Newton observation reveals the presence of an obscured (N H ∼ 5 x 10 23 cm -2 ), Seyfert-like (L 2-10keV = 4.7 x 10 42 erg s -1 ) nucleus in the northern galaxy, which lacks unambiguous optical AGN signatures. Our spectral analysis also provides strong evidence that the IR-luminous southern galaxy hosts a Type 2 quasar embedded in a bright starburst emission. In particular, the X-ray primary continuum from the nucleus appears totally depressed in the XMM-Newton band as expected in the case of a Compton-thick absorber, and only the emission produced by Compton scattering ('reflection') of the continuum from circumnuclear matter is seen. As such, IRAS 20210+1121 seems to provide an excellent opportunity to witness a key, early phase in the quasar evolution predicted by the theoretical models of quasar activation by galaxy collisions.

  7. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei

    2016-03-01

    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  8. Characterizing filaments in regions of high-mass star formation: High-resolution submilimeter imaging of the massive star-forming complex NGC 6334 with ArTéMiS

    Science.gov (United States)

    André, Ph.; Revéret, V.; Könyves, V.; Arzoumanian, D.; Tigé, J.; Gallais, P.; Roussel, H.; Le Pennec, J.; Rodriguez, L.; Doumayrou, E.; Dubreuil, D.; Lortholary, M.; Martignac, J.; Talvard, M.; Delisle, C.; Visticot, F.; Dumaye, L.; De Breuck, C.