Classification of IRAS asteroids

International Nuclear Information System (INIS)

Tedesco, E.F.; Matson, D.L.; Veeder, G.J.

1989-01-01

Albedos and spectral reflectances are essential for classifying asteroids. For example, classes E, M and P are indistinguishable without albedo data. Colorometric data are available for about 1000 asteroids but, prior to IRAS, albedo data was available for only about 200. IRAS broke this bottleneck by providing albedo data on nearly 2000 asteroids. Hence, excepting absolute magnitudes, the albedo and size are now the most common asteroid physical parameters known. In this chapter the authors present the results of analyses of IRAS-derived asteroid albedos, discuss their application to asteroid classification, and mention several studies which might be done to exploit further this data set

Optical identifications of IRAS point sources: the Fornax, Hydra I and Coma clusters

International Nuclear Information System (INIS)

Wang, G.; Leggett, S.K.; Savage, A.

1991-01-01

We present optical identifications for 66 IRAS point sources in the region of the Fornax cluster of galaxies, 106 IRAS point sources in the region of the Hydra I cluster of galaxies (Abell 1060) and 59 IRAS point sources in the region of the Coma cluster of galaxies (Abell 1656). Eight other sources in Hydra I do not have optical counterparts and are very probably due to infrared cirrus. Twenty-three (35 per cent) of the Fornax sources are associated with stars and 43 (65 per cent) with galaxies; 48 (42 per cent) of the Hydra I sources are associated with stars and 58 (51 per cent) with galaxies; 18 (31 per cent) of the Coma sources are associated with stars and 41 (69 per cent) with galaxies. The stellar and infrared cirrus surface density is consistent with the galactic latitude of each field. (author)

IRAS observations of the Pleiades

Science.gov (United States)

Cox, P.; he ultraviolet.

1987-01-01

The Infrared Astronomy Satellite (IRAS) observations of the Pleiades region are reported. The data show large flux densities at 12 and 25 microns, extended over the optical nebulosity. This strong excess emission, implying temperatures of a few hundred degrees Kelvin, indicates a population of very small grains in the Pleiades. It is suggested that these grains are similar to the small grains needed to explain the surface brightness measurements made in the ultraviolet.

IRAS observations of the Pleiades

International Nuclear Information System (INIS)

Cox, P.; Leene, A.

1987-01-01

The Infrared Astronomy Satellite (IRAS) observations of the Pleiades region are reported. The data show large flux densities at 12 and 25 microns, extended over the optical nebulosity. This strong excess emission, implying temperatures of a few hundred degrees Kelvin, indicates a population of very small grains in the Pleiades. It is suggested that these grains are similar to the small grains needed to explain the surface brightness measurements made in the ultraviolet

A highly embedded protostar in SFO 18: IRAS 05417+0907

Science.gov (United States)

Saha, Piyali; Gopinathan, Maheswar; Puravankara, Manoj; Sharma, Neha; Soam, Archana

2018-04-01

Bright-rimmed clouds, located at the periphery of relatively evolved HIT regions, are considered to be the sites of star formation possibly triggered by the implosion caused due to the ionizing radiation from nearby massive stars. SFO 18 is one such region showing a bright-rim on the side facing the 0-type star, A Ori. A point source, IRAS 05417+0907, is detected towards the high density region of the cloud. A molecular outflow has been found to be associated with the source. The outflow is directed towards a Herbig-Haro object, HH 175. From the Spitzer and WISE observations, we show evidence of a physical connection between the molecular outflow, IRAS 05417+0907 and the HH object. The spectral energy distribution constructed using multi-wavelength data shows that the point source is most likely a highly embedded protostar.

EXTERNALLY HEATED PROTOSTELLAR CORES IN THE OPHIUCHUS STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A. [NASA Goddard Space Flight Center, Astrochemistry Laboratory, Mail Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Jørgensen, Jes K.; Bjerkeli, Per, E-mail: johan.lindberg@nasa.gov [Centre for Star and Planet Formation, Niels Bohr Institute and Natural History Museum of Denmark, University of Copenhagen, Øster Voldgade 5-7, DK-1350 Copenhagen K (Denmark)

2017-01-20

We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbig Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

EXTINCTION AND POLYCYCLIC AROMATIC HYDROCARBON INTENSITY VARIATIONS ACROSS THE H II REGION IRAS 12063-6259

Energy Technology Data Exchange (ETDEWEB)

Stock, D. J.; Peeters, E.; Otaguro, J. N. [Department of Physics and Astronomy, University of Western Ontario, London, ON N6A 3K7 (Canada); Tielens, A. G. G. M. [Leiden Observatory, Leiden University, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Bik, A. [Max-Planck-Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany)

2013-07-01

The spatial variations in polycyclic aromatic hydrocarbon (PAH) band intensities are normally attributed to the physical conditions of the emitting PAHs, however in recent years it has been suggested that such variations are caused mainly by extinction. To resolve this question, we have obtained near-infrared (NIR), mid-infrared (MIR), and radio observations of the compact H II region IRAS 12063-6259. We use these data to construct multiple independent extinction maps and also to measure the main PAH features (6.2, 7.7, 8.6, and 11.2 {mu}m) in the MIR. Three extinction maps are derived: the first using the NIR hydrogen lines and case B recombination theory; the second combining the NIR data with radio data; and the third making use of the Spitzer/IRS MIR observations to measure the 9.8 {mu}m silicate absorption feature using the Spoon method and PAHFIT (as the depth of this feature can be related to overall extinction). The silicate absorption over the bright, southern component of IRAS 12063-6259 is almost absent while the other methods find significant extinction. While such breakdowns of the relationship between the NIR extinction and the 9.8 {mu}m absorption have been observed in molecular clouds, they have never been observed for H II regions. We then compare the PAH intensity variations in the Spitzer/IRS data after dereddening to those found in the original data. It was found that in most cases, the PAH band intensity variations persist even after dereddening, implying that extinction is not the main cause of the PAH band intensity variations.

The High-Resolution IRAS Galaxy Atlas

Science.gov (United States)

Cao, Yu; Terebey, Susan; Prince, Thomas A.; Beichman, Charles A.; Oliversen, R. (Technical Monitor)

1997-01-01

An atlas of the Galactic plane (-4.7 deg is less than b is less than 4.7 deg), along with the molecular clouds in Orion, rho Oph, and Taurus-Auriga, has been produced at 60 and 100 microns from IRAS data. The atlas consists of resolution-enhanced co-added images with 1 min - 2 min resolution and co-added images at the native IRAS resolution. The IRAS Galaxy Atlas, together with the Dominion Radio Astrophysical Observatory H(sub I) line/21 cm continuum and FCRAO CO (1-0) Galactic plane surveys, which both have similar (approx. 1 min) resolution to the IRAS atlas, provides a powerful tool for studying the interstellar medium, star formation, and large-scale structure in our Galaxy. This paper documents the production and characteristics of the atlas.

Gemini IFU, VLA, and HST observations of the OH megamaser galaxy IRAS F23199+0123: the hidden monster and its outflow

Science.gov (United States)

Hekatelyne, C.; Riffel, Rogemar A.; Sales, Dinalva; Robinson, Andrew; Gallimore, Jack; Storchi-Bergmann, Thaisa; Kharb, Preeti; O'Dea, Christopher; Baum, Stefi

2018-03-01

We present Gemini Multi-Object Spectrograph (GMOS) Integral field Unit (IFU), Very Large Array (VLA), and Hubble Space Telescope (HST) observations of the OH megamaser (OHM) galaxy IRAS F23199+0123. Our observations show that this system is an interacting pair, with two OHM sources associated with the eastern (IRAS 23199E) member. The two members of the pair present somewhat extended radio emission at 3 and 20 cm, with flux peaks at each nucleus. The GMOS-IFU observations cover the inner ˜6 kpc of IRAS 23199E at a spatial resolution of 2.3 kpc. The GMOS-IFU flux distributions in Hα and [N II] λ6583 are similar to that of an HST [N II]+Hα narrow-band image, being more extended along the north-east-south-west direction, as also observed in the continuum HST F814W image. The GMOS-IFU Hα flux map of IRAS 23199E shows three extranuclear knots attributed to star-forming complexes. We have discovered a Seyfert 1 nucleus in this galaxy, as its nuclear spectrum shows an unresolved broad (full width at half-maximum ≈2170 km s-1) double-peaked Hα component, from which we derive a black hole mass of M_{BH} = 3.8^{+0.3}_{-0.2}× 106 M⊙. The gas kinematics shows low velocity dispersions (σ) and low [N II]/Hα ratios for the star-forming complexes and higher σ and [N II]/Hα surrounding the radio emission region, supporting interaction between the radio plasma and ambient gas. The two OH masers detected in IRAS F23199E are observed in the vicinity of these enhanced σ regions, supporting their association with the active nucleus and its interaction with the surrounding gas. The gas velocity field can be partially reproduced by rotation in a disc, with residuals along the north-south direction being tentatively attributed to emission from the front walls of a bipolar outflow.

Chemistry of the High-mass Protostellar Molecular Clump IRAS 16562–3959

Science.gov (United States)

Guzmán, Andrés E.; Guzmán, Viviana V.; Garay, Guido; Bronfman, Leonardo; Hechenleitner, Federico

2018-06-01

We present molecular line observations of the high-mass molecular clump IRAS 16562‑3959 taken at 3 mm using the Atacama Large Millimeter/submillimeter Array at 1.″7 angular resolution (0.014 pc spatial resolution). This clump hosts the actively accreting high-mass young stellar object (HMYSO) G345.4938+01.4677, which is associated with a hypercompact H II region. We identify and analyze emission lines from 22 molecular species (encompassing 34 isomers) and classify them into two groups, depending on their spatial distribution within the clump. One of these groups gathers shock tracers (e.g., SiO, SO, HNCO) and species formed in dust grains like methanol (CH3OH), ethenone or ketene (H2CCO), and acetaldehyde (CH3CHO). The second group collects species closely resembling the dust continuum emission morphology and are formed mainly in the gas phase, like hydrocarbons (CCH, c-C3H2, CH3CCH), cyanopolyynes (HC3N and HC5N), and cyanides (HCN and CH3C3N). Emission from complex organic molecules (COMs) like CH3OH, propanenitrile (CH3CH2CN), and methoxymethane (CH3OCH3) arise from gas in the vicinity of a hot molecular core (T ≳ 100 K) associated with the HMYSO. Other COMs such as propyne (CH3CCH), acrylonitrile (CH2CHCN), and acetaldehyde seem to better trace warm (T ≲ 80 K) dense gas. In addition, deuterated ammonia (NH2D) is detected mostly in the outskirts of IRAS 16562‑3959 and associated with near-infrared dark globules, probably gaseous remnants of the clump’s prestellar phase. The spatial distribution of molecules in IRAS 16562‑3959 supports the view that in protostellar clumps, chemical tracers associated with different evolutionary stages—starless to hot cores/H II regions—exist coevally.

EXTINCTION AND POLYCYCLIC AROMATIC HYDROCARBON INTENSITY VARIATIONS ACROSS THE H II REGION IRAS 12063–6259

International Nuclear Information System (INIS)

Stock, D. J.; Peeters, E.; Otaguro, J. N.; Tielens, A. G. G. M.; Bik, A.

2013-01-01

The spatial variations in polycyclic aromatic hydrocarbon (PAH) band intensities are normally attributed to the physical conditions of the emitting PAHs, however in recent years it has been suggested that such variations are caused mainly by extinction. To resolve this question, we have obtained near-infrared (NIR), mid-infrared (MIR), and radio observations of the compact H II region IRAS 12063–6259. We use these data to construct multiple independent extinction maps and also to measure the main PAH features (6.2, 7.7, 8.6, and 11.2 μm) in the MIR. Three extinction maps are derived: the first using the NIR hydrogen lines and case B recombination theory; the second combining the NIR data with radio data; and the third making use of the Spitzer/IRS MIR observations to measure the 9.8 μm silicate absorption feature using the Spoon method and PAHFIT (as the depth of this feature can be related to overall extinction). The silicate absorption over the bright, southern component of IRAS 12063–6259 is almost absent while the other methods find significant extinction. While such breakdowns of the relationship between the NIR extinction and the 9.8 μm absorption have been observed in molecular clouds, they have never been observed for H II regions. We then compare the PAH intensity variations in the Spitzer/IRS data after dereddening to those found in the original data. It was found that in most cases, the PAH band intensity variations persist even after dereddening, implying that extinction is not the main cause of the PAH band intensity variations.

Complex molecules in the hot core of the low-mass protostar NGC 1333 IRAS 4A

NARCIS (Netherlands)

Bottinelli, S; Ceccarelli, C; Lefloch, B; Williams, JP; Castets, A; Caux, E; Cazaux, S; Maret, S; Parise, B; Tielens, AGGM

2004-01-01

We report the detection of complex molecules (HCOOCH3, HCOOH, and CH3CN), signposts of a hot core like region, toward the low-mass Class 0 source NGC 1333 IRAS 4A. This is the second low-mass protostar in which such complex molecules have been searched for and reported, the other source being IRAS

Warm water deuterium fractionation in IRAS 16293-2422

DEFF Research Database (Denmark)

Persson, Magnus Vilhelm; Jørgensen, Jes Kristian; van Dishoeck, E. F.

2013-01-01

observations reveal the physical and chemical structure of water vapor close to the protostars on solar-system scales. The red-shifted absorption detected toward source B is indicative of infall. The excitation temperature is consistent with the picture of water ice evaporation close to the protostar. The low......Context. Measuring the water deuterium fractionation in the inner warm regions of low-mass protostars has so far been hampered by poor angular resolution obtainable with single-dish ground- and space-based telescopes. Observations of water isotopologues using (sub)millimeter wavelength...... interferometers have the potential to shed light on this matter. Aims: To measure the water deuterium fractionation in the warm gas of the deeply-embedded protostellar binary IRAS 16293-2422. Methods: Observations toward IRAS 16293-2422 of the 53,2 - 44,1 transition of H218O at 692.07914 GHz from Atacama Large...

IRAS variables as galactic structure tracers - Classification of the bright variables

Science.gov (United States)

Allen, L. E.; Kleinmann, S. G.; Weinberg, M. D.

1993-01-01

The characteristics of the 'bright infrared variables' (BIRVs), a sample consisting of the 300 brightest stars in the IRAS Point Source Catalog with IRAS variability index VAR of 98 or greater, are investigated with the purpose of establishing which of IRAS variables are AGB stars (e.g., oxygen-rich Miras and carbon stars, as was assumed by Weinberg (1992)). Results of the analysis of optical, infrared, and microwave spectroscopy of these stars indicate that, out of 88 stars in the BIRV sample identified with cataloged variables, 86 can be classified as Miras. Results of a similar analysis performed for a color-selected sample of stars, using the color limits employed by Habing (1988) to select AGB stars, showed that, out of 52 percent of classified stars, 38 percent are non-AGB stars, including H II regions, planetary nebulae, supergiants, and young stellar objects, indicating that studies using color-selected samples are subject to misinterpretation.

Photodynamic therapy (PDT and waterfiltered infrared A (wIRA in patients with recalcitrant common hand and foot warts

Directory of Open Access Journals (Sweden)

Hoffmann, Gerd

2004-10-01

Full Text Available Background: Common warts (verrucae vulgares are human papilloma virus (HPV infections with a high incidence and prevalence, most often affecting hands and feet, being able to impair quality of life. About 30 different therapeutic regimens described in literature reveal a lack of a single striking strategy. Recent publications showed positive results of photodynamic therapy (PDT with 5-aminolevulinic acid (5-ALA in the treatment of HPV-induced skin diseases, especially warts, using visible light (VIS to stimulate an absorption band of endogenously formed protoporphyrin IX. Additional experiences adding waterfiltered infrared A (wIRA during 5-ALA-PDT revealed positive effects. Aim of the study: First prospective randomised controlled blind study including PDT and wIRA in the treatment of recalcitrant common hand and foot warts. Comparison of "5-ALA cream (ALA vs. placebo cream (PLC" and "irradiation with visible light and wIRA (VIS+wIRA vs. irradiation with visible light alone (VIS". Methods: Pre-treatment with keratolysis (salicylic acid and curettage. PDT treatment: topical application of 5-ALA (Medac in "unguentum emulsificans aquosum" vs. placebo; irradiation: combination of VIS and a large amount of wIRA (Hydrosun® radiator type 501, 4 mm water cuvette, waterfiltered spectrum 590-1400 nm, contact-free, typically painless vs. VIS alone. Post-treatment with retinoic acid ointment. One to three therapy cycles every 3 weeks. Main variable of interest: "Percent change of total wart area of each patient over the time" (18 weeks. Global judgement by patient and by physician and subjective rating of feeling/pain (visual analogue scales. 80 patients with therapy-resistant common hand and foot warts were assigned randomly into one of the four therapy groups with comparable numbers of warts at comparable sites in all groups. Results: The individual total wart area decreased during 18 weeks in group 1 (ALA+VIS+wIRA and in group 2 (PLC+VIS+wIRA

Ligand binding affinity at the insulin receptor isoform A (IR-A and subsequent IR-A tyrosine phosphorylation kinetics are important determinants of mitogenic biological outcomes.

Directory of Open Access Journals (Sweden)

Harinda eRajapaksha

2015-07-01

Full Text Available The insulin receptor (IR is a tyrosine kinase receptor that can mediate both metabolic and mitogenic biological actions. The IR isoform-A (IR-A arises from alternative splicing of exon 11 and has different ligand binding and signalling properties compared to the IR isoform-B. The IR-A not only binds insulin but also insulin-like growth factor-II (IGF-II with high affinity. IGF-II acting through the IR-A promotes cancer cell proliferation, survival and migration by activating some unique signalling molecules compared to those activated by insulin. This observation led us to investigate whether the different IR-A signalling outcomes in response to IGF-II and insulin could be attributed to phosphorylation of a different subset of IR-A tyrosine residues or to the phosphorylation kinetics. We correlated IR-A phosphorylation to activation of molecules involved in mitogenic and metabolic signalling (MAPK and Akt and receptor internalisation rates (related to mitogenic signalling. We also extended this study to incorporate two ligands that are known to promote predominantly mitogenic ([His4, Tyr15, Thr49, Ile51] IGF-I, qIGF-I or metabolic (S597 peptide biological actions, to see if common mechanisms can be used to define mitogenic or metabolic signalling through the IR-A. The 3-fold lower mitogenic action of IGF-II compared to insulin was associated with a decreased potency in activation of Y960, Y1146, Y1150, Y1151, Y1316 and Y1322, in MAPK phosphorylation and in IR-A internalization. With the poorly mitogenic S597 peptide it was a decreased rate of tyrosine phosphorylation rather than potency that was associated with a low mitogenic potential. We conclude that both decreased affinity of IR-A binding and the kinetics of IR-A phosphorylation can independently lead to a lower mitogenic activity. None of the studied parameters could account for the lower metabolic activity of qIGF-I.

Radio and optical studies of high luminosity Iras galaxies

International Nuclear Information System (INIS)

Wolstencroft, R.D.; Parker, Q.A.; Savage, A.; MacGillivray, H.T.; Leggett, S.K.; Clowes, R.G.; Unger, S.W.; Pedlar, A.; Heasley, J.N.; Menzies, J.W.

1987-01-01

Follow-up observations of a complete sample of 154 IRAS galaxies, optically identified down to B=21, indicate that between 3 and 9% of the sample are ultraluminous depending on the choice of H 0 . VLA observations at 20 cm of the complete sample indicate that 85% are detected above 1mJy and for the most part the radio emission is centrally concentrated. The tight linear relation between radio and infrared luminosities is valid at the highest luminosities. Of the 11 most luminous objects one is a quasar: it fits the radio infrared relation very well which suggests that the infrared and radio emission has the same origin as in the other IRAS galaxies, ie. it probably originates primarily in regions of star formation in the host galaxy. The other 10 very luminous galaxies are either close but resolved mergers or double galaxies, presumably interacting. Radio observations of the 10 original empty field sources in our sample with no optical counterpart (B ≤ 21) allow us to conclude that 4 of these are fainter galaxies just outside the IRAS error ellipse with high values of L IR /L B . One other object, with a radio source at the edge of the error ellipse but no optical counterpart brighter than B = 23, may prove to be a highly luminous galaxy with L IR /L B > ∼ 1250

Water-filtered infrared-A (wIRA overcomes swallowing disorders and hypersalivation – a case report

Directory of Open Access Journals (Sweden)

Hoffmann, Gerd

2017-08-01

Full Text Available Case description: A patient with a Barrett oesophageal carcinoma and a resection of the oesophagus with gastric pull-up developed swallowing disorders 6 years and 2 months after the operation. Within 1 year and 7 months two recurrences of the tumor at the anastomosis were found and treated with combined chemoradiotherapy or chemotherapy respectively. 7 years and 9 months after the operation local tumor masses and destruction were present with no ability to orally drink or eat (full feeding by jejunal PEG tube: quality of life was poor, as saliva and mucus were very viscous (pulling filaments and could not be swallowed and had to be spat out throughout the day and night resulting in short periods of sleep (awaking from the necessity to spit out. In total the situation was interpreted more as a problem related to a feeling of choking (with food or fluid in the sense of a functional dysphagia rather than as a swallowing disorder from a structural stenosis. At that time acetylcysteine (2 times 200 mg per day, given via the PEG tube and irradiation with water-filtered infrared-A (wIRA, a special form of heat radiation, of the ventral part of the neck and the thorax were added to the therapy. Within 1 day with acetylcysteine saliva and mucus became less viscous. Within 2 days with wIRA (one day with 4 to 5 hours with irradiation with wIRA at home salivation decreased markedly and quality of life clearly improved: For the first time the patient slept without interruption and without the need for sleep-inducing medication. After 5 days with wIRA the patient could eat his first soft dumpling although drinking of fluids was still not possible. After 2½ weeks with wIRA the patient could eat his first minced schnitzel (escalope. Following the commencement of wIRA (with typically approximately 90–150 minutes irradiation with wIRA per day the patient had 8 months with good quality of life with only small amounts of liquid saliva and mucus and without the

Asteroid results from the IRAS survey

International Nuclear Information System (INIS)

Veeder, G.J.; Tedesco, E.F.; Matson, D.L.

1989-01-01

This paper reports that the IRAS Asteroid and Comet Survey yield a data base of infrared flux densities for 1811 individual asteroids. Albedos and diameters for these have been derived via a standard thermal model. IRAS sampled a large number of small asteroids and detected many dark asteroids in the outer belt. High-albedo asteroids remain rare. Observations of the brighter asteroids at multiple wavelengths shows the expected range of color temperatures through the main belt

Impact of Tax Reform Act of 1986 on IRA's Investment Value

OpenAIRE

William Reichenstein; Mark L. Cross

1989-01-01

The purpose of this study is to present an economic analysis of the tax advantages of deductible and nondeductible IRAs under the 1986 Tax Reform Act. These advantages are compared to those offered by other pension plans. The results show that the tax advantages of deductible IRAs allow for substantially higher values than the value of a similar investment held outside a pension account. The nondeductible IRA does not provide tax advantages over non-IRA investments if investors expect to with...

THE PHYSICAL ENVIRONMENT AROUND IRAS 17599–2148: INFRARED DARK CLOUD AND BIPOLAR NEBULA

Energy Technology Data Exchange (ETDEWEB)

Dewangan, L. K.; Janardhan, P. [Physical Research Laboratory, Navrangpura, Ahmedabad 380 009 (India); Ojha, D. K. [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400 005 (India); Zinchenko, I. [Institute of Applied Physics of the Russian Academy of Sciences, 46 Ulyanov st., Nizhny Novgorod 603950 (Russian Federation); Ghosh, S. K. [National Centre for Radio Astrophysics, Ganeshkhind, Pune 411 007 (India); Luna, A., E-mail: lokeshd@prl.res.in [Instituto Nacional de Astrofísica, Óptica y Electrónica, Luis Enrique Erro # 1, Tonantzintla, Puebla, C.P. 72840 (Mexico)

2016-12-20

We present a multiscale and multiwavelength study to investigate the star formation process around IRAS 17599–2148, which is part of an elongated filamentary structure (EFS) (extension ∼21 pc) seen in the Herschel maps. Using the Herschel data analysis, at least six massive clumps (M {sub clump} ∼ 777–7024 M {sub ⊙}) are found in the EFS with a range of temperature and column density of ∼16–39 K and ∼(0.6–11) × 10{sup 22} cm{sup −2} (A {sub V}  ∼ 7–117 mag), respectively. The EFS hosts cold gas regions (i.e., infrared dark cloud) without any radio detection and a bipolar nebula (BN) linked with the H ii region IRAS 17599–2148, tracing two distinct environments inferred through the temperature distribution and ionized emission. Based on virial analysis and higher values of self-gravitating pressure, the clumps are found unstable against gravitational collapse. We find 474 young stellar objects (YSOs) in the selected region, and ∼72% of these YSOs are found in the clusters distributed mainly toward the clumps in the EFS. These YSOs might have spontaneously formed due to processes not related to the expanding H ii region. At the edges of BN, four additional clumps are also associated with YSO clusters, which appear to be influenced by the expanding H ii region. The most massive clump in the EFS contains two compact radio sources traced in the Giant Metre-wave Radio Telescope 1.28 GHz map and a massive protostar candidate, IRS 1, prior to an ultracompact H ii phase. Using the Very Large Telescope/NACO near-infrared images, IRS 1 is resolved with a jet-like feature within a 4200 au scale.

A redshift survey of IRAS galaxies. I. Sample selection

International Nuclear Information System (INIS)

Strauss, M.A.; Davis, M.; Yahil, A.; Huchra, J.P.

1990-01-01

A complete all-sky sample of objects, flux-limited at 60 microns, has been extracted from the data base of the IRAS. The sample consists of 5014 objects, of which 2649 are galaxies and 13 are not yet identified. In order to study large-scale structure with this sample, it must be free of systematic biases. Corrections are applied for a major systematic effect in the flux densities listed in the IRAS Point Source Catalog: sources resolved by the IRAS beam have flux densities systematically underestimated. In addition, accurate flux densities are obtained for sources flagged as variable, or of moderate flux quality at 60 microns. The IRAS detectors suffered radiation-induced responsivity enhancement (hysteresis) due to crossings of the satellite scans across the Galactic plane; this effect is measured and is shown to be negligible. 53 refs

IRAS 17423-1755 (HEN 3-1475) REVISITED: AN O-RICH HIGH-MASS POST-ASYMPTOTIC GIANT BRANCH STAR

International Nuclear Information System (INIS)

Manteiga, M.; GarcIa-Hernandez, D. A.; Manchado, A.; Ulla, A.; GarcIa-Lario, P.

2011-01-01

The high-resolution (R ∼ 600) Spitzer/IRS spectrum of the bipolar protoplanetary nebula (PN) IRAS 17423-1755 is presented in order to clarify the dominant chemistry (C-rich versus O-rich) of its circumstellar envelope as well as to constrain its evolutionary stage. The high-quality Spitzer/IRS spectrum shows weak 9.7 μm absorption from amorphous silicates. This confirms for the first time the O-rich nature of IRAS 17423-1755 in contradiction to a previous C-rich classification, which was based on the wrong identification of the strong 3.1 μm absorption feature seen in the Infrared Space Observatory spectrum as due to acetylene (C 2 H 2 ). The high-resolution Spitzer/IRS spectrum displays a complete lack of C-rich mid-IR features such as molecular absorption features (e.g., 13.7 μm C 2 H 2 , 14.0 μm HCN, etc.) or the classical polycyclic aromatic hydrocarbon infrared emission bands. Thus, the strong 3.1 μm absorption band toward IRAS 17423-1755 has to be identified as water ice. In addition, an [Ne II] nebular emission line at 12.8 μm is clearly detected, indicating that the ionization of its central region may be already started. The spectral energy distribution in the infrared (∼2-200 μm) and other observational properties of IRAS 17423-1755 are discussed in comparison with the similar post-asymptotic giant branch (AGB) objects IRAS 19343+2926 and IRAS 17393-2727. We conclude that IRAS 17423-1755 is an O-rich high-mass post-AGB object that represents a link between OH/IR stars with extreme outflows and highly bipolar PN.

A young bipolar outflow from IRAS 15398-3359

DEFF Research Database (Denmark)

Bjerkeli, Per; Jørgensen, Jes Kristian; Brinch, Christian

2016-01-01

emission towards IRAS 15398-3359. The lineradiative transfer code LIME is used to construct a full 3D model of thesystem taking all relevant components and scales into account. Results: CO, HCO+, and N2H+ aredetected and shown to trace the motions of the outflow. For CO, thecircumstellar envelope...... and the surrounding cloud also have a profoundimpact on the observed line profiles. N2H+ isdetected in the outflow, but is suppressed towards the central region,perhaps because of the competing reaction between CO andH3+ in the densest regions as well as thedestruction of N2H+ by CO.N2D+ is detected in a ridge south...

An atlas of high-resolution IRAS maps on nearby galaxies

Science.gov (United States)

Rice, Walter

1993-01-01

An atlas of far-infrared IRAS maps with near 1 arcmin angular resolution of 30 optically large galaxies is presented. The high-resolution IRAS maps were produced with the Maximum Correlation Method (MCM) image construction and enhancement technique developed at IPAC. The MCM technique, which recovers the spatial information contained in the overlapping detector data samples of the IRAS all-sky survey scans, is outlined and tests to verify the structural reliability and photometric integrity of the high-resolution maps are presented. The infrared structure revealed in individual galaxies is discussed. The atlas complements the IRAS Nearby Galaxy High-Resolution Image Atlas, the high-resolution galaxy images encoded in FITS format, which is provided to the astronomical community as an IPAC product.

Poblacion estelar joven embebida en la nube molecular galactica asociada a la fuente IRAS 18236-1205

Science.gov (United States)

Romero, Ricardo Retes

2008-06-01

En esta tesis presento una metodología de seleccion y estudio de la población estelar embebida en la nube molecular galactica asociada a la fuente IRAS 18236-1205. La fuente IRAS posee colores de region Ultra Compacta HII (UCHII) y tiene deteccióon en monosulfuro de carbono (CS), trazador molecular de alta densidad, lo cual da la posibilidad de definir la nube molecular asociada hacia esta region. Lo anterior muestra que esta es buena candidata a región de formación estelar masiva. La metodología de seleccion de la población embebida, est à basada por una parte, en la distribución del gas molecular monoxido de carbono (13CO) asociado a la fuente IRAS, nube molecular seleccionada del mapeo Galactic Ring Survey (GRS) realizado en 13CO. Otros pasos de la seleccion, se basan en los diagramas color-color y color-magnitud con datos del cercano infrarrrojo de 2MASS. Para el estudio de la componente estelar se usaron los catalogos de fuentes puntuales en el cercano, medio y lejano infrarrojo de 2MASS, SPITZER e IRAS, respectivamente. De los diagramas color-color y color-magnitud, usando datos de 2MASS, se construyo un criterio fotométrico para identificar los objetos estelares j ovenes embebidos en la region molecular. Aplicando modelos a la distribución espectral de energía (SED) de algunos ellos, se encontraron parametros estelares de objetos estelares j ovenes embebidos de masa intermedia y alta. Adicionalmente, se encontro un objeto de masa ´ intermedia no identifiado por el catalogo de 2MASS y su efecto sobre el medio interestelar, emision en la banda de [4.5] μm de IRAC-Spitzer asociado a un outflow. Dos de los objetos seleccionados por el criterio fotometrico resultaron ser objetos estelares jovenes de alta e intermedia masa (B1V/B2V y B8V/A0V respectivamente), los cuales deben estar asociados a la emision radiativa responsable de los colores de región UC HII. Otro objeto estelar joven de baja masa (F0V/F5V) fue encontrado en la region de estudio

Application of MCM image construction to IRAS comet observations

Science.gov (United States)

Schlapfer, Martin F.; Walker, Russell G.

1994-01-01

There is a wealth of IRAS comet data, obtained in both the survey and pointed observations modes. However, these measurements have remained largely untouched due to difficulties in removing instrumental effects from the data. We have developed a version of the Maximum Correlation Method for Image Construction algorithm (MCM) which operates in the moving coordinate system of the comet and properly treats both real cometary motion and apparent motion due to spacecraft parallax. This algorithm has been implemented on a 486/33 PC in FORTRAN and IDL codes. Preprocessing of the IRAS CRDD includes baseline removal, deglitching, and removal of long tails due to dielectric time constants of the detectors. The resulting images are virtually free from instrumental effects and have the highest possible spatial resolution consistent with the data sampling. We present examples of high resolution IRAS images constructed from survey observations of Comets P/Tempel 1 and P/Tempel 2, and pointed observations of IRAS-Araki-Alcock.

CRYSTALLINE SILICATES IN EVOLVED STARS. I. SPITZER/INFRARED SPECTROGRAPH SPECTROSCOPY OF IRAS 16456-3542, 18354-0638, AND 23239+5754

Energy Technology Data Exchange (ETDEWEB)

Jiang, B. W.; Zhang, Ke [Department of Astronomy, Beijing Normal University, Beijing 100875 (China); Li, Aigen [Department of Physics and Astronomy, University of Missouri, Columbia, MO 65211 (United States); Lisse, C. M., E-mail: bjiang@bnu.edu.cn, E-mail: kzhang@caltech.edu, E-mail: lia@missouri.edu, E-mail: carey.lisse@jhuapl.edu [Johns Hopkins University, Applied Physics Laboratory, Laurel, MD 20723 (United States)

2013-03-01

We report the Spitzer Infrared Spectrograph (IRS) observations of three evolved stars: IRAS 16456-3542, 18354-0638, and 23239+5754. The 9.9-37.2 {mu}m Spitzer/IRS high-resolution spectra of these three sources exhibit rich sets of enstatite-dominated crystalline silicate emission features. IRAS 16456-3542 is extremely rich in crystalline silicates, with >90% of its silicate mass in crystalline form, the highest to date ever reported for crystalline silicate sources.

MIDCOURSE SPACE EXPERIMENT VERSUS IRAS TWO-COLOR DIAGRAMS AND THE CIRCUMSTELLAR ENVELOPE-SEQUENCE OF OXYGEN-RICH LATE-TYPE STARS

International Nuclear Information System (INIS)

Sjouwerman, Lorant O.; Capen, Stephanie M.; Claussen, Mark J.

2009-01-01

We present Midcourse Space Experiment (MSX) two-color diagrams that can be used to characterize circumstellar environments of sources with good quality MSX colors in terms of IRAS color regions for oxygen-rich stars. With these diagrams, we aim to provide a new tool that can be used to study circumstellar environments and to improve detection rates for targeted surveys for circumstellar maser emission similar to the IRAS two-color diagram. This new tool is especially useful for regions in the sky where IRAS was confused, in particular in the Galactic plane and bulge region. Unfortunately, using MSX colors alone does not allow one to distinguish between carbon-rich and oxygen-rich objects. An application of this tool on 86 GHz SiO masers shows that for this type of masers an instantaneous detection rate of 60% to 80% can be achieved if target sources are selected according to MSX color (region). Our investigations may have revealed an error in the MSX point source catalog version 2.3. That is, the photometry of the 21.3 μm (MSX E filter) band for most weak 8.28 μm (or MSX A filter) band sources seems off by about a factor 2 (0.5-1 mag too bright).

Star formation and gas inflows in the OH Megamaser galaxy IRAS03056+2034

Science.gov (United States)

Hekatelyne, C.; Riffel, Rogemar A.; Sales, Dinalva; Robinson, Andrew; Storchi-Bergmann, Thaisa; Kharb, Preeti; Gallimore, Jack; Baum, Stefi; O'Dea, Christopher

2018-06-01

We have obtained observations of the OH Megamaser galaxy IRAS03056+0234 using Gemini Multi-Object Spectrograph (GMOS) Integral Field Unit (IFU), Very Large Array (VLA) and Hubble Space Telescope (HST). The HST data reveals spiral arms containing knots of emission associated to star forming regions. The GMOS-IFU data cover the spectral range of 4500 to 7500 Å at a velocity resolution of 90 km s-1 and spatial resolution of 506 pc. The emission-line flux distributions reveal a ring of star forming regions with radius of 786 pc centred at the nucleus of the galaxy, with an ionized gas mass of 1.2× 108M⊙, an ionizing photon luminosity of log Q[H+]=53.8 and a star formation rate of 4.9 M⊙ yr-1. The emission-line ratios and radio emission suggest that the gas at the nuclear region is excited by both starburst activity and an active galactic nucleus. The gas velocity fields are partially reproduced by rotation in the galactic plane, but show, in addition, excess redshifts to the east of the nucleus, consistent with gas inflows towards the nucleus, with velocity of ˜45 km s-1 and a mass inflow rate of ˜7.7 × 10-3 M⊙ yr-1.

The Small Magellanic Cloud in the far infrared. I. ISO's 170 mu m map and revisit of the IRAS 12-100 mu m data

Science.gov (United States)

Wilke, K.; Stickel, M.; Haas, M.; Herbstmeier, U.; Klaas, U.; Lemke, D.

2003-04-01

The ISOPHOT experiment onboard the ISO satellite generated a complete view of the Small Magellanic Cloud (SMC) at 170 mu m with 1.5 arcmin resolution. The map is analysed using an automated photometry program enabling accurate photometric characterization of the far infrared (FIR) emitting regions. An integrated FIR luminosity of 8.5x 107 Lsun is obtained, leading to a star formation rate of SFRFIR=0.015 Msun/yr. With an average dust temperature of TD, 170/100}=20.5 K>, the total dust mass follows to MD=3.7x105 Msun. In this paper, the sources detected at 170 mu m are compared with those obtainable from the IRAS satellite data. For this purpose, the 12 mu m, 25 mu m, 60 mu m, and 100 mu m IRAS high resolution (HiRes) maps of the SMC are re-examined using the same method. In contrast to former studies, this provides an all-band ISO/IRAS source catalog which is no longer based on eyeball classification, but relies on an algorithm which is capable of automated, repeatable photometry, even for irregular sources. In the mid infrared IRAS bands numerous bright FIR emitting regions in the SMC are detected and classified: 73 sources are found at 12 mu m, 135 at 25 mu m (most of them with Fnu =2.0 Jy. Comparable numbers are found for the two FIR IRAS maps at 60 mu m (384) and 100 mu m (338) with fluxes up to 450 Jy. 70 of the 243 170 mu m sources are assigned a general SED type (``cold'', ``warm'', i.e., 30 K) for the first time. A comparison with earlier IRAS results suggests that many source flux densities in those studies have been under- or overestimated because of non-standardized fitting methods. Many sources with flux densities up to 40 Jy listed in former catalogs cannot be identified in our data. Based on observations with ISO, an ESA project with instruments funded by ESA Member States (especially the PI countries: France, Germany, The Netherlands and the UK) and with the participation of ISAS and NASA. The tables in Appendices A to E are only available in

Infrared Astronomical Satellite (IRAS) Catalogs and Atlases. Explanatory Supplement

Science.gov (United States)

Beichman, C. A. (Editor); Neugebauer, G. (Editor); Habing, H. J. (Editor); Clegg, P. E. (Editor); Chester, T. J. (Editor)

1985-01-01

The Infrared Astronomical Satellite (IRAS) mission is described. An overview of the mission, a description of the satellite and its telescope system, and a discussion of the mission design, requirements, and inflight modifications are given. Data reduction, flight tests, flux reconstruction and calibration, data processing, and the formats of the IRAS catalogs and atlases are also considered.

IRAS far-infrared colours of normal stars

Science.gov (United States)

Waters, L. B. F. M.; Cote, J.; Aumann, H. H.

1987-01-01

The analysis of IRAS observations at 12, 25, 60 and 100 microns of bright stars of spectral type O to M is presented. The objective is to identify the 'normal' stellar population and to characterize it in terms of the relationships between (B-V) and (V-/12/), between (R-I) and (V-/12/), and as a function of spectral type and luminosity class. A well-defined relation is found between the color of normal stars in the visual (B-V), (R-I) and in the IR, which does not depend on luminosity class. Using the (B-V), (V-/12/) relation for normal stars, it is found that B and M type stars show a large fraction of deviating stars, mostly with IR excess that is probably caused by circumstellar material. A comparison of IRAS colors with the Johnson colors as a function of spectral type shows good agreement except for the K0 to M5 type stars. The results will be useful in identifying the deviating stars detected with IRAS.

Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions

Science.gov (United States)

Povich, Matthew Samuel; Binder, Breanna Arlene

2018-01-01

We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

MILLIMETRIC AND SUBMILLIMETRIC OBSERVATIONS OF IRAS 05327+3404 ''HOLOEA'' IN M36

International Nuclear Information System (INIS)

Morata, O.; Ho, P. T. P.; Kuan, Y.-J.; Huang, H.-C.; Zhao-Geisler, R.; Magnier, E. A.

2013-01-01

The transition between the protostar, Class I, and the pre-main-sequence star, Class II, phases is still one of the most uncertain, and important, stages in the knowledge of the process of formation of an individual star because it is the stage that determines the final mass of the star. We observed the young stellar object ''Holoea'', associated with IRAS 05327+3404, which was classified as an object in the transition between the Class I and Class II phases with several unusual properties, and appears to be surrounded by large amounts of circumstellar material. We used the SMA and BIMA telescopes at millimeter and submillimeter (submm) wavelengths to observe the dust continuum emission and the CO (1-0) and (2-1), HCO + (1-0) and (3-2), and HCN (1-0) transitions in the region around IRAS 05327+3404. We detected two continuum emission peaks at 1.1 mm: SMM 1, the submm counterpart of IRAS 05327+3404, and SMM 2, ∼6 arcsec to the west. The emissions of the three molecules show marked differences. The CO emission near the systemic velocity is filtered out by the telescopes, and CO mostly traces the high-velocity gas. The HCO + and HCN emissions are more concentrated around the central parts of the region, and show several intensity peaks coincident with the submm continuum peaks. We identify two main molecular outflows: a bipolar outflow in an E-W direction that would be powered by SMM 1 and the other in a NE direction, which we associate with SMM 2. We propose that the SMM sources are probably Class I objects, with SMM 1 in an earlier evolutionary stage

The Tully-Fisher relation of the IRAS minisurvey galaxies

Science.gov (United States)

Van Driel, W.; Van Den Broek, A. C.; Baan, W. A.

1995-01-01

We investigated the possible influence on the Tully-Fisher relation of active massive star formation in IRAS galaxies, in order to estimate the contribution of star formation to their near-infrared luminosity. We observed 60 galaxies from the infrared complete so-called IRAS Minisurvey sample in the 21 cm H1 line at Arecibo, determined the near-infrared (H-band) Tully-Fisher relation for the 36 objects in the sample we judged to be usable for this purpose, and compared this relation with that of optically selected normal galaxies. The results show no significant enhancement of the near-infrared luminosities of the IRAS Minisurvey galaxies compared to those of the optically selected normal glaxies. From these results we inferred that in the minisurvey galaxies the average contribution of the active massive star formation to the total near-infrared luminosity is less and that exponential decay times for the starbursts occurring in the Minisurvey galaxies are of the order of 10 Myr. The Tully-Fisher relation shows one exceptional galaxy (IRAS 03565+2139) with an about 25 times higher luminosity than average for its rotational velocity.

Detection of OH radicals from IRAS sources

International Nuclear Information System (INIS)

Lewis, B.M.; Eder, J.; Terzian, Y.

1985-01-01

An efficient method for detecting new OH/infrared stars is to begin with IRAS source positions, selected for appropriate infrared colours, and using radio-line observations to confirm the OH properties. The authors demonstrate the validity of this approach here, using the Arecibo 305 m radio-telescope to confirm the 1,612 MHz line observations of sources in IRAS Circulars 8 and 9; the present observations identify 21 new OH/infrared stars. The new sources have weaker 1,612 MHz fluxes, bluer (60-25) μm colours and a smaller mean separation between the principal emission peaks than previous samples. (author)

The Herschel/HIFI unbiased spectral survey of the solar-mass protostar IRAS16293

Science.gov (United States)

Bottinelli, S.; Caux, E.; Cecarelli, C.; Kahane, C.

2012-03-01

Unbiased spectral surveys are powerful tools to study the chemistry and the physics of star forming regions, because they can provide a complete census of the molecular content and the observed lines probe the physical structure of the source. While unbiased surveys at the millimeter and sub-millimeter wavelengths observable from ground-based telescopes have previously been performed towards several high-mass protostars, very little data exist on low-mass protostars, with only one such ground-based survey carried out towards this kind of object. However, since low-mass protostars are believed to resemble our own Sun's progenitor, the information provided by spectral surveys is crucial in order to uncover the birth mechanisms of low-mass stars and hence of our Sun. To help fill up this gap in our understanding, we carried out an almost complete spectral survey towards the solar-type protostar IRAS16293-2422 with the HIFI instrument onboard Herschel. The observations covered a range of about 700 GHz, in which a few hundreds lines were detected with more than 3σ confidence interval certainty and identified. All the detected lines which were free from obvious blending effects were fitted with Gaussians to estimate their basic kinematic properties. Contrarily to what is observed in the millimeter range, no lines from complex organic molecules have been observed. In this work, we characterize the different components of IRAS16293-2422 (a known binary at least) by analyzing the numerous emission and absorption lines identified.

A study of the stellar population in the Lynds 1641 dark cloud. I. The IRAS catalog sources

International Nuclear Information System (INIS)

Strom, K.M.; Newton, G.; Strom, S.E.; Seaman, R.L.; Carrasco, L.

1989-01-01

The character of the sources identified in the IRAS Point Source Catalog and located within the boundaries of the nearest giant molecular cloud, Lynds 1641 is discussed. New optical and near-infrared photometry are combined to provide spectral energy distributions (SEDs) for these objects divided into three classes: class I objects with flat or rising spectra, class II objects with spectra intermediate in slope between a flat and blackbody spectrum, and class III objects with spectra similar to those of blackbodies. It is found that L1641 contains a much larger percentage of class I sources than does the nearby Taurus-Auriga star-forming complex. Spectral energy distributions for the IRAS-selected sample are examined and compared with SEDs for young stellar objects (YSOs) located in Taurus-Auriga. The IRAS-selected sources having optical counterparts in the H-R diagram are identified and discussed along with the distribution of masses and ages for these YSOs. 86 refs

Radio identifications of IRAS point sources with b greater than 30 deg

International Nuclear Information System (INIS)

Condon, J.J.; Broderick, J.J.; Virginia Polytechnic Institute and State Univ., Blacksburg)

1986-01-01

The present radio identifications of IRAS point sources on the basis of Green Bank 1400 MHz survey maps notes that 365 hot IR sources are not detectable radio sources, and that nearly all cool high latitude IRAS sources are extragalactic. The fainter IR-source identifications encompass optically bright quasars, BL Lac objects, Seyfert galaxies, and elliptical galaxies. No IRAS sources could be identified with distant elliptical radio galaxies, so that although the radio and IR fluxes of most IRAS extragalactic sources are tightly correlated, complete samples of strong radio and IR sources are almost completely disjoint; no more than 1 percent of the IR sources are radio sources and less than 1 percent of the radio sources are IR ones. 35 references

Multiple monopolar outflows driven by massive protostars in IRAS 18162-2048

Energy Technology Data Exchange (ETDEWEB)

Fernández-López, M. [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States); Girart, J. M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB, Facultat de Ciencies, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Curiel, S.; Fonfría, J. P. [Instituto de Astronomía, Universidad Nacional Autónoma de México (UNAM), Apartado Postal 70-264, 04510 México, DF (Mexico); Zapata, L. A. [Centro de Radioastronomía y Astrofísica, UNAM, Apartado Postal 3-72, Morelia, Michoacán 58089 (Mexico); Qiu, K., E-mail: manferna@illinois.edu, E-mail: girart@ieec.cat [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China)

2013-11-20

In this article, we present Combined Array for Research in Millimeter-wave Astronomy (CARMA) 3.5 mm observations and SubMillimeter Array (SMA) 870 μm observations toward the high-mass star-forming region IRAS 18162-2048, which is the core of the HH 80/81/80N system. Molecular emission from HCN, HCO{sup +}, and SiO traces two molecular outflows (the so-called northeast and northwest outflows). These outflows have their origin in a region close to the position of MM2, a millimeter source known to harbor two protostars. For the first time we estimate the physical characteristics of these molecular outflows, which are similar to those of 10{sup 3}-5 × 10{sup 3} L {sub ☉} protostars, and suggest that MM2 harbors high-mass protostars. High-angular resolution CO observations show an additional outflow due southeast. Also for the first time, we identify its driving source, MM2(E), and see evidence of precession. All three outflows have a monopolar appearance, but we link the NW and SE lobes, and explain their asymmetric shape as being a consequence of possible deflection.

Infrared astronomical satellite (IRAS) catalogs and atlases. Volume 1: Explanatory supplement

Science.gov (United States)

Beichman, C. A. (Editor); Neugebauer, G. (Editor); Habing, H. J. (Editor); Clegg, P. E. (Editor); Chester, Thomas J. (Editor)

1988-01-01

The Infrared Astronomical Satellite (IRAS) was launched on January 26, 1983. During its 300-day mission, IRAS surveyed over 96 pct of the celestial sphere at four infrared wavelengths, centered approximately at 12, 25, 60, and 100 microns. Volume 1 describes the instrument, the mission, and data reduction.

IRAS associations with dark clouds of opacity class 6

International Nuclear Information System (INIS)

Parker, N.D.

1988-01-01

Accurate positions of the opacity class 6 clouds from the Lynds Catalog of Dark Nebulae have been measured on blue and red prints from the Polomar Observatory Sky Survey (POSS) plates. These revised positions and the dimensions of ellipses fitted to the clouds are listed. The IRAS point source catalog has been searched for sources lying within the boundaries of the 147 clouds in the sample. The distribution and properties of these IRAS sources are discussed briefly. (author)

Symbiotic stars observed from the IRAS satellite

International Nuclear Information System (INIS)

Luud, L.; Tuvikene, T.

1987-01-01

Symbiotic stars according to Alfven's catalogue have been checked for coincidence with the IRAS-observed for-infrared sources. 72 symbiotic and possible symbiotic stars have been identified with the IRAS-observed sources. A catalogue of identified stars and energy distributions of representative stars are given. It turns out that the dust in symbiotic stars is a more widespread phenomenon than that it was believed before. Almost 40% of systems are the dusty ones. Among objects with dust temperature some tens of K have been found. It is shown that the only useful two-color diagram is (K-m 12 )-(m 12 -m 25 ). Attention is paid to a type of symbiotic stars with G spectral class cold component which needs special investigation

IRAS 10479 - 2808: a quasar

International Nuclear Information System (INIS)

Clowes, R.G.; Leggett, S.K.; Savage, A.

1991-01-01

The IRAS point source 10479-2808 is a quasar with B J ∼ 16 and z = 0.190. It is not in the Parkes and Molonglo radio catalogues. At the resolution of the UK and ESO Schmidt telescopes it appears to be star-like, with no sign of surrounding fuzz or interactions; it is probably optically variable. (author)

An IRAS-Based Search for New Dusty Late-Type WC Wolf-Rayet Stars

Science.gov (United States)

Cohen, Martin

1995-01-01

I have examined all Infrared Astronomical Satellite (IRAS) data relevant to the 173 Galactic Wolf-Rayet (W-R) stars in an updated catalog, including the 13 stars newly discovered by Shara and coworkers. Using the W-R coordinates in these lists, I have examined the IRAS Point Source Catalog (PSC), the Faint Source Catalog, and the Faint Source Reject Catalog, and have generated one-dimensional spatial profiles, 'ADDSCANs', and two-dimensional full-resolution images, 'FRESCOS'. The goal was to assemble the best set of observed IRAS color indices for different W-R types, in particular for known dusty late-type WC Wolf-Rayet (WCL) objects. I have also unsuccessfully sought differences in IRAS colors and absolute magnitudes between single and binary W-R stars. The color indices for the entire ensemble of W-R stars define zones in the IRAS color-color ([12] - [25], [25] - [60])-plane. By searching the PSC for otherwise unassociated sources that satisfy these colors, I have identified potential new W-R candidates, perhaps too faint to have been recognized in previous optical searches. I have extracted these candidates' IRAS low-resolution spectrometer (LRS) data and compared the spectra with the highly characteristic LRS shape for known dusty WCL stars. The 13 surviving candidates must now be ex amined by optical spectroscopy. This work represents a much more rigorous and exhaustive version of the LRS study that identified IRAS 17380 - 3031 (WR98a) as the first new W-R (WC9) star discovered by IPAS. This search should have detected dusty WCL stars to a distance of 7.0 kpc from the Sun, for l is greater than 30 degrees, and to 2.9 kpc even in the innermost galaxy. For free-free-dominated W-R stars the corresponding distances are 2.5 and 1.0 kpc, respectively.

ALMA 690 GHz OBSERVATIONS OF IRAS 16293–2422B: INFALL IN A HIGHLY OPTICALLY THICK DISK

International Nuclear Information System (INIS)

Zapata, Luis A.; Loinard, Laurent; Rodríguez, Luis F.; Hernández-Hernández, Vicente; Takahashi, Satoko; Trejo, Alfonso; Parise, Bérengère

2013-01-01

We present sensitive, high angular resolution (∼0.''2) submillimeter continuum and line observations of IRAS 16293–2422B made with the Atacama Large Millimeter/Submillimeter Array. The 0.45 mm continuum observations reveal a single and very compact source associated with IRAS 16293–2422B. This submillimeter source has a deconvolved angular size of about 400 mas (50 AU) and does not show any inner structure inside of this diameter. The H 13 CN, HC 15 N, and CH 3 OH line emission regions are about twice as large as the continuum emission and reveal a pronounced inner depression or ''hole'' with a size comparable to that estimated for the submillimeter continuum. We suggest that the presence of this inner depression and the fact that we do not see an inner structure (or a flat structure) in the continuum are produced by very optically thick dust located in the innermost parts of IRAS 16293–2422B. All three lines also show pronounced inverse P-Cygni profiles with infall and dispersion velocities larger than those recently reported from observations at lower frequencies, suggesting that we are detecting faster and more turbulent gas located closer to the central object. Finally, we report a small east-west velocity gradient in IRAS 16293–2422B that suggests that its disk plane is likely located very close to the plane of the sky.

29 CFR 2509.99-1 - Interpretive Bulletin Relating to Payroll Deduction IRAs.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Interpretive Bulletin Relating to Payroll Deduction IRAs... SECURITY ACT OF 1974 § 2509.99-1 Interpretive Bulletin Relating to Payroll Deduction IRAs. (a) Scope. This...), as applied to payroll deduction programs established by employers 1 for the purpose of enabling...

IRAS IDENTIFICATION OF PRE-MAIN-SEQUENCE STARS IN THE CHAMELEON-II ASSOCIATION

NARCIS (Netherlands)

PRUSTI, T; WHITTET, DCB; ASSENDORP, R; WESSELIUS, PR

We report the results of a search for new pre-main sequence candidates in the Chamaeleon II dark cloud based on three IRAS catalogues (the Point Source Catalog, the Serendipitous Survey Catalog and the Faint Source Survey). A total of 30 sources were selected. Twelve of these display IRAS colours

IMAGE CONSTRUCTION FROM THE IRAS SURVEY

NARCIS (Netherlands)

BONTEKOE, TR; KESTER, DJM; PRICE, SD; DEJONGE, ARW; WESSELIUS, PR

IRAS survery data can be used successfully to produce images of extended objects. The major difficulties, viz. non-uniform sampling, different response functions for each detector, and varying signal-to-noise levels for each detector for each scan, have been resolved. The results of three different

Dynamical structure of the inner 100 AU of the deeply embedded protostar IRAS 16293–2422

Energy Technology Data Exchange (ETDEWEB)

Favre, Cécile; Field, David [Department of Physics and Astronomy, University of Aarhus, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Jørgensen, Jes K.; Brinch, Christian; Bisschop, Suzanne E. [Centre for Star and Planet Formation, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø (Denmark); Bourke, Tyler L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street MS42, Cambridge, MA 02138 (United States); Hogerheijde, Michiel R. [Leiden Observatory, Leiden University, P.O. Box 9513, 2300-RA Leiden (Netherlands); Frieswijk, Wilfred W. F., E-mail: cfavre@umich.edu [Netherlands Institute for Radio Astronomy, Postbus 2, 7990-AA Dwingeloo (Netherlands)

2014-07-20

A fundamental question about the early evolution of low-mass protostars is when circumstellar disks may form. High angular resolution observations of molecular transitions in the (sub)millimeter wavelength windows make it possible to investigate the kinematics of the gas around newly formed stars, for example, to identify the presence of rotation and infall. IRAS 16293–2422 was observed with the extended Submillimeter Array (eSMA) resulting in subarcsecond resolution (0.''46 × 0.''29, i.e., ∼55 × 35 AU) images of compact emission from the C{sup 17}O (3-2) and C{sup 34}S (7-6) transitions at 337 GHz (0.89 mm). To recover the more extended emission we have combined the eSMA data with SMA observations of the same molecules. The emission of C{sup 17}O (3-2) and C{sup 34}S (7-6) both show a velocity gradient oriented along a northeast-southwest direction with respect to the continuum marking the location of one of the components of the binary, IRAS 16293A. Our combined eSMA and SMA observations show that the velocity field on the 50-400 AU scales is consistent with a rotating structure. It cannot be explained by simple Keplerian rotation around a single point mass but rather needs to take into account the enclosed envelope mass at the radii where the observed lines are excited. We suggest that IRAS 16293–2422 could be among the best candidates to observe a pseudo-disk with future high angular resolution observations.

A practical approach to the classification of IRAS sources using infrared colors alone

International Nuclear Information System (INIS)

Walker, H.J.; Volk, K.; Wainscoat, R.J.; Schwartz, D.E.; Cohen, M.

1989-01-01

Zones of the IRAS color-color planes in which a variety of different types of known source occur, have been defined for the purpose of obtaining representative IRAS colors for them. There is considerable overlap between many of these zones, rendering a unique classification difficult on the basis of IRAS colors alone, although galactic latitude can resolve ambiguities between galactic and extragalactic populations. The color dependence of these zones on the presence of spectral emission/absorption features and on the spatial extent of the sources has been investigated. It is found that silicate emission features do not significantly influence the IRAS colors. Planetary nebulae may show a dependence of color on the presence of atomic or molecular features in emission, although the dominant cause of this effect may be the underlying red continua of nebulae with strong atomic lines. Only small shifts are detected in the colors of individual spatially extended sources when total flux measurements are substituted for point-source measurements. 36 refs

The census of complex organic molecules in the solar-type protostar IRAS16293-2422

Energy Technology Data Exchange (ETDEWEB)

Jaber, Ali A.; Ceccarelli, C.; Kahane, C. [Université Grenoble Alpes, IPAG, F-38000 Grenoble (France); Caux, E. [Université de Toulouse, UPS-OMP, IRAP, F-31400 Toulouse (France)

2014-08-10

Complex organic molecules (COMs) are considered to be crucial molecules, since they are connected with organic chemistry, at the basis of terrestrial life. More pragmatically, they are molecules which in principle are difficult to synthesize in harsh interstellar environments and, therefore, are a crucial test for astrochemical models. Current models assume that several COMs are synthesized on lukewarm grain surfaces (≳30-40 K) and released in the gas phase at dust temperatures of ≳100 K. However, recent detections of COMs in ≲20 K gas demonstrate that we still need important pieces to complete the puzzle of COMs formation. Here, we present a complete census of the oxygen- and nitrogen-bearing COMs, previously detected in different Interstellar Medium (ISM) regions, toward the solar-type protostar IRAS16293-2422. The census was obtained from the millimeter-submillimeter unbiased spectral survey TIMASSS. Of the 29 COMs searched for, 6 were detected: methyl cyanide, ketene, acetaldehyde, formamide, dimethyl ether, and methyl formate. Multifrequency analysis of the last five COMs provides clear evidence that they are present in the cold (≲30 K) envelope of IRAS16293-2422, with abundances of 0.03-2 × 10{sup –10}. Our data do not allow us to support the hypothesis that the COMs abundance increases with increasing dust temperature in the cold envelope, as expected if COMs were predominately formed on lukewarm grain surfaces. Finally, when also considering other ISM sources, we find a strong correlation over five orders of magnitude between methyl formate and dimethyl ether, and methyl formate and formamide abundances, which may point to a link between these two couples of species in cold and warm gas.

High resolution radio observations of nuclear and circumnuclear regions of luminous infrared galaxies (LIRGs)

Energy Technology Data Exchange (ETDEWEB)

Alberdi, A; Perez-Torres, M A [Instituto de Astrofisica de Andalucia (IAA, CSIC), PO Box 3004, 18080-Granada (Spain); Colina, L [Instituto de Estructura de la Materia - IEM, CSIC, C, Serrano 115, 28005 Madrid (Spain); Torrelles, J M [Instituto de Ciencias del Espacio (ICE, CSIC) and IEEC, Gran Capita 2-4, 08034 Barcelona (Spain)], E-mail: antxon@iaa.es, E-mail: torres@iaa.es, E-mail: colina@damir.iem.csic.es, E-mail: torrelle@ieec.fcr.es

2008-10-15

High-resolution radio observations of the nuclear region of Luminous and Ultraluminous Infrared Galaxies (ULIRGs) have shown that its radio structure consists of a compact high surface-brightness central radio source immersed in a diffuse low brightness circumnuclear halo. While the central component could be associated with an AGN or compact star-forming regions where radio supernovae are exploding, it is well known that the circumnuclear regions host bursts of star-formation. The studies of radio supernovae can provide essential information about stellar evolution and CSM/ISM properties in regions hidden by dust at optical and IR wavelengths. In this contribution, we show results from radio interferometric observations from NGC 7469, IRAS 18293-3413 and IRAS 17138-1017 where three extremely bright radio supernovae have been found. High-resolution radio observations of these and other LIRGs would allow us to determine the core-collapse supernova rate in them as well as their star-formation rate.

IRAS 06562-0337, The Ironclad Nebula: A New Young Star Cluster

International Nuclear Information System (INIS)

Alves, D.R.; Hoard, D.W.; Rodgers, B.

1998-01-01

IRAS 06562-0337 has been the recent subject of a classic debate: is it a proto endash planetary nebula or a young stellar object? We present the first 2 μm image of IRAS 06562-0337, which reveals an extended diffuse nebula containing approximately 70 stars inside a 30 double-prime radius around a bright, possibly resolved, central object. The derived stellar luminosity function is consistent with that expected from a single coeval population, and the brightness of the nebulosity is consistent with the predicted flux of unresolved low-mass stars. The stars and nebulosity are spatially coincident with strong CO line emission. We therefore identify IRAS 06562-0337 as a new young star cluster embedded in its placental molecular cloud. The central object is likely a Herbig Be star, M ∼ 20 M circle-dot , which may be seen in reflection. We present medium-resolution high signal-to-noise ratio 1997 epoch optical spectra of the central object. Comparison with previously published spectra shows new evidence for time-variable permitted and forbidden line emission, including Si ii, Fe ii, [Fe ii], and [O i]. We suggest that the origin is a dynamic stellar wind in the extended stratified atmosphere of the massive central star in IRAS 06562-0337. copyright copyright 1998. The American Astronomical Society

Análisis factorial confirmatorio del inventario multicultural de la expresión de la ira y hostilidad

Directory of Open Access Journals (Sweden)

Manolete S. Moscoso

2016-12-01

Full Text Available El propósito principal del presente estudio fue verificar la estructura factorial de las dos escalas que componen el Inventario Multicultural de la Expresión de la Ira y Hostilidad desde una perspectiva confirmatoria. Se utilizó el Análisis Factorial Confirmatorio en una muestra de 264 participantes provenientes de una universidad privada de Lima, Perú. El muestreo fue no probabilístico e incluyó estudiantes (25%, personal docente (17.8% y personal administrativo (57.2%. La confiabilidad del instrumento fue evaluada mediante los modelos congenérico, tau-equivalente y paralelo para cada una de las seis subescalas del instrumento, así como también calculada en base al coeficiente alfa de Cronbach con intervalos de confianza. Resultados: El análisis factorial realizado en la presente muestra peruana identificó cuatro dimensiones para la Escala de la Ira (ira manifiesta, ira contenida, control de la ira manifiesta y control de la ira contenida y dos factores para la Escala de la Hostilidad (reacción impulsiva a la ira; y temperamento, lo cual replica sustancialmente los resultados de estudios previos realizados en América Latina con muestras hispanoparlantes. El modelo congenérico nos indica un ajuste adecuado para cada una de las subescalas de la ira y hostilidad. En base a los resultados del Análisis Factorial Confirmatorio realizado en el presente estudio, la estructura factorial de ambas escalas del Inventario Multicultural de la Ira y Hostilidad es robusta y demuestra sustancial evidencia empírica de validez de construcción y consistencia interna del instrumento.

A search for hot post-AGE stars in the IRAS Point Source Catalog

NARCIS (Netherlands)

Oudmaijer, RD

In this paper a first step is made to search for hot post-AGB stars in the IRAS Point Source Catalog. In order to find objects that evolved off the AGE a longer time ago than post-AGB objects discussed in the literature, objects that were not detected at 12 mu m by IRAS were selected. The selection

IRAS colors of carbon stars - An optical spectroscopic test

International Nuclear Information System (INIS)

Cohen, M.; Wainscoat, R.J.; Walker, H.J.; Volk, K.; Schwartz, D.E.

1989-01-01

Optical spectra are obtained of 57 photographic counterparts to IRAS sources not previously studied spectroscopically, and expected on the basis of their IRAS colors to be M or C type stars. Confirmed carbon stars are found only in a restricted range of 12-25 index, and constitute a striking vertical sequence in the 12-25-60 micron color-color diagram. This sequence is in accord with evolutionary models for AGB stars that convert M into C stars by dredge-up, and follow loops in the color-color plane. Optically visible and optically invisible carbon stars occupy different color-color locations consistent with their representations of different evolutionary states in the life of relatively low-mass stars. 16 refs

Expresión de la ira y autoconcepto en adolescentes tempranos

Directory of Open Access Journals (Sweden)

Yuri Arsenio Sanz-Martínez

2012-01-01

Full Text Available Abordó la exploración de las implicaciones de las modalidades de expresión de la ira entre adolescentes tempranos de la zona oriental de Cuba. La muestra estuvo compuesta por 498 adolescentes tempranos de Holguín y Santiago de Cuba respectivamente. Se obtuvo que la expresión abierta, y destructiva de la ira correlacionó negativamente con el autoconcepto en dominios de la escuela y las relaciones con el sexo opuesto. La expresión inhibida o interiorizada de esta emoción predijo fuertemente aspectos del autoconcepto relacionados con el dominio de la escuela. La ira expresada de forma controlada, calmada y asertiva se relacionó fuertemente con el autoconcepto en dimensiones generales, del ámbito escolar, de las relaciones interpersonales y de cualidades de honestidad y seguridad. Se recomienda realizar estudios paralelos para obtener información en otras etapas del desarrollo humano.

The infrared emission of carbonaceous particles around C-rich IRAS sources

International Nuclear Information System (INIS)

Blanco, A.; Borghesi, A.; Fonti, S.; Orofino, V.; Strafella, F.

1997-01-01

The IRAS spectra of 23 carbon-rich sources have been fitted by means of an improved theoretical model based on the Leung-Spagna radiative transfer code and using extinction data obtained in their laboratory for different types of amorphous carbon and silicon carbide submicron particles. The agreement between observations and theoretical spectra is rather good. A comparison between the IRAS spectrum of the object 12447 + 0425 (RU Vir) and that recently obtained at UKIRT, for the same object but with higher resolution, seems to open new problems

MILLIMETRIC AND SUBMILLIMETRIC OBSERVATIONS OF IRAS 05327+3404 ''HOLOEA'' IN M36

Energy Technology Data Exchange (ETDEWEB)

Morata, O.; Ho, P. T. P. [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, Taipei 106, Taiwan (China); Kuan, Y.-J.; Huang, H.-C.; Zhao-Geisler, R. [Department of Earth Sciences, National Taiwan Normal University, 88 Section 4, Ting Chou Road, Taipei 116, Taiwan (China); Magnier, E. A., E-mail: omorata@asiaa.sinica.edu.tw [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

2013-09-15

The transition between the protostar, Class I, and the pre-main-sequence star, Class II, phases is still one of the most uncertain, and important, stages in the knowledge of the process of formation of an individual star because it is the stage that determines the final mass of the star. We observed the young stellar object ''Holoea'', associated with IRAS 05327+3404, which was classified as an object in the transition between the Class I and Class II phases with several unusual properties, and appears to be surrounded by large amounts of circumstellar material. We used the SMA and BIMA telescopes at millimeter and submillimeter (submm) wavelengths to observe the dust continuum emission and the CO (1-0) and (2-1), HCO{sup +} (1-0) and (3-2), and HCN (1-0) transitions in the region around IRAS 05327+3404. We detected two continuum emission peaks at 1.1 mm: SMM 1, the submm counterpart of IRAS 05327+3404, and SMM 2, {approx}6 arcsec to the west. The emissions of the three molecules show marked differences. The CO emission near the systemic velocity is filtered out by the telescopes, and CO mostly traces the high-velocity gas. The HCO{sup +} and HCN emissions are more concentrated around the central parts of the region, and show several intensity peaks coincident with the submm continuum peaks. We identify two main molecular outflows: a bipolar outflow in an E-W direction that would be powered by SMM 1 and the other in a NE direction, which we associate with SMM 2. We propose that the SMM sources are probably Class I objects, with SMM 1 in an earlier evolutionary stage.

A ROTATING MOLECULAR DISK TOWARD IRAS 18162-2048, THE EXCITING SOURCE OF HH 80-81

International Nuclear Information System (INIS)

Fernandez-Lopez, M.; Curiel, S.; Girart, J. M.; Gomez, Y.; Ho, P. T. P.; Patel, N.

2011-01-01

We present several molecular line emission arcsecond and subarcsecond observations obtained with the Submillimeter Array in the direction of the massive protostar IRAS 18162-2048, the exciting source of HH 80-81. The data clearly indicate the presence of a compact (radius ∼425-850 AU) SO 2 structure, enveloping the more compact (radius ∼ sun . The SO 2 spectral line data also allow us to constrain the structure temperature between 120 and 160 K and the volume density ∼> 2 x 10 9 cm -3 . We also find that such a rotating flattened system could be unstable due to gravitational disturbances. The data from C 17 O line emission show a dense core within this star-forming region. Additionally, the H 2 CO and SO emissions appear clumpy and trace the disk-like structure, a possible interaction between a molecular core and the outflows, and in part, the cavity walls excavated by the thermal radio jet.

IRAS observations of the ISM in the gamma CAS reflection nebula

Science.gov (United States)

Buss, Richard H., Jr.; Werner, Michael W.

1990-01-01

Mid-infrared emission from other galaxies originates both from interstellar grains heated by diffuse starlight and local excitation of grains by hot OB stars. Thus, a detailed examination of the Infrared Astronomy Satellite (IRAS) data from a B star interacting with the interstellar medium (ISM) could provide insight into infrared (IR) emission processes in external galaxies. Researchers have therefore used IRAS data to study the B0 IVe star gamma Cas and its surroundings, which they find to exhibit evidence of grain heating, destruction, and possible star formation.

ESTUDIO DESCRIPTIVO CORRELACIONAL ENTRE IRA Y PERSONALIDAD A LA LUZ DE LA TEORÍA DE HANS EYSENCK

Directory of Open Access Journals (Sweden)

Clemencia Montaña de Barragán

2002-07-01

Full Text Available Este trabajo presenta una cuidadosa revisión teórica sobre el tema de la ira, su evaluación e intervención, relacionada muy directamente con la agresividad y teorías importantes de la personalidad, enfocándose principalmente a la teoría de H. Eysenck. Se aplicaron dos instrumentos, uno para medir ira (escala MAG de Ira y otro para medir dimensiones de personalidad Extroversión – Neuroticismo – Psicoticismo (EPQ-J, a 200 niños de ambos sexos, con edades comprendidas entre 9 y 11 años, en tres colegios de Santafé de Bogotá. Se realizó una aplicación piloto y validación por jueces para la Escala MAG de ira con el objetivo de verificar su efectividad, mostrando unos buenos resultados mediante una consistencia interna de 0.8236. Al relacionar esta dos pruebas se encontró que hay niveles muy significativos de correlación entre personalidad e ira, a la vez que hay buenas intercorrelaciones entre las dimensiones del EPQ-J. Se encontraron correlaciones significativas entre ira y conducta antisocial. El aporte del trabajo es la presentación de la escala MAG para aplicarla en población infantil.

Search for near-infrared counterparts of IRAS embedded sources in the M17 SW giant molecular cloud

International Nuclear Information System (INIS)

Elmegreen, D.M.; Phillips, J.; Beck, K.; Thomas, H.; Howard, J.

1988-01-01

Wide-field near-infrared and blue band plates of the region containing the M17 giant molecular cloud complex have been blinked to locate bright near-infrared stars that may be embedded in the M17 SW giant molecular cloud. Twenty such stars coincided with the positions of IRAS point sources that appeared embedded based on color-color diagrams. Some of these stars may be the sources of the infrared luminosities. Of the 20 stars, seven were too faint to appear on the B band plate. The optical magnitudes and colors determined from the plate image diameters were measured for the other 13 coincident stars; they are most likely upper main-sequence or pre-main-sequence stars with extinctions of 7 mag. The IRAS luminosity-temperature diagram indicates that the embedded sources in M17 are more massive than those in the Orion cloud. 35 references

NEBULAR EMISSION-LINES IN IRAS 10215-5916

NARCIS (Netherlands)

GARCIALARIO, P; MANCHADO, A; PARTHASARATHY, M; POTTASCH, [No Value

From low and high resolution spectroscopic observations of IRAS 10215 - 5916 we have discovered the presence of nebular emission lines in this G-type supergiant star in the post-AGB stage. From its high resolution spectrum we derived an expansion velocity of 17 km s-1 for the shell, similar to the

Insights into the working mechanism of water filtered infrared A (wIRA) irradiation on Chlamydia trachomatis serovar E

Science.gov (United States)

Kuratli, Jasmin; Pesch, Theresa; Marti, Hanna; Blenn, Christian; Borel, Nicole

2018-02-01

Infections with Chlamydia trachomatis are the major cause for infectious blindness and still represent the most common bacterial sexually transmitted disease worldwide. Considering the possible side effects of antibiotic therapy and the increasing threat of antibiotic resistance, alternative therapeutic strategies are needed. Previous studies showed a reduction of C. trachomatis infectivity after irradiation with water filtered infrared A alone (wIRA) or in combination with visible light (wIRA/VIS). In this study, we aimed to gain further insight into the working mechanism of wIRA/VIS by analyzing cytokine and chemokine levels of infected and non-infected HeLa cells following triple dose irradiation at 24, 36 and 40 hours post infection. Subsequently, we examined the influence of cytokines on irradiation and chlamydial infection using a cytokine/chemokine inhibitor (Azelastine) and by IL-6 and IL-8 gene silencing. A triple dose irradiation significantly reduced chlamydial infectivity in HeLa cells without inducing the chlamydial stress response. The reducing effect was present regardless of the addition of cycloheximide (CHX), a host protein synthesis inhibitor. Chlamydial infection, wIRA/VIS treatment and the combination of both revealed a similar release pattern of a subset of pro-inflammatory cytokines (IL-6, IL-8, RANTES, Serpin E1). The addition of Azelastine induced the chlamydial stress response in non-irradiated samples. This effect was even more pronounced in wIRA/VIS-treated conditions. Silencing of IL-6 and IL-8 resulted in a lower chlamydial infectivity. However, wIRA/VIS treatment of infected and silenced cells reduced the chlamydial infectivity similar to wIRA/VIS treated control cells. Further studies are needed to elucidate the working mechanism of wIRA/VIS.

The peculiar acceleration of the Local Group as deduced from the optical and IRAS flux dipoles

International Nuclear Information System (INIS)

Lahav, O.; Lynden-Bell, D.

1988-01-01

The relation between the peculiar acceleration of the Local Group and the surface brightness dipole moments of all-sky optical and IRAS samples is studied. Our revised optical dipole lies within 7 0 of the direction of the Local Group's motion through the Microwave Background Radiation (MBR). The directions of the optical, IRAS and MBR dipoles are all consistent with each other. To analyse the optical dipole we have calculated diameter functions for the UGC and ESO galaxy catalogues from redshift surveys. Most of the optical dipole arises from the Centaurus-Virgo direction and from the 'Local Void' on the opposite side of the sky. The sources of the IRAS dipole are more evenly distributed around the sky. A simple 'shell model', fitted to the variation of the dipoles as a function of flux, suggests that the dipoles arise from galaxies whose recession velocities are smaller than 4000 kms -1 . We find a high Ω 0 value for the IRAS sample and a low one for the optical sample. These results may be reconciled if the optical galaxy distribution is more biased relative to the matter distribution than the IRAS galaxy distribution. (author)

Estrategias terapéuticas e intelectualismo en el De ira de Séneca

Directory of Open Access Journals (Sweden)

Rodrigo Sebastián Braicovich

2015-01-01

Full Text Available Pretendo demostrar que a el tratado De IRA de Séneca incluye no una sino dos estrategias terapéuticas diseñadas para evitar la ira, y que b que la segunda de estasestrategiasla cual ha sido desatendida en la literatura secundaria– presenta problemas irresolubles cuando la contrastamos contra la teoría estoica de la acción, lacual se funda en premisas intelectualistas.

Radiation effects in IRAS extrinsic infrared detectors

Science.gov (United States)

Varnell, L.; Langford, D. E.

1982-01-01

During the calibration and testing of the Infrared Astronomy Satellite (IRAS) focal plane, it was observed that the extrinsic photoconductor detectors were affected by gamma radiation at dose levels of the order of one rad. Since the flight environment will subject the focal plane to dose levels of this order from protons in single pass through the South Atlantic Anomaly, an extensive program of radiation tests was carried out to measure the radiation effects and to devise a method to counteract these effects. The effects observed after irradiation are increased responsivity, noise, and rate of spiking of the detectors after gamma-ray doses of less than 0.1 rad. The detectors can be returned almost to pre-irradiation performance by increasing the detector bias to breakdown and allowing a large current to flow for several minutes. No adverse effects on the detectors have been observed from this bias boost, and this technique will be used for IRAS with frequent calibration to ensure the accuracy of observations made with the instrument.

Influence of water-filtered infrared-A (wIRA on reduction of local fat and body weight by physical exercise

Directory of Open Access Journals (Sweden)

Schmitz, Gerd

2006-07-01

treatment were not seen. Discussion: The results of the study suggest, that wIRA – during moderate bicycle ergometer endurance exercise as lipolytic stimulus – increases local lipolysis with a local fat reduction (thighs in the otherwise bradytrophic fatty tissue. The presumably underlying mechanisms of wIRA have already been proven: wIRA acts both by thermal effects and by non-thermal effects. Thermal effects of wIRA are the generation of a therapeutic field of warmth with the increase of tissue temperature, tissue oxygen partial pressure, and tissue blood flow, and by this regional metabolism. As fatty tissue normally has a slow metabolism (bradytrophic and hypothermic tissue with a low rate of lipolysis, wIRA can increase lipolysis in fatty tissue and the mobilized fats are burned in musculature during the ergometer exercise. Conclusion: The results of the study indicate, that wIRA irradiation during moderate ergometer endurance exercise can be used – in combination with an appropriate nutrition – to improve body composition, especially local fat distribution, and the reduction of fat and body weight in obese persons.

BRDF measurements of sunshield and baffle materials for the IRAS telescope

Science.gov (United States)

Smith, S. M.

1982-01-01

Measurements of the far-infrared bidirectional reflectance distribution functions (BRDF) of four samples of Martin Black coating and one sample of gold coated aluminum from the telescope to be flown on the Infrared Astronomy Satellite (IRAS) are presented. At incidence angles near 35 deg Martin Black is a diffuse reflector at wavelengths as long as 36 microns. The gold coated aluminum sample from the IRAS sunshield has a visible grain which causes a strong diffraction enhancement of the BRDF at large nonspecular angles. This enhancement from the sunshield will increase the stray light level inside the telescope.

OH masers associated with IRAS point sources

NARCIS (Netherlands)

Masheder, MRW; Cohen, RJ; Martin-Hernandez, NL; Migenes,; Reid, MJ

2002-01-01

We report a search for masers from the Lambda-doublet of the ground-state of OH at 18cm, carried out with the Jodrell Bank Lovell Telescope and with the 25m Dwingeloo telescope. All objects north of delta = -20degrees which appear in the IRAS Point Source Catalog with fluxes > 1000 Jy at 60mum and

Análisis de la ira en pacientes con cardiopatía isquémica de la ciudad de Medellín (Colombia

Directory of Open Access Journals (Sweden)

Andrea Ochoa Ochoa

2010-01-01

Full Text Available Este estudio tuvo como objetivo comparar los niveles de ira, y sus componentes, entre un grupo de personas con Cardiopatía Isquémica y un grupo control sin esta enfermedad. Participaron 90 pacientes con cardiopatía isquémica de la Clínica Cardiovascular en Medellín y 78 controles sin la enfermedad. A cada uno de los participantes de les administró la prueba del STAXI- 2. Los resultados muestran que, comparado con los controles, los pacientes con cardiopatía isquémica tuvieron niveles significativamente más altos de ira como rasgo (p < 0.01, específicamente en la subescala reacción de ira (p < 0.05, y expresión interna de ira (p < 0.05. Los pacientes con cardiopatía isquémica experimentan más frecuentemente sentimientos de ira (ira rasgo, aparentemente debido a que son más sensibles a las críticas de los demás (reacción de ira, pero tienden a suprimir la expresión de esta emoción (expresión de ira interna. Estos datos confirman la necesidad de implementar programas dirigidos al manejo adecuado de la ira en estos pacientes y entender mejor las implicaciones que pueda tener la ira en la progresión de su enfermedad.

Estudio descriptivo correlacional entre ira y personalidad, a la luz de la teoría de Hans Eysenck

Directory of Open Access Journals (Sweden)

Clemencia Montaña de Barragán

2002-01-01

Full Text Available Este trabajo presenta una cuidadosa revisión teórica sobre el tema de la ira, su evaluación e intervención, relacionada muy directamente con la agresividad y teorías importantes de la personalidad, enfocándose principalmente a la teoría de H. Eysenck. Se aplicaron dos instrumentos, uno para medir ira (escala MAG de Ira y otro para medir dimensiones de personalidad Extroversión – Neuroticismo – Psicoticismo (EPQ-J, a 200 niños de ambos sexos, con edades comprendidas entre 9 y 11 años, en tres colegios de Santafé de Bogotá. Se realizó una aplicación piloto y validación por jueces para la Escala MAG de ira con el objetivo de verificar su efectividad, mostrando unos buenos resultados mediante una consistencia interna de 0.8236. Al relacionar esta dos pruebas se encontró que hay niveles muy significativos de correlación entre personalidad e ira, a la vez que hay buenas intercorrelaciones entre las dimensiones del EPQ-J. Se encontraron correlaciones significativas entre ira y conducta antisocial. El aporte del trabajo es la presentación de la escala MAG para aplicarla en población infantil

Far Infrared Mapping of Three Galactic Star Forming Regions: W3 ...

Indian Academy of Sciences (India)

R. Narasimhan (Krishtel eMaging Solutions)

- nyk 1990). Although extensions are seen in many IRAS bands, the TIFR maps show superior angular resolution as a result of their smaller and circular beam. Discrete sources have been extracted from the TIFR and HIRES maps using a.

Water distribution in shocked regions of the NGC 1333-IRAS 4A protostellar outflow

Science.gov (United States)

Santangelo, G.; Nisini, B.; Codella, C.; Lorenzani, A.; Yıldız, U. A.; Antoniucci, S.; Bjerkeli, P.; Cabrit, S.; Giannini, T.; Kristensen, L. E.; Liseau, R.; Mottram, J. C.; Tafalla, M.; van Dishoeck, E. F.

2014-08-01

Context. Water is a key molecule in protostellar environments because its line emission is very sensitive to both the chemistry and the physical conditions of the gas. Observations of H2O line emission from low-mass protostars and their associated outflows performed with HIFI onboard the Herschel Space Observatory have highlighted the complexity of H2O line profiles, in which different kinematic components can be distinguished. Aims: The goal is to study the spatial distribution of H2O, in particular of the different kinematic components detected in H2O emission, at two bright shocked regions along IRAS 4A, one of the strongest H2O emitters among the Class 0 outflows. Methods: We obtained Herschel-PACS maps of the IRAS 4A outflow and HIFI observations of two shocked positions. The largest HIFI beam of 38'' at 557 GHz was mapped in several key water lines with different upper energy levels, to reveal possible spatial variations of the line profiles. A large velocity gradient (LVG) analysis was performed to determine the excitation conditions of the gas. Results: We detect four H2O lines and CO (16-15) at the two selected shocked positions. In addition, transitions from related outflow and envelope tracers are detected. Different gas components associated with the shock are identified in the H2O emission. In particular, at the head of the red lobe of the outflow, two distinct gas components with different excitation conditions are distinguished in the HIFI emission maps: a compact component, detected in the ground-state water lines, and a more extended one. Assuming that these two components correspond to two different temperature components observed in previous H2O and CO studies, the LVG analysis of the H2O emission suggests that the compact (about 3'', corresponding to about 700 AU) component is associated with a hot (T ~ 1000 K) gas with densities nH2 ~ (1-4) × 105 cm-3, whereas the extended (10''-17'', corresponding to 2400-4000 AU) one traces a warm (T ~ 300

Antimicrobial Photoinactivation Using Visible Light Plus Water-Filtered Infrared-A (VIS + wIRA Alters In Situ Oral Biofilms.

Directory of Open Access Journals (Sweden)

A Al-Ahmad

Full Text Available Recently, growing attention has been paid to antimicrobial photodynamic therapy (aPDT in dentistry. Changing the microbial composition of initial and mature oral biofilm by aPDT using visible light plus water-filtered infrared-A wavelengths (VIS + wIRA has not yet been investigated. Moreover, most aPDT studies have been conducted on planktonic bacterial cultures. Therefore, in the present clinical study we cultivated initial and mature oral biofilms in six healthy volunteers for 2 hours or 3 days, respectively. The biofilms were treated with aPDT using VIS+wIRA (200 mW cm(-2, toluidine blue (TB and chlorine e6 (Ce6 for 5 minutes. Chlorhexidine treated biofilm samples served as positive controls, while untreated biofilms served as negative controls. After aPDT treatment the colony forming units (CFU of the biofilm samples were quantified, and the surviving bacteria were isolated in pure cultures and identified using MALDI-TOF, biochemical tests and 16S rDNA-sequencing. aPDT killed more than 99.9% of the initial viable bacterial count and 95% of the mature oral biofilm in situ, independent of the photosensitizer. The number of surviving bacterial species was highly reduced to 6 (TB and 4 (Ce6 in the treated initial oral biofilm compared to the 20 different species of the untreated biofilm. The proportions of surviving bacterial species were also changed after TB- and Ce6-mediated aPDT of the mature oral biofilm, resulting in a shift in the microbial composition of the treated biofilm compared to that of the control biofilm. In conclusion, aPDT using VIS + wIRA showed a remarkable potential to eradicate both initial and mature oral biofilms, and also to markedly alter the remaining biofilm. This encourages the clinical use of aPDT with VIS + wIRA for the treatment of periimplantitis and periodontitis.

STAR-FORMING ACTIVITY IN THE H ii REGIONS ASSOCIATED WITH THE IRAS 17160–3707 COMPLEX

Energy Technology Data Exchange (ETDEWEB)

Nandakumar, G.; Veena, V. S.; Vig, S.; Tej, A. [Indian Institute of Space Science and Technology, Thiruvananthapuram 695 547 (India); Ghosh, S. K.; Ojha, D. K. [Tata Institute of Fundamental Research, Mumbai (Bombay) 400 005 (India)

2016-11-01

We present a multiwavelength investigation of star formation activity toward the southern H ii regions associated with IRAS 17160–3707, located at a distance of 6.2 kpc with a bolometric luminosity of 8.3 × 10{sup 5} L {sub ⊙}. The ionized gas distribution and dust clumps in the parental molecular cloud are examined in detail using measurements at infrared, submillimeter and radio wavelengths. The radio continuum images at 1280 and 610 MHz obtained using the Giant Metrewave Radio Telescope reveal the presence of multiple compact sources as well as nebulous emission. At submillimeter wavelengths, we identify seven dust clumps and estimate their physical properties such as temperature: 24–30 K, mass: 300–4800 M {sub ⊙} and luminosity: 9–317 × 10{sup 2} L {sub ⊙} using modified blackbody fits to the spectral energy distributions (SEDs) between 70 and 870 μ m. We find 24 young stellar objects (YSOs) in the mid-infrared, with a few of them coincident with the compact radio sources. The SEDs of the YSOs have been fitted by the Robitaille models and the results indicate that those having radio compact sources as counterparts host massive objects in early evolutionary stages with best fit age ≤0.2 Myr. We compare the relative evolutionary stages of clumps using various signposts such as masers, ionized gas, presence of YSOs and infrared nebulosity, and find six massive star-forming clumps and one quiescent clump. Of the former, five are in a relatively advanced stage and one in an earlier stage.

Unidentified point sources in the IRAS minisurvey

Science.gov (United States)

Houck, J. R.; Soifer, B. T.; Neugebauer, G.; Beichman, C. A.; Aumann, H. H.; Clegg, P. E.; Gillett, F. C.; Habing, H. J.; Hauser, M. G.; Low, F. J.

1984-01-01

Nine bright, point-like 60 micron sources have been selected from the sample of 8709 sources in the IRAS minisurvey. These sources have no counterparts in a variety of catalogs of nonstellar objects. Four objects have no visible counterparts, while five have faint stellar objects visible in the error ellipse. These sources do not resemble objects previously known to be bright infrared sources.

IRaPPA: information retrieval based integration of biophysical models for protein assembly selection.

Science.gov (United States)

Moal, Iain H; Barradas-Bautista, Didier; Jiménez-García, Brian; Torchala, Mieczyslaw; van der Velde, Arjan; Vreven, Thom; Weng, Zhiping; Bates, Paul A; Fernández-Recio, Juan

2017-06-15

In order to function, proteins frequently bind to one another and form 3D assemblies. Knowledge of the atomic details of these structures helps our understanding of how proteins work together, how mutations can lead to disease, and facilitates the designing of drugs which prevent or mimic the interaction. Atomic modeling of protein-protein interactions requires the selection of near-native structures from a set of docked poses based on their calculable properties. By considering this as an information retrieval problem, we have adapted methods developed for Internet search ranking and electoral voting into IRaPPA, a pipeline integrating biophysical properties. The approach enhances the identification of near-native structures when applied to four docking methods, resulting in a near-native appearing in the top 10 solutions for up to 50% of complexes benchmarked, and up to 70% in the top 100. IRaPPA has been implemented in the SwarmDock server ( http://bmm.crick.ac.uk/∼SwarmDock/ ), pyDock server ( http://life.bsc.es/pid/pydockrescoring/ ) and ZDOCK server ( http://zdock.umassmed.edu/ ), with code available on request. moal@ebi.ac.uk. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

IRAS 03063+5735: A BOWSHOCK NEBULA POWERED BY AN EARLY B STAR

Energy Technology Data Exchange (ETDEWEB)

Kobulnicky, Henry A.; Lundquist, Michael J.; Bhattacharjee, Anirban [Department of Physics and Astronomy, 1000 E. University Avenue, University of Wyoming Laramie, WY 82071 (United States); Kerton, C. R., E-mail: chipk@uwyo.edu, E-mail: mlundqui@uwyo.edu, E-mail: abhattac@uwyo.edu, E-mail: kerton@iastate.edu [Department of Physics and Astronomy, Iowa State University Ames, IA 50011 (United States)

2012-03-15

Mid-infrared images from the Spitzer Space Telescope Galactic Legacy Infrared MidPlane Survey Extraordinaire program reveal that the infrared source IRAS 03063+5735 is a bowshock nebula produced by an early B star, 2MASS 03101044+5747035. We present new optical spectra of this star, classify it as a B1.5 V, and determine a probable association with a molecular cloud complex at V{sub LSR} = -38 to -42 km s{sup -1} in the outer Galaxy near l = 140.{sup 0}59, b = -0.{sup 0}250. On the basis of spectroscopic parallax, we estimate a distance of 4.0 {+-} 1 kpc to both the bowshock nebula and the molecular complex. One plausible scenario is that this is a high-velocity runaway star impinging upon a molecular cloud. We identify the H II region and stellar cluster associated with IRAS 03064+5638 at a projected distance of 64 pc as one plausible birth site. The spectrophotometric distance and linkage to a molecular feature provides another piece of data helping to secure the ill-determined rotation curve in the outer Galaxy. As a by-product of spectral typing this star, we present empirical spectral diagnostic diagrams suitable for approximate spectral classification of O and B stars using He lines in the little-used yellow-red portion of the optical spectrum.

Finding charts for southern IRAS galaxies

International Nuclear Information System (INIS)

Sutherland, W.J.; Maddox, S.J.; Saunders, W.

1991-01-01

Using the APM Galaxy Survey, we have generated a collection of finding charts for 4614 sources with non-stellar colours in the IRAS Faint Source Catalogue south of δ= -17.5 o . Over 90 per cent of the sources are reliably identified with an optical object, and we provide 1-arcsec positions and B J magnitudes for these. We will provide paper copies of the charts on request, at a small charge to cover photocopying costs. (author)

New CO and HCN sources associated with IRAS carbon stars

Science.gov (United States)

NGUYEN-Q-RIEU; Epchtein, N.; TRUONG-BACH; Cohen, M.

1987-01-01

Emission of CO and HCN was detected in 22 out of a sample of 53 IRAS sources classified as unidentified carbon-rich objects. The sample was selected according to the presence of the silicon carbide feature as revealed by low-resolution spectra. The molecular line widths indicate that the CO and HCN emission arises from the circumstellar envelopes of very highly evolved stars undergoing mass loss. The visible stars tend to be deficient in CO as compared with unidentified sources. Most the detected CO and HCN IRAS stars are distinct and thick-shelled objects, but their infrared and CO luminosities are similar to those of IRC + 102156 AFGL and IRC-CO evolved stars. The 12 micron flux seems to be a good indicator of the distance, hence a guide for molecular searches.

Changes of MMP-1 and collagen type Ialpha1 by UVA, UVB and IRA are differentially regulated by Trx-1.

Science.gov (United States)

Buechner, Nicole; Schroeder, Peter; Jakob, Sascha; Kunze, Kerstin; Maresch, Tanja; Calles, Christian; Krutmann, Jean; Haendeler, Judith

2008-07-01

Exposure of human skin to solar radiation, which includes ultraviolet (UV) radiation (UVA and UVB) visible light and infrared radiation, induces skin aging. The effects of light have been attributed to irradiation-induced reactive oxygen species (ROS) formation, but the specific signaling pathways are not well understood. Detrimental effects of solar radiation are dermal diseases and photoaging. Exposure of cultured human dermal fibroblasts to UVA, UVB or IRA increased ROS formation in vitro. One important redox regulator is the oxidoreductase thioredoxin-1 (Trx). Trx is ubiquitously expressed and has anti-oxidative and anti-apoptotic properties. Besides its function to reduce H(2)O(2), Trx binds to and regulates transcription factors. The aim of this study was to investigate whether Trx influences the regulation of MMP-1 and collagen Ialpha1 by UVA, UVB and IRA. We irradiated human dermal fibroblasts with UVA, UVB and IRA. UVA, UVB and IRA upregulated MMP-1 expression. Trx inhibited UVA-induced MMP-1 upregulation in a NFkappaB dependent manner. UVA, UVB and IRA reduced collagen Ialpha1 expression. Incubation with Trx inhibited the effects of UVB and IRA on collagen Ialpha1 expression. In conclusion, MMP-1 and collagen Ialpha1, which play important roles in aging processes, seems to be regulated by different transcriptional mechanisms and Trx can only influence distinct signaling pathways induced by UVA, UVB and probably IRA. Thus, Trx may serve as an important contributor to an "anti-aging therapeutic cocktail".

Dialogic & Critical Pedagogies: An Interview with Ira Shor

Science.gov (United States)

Shor, Ira; Matusov, Eugene; Marjanovic-Shane, Ana; Cresswel, lJames

2017-01-01

In 2016, the Main Editors of "Dialogic Pedagogy Journal" issued a call for papers and contributions to a wide range of dialogic pedagogy scholars and practitioners. One of the scholars who responded to our call is famous American educator Ira Shor, a professor at the College of Staten Island, City University of New York. Shor has been…

THE VLA NASCENT DISK AND MULTIPLICITY (VANDAM) SURVEY OF PERSEUS PROTOSTARS. RESOLVING THE SUB-ARCSECOND BINARY SYSTEM IN NGC 1333 IRAS2A

International Nuclear Information System (INIS)

Tobin, John J.; Looney, Leslie W.; Dunham, Michael M.; Li, Zhi-Yun; Chandler, Claire J.; Perez, Laura M.; Segura-Cox, Dominique; Harris, Robert J.; Hull, Charles L. H.; Sadavoy, Sarah I.; Melis, Carl; Kratter, Kaitlin; Jørgensen, Jes K.; Plunkett, Adele L.

2015-01-01

We are conducting a Jansky Very Large Array (VLA) Ka-band (8 mm and 1 cm) and C-band (4 cm and 6.4 cm) survey of all known protostars in the Perseus Molecular Cloud, providing resolution down to ∼0.''06 and ∼0.''35 in the Ka band and C band, respectively. Here we present first results from this survey that enable us to examine the source NGC 1333 IRAS2A in unprecedented detail and resolve it into a protobinary system separated by 0.''621 ± 0.''006 (∼143 AU) at 8 mm, 1 cm, and 4 cm. These two sources (IRAS2A VLA1 and VLA2) are likely driving the two orthogonal outflows known to originate from IRAS2A. The brighter source IRAS2A VLA1 is extended perpendicular to its outflow in the VLA data, with a deconvolved size of 0.''055 (∼13 AU), possibly tracing a protostellar disk. The recently reported candidate companions (IRAS2A MM2 and MM3) are not detected in either our VLA data, Combined Array for Research in Millimeter-wave Astronomy (CARMA) 1.3 mm data, or Submillimeter Array (SMA) 850 μm data. SMA CO (J = 3 → 2), CARMA CO (J = 2 → 1), and lower-resolution CARMA CO (J = 1 → 0) observations are used to examine the outflow origins and the nature of the candidate companions to IRAS2A VLA1. The CO (J = 3 → 2) and (J = 2 → 1) data show that IRAS2A MM2 is coincident with a bright CO emission spot in the east-west outflow, and IRAS2A MM3 is within the north-south outflow. In contrast, IRAS2A VLA2 lies at the east-west outflow symmetry point. We propose that IRAS2A VLA2 is the driving source of the east-west outflow and a true companion to IRAS2A VLA1, whereas IRAS2A MM2 and MM3 may not be protostellar

THE VLA NASCENT DISK AND MULTIPLICITY (VANDAM) SURVEY OF PERSEUS PROTOSTARS. RESOLVING THE SUB-ARCSECOND BINARY SYSTEM IN NGC 1333 IRAS2A

Energy Technology Data Exchange (ETDEWEB)

Tobin, John J.; Looney, Leslie W. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Dunham, Michael M. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Li, Zhi-Yun [Department of Astronomy, University of Virginia, Charlottesville, VA 22903 (United States); Chandler, Claire J.; Perez, Laura M. [National Radio Astronomy Observatory, Socorro, NM 87801 (United States); Segura-Cox, Dominique; Harris, Robert J.; Hull, Charles L. H. [Department of Astronomy, University of Illinois, Urbana, IL 61801 (United States); Sadavoy, Sarah I. [Max-Planck-Institut für Astronomie, D-69117 Heidelberg (Germany); Melis, Carl [Center for Astrophysics and Space Sciences, University of California, San Diego, CA 92093 (United States); Kratter, Kaitlin [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Jørgensen, Jes K. [Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø. (Denmark); Plunkett, Adele L., E-mail: jtobin@nrao.edu, E-mail: jeskj@nbi.dk [Department of Astronomy, Yale University, New Haven, CT 06520 (United States)

2015-01-01

We are conducting a Jansky Very Large Array (VLA) Ka-band (8 mm and 1 cm) and C-band (4 cm and 6.4 cm) survey of all known protostars in the Perseus Molecular Cloud, providing resolution down to ∼0.''06 and ∼0.''35 in the Ka band and C band, respectively. Here we present first results from this survey that enable us to examine the source NGC 1333 IRAS2A in unprecedented detail and resolve it into a protobinary system separated by 0.''621 ± 0.''006 (∼143 AU) at 8 mm, 1 cm, and 4 cm. These two sources (IRAS2A VLA1 and VLA2) are likely driving the two orthogonal outflows known to originate from IRAS2A. The brighter source IRAS2A VLA1 is extended perpendicular to its outflow in the VLA data, with a deconvolved size of 0.''055 (∼13 AU), possibly tracing a protostellar disk. The recently reported candidate companions (IRAS2A MM2 and MM3) are not detected in either our VLA data, Combined Array for Research in Millimeter-wave Astronomy (CARMA) 1.3 mm data, or Submillimeter Array (SMA) 850 μm data. SMA CO (J = 3 → 2), CARMA CO (J = 2 → 1), and lower-resolution CARMA CO (J = 1 → 0) observations are used to examine the outflow origins and the nature of the candidate companions to IRAS2A VLA1. The CO (J = 3 → 2) and (J = 2 → 1) data show that IRAS2A MM2 is coincident with a bright CO emission spot in the east-west outflow, and IRAS2A MM3 is within the north-south outflow. In contrast, IRAS2A VLA2 lies at the east-west outflow symmetry point. We propose that IRAS2A VLA2 is the driving source of the east-west outflow and a true companion to IRAS2A VLA1, whereas IRAS2A MM2 and MM3 may not be protostellar.

IRAS Colors of the Pleiades

Science.gov (United States)

Carey, Sean J.; Shipman, R. F.; Clark, F. O.

1996-01-01

We present large scale images of the infrared emission of the region around the Pleiades using the ISSA data product from the IRAS mission. Residual Zodiacal background and a discontinuity in the image due to the scanning strategy of the satellite necessitated special background subtraction methods. The 60/100 color image clearly shows the heating of the ambient interstellar medium by the cluster. The 12/100 and 25/100 images peak on the cluster as expected for exposure of small dust grains to an enhanced UV radiation field; however, the 25/100 color declines to below the average interstellar value at the periphery of the cluster. Potential causes of the color deficit are discussed. A new method of identifying dense molecular material through infrared emission properties is presented. The difference between the 100 micron flux density and the 60 micron flux density scaled by the average interstellar 60/100 color ratio (Delta I(sub 100) is a sensitive diagnostic of material with embedded heating sources (Delta I(sub 100) less than 0) and cold, dense cores (Delta I(sub 100) greater than 0). The dense cores of the Taurus cloud complex as well as Lynds 1457 are clearly identified by this method, while the IR bright but diffuse Pleiades molecular cloud is virtually indistinguishable from the nearby infrared cirrus.

A catalog of pre-main-sequence emission-line stars with IRAS source associations

International Nuclear Information System (INIS)

Weintraub, D.A.

1990-01-01

To aid in finding premain-sequence (PMS) emission-line stars that might have dusty circumstellar environments, 361 PMS stars that are associated with 304 separate IRAS sources were identified. These stars include 200 classical T Tauri stars, 25 weak-lined (naked) T Tauri stars, 56 Herbig Ae/Be stars, six FU Orionis stars, and two SU Aurigae stars. All six of the FU Orionis stars surveyed by IRAS were detected. Of the PMS-IRAS Point Source Catalog (PSC) associations, 90 are new and are not noted in the PSC. The other 271 entries include 104 that are correctly identified in the PSC but have not yet appeared in the literature, 56 more that can be found in both the PSC and in the published and unpublished iterature, and 111 that are in the literature but not in the PSC. Spectral slope diagrams constructed from the 12-, 25-, and 60-micron flux densities reveal unique distributions for the different PMS subclasses; these diagrams may help identify the best candidate PMS stars for observations of circumstellar dust. 30 refs

Galaxy evolution and large-scale structure in the far-infrared. I. IRAS pointed observations

International Nuclear Information System (INIS)

Lonsdale, C.J.; Hacking, P.B.

1989-01-01

Redshifts for 66 galaxies were obtained from a sample of 93 60-micron sources detected serendipitously in 22 IRAS deep pointed observations, covering a total area of 18.4 sq deg. The flux density limit of this survey is 150 mJy, 4 times fainter than the IRAS Point Source Catalog (PSC). The luminosity function is similar in shape with those previously published for samples selected from the PSC, with a median redshift of 0.048 for the fainter sample, but shifted to higher space densities. There is evidence that some of the excess number counts in the deeper sample can be explained in terms of a large-scale density enhancement beyond the Pavo-Indus supercluster. In addition, the faintest counts in the new sample confirm the result of Hacking et al. (1989) that faint IRAS 60-micron source counts lie significantly in excess of an extrapolation of the PSC counts assuming no luminosity or density evolution. 81 refs

76 FR 37194 - Proposed Collection; Comment Request for Form 1099-R.

Science.gov (United States)

2011-06-24

... 1099-R. AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... Form 1099-R, Distributions From Pensions, Annuities, Retirement or Profit-Sharing Plans, IRAs..., Insurance Contracts, etc. OMB Number: 1545-0119. Form Number: 1099-R. Abstract: Form 1099-R is used to...

Expresión de la ira en adolescentes holguineros. Repercusión psicológica y diferencias de género

Directory of Open Access Journals (Sweden)

Yuri Arsenio Sanz Martínez

2006-01-01

Full Text Available Aborda el proceso de validación de dos instrumentos diagnósticos: Escala Pediátrica de la Expresión de la Ira y Juego Clase, aplicados a un grupo de adolescentes tempranos. Se obtiene que ambos instrumentos poseen índices aceptables y altos de confiabilidad y se reporta validez de constructo. Se comprueba que los adolescentes que externalizan la ira emiten menos comportamientos prosociales que aquellos que la manejan de forma controlada, quienes son más sociables, aceptados, y tienen más amigos. Los adolescentes que reprimen su ira son los que menos comportamientos prosociales emiten. Los varones expresan de forma más abierta su ira que las hembras.

Application of radioactive tracers in upgradation of industrial grade ion exchange resin (Amberlite IRA-400)

International Nuclear Information System (INIS)

Lokhande, R.S.; Singare, P.U.

1998-01-01

The exchange rates of ion exchange are determined by application of 131 I as a tracer isotope. The exchange study carried out in this investigation deals with understanding the effectiveness of ion exchange resin (in iodide form) Amberlite IRA-400 at different concentrations of potassium iodide solution (electrolyte) with temperature of solution varying from 27-48 degC by keeping amount of ion exchange resin constant (1.0 g). The exchange study is also carried out by varying amount of ion exchange resins, for fixed temperature (27.0 degC) and for fixed concentration of potassium iodide solution (0.005 M). (author)

Search for brown dwarfs in the IRAS data bases

International Nuclear Information System (INIS)

Low, F.J.

1986-01-01

A report is given on the initial searches for brown dwarf stars in the IRAS data bases. The paper was presented to the workshop on 'Astrophysics of brown dwarfs', Virginia, USA, 1985. To date no brown dwarfs have been discovered in the solar neighbourhood. Opportunities for future searches with greater sensitivity and different wavelengths are outlined. (U.K.)

IRAS constraints on a cold cloud around the solar system

International Nuclear Information System (INIS)

Aumann, H.H.; Good, J.C.

1990-01-01

IRAS 60- and 100-micron observations of G-stars in the solar neighborhood indicate that the typical G star is surrounded by a cold cloud. The assumption that the sun is archetypical requires that a cloud of typical G star extent and temperature surrounds our solar system. IRAS ecliptic plane scans, which are dominated by a 40-deg wide band of zodiacal dust, asteroid debris trails, and the Galactic plane, are consistent with a larger than typical G star cold cloud. Consistency with the typical G star and the direct observations constrain the width of the cold cloud perpendicular to the ecliptic plane to be larger than 5 deg. The 100-150 AU radius of this cloud is larger, but not inconsistent with the inner boundary of a cloud of comets, postulated previously at a radius of 50 AU based on Neptune orbital perturbations and models of short period comets. 17 refs

A laboratory analog for the carrier of the 3 micron emission of the protoplanetary nebula IRAS 05341+0852.

Science.gov (United States)

Beegle, L W; Wdowiak, T J; Arnoult, K M

1997-09-10

A mixture of the polycyclic aromatic hydrocarbons (PAHs), acenaphthylene and acenaphthene, when subjected to the energetic environment of a hydrogen plasma, is transformed into a material that exhibits an infrared absorption profile in the 3 micron region that is an excellent match of the protoplanetary nebula IRAS 05341+0852 emission profile in the same wavelength region. Acenaphthylene and acenaphthene were chosen as precursors in the experiment because these molecules have a structure that can be described as a keystone in a process in which carbon atoms in a stellar wind condense into PAH species. The spectral match between experiment and observations appears to validate that scenario.

ALMA Observations of the Water Fountain Pre-Planetary Nebula IRAS 16342-3814: High-Velocity Bipolar Jets and an Expanding Torus.

Science.gov (United States)

Sahai, R; Vlemmings, W H T; Gledhill, T; Sánchez Contreras, C; Lagadec, E; Nyman, L-Å; Quintana-Lacaci, G

2017-01-20

We have mapped 12 CO J=3-2 and other molecular lines from the "water-fountain" bipolar pre-planetary nebula (PPN) IRAS 16342-3814 with [Formula: see text] resolution using ALMA. We find (i) two very high-speed knotty, jet-like molecular outflows, (ii) a central high-density (> few × 10 6 cm -3 ), expanding torus of diameter 1300 AU, and (iii) the circumstellar envelope of the progenitor AGB, generated by a sudden, very large increase in the mass-loss rate to > 3.5 × 10 -4 M ⊙ yr -1 in the past ~455 yr. Strong continuum emission at 0.89 mm from a central source (690 mJy), if due to thermally-emitting dust, implies a substantial mass (0.017 M ⊙ ) of very large (~mm-sized) grains. The measured expansion ages of the above structural components imply that the torus (age~160 yr) and the younger high-velocity outflow (age~110 yr) were formed soon after the sharp increase in the AGB mass-loss rate. Assuming a binary model for the jets in IRAS 16342, the high momentum rate for the dominant jet-outflow in IRAS 16342 implies a high minimum accretion rate, ruling out standard Bondi-Hoyle-Lyttleton wind accretion and wind Roche lobe overflow (RLOF) models with white-dwarf or main-sequence companions. Most likely, enhanced RLOF from the primary or accretion modes operating within common envelope evolution are needed.

IRAS surface brightness maps of visible reflection nebulae: evidence for non-equilibrium infrared emission

International Nuclear Information System (INIS)

Castelaz, M.W.; Werner, M.W.; Sellgren, K.

1986-01-01

Surface brightness maps at 12, 25, 60, and 100 microns of 16 visible reflection nebulae were extracted from the Infrared Astronomy Satellite (IRAS) database. The maps were produced by coadding IRAS survey scans over areas centered on the illuminating stars, and have spatial resolutions of 0.9' x 4' at 12 and 25 microns, 1.8' x 4.5' at 60 microns, and 3.6' x 5' at 100 microns. Extended emission in the four IRAS bandpasses was detected in fourteen of the reflection nebulae. The IRAS data were used to measure the flux of the infrared emission associated with each source. The energy distributions show that the 12 micron flux is greater than the 25 micron flux in 11 of the nebulae, and the peak flux occurs in the 60 or 100 micron bandpass in all 16 nebular. The 60 and 100 micron flux can be approximated by blackbodies with temperatures between 30 and 50 K, consistent with temperatures expected from extrapolation of greybody fits to the 60 and 100 micron data. The excess 12 and 25 micron emission is attributed to a nonequilibrium process such as emission from thermal fluctuations of very small grains excited by single ultraviolet photons, or emission from polycyclic aromatic hydrocarbons (PAHs) excited by ultraviolet radiation. The common features of the energy distributions of the 16 reflection nebulae, also seen in the reflection nebulae associated with the Pleiades, suggest that PAHs or very small grains may be found in most reflection nebulae

Investigation of conspicuous infrared star cluster and star-forming region RCW 38 IR Cluster

International Nuclear Information System (INIS)

Gyulbudaghian, A.L.; May, J.

2008-01-01

An infrared star cluster RCW 38 IR Cluster, which is also a massive star-forming region, is investigated. The results of observations with SEST (Cerro is Silla, Chile) telescope on 2.6-mm 12 CO spectral line and with SIMBA on 1.2-mm continuum are given. The 12 CO observations revealed the existence of several molecular clouds, two of which (clouds I and 2) are connected with the object RCW 38 IR Cluster. Cloud 1 is a massive cloud, which has a depression in which the investigated object is embedded. It is not excluded that the depression was formed by the wind and/or emission from the young bright stars belonging to the star cluster. Rotation of cloud 2, around the axis having SE-NW direction, with an angular velocity ω 4.6 · 10 -14 s -1 is also found. A red-shifted outflow with velocity ∼+5.6 km/s, in the SE direction and perpendicular to the elongation of cloud 2 has been also found. The investigated cluster is associated with an IR point source IRAS 08573-4718, which has IR colours typical for a, non-evolved embedded (in the cloud) stellar object. The cluster is also connected with a water maser. The SIMBA image shoves the existence of a central bright condensation, coinciding with the cluster itself, and two extensions. One of these extensions (the one with SW-NE direction) coincides, both in place and shape, with cloud 2, so that it is not excluded the possibility that this extension might be also rotating like cloud 2. In the vicinity of these extensions there are condensations resembling HH objects

Circumstellar envelopes seen in radio (OH masers) and in the infrared observations (IRAS)

International Nuclear Information System (INIS)

David, Pedro-Correia-de-Matos

1992-01-01

Intermediate mass stars, namely from one to nine solar masses, eject mass into the surrounding interstellar medium at high rates (up to 1/10000 solar masses per year) in their late stages of evolution on the so called asymptotic giant branch (AGB). Indeed, the presence of a circumstellar envelope (CSE) composed of dust and gas is one of the principal features of the objects on the AGB. Because of the high opacity at visible wavelength of the CSE, most of these objects can only be observed at infrared and radio frequencies. This study was undertaken using infrared and radio data from a large sample of CSE sources. The infrared data was obtained from the infrared astronomical satellite (IRAS) data base. For a selection of IRAS objects, radio observations were made of the OH maser at 1612 and 1667 MHz at the Nancay radio telescope, France. This work consists in two parts, one is theoretical in nature, the other observational. The theoretical part is concerned with the modeling of IRAS low resolution spectra (LRS catalog) and IRAS photometry through the use of a radiative transfer code. Confrontation between models and data has yielded such results as a better definition of the grain optical properties and the behavior of the CSE as it evolves. A model of a shock wave (a possible lifting engine of the CSE) propagating in the atmosphere of Mira stars (AGB) is described. On the observational side, a large number of objects has been surveyed for the presence of OH masers at 1612 and 1667 MHz. A statistical analysis has established more clearly the evolutionary status of CSE and the OH maser characteristics. A compiling of detection rates for the occurrence of masers, average location of these masing CSEs in the Galaxy, and OH maser characteristics is reported for use in future work. (author) [fr

CSO BOLOCAM 1.1 mm CONTINUUM MAPPING OF THE BRAID NEBULA STAR FORMATION REGION IN CYGNUS OB7

International Nuclear Information System (INIS)

Aspin, Colin; Beck, Tracy L.; Davis, Chris J.

2011-01-01

We present a 1.1 mm map of the Braid Nebula star formation region in Cygnus OB7 taken using Bolocam on the Caltech Submillimeter Observatory. Within the 1 deg 2 covered by the map, we have detected 55 cold dust clumps all of which are new detections. A number of these clumps are coincident with IRAS point sources although the majority are not. Some of the previously studied optical/near-IR sources are detected at 1.1 mm. We estimate total dust/gas masses for the 55 clumps together with peak visual extinctions. We conclude that over the whole region, approximately 20% of the clumps are associated with IRAS sources suggesting that these are protostellar objects. The remaining 80% are classed as starless clumps. In addition, both FU Orionis (FUor) like objects in the field, the Braid Star and HH 381 IRS, are associated with strong millimeter emission. This implies that FUor eruptions can occur at very early stages of pre-main-sequence life. Finally, we determine that the cumulative clump mass function for the region is very similar to that found in both the Perseus and ρ Ophiuchus star-forming regions.

Relación entre locus de control, ira y rendimiento deportivo en jugadores de tenis de mesa

Directory of Open Access Journals (Sweden)

Higinio González-García

2017-01-01

Full Text Available Los objetivos de este estudio fueron comprobar la relación entre el locus de control y el rendimiento de- portivo, y conocer la relación entre el locus de control y las variables de ira. La muestra de la investigación se compuso de 58 jugadores federados de tenis de mesa de toda la geografía española. Los participantes completa- ron un cuestionario sociodemográfico ad hoc , la Escala de Locus de Control (ELC y el Inventario de Expresión de la Ira Estado-Rasgo (STAXI-2. Los resultados revela- ron que no había diferencias de medias en los niveles de locus de control externo en función de la división de juego y del tipo de práctica deportiva (profesionales vs amateurs. Por otro lado, se confirmó la relación entre el locus de control externo y la expresión externa de la ira, encontrándose diferencias estadísticamente signifi- cativas entre la expresión externa de la ira y los grupos de locus de control externo alto y bajo. Finalmente, se concluyó que el nivel de rendimiento deportivo no in- terfería en los niveles de locus de control y, por otro lado, se confirma la relación del locus de control exter- no en la expresión externa de la ira de los jugadores de tenis de mesa. Por lo tanto, el locus de control interno se muestra como una variable protectora importante para intervenir con jugadores y entrenadores.

IRAS surface brightness maps of reflection nebulae in the Pleiades

Science.gov (United States)

Castelaz, Michael W.; Werner, M. W.; Sellgren, K.

1987-01-01

Surface brightness maps at 12, 25, 60, and 100 microns were made of a 2.5 deg x 2.5 deg area of the reflection nebulae in the Pleiades by coadding IRAS scans of this region. Emission is seen surrounding 17 Tau, 20 Tau, 23 Tau, and 25 Tau in all four bands, coextensive with the visible reflection nebulosity, and extending as far as 30 arcminutes from the illuminating stars. The infrared energy distributions of the nebulae peak in the 100 micron band, but up to 40 percent of the total infrared power lies in the 12 and 25 micron bands. The brightness of the 12 and 25 micron emission and the absence of temperature gradients at these wavelengths are inconsistent with the predictions of equilibrium thermal emission models. The emission at these wavelengths appears to be the result of micron nonequilibrium emission from very small grains, or from molecules consisting of 10-100 carbon atoms, which have been excited by ultraviolet radiation from the illuminating stars.

Chemistry of Carbon Rich Star IRAS 15194–5115 A. Ali

Indian Academy of Sciences (India)

We have constructed two gas-phase models to study the chem- ... 1. Introduction. IRAS 15194–5115 is the third brightest carbon star at 12 µm and the brightest one ..... The main formation routes of CN, HCN and HNC in the inner part are.

Percolation Analysis of a Wiener Reconstruction of the IRAS 1.2 Jy Redshift Catalog

Science.gov (United States)

Yess, Capp; Shandarin, Sergei F.; Fisher, Karl B.

1997-01-01

We present percolation analyses of Wiener reconstructions of the IRAS 1.2 Jy redshift survey. There are 10 reconstructions of galaxy density fields in real space spanning the range β = 0.1-1.0, where β = Ω0.6/b, Ω is the present dimensionless density, and b is the bias factor. Our method uses the growth of the largest cluster statistic to characterize the topology of a density field, where Gaussian randomized versions of the reconstructions are used as standards for analysis. For the reconstruction volume of radius R ~ 100 h-1 Mpc, percolation analysis reveals a slight ``meatball'' topology for the real space, galaxy distribution of the IRAS survey.

Observations of 40-70 micron bands of ice in IRAS 09371 + 1212 and other stars

Science.gov (United States)

Omont, A.; Forveille, T.; Moseley, S. H.; Glaccum, W. J.; Harvey, P. M.; Likkel, L.; Loewenstein, R. F.; Lisse, C. M.

1990-01-01

IRAS 09371 + 1212 is still an absolutely unique object. This M giant star, with circumstellar CO and a spectacular bipolar nebula, displays unique IRAS FIR colors which had been attributed to strong emission in the 40-70-micron bands of ice, as subsequently supported by the observation of a strong 3.1-micron absorption band. The results of the KAO observations have confirmed its unusual nature: the far-infrared bands of ice are by far the strongest known. Its dust temperature, 50 K or less, is by far the lowest known for a late-type circumstellar envelope.

Study of deuterated water in the low-mass protostar IRAS16293-2422

Science.gov (United States)

Coutens, A.; Vastel, C.; Caux, E.; Ceccarelli, C.; Herschel Chess Team

2011-05-01

Observations of deuterated water are an important complement for studies of H2O, since they give strong constraints on the formation processes: grain surfaces versus gas-phase chemistry through energetic process as shocks. The CHESS (Chemical HErschel Surveys of Star forming regions) Key Program has allowed to detect a lot of transitions of HDO (8) and H2O (16) as well as its isotopes H_218O and H_217O towards the low-mass protostar IRAS16293-2422 thanks to the unbiaised spectral survey carried out with the HIFI instrument on board the Herschel Space Observatory. Complementary data of HDO from the ground-based telescopes IRAM and JCMT are also available, allowing a precise determination of the abundance of deuterated water through the protostar envelope. In order to reproduce the observed line profiles, we have performed a modeling of HDO from the hot corino through the envelope using the physical structure of the protostar (Crimier et al. 2010) and the spherical Monte Carlo radiative transfer code RATRAN, which takes also into account radiative pumping by continuum emission from dust. We have used new HDO collision rates with H_2, recently computed by Wiesenfeld, Scribano and Faure (2011, PCCP). The same method has been applied to model H_2O and its isotopes H_218O and H_217O. We will present the results of this analysis and discuss the determined abundances.

SPECTROSCOPIC VARIABILITY OF IRAS 22272+5435

International Nuclear Information System (INIS)

Začs, Laimons; Grankina, Aija; Musaev, Faig; Kaminsky, Bogdan; Pavlenko, Yakiv; Sperauskas, Julius; Hrivnak, Bruce J.

2016-01-01

A time series of high-resolution spectra was observed in the optical wavelength region for the bright proto-planetary nebula IRAS 22272+5435 (HD 235858), along with a simultaneous monitoring of its radial velocity and BV R C magnitudes. The object is known to vary in light, color, and velocity owing to pulsation with a period of 132 days. The light and color variations are accompanied by significant changes in spectral features, most of which are identified as lines of carbon-bearing molecules. According to the observations, the C 2 Swan system and CN Red system lines are stronger near the light minimum. A photospheric spectrum of the central star was calculated using new self-consistent atmospheric models. The observed intensity variations in the C 2 Swan system and CN Red system lines were found to be much larger than expected if due solely to the temperature variation in the atmosphere of the pulsating star. In addition, the molecular lines are blueshifted relative to the photospheric velocity. The site of formation of the strong molecular features appears to be a cool outflow triggered by the pulsation. The variability in atomic lines seems to be mostly due variations of the effective temperature during the pulsation cycle. The profiles of strong atomic lines are split, and some of them are variable in a timescale of a week or so, probably because of shock waves in the outer atmosphere

Brief description of the programmes of the Institut fuer Reaktordynamik und Anlagensicherheit (IRA)

International Nuclear Information System (INIS)

1977-01-01

All programmes used by the IRA are presented, giving name and abbreviation, field of application, purpose and solution method, requirements made on the computer, necessary auxiliary programmes, and machine time for typical examples. (RW) [de

IRAS observations of starburst galaxies

International Nuclear Information System (INIS)

Sekiguchi, K.

1987-01-01

Far infrared properties of Starburst galaxies were analyzed using IRAS observations at 25, 60, and 100 micrometers. Seventy-nine of 102 Starburst galaxies from the list of Balzano were detected. These galaxies have high IR luminosities of up to a few 10 to the 12th power L sub 0 and concentrate in a small area of the IR color - color diagram. The IR power law spectral indices, alpha, lie within the ranges -2.5 < alpha(60,25)< -1.5 and -1.5 < alpha(100,60)< 0. These observed indices can be interpreted in terms of a cold disk component and a warm component. More than 80% of the 60 micrometer emission comes from the warm component. The fraction of the 60 micrometer emission attributable to the warm component can be used as an activity indicator

Infrared galaxies in the IRAS minisurvey

Science.gov (United States)

Soifer, B. T.; Neugebauer, G.; Rowan-Robinson, M.; Clegg, P. E.; Emerson, J. P.; Houck, J. R.; De Jong, T.; Aumann, H. H.; Beichman, C. A.; Boggess, N.

1984-01-01

A total of 86 galaxies have been detected at 60 microns in the high galactic latitude portion of the IRAS minisurvey. The surface density of detected galaxies with flux densities greater than 0.5 Jy is 0.25 sq deg. Virtually all the galaxies detected are spiral galaxies and have an infrared to blue luminosity ratio ranging from 50 to 0.5. For the infrared-selected sample, no obvious correlation exists between infrared excess and color temperature. The infrared flux from 10 to 100 microns contributes approximately 5 percent of the blue luminosity for galaxies in the magnitude range 14 less than m(pg) less than 18 mag. The fraction of interacting galaxies is between one-eighth and one-fourth of the sample.

The ALMA-PILS survey: the sulphur connection between protostars and comets: IRAS 16293-2422 B and 67P/Churyumov-Gerasimenko

Science.gov (United States)

Drozdovskaya, Maria N.; van Dishoeck, Ewine F.; Jørgensen, Jes K.; Calmonte, Ursina; van der Wiel, Matthijs H. D.; Coutens, Audrey; Calcutt, Hannah; Müller, Holger S. P.; Bjerkeli, Per; Persson, Magnus V.; Wampfler, Susanne F.; Altwegg, Kathrin

2018-06-01

The evolutionary past of our Solar system can be pieced together by comparing analogous low-mass protostars with remnants of our Protosolar Nebula - comets. Sulphur-bearing molecules may be unique tracers of the joint evolution of the volatile and refractory components. ALMA Band 7 data from the large unbiased Protostellar Interferometric Line Survey are used to search for S-bearing molecules in the outer disc-like structure, ˜60 au from IRAS 16293-2422 B, and are compared with data on 67P/Churyumov-Gerasimenko (67P/C-G) stemming from the ROSINA (Rosetta Orbiter Spectrometer for Ion and Neutral Analysis) instrument aboard Rosetta. Species such as SO2, SO, OCS, CS, H2CS, H2S, and CH3SH are detected via at least one of their isotopologues towards IRAS 16293-2422 B. The search reveals a first-time detection of OC33S towards this source and a tentative first-time detection of C36S towards a low-mass protostar. The data show that IRAS 16293-2422 B contains much more OCS than H2S in comparison to 67P/C-G; meanwhile, the SO/SO2 ratio is in close agreement between the two targets. IRAS 16293-2422 B has a CH3SH/H2CS ratio in range of that of our Solar system (differences by a factor of 0.7-5.3). It is suggested that the levels of UV radiation during the initial collapse of the systems may have varied and have potentially been higher for IRAS 16293-2422 B due to its binary nature; thereby, converting more H2S into OCS. It remains to be conclusively tested if this also promotes the formation of S-bearing complex organics. Elevated UV levels of IRAS 16293-2422 B and a warmer birth cloud of our Solar system may jointly explain the variations between the two low-mass systems.

Descoberta de um aglomerado estelar massivo associado a fonte IRAS 16177-5018

Science.gov (United States)

Roman Lopes, A.; Abraham, Z.; Lépine, J. R. D.

2003-08-01

Neste trabalho apresentamos a descoberta de um aglomerado de estrelas jovens e massivas embebido em uma região HII extensa associado com a fonte IRAS 16177-5018, que se apresenta invisível na faixa óptica do espectro eletromagnético, onde a extinção é da ordem de AV = 26 magnitudes. As observações foram feitas com a camera infravermelha (CamIV) do Laboratório Nacional de Astrofísica, Brasil, equipada com um detector Hawaii de HgCdTe de 1024´1024 pixel acoplada ao telescópio de 60 cm Boller & Chivens do IAG. A fotometria obtida a partir das imagens nas bandas J, H e K (filtro estreito) mostrou a presença de fontes com excesso de emissão no infravermelho em 2.2 mm, concentradas em uma área de aproximadamente um minuto de arco quadrado em torno da nebulosa na qual esta embebido o objeto identificado como a fonte IRAS. A fonte IRAS apresenta um índice espectral (entre 2.2 21.3 mm) a = d log(l Fl) / d log l = 4.78, característico de um objeto extremamente jovem com luminosidade bolométrica (obtida da integral da densidade de fluxo entre o infravermelho próximo (1.25mm) e o infravermelho distante (100mm)) de 2.8´105L¤, o qual corresponde a uma estrela da sequência principal de idade zero de cerca de 42 M¤. A partir do diagrama cor-magnitude foi possível classificar a maioria dos membros do aglomerado como estrelas massivas mais luminosas que tipo espectral B5.

Ira as a pioneer in audiology: His contributions to the clinical measurement of hearing and hearing impairment

Science.gov (United States)

Formby, C.; Gagne, J. P.

2002-05-01

Ira Hirsh's contributions to clinical science and research are diverse and significant. In fact, approximately one-third of the 100+ publications that Ira lists in his curriculum vitae (CV) are clinical in nature, dealing with various aspects of audiology, deafness, hearing aids, aural rehabilitation, and speech and language pathology. The majority of these citations, fully one-quarter of his publication list, addresses problems specific to the clinical measurement of hearing and hearing impairment. Undoubtedly, the most influential of these published works appears in his CV under the citation ``The Measurement of Hearing.'' The forward for this publication, his only textbook, was penned in June, 1952 (now precisely half a century past at the time of this session). The aims of this presentation are to (1) provide perspective on the fundamental importance of his virtually timeless text in shaping the fledgling discipline of audiology, and (2) celebrate Ira's many contributions to the profession and practice of audiology. [Preparation for this presentation was supported, in part, by a K24 career development award from NIDCD.

Areas and forms of regional cooperation in multi-structured (matreshka-style) regions (Tyumen region, Russia)

OpenAIRE

LARIONOV ANDREY V.

2015-01-01

The problem of the administrative, economic and social sustainability of a group consisting of neighboring regions with close ties has no clear solution yet. Should closely-tied regions in the long run form a centralized system of administrative bodies, compress their budgets into one, and construct unified social programs, or not? To answer this question, in the article we describe a case that represents the paramount form of cooperation amongst closely-tied regions. It is the case of the so...

26 CFR 1.408(q)-1 - Deemed IRAs in qualified employer plans.

Science.gov (United States)

2010-04-01

... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.408(q)-1... restrictions that a trustee, custodian, or insurance company is permitted to impose on distributions from... accounts of any of the deemed IRAs is invested in life insurance contracts, regardless of whether the...

Gemini Spectroscopic Survey of Young Intermediate-Mass Star-Forming Regions

Science.gov (United States)

Lundquist, Michael; Kobulnicky, Henry

2018-01-01

The majority of stars form in embedded clusters. Current research into star formation has focused on either high-mass star-forming regions or low-mass star-forming regions. We present the results from a Gemini spectroscopic survey of young intermediate-mass star-forming regions. These are star forming regions selected to produce stars up to but not exceeding 8 solar masses. We obtained spectra of these regions with GNIRS on Gemini North and Flamingos-2 on Gemini South. We also combine this with near-infrared imaging from 2MASS, UKIDSS, and VVV to study the stellar content.

EL CADÁVER DE LA IRA COMO EFECTO MARIPOSA: LA REALIZACIÓN DE UN RELATO DE FICCIÓN

OpenAIRE

VALERO MARCO, DANIEL

2016-01-01

[ES] El presente proyecto trata sobre la realización de un cortometraje de ficción con el tema de la ira y el efecto mariposa. En primer lugar se realiza un proceso de documentación teórica en el que se estudia el comportamiento de la ira y se relaciona con el efecto mariposa de la teoría del caos. Tras esto, se plantea la creación de un cortometraje de ficción que refleje las principales conclusiones de la investigación realizada. ...

ANOMALOUSLY STEEP REDDENING LAW IN QUASARS: AN EXCEPTIONAL EXAMPLE OBSERVED IN IRAS 14026+4341

International Nuclear Information System (INIS)

Jiang Peng; Zhou Hongyan; Ji Tuo; Shu Xinwen; Liu Wenjuan; Dong Xiaobo; Wang Huiyuan; Wang Tinggui; Wang Jianguo; Bai Jinming

2013-01-01

A fraction of the heavily reddened quasars require a reddening curve that is even steeper than that of the Small Magellanic Cloud. In this paper, we thoroughly characterize the anomalously steep reddening law in quasars via an exceptional example observed in IRAS 14026+4341. By comparing the observed spectrum to the quasar composite spectrum, we derive a reddening curve in the rest-frame wavelength range of 1200-10000 Å. It has a steep rise at wavelengths shorter than 3000 Å, but no significant reddening at longer wavelengths. The absence of dust reddening in the optical continuum is confirmed by the normal broad-line Balmer decrement (the Hα/Hβ ratio) in IRAS 14026+4341. The anomalous reddening curve can be satisfactorily reproduced with a dust model containing silicate grains in a power-law size distribution, dn(a)/da∝a –1.4 , truncated at a maximum size of a max = 70 nm. The unusual size distribution may be caused by the destruction of large 'stardust' grains by quasar activities or a different dust formation mechanism (i.e., the in situ formation of dust grains in quasar outflows). It is also possible that the analogies of the dust grains observed near the Galactic center are responsible for the steep reddening curve. In addition, we find that IRAS 14026+4341 is a weak emission-line quasar (i.e., PHL 1811 analogies) with heavy dust reddening and blueshifted broad absorption lines.

Warm absorber and truncated accretion disc in IRAS 05078+1626

Czech Academy of Sciences Publication Activity Database

Svoboda, Jiří; Guainazzi, M.; Karas, Vladimír

2010-01-01

Roč. 512, Mar-Apr (2010), A62/1-A62/8 ISSN 0004-6361 R&D Projects: GA ČR GD205/09/H033; GA ČR GA205/07/0052 Grant - others:ESA(XE) ESA- PECS project No. 98040; Univerzita Karlova(CZ) GAUK 33308 Institutional research plan: CEZ:AV0Z10030501 Keywords : galaxies: active * galaxies: Seyfert * galaxies: individual: IRAS 05078+1626 Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010

La ira en la primera tradición cidiana

Directory of Open Access Journals (Sweden)

Oscar Martín

2007-11-01

Full Text Available The expressions of the wrath in the Cantar de Mio Cid include a group of traditions of different nature, which constitute a point of departure for the proper interpretation of the text. On the one hand, the ira regia ('regal wrath' is related to the emotional medieval theory on wrath, and, on the other hand, the analysis of the political dimension of wrath in the Cantar and in the preceding Cidian tradition, contributes with new aspects on cultural practices and legal systems in the Middle Ages.

La ira de Dios: sobre ‘Relatos salvajes’ de Damián Szifrón

Directory of Open Access Journals (Sweden)

Gonzalo Aguilar

2017-12-01

Full Text Available “La ira de Dios (sobre ‘Relatos salvajes’ de Damián Szifrón” propone un debate sobre una de las películas argentinas más exitosas de todos los tiempos. En polémica con las lecturas que señalaban y cuestionaban el carácter prepolítico del film y su uso de las pasiones más bajas del público, este ensayo busca otro camino: por un lado, analizar la ira como uno de los capitales políticos más importantes y decisivos de la sociedad contemporánea. Por otro, investigar los vínculos entre la película Relatos salvajes y la pospolítica en la sociedad del espectáculo.

Infrared studies of H II regions: the Sharpless regions S148, 184, 198, 206 and 269

International Nuclear Information System (INIS)

Pismis, Paris

1991-01-01

We present the results of a combined near-infrared and IRAS mapping study of five H II regions for which fairly complete information at optical and radio wavelengths previously existed. The near-infrared observations, carried out with the 2.1-m telescope at Observatorio de San Pedro Martir (Mexico), allowed us to study the the stellar content at the core of each nebula, while an analysis of extended near-infrared emission zones showed these to arise mainly from ionized gas (S148 and S206) or through scattering and thermal emission from dust grains surrounding a massive young star (S269-IRS2). The analysis of IRAS data, on the other hand, suggests that two different populations of grains contribute to the observed 12- to 100-μm fluxes. (author)

Nucleus of Comet IRAS-Araki-Alcock (1983 VII)

International Nuclear Information System (INIS)

Sekanina, Z.

1988-01-01

Optical, radar, infrared, UV, and microwave-continuum observations of Comet IRAS-Araki-Alcok were obtained in May 1983, the week of the comet's close approach to earth. The comet has a nucleus dimension and a rotation period which are similar to those of Comet Halley, but a different morphological signature (a persisting sunward fan-shaped coma). Time variations are noted in the projected nucleus cross section. Results suggest significant limb-darkening effects in the relevant domains of radio waves, and that the comet's interior must be extremely cold. It is found that the thermal-infrared fluxes from the inner coma of the comet are dominated by the nucleus. 63 references

Detection of glycolaldehyde toward the solar-type protostar NGC 1333 IRAS2A

DEFF Research Database (Denmark)

Coutens, Audrey; Persson, M. V.; Jørgensen, J. K.

2015-01-01

Glycolaldehyde is a key molecule in the formation of biologically relevant molecules such as ribose. We report its detection with the Plateau de Bure interferometer toward the Class 0 young stellar object NGC 1333 IRAS2A, which is only the second solar-type protostar for which this prebiotic mole...

A young bipolar outflow from IRAS 15398-3359

Science.gov (United States)

Bjerkeli, P.; Jørgensen, J. K.; Brinch, C.

2016-03-01

Context. Changing physical conditions in the vicinity of protostars allow for a rich and interesting chemistry to occur. Heating and cooling of the gas allows molecules to be released from and frozen out on dust grains. These changes in physics, traced by chemistry as well as the kinematical information, allows us to distinguish between different scenarios describing the infall of matter and the launching of molecular outflows and jets. Aims: We aim to determine the spatial distribution of different species that are of different chemical origin. This is to examine the physical processes in play in the observed region. From the kinematical information of the emission lines we aim to determine the nature of the infalling and outflowing gas in the system. We also aim to determine the physical properties of the outflow. Methods: Maps from the Submillimeter Array (SMA) reveal the spatial distribution of the gaseous emission towards IRAS 15398-3359. The line radiative transfer code LIME is used to construct a full 3D model of the system taking all relevant components and scales into account. Results: CO, HCO+, and N2H+ are detected and shown to trace the motions of the outflow. For CO, the circumstellar envelope and the surrounding cloud also have a profound impact on the observed line profiles. N2H+ is detected in the outflow, but is suppressed towards the central region, perhaps because of the competing reaction between CO and H3+ in the densest regions as well as the destruction of N2H+ by CO. N2D+ is detected in a ridge south-west of the protostellar condensation and is not associated with the outflow. The morphology and kinematics of the CO emission suggests that the source is younger than ~1000 years. The mass, momentum, momentum rate, mechanical luminosity, kinetic energy, and mass-loss rate are also all estimated to be low. A full 3D radiative transfer model of the system can explain all the kinematical and morphological features in the system.

ON THE NATURE OF THE ENIGMATIC OBJECT IRAS 19312+1950: A RARE PHASE OF MASSIVE STAR FORMATION?

Energy Technology Data Exchange (ETDEWEB)

Cordiner, M. A.; Charnley, S. B.; Milam, S. N. [Astrochemistry Laboratory, NASA Goddard Space Flight Center, Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Boogert, A. C. A. [Universities Space Research Association, Stratospheric Observatory for Infrared Astronomy, NASA Ames Research Center, MS 232-11, Moffett Field, CA 94035 (United States); Justtanont, K.; Wirström, E. S. [Department of Earth and Space Sciences, Chalmers University of Technology, Onsala Space Observatory, SE-439 92, Onsala (Sweden); Cox, N. L. J. [Instituut voor Sterrenkunde, KU Leuven, Celestijnenlaan 200D, bus 2401, B-3001, Leuven (Belgium); Smith, R. G. [School of Physical, Environmental and Mathematical Sciences, The University of New South Wales, Australian Defence Force Academy, Canberra ACT 2600 (Australia); Tielens, A. G. G. M. [Leiden Observatory, University of Leiden, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Keane, J. V., E-mail: martin.cordiner@nasa.gov [Institute for Astronomy, University of Hawaii, Honolulu, HI 96822 (United States)

2016-09-01

IRAS 19312+1950 is a peculiar object that has eluded firm characterization since its discovery, with combined maser properties similar to an evolved star and a young stellar object (YSO). To help determine its true nature, we obtained infrared spectra of IRAS 19312+1950 in the range 5–550 μ m using the Herschel and Spitzer space observatories. The Herschel PACS maps exhibit a compact, slightly asymmetric continuum source at 170 μ m, indicative of a large, dusty circumstellar envelope. The far-IR CO emission line spectrum reveals two gas temperature components: ≈0.22 M {sub ⊙} of material at 280 ± 18 K, and ≈1.6 M {sub ⊙} of material at 157 ± 3 K. The O i 63 μ m line is detected on-source but no significant emission from atomic ions was found. The HIFI observations display shocked, high-velocity gas with outflow speeds up to 90 km s{sup −1} along the line of sight. From Spitzer spectroscopy, we identify ice absorption bands due to H{sub 2}O at 5.8 μ m and CO{sub 2} at 15 μ m. The spectral energy distribution is consistent with a massive, luminous (∼2 × 10{sup 4} L {sub ⊙}) central source surrounded by a dense, warm circumstellar disk and envelope of total mass ∼500–700 M {sub ⊙}, with large bipolar outflow cavities. The combination of distinctive far-IR spectral features suggest that IRAS 19312+1950 should be classified as an accreting, high-mass YSO rather than an evolved star. In light of this reclassification, IRAS 19312+1950 becomes only the fifth high-mass protostar known to exhibit SiO maser activity, and demonstrates that 18 cm OH maser line ratios may not be reliable observational discriminators between evolved stars and YSOs.

On the Nature of the Enigmatic Object IRAS 19312+1950: A Rare Phase of Massive Star Formation?

Science.gov (United States)

Cordiner, M. A.; Boogert, A. C. A.; Charnley, S. B.; Justtanont, K.; Cox, N. L. J.; Smith, R. G.; Tielens, A. G. G. M.; Wirstrom, E. S.; Milam, S. N.; Keane, J. V.

2016-01-01

IRAS?19312+1950 is a peculiar object that has eluded firm characterization since its discovery, with combined maser properties similar to an evolved star and a young stellar object (YSO). To help determine its true nature, we obtained infrared spectra of IRAS?19312+1950 in the range 5-550 microns using the Herschel and Spitzer space observatories. The Herschel PACS maps exhibit a compact, slightly asymmetric continuum source at 170 microns, indicative of a large, dusty circumstellar envelope. The far-IR CO emission line spectrum reveals two gas temperature components: approx. = 0.22 Stellar Mass of material at 280+/-18 K, and ˜1.6 Me of material at 157+/-3 K. The OI 63 micron line is detected on-source but no significant emission from atomic ions was found. The HIFI observations display shocked, high-velocity gas with outflow speeds up to 90 km/s along the line of sight. From Spitzer spectroscopy, we identify ice absorption bands due to H2O at 5.8 microns and CO2 at 15 microns. The spectral energy distribution is consistent with a massive, luminous (approx. 2 × 10(exp 4) Stellar Luminosity) central source surrounded by a dense, warm circumstellar disk and envelope of total mass approx. 500-700 Stellar Mass with large bipolar outflow cavities. The combination of distinctive far-IR spectral features suggest that IRAS19312+1950 should be classified as an accreting, high-mass YSO rather than an evolved star. In light of this reclassification, IRAS19312+1950 becomes only the fifth high-mass protostar known to exhibit SiO maser activity, and demonstrates that 18 cm OH maser line ratios may not be reliable observational discriminators between evolved stars and YSOs.

Symbiotic stars according to IRAS observations

International Nuclear Information System (INIS)

Luud, L.; Tuvikene, T.

1987-01-01

Symbiotic stars contained in Allen's catalog are examined with a view to establishing their coincidence with sources of far infrared radiation in the catalog of point sources observed with the IRAS satellite. Altogether, 72 symbiotic or suspected symbiotic objects have been identified. A list of the identified stars has been compiled, and the energy distributions in the infrared spectra of selected stars are given. It has been found that the presence of dust in symbiotic systems is a more widespread phenomenon than hitherto believed. Almost 40% of them are dust systems. Among them, objects with dust temperature of several tens of degrees kelvin have been found. It is shown that the only useful two-color diagram is the (K - m 12 )-(m 12 - m 25 ) diagram. Finally, attention is drawn to a type of symbiotic stars having cold components of the spectral class G; these require a special investigation

Niveles de ira en deportistas: diferencias en función del grado de contacto y el género. [Anger intensity in sportspeople: differences based on contact and gender].

Directory of Open Access Journals (Sweden)

José Ignacio Menéndez-Santurio

2017-10-01

Full Text Available Los objetivos de este estudio fueron tres: (1 analizar los niveles de ira de las personas en función del grado de contacto en el deporte practicado, (2 examinar los niveles de ira en función del género, y (3 determinar posibles correlaciones entre la ira y la edad, los años, los días y las horas semanales de práctica. 398 personas (188 hombres y 210 mujeres entre 16 y 35 años accedieron a participar: 148 competidores de deportes de contacto, 138 de deportes sin contacto y 112 no practicantes. Se llevó a cabo una investigación cuantitativa de tipo comparativa transversal. Se utilizó el Inventario de la Expresión de la Ira Estado-Rasgo. Los resultados mostraron diferencias significativas (p < 0,05 en el sentimiento de ira entre no practicantes y practicantes de deportes sin contacto, en la expresión verbal de la ira entre practicantes de deportes de contacto y sin contacto y en la reacción a la ira entre no-practicantes y practicantes de deportes de contacto. Asimismo, se hallaron diferencias significativas (p < 0,05 en las variables rasgo de ira, control interno de ira y expresión física de la ira en función del género. También se encontraron correlaciones negativas significativas (p < 0,05 entre la edad, días y años de práctica y la ira. Estos hallazgos señalan que los niveles de ira se ven afectados por la cantidad, intensidad y grado de contacto de su práctica deportiva, así como por el género. Abstract The aims of this study were three: (1 to assess individuals’ anger levels based on the contact in the sport, (2 to examine anger levels based on gender, and (3 to determine possible correlations between anger and age, years, days, and hours of practice. 398 individuals (188 males and 210 females between 16 and 35 years agreed to participate: 148 contact-sport competitors, 138 contactless sport and 112 individuals who did not practice any sport. A comparative, transversal quantitative research design was carried out

IRAS 14348-1447, an Ultraluminous Pair of Colliding, Gas-Rich Galaxies: The Birth of a Quasar?

Science.gov (United States)

Sanders, D B; Scoville, N Z; Soifer, B T

1988-02-05

Ground-based observations of the object IRAS 14348-1447, which was discovered with the Infrared Astronomical Satellite, show that it is an extremely luminous colliding galaxy system that emits more than 95 percent of its energy at far-infrared wavelengths. IRAS 14348-1447, which is receeding from the sun at 8 percent of the speed of light, has a bolometric luminosity more than 100 times larger than that of our galaxy, and is therefore as luminous as optical quasars. New optical, infrared, and spectroscopic measurements suggest that the dominant luminosity source is a dustenshrouded quasar. The fuel for the intense activity is an enormous supply of molecular gas. Carbon monoxide emission has been detected at a wavelength of 2.6 millimeters by means of a new, more sensitive receiver recently installed on the 12-meter telescope of the National Radio Astronomy Observatory. IRAS 14348-1447 is the most distant and luminous source of carbon monoxide line emission yet detected. The derived mass of interstellar molecular hydrogen is 6 x 10(10) solar masses. This value is approximately 20 times that of the molecular gas content of the Milky Way and is similar to the largest masses of atomic hydrogen found in galaxies. A large mass of molecular gas may be a prerequisite for the formation of quasars during strong galactic collisions.

Development and validation of a questionnaire (the IRA-AGHN to assess teachers' knowledge of Attention Deficit Hyperactivity Disorder

Directory of Open Access Journals (Sweden)

Marian Soroa

2014-10-01

Full Text Available The purpose of this study was to develop a questionnaire, called IRA-AGHN, to assess infant and primary school teachers' knowledge of Attention Deficit Hyperactivity Disorder. The psychometric properties of this questionnaire were examined in a sample of 752 teachers aged between 20 and 64 years (M = 41.57; SD = 9.69. These teachers were employed at 84 randomly selected schools in the Autonomous Community of the Basque Country and Navarre. The factor validity, internal consistency, temporal stability, convergent validity and external validity of the instrument were all analysed. The results suggest that the IRA-AGHN is a valid and reliable measure for assessing teachers' knowledge of ADHD.

The infrared emission bands. III. Southern IRAS sources.

Science.gov (United States)

Cohen, M; Tielens, A G; Bregman, J; Witteborn, F C; Rank, D M; Allamandola, L J; Wooden, D H; de Muizon, M

1989-06-01

We present airborne 5-8 micrometers spectra of southern IRAS sources which reveal strong polycyclic aromatic hydrocarbon (PAH) emission features. The good correlation between the bands, in particular the dominant 6.2 and "7.7" micrometers features, strongly imply a common carrier, reinforcing the PAH hypothesis. However, small but detectable spectral variations exist. Planetaries have a distinctly different ratio of I(6.2)/I(7.7) than other nebulae, accompanied by a redward shift in the actual wavelength of the "7.7" micrometers peak. Further, we have detected a new feature, previously predicted from laboratory spectra of PAH molecules, at 5.2 micrometers in many of these sources. Spectra of two rare [WC 10] planetary nebular nuclei indicate a very prominent plateau of emission, linking the 6.2 and 7.7 micrometers bands. Several of our sources show definite evidence for emission structure between 14 and 23 micrometers in their IRAS Low-Resolution Spectral Atlas spectra: we attribute this structure to PAH bands. too. We have defined the "generic" spectrum of emission bands relating the mean intensities of each band to that of the strongest, near 7.7 micrometers. We have added three more planetary or protoplanetary nebulae to our correlation between 7.7 micrometers band intensity and nebular gas phase C/O ratio, namely NGC 6302, HR 4049, and the highly carbon-rich [WC 10] nucleus, CPD--56 degrees 8032. For the latter we have determined a ratio for C/O of approximately 4.8 from IUE observations. The good correlation between the intensity ratio of the "7.7" micrometers feature relative to the far-infrared dust continuum and nebular C/O also supports a carbonaceous carrier for these emission features.

Dante, i diavoli e l'ira di Virgilio

Directory of Open Access Journals (Sweden)

Federico Saviotti

2014-07-01

Full Text Available Riassunto: Numerosi interventi critici hanno analizzato ad ogni livello la diablerie che Dante mette in scena in If. XXI-XXIII; tuttavia, la sua eccentricità formale e contenutistica rispetto al resto del poema sembra ancora imbarazzare gli esegeti. In questo articolo si cerca di giustificarne la coerenza nel quadro della poetica della comedìa dantesca, concentrandosi su alcuni aspetti di particolare interesse: tra questi, l’opportunità di una lettura carnevalesca – in senso bachtiniano – della diablerie e il senso del “riso” di cui questa è portatrice; la presenza di un rovesciamento intra-testuale definibile come “auto-parodico” rispetto alla scena di If. VIII-IX e apprezzabile a partire dalla rappresentazione dei diversi personaggi; la “sconfitta” due volte patita da Virgilio nei confronti dei diavoli e la definizione, in entrambi ed altri casi, della sua ira. Abstract: Many scholars have analyzed at any level the diablerie Dante puts on stage in If. XXI-XXIII; nevertheless, its formal and substantial eccentricity compared with the rest of the poem still seems to puzzle the commentators. In this paper I will try to demonstrate its coherence with the poetics of Dante’s comedìa, by focusing on some very interesting elements: the opportunity of a bachtinian interpretation of the diablerie as a carnival expression and the meaning of the “laughter” it conveys; the presence of an intra-textual reversal which may be defined as “auto-parodic” in respect to the scene in If. VIII-IX and appreciated through the poetic representation of the different characters; the “defeat” which Virgilio undergoes twice against the devils and the definition, in both and other cases, of its ira.  

Radar observations of Comet IRAS-Araki-Alcock 1983d

International Nuclear Information System (INIS)

Harmon, J.K.; Hine, A.A.; Campbell, D.B.; Shapiro, I.I.; Marsden, B.G.

1989-01-01

A detailed analysis and interpretation of the Arecibo S-band radar observations of Comet IRAS-Araki-Alcock 1983d are presented. The very high signal strengths are used to make an accurate determination of the shape of the echo spectrum in the two orthogonal senses of circular polarization. The narrow-band component is used to place constraints on the size, rotation, period, reflectivity, and roughness of the nucleus. Detailed analysis of the broadband component yields estimates of, or bounds on, the spatial extent, position, and mass of the particle cloud, as well as the effective size of the constituent particles. 41 references

Stray radiation and the Infrared Astronomical Satellite /IRAS/ telescope

Science.gov (United States)

Noll, R. J.; Harned, R.; Breault, R. P.; Malugin, R.

1981-01-01

Stray light control is a major consideration in the design of infrared cryogenically cooled telescopes such as the Infrared Astronomical Satellite (IRAS). The basic design of the baffle system, and the placement, shape, and coating of the secondary support struts for the telescope subsystem are described. The intent of this paper is to highlight the stray light problems encountered while designing the system, and to illustrate how computer analysis can be a useful design aid. Scattering measurements of the primary mirror, and a full system level scatter measurement are presented. Comparisons of predicted performance with the measured results are also presented.

Photoinactivation Using Visible Light Plus Water-Filtered Infrared-A (vis+wIRA and Chlorine e6 (Ce6 eradicates Planktonic Periodontal Pathogens and Subgingival Biofilms

Directory of Open Access Journals (Sweden)

Ali Al-Ahmad

2016-11-01

Full Text Available Alternative treatment methods for pathogens and microbial biofilms are required due to the widespread rise in antibiotic resistance. Antimicrobial photodynamic therapy (aPDT has recently gained attention as a novel method to eradicate pathogens. The aim of this study was to evaluate the antimicrobial effects of a novel aPDT method using visible light (vis and water infiltrated infrared A (wIRA in combination with chlorine e6 (Ce6 against different periodontal pathogens in planktonic form and within in situ subgingival oral biofilms. Eight different periodontal pathogens were exposed to aPDT using vis+wIRA and 100 µg/ml Ce6 in planktonic culture. Additionally, pooled subgingival dental biofilm was also treated by aPDT and the number of viable cells determined as colony forming units (CFU. Live/dead staining was used in combination with confocal laser scanning microscopy (CLSM to visualize and quantify antimicrobial effects within the biofilm samples. Untreated negative controls as well as 0.2 % chlorhexidine (CHX-treated positive controls were used. All eight tested periodontal pathogens including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Eikenella corrodens, Actinomyces odontolyticus, Fusobacterium nucleatum, Parvimonas micra, Slackia exigua and Atopopium rimae and the aPDT-treated subgingival biofilm were eliminated over the ranges of 3.43 - 8.34 and 3.91 - 4.28 log10 CFU in the log10 scale, respectively. Thus, aPDT showed bactericidal effects on the representative pathogens as well as on the in situ subgingival biofilm. The live/dead staining also revealed a significant reduction (33.45 % of active cells within the aPDT-treated subgingival biofilm. Taking the favorable tissue healing effects of vis+wIRA into consideration, the significant antimicrobial effects revealed in this study highlight the potential of aPDT using this light source in combination with Ce6 as an adjunctive method to treat periodontitis as well as

Near-infrared observations of IRAS minisurvey galaxies

International Nuclear Information System (INIS)

Carico, D.P.; Soifer, B.T.; Elias, J.H.; Matthews, K.; Neugebauer, G.; Beichman, C.; Persson, C.J.; Persson, S.E.

1987-01-01

Near infrared photometry at J, H, and K was obtained for 82 galaxies from the IRAS minisurvey. The near infrared colors of these galaxies cover a larger range in J-H and H-K than do normal field spiral galaxies, and evidence is presented of a tighter correlation between the near and far infrared emission in far infrared bright galaxies than exists between the far infrared and the visible emission. These results suggest the presence of dust in the far infrared bright galaxies, with hot dust emission contributing to the 2.2 micron emission, and extinction by dust affecting both the near infrared colors and the visible luminosities. In addition, there is some indication that the infrared emission in many of the minisurvey galaxies is coming from a strong nuclear component

The Infrared Astronomical Satellite (IRAS) mission

Science.gov (United States)

Neugebauer, G.; Habing, H. J.; Van Duinen, R.; Aumann, H. H.; Beichman, C. A.; Baud, B.; Beintema, D. A.; Boggess, N.; Clegg, P. E.; De Jong, T.

1984-01-01

The Infrared Astronomical Satellite (IRAS) consists of a spacecraft and a liquid helium cryostat that contains a cooled IR telescope. The telescope's focal plane assembly is cooled to less than 3 K, and contains 62 IR detectors in the survey array which are arranged so that every source crossing the field of view can be seen by at least two detectors in each of four wavelength bands. The satellite was launched into a 900 km-altitude near-polar orbit, and its cryogenic helium supply was exhausted on November 22, 1983. By mission's end, 72 percent of the sky had been observed with three or more hours-confirming scans, and 95 percent with two or more hours-confirming scans. About 2000 stars detected at 12 and 25 microns early in the mission, and identified in the SAO (1966) catalog, have a positional uncertainty ellipse whose axes are 45 x 9 arcsec for an hours-confirmed source.

Current Diagnosis and Management of Immune Related Adverse Events (irAEs Induced by Immune Checkpoint Inhibitor Therapy

Directory of Open Access Journals (Sweden)

Vivek Kumar

2017-02-01

Full Text Available The indications of immune checkpoint inhibitors (ICIs are set to rise further with the approval of newer agent like atezolimumab for use in patients with advanced stage urothelial carcinoma. More frequent use of ICIs has improved our understanding of their unique side effects, which are known as immune-related adverse events (irAEs. The spectrum of irAEs has expanded beyond more common manifestations such as dermatological, gastrointestinal and endocrine effects to rarer presentations involving nervous, hematopoietic and urinary systems. There are new safety data accumulating on ICIs in patients with previously diagnosed autoimmune conditions. It is challenging for clinicians to continuously update their working knowledge to diagnose and manage these events successfully. If diagnosed timely, the majority of events are completely reversible, and temporary immunosuppression with glucocorticoids, infliximab or other agents is warranted only in the most severe grade illnesses. The same principles of management will possibly apply as newer anti- cytotoxic T lymphocytes-associated antigen 4 (CTLA-4 and programmed cell death protein 1 (PD-1/PD-L1 antibodies are introduced. The current focus of research is for prophylaxis and for biomarkers to predict the onset of these toxicities. In this review we summarize the irAEs of ICIs and emphasize their growing spectrum and their management algorithms, to update oncology practitioners.

Adsorption of uranium(VI) from sulphate solutions using Amberlite IRA-402 resin: Equilibrium, kinetics and thermodynamics study

International Nuclear Information System (INIS)

Solgy, Mostafa; Taghizadeh, Majid; Ghoddocynejad, Davood

2015-01-01

Highlights: • Adsorption of uranium from sulphate solutions by an anion exchange resin. • The effects of pH, contact time and adsorbent dosage were investigated. • The adsorption equilibrium is well described by the Freundlich isotherm model. • The adsorption kinetics can be predicted by the pseudo second-order model. • The adsorption is a physical, spontaneous and endothermic process. - Abstract: In the present study, adsorption of uranium from sulphate solutions was evaluated using Amberlite IRA-402 resin. The variation of adsorption process was investigated in batch sorption mode. The parameters studied were pH, contact time and adsorbent dosage. Langmuir and Freundlich isotherm models were used in order to present a mathematical description of the equilibrium data at three different temperatures (25 °C, 35 °C and 45 °C). The final results confirmed that the equilibrium data tend to follow Freundlich isotherm model. The maximum adsorption capacity of Amberlite IRA-402 for uranium(VI) was evaluated to be 213 mg/g for the Langmuir model at 25 °C. The adsorption of uranium on the mentioned anion exchange resin was found to follow the pseudo-second order kinetic model, indicating that chemical adsorption was the rate limiting-step. The values of thermodynamic parameters proved that adsorption process of uranium onto Amberlite IRA-402 resin could be considered endothermic (ΔH > 0) and spontaneous (ΔG < 0)

Newly discovered IRAS QSO close to the Galactic plane

International Nuclear Information System (INIS)

Strauss, M.A.; Kirhakos, S.D.; Yahil, A.

1988-01-01

CCD observations of the IRAS QSO candidate I09149-6206 performed at CTIO during December 1987 are reported, including 564-806-nm spectroscopy obtained with the 1.5-m telescope and direct UVBRI imaging obtained with the 0.91-m telescope. The data are presented in tables and graphs and characterized in detail. It is found that the source is surrounded by a faint fuzz with low surface brightness and strong forbidden O III lines. Parameters determined include redshift z = 0.0571, Galactic latitude -9.2 deg, V magnitude 13.55, Galactic reddening E(B-V) = about 0.23, and absolute V magnitude about -24.87. 33 references

The Dense Molecular Gas and Nuclear Activity in the ULIRG IRAS 13120–5453

Energy Technology Data Exchange (ETDEWEB)

Privon, G. C.; Treister, E. [Instituto de Astrofśica, Facultad de Física, Pontificia Universidad Católica de Chile, Casilla 306, Santiago 22 (Chile); Aalto, S.; Falstad, N.; Muller, S.; Costagliola, F. [Department of Earth and Space Sciences, Chalmers University of Technology, Onsala Space Observatory, SE-439 94 Onsala (Sweden); González-Alfonso, E. [Universidad de Alcalá, Departamento de Física y Matemáticas, Campus Universitario, E-28871 Alcalá de Henares, Madrid (Spain); Sliwa, K. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Armus, L. [Spitzer Science Center, California Institute of Technology, MS 220-6, Pasadena, CA, 91125 (United States); Evans, A. S. [Department of Astronomy, University of Virginia, Charlottesville, VA 22903 (United States); Garcia-Burillo, S. [Observatorio de Madrid, OAN-IGN, Alfonso XII, 3, E-28014-Madrid (Spain); Izumi, T. [Institute of Astronomy, School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Sakamoto, K. [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, 10617, Taipei, Taiwan (China); Werf, P. van der [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Chu, J. K. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

2017-02-01

We present new Atacama Large Millimeter/submillimeter Array Band 7 (∼340 GHz) observations of the dense gas tracers HCN, HCO{sup +}, and CS in the local, single-nucleus, ultraluminous infrared galaxy IRAS 13120–5453. We find centrally enhanced HCN (4–3) emission, relative to HCO{sup +} (4–3), but do not find evidence for radiative pumping of HCN. Considering the size of the starburst (0.5 kpc) and the estimated supernovae rate of ∼1.2 yr{sup −1}, the high HCN/HCO{sup +} ratio can be explained by an enhanced HCN abundance as a result of mechanical heating by the supernovae, though the active galactic nucleus and winds may also contribute additional mechanical heating. The starburst size implies a high Σ{sub IR} of 4.7 × 10{sup 12} L {sub ⊙} kpc{sup −2}, slightly below predictions of radiation-pressure limited starbursts. The HCN line profile has low-level wings, which we tentatively interpret as evidence for outflowing dense molecular gas. However, the dense molecular outflow seen in the HCN line wings is unlikely to escape the Galaxy and is destined to return to the nucleus and fuel future star formation. We also present modeling of Herschel observations of the H{sub 2}O lines and find a nuclear dust temperature of ∼40 K. IRAS 13120–5453 has a lower dust temperature and Σ{sub IR} than is inferred for the systems termed “compact obscured nuclei (CONs)” (such as Arp 220 and Mrk 231). If IRAS 13120–5453 has undergone a CON phase, we are likely witnessing it at a time when the feedback has already inflated the nuclear ISM and diluted star formation in the starburst/active galactic nucleus core.

Manejo de las infecciones respiratorias agudas (IRA en una comunidad kaqchiquel de Guatemala

Directory of Open Access Journals (Sweden)

Sáenz de Tejada Sandra

1997-01-01

Full Text Available Las infecciones respiratorias agudas (IRA figuran entre las principales causas de morbilidad y mortalidad infantiles en América Latina. En Guatemala, la neumonía es la primera causa de muerte en niños pequeños y ocasiona aproximadamente una tercera parte de las consultas ambulatorias a servicios pediátricos. Una buena proporción de estas muertes se deben a un manejo deficiente, atribuible a la falta de reconocimiento de los primeros signos de neumonía, a la presencia de barreras que impiden una búsqueda inmediata de atención, a la consulta a proveedores inapropiados o a recomendaciones terapéuticas inadecuadas. El propósito de esta breve investigación cualitativa fue estudiar las percepciones y los comportamientos de los habitantes de San Juan Comalapa, comunidad kaqchiquel en el altiplano central de Guatemala, en lo que respecta a las IRA. Se entrevistó a 32 madres en su domicilio con el fin de determinar cómo clasificaban las IRA y qué signos y síntomas las hacían buscar atención inmediata. Los resultados revelaron que las madres sabían reconocer la presencia de respiración rápida, pero no de tiraje respiratorio (dos signos importantes de neumonía. Cuando buscaban atención, solían acudir a médicos u otros proveedores en centros de salud y ocasionalmente en consultorios privados, pero la búsqueda raras veces era oportuna debido a la poca accesibilidad de los servicios y a la subestimación de la gravedad de los síntomas. Esta conducta podría modificarse por medio de una intervención educativa. Al final se hacen recomendaciones orientadas a mejorar la comunicación verbal entre los proveedores de atención de salud y las madres.

Manejo de las infecciones respiratorias agudas (IRA en una comunidad kaqchiquel de Guatemala

Directory of Open Access Journals (Sweden)

Sandra Sáenz de Tejada

1997-04-01

Full Text Available Las infecciones respiratorias agudas (IRA figuran entre las principales causas de morbilidad y mortalidad infantiles en América Latina. En Guatemala, la neumonía es la primera causa de muerte en niños pequeños y ocasiona aproximadamente una tercera parte de las consultas ambulatorias a servicios pediátricos. Una buena proporción de estas muertes se deben a un manejo deficiente, atribuible a la falta de reconocimiento de los primeros signos de neumonía, a la presencia de barreras que impiden una búsqueda inmediata de atención, a la consulta a proveedores inapropiados o a recomendaciones terapéuticas inadecuadas. El propósito de esta breve investigación cualitativa fue estudiar las percepciones y los comportamientos de los habitantes de San Juan Comalapa, comunidad kaqchiquel en el altiplano central de Guatemala, en lo que respecta a las IRA. Se entrevistó a 32 madres en su domicilio con el fin de determinar cómo clasificaban las IRA y qué signos y síntomas las hacían buscar atención inmediata. Los resultados revelaron que las madres sabían reconocer la presencia de respiración rápida, pero no de tiraje respiratorio (dos signos importantes de neumonía. Cuando buscaban atención, solían acudir a médicos u otros proveedores en centros de salud y ocasionalmente en consultorios privados, pero la búsqueda raras veces era oportuna debido a la poca accesibilidad de los servicios y a la subestimación de la gravedad de los síntomas. Esta conducta podría modificarse por medio de una intervención educativa. Al final se hacen recomendaciones orientadas a mejorar la comunicación verbal entre los proveedores de atención de salud y las madres.

New Herbig-Haro objects in star-forming regions

Science.gov (United States)

Reipurth, BO; Graham, J. A.

1988-01-01

A list of 25 new Herbig-Haro objects, HH 58 to HH 82, in the Orion molecular clouds and in southern molecular cloud complexes has been compiled. CCD images in the S II 6717, 6731 forbidden lines are presented for the objects, together with a few spectra and some IR observations. The individual objects and, when identified, their energy sources are discussed. HH 65 is located in the red lobe of the bipolar outflow associated with the highly variable reflection nebula Re 50. HH 67 is a 22-arcsec long sinusoidal jet. HH 68/69 consists of a long, linear chain of four HH knots. HH 72 emerges from a 120-solar luminosity IRAS source embedded in a Bok globule. HH 79 is the first HH object discovered in the Ophiuchus clouds. HH 80/81 in Sagittarius are among the brightest HH objects known, have complex velocities, high excitation conditions and emerge from a 6000-solar luminosity young B-star. HH 82 is associated with the bright variable star S Coronae Australis.

Optical polarimetric and near-infrared photometric study of the RCW95 Galactic H II region

Science.gov (United States)

Vargas-González, J.; Roman-Lopes, A.; Santos, F. P.; Franco, G. A. P.; Santos, J. F. C.; Maia, F. F. S.; Sanmartim, D.

2018-02-01

We carried out an optical polarimetric study in the direction of the RCW 95 star-forming region in order to probe the sky-projected magnetic field structure by using the distribution of linear polarization segments which seem to be well aligned with the more extended cloud component. A mean polarization angle of θ = 49.8° ± 7.7°7 was derived. Through the spectral dependence analysis of polarization it was possible to obtain the total-to-selective extinction ratio (RV) by fitting the Serkowski function, resulting in a mean value of RV = 2.93 ± 0.47. The foreground polarization component was estimated and is in agreement with previous studies in this direction of the Galaxy. Further, near-infrared (NIR) images from Vista Variables in the Via Láctea (VVV) survey were collected to improve the study of the stellar population associated with the H II region. The Automated Stellar Cluster Analysis algorithm was employed to derive structural parameters for two clusters in the region, and a set of PAdova and TRieste Stellar Evolution Code (PARSEC) isochrones was superimposed on the decontaminated colour-magnitude diagrams to estimate an age of about 3 Myr for both clusters. Finally, from the NIR photometry study combined with spectra obtained with the Ohio State Infrared Imager and Spectrometer mounted at the Southern Astrophysics Research Telescope we derived the spectral classification of the main ionizing sources in the clusters associated with IRAS 15408-5356 and IRAS 15412-5359, both objects classified as O4V stars.

Spatial and kinematic structure of Monoceros star-forming region

Science.gov (United States)

Costado, M. T.; Alfaro, E. J.

2018-05-01

The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

Small Galactic H II regions. II. The molecular clouds and star formation

International Nuclear Information System (INIS)

Hunter, D.A.; Thronson, H.A. Jr.; Wilton, C.

1990-01-01

CO maps of molecular clouds associated with 11 small Galactic H II regions are presented and compared with IR images obtained by IRAS. The molecular masses of the clouds are computed and compared with the masses of the stellar content. The mapped clouds have masses of 1000-60,000 solar and are typical of the more numerous, smaller Galactic molecular clouds. All of the clouds have recently made massive OB stars, and many have complex spatial and kinematic structures. The coincidence of IRAS sources and CO peaks suggests that many of the clouds have sites of star formation other than the optically visible H II region. Star-formation efficiencies are uncertain, with values for the clouds ranging from 0.02 to 0.6 with an average value of 0.2. There is no trend of the upper stellar mass limit with Galactic radius and with molecular cloud mass. 53 refs

Respuesta emocional de ira y alteraciones del lenguaje en pacientes con esquizofrenia

OpenAIRE

Herrero Sebastián, Neus

2015-01-01

Los pacientes con esquizofrenia presentan alteraciones en el procesamiento emocional especialmente en la expresión, y en el reconocimiento de emociones. Sin embargo, se ha investigado poco cómo experimentan las emociones los pacientes con esquizofrenia y en concreto existe una literatura muy escasa sobre la respuesta cardiovascular, hormonal o de la activación asimétrica cerebral. Por otro lado, la ira es clave en la conducta agresiva, y en el caso de la esquizofrenia parece estar mediada por...

Ortho-to-para ratio of interstellar heavy water

NARCIS (Netherlands)

Vastel, C.; Ceccarelli, C.; Caux, E.; Coutens, A.; Cernicharo, J.; Bottinelli, S.; Demyk, K.; Faure, A.; Wiesenfeld, L.; Scribano, Y.; Bacmann, A.; Hily-Blant, P.; Maret, S.; Walters, A.; Bergin, E.A.; Blake, G.A.; Castets, A.; Crimier, N.; Dominik, C.; Encrenaz, P.; Gérin, M.; Hennebelle, P.; Kahane, C.; Klotz, A.; Melnick, G.; Pagani, L.; Parise, B.; Schilke, P.; Wakelam, V.; Baudry, A.; Bell, T.; Benedettini, M.; Boogert, A.; Cabrit, S.; Caselli, P.; Codella, C.; Comito, C.; Falgarone, E.; Fuente, A.; Goldsmith, P.F.; Helmich, F.; Henning, T.; Herbst, E.; Jacq, T.; Kama, M.; Langer, W.; Lefloch, B.; Lis, D.; Lord, S.; Lorenzani, A.; Neufeld, D.; Nisini, B.; Pacheco, S.; Pearson, J.; Phillips, T.; Salez, M.; Saraceno, P.; Schuster, K.; Tielens, X.; van der Tak, F.; van der Wiel, M.H.D.; Viti, S.; Wyrowski, F.; Yorke, H.; Cais, P.; Krieg, J.M.; Olberg, M.; Ravera, L.

2010-01-01

Context. Despite the low elemental deuterium abundance in the Galaxy, enhanced molecular D/H ratios have been found in the environments of low-mass star-forming regions, and in particular the Class 0 protostar IRAS 16293-2422. Aims. The CHESS (Chemical HErschel Surveys of Star forming regions) key

8- to 13-micron spectrophotometry of Comet IRAS-Araki-Alcock

Science.gov (United States)

Feierberg, M. A.; Witteborn, F. C.; Johnson, J. R.; Campins, H.

1984-01-01

Spectrophotometry between 8.0 and 13.0 microns at 2 percent spectral resolution is presented for areas in and near the nuclear condensation of Comet IRAS-Araki-Alcock (1983d) on May 11 and 12, 1983. All the spectra can be fit very well by blackbody curves, and no 10-micron silicate emissions are seen. The temperature structure of the coma suggests the presence of small (radii less than 5 microns) dust particles within 150 km of the nucleus and larger ones further out. The change in the spatial distribution of the infrared flux between the two nights suggests that an outburst may have occurred sometime on May 11.

Luminosity function of the brightest galaxies in the IRAS survey

International Nuclear Information System (INIS)

Soifer, B.T.; Sanders, D.B.; Madore, B.F.; Neugebauer, G.; Persson, C.J.; Persson, S.E.; Rice, W.L.

1987-01-01

Results from a study of the far infrared properties of the brightest galaxies in the IRAS survey are described. There is a correlation between the infrared luminosity and the infrared to optical luminosity ratio and between the infrared luminosity and the far infrared color temperature in these galaxies. The infrared bright galaxies represent a significant component of extragalactic objects in the local universe, being comparable in space density to the Seyferts, optically identified starburst galaxies, and more numerous than quasars at the same bolometric luminosity. The far infrared luminosity in the local universe is approximately 25% of the starlight output in the same volume

CO and IRAS detection of an intermediate-velocity cloud

International Nuclear Information System (INIS)

Desert, F.X.; Bazell, D.; Blitz, L.

1990-01-01

In the course of a radio survey of high-Galactic-latitude clouds, CO emission was detected at the position l = 210.8 deg and b = 63.1 deg with an LSR velocity of -39 km/sec. This molecular cloud constitutes the third one with an unusually large absolute velocity at these latitudes, as compared with the 5.4-km/sec cloud-to-cloud velocity dispersion of the high-latitude molecular clouds. The position is coincident with an H I intermediate-velocity cloud (GHL 11, Verschuur H, OLM 268) and the IR-excess cloud 306 in the list by Desert et al. (1988). This cloud is clearly detected at all four IRAS wavelengths and has warmer colors than the local ISM. 27 refs

Forming the development program of industrial cooperation in the region

Directory of Open Access Journals (Sweden)

Aleksandr Viktorovich Makarov

2011-09-01

Full Text Available The paper defines the role of industrial cooperation in the process of ensuring the competitiveness of the Russian economy. Economic nature of this form of long-term cooperation specified subjects and objects of cooperatives, the effects of its introduction is disclosed. Formed concept of the Programme of development of industrial cooperation in the region, taking into account the state gained in building industrial complex and the differentiation of state support measures at various stages of development cooperation. Forecast parameters on implementation of cooperation development in Sverdlovsk region for the period up to 2020 are formed. According to the reported characteristics and conducted author's calculations, based on realistic projections of engineering enterprises of Sverdlovsk region, a four-indicator sectorgram for the performance evaluation of the program for the development of industrial and technological cooperation in the field of engineering is presented. The described approach to the establishment of a development program for the industrial cooperation in the region can monitor the situation, timely adjust regional performance standards and policies in this field

Multimolecular studies of Galactic star-forming regions

NARCIS (Netherlands)

Baan, W. A.; Loenen, A. F.; Spaans, M.

2014-01-01

Molecular emission-line observations of isolated Galactic star-forming regions are used to model the physical properties of the molecular interstellar medium in these systems. Observed line ratios are compared with the results predicted by models that incorporate gas-phase chemistry and the heating

IRAS observations of the exciting stars of Herbig-Haro objects. II. The Reipurth and Graham sample and low-resolution spectra

International Nuclear Information System (INIS)

Cohen, M.

1990-01-01

Using IRAS COADDed images, candidates are suggested for the exciting stars of Herbig-Haro objects from the Reipurth and Graham sample. The IRAS low-resolution spectrometer provides spectra for 20 of the 46 candidate stars so far identified as exciting young, unevolved H-H systems. These reveal 10-micron silicate absorption features, or are too red to show detectable flux near 10 microns. The histogram of bolometric luminosities for 46 young Herbig-Haro exciting stars has a median of 13 solar luminosities and a mode between 16 and 32 solar luminosities. Although the enlarged sample of known exciting stars has more of the higher luminosity objects than an earlier sample, the histogram still represents a generally low-luminosity distribution. 27 refs

Observações espectroscópicas da candidata a pós-AGB IRAS 19386+0155

Science.gov (United States)

Lorenz-Martins, S.; Pereira, C. B.

2003-08-01

Nesse trabalho apresentamos a análise fotosférica da estrela candidata a pós-AGB IRAS 19386+0155. Com os dados obtidos no espectrógrafo FEROS foram determinados os parâmetros atmosféricos e abundâncias fotosféricas utilizando o código MOOG. A análise do espectro mostrou que IRAS 19386+0155 possui os seguintes parâmetros atmosféricos : Teff = 6800K, log g = 1.4, [M/H] = -1.5 e Vt = 8.4 km/s. O padrão de abundância obtido para os elementos mais leves (Carbono, Nitrogênio e Oxigênio) e elementos a (Magnésio, Silício e Cálcio) foi inferior ao solar (log C = 7.74, log N = 7.28, Log O = 8.43, log Mg = 7.14, log Si = 7.54 e log Ca = 5.91). Uma inspeção visual do espectro ISO deste objeto revela a presença de poeira fria na forma de silicatos cristalinos. Embora as bandas mais marcantes de silicatos amorfos (em 10 mm e 18mm) não sejam observadas, a emissão em 21 mm, presente em algumas pós-AGBs também não está presente. O espectro ISO parece revelar um meio rico em oxigênio, mas a forma da distribuição de energia no infravermelho não obedece ao padrão apresentado por outras pós-AGBs. Nossos resultados nos levam a sugerir que IRAS 19386+0155 talvez faça parte de um sistema binário, uma vez que outras pós-AGBs que são membros de sistemas binários apresentam padrão de abundância semelhante.

A Biomarker to Differentiate between Primary and Cocaine-Induced Major Depression in Cocaine Use Disorder: The Role of Platelet IRAS/Nischarin (I1-Imidazoline Receptor

Directory of Open Access Journals (Sweden)

Benjamin Keller

2017-12-01

Full Text Available The association of cocaine use disorder (CUD and comorbid major depressive disorder (MDD; CUD/MDD is characterized by high prevalence and poor treatment outcomes. CUD/MDD may be primary (primary MDD or cocaine-induced (CUD-induced MDD. Specific biomarkers are needed to improve diagnoses and therapeutic approaches in this dual pathology. Platelet biomarkers [5-HT2A receptor and imidazoline receptor antisera selected (IRAS/nischarin] were assessed by Western blot in subjects with CUD and primary MDD (n = 16 or CUD-induced MDD (n = 9; antidepressant free, AD−; antidepressant treated, AD+ and controls (n = 10 at basal level and/or after acute tryptophan depletion (ATD. Basal platelet 5-HT2A receptor (monomer was reduced in comorbid CUD/MDD subjects (all patients: 43% compared to healthy controls, and this down-regulation was independent of AD medication (decreases in AD−: 47%, and in AD+: 40%. No basal differences were found for IRAS/nischarin contents in AD+ and AD− comorbid CUD/MDD subjects. The comparison of IRAS/nischarin in the different subject groups during/after ATD showed opposite modulations (i.e., increases and decreases in response to low plasma tryptophan levels with significant differences discriminating between the subgroups of CUD with primary MDD and CUD-induced MDD. These specific alterations suggested that platelet IRAS/nischarin might be useful as a biomarker to discriminate between primary and CUD-induced MDD in this dual pathology.

Orion star-forming region - far-infrared and radio molecular observations

International Nuclear Information System (INIS)

Thronson, H.A. Jr.; Harper, D.A.; Bally, J.; Dragovan, M.; Mozurkewich, D.; Yerkes Observatory, Williams Bay, WI; ATandT Bell Labs., Holmdel, NJ; Chicago Uni., IL; E. O. Hulburt Center for Space Research, Washington, DC)

1986-01-01

New J = 1-0 CO and far-infrared maps of the Orion star-forming region are presented and discussed. The total infrared luminosity of the Orion star-forming ridge is 250,000 solar luminosities. The material that is emitting strongly at 60 microns is traced and found to be highly centrally concentrated. However, the majority of the extended emission from this region comes from dust that is ultimately heated by the visible Trapezium cluster stars. The luminosity of IRc 2, the most luminous member of the infrared cluster, is estimated to be 40,000-50,000 solar luminosities. A schematic drawing of the Ori MC 1 region is presented. 30 references

Influencia de las Emociones Negativas (Ansiedad, Depresión e Ira sobre la Eficacia de un Programa de Tratamiento Cognitivo Conductual de Deshabituación al Tabaco

Directory of Open Access Journals (Sweden)

Francisco Javier Pérez-Pareja

2010-01-01

Full Text Available El objetivo de esta investigación es analizar la influencia de la ansiedad, la ira y la depresión, como emociones negativas, sobre el éxito en la aplicación de un tratamiento psicológico de carácter cognitivo-conductual para dejar de fumar. Estas tres respuestas emocionales fueron evaluadas en una muestra final de 180 personas antes de iniciar el tratamiento. Los resultados muestran que la depresión y la ira ejercen una importante influencia sobre el éxito terapéutico; es decir, habiendo dejado de fumar, mientras que la ansiedad no muestra efectos significativos. Sujetos con elevadas puntuaciones en depresión presentan importantes dificultades para finalizar el programa de manera exitosa, mientras que sujetos con puntuaciones elevadas en ira muestran una buena adherencia y un importante porcentaje de éxito en el tratamiento.

Studies of IRAS sources at high galactic latitudes

International Nuclear Information System (INIS)

Rowan-Robinson, M.; Helou, G.; Walker, D.

1987-01-01

A detailed study has been carried out of a complete sample of IRAS 25-, 60- and 100-μm sources identified with galaxies brighter than 14.5 mag at b > 60 0 . Redshifts are available for virtually all these galaxies. The 60- and 100-μm luminosities are well correlated with the corrected absolute magnitude Msub(B), the 25-μm luminosity less well so. There is a clear correlation of the ratio of far-infrared luminosity to optical luminosity, Lsub(FIR)/Lsub(B), with 100 μm/60 μm colour, in the sense that the more luminous infrared galaxies are warmer. This behaviour can be modelled as a mixture of a normal 'disc' component and a starburst component. There is no significant difference in the distribution of Lsub(FIR)/Lsub(B) versus 100 μm/60 μm colour for edge-on and face-on spirals, showing that the adopted internal extinction correction is a good approximation. (author)

Forming controlled inset regions by ion implantation and laser bombardment

International Nuclear Information System (INIS)

Gibbons, J.F.

1981-01-01

A semiconductor integrated circuit structure in which the inset regions are ion implanted and laser annealed to maintain substantially the dimensions of the implantation and the method of forming inset implanted regions having controlled dimensions

The identification of IRAS 15194-5115 with a bright extreme carbon star

International Nuclear Information System (INIS)

Meadows, P.J.

1987-01-01

The authors identify IRAS 15194-5115 with a previously unknown extreme carbon star which is the third brightest carbon star in the sky at 12 μm (1148 Jy). Results of optical and infrared photometry and spectroscopy are presented. The 3.03 μm absorption feature associated with C 2 H 2 and HCN is seen as well as SiC emission at 11.2 μm. A comparison with recent model calculations of other workers indicates that this star is very similar to IRC+10216 and that it lies at a distance of about 1.7 kpc. (author)

TIMASSS: the IRAS 16293-2422 millimeter and submillimeter spectral survey. I. Observations, calibration, and analysis of the line kinematics

Science.gov (United States)

Caux, E.; Kahane, C.; Castets, A.; Coutens, A.; Ceccarelli, C.; Bacmann, A.; Bisschop, S.; Bottinelli, S.; Comito, C.; Helmich, F. P.; Lefloch, B.; Parise, B.; Schilke, P.; Tielens, A. G. G. M.; van Dishoeck, E.; Vastel, C.; Wakelam, V.; Walters, A.

2011-08-01

Context. Unbiased spectral surveys are powerful tools to study the chemistry and the physics of star forming regions, because they can provide a complete census of the molecular content and the observed lines probe the physical structure of the source. Aims: While unbiased surveys at the millimeter and sub-millimeter wavelengths observable from ground-based telescopes have previously been performed towards several high mass protostars, very little exists on low mass protostars, which are believed to resemble our own Sun's progenitor. To help fill up this gap in our understanding, we carried out a complete spectral survey of the bands at 3, 2, 1, and 0.9 mm towards the solar type protostar IRAS 16293-2422. Methods: The observations covered a range of about 200 GHz and were obtained with the IRAM-30 m and JCMT-15 m telescopes during about 300 h of observations. Particular attention was devoted to the inter-calibration of the acquired spectra with previous observations. All the lines detected with more than 3σ confidence-interval certainty and free from obvious blending effects were fitted with Gaussians to estimate their basic kinematic properties. Results: More than 4000 lines were detected (with σ ≥ 3) and identified, yielding a line density of approximatively 20 lines per GHz, comparable to previous surveys in massive hot cores. The vast majority (about two-thirds) of the lines are weak and produced by complex organic molecules. The analysis of the profiles of more than 1000 lines belonging to 70 species firmly establishes the presence of two distinct velocity components associated with the two objects, A and B, forming the IRAS 16293-2422 binary system. In the source A, the line widths of several species increase with the upper level energy of the transition, a behavior compatible with gas infalling towards a ~1 M⊙ object. The source B, which does not show this effect, might have a much lower central mass of ~0.1 M⊙. The difference in the rest velocities

Academy panel proposes new form of regional institution

International Nuclear Information System (INIS)

Kloman, E.H.

1977-01-01

A panel of the National Academy of Public Administration has proposed development of a new form of interstate regional institution as an instrument for the siting, licensing, and regulating of nuclear facilities. Noting the danger that the nation's energy supplies may prove inadequate to meet basic needs of the economy despite increasing emphasis on greater use of coal and energy conservation, the panel pointed to the virtual stalemate in the national decision-making process for siting and licensing nuclear plants. A basic cause of the logjam is the growing conflict and overlap between federal and state agencies for authorizing nuclear development. The panel recommended setting up a new form of regional organization to fill an institutional void between federal and state levels of government. The proposed regional organizations would be established through federal legislation preempting to the Federal Government the regulation of siting, licensing, and construction of nuclear facilities. They would have jurisdiction over all matters in the operation of nuclear plants relating to public health and safety including those environmental factors and socio-economic factors covered in the preparation of environmental impact statements

Recovery of carboxylic acids produced during dark fermentation of food waste by adsorption on Amberlite IRA-67 and activated carbon.

Science.gov (United States)

Yousuf, Ahasa; Bonk, Fabian; Bastidas-Oyanedel, Juan-Rodrigo; Schmidt, Jens Ejbye

2016-10-01

Amberlite IRA-67 and activated carbon were tested as promising candidates for carboxylic acid recovery by adsorption. Dark fermentation was performed without pH control and without addition of external inoculum at 37°C in batch mode. Lactic, acetic and butyric acids, were obtained, after 7days of fermentation. The maximum acid removal, 74%, from the Amberlite IRA-67 and 63% from activated carbon was obtained from clarified fermentation broth using 200gadsorbent/Lbroth at pH 3.3. The pH has significant effect and pH below the carboxylic acids pKa showed to be beneficial for both the adsorbents. The un-controlled pH fermentation creates acidic environment, aiding in adsorption by eliminating use of chemicals for efficient removal. This study proposes simple and easy valorization of waste to valuable chemicals. Copyright © 2016 Elsevier Ltd. All rights reserved.

Discriminación en el trabajo y el vecindario hacia las mujeres que viven con VIH y su relación con la depresión y la ira

Directory of Open Access Journals (Sweden)

José Moral de la Rubia

2015-01-01

Full Text Available Se describe el nivel de discriminación percibida en el trabajo y el vecindario, y se estudia la relación que tiene con la depresión y la ira. La escala de Discriminación Temida y Percibida, el Inventario de Depresión de Beck y el Inventario de Rasgo- Estado-Expresión de Ira se aplicaron a una muestra no probabilística de 200 mujeres con VIH. Se percibe discriminación en el trabajo y el vecindario con mayor frecuencia que en la familia. La discriminación se relacionó más con depresión, no teniendo la ira un papel mediador. Se concluye que prevenir la discriminación podría ser un factor protector de depresión en mujeres que viven con VIH.

Probing the water and CO snow lines in the young protostar NGC 1333-IRAS4B

Science.gov (United States)

Anderl, Sibylle; Maret, Sébastien; André, Philippe; Maury, Anaëlle; Belloche, Arnaud; Cabrit, Sylvie; Codella, Claudio; Lefloch, Bertrand

2015-08-01

Today, we believe that the onset of life requires free energy, water, and complex, probably carbon-based chemistry. In the interstellar medium, complex organic molecules seem to mostly form in reactions happening on the icy surface of dust grains, such that they are released into the gas phase when the dust is heated. The resulting “snow lines”, marking regions where ices start to sublimate, play an important role for planet growth and bulk composition in protoplanetary disks. However, they can already be observed in the envelopes of the much younger, low-mass Class 0 protostars that are still in their early phase of heavy accretion. The information on the sublimation regions of different kinds of ices can be used to understand the chemistry of the envelope, its temperature and density structure, and may even hint at the history of the accretion process. Accordingly, it is a crucial piece of information in order to get the full picture of how organic chemistry evolves already at the earliest stages of the formation of sun-like stars. As part of the CALYPSO Large Program (http://irfu.cea.fr/Projets/Calypso/), we have obtained observations of C18O, N2H+ and CH3OH towards the Class 0 protostar NGC 1333-IRAS4B with the IRAM Plateau de Bure interferometer at sub-arcsecond resolution. Of these we use the methanol observations as a proxy for the water snow line, assuming methanol is trapped in water ice. The observed anti-correlation of C18O and N2H+, with N2H+ forming a ring around the centrally peaked C18O emission, reveals for the first time the CO snow line in this protostellar envelope, with a radius of ~300 AU. The methanol emission is much more compact than that of C18O, and traces the water snow line with a radius of ~40 AU. We have modeled the emission using a chemical model coupled with a radiative transfer module. We find that the CO snow line appears further inwards than expected from the binding energy of pure CO ices. This may hint at CO being frozen out

Very deep IRAS survey - constraints on the evolution of starburst galaxies

International Nuclear Information System (INIS)

Hacking, P.; Houck, J.R.; Condon, J.J.; National Radio Astronomy Observatory, Charlottesville, VA)

1987-01-01

Counts of sources (primarily starburst galaxies) from a deep 60 microns IRAS survey published by Hacking and Houck (1987) are compared with four evolutionary models. The counts below 100 mJy are higher than expected if no evolution has taken place out to a redshift of approximately 0.2. Redshift measurements of the survey sources should be able to distinguish between luminosity-evolution and density-evolution models and detect as little as a 20 percent brightening or increase in density of infrared sources per billion years ago (H/0/ = 100 km/s per Mpc). Starburst galaxies cannot account for the reported 100 microns background without extreme evolution at high redshifts. 21 references

NGVLA Observations of Dense Gas Filaments in Star-Forming Regions

Science.gov (United States)

Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team

2018-01-01

Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

MEDICIÓN DE LA IRA EN EL DEPORTE DE COMBATE: VALIDACIÓN DEL STAXI-2 EN DEPORTISTAS MEXICANOS/ MEASUREMENT OF ANGER IN COMBAT SPORT:VALIDATION OF STAXI-2 IN MEXICAN SPORTSMEN

Directory of Open Access Journals (Sweden)

Nazira Calleja Bello**

2010-05-01

Full Text Available RESUMENLa ira es una emoción que juega un papel fundamental en la ejecución de los deportes de combate. El propósito delpresente estudio fue desarrollar una versión para deportistas de combate del Inventario de Expresión de la Ira Estado-Rasgo, STAXI-2, versión española. La muestra estuvo conformada por 303 deportistas que formaban parte de las seleccionesnacionales mexicanas de cinco deportes de combate. Los resultados mostraron una estructura factorial similar a la versiónespañola, que reporta tres escalas: Ira-Estado, Ira-Rasgo y Expresión de Ira; sin embargo, de los 49 reactivos iniciales sólose conservaron 28, que se agruparon en siete factores y no en las nueve subescalas que conformaban el instrumento original.Los índices de consistencia interna fueron aceptables y se obtuvieron correlaciones significativas entre los factores, exceptocon el Control de la ira. El inventario obtenido es un instrumento válido y confiable para su utilización en la medición de laira en el deporte de combate.ABSTRACTThe anger is an emotion that plays a fundamental role in combat sports execution. The purpose of the present study wasto develop a version for combat sportsmen of the State-Trait Anger Expression Inventory, STAXI-2, Spanish version. Thesample was conformed by 303 sportsmen that were part of the selections national Mexicans of five combat sports. Theresults showed a similar factorial structure to the Spanish version which reports three scales: Anger-State, Anger-Trait andAnger-Expression; however, of the 49 initial items only 28 were conserved that grouped in seven factors and not in the ninesubscales that consisted the original instrument. The indexes of internal consistency were acceptable and significantcorrelations were obtained among the factors, except with the Anger-Control. The obtained inventory is a reliable and validfor its use in anger mensuration in combat sports.

TOWARD UNDERSTANDING THE B[e] PHENOMENON. III. PROPERTIES OF THE OPTICAL COUNTERPART OF IRAS 00470+6429

International Nuclear Information System (INIS)

Miroshnichenko, A. S.; Chentsov, E. L.; Klochkova, V. G.; Zharikov, S. V.; Grankin, K. N.; Kusakin, A. V.; Gandet, T. L.; Klingenberg, G.; Kildahl, S.; Rudy, R. J.; Lynch, D. K.; Venturini, C. C.; Mazuk, S.; Puetter, R. C.; Perry, R. B.; Carciofi, A. C.; Bjorkman, K. S.; Gray, R. O.; Bernabei, S.; Polcaro, V. F.

2009-01-01

FS CMa type stars are a group of Galactic objects with the B[e] phenomenon. They exhibit strong emission-line spectra and infrared excesses, which are most likely due to recently formed circumstellar dust. The group content and identification criteria were described in the first two papers of the series. In this paper we report our spectroscopic and photometric observations of the optical counterpart of IRAS 00470+6429 obtained in 2003-2008. The optical spectrum is dominated by emission lines, most of which have P Cyg type profiles. We detected significant brightness variations, which may include a regular component, and variable spectral line profiles in both shape and position. The presence of a weak Li I 6708 A line in the spectrum suggests that the object is most likely a binary system with a B2-B3 spectral-type primary companion of a luminosity log L/L sun = 3.9 ± 0.3 and a late-type secondary companion. We estimate a distance toward the object to be 2.0 ± 0.3 kpc from the Sun.

Determination of GMPE functional form for an active region with limited strong motion data: application to the Himalayan region

Science.gov (United States)

Bajaj, Ketan; Anbazhagan, P.

2018-01-01

Advancement in the seismic networks results in formulation of different functional forms for developing any new ground motion prediction equation (GMPE) for a region. Till date, various guidelines and tools are available for selecting a suitable GMPE for any seismic study area. However, these methods are efficient in quantifying the GMPE but not for determining a proper functional form and capturing the epistemic uncertainty associated with selection of GMPE. In this study, the compatibility of the recent available functional forms for the active region is tested for distance and magnitude scaling. Analysis is carried out by determining the residuals using the recorded and the predicted spectral acceleration values at different periods. Mixed effect regressions are performed on the calculated residuals for determining the intra- and interevent residuals. Additionally, spatial correlation is used in mixed effect regression by changing its likelihood function. Distance scaling and magnitude scaling are respectively examined by studying the trends of intraevent residuals with distance and the trend of the event term with magnitude. Further, these trends are statistically studied for a respective functional form of a ground motion. Additionally, genetic algorithm and Monte Carlo method are used respectively for calculating the hinge point and standard error for magnitude and distance scaling for a newly determined functional form. The whole procedure is applied and tested for the available strong motion data for the Himalayan region. The functional form used for testing are five Himalayan GMPEs, five GMPEs developed under NGA-West 2 project, two from Pan-European, and one from Japan region. It is observed that bilinear functional form with magnitude and distance hinged at 6.5 M w and 300 km respectively is suitable for the Himalayan region. Finally, a new regression coefficient for peak ground acceleration for a suitable functional form that governs the attenuation

Influencia de las Emociones Negativas (Ansiedad, Depresión e Ira) sobre la Eficacia de un Programa de Tratamiento Cognitivo Conductual de Deshabituación al Tabaco

OpenAIRE

Francisco Javier Pérez-Pareja; Albert Sesé; Ana Filomena Romo; Alfonso Palmer; Manuel Tomás

2010-01-01

El objetivo de esta investigación es analizar la influencia de la ansiedad, la ira y la depresión, como emociones negativas, sobre el éxito en la aplicación de un tratamiento psicológico de carácter cognitivo-conductual para dejar de fumar. Estas tres respuestas emocionales fueron evaluadas en una muestra final de 180 personas antes de iniciar el tratamiento. Los resultados muestran que la depresión y la ira ejercen una importante influencia sobre el éxito terapéutico; es decir, habiendo deja...

OH outflows in star-forming regions

International Nuclear Information System (INIS)

Mirabel, I.F.; Ruiz, A.; Rodriguez, L.F.; Canto, J.; Universidad de Puer; Universidad de Puerto Rico, Rio Piedras; Universidad Nacional Autonoma de Mexico, Mexico City)

1987-01-01

The results from a survey for high-velocity OH in molecular outflows in star-forming regions are reported. High-velocity OH was detected in absorption in nine of these regions. When the telescope beam can resolve the outflows, they show similar anisotropic angular distribution as the redshifted and blueshifted CO. The OH transitions are markedly subthermal since for several sources it is found that the radiation that is being absorbed is a background continuum constituted by the cosmic component plus a small Galactic contribution. The absorbing OH appears to trace gas with higher velocities and lower densities than does the CO and, in some cases, provides information on the structure of the outflows at larger distances from the central source. At scales of 0.1 pc, the outflows are elongated in the direction of the steepest density gradient of the ambient cloud, suggesting that the large-scale collimation of the outflow is produced by the density structure of the ambient cloud. 29 references

Stellar Feedback in Massive Star-Forming Regions

Science.gov (United States)

Baldwin, Jack; Pellegrini, Eric; Ferland, Gary; Murray, Norm; Hanson, Margaret

2008-02-01

Star formation rates and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study in the two nearest giant star-forming regions to nail down the physics that produces the 10-20 parsec bubbles seen to surround young massive clusters in the Milky Way. This will determine if and how the clusters disrupt their natal giant molecular clouds (GMCs). Here we request 4 nights on the Blanco telescope to obtain dense grids of optical long-slit spectra criss-crossing each nebula. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3000 different spots in each nebula. From this we can determine a number of dynamically important quantities, such as the gas density and temperature, hence pressure in and around these bubbles. These quantities can be compared to the dynamical (gravitationally induced) pressure, and the radiation pressure. All can be employed in dynamical models for the evolution of a GMC under the influence of an embedded massive star cluster. This research will elucidate the detailed workings of the star-forming regions which dominate the star formation rate in the Milky Way, and also will steadily improve our calibration and understanding of more distant, less well-resolved objects such as ULIRGS, Lyman break, and submillimeter galaxies.

HIGH-RESOLUTION 8 mm AND 1 cm POLARIZATION OF IRAS 4A FROM THE VLA NASCENT DISK AND MULTIPLICITY (VANDAM) SURVEY

Energy Technology Data Exchange (ETDEWEB)

Cox, Erin G.; Harris, Robert J.; Looney, Leslie W.; Segura-Cox, Dominique M. [Department of Astronomy, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Tobin, John [Leiden Observatory, Leiden University, P.O. Box 9513, 2000-RA Leiden (Netherlands); Li, Zhi-Yun [Department of Astronomy, University of Virginia, Charlottesville, VA 22903 (United States); Tychoniec, Łukasz [Astronomical Observatory Institute, Faculty of Physics, A. Mickiewicz University, Słoneczna 36, PL-60-268 Poznań (Poland); Chandler, Claire J.; Perez, Laura M. [National Radio Astronomy Observatory, Socorro, NM 87801 (United States); Dunham, Michael M. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Kratter, Kaitlin [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Melis, Carl [Center for Astrophysics and Space Sciences, University of California, San Diego, CA 92093 (United States); Sadavoy, Sarah I., E-mail: egcox2@illinois.edu [Max-Planck-Institut für Astronomie, D-69117 Heidelberg (Germany)

2015-12-01

Magnetic fields can regulate disk formation, accretion, and jet launching. Until recently, it has been difficult to obtain high-resolution observations of the magnetic fields of the youngest protostars in the critical region near the protostar. The VANDAM survey is observing all known protostars in the Perseus Molecular Cloud. Here we present the polarization data of IRAS 4A. We find that with ∼0.″2 (50 AU) resolution at λ = 8.1 and 10.3 mm, the inferred magnetic field is consistent with a circular morphology, in marked contrast with the hourglass morphology seen on larger scales. This morphology is consistent with frozen-in field lines that were dragged in by rotating material entering the infall region. The field morphology is reminiscent of rotating circumstellar material near the protostar. This is the first polarization detection of a protostar at these wavelengths. We conclude from our observations that the dust emission is optically thin with β ∼ 1.3, suggesting that millimeter-/centimeter-sized grains have grown and survived in the short lifetime of the protostar.

The ALMA-PILS survey: 3D modeling of the envelope, disks and dust filament of IRAS 16293-2422

Science.gov (United States)

Jacobsen, S. K.; Jørgensen, J. K.; van der Wiel, M. H. D.; Calcutt, H.; Bourke, T. L.; Brinch, C.; Coutens, A.; Drozdovskaya, M. N.; Kristensen, L. E.; Müller, H. S. P.; Wampfler, S. F.

2018-04-01

Context. The Class 0 protostellar binary IRAS 16293-2422 is an interesting target for (sub)millimeter observations due to, both, the rich chemistry toward the two main components of the binary and its complex morphology. Its proximity to Earth allows the study of its physical and chemical structure on solar system scales using high angular resolution observations. Such data reveal a complex morphology that cannot be accounted for in traditional, spherical 1D models of the envelope. Aims: The purpose of this paper is to study the environment of the two components of the binary through 3D radiative transfer modeling and to compare with data from the Atacama Large Millimeter/submillimeter Array. Such comparisons can be used to constrain the protoplanetary disk structures, the luminosities of the two components of the binary and the chemistry of simple species. Methods: We present 13CO, C17O and C18O J = 3-2 observations from the ALMA Protostellar Interferometric Line Survey (PILS), together with a qualitative study of the dust and gas density distribution of IRAS 16293-2422. A 3D dust and gas model including disks and a dust filament between the two protostars is constructed which qualitatively reproduces the dust continuum and gas line emission. Results: Radiative transfer modeling in our sampled parameter space suggests that, while the disk around source A could not be constrained, the disk around source B has to be vertically extended. This puffed-up structure can be obtained with both a protoplanetary disk model with an unexpectedly high scale-height and with the density solution from an infalling, rotating collapse. Combined constraints on our 3D model, from observed dust continuum and CO isotopologue emission between the sources, corroborate that source A should be at least six times more luminous than source B. We also demonstrate that the volume of high-temperature regions where complex organic molecules arise is sensitive to whether or not the total

Irrationality, barbarism and violence in the Seneca’s De Ira: a political reading

Directory of Open Access Journals (Sweden)

Ignacio Pajón Leyra

2018-03-01

Full Text Available Seneca’s philosophy dedicates a special attention to passions, regarded as the main obstacle to attaining wisdom, and in particular to anger, considered the most dreadful of them all. Scholars have usually interpreted his treaty On anger (De ira as a private handbook of ethics containing advice about how to become wise. However, this article explores a different approach to the text, placing it in the context of Seneca’s discussion about the virtue of courage. Thus, in Seneca’s thought anger appears as a social issue that affects both political communities and isolated individuals.

YOUNG STELLAR OBJECTS IN THE MASSIVE STAR-FORMING REGION W49

Energy Technology Data Exchange (ETDEWEB)

Saral, G.; Hora, J. L.; Willis, S. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Gutermuth, R. A. [University of Massachusetts, Department of Astronomy, Amherst, MA 01003 (United States); Saygac, A. T., E-mail: gsaral@cfa.harvard.edu [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

2015-11-01

We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the young stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.

VLBA Changes Picture of Famous Star-Forming Region

Science.gov (United States)

2007-10-01

Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is

AN EXTREME HIGH-VELOCITY BIPOLAR OUTFLOW IN THE PRE-PLANETARY NEBULA IRAS 08005-2356

Energy Technology Data Exchange (ETDEWEB)

Sahai, R. [Jet Propulsion Laboratory, California Institute of Technology, MS 183-900, Pasadena, CA 91109 (United States); Patel, N. A., E-mail: raghvendra.sahai@jpl.nasa.gov [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States)

2015-09-01

We report interferometric mapping of the bipolar pre-planetary nebula IRAS 08005-2356 (I 08005) with an angular resolution of ∼1″–5″, using the Submillimeter Array, in the {sup 12}CO J = 2–1, 3–2, {sup 13}CO J = 2–1, and SiO J = 5–4 (v = 0) lines. Single-dish observations, using the SMT 10 m, were made in these lines as well as in the CO J = 4–3 and SiO J = 6–5 (v = 0) lines. The line profiles are very broad, showing the presence of a massive (>0.1 M{sub ⊙}), extreme high velocity outflow (V ∼ 200 km s{sup −1}) directed along the nebular symmetry axis derived from the Hubble Space Telescope imaging of this object. The outflow's scalar momentum far exceeds that available from radiation pressure of the central post-AGB star, and it may be launched from an accretion disk around a main-sequence companion. We provide indirect evidence for such a disk from its previously published, broad Hα emission profile, which we propose results from Lyβ emission generated in the disk followed by Raman-scattering in the innermost regions of a fast, neutral wind.

A Molecular-line Study of the Interstellar Bullet Engine IRAS05506+2414

Science.gov (United States)

Sahai, Raghvendra; Lee, Chin-Fei; Sánchez Contreras, Carmen; Patel, Nimesh; Morris, Mark R.; Claussen, Mark

2017-12-01

We present interferometric and single-dish molecular line observations of the interstellar bullet-outflow source IRAS 05506+2414, whose wide-angle bullet spray is similar to the Orion BN/KL explosive outflow and likely arises from an entirely different mechanism than the classical accretion-disk-driven bipolar flows in young stellar objects. The bullet-outflow source is associated with a large pseudo-disk and three molecular outflows—a high-velocity outflow (HVO), a medium-velocity outflow (MVO), and a slow, extended outflow (SEO). The size (mass) of the pseudo-disk is 10,350 au × 6400 au (0.64-0.17 M ⊙) from a model-fit assuming infall and rotation, we derive a central stellar mass of 8-19 M ⊙. The HVO (MVO) has an angular size ˜5180 (˜3330) au and a projected outflow velocity of ˜140 km s-1 (˜30 km s-1). The SEO size (outflow speed) is ˜0.9 pc (˜6 km s-1). The HVO’s axis is aligned with (orthogonal to) that of the SEO (pseudo-disk). The velocity structure of the MVO is unresolved. The scalar momenta in the HVO and SEO are very similar, suggesting that the SEO has resulted from the HVO interacting with ambient-cloud material. The bullet spray shares a common axis with the pseudo-disk and has an age comparable to that of MVO (few hundred years), suggesting that these three structures are intimately linked. We discuss several models for the outflows in IRAS 05506+2414 (including dynamical decay of a stellar cluster, chance encounter of a runaway star with a dense cloud, and close passage of two protostars), and conclude that second-epoch imaging to derive proper motions of the bullets and nearby stars can help to discriminate between them.

The chemical structure of the Class 0 protostellar envelope NGC 1333 IRAS 4A⋆⋆

Science.gov (United States)

Koumpia, E.; Semenov, D. A.; van der Tak, F. F. S.; Boogert, A. C. A.; Caux, E.

2017-07-01

Context. It is not well known what drives the chemistry of a protostellar envelope, in particular the role of the stellar mass and the protostellar outflows on the chemical enrichment of such environments. Aims: We study the chemical structure of the Class 0 protostellar envelope NGC 1333 IRAS 4A in order to (I) investigate the influence of the outflows on the chemistry; (II) constrain the age of our studied object; (III) compare it with a typical high-mass protostellar envelope. Methods: In our analysis we use JCMT line mapping (360-373 GHz) and HIFI pointed spectra (626.01-721.48 GHz). To study the influence of the outflow on the degree of deuteration, we compare JCMT maps of HCO+ and DCO+ with non-LTE (RADEX) models in a region that spatially covers the outflow activity of IRAS 4A. To study the envelope chemistry, we derive empirical molecular abundance profiles for the observed species using the Monte Carlo radiative transfer code (RATRAN) and adopting a 1D dust density/temperature profile from the literature. We use a combination of constant abundance profiles and abundance profiles that include jumps at two radii (T 100 K or T 30 K) to fit our observations. We compare our best-fit observed abundance profiles with the predictions from the time dependent gas grain chemical code (ALCHEMIC). Results: We detect CO, 13CO, C18O, CS, HCN, HCO+, N2H+, H2CO, CH3OH, H2O, H2S, DCO+, HDCO, D2CO, SO, SO2, SiO, HNC, CN, C2H and OCS. We divide the detected lines in three groups based on their line profiles: a) broad emission (FWHM = 4-11 km s-1), b) narrow emission (FWHMtime-dependent gas-grain chemical model for the outer envelope, with the exceptions of HCN, HNC, CN. These species along with the CO abundance require an enhanced UV field which points towards an outflow cavity. The abundances with respect to H2 are 1 to 2 orders of magnitude lower than those observed in the high mass protostellar envelope (AFGL 2591), while they are found to be similar within factors of a

IRAS bright galaxy sample. II. The sample and luminosity function

International Nuclear Information System (INIS)

Soifer, B.T.; Sanders, D.B.; Neugebauer, G.; Madore, B.F.; Danielson, G.E.; David Dunlap Observatory, Richmond Hill, Canada; Palomar Observatory; California Institute of Technology, Pasadena)

1987-01-01

A statistically complete sample of 324 of the brightest infrared galaxies discovered at 60 microns in the IRAS all-sky survey is described. The results show that far-infrared emission is a significant luminosity component in the local universe, representing 25 percent of the luminosity emitted by stars in the same volume. Above 10 to the 11th solar luminosities, the infrared luminous galaxies are the dominant population of objects in the universe, being as numerous as the Seyfert galaxies and more numerous than quasars at higher luminosities. The infrared luminosity appears to be independent of the optical luminosity of galaxies. Most infrared bright galaxies appear to require much of the interstellar matter to be contributing to the observed infrared luminosity. Approximately 60-80 percent of the far-infrared luminosity of the local universe can be attributed, directly or indirectly, to recent or ongoing star formation. 67 references

Rotation-Infall Motion around the Protostar IRAS 16293-2422 Traced by Water Maser Emission

Science.gov (United States)

Imai, Hiroshi; Iwata, Takahiro; Miyoshi, Makoto

1999-08-01

We made VLBI observations of the water maser emission associated with a protostar, IRAS 16293-2422, using the Kashima-Nobeyama Interferometer (KNIFE) and the Japanese domestic VLBI network (J-Net).\\footnote[2]. These distributions of water maser features showed the blue-shifted and red-shifted components separated in the north-south direction among three epochs spanning three years. The direction of the separation was perpendicular to the molecular outflow and parallel to the elongation of the molecular disk. These steady distributions were successfully modeled by a rotating-infalling disk with an outer radius of 100 AU around a central object with a mass of 0.3 MO . The local specific angular momentum of the disk was calculated to be 0.2-1.0times 10-3 km s-1 pc at a radius of 20-100 AU. This value is roughly equal to that of the disk of IRAS 00338+6312 in L1287 and those of the molecular disks around the protostars in the Taurus molecular cloud. The relatively large disk radius of about 100 AU traced by water maser emission suggests that impinging clumps onto the disk should be hotter than 200 K to excite the water maser emission. Mizusawa, Nobeyama, and Kagoshima stations are operated by staff members of National Astronomical Observatory of the Ministry of Education, Science, Sports and Culture. Kashima station is operated by staff members of Communications Research Laboratory of the Ministry of Posts and Telecomunications. The recent status of J-Net is seen in the WWW home page: http://www.nro.nao.ac.jp/\\ \\ miyaji/Jnet.

The IRAS minisurvey. [Infra Red Astronomy Satellite study of selected sources

Science.gov (United States)

Rowan-Robinson, M.; Clegg, P. E.; Emerson, J. P.; Beichman, C. A.; Aumann, H. H.; Gautier, T. N.; Neugebauer, G.; Soifer, B. T.; Beintema, D. A.; Boggess, N.

1984-01-01

Before the main Infrared Astronomical Satellite (IRAS) all-sky survey was started, a preliminary survey of 900 sq deg was carried out. Some results from this 'minisurvey' are given here. The completeness of the minisurvey at galactic latitudes from 20 to 40 deg drops sharply at flux densities below 0.4, 0.4, 0.5, and 2.5 Jy at 12, 25, 60, and 100 microns, respectively. The corresponding surface densities of point sources brighter than these flux levels are 1.1, 0.4, 0.65, and 1.25/sq deg, respectively. Outside the galactic plane, the majority of the sources at 12 and 25 microns are stars, while galaxies make up a significant proportion of 60 micron sources. The 100 micron band is dominated by emission from interstellar dust over much of the minisurvey area.

Spatially resolved chemistry in nearby galaxies. III. Dense molecular gas in the inner disk of the LIRG IRAS 04296+2923

Energy Technology Data Exchange (ETDEWEB)

Meier, David S. [Department of Physics, New Mexico Institute of Mining and Technology, 801 Leroy Place, Socorro, NM 87801 (United States); Turner, Jean L. [Department of Physics and Astronomy, UCLA, Los Angeles, CA 90095-1547 (United States); Beck, Sara C., E-mail: dmeier@nmt.edu, E-mail: turner@astro.ucla.edu, E-mail: sara@wise.tau.ac.il [Department of Physics and Astronomy, Tel Aviv University, 69978 Ramat Aviv (Israel)

2014-11-10

We present a survey of 3 mm molecular lines in IRAS 04296+2923, one of the brightest known molecular-line emitting galaxies, and one of the closest luminous infrared galaxies (LIRGs). Data are from the Owens Valley and CARMA millimeter interferometers. Species detected at ≲ 4'' resolution include C{sup 18}O, HCN, HCO{sup +}, HNC, CN, CH{sub 3}OH, and, tentatively, HNCO. Along with existing CO, {sup 13}CO, and radio continuum data, these lines constrain the chemical properties of the inner disk. Dense molecular gas in the nucleus fuels a star formation rate ≳10 M {sub ☉} yr{sup –1} and is traced by lines of HCN, HCO{sup +}, HNC, and CN. A correlation between HCN and star formation rate is observed on sub-kiloparsec scales, consistent with global relations. Toward the nucleus, CN abundances are similar to those of HCN, indicating emission comes from a collection (∼40-50) of moderate visual extinction, photon-dominated-region clouds. The CO isotopic line ratios are unusual: CO(1-0)/{sup 13}CO(1-0) and CO(1-0)/C{sup 18}O(1-0) line ratios are large toward the starburst, as is commonly observed in LIRGs, but farther out in the disk these ratios are remarkably low (≲ 3). {sup 13}CO/C{sup 18}O abundance ratios are lower than in Galactic clouds, possibly because the C{sup 18}O is enriched by massive star ejecta from the starburst. {sup 13}CO is underabundant relative to CO. Extended emission from CH{sub 3}OH indicates that dynamical shocks pervade both the nucleus and the inner disk. The unusual CO isotopologue ratios, the CO/HCN intensity ratio versus L {sub IR}, the HCN/CN abundance ratio, and the gas consumption time versus inflow rate all indicate that the starburst in IRAS 04296+2923 is in an early stage of development.

New far infrared images of bright, nearby, star-forming regions

Science.gov (United States)

Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.

1995-01-01

Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

Characterization of the volatile components in green tea by IRAE-HS-SPME/GC-MS combined with multivariate analysis.

Science.gov (United States)

Yang, Yan-Qin; Yin, Hong-Xu; Yuan, Hai-Bo; Jiang, Yong-Wen; Dong, Chun-Wang; Deng, Yu-Liang

2018-01-01

In the present work, a novel infrared-assisted extraction coupled to headspace solid-phase microextraction (IRAE-HS-SPME) followed by gas chromatography-mass spectrometry (GC-MS) was developed for rapid determination of the volatile components in green tea. The extraction parameters such as fiber type, sample amount, infrared power, extraction time, and infrared lamp distance were optimized by orthogonal experimental design. Under optimum conditions, a total of 82 volatile compounds in 21 green tea samples from different geographical origins were identified. Compared with classical water-bath heating, the proposed technique has remarkable advantages of considerably reducing the analytical time and high efficiency. In addition, an effective classification of green teas based on their volatile profiles was achieved by partial least square-discriminant analysis (PLS-DA) and hierarchical clustering analysis (HCA). Furthermore, the application of a dual criterion based on the variable importance in the projection (VIP) values of the PLS-DA models and on the category from one-way univariate analysis (ANOVA) allowed the identification of 12 potential volatile markers, which were considered to make the most important contribution to the discrimination of the samples. The results suggest that IRAE-HS-SPME/GC-MS technique combined with multivariate analysis offers a valuable tool to assess geographical traceability of different tea varieties.

Characterization of the volatile components in green tea by IRAE-HS-SPME/GC-MS combined with multivariate analysis.

Directory of Open Access Journals (Sweden)

Yan-Qin Yang

Full Text Available In the present work, a novel infrared-assisted extraction coupled to headspace solid-phase microextraction (IRAE-HS-SPME followed by gas chromatography-mass spectrometry (GC-MS was developed for rapid determination of the volatile components in green tea. The extraction parameters such as fiber type, sample amount, infrared power, extraction time, and infrared lamp distance were optimized by orthogonal experimental design. Under optimum conditions, a total of 82 volatile compounds in 21 green tea samples from different geographical origins were identified. Compared with classical water-bath heating, the proposed technique has remarkable advantages of considerably reducing the analytical time and high efficiency. In addition, an effective classification of green teas based on their volatile profiles was achieved by partial least square-discriminant analysis (PLS-DA and hierarchical clustering analysis (HCA. Furthermore, the application of a dual criterion based on the variable importance in the projection (VIP values of the PLS-DA models and on the category from one-way univariate analysis (ANOVA allowed the identification of 12 potential volatile markers, which were considered to make the most important contribution to the discrimination of the samples. The results suggest that IRAE-HS-SPME/GC-MS technique combined with multivariate analysis offers a valuable tool to assess geographical traceability of different tea varieties.

The distribution of warm gas in the G327.3-0.6 star forming region

NARCIS (Netherlands)

Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

Monte Carlo calculations and experimental measurements of dosimetric parameters of the IRA-103Pd brachytherapy source

International Nuclear Information System (INIS)

Sadeghi, Mahdi; Raisali, Gholamreza; Hosseini, S. Hamed; Shavar, Arzhang

2008-01-01

This article presents a brachytherapy source having 103 Pd adsorbed onto a cylindrical silver rod that has been developed by the Agricultural, Medical, and Industrial Research School for permanent implant applications. Dosimetric characteristics (radial dose function, anisotropy function, and anisotropy factor) of this source were experimentally and theoretically determined in terms of the updated AAPM Task group 43 (TG-43U1) recommendations. Monte Carlo simulations were used to calculate the dose rate constant. Measurements were performed using TLD-GR200A circular chip dosimeters using standard methods employing thermoluminescent dosimeters in a Perspex phantom. Precision machined bores in the phantom located the dosimeters and the source in a reproducible fixed geometry, providing for transverse-axis and angular dose profiles over a range of distances from 0.5 to 5 cm. The Monte Carlo N-particle (MCNP) code, version 4C simulation techniques have been used to evaluate the dose-rate distributions around this model 103 Pd source in water and Perspex phantoms. The Monte Carlo calculated dose rate constant of the IRA- 103 Pd source in water was found to be 0.678 cGy h -1 U -1 with an approximate uncertainty of ±0.1%. The anisotropy function, F(r,θ), and the radial dose function, g(r), of the IRA- 103 Pd source were also measured in a Perspex phantom and calculated in both Perspex and liquid water phantoms

Performance Comparisons of Improved Regular Repeat Accumulate (RA and Irregular Repeat Accumulate (IRA Turbo Decoding

Directory of Open Access Journals (Sweden)

Ahmed Abdulkadhim Hamad

2017-08-01

Full Text Available In this paper, different techniques are used to improve the turbo decoding of regular repeat accumulate (RA and irregular repeat accumulate (IRA codes. The adaptive scaling of a-posteriori information produced by Soft-output Viterbi decoder (SOVA is proposed. The encoded pilots are another scheme that applied for short length RA codes. This work also suggests a simple and a fast method to generate a random interleaver having a free 4 cycle Tanner graph. Progressive edge growth algorithm (PEG is also studied and simulated to create the Tanner graphs which have a great girth.

Organic Chemistry of Southern Sources: Microwave Spectroscopy of Cha-MMS1 and IRAS 15194-5115

Science.gov (United States)

Cordiner, Martin; Charnley, Steven

2011-01-01

We report new spectra of molecule-rich sources in the southern hemisphere obtained using the 22-meter Mopra telescope. Spectra and maps are presented of organic molecules detected between 30 and 50 GHz in the young Class 0 protostar Chamaeleon MMS-1. The large abundances of polyynes, cyanopolyynes and methanol may be indicative of a warm carbon chemistry in the dense gas surrounding this protostar. Spectra are also presented from a 78-96 GHz scan of the carbon-rich AGB star IRAS 15194-5115, including new detections of HC5N, CCS and C13CH.

WITNESSING THE KEY EARLY PHASE OF QUASAR EVOLUTION: AN OBSCURED ACTIVE GALACTIC NUCLEUS PAIR IN THE INTERACTING GALAXY IRAS 20210+1121

International Nuclear Information System (INIS)

Piconcelli, Enrico; Fiore, Fabrizio; Maiolino, Roberto; Nicastro, Fabrizio; Vignali, Cristian; Bianchi, Stefano; Mathur, Smita; Guainazzi, Matteo; Lanzuisi, Giorgio

2010-01-01

We report the discovery of an active galactic nucleus (AGN) pair in the interacting galaxy system IRAS 20210+1121 at z = 0.056. An XMM-Newton observation reveals the presence of an obscured (N H ∼ 5 x 10 23 cm -2 ), Seyfert-like (L 2-10keV = 4.7 x 10 42 erg s -1 ) nucleus in the northern galaxy, which lacks unambiguous optical AGN signatures. Our spectral analysis also provides strong evidence that the IR-luminous southern galaxy hosts a Type 2 quasar embedded in a bright starburst emission. In particular, the X-ray primary continuum from the nucleus appears totally depressed in the XMM-Newton band as expected in the case of a Compton-thick absorber, and only the emission produced by Compton scattering ('reflection') of the continuum from circumnuclear matter is seen. As such, IRAS 20210+1121 seems to provide an excellent opportunity to witness a key, early phase in the quasar evolution predicted by the theoretical models of quasar activation by galaxy collisions.

Revealing the ultrafast outflow in IRAS 13224-3809 through spectral variability

Science.gov (United States)

Parker, M. L.; Alston, W. N.; Buisson, D. J. K.; Fabian, A. C.; Jiang, J.; Kara, E.; Lohfink, A.; Pinto, C.; Reynolds, C. S.

2017-08-01

We present an analysis of the long-term X-ray variability of the extreme narrow-line Seyfert 1 galaxy IRAS 13224-3809 using principal component analysis (PCA) and fractional excess variability (Fvar) spectra to identify model-independent spectral components. We identify a series of variability peaks in both the first PCA component and Fvar spectrum which correspond to the strongest predicted absorption lines from the ultrafast outflow (UFO) discovered by Parker et al. (2017). We also find higher order PCA components, which correspond to variability of the soft excess and reflection features. The subtle differences between RMS and PCA results argue that the observed flux-dependence of the absorption is due to increased ionization of the gas, rather than changes in column density or covering fraction. This result demonstrates that we can detect outflows from variability alone and that variability studies of UFOs are an extremely promising avenue for future research.

Heavy water stratification in a low-mass protostar

NARCIS (Netherlands)

Coutens, A.; Vastel, C.; Cazaux, S.; Bottinelli, S.; Caux, E.; Ceccarelli, C.; Demyk, K.; Taquet, V.; Wakelam, V.

Context. Despite the low elemental deuterium abundance in the Galaxy, enhanced molecular deuterium fractionation has been found in the environments of low-mass star-forming regions and, in particular, the Class 0 protostar IRAS 16293-2422. Aims. The key program Chemical HErschel Surveys of Star

Provocaciones del alumnado y emoción de ira en el profesorado de Educación Física: El caso de los centros de atención educativa preferente de la ciudad de Barcelona

Directory of Open Access Journals (Sweden)

Sylvain Ayme

2010-09-01

Full Text Available Los objetivos de este artículo son: a identificar los diferentes tipos de provocaciones del alumnado en las clases de Educación Física y b relacionarlos con las reacciones de ira (y sus grados de intensidad de cinco profesores de esta materia que ejercen en centros de atención educativa preferente (CAEP en Barcelona. Los resultados del análisis de cincuenta sesiones muestran que: a cuatro de los cinco profesores sintieron intensidades “bajas” de ira en la mayoría de ocasiones; b lo que les produce una mayor intensidad de ira es la no participación del alumnado, aunque las intensidades emocionales varían según el tipo de provocación, y c la percepción del “nivel de perjuicio” y “carácter voluntario” de las provocaciones explican hasta un 51 % de la variación del nivel de intensidad de las respuestas emocionales de estos profesores.

Chandra X-ray observations of the hyper-luminous infrared galaxy IRAS F15307+3252

Science.gov (United States)

Hlavacek-Larrondo, J.; Gandhi, P.; Hogan, M. T.; Gendron-Marsolais, M.-L.; Edge, A. C.; Fabian, A. C.; Russell, H. R.; Iwasawa, K.; Mezcua, M.

2017-01-01

Hyper-luminous infrared galaxies (HyLIRGs) lie at the extreme luminosity end of the IR galaxy population with LIR > 1013 L⊙. They are thought to be closer counterparts of the more distant sub-millimeter galaxies, and should therefore be optimal targets to study the most massive systems in formation. We present deep Chandra observations of IRAS F15307+3252 (100 ks), a classical HyLIRG located at z = 0.93 and hosting a radio-loud AGN (L1.4 GHz ˜ 3.5 × 1025 W Hz-1). The Chandra images reveal the presence of extended (r = 160 kpc), asymmetric X-ray emission in the soft 0.3-2.0 keV band that has no radio counterpart. We therefore argue that the emission is of thermal origin originating from a hot intragroup or intracluster medium virializing in the potential. We find that the temperature (˜2 keV) and bolometric X-ray luminosity (˜3 × 1043 erg s-1) of the gas follow the expected LX-ray-T correlation for groups and clusters, and that the gas has a remarkably short cooling time of 1.2 Gyr. In addition, VLA radio observations reveal that the galaxy hosts an unresolved compact steep-spectrum (CSS) source, most likely indicating the presence of a young radio source similar to 3C186. We also confirm that the nucleus is dominated by a redshifted 6.4 keV Fe Kα line, strongly suggesting that the AGN is Compton-thick. Finally, Hubble images reveal an overdensity of galaxies and sub-structure in the galaxy that correlates with soft X-ray emission. This could be a snapshot view of on-going groupings expected in a growing cluster environment. IRAS F15307+3252 might therefore be a rare example of a group in the process of transforming into a cluster.

Form factors and QCD in spacelike and timelike region

International Nuclear Information System (INIS)

A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

2000-01-01

The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

Form factors and QCD in spacelike and timelike regions

International Nuclear Information System (INIS)

Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

2000-01-01

We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

Energy Technology Data Exchange (ETDEWEB)

Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Kuhn, Michael A. [Millennium Institute of Astrophysics, Camino El Observatorio 1515, Las Condes, Santiago (Chile); Povich, Matthew S., E-mail: edf@astro.psu.edu [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Ave., Pomona, CA 91768 (United States)

2016-12-20

The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

International Nuclear Information System (INIS)

Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.; Kuhn, Michael A.; Povich, Matthew S.

2016-01-01

The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

Diatomáceas perifíticas em um sistema eutrófico brasileiro (Reservatório do Iraí, estado do Paraná Periphytic diatoms in a Brazilian eutrophic system (Iraí reservoir, Paraná state

Directory of Open Access Journals (Sweden)

Angela Maria da Silva

2010-12-01

Full Text Available O estudo sobre a diversidade das diatomáceas do reservatório do Iraí ampliou o conhecimento da flora diatomológica perifítica de ambientes eutróficos do estado do Paraná e contribuiu para subsidiar futuros trabalhos que utilizem diatomáceas como bioindicadoras das condições tróficas da água. Coletas trimestrais foram realizadas no reservatório durante um ano. As amostras perifíticas foram obtidas pela remoção do biofilme aderido a caules da macrófita Polygonum sp. e a lâminas de vidro. Estas foram colocadas em complexos de madeira e deixadas submersas durante 30 dias para colonização. O estudo taxonômico resultou na identificação de 11 citações pioneiras para o estado do Paraná entre as 96 espécies de diatomáceas determinadas. Maior diversidade de espécies foi registrada para o substrato macrófita. Achnanthidium minutissimum foi dominante na maior parte das amostras analisadas, sendo considerada tolerante às condições eutróficas do reservatório do Iraí. Fragilaria rumpens, Fragilaria vaucheriae var. capitellata e Gomphonema gracile foram abundantes. Informações ecológicas sobre as espécies foram obtidas em literatura, sendo 35% características de sistemas aquáticos em processo avançado de eutrofização, 18% de ambientes mesotróficos e 19% classificadas como tolerantes e indiferentes ao estado trófico dos ambientes.This floristic survey contributed to our knowledge of periphytic diatoms in a eutrophic reservoir in Paraná state, and provided a basis for future works using diatoms as bioindicators of trophic water conditions. Samples were collected quarterly, over a year, by removing the biofilm attached to Polygonum sp. stems and to glass slides. The slides were placed in wooden frames and remained submersed for 30 days to colonize. The taxonomic study resulted in 11 new taxonomic records for Paraná state among the 96 identified diatoms. The highest species diversity was found in the macrophyte

Dynamical evolution of star-forming regions - II. Basic kinematics

Science.gov (United States)

Parker, Richard J.; Wright, Nicholas J.

2016-04-01

We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

Science.gov (United States)

Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

2012-01-01

We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

WIDE-FIELD INFRARED SURVEY EXPLORER OBSERVATIONS OF THE EVOLUTION OF MASSIVE STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Padgett, D. L.; Rebull, L. M.; Assef, R. J.

2012-01-01

We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworks hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

A RECENT ACCRETION BURST IN THE LOW-MASS PROTOSTAR IRAS 15398-3359: ALMA IMAGING OF ITS RELATED CHEMISTRY

International Nuclear Information System (INIS)

Jørgensen, Jes K.; Brinch, Christian; Lindberg, Johan E.; Bisschop, Suzanne E.; Visser, Ruud; Bergin, Edwin A.; Sakai, Nami; Yamamoto, Satoshi; Harsono, Daniel; Van Dishoeck, Ewine F.; Persson, Magnus V.

2013-01-01

Low-mass protostars have been suggested to show highly variable accretion rates throughout their evolution. Such changes in accretion, and related heating of their ambient envelopes, may trigger significant chemical variations on different spatial scales and from source-to-source. We present images of emission from C 17 O, H 13 CO + , CH 3 OH, C 34 S and C 2 H toward the low-mass protostar IRAS 15398-3359 on 0.''5 (75 AU diameter) scales with the Atacama Large Millimeter/submillimeter Array at 340 GHz. The resolved images show that the emission from H 13 CO + is only present in a ring-like structure with a radius of about 1-1.''5 (150-200 AU) whereas the CO and other high dipole moment molecules are centrally condensed toward the location of the central protostar. We propose that HCO + is destroyed by water vapor present on small scales. The origin of this water vapor is likely an accretion burst during the last 100-1000 yr increasing the luminosity of IRAS 15398-3359 by a factor of 100 above its current luminosity. Such a burst in luminosity can also explain the centrally condensed CH 3 OH and extended warm carbon-chain chemistry observed in this source and furthermore be reflected in the relative faintness of its compact continuum emission compared to other protostars

The Topology of Large-Scale Structure in the 1.2 Jy IRAS Redshift Survey

Science.gov (United States)

Protogeros, Zacharias A. M.; Weinberg, David H.

1997-11-01

We measure the topology (genus) of isodensity contour surfaces in volume-limited subsets of the 1.2 Jy IRAS redshift survey, for smoothing scales λ = 4, 7, and 12 h-1 Mpc. At 12 h-1 Mpc, the observed genus curve has a symmetric form similar to that predicted for a Gaussian random field. At the shorter smoothing lengths, the observed genus curve shows a modest shift in the direction of an isolated cluster or ``meatball'' topology. We use mock catalogs drawn from cosmological N-body simulations to investigate the systematic biases that affect topology measurements in samples of this size and to determine the full covariance matrix of the expected random errors. We incorporate the error correlations into our evaluations of theoretical models, obtaining both frequentist assessments of absolute goodness of fit and Bayesian assessments of models' relative likelihoods. We compare the observed topology of the 1.2 Jy survey to the predictions of dynamically evolved, unbiased, gravitational instability models that have Gaussian initial conditions. The model with an n = -1 power-law initial power spectrum achieves the best overall agreement with the data, though models with a low-density cold dark matter power spectrum and an n = 0 power-law spectrum are also consistent. The observed topology is inconsistent with an initially Gaussian model that has n = -2, and it is strongly inconsistent with a Voronoi foam model, which has a non-Gaussian, bubble topology.

76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms

Science.gov (United States)

2011-07-15

... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

Planetary transit candidates in Corot-IRa01 field

Science.gov (United States)

Carpano, S.; Cabrera, J.; Alonso, R.; Barge, P.; Aigrain, S.; Almenara, J.-M.; Bordé, P.; Bouchy, F.; Carone, L.; Deeg, H. J.; de La Reza, R.; Deleuil, M.; Dvorak, R.; Erikson, A.; Fressin, F.; Fridlund, M.; Gondoin, P.; Guillot, T.; Hatzes, A.; Jorda, L.; Lammer, H.; Léger, A.; Llebaria, A.; Magain, P.; Moutou, C.; Ofir, A.; Ollivier, M.; Janot-Pacheco, E.; Pätzold, M.; Pont, F.; Queloz, D.; Rauer, H.; Régulo, C.; Renner, S.; Rouan, D.; Samuel, B.; Schneider, J.; Wuchterl, G.

2009-10-01

Context: CoRoT is a pioneering space mission devoted to the analysis of stellar variability and the photometric detection of extrasolar planets. Aims: We present the list of planetary transit candidates detected in the first field observed by CoRoT, IRa01, the initial run toward the Galactic anticenter, which lasted for 60 days. Methods: We analysed 3898 sources in the coloured bands and 5974 in the monochromatic band. Instrumental noise and stellar variability were taken into account using detrending tools before applying various transit search algorithms. Results: Fifty sources were classified as planetary transit candidates and the most reliable 40 detections were declared targets for follow-up ground-based observations. Two of these targets have so far been confirmed as planets, CoRoT-1b and CoRoT-4b, for which a complete characterization and specific studies were performed. The CoRoT space mission, launched on December 27th 2006, has been developed and is operated by CNES, with contributions from Austria, Belgium, Brazil, ESA, Germany, and Spain. Four French laboratories associated with the CNRS (LESIA, LAM, IAS ,OMP) collaborate with CNES on the satellite development. First CoRoT data are available to the public from the CoRoT archive: http://idoc-corot.ias.u-psud.fr.

Molecular jet of IRAS 04166+2706

Energy Technology Data Exchange (ETDEWEB)

Wang, Liang-Yao [Graduate Institute of Astronomy and Astrophysics, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China); Shang, Hsien; Su, Yu-Nung; Hirano, Naomi; Lee, Chin-Fei [Academia Sinica, Institute of Astrophysics (ASIAA), P.O. Box 23141, Taipei 106, Taiwan (China); Santiago-García, Joaquín [Instituto de Radioastronomía Milimétrica (IRAM), Avenida Divina Pastora 7, Núcleo Central, E-18012 Granada (Spain); Tafalla, Mario [Observatorio Astronómico Nacional (IGN), Alfonso XII 3, E-28014 Madrid (Spain); Zhang, Qizhou, E-mail: lywang@asiaa.sinica.edu.tw [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

2014-01-01

The molecular outflow from IRAS 04166+2706 was mapped with the Submillimeter Array at a 350 GHz continuum and CO J = 3-2 at an angular resolution of ∼1''. The field of view covers the central arcminute, which contains the inner four pairs of knots of the molecular jet. On the channel map, conical structures are clearly present in the low-velocity range (|V – V {sub 0}| < 10 km s{sup –1}), and the highly collimated knots appear in the extremely high velocity range (50 >|V – V {sub 0}| > 30 km s{sup –1}). The higher angular resolution of ∼1'' reveals the first blue-shifted knot (B1) that was missing in previous Plateau de Bure Interferometer observation of Santiago-García et al. at an offset of ∼6'' to the northeast of the central source. This identification completes the symmetric sequence of knots in both the blue- and red-shifted lobes of the outflow. The innermost knots R1 and B1 have the highest velocities within the sequence. Although the general features appear to be similar to previous CO J = 2-1 images in Santiago-García et al., the emission in CO J = 3-2 almost always peaks further away from the central source than that of CO J = 2-1 in the red-shifted lobe of the channel maps. This gives rise to a gradient in the line-ratio map of CO J = 3-2/J = 2-1 from head to tail within a knot. A large velocity gradient analysis suggests that the differences may reflect a higher gas kinetic temperature at the head. We also explore possible constraints imposed by the nondetection of SiO J = 8-7.

The environment and star formation of H II region Sh2-163: a multi-wavelength study

Science.gov (United States)

Yu, Naiping; Wang, Jun-Jie; Li, Nan

2014-12-01

To investigate the environment of H II region Sh2-163 and search for evidence of triggered star formation in this region, we performed a multi-wavelength study of this H II region. Most of our data were taken from large-scale surveys: 2MASS, CGPS, MSX and SCUBA. We also made CO molecular line observations, using the 13.7-m telescope. The ionized region of Sh2-163 is detected by both the optical and radio continuum observations. Sh2-163 is partially bordered by an arc-like photodissociation region (PDR), which is coincident with the strongest optical and radio emissions, indicating interactions between the H II region and the surrounding interstellar medium. Two molecular clouds were discovered on the border of the PDR. The morphology of these two clouds suggests they are compressed by the expansion of Sh2-163. In cloud A, we found two molecular clumps. And it seems star formation in clump A2 is much more active than in clump A1. In cloud B, we found new outflow activities and massive star(s) are forming inside. Using 2MASS photometry, we tried to search for embedded young stellar object (YSO) candidates in this region. The very good agreement between CO emission, infrared shell and YSOs suggest that it is probably a star formation region triggered by the expansion of Sh2-163. We also found the most likely massive protostar related to IRAS 23314+6033.

77 FR 67792 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms

Science.gov (United States)

2012-11-14

... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... offered in the Northeast region. Exemption programs may allow a vessel to fish in an area that is limited.... Vessels are also required to request gillnet and lobster tags through the Northeast region permit office...

Planck early results. XIX. All-sky temperature and dust optical depth from Planck and IRAS. Constraints on the "dark gas" in our Galaxy

DEFF Research Database (Denmark)

Poutanen, T.; Natoli, P.; Polenta, G.

2011-01-01

An all sky map of the apparent temperature and optical depth of thermal dust emission is constructed using the Planck-HFI (350μm to 2 mm) andIRAS(100μm) data. The optical depth maps are correlated with tracers of the atomic (Hi) and molecular gas traced by CO. The correlation with the column dens...

Observations of star-forming regions with the Midcourse Space Experiment

NARCIS (Netherlands)

Kraemer, KE; Shipman, RF; Price, SD; Mizuno, DR; Kuchar, T; Carey, SJ

We have imaged seven nearby star-forming regions, the Rosette Nebula, the Orion Nebula, W3, the Pleiades, G300.2-16.8, S263, and G159.6-18.5, with the Spatial Infrared Imaging Telescope on the Midcourse Space Experiment (MSX) satellite at 1800 resolution at 8.3, 12.1, 14.7, and 21.3 mum. The large

Water in low-mass star-forming regions with Herschel

DEFF Research Database (Denmark)

Kristensen, L. E.; Visser, R.; Van Dishoeck, E. F.

2010-01-01

"Water In Star-forming regions with Herschel" (WISH) is a key programme dedicated to studying the role of water and related species during the star-formation process and constraining the physical and chemical properties of young stellar objects. The Heterodyne Instrument for the Far-Infrared (HIF...

Implications of the IRAS data for galactic gamma-ray astronomy and EGRET

International Nuclear Information System (INIS)

Stecker, F.W.

1990-01-01

Using the results of gamma-ray, millimeter wave and far infrared surveys of the galaxy, one can derive a logically consistent picture of the large scale distribution of galactic gas and cosmic rays, one tied to the overall processes of stellar birth and destruction on a galactic scale. Using the results of the IRAS far-infrared survey of the galaxy, the large scale radial distributions of galactic far-infrared emission were obtained independently for both the northern and southern hemisphere sides of the Galaxy. It was found that the dominant feature in these distributions to be a broad peak coincident with the 5 kpc molecular gas cloud ring. Also found was evidence of spiral arm features. Strong correlations are evident between the large scale galactic distributions of far infrared emission, gamma-ray emission and total CO emission. There is a particularly tight correlation between the distribution of warm molecular clouds and far-infrared emission on a galactic scale

RECTIFIED ASTEROID ALBEDOS AND DIAMETERS FROM IRAS AND MSX PHOTOMETRY CATALOGS

International Nuclear Information System (INIS)

Ryan, Erin Lee; Woodward, Charles E.

2010-01-01

Rectified diameters and albedo estimates of 1517 main-belt asteroids selected from IRAS and the Mid-Course Space Experiment asteroid photometry catalogs are derived from updated infrared thermal models, the Standard Thermal Model and the Near-Earth Asteroid Thermal Model (NEATM), and Monte Carlo simulations, using new Minor Planet Center compilations of absolute magnitudes (H values) constrained by occultation- and radar-derived parameters. The NEATM approach produces a more robust estimate of albedos and diameters, yielding albedos of p v (NEATM mean) =0.081 ± 0.064. The asteroid beaming parameter (η) for the selected asteroids has a mean value of 1.07 ± 0.27, and the smooth distribution of η suggests that this parameter is independent of asteroid properties such as composition. No trends in η due to size-dependent rotation rates are evident. Comparison of derived values of η as a function of taxonomic type indicates that the beaming parameter values for S- and C-type asteroids are identical within the standard deviation of the population of beaming parameters.

Far-infrared data for symbiotic stars. II. The IRAS survey observations

International Nuclear Information System (INIS)

Kenyon, S.J.; Fernandez-Castro, T.; Stencel, R.E.

1988-01-01

IRAS survey data for all known symbiotic binaries are reported. S type systems have 25 micron excesses much larger than those of single red giant stars, suggesting that these objects lose mass more rapidly than do normal giants. D type objects have far-IR colors similar to those of Mira variables, implying mass-loss rate of about 10 to the -6th solar masses/yr. The near-IR extinctions of the D types indicate that their Mira components are enshrouded in optically thick dust shells, while their hot companions lie outside the shells. If this interpretation of the data is correct, then the very red near-IR colors of D type symbiotic stars are caused by extreme amounts of dust absorption rather than dust emission. The small group of D prime objects possesses far-IR colors resembling those of compact planetary nebulae or extreme OH/IR stars. It is speculated that these binaries are not symbiotic stars at all, but contain a hot compact star and an exasymptotic branch giant which is in the process of ejecting a planetary nebula shell. 42 references

HUBBLE'S PANORAMIC PORTRAIT OF A VAST STAR-FORMING REGION

Science.gov (United States)

2002-01-01

NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

Energy Technology Data Exchange (ETDEWEB)

Izumi, Natsuko; Yasui, Chikako; Saito, Masao [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kobayashi, Naoto; Hamano, Satoshi, E-mail: natsuko.izumi@nao.ac.jp [Laboratory of Infrared High-resolution spectroscopy (LIH), Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan)

2017-10-01

The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions in the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.

The ALMA Protostellar Interferometric Line Survey (PILS). First results from an unbiased submillimeter wavelength line survey of the Class 0 protostellar binary IRAS 16293-2422 with ALMA

Science.gov (United States)

Jørgensen, J. K.; van der Wiel, M. H. D.; Coutens, A.; Lykke, J. M.; Müller, H. S. P.; van Dishoeck, E. F.; Calcutt, H.; Bjerkeli, P.; Bourke, T. L.; Drozdovskaya, M. N.; Favre, C.; Fayolle, E. C.; Garrod, R. T.; Jacobsen, S. K.; Öberg, K. I.; Persson, M. V.; Wampfler, S. F.

2016-11-01

Context. The inner regions of the envelopes surrounding young protostars are characterized by a complex chemistry, with prebiotic molecules present on the scales where protoplanetary disks eventually may form. The Atacama Large Millimeter/submillimeter Array (ALMA) provides an unprecedented view of these regions zooming in on solar system scales of nearby protostars and mapping the emission from rare species. Aims: The goal is to introduce a systematic survey, the Protostellar Interferometric Line Survey (PILS), of the chemical complexity of one of the nearby astrochemical templates, the Class 0 protostellar binary IRAS 16293-2422, using ALMA in order to understand the origin of the complex molecules formed in its vicinity. In addition to presenting the overall survey, the analysis in this paper focuses on new results for the prebiotic molecule glycolaldehyde, its isomers, and rarer isotopologues and other related molecules. Methods: An unbiased spectral survey of IRAS 16293-2422 covering the full frequency range from 329 to 363 GHz (0.8 mm) has been obtained with ALMA, in addition to a few targeted observations at 3.0 and 1.3 mm. The data consist of full maps of the protostellar binary system with an angular resolution of 0.5'' (60 AU diameter), a spectral resolution of 0.2 km s-1, and a sensitivity of 4-5 mJy beam-1 km s-1, which is approximately two orders of magnitude better than any previous studies. Results: More than 10 000 features are detected toward one component in the protostellar binary, corresponding to an average line density of approximately one line per 3 km s-1. Glycolaldehyde; its isomers, methyl formate and acetic acid; and its reduced alcohol, ethylene glycol, are clearly detected and their emission well-modeled with an excitation temperature of 300 K. For ethylene glycol both lowest state conformers, aGg' and gGg', are detected, the latter for the first time in the interstellar medium (ISM). The abundance of glycolaldehyde is comparable to or

Journal of Astrophysics and Astronomy | Indian Academy of Sciences

Indian Academy of Sciences (India)

Three Galactic star forming regions associated with W3(OH), S209 and S187 have been simultaneously mapped in two trans-IRAS far infrared (FIR) bands centered at ∼ 140 and 200m using the TIFR 100 cm balloon borne FIR telescope. These maps showextended FIR emission with structures. The HIRES processed ...

INTERMEDIATE-MASS HOT CORES AT ∼500 AU: DISKS OR OUTFLOWS?

International Nuclear Information System (INIS)

Palau, Aina; Girart, Josep M.; Fuente, Asunción; Alonso-Albi, Tomás; Fontani, Francesco; Sánchez-Monge, Álvaro; Boissier, Jérémie; Piétu, Vincent; Neri, Roberto; Busquet, Gemma; Estalella, Robert; Zapata, Luis A.; Zhang, Qizhou; Ho, Paul T. P.; Audard, Marc

2011-01-01

Observations with the Plateau de Bure Interferometer in the most extended configuration toward two intermediate-mass star-forming regions, IRAS 22198+6336 and AFGL 5142, reveal the presence of several complex organic molecules at ∼500 AU scales, confirming the presence of hot cores in both regions. The hot cores are not rich in CN-bearing molecules, as often seen in massive hot cores, and are mainly traced by CH 3 CH 2 OH, (CH 2 OH) 2 , CH 3 COCH 3 , and CH 3 OH, with, additionally, CH 3 CHO, CH 3 OD, and HCOOD for IRAS 22198+6336, and C 6 H and O 13 CS for AFGL 5142. The emission of complex molecules is resolved down to sizes of ∼300 and ∼600 AU, for IRAS 22198+6336 and AFGL 5142, respectively, and most likely is tracing protostellar disks rather than flattened envelopes or toroids as is usually found. This is especially clear for the case of IRAS 22198+6336, where we detect a velocity gradient for all the mapped molecules perpendicular to the most chemically rich outflow of the region, yielding a dynamic mass ∼> 4 M ☉ . As for AFGL 5142, the hot core emission is resolved into two elongated cores separated ∼1800 AU. A detailed comparison of the complex molecule peaks to the new CO (2-1) data and H 2 O maser data from the literature suggests also that for AFGL 5142 the complex molecules are mainly associated with disks, except for a faint and extended molecular emission found to the west, which is possibly produced in the interface between one of the outflows and the dense surrounding gas.

CONSTRAINING THE ABUNDANCES OF COMPLEX ORGANICS IN THE INNER REGIONS OF SOLAR-TYPE PROTOSTARS

Energy Technology Data Exchange (ETDEWEB)

Taquet, Vianney; Charnley, Steven B. [Astrochemistry Laboratory and The Goddard Center for Astrobiology, Mailstop 691, NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20770 (United States); López-Sepulcre, Ana; Ceccarelli, Cecilia; Kahane, Claudine [Univ. Grenoble Alpes, IPAG, F-38000 Grenoble (France); Neri, Roberto, E-mail: taquet@strw.leidenuniv.nl [Institut de Radioastronomie Millimétrique, Grenoble (France)

2015-05-10

The high abundances of Complex Organic Molecules (COMs) with respect to methanol, the most abundant COM, detected toward low-mass protostars, tend to be underpredicted by astrochemical models. This discrepancy might come from the large beam of the single-dish telescopes, encompassing several components of the studied protostar, commonly used to detect COMs. To address this issue, we have carried out multi-line observations of methanol and several COMs toward the two low-mass protostars NGC 1333-IRAS 2A and -IRAS 4A with the Plateau de Bure interferometer at an angular resolution of 2″, resulting in the first multi-line detection of the O-bearing species glycolaldehyde and ethanol and of the N-bearing species ethyl cyanide toward low-mass protostars other than IRAS 16293. The high number of detected transitions from COMs (more than 40 methanol transitions for instance) allowed us to accurately derive the source size of their emission and the COM column densities. The COM abundances with respect to methanol derived toward IRAS 2A and IRAS 4A are slightly, but not substantitally, lower than those derived from previous single-dish observations. The COM abundance ratios do not vary significantly with the protostellar luminosity, over five orders of magnitude, implying that low-mass hot corinos are quite chemically rich as high-mass hot cores. Astrochemical models still underpredict the abundances of key COMs, such as methyl formate or di-methyl ether, suggesting that our understanding of their formation remains incomplete.

Estudio clínico-epidemiológico y molecular de Metapneumovirus Humano en pacientes con Infecciones Respiratorias Agudas (IRA) en Venezuela

OpenAIRE

Tovar H, Cerraf E; Moncho S, Alessandra; Fernandez S, David; Aguilar M, Marwan S; Morón, Dulce

2014-01-01

El Metapneumovirus Humano (MPVh) ha sido asociado con Infecciones Respiratorias Agudas (IRA) en pacientes de todas las edades. Estudios epidemiológicos indican la prevalencia del MPVh alrededor del mundo, sin embargo, en Venezuela poco se conoce sobre su comportamiento en la población. Este estudio pretende describir el comportamiento epidemiológico de la infección por MPVh en pacientes venezolanos. Se evaluaron por RT-PCR multiplex 1812 hisopados nasales (HN) provenientes de pacientes con di...

The 1.5 Ms Observing Campaign on IRAS 13224-3809: X-ray Spectral Analysis I.

Science.gov (United States)

Jiang, J.; Parker, M. L.; Fabian, A. C.; Alston, W. N.; Buisson, D. J. K.; Cackett, E. M.; Chiang, C.-Y.; Dauser, T.; Gallo, L. C.; García, J. A.; Harrison, F. A.; Lohfink, A. M.; De Marco, B.; Kara, E.; Miller, J. M.; Miniutti, G.; Pinto, C.; Walton, D. J.; Wilkins, D. R.

2018-03-01

We present a detailed spectral analysis of the recent 1.5 Ms XMM-Newton observing campaign on the narrow line Seyfert 1 galaxy IRAS 13224-3809, taken simultaneously with 500 ks of NuSTAR data. The X-ray lightcurve shows three flux peaks, registering at about 100 times the minimum flux seen during the campaign, and rapid variability with a time scale of kiloseconds. The spectra are well fit with a primary powerlaw continuum, two relativistic-blurred reflection components from the inner accretion disk with very high iron abundance, and a simple blackbody-shaped model for the remaining soft excess. The spectral variability is dominated by the power law continuum from a corona region within a few gravitational radii from the black hole. Additionally, blueshifted Ne X, Mg XII, Si XIV and S XVI absorption lines are identified in the stacked low-flux spectrum, confirming the presence of a highly ionized outflow with velocity up to v = 0.263 and 0.229 c. We fit the absorption features with xstar models and find a relatively constant velocity outflow through the whole observation. Finally, we replace the bbody and supersolar abundance reflection models by fitting the soft excess successfully with the extended reflection model relxillD, which allows for higher densities than the standard relxill model. This returns a disk electron density ne > 1018.7 cm-3 and lowers the iron abundance from Z_Fe=24^{+3}_{-4}Z_⊙ with ne ≡ 1015 cm-3 to Z_Fe=6.6^{+0.8}_{-2.1}Z_⊙.

Local work-function changes of Pt(111) studied by STM and IRAS: coadsorption of Cl - with H 3O +, NO, and CO molecules

Science.gov (United States)

Fukushima, Takashi; Song, Moon-Bong; Ito, Masatoki

2000-10-01

The coadsorption of chloride anion (Cl -) with hydronium cation (H 3O +), nitrogen monoxide (NO), and carbon monoxide (CO) on Pt(111) was studied in an ultra-high-vacuum system using scanning tunneling microscopy (STM), infrared reflection absorption spectroscopy (IRAS), and low-energy electron diffraction (LEED). HCl molecules adsorbed on Pt(111) at 100 K form a (3×3) structure ( θCl -=0.44). Water adsorption on the 3×3 structure produces c(4×2)-(Cl -+H 3O +) coadsorption structures. The hydronium cation adsorbs through oxygen lone pair, and hydrogen bonding (OH…Cl) extends on the surface with these structures. Stretching absorption bands of NO (or CO) adsorbed on the 3×3-Cl - and c(4×2)-(Cl -+H 3O +) adlayers on Pt(111) show remarkably higher and lower frequency shifts, respectively. The frequency shifts can be explained by the local charge density states of platinum atoms derived from electron withdrawal or supply from the coadsorbates (Cl - or H 3O +) to platinum atoms.

High-resolution observations of IRAS 08544-4431. Detection of a disk orbiting a post-AGB star and of a slow disk wind

Science.gov (United States)

Bujarrabal, V.; Castro-Carrizo, A.; Winckel, H. Van; Alcolea, J.; Contreras, C. Sánchez; Santander-García, M.; Hillen, M.

2018-06-01

Context. Aims: In order to study the effects of rotating disks in the post-asymptotic giant branch (post-AGB) evolution, we observe a class of binary post-AGB stars that seem to be systematically surrounded by equatorial disks and slow outflows. Although the rotating dynamics had only been well identified in three cases, the study of such structures is thought to be fundamental to the understanding of the formation of disks in various phases of the late evolution of binary stars and the ejection of planetary nebulae from evolved stars. Methods: We present ALMA maps of 12CO and 13CO J = 3-2 lines in the source IRAS 08544-4431, which belongs to the above mentioned class of objects. We analyzed the data by means of nebula models, which account for the expectedly composite source and can reproduce the data. From our modeling, we estimated the main nebula parameters, including the structure and dynamics and the density and temperature distributions. We discuss the uncertainties of the derived values and, in particular, their dependence on the distance. Results: Our observations reveal the presence of an equatorial disk in rotation; a low-velocity outflow is also found, probably formed of gas expelled from the disk. The main characteristics of our observations and modeling of IRAS 08544-4431 are similar to those of better studied objects, confirming our interpretation. The disk rotation indicates a total central mass of about 1.8 M⊙, for a distance of 1100 pc. The disk is found to be relatively extended and has a typical diameter of 4 × 1016 cm. The total nebular mass is 2 × 10-2 M⊙, of which 90% corresponds to the disk. Assuming that the outflow is due to mass loss from the disk, we derive a disk lifetime of 10 000 yr. The disk angular momentum is found to be comparable to that of the binary system at present. Assuming that the disk angular momentum was transferred from the binary system, as expected, the high values of the disk angular momentum in this and other

Infrared spectrophotometry of Comet IRAS-Araki-Alcock (1983d) - A bare nucleus revealed?

Science.gov (United States)

Hanner, M. S.; Aitken, D. K.; Knacke, R.; Mccorkle, S.; Roche, P. F.; Tokunaga, A. T.

1985-01-01

Spectra of the central core and surrounding coma of Comet IRAS-Araki-Alcock (1983d) were obtained at 8-13 microns on May 11 and 2-4 microns on May 12, 1983. Spatially resolved measurements at 10 microns with a 4-arcsec beam showed that the central core was more than 100 times brighter than the inner coma only 8 arcsec away; for radially outflowing dust, the brightness ratio would be a factor of 8. The observations of the central core are consistent with direct detection of a nucleus having a radius of approximately 5 km. The temperature of the sunlit hemisphere was greater than 300 K. Spectra of the core are featureless, while spectra of the coma suggest weak silicate emission. The spectra show no evidence for icy grains. The dust production rate on May 11.4 was about 100,000 g/sec, assuming that the gas flux from the dust-producing areas on the nucleus was about 0.00001 g/sq cm per sec.

Distribution and origin of polycyclic aromatic hydrocarbons in surface sediments from an urban river basin at the Metropolitan region of Curitiba, Brazil.

Science.gov (United States)

Leite, Natalicio Ferreira; Peralta-Zamora, Patricio; Grassi, Marco Tadeu

2011-01-01

The concentrations of 16 polycyclic aromatic hydrocarbons (PAHs) were determined in surface sediment samples from nine sites located at the Iguaçu River Basin in the Metropolitan Region of Curitiba, Brazil to evaluate their distribution and sources. The total concentration of the PAHs was greater for sediments from highly urbanized areas, while the sediments from the Iraí Environmental Protection Area (Iraí EPA) showed significantly low concentrations. The sediments from the Iguaçu and Barigui rivers were classified as highly contaminated, while those from the Cercado and Curralinho rivers were classified as moderately contaminated. The predominance of PAHs containing two to four aromatic rings in most of the samples suggested the direct input of raw sewage into the water resources evaluated. Benzo[g,h,i]perylene, dibenzo[a,h]anthracene and indeno[1,2,3-cd]pyrene were predominant in sediments from the areas under the greatest urban and industrial development. The correlation between thermodynamic stability and the kinetics of evolution presented by the isomeric pairs indicated that combustion is the predominant source of PAHs in the sediments because the combustion of fossil fuels affected most of the points evaluated, followed by combustion of biomass and eventually combustion of oil product inputs. In general, the results showed that areas under strong urban influence, as well as the Iraí EPA, receive contributions of PAHs from similar sources.

Commuting behaviour and urban form: a longitudinal study of a polycentric urban region in Denmark

DEFF Research Database (Denmark)

Grunfelder, Julien; Nielsen, Thomas Alexander Sick

2012-01-01

is a polycentric urban region in Denmark. Data from the National Transport Survey of Denmark were used for this quantitative analysis and two time periods were selected to highlight any potential changes over time. Empirical findings indicate that urban form and location variables help to explain the three......This paper is an empirical investigation of the relation between urban form and commuting behaviour in a polycentric urban region. It explores to what extent urban form and location variables help to explain commuting time, distance and mode based on an empirical case, East Jutland, which...... selected aspects of commuting. However, urban form variables have greater explanatory power in explaining commuting modes than commuting time and commuting distance. No general trends in commuting were detectable from the data. Finally, the empirical findings revealed specificities of the case study...

El medio interestelar en los alrededores de la region HII Sh2-183

Science.gov (United States)

Cichowolski, S.; Cappa, C. E.; Blanco, A.; Eppens, L.; Ertini, K.; Leiva, M. M.

2017-10-01

We present a multiwavelength study of the HII region Sh2-183, located at (,) = (123.3,+3.0) at a distance of 7.0 1.5 kpc from the Sun. Based on the radio continuum data we estimated the amount of ionized gas, the electronic density, and the number of ionizing photons needed to keep the region ionized, which is important since the star/s responsible of the region was/were not detected yet. On the other hand, based on IRAS data we have analyzed the dust temperature and distribution. The Hi line data allowed the detection of a shell-like structure surrounding the ionized gas and the CO data revealed the presence of 6 molecular clouds probably related to Sh2-183, which harbor several young stellar object candidates.

VLA Ammonia Observations of IRAS 16253-2429: A Very Young and Low Mass Protostellar System

Science.gov (United States)

Wiseman, Jennifer J.

2011-01-01

IRAS l6253-2429. the source of the Wasp-Waist Nebula seen in Spitzer IRAC images, is an isolated very low luminosity ("VeLLO") Class 0 protostar in the nearby rho Ophiuchi cloud. We present VLA ammonia mapping observations of the dense gas envelope feeding the central core accreting system. We find a flattened envelope perpendicular to the outflow axis, and gas cavities that appear to cradle the outflow lobes as though carved out by the flow and associated (apparently precessing) jet. Based on the NH3 (1,1) and (2,2) emission distribution, we derive the mass, velocity fields and temperature distribution for the envelope. We discuss the combined evidence for this source as possibly one of the youngest and lowest mass sources in formation yet known.

The Structure of the Nearby Giant Star-Forming Region 30 Doradus

Science.gov (United States)

Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

2007-08-01

The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

H2O masers in star-forming regions

International Nuclear Information System (INIS)

Downes, D.

1985-01-01

Water vapour near star forming regions was first detected by Cheung et al. (1969) and shortly thereafter was recognised to be maser emission. In spite of this 15 year history of H 2 O observations, the problem of interpreting such strong H 2 O masers as W49 and Orion is still very acute. Not one of the models now available can explain in an unconstrained fashion why a very large maser flux can emanate from clouds of such small size. Whereas some models proposed to explain OH masers have retained their plausibility under the pressure of new observations, H 2 O models have not. The author outlines the background of the H 2 O problem, stating that the strongest of the masers discovered are still not satisfactorily explained today. (Auth.)

Planck intermediate results XXIX. All-sky dust modelling with Planck, IRAS, and WISE observations

DEFF Research Database (Denmark)

Ade, P. A. R.; Aghanim, N.; Alves, M. I. R.

2016-01-01

We present all-sky modelling of the high resolution Planck, IRAS, andWISE infrared (IR) observations using the physical dust model presented by Draine & Li in 2007 (DL, ApJ, 657, 810). We study the performance and results of this model, and discuss implications for future dust modelling....... The present work extends the DL dust modelling carried out on nearby galaxies using Herschel and Spitzer data to Galactic dust emission. We employ the DL dust model to generate maps of the dust mass surface density Sigma(Md), the dust optical extinction A(V), and the starlight intensity heating the bulk...... of the dust, parametrized by U-min. The DL model reproduces the observed spectral energy distribution (SED) satisfactorily over most of the sky, with small deviations in the inner Galactic disk and in low ecliptic latitude areas, presumably due to zodiacal light contamination. In the Andromeda galaxy (M31...

A utilização da solução natural de eucalipto nas nebulizações, como auxiliar nos tratamentos das infecções respiratórias agudas: (IRA

Directory of Open Access Journals (Sweden)

Ana Tania Lopes Sampaio Alves

1992-09-01

Full Text Available Em um total de 4.625 consultas médicas à criança menor de 5 anos, durante um período de 7 meses, foram diagnosticados 936 casos de infecções respiratórias agudas (20,2%. Estudou-se algumas características clínicas e fatores de risco mais comumente encontradas em cada tipo catalogado de IRA. O mais freqüente sintoma foi o desconforto respiratório moderado. O presente trabalho tem por objetivo relatar a experiência vivenciada em Macaíba/RN (F.SESP, relacionada à adaptação do uso da solução natural de eucalipto manipulada pela equipe de enfermagem em substituição às convenientemente utilizadas, ou seja, as soluções farmacológicas, em Inalações de crianças com IRA.

Water in Star-forming Regions with Herschel (WISH): recent results and trends

Science.gov (United States)

van Dishoeck, E. F.

2012-03-01

Water is a key molecule in the physics and chemistry of star- and planet-forming regions. In the `Water in Star-forming Regions with Herschel' (WISH) Key Program, we have obtained a comprehensive set of water data toward a large sample of well-characterized protostars, covering a wide range of masses and luminosities --from the lowest to the highest mass protostars--, as well as evolutionary stages --from pre-stellar cores to disks. Lines of both ortho- and para-H_2O and their isotopologues, as well as chemically related hydrides, are observed with the HIFI and PACS instruments. The data elucidate the physical processes responsible for the warm gas, probe dynamical processes associated with forming stars and planets (outflow, infall, expansion), test basic chemical processes and reveal the chemical evolution of water and the oxygen-reservoir into planet-forming disks. In this brief talk a few recent WISH highlights will be presented, including determinations of the water abundance in each of the different physical components (inner and outer envelope, outflow) and constraints on the ortho/para ratio. Special attention will be given to trends found across the sample, especially the similarity in profiles from low to high-mass protostars and the evolution of the gas-phase water abundance from prestellar cores to disks. More details can be found at http://www.strw.leidenuniv.nl/WISH, whereas overviews are given in van Dishoeck et al. (2011, PASP 123, 138), Kristensen & van Dishoeck (2011, Astronomische Nachrichten 332, 475) and Bergin & van Dishoeck (2012, Phil. Trans. Royal Soc. A).

THE DISK POPULATION OF THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.

2010-01-01

We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 μm that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg 2 ) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Through these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is ∼75% for solar-mass stars and declines to ∼45% for low-mass stars and brown dwarfs (0.01-0.3 M sun ). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower (∼20%) in IC 348 and σ Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for ∼200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks. The ratio of the number of evolved and

Problems of regional innovation strategy forming

Directory of Open Access Journals (Sweden)

I. M. Golova

2010-09-01

Full Text Available The author considered problems and contradictions of modern innovation policy in Russia. It is shown, that at present time regions are removed from management of science-technical complex and spatial priorities are not produced. It is a serious factor of risk for conservation perspectives of innovation development for Russia. With taking into account of world experience main districts of rise effects regional police were formulated. It is underlined, that creation conditions for transformation of regional authorities in active subjects of innovation policy is necessary condition for building vital innovation system. It is shown, that state innovation policy must be constructed at combination of next principles: a support science-technical potential of regions — generators of innovation and creation conditions for its realization; b using of innovations for evening-out disproportions of social-economic development between regions; c widening powers and financial possibilities of regions at management of innovation climate. Methodical approaches for making effective mechanisms of management of innovation processes of territory are opened. Typology of Russian regions with high and middle degree of innovation climate is proposed, which takes level of science and innovation potential of territory and also degree of comfort of social-economic conditions for development of innovation activity are offered. Peculiarities of innovation strategy for different types of regions are defined. This typology may be used for substantiation spatial priorities of innovation strategy of Russia.

Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI

DEFF Research Database (Denmark)

O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine

2013-01-01

of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...

INTERMEDIATE-MASS HOT CORES AT {approx}500 AU: DISKS OR OUTFLOWS?

Energy Technology Data Exchange (ETDEWEB)

Palau, Aina; Girart, Josep M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciencies, Torre C5-parell 2, 08193 Bellaterra, Catalunya (Spain); Fuente, Asuncion; Alonso-Albi, Tomas [Observatorio Astronomico Nacional, P.O. Box 112, 28803 Alcala de Henares, Madrid (Spain); Fontani, Francesco; Sanchez-Monge, Alvaro [Osservatorio Astrofisico di Arcetri, INAF, Largo E. Fermi 5, 50125 Firenze (Italy); Boissier, Jeremie [Istituto di Radioastronomia, INAF, Via Gobetti 101, Bologna (Italy); Pietu, Vincent; Neri, Roberto [IRAM, 300 Rue de la piscine, 38406 Saint Martin d' Heres (France); Busquet, Gemma [Istituto di Fisica dello Spazio Interplanetario, INAF, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, 00133 Roma (Italy); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut Ciencies Cosmos, Universitat Barcelona, Marti Franques 1, 08028 Barcelona (Spain); Zapata, Luis A. [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, P.O. Box 3-72, 58090 Morelia, Michoacan (Mexico); Zhang, Qizhou; Ho, Paul T. P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Audard, Marc, E-mail: palau@ieec.uab.es [Geneva Observatory, University of Geneva, Ch. des Maillettes 51, 1290 Versoix (Switzerland)

2011-12-20

Observations with the Plateau de Bure Interferometer in the most extended configuration toward two intermediate-mass star-forming regions, IRAS 22198+6336 and AFGL 5142, reveal the presence of several complex organic molecules at {approx}500 AU scales, confirming the presence of hot cores in both regions. The hot cores are not rich in CN-bearing molecules, as often seen in massive hot cores, and are mainly traced by CH{sub 3}CH{sub 2}OH, (CH{sub 2}OH){sub 2}, CH{sub 3}COCH{sub 3}, and CH{sub 3}OH, with, additionally, CH{sub 3}CHO, CH{sub 3}OD, and HCOOD for IRAS 22198+6336, and C{sub 6}H and O{sup 13}CS for AFGL 5142. The emission of complex molecules is resolved down to sizes of {approx}300 and {approx}600 AU, for IRAS 22198+6336 and AFGL 5142, respectively, and most likely is tracing protostellar disks rather than flattened envelopes or toroids as is usually found. This is especially clear for the case of IRAS 22198+6336, where we detect a velocity gradient for all the mapped molecules perpendicular to the most chemically rich outflow of the region, yielding a dynamic mass {approx}> 4 M{sub Sun }. As for AFGL 5142, the hot core emission is resolved into two elongated cores separated {approx}1800 AU. A detailed comparison of the complex molecule peaks to the new CO (2-1) data and H{sub 2}O maser data from the literature suggests also that for AFGL 5142 the complex molecules are mainly associated with disks, except for a faint and extended molecular emission found to the west, which is possibly produced in the interface between one of the outflows and the dense surrounding gas.

IRAS observations of dust heating and energy balance in the Rho Ophiuchi dark cloud

Science.gov (United States)

Greene, Thomas P.; Young, Erick T.

1989-01-01

The equilibrium process dust emission in the Rho Ophiuchi dark cloud is studied. The luminosity of the cloud is found to closely match the luminosity of the clouds's known embedded and external radiation sources. There is no evidence for a large population of undetected low-luminosity sources within the cloud and unknown external heating is also only a minor source of energy. Most of the cloud's luminosity is emitted in the mid-to-far-IR. Dust temperature maps indicate that the dust is not hot enough to heat the gas to observed temperatures. A simple cloud model with a radiation field composed of flux HD 147889, S1, and Sco OB2 associations predicts the observed IRAS 60 to 100 micron in-band flux ratios for a mean cloud density n(H2) = 1400. Flattened 12 and 25 micron observations show much extended emission in these bands, suggesting stochastic heating of very small grains or large molecules.

Electrochemical, atomic force microscopy and infrared reflection absorption spectroscopy studies of pre-formed mussel adhesive protein films on carbon steel for corrosion protection

Energy Technology Data Exchange (ETDEWEB)

Zhang, Fan, E-mail: fanzhang@kth.se [KTH Royal Institute of Technology, School of Chemical Science and Engineering, Department of Chemistry, Div. of Surface and Corrosion Science, Drottning Kristinas vaeg.51, SE-100 44 Stockholm (Sweden); Pan, Jinshan [KTH Royal Institute of Technology, School of Chemical Science and Engineering, Department of Chemistry, Div. of Surface and Corrosion Science, Drottning Kristinas vaeg.51, SE-100 44 Stockholm (Sweden); Claesson, Per Martin [KTH Royal Institute of Technology, School of Chemical Science and Engineering, Department of Chemistry, Div. of Surface and Corrosion Science, Drottning Kristinas vaeg.51, SE-100 44 Stockholm (Sweden); Institute for Surface Chemistry, P.O. Box 5607, SE-114 86 Stockholm (Sweden); Brinck, Tore [KTH Royal Institute of Technology, School of Chemical Science and Engineering, Department of Physical Chemistry, Division of Physical Chemistry, Teknikringen 36, SE-10044 Stockholm (Sweden)

2012-10-01

Electrochemical measurements, in situ and ex situ atomic force microscopy (AFM) experiments and infrared reflection absorption spectroscopy (IRAS) analysis were performed to investigate the formation and stability as well as corrosion protection properties of mussel adhesive protein (Mefp-1) films on carbon steel, and the influence of cross-linking by NaIO{sub 4} oxidation. The in situ AFM measurements show flake-like adsorbed protein aggregates in the film formed at pH 9. The ex situ AFM images indicate multilayer-like films and that the film becomes more compact and stable in NaCl solution after the cross-linking. The IRAS results reveal the absorption bands of Mefp-1 on carbon steel before and after NaIO{sub 4} induced oxidation of the pre-adsorbed protein. Within a short exposure time, a certain corrosion protection effect was noted for the pre-formed Mefp-1 film in 0.1 M NaCl solution. Cross-linking the pre-adsorbed film by NaIO{sub 4} oxidation significantly enhanced the protection efficiency by up to 80%. - Highlights: Black-Right-Pointing-Pointer Mussel protein was tested as 'green' corrosion protection strategy for steel. Black-Right-Pointing-Pointer At pH 9, the protein adsorbs on carbon steel and forms a multilayer-like film. Black-Right-Pointing-Pointer NaIO{sub 4} leads to structural changes and cross-linking of the protein film. Black-Right-Pointing-Pointer Cross-linking results in a dense and compact film with increased stability. Black-Right-Pointing-Pointer Cross-linking of preformed film significantly enhances the corrosion protection.

Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

Energy Technology Data Exchange (ETDEWEB)

Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

2017-11-01

Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated for global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.

The comparison of physical properties derived from gas and dust in a massive star-forming region

Energy Technology Data Exchange (ETDEWEB)

Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

2014-05-10

We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

The comparison of physical properties derived from gas and dust in a massive star-forming region

International Nuclear Information System (INIS)

Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

2014-01-01

We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

Shear viscosity of glass-forming melts in the liquid-glass transition region

International Nuclear Information System (INIS)

Sanditov, D. S.

2010-01-01

A new approach to interpreting the hole-activation model of a viscous flow of glass-forming liquids is proposed. This model underlies the development of the concept on the exponential temperature dependence of the free energy of activation of a flow within the range of the liquid-glass transition in complete agreement with available experimental data. The 'formation of a fluctuation hole' in high-heat glass-forming melts is considered as a small-scale low-activation local deformation of a structural network, i.e., the quasi-lattice necessary for the switching of the valence bond, which is the main elementary event of viscous flow of glasses and their melts. In this sense, the hole formation is a conditioned process. A drastic increase in the activation free energy of viscous flow in the liquid-glass transition region is explained by a structural transformation that is reduced to a limiting local elastic deformation of the structural network, which, in turn, originates from the excitation (critical displacement) of a bridging atom like the oxygen atom in the Si-O-Si bridge. At elevated temperatures, as a rule, a necessary amount of excited bridging atoms (locally deformed regions of the structural network) always exists, and the activation free energy of viscous flow is almost independent of temperature. The hole-activation model is closely connected with a number of well-known models describing the viscous flow of glass-forming liquids (the Avramov-Milchev, Nemilov, Ojovan, and other models).

Investigation on the geographical distribution and life form of plant species in sub alpine zone Karsanak region, Shahrekord

Directory of Open Access Journals (Sweden)

Jahanbakhsh Pairanj

2011-09-01

Full Text Available This study was carried out in rangelands of Karsanak, Chaharmahal and Bakhtiari province, which is regarded as one of the rich rangelands. Phytogeographically, this region is located in Irano-Turanian (zone of sub alpine. Endemic and rare plants were identified and geographical distribution and life form of identified plant species were investigated as well. Overall, 100 species from 17 families were identified from which 20 percent of identified species was endemic element of Irano-Turanian region. Results indicated that 75.7 percent of identified plants belonged to the Irano-Turanian and only 3 and 2 percent belonged to Euro-Siberian and Mediterranean regions respectively. The reason of high percentage of Irano-Turanian elements is probably the long distance of this region from other regions. Similarities of Irano-Turanian and Mediterranean were included 6.1 percent of identified plants and Irano-Turanian and Euro-Siberian included 2 percent. Results of life forms showed hemichryptophytes including 60 percent of life forms which indicate the cold and mountainous weather.

Does the Functional Form of the Association Between Education and Mortality Differ by U.S. Region?

Science.gov (United States)

Sheehan, Connor; Montez, Jennifer Karas; Sasson, Isaac

2018-01-01

To understand the education-mortality association among U.S. adults, recent studies have documented its national functional form. However, the functional form of education-mortality relationship may vary across geographic contexts. The four U.S. Census regions differ considerably in their social and economic policies, employment opportunities, income levels, and other factors that may affect how education lowers the risk of mortality. Thus, we documented regional differences in the functional form of the education-mortality association and examined the role of employment and income in accounting for regional differences. We used data on non-Hispanic white adults (2,981,672, person years) aged 45-84 in the 2000-2009 National Health Interview Survey, with Linked Mortality File through 2011 (37,598 deaths) and estimated discrete-time hazard models. The functional form of education and adult mortality was best characterized by credentialism in the Midwest, Northeast, and for Western men. For Western women, the association was linear, consistent with the human capital model. In the South, we observed a combination of mechanisms, with mortality risk declining with each year of schooling and a step change with high school graduation, followed by steeper decline thereafter. Our work adds to the increasing body of research that stresses the importance of contexts in shaping the education-mortality relationship.

The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region

Science.gov (United States)

Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia

2016-04-01

The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by

77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms

Science.gov (United States)

2012-08-08

... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

On ambiente de binárias de pequena massa em formação: o caso do glóbulo cometário CG30 e IRAS08076-3556

Science.gov (United States)

Hickel, G. R.; Vilas-Boas, J. W. S.

2003-08-01

Neste trabalho, combinamos observações de polarização linear no óptico (banda R), dados no infravermelho distante (IRAS) e observações de transições moleculares em radiofreqüências (CO e espécies isotópicas, HCN e HCO+) para analisar o glóbulo cometário (GC) CG30 (na região da IRAS Vela Shell), que apresenta objetos Herbig-Haro e ejeções de matéria, além de uma fonte pontual IRAS em seu interior. Os objetivos deste estudo são: determinar a eficiência de formação estelar nos glóbulos cometários, através da relação entre a massa total do GC e da massa das estrelas em formação; determinar como o campo magnético influencia na formação de estrelas no interior destes objetos; e analisar as modificações que ejeções de matéria de estrelas em formação causam no gás e no campo magnético dos GCs. Combinando nossos dados com trabalhos já publicados, mostramos que CG30 tem uma eficiência de formação estelar em torno de 3%; que o campo magnético é importante na manutenção da estrutura global do GC e demonstra sinais de torção e compressão; e que a ejeção bipolar de matéria das estrelas do par formam uma ejeção quadripolar, a qual influencia na densidade e temperatura do gás e no grau de polarização dos grãos de poeira associados ao gás do GC.

Wide-field Infrared Survey Explorer Observations of the Evolution of Massive Star-forming Regions

OpenAIRE

Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

2012-01-01

We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from th...

La Evoluci?n de la percepci?n del rol del IRA Provisional a partir de est?mulos generados por el Sistema Internacional

OpenAIRE

Cort?s Rojas, Mar?a Alejandra

2017-01-01

Esta investigaci?n tiene como objetivo explicar los cambios en la forma de lucha, tanto armada como pol?tica, del IRA Provisional a partir del surgimiento de movimientos por los derechos civiles en Estados Unidos, el fin de la Guerra Fr?a y la deslegitimaci?n de los movimientos anti-imperialistas, el auge econ?mico irland?s y la expansi?n de los valores de la Uni?n Europea. Estos cambios pueden verse explicados por la forma en la que el grupo cambia su percepci?n del rol que desarrolla dentro...

78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms

Science.gov (United States)

2013-04-02

... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

MANAGEMENT OF THE INTERNAL LABOR MARKET (BASING ON CASES OF THE SVERDLOVSK REGION CITY-FORMING ENTERPRISES

Directory of Open Access Journals (Sweden)

S.V. Orekhova

2008-12-01

Full Text Available This paper presents an estimation procedure of regional labor market influence on sustainability of internal labor market institutions. The paper refines the categories of regional and internal labor market. Internal labor market institutions have been classified and evaluated regarding the level of their sustainability (basing on cases of the Sverdlovsk region city-forming enterprises. As a result the model of labor expenses evaluation is elaborated for enterprises concerned.

Molecular line study of massive star-forming regions from the Red MSX Source survey

Science.gov (United States)

Yu, Naiping; Wang, Jun-Jie

2014-05-01

In this paper, we have selected a sample of massive star-forming regions from the Red MSX Source survey, in order to study star formation activities (mainly outflow and inflow signatures). We have focused on three molecular lines from the Millimeter Astronomy Legacy Team Survey at 90 GHz: HCO+(1-0), H13CO+(1-0) and SiO(2-1). According to previous observations, our sources can be divided into two groups: nine massive young stellar object candidates (radio-quiet) and 10 H II regions (which have spherical or unresolved radio emissions). Outflow activities have been found in 11 sources, while only three show inflow signatures in all. The high outflow detection rate means that outflows are common in massive star-forming regions. The inflow detection rate was relatively low. We suggest that this was because of the beam dilution of the telescope. All three inflow candidates have outflow(s). The outward radiation and thermal pressure from the central massive star(s) do not seem to be strong enough to halt accretion in G345.0034-00.2240. Our simple model of G318.9480-00.1969 shows that it has an infall velocity of about 1.8 km s-1. The spectral energy distribution analysis agrees our sources are massive and intermediate-massive star formation regions.

FAR-INFRARED OBSERVATIONS OF THE VERY LOW LUMINOSITY EMBEDDED SOURCE L1521F-IRS IN THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Terebey, Susan; Fich, Michel; Noriega-Crespo, Alberto; Padgett, Deborah L.; Brooke, Tim; Carey, Sean; McCabe, Caer-Eve; Rebull, Luisa; Fukagawa, Misato; Audard, Marc; Evans, Neal J.; Guedel, Manuel; Hines, Dean; Huard, Tracy; Knapp, Gillian R.; Menard, Francois; Monin, Jean-Louis

2009-01-01

We investigate the environment of the very low luminosity object L1521F-IRS using data from the Taurus Spitzer Legacy Survey. The MIPS 160 μm image shows both extended emission from the Taurus cloud and emission from multiple cold cores over a 1 0 x 2 0 region. Analysis shows that the cloud dust temperature is 14.2 ± 0.4 K and the extinction ratio is A 160 /A K = 0.010 ± 0.001 up to A V ∼ 4 mag. We find κ 160 = 0.23 ± 0.046 cm 2 g -1 for the specific opacity of the gas-dust mixture. Therefore, for dust in the Taurus cloud we find that the 160 μm opacity is significantly higher than that measured for the diffuse interstellar medium, but not too different from dense cores, even at modest extinction values. Furthermore, the 160 μm image shows features that do not appear in the IRAS 100 μm image. We identify six regions as cold cores, i.e., colder than 14.2 K, all of which have counterparts in extinction maps or C 18 O maps. Three of the six cores contain embedded young stellar objects, which demonstrates the cores are sites of current star formation. We compare the effects of L1521F-IRS on its natal core and find there is no evidence for dust heating at 160 or 100 μm by the embedded source. From the infrared luminosity L TIR = 0.024 L sun we find L bol-int =0.034-0.046 L odot , thus confirming the source's low luminosity. Comparison of L1521F-IRS with theoretical simulations for the very early phases of star formation appears to rule out the first core collapse phase. The evolutionary state appears similar to or younger than the class 0 phase, and the estimated mass is likely to be substellar.

SUBARCSECOND ANALYSIS OF THE INFALLING–ROTATING ENVELOPE AROUND THE CLASS I PROTOSTAR IRAS 04365+2535

Energy Technology Data Exchange (ETDEWEB)

Sakai, Nami [The Institute of Physical and Chemical Research (RIKEN), 2-1, Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Oya, Yoko; López-Sepulcre, Ana; Watanabe, Yoshimasa; Yamamoto, Satoshi [Department of Physics, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sakai, Takeshi [Department of Communication Engineering and Informatics, Graduate School of Informatics and Engineering, The University of Electro-Communications, Chofugaoka, Chofu, Tokyo 182-8585 (Japan); Hirota, Tomoya [National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan); Aikawa, Yuri [Center for Computational Science, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Ceccarelli, Cecilia; Lefloch, Bertrand; Kahane, Claudine [Universite de Grenoble Alpes, IPAG, F-38000 Grenoble (France); Caux, Emmanuel; Vastel, Charlotte [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France)

2016-04-01

Subarcsecond images of the rotational line emission of CS and SO have been obtained toward the Class I protostar IRAS 04365+2535 in TMC-1A with ALMA. A compact component around the protostar is clearly detected in the CS and SO emission. The velocity structure of the compact component of CS reveals infalling–rotating motion conserving the angular momentum. It is well explained by a ballistic model of an infalling–rotating envelope with the radius of the centrifugal barrier (one-half of the centrifugal radius) of 50 au, although the distribution of the infalling gas is asymmetric around the protostar. The distribution of SO is mostly concentrated around the radius of the centrifugal barrier of the simple model. Thus, a drastic change in chemical composition of the gas infalling onto the protostar is found to occur at a 50 au scale probably due to accretion shocks, demonstrating that the infalling material is significantly processed before being delivered into the disk.

77 FR 56912 - Proposed Collection; Comment Request for Form 2438

Science.gov (United States)

2012-09-14

... Program for SIMPLE IRAs; Revenue Procedure 2006-30, Restaurant Tips--Attributed Tip Income Program (ATIP... Reporting Burden Hours: 25,870. (3) Title: Restaurant Tips--Attributed Tip Income Program (ATIP). OMB Number... information technology; and (e) estimates of capital or start-up costs and costs of operation, maintenance...

Serendipitous discovery of warm absorbers in the Seyfert 2 galaxy IRAS 18325-5926

International Nuclear Information System (INIS)

Zhang Shuinai; Gu Qiusheng; Peng Zhixin; Ji Li

2011-01-01

Warm absorption is a common phenomenon in Seyfert 1s and quasars, but is rare in Seyfert 2s. We report the detection of warm absorbers with high energy resolution in the Seyfert 2 galaxy IRAS 18325-5926 for the first time with Chandra HETGS spectra. An intrinsic absorbing line system with an outflow velocity ∼ 400 km s -1 was found, which is contributed by two warm absorbers with FWHM of 570 km s -1 and 1360 km s -1 , respectively. The two absorbers were adjacent, and moving transversely across our line of sight. We constrained the distance between the center and the absorbers to be a small value, suggesting that the absorbers may originate from the highly ionized accretion disk wind ejected five years ago. The perspective of this type 2 Seyfert provides the best situation in which to investigate the vertical part of the funnel-like outflows. Another weak absorbing line system with zero redshift was also detected, which could be due to Galactic absorption with very high temperature or an intrinsic outflow with a very high velocity ∼ 6000 km s -1 . (research papers)

Probing Protoplanetary Disks: From Birth to Planets

Science.gov (United States)

Cox, Erin Guilfoil

2018-01-01

Disks are very important in the evolution of protostars and their subsequent planets. How early disks can form has implications for early planet formation. In the youngest protostars (i.e., Class 0 sources) magnetic fields can control disk growth. When the field is parallel to the collapsing core’s rotation axis, infalling material loses angular momentum and disks form in later stages. Sub-/millimeter polarization continuum observations of Class 0 sources at ~1000 au resolution support this idea. However, in the inner (~100 au), denser regions, it is unknown if the polarization only traces aligned dust grains. Recent theoretical studies have shown that self-scattering of thermal emission in the disk may contribute significantly to the polarization. Determining the scattering contribution in these sources is important to disentangle the magnetic field. At older times (the Class II phase), the disk structure can both act as a modulator and signpost of planet formation, if there is enough of a mass reservoir. In my dissertation talk, I will present results that bear on disk evolution at both young and late ages. I will present 8 mm polarization results of two Class 0 protostars (IRAS 4A and IC348 MMS) from the VLA at ~50 au resolution. The inferred magnetic field of IRAS 4A has a circular morphology, reminiscent of material being dragged into a rotating structure. I will show results from SOFIA polarization data of the area surrounding IRAS 4A at ~4000 au. I will also present ALMA 850 micron polarization data of ten protostars in the Perseus Molecular Cloud. Most of these sources show very ordered patterns and low (~0.5%) polarization in their inner regions, while having very disordered patterns and high polarization patterns in their extended emission that may suggest different mechanisms in the inner/outer regions. Finally, I will present results from our ALMA dust continuum survey of protoplanetary disks in Rho Ophiuchus; we measured both the sizes and fluxes of

78 FR 31584 - Notice of Proposed Amendment to Prohibited Transaction Exemption 80-26 (PTE 80-26) For Certain...

Science.gov (United States)

2013-05-24

...) of the Code, including individual retirement accounts (IRAs), are generally subject to taxation under... of IRA Owners may be concerned that their accounts could be disqualified and subject to taxation as... past Form 5500 filings, and eliminate questions from auditors with respect to past related party...

Chemical Abundances and Physical Parameters of H II Regions in the Magellanic Clouds

Science.gov (United States)

Reyes, R. E. C.

The chemical abundances and physical parameters of H II regions are important pa rameters to determine in order to understand how stars and galaxies evolve. The Magellanic Clouds offer us a unique oportunity to persue such studies in low metallicity galaxies. In this contribution we present the results of the photoionization modeling of 5 H II regions in each of the Large Magellanic Cloud (LMC) and Small Magellanic Cloud (SMC) sys tems. Optical data were collected from the literature, complemented by our own observa tions (Carlos Reyes et al. 1998), including UV spectra from the new IUE data ban k and infrared fluxes from the IRAS satellite. The chemical abundances of He, C, N, O, Ne, S, Ar and physical parameters like the densities, the ionized masses, the luminosities, the ionization temperatures , the filling factor and optical depth are determined. A comparison of the abundances of these HII regions with those of typical planetary nebulae and supergiants stars is also presented.

Monte Carlo calculations and experimental measurements of dosimetric parameters of the IRA-103Pd source

International Nuclear Information System (INIS)

Sadeghi, Mahdi; Hosseini, Hamed; Raisali, Gholamreza

2008-01-01

Full text: The use of 103 Pd seed sources for permanent prostate implantation has become a popular brachytherapy application. As recommended by AAPM the dosimetric characteristics of the new source must be determined using experimental and Monte Carlo simulations, before its use in clinical applications thus The goal of this report is the experimental and theoretical determination of the dosimetric characteristics of this source following the recommendations in the AAPM TG-43U1 protocol. Figure 1 shows the geometry of the IRA- 103 Pd source. The source consists of a cylindrical silver core, 0.3 cm long x 0.05 cm in diameter, onto which 0.5 nm layer of 103 Pd has been uniformly adsorbed. The effective active length of source is 0.3 cm and the silver core encapsulated inside a hollow titanium tube with 0.45 cm long, 0.07 cm and 0.08 inner and outer diameters and two caps. The Monte Carlo N-Particle (MCNP) code, version 4C, was used to determine the relevant dosimetric parameters of the source. The geometry of the Monte Carlo simulation performed in this study consisted of a sphere with 30 cm diameter. Dose distributions around this source were measured in two Perspex phantom using enough TLD chips. For these measurements, slabs of Perspex material were machined to accommodate the source and TLD chips. A value of 0.67± 1% cGy.h -1 .U -1 for, Λ, was calculated as the ratio of d(r 0 ,θ 0 ) and s K , that may be compared with Λ values obtained for 103 Pd sources. Result of calculations and measurements values of dosimetric parameters of the source including radial dose function, g(r), and anisotropy function, F(r,θ), has been shown in separate figures. The radial dose function, g(r), for the IRA- 103 Pd source and other 103 Pd sources is included in Fig. 2. Comparison between measured and Monte Carlo simulated dose function, g(r), and anisotropy function, F(r,θ), of this source demonstrated that they are in good agreement with each other and The value of Λ is

Functional modulation of cardiac form through regionally confined cell shape changes.

Directory of Open Access Journals (Sweden)

Heidi J Auman

2007-03-01

Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.

IRAS 15099-5856: REMARKABLE MID-INFRARED SOURCE WITH PROMINENT CRYSTALLINE SILICATE EMISSION EMBEDDED IN THE SUPERNOVA REMNANT MSH15-52

International Nuclear Information System (INIS)

Koo, Bon-Chul; Kim, Hyun-Jeong; Im, Myungshin; McKee, Christopher F.; Suh, Kyung-Won; Moon, Dae-Sik; Lee, Ho-Gyu; Onaka, Takashi; Burton, Michael G.; Hiramatsu, Masaaki; Bessell, Michael S.; Gaensler, B. M.; Lee, Jae-Joon; Jeong, Woong-Seob; Tatematsu, Ken'ichi; Kawabe, Ryohei; Ezawa, Hajime; Kohno, Kotaro; Wilson, Grant; Yun, Min S.

2011-01-01

We report new mid-infrared (MIR) observations of the remarkable object IRAS 15099-5856 using the space telescopes AKARI and Spitzer, which demonstrate the presence of prominent crystalline silicate emission in this bright source. IRAS 15099-5856 has a complex morphology with a bright central compact source (IRS1) surrounded by knots, spurs, and several extended (∼4') arc-like filaments. The source is seen only at ≥10 μm. The Spitzer mid-infrared spectrum of IRS1 shows prominent emission features from Mg-rich crystalline silicates, strong [Ne II] 12.81 μm, and several other faint ionic lines. We model the MIR spectrum as thermal emission from dust and compare with the Herbig Be star HD 100546 and the luminous blue variable R71, which show very similar MIR spectra. Molecular line observations reveal two molecular clouds around the source, but no associated dense molecular cores. We suggest that IRS1 is heated by UV radiation from the adjacent O star Muzzio 10 and that its crystalline silicates most likely originated in a mass outflow from the progenitor of the supernova remnant (SNR) MSH 15-52. IRS1, which is embedded in the SNR, could have been shielded from the SN blast wave if the progenitor was in a close binary system with Muzzio 10. If MSH 15-52 is a remnant of Type Ib/c supernova (SN Ib/c), as has been previously proposed, this would confirm the binary model for SN Ib/c. IRS1 and the associated structures may be the relics of massive star death, as shaped by the supernova explosion, the pulsar wind, and the intense ionizing radiation of the embedded O star.

El efecto del rumor en el cambio del voto: la ira, el miedo y la incertidumbre generados por el rumor en procesos electorales y sus contribuciones en las decisiones del votante

Directory of Open Access Journals (Sweden)

Caroline Ávila

2016-01-01

Full Text Available El rumor es un componente reiterado en las campañas electorales, sin embargo, poco se ha estudiado sobre los efectos directos en las emociones y cómo estas inciden en el votante. Esta investigación presenta, con datos empíricos, evidencias de los efectos reales del rumor en emociones, como la ira, el miedo y la incertidumbre, a través de un estudio de las elecciones intermedias en Ecuador de febrero de 2014. La metodología es de tipo cuantitativo a través de encuestas aplicadas a los hogares objeto de este estudio. Los resultados fueron sometidos a análisis estadísticos de correlación de rho de Spearman y regresión logística que permiten explicar el cambio en el voto de acuerdo con las variables que evalúan la incidencia del rumor en emociones negativas, como la ira, la incertidumbre y el miedo. A efectos de este estudio, fue analizado el caso Tranvía Cuatro Ríos en la ciudad de Cuenca (500 000 habitantes.

FORMING AN O STAR VIA DISK ACCRETION?

International Nuclear Information System (INIS)

Qiu Keping; Zhang Qizhou; Beuther, Henrik; Fallscheer, Cassandra

2012-01-01

We present a study of outflow, infall, and rotation in a ∼10 5 L ☉ star-forming region, IRAS 18360-0537, with Submillimeter Array and IRAM 30 m observations. The 1.3 mm continuum map shows a 0.5 pc dust ridge, of which the central compact part has a mass of ∼80 M ☉ and harbors two condensations, MM1 and MM2. The CO (2-1) and SiO (5-4) maps reveal a biconical outflow centered at MM1, which is a hot molecular core (HMC) with a gas temperature of 320 ± 50 K and a mass of ∼13 M ☉ . The outflow has a gas mass of 54 M ☉ and a dynamical timescale of 8 × 10 3 yr. The kinematics of the HMC are probed by high-excitation CH 3 OH and CH 3 CN lines, which are detected at subarcsecond resolution and unveil a velocity gradient perpendicular to the outflow axis, suggesting a disk-like rotation of the HMC. An infalling envelope around the HMC is evidenced by CN lines exhibiting a profound inverse P Cygni profile, and the estimated mass infall rate, 1.5 × 10 –3 M ☉ yr –1 , is well comparable to that inferred from the mass outflow rate. A more detailed investigation of the kinematics of the dense gas around the HMC is obtained from the 13 CO and C 18 O (2-1) lines; the position-velocity diagrams of the two lines are consistent with the model of a free-falling and Keplerian-like rotating envelope. The observations suggest that the protostar of a current mass ∼10 M ☉ embedded within MM1 will develop into an O star via disk accretion and envelope infall.

Biznesa formāta franšīzes līguma tiesiskais regulējums

OpenAIRE

Gailāns, Andrejs

2009-01-01

Šajā darbā autors analizē tiesisko regulējumu, kas izriet no Biznesa Formāta Franšīzes (BFF) attiecībām. Darbā ir aprakstīta franšīzes līguma izcelšanās vēsture, sniegta Biznesa Formāta Franšīzes līguma definīcija, norādītas galvenās tā pazīmes, un kritēriji, ar kuriem BFF atšķiras no citiem franšīzes modeļiem, kā arī dots īss franšīzes veidu raksturojums. Darbā ir sniegts nozares doktrinālo dokumentu apraksts, kā arī aprakstīti franšīzes līguma nozīmīgākie posmi, tādi kā pirmslīguma attiecīb...

THE SCHMIDT-KENNICUTT LAW OF MATCHED-AGE STAR-FORMING REGIONS; Paα OBSERVATIONS OF THE EARLY-PHASE INTERACTING GALAXY TAFFY I

International Nuclear Information System (INIS)

Komugi, S.; Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabé, T.; Yoshii, Y.; Takagi, T.; Iono, D.; Kaneko, H.; Ueda, J.; Saitoh, T. R.

2012-01-01

In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Paα image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M ☉ yr –1 , was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are ∼7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

PHYSICAL CONDITIONS IN THE ULTRAVIOLET ABSORBERS OF IRAS F22456-5125

International Nuclear Information System (INIS)

Dunn, Jay P.; Crenshaw, D. Michael; Trippe, M. L.; Kraemer, S. B.

2010-01-01

We present the ultraviolet (UV) and X-ray spectra observed with the Far Ultraviolet Spectroscopic Explorer (FUSE) and the XMM-Newton satellite, respectively, of the low-z Seyfert 1 galaxy IRAS F22456 - 5125. This object shows absorption from five distinct, narrow kinematic components that span a significant range in velocity (∼0 to -700 km s -1 ) and ionization (Lyman series, C III, N III, and O VI). We also show that three of the five kinematic components in these lines appear to be saturated in Lyβ λ1026 and that all five components show evidence of saturation in the O VI doublet lines λλ1032, 1038. Further, all five components show evidence for partial covering due to the absorption seen in the O VI doublet. This object is peculiar because it shows no evidence for corresponding X-ray absorption to the UV absorption in the X-ray spectrum, which violates the 1:1 correlation known for low-z active galactic nuclei (AGNs). We perform photoionization modeling of the UV absorption lines and predict that the O VII column density should be small, which would produce little to no absorption in agreement with the X-ray observation. We also examine the UV variability of the continuum flux for this object (an increase of a factor of 6). As the absorption components lack variability, we find a lower limit of ∼20 kpc for the distance for the absorbers from the central AGN.

Complex organic molecules toward low-mass and high-mass star forming regions

Science.gov (United States)

Favre, C.; Ceccarelli, C.; Lefloch, B.; Bergin, E.; Carvajal, M.; Brouillet, N.; Despois, D.; Jørgensen, J.; Kleiner, I.

2016-12-01

One of the most important questions in molecular astrophysics is how, when, and where complex organic molecules, COMs (≥ 6 atoms) are formed. In the Interstellar-Earth connection context, could this have a bearing on the origin of life on Earth? Formation mechanisms of COMs, which include potentially prebiotic molecules, are still debated and may include grain-mantle and/or gas-phase chemistry. Understanding the mechanisms that lead to the interstellar molecular complexification, along with the involved physicochemical processes, is mandatory to answer the above questions. In that context, active researches are ongoing in theory, laboratory experiment, chemical modeling and observations. Thanks to recent progress in radioastronomy instrumentation for both single-dish and millimeter array (e.g. Herschel, NOEMA, ALMA), new results have been obtained. I will review some notable results on the detection of COMs, including prebiotic molecules, towards star forming regions.

Extended high circular polarization in the Orion massive star forming region: implications for the origin of homochirality in the solar system.

Science.gov (United States)

Fukue, Tsubasa; Tamura, Motohide; Kandori, Ryo; Kusakabe, Nobuhiko; Hough, James H; Bailey, Jeremy; Whittet, Douglas C B; Lucas, Philip W; Nakajima, Yasushi; Hashimoto, Jun

2010-06-01

We present a wide-field (approximately 6' x 6') and deep near-infrared (K(s) band: 2.14 mum) circular polarization image in the Orion nebula, where massive stars and many low-mass stars are forming. Our results reveal that a high circular polarization region is spatially extended (approximately 0.4 pc) around the massive star-forming region, the BN/KL nebula. However, other regions, including the linearly polarized Orion bar, show no significant circular polarization. Most of the low-mass young stars do not show detectable extended structure in either linear or circular polarization, in contrast to the BN/KL nebula. If our solar system formed in a massive star-forming region and was irradiated by net circularly polarized radiation, then enantiomeric excesses could have been induced, through asymmetric photochemistry, in the parent bodies of the meteorites and subsequently delivered to Earth. These could then have played a role in the development of biological homochirality on Earth.

TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions

OpenAIRE

Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.

2014-01-01

We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

Water in massive star-forming regions with Herschel Space Observatory

Science.gov (United States)

Chavarria, L.; Herpin, F.; Bontemps, S.; Jacq, T.; Baudry, A.; Braine, J.; van der Tak, F.; Wyrowski, F.; van Dishoeck, E. F.

2011-05-01

High-mass stars formation process is much less understood than the low-mass case: short timescales, high opacities and long distance to the sources challenge the study of young massive stars. The instruments on board the Heschel Space Observatory permit us to investigate molecular species at high spectral resolution in the sub-milimeter wavelengths. Water, one of the most abundant molecules in the Universe, might elucidate key episodes in the process of stellar birth and it may play a major role in the formation of high-mass stars. This contribution presents the first results of the Heschel Space Observatory key-program WISH (Water In Star forming regions with Herschel) concerning high-mass protostars. The program main purpose is to follow the process of star formation during the various stages using the water molecule as a physical diagnostic throughout the evolution. In general, we aim to adress the following questions: How does protostars interact with their environment ? How and where water is formed ? How is it transported from cloud to disk ? When and where water becomes a dominant cooling or heating agent ? We use the HIFI and PACS instruments to obtain maps and spectra of ~20 water lines in ~20 massive protostars spanning a large range in physical parameters, from pre-stellar cores to UCHII regions. I will review the status of the program and focus specifically on the spectroscopic results. I will show how powerful are the HIFI high-resolution spectral observations to resolve different physical source components such as the dense core, the outflows and the extended cold cloud around the high-mass object. We derive water abundances between 10-7 and 10-9 in the outer envelope. The abundance variations derived from our models suggest that different chemical mechanisms are at work on these scales (e.g. evaporation of water-rich icy grain mantles). The detection and derived abundance ratios for rare isotopologues will be discussed. Finally, a comparison in tems

Anomalou OH emission in galactic star-forming regions - A clue to the megamaser phenomenon?

International Nuclear Information System (INIS)

Mirabel, I.F.; Rodriguez, L.F.; Ruiz, A.

1989-01-01

The detection of spatially extended, anomalous OH emission in galactic star-forming regions is reported. This OH emission is similar to, although much weaker than, that produced by extragalactic megamasers. This new type of galactic emission may provide clues to elucidate the nature of the extragalactic OH megamaser phenomenon observed in luminous IR galaxies. 10 refs

Estrés percibido, ansiedad, depresión e ira en el proceso de reproducción asistida : un estudio de caso

OpenAIRE

Pérez Ortega, Melania; Barraca Mairal, Jorge

2014-01-01

En el artículo se presenta un caso donde se analiza la presencia del estrés, la tristeza, la ansiedad, la ira y el desajuste emocional a lo largo de la aplicación de una técnica de reproducción asistida (Microinyección Espermática-ICSI). Se evaluó a una pareja, ambos de 34 años, antes de comenzar ICSI, durante las fases del proceso y posteriormente. Para la evaluación de sintomatología a lo largo de la intervención médica se utilizaron el BDI-II, el STAI, el STAXI-2...

COMPETITION AS A FORM OF ORGANIZING CULTURAL ACTIVITIES OF THE KRASNOYARSK REGION POPULATION IN THE 1960-1980S

Directory of Open Access Journals (Sweden)

Ekaterina Ivanovna Lobyneva

2014-08-01

Full Text Available In the article the author deals with the socialist completion as demonstration of huge enthusiasm and creative initiative of the Krasnoyarsk region population in the 1960s. There were more than twenty shock Komsomol construction sites, which became an effective form of youth participating in the economy development.The aim of the work is to find out in what way socialist completion influences on developing different personal features, like abilities, knowledge, erudition, skills, experience, needs, call of duty, responsibility, etc.The methods of historical approach and objectivism are used in the article.The results of work are to considerate problems concerning with organization of the socialist competition in the Krasnoyarsk region. New materials and some documents of local archives are introduced during the research.The study of the socialist competition in the Krasnoyarsk region enables to make a conclusion that the socialist competition is a form of organizing cultural activities of the Krasnoyarsk region population in the 1960s.

Optical polarimetry of star-forming regions

Energy Technology Data Exchange (ETDEWEB)

Gledhill, T M

1987-01-01

The polarimetric investigation of nebulosity associated with loss-mass pre-main sequence (PMS) stellar objects is detailed. Three regions of on-going star formation are considered, specifically, the Haro 6-5 and the HL/XZ Tau systems - both associated with dark clouds in the Taurus complex - and the PV Cephei nebulosity near NGC7023. In each region the imaging observations suggest bipolarity in the optical structure of the nebulosity, and the polarimetric data are used to determine the locations of the illuminating sources. Evidence is found for the association of circumstellar discs of obscuration with the PMS objects Haro 6-5A (FS Tau), Haro 6-5B, HL Tau, and PV Cephei. In each case the polarimetric data suggest that the local magnetic field has played an important role in the evolution of the star and the circumstellar material. Examination of the source-region polarization maps suggests that at least one of the objects considered is surrounded by a dust grain-aligning magnetic field with a predominantly toroidal geometry in the plane of the circumstellar disc. Implications for current theories of outflow acceleration and cloud evolution are discussed.

Searching for the UV counterpart of the extraordinary X-ray UFO in the NLSy1 IRAS17020+4544

Science.gov (United States)

Krongold, Yair

2017-08-01

We recently reported the first unambiguous discovery in high resolution X-ray data of an ultra fast outflow (UFO) with velocity .1c. This wind, in Narrow Line Seyfert 1 galaxy IRAS17020+4544, represents so far the most compelling detection of an UFO, with many different absorption lines that give rise to very high significance detections. The charge states that form the wind clearly indicate a large range of ionization states in the gas, and significant absorption by Ly alpha, C IV, Si IV and N V (among other ions) is expected in the UV band. The goal of our proposed program is to observe an characterize the best X-ray detected UFO in the UV. These observations are crucial to study in great detail the UFO phenomenon, and understand its nature and its relation to the narrow absorption line low velocity systems. Only through detection of Ly alpha absorption in the UV data, measurements of the metallicity of these winds will be possible. The proposed program will help guide new theoretical models of UFOs origins, beyond the simple actual picture that predicts only very high ionization Fe absorption. UV data are required to understand the wind nature and launching mechanism (whether due to radiation pressure via line or continuum opacity, or magnetic forces). Fully characterizing the wind properties will put stronger constraints in the mass outflow and kinetic outflow rates of these systems, as well as in their geometry. Such estimates will give a much clearer picture of UFOs feedback potential, and will provide clues on the feedback mode in action (e.g. energy conserving vs. momentum conserving).

THE SPITZER SURVEY OF INTERSTELLAR CLOUDS IN THE GOULD BELT. III. A MULTI-WAVELENGTH VIEW OF CORONA AUSTRALIS

International Nuclear Information System (INIS)

Peterson, Dawn E.; Bourke, Tyler L.; Forbrich, Jan; Patten, Brian M.; Caratti o Garatti, Alessio; Gutermuth, Robert A.; Joergensen, Jes K.; Allen, Lori E.; Dunham, Michael M.; Harvey, Paul M.; Evans, Neal J.; MerIn, Bruno; Chapman, Nicholas L.; Cieza, Lucas A.; Huard, Tracy L.; Knez, Claudia; Prager, Brian

2011-01-01

We present Spitzer Space Telescope IRAC and MIPS observations of a 0.85 deg 2 field including the Corona Australis (CrA) star-forming region. At a distance of 130 pc, CrA is one of the closest regions known to be actively forming stars, particularly within its embedded association, the Coronet. Using the Spitzer data, we identify 51 young stellar objects (YSOs) in CrA which include sources in the well-studied Coronet cluster as well as sources distributed throughout the molecular cloud. Twelve of the YSOs discussed are new candidates, one of which is located in the Coronet. Known YSOs retrieved from the literature are also added to the list, and a total of 116 candidate YSOs in CrA are compiled. Based on these YSO candidates, the star formation rate is computed to be 12 M sun Myr -1 , similar to that of the Lupus clouds. A clustering analysis was also performed, finding that the main cluster core, consisting of 68 members, is elongated (having an aspect ratio of 2.36), with a circular radius of 0.59 pc and mean surface density of 150 pc -2 . In addition, we analyze outflows and jets in CrA by means of new CO and H 2 data. We present 1.3 mm interferometric continuum observations made with the Submillimeter Array (SMA) covering R CrA, IRS 5, IRS 7, and IRAS 18595-3712 (IRAS 32). We also present multi-epoch H 2 maps and detect jets and outflows, study their proper motions, and identify exciting sources. The Spitzer and ISAAC/VLT observations of IRAS 32 show a bipolar precessing jet, which drives a CO(2-1) outflow detected in the SMA observations. There is also clear evidence for a parsec-scale precessing outflow, which is east-west oriented and originates in the SMA 2 region and likely driven by SMA 2 or IRS 7A.

Hα emission stars in the region of Lynds 1228

International Nuclear Information System (INIS)

Ogura, Katsuo; Sato, Fumio.

1990-01-01

The dark cloud L1228 and its surrounding region have been surveyed for candidate pre-main-sequence stars by use of the Kiso Schmidt telescope with an objective prism. 69 Hα emission stars and 49 suspects have been found. Their celestial coordinates and rough estimates of their magnitude and color have been derived from the positions and image diameters on Palomar Sky Survey prints. Nine of them cluster in a small area near the central part of L1228, suggesting active star formation there in the near past. A star with a large color index lying in the northern part has been identified with an IRAS point source having a far-infrared spectrum of moderately low temperature. Preliminary 13 CO (J=1-0) line observations show that the star is embedded in the core of the molecular cloud. (author)

A study of the stellar population in the Lynds 1641 dark cloud - deep near-infrared imaging

International Nuclear Information System (INIS)

Strom, K.M.; Margulis, M.; Strom, S.E.

1989-01-01

Deep H and K photometry of a selection of IRAS point sources in the L1641 cloud is presented. Using these data in combination with IRAS data and previously published near-infrared photometry for sources in this region, it is found that the L1641 cloud contains newly born stars embedded within cores of unusually large visual extinction. A comparison of the properties of cores in L1641 with those in the Taurus-Auriga star-forming complex reveals that L1641 contains cores with higher visual extinctions, larger ammonia (J, K) = (1, 1) line widths, greater kinetic temperatures, and probably higher optical depths at 100 microns than any cores in Taurus-Auriga. These results are qualitatively consistent with recent suggestions that the process of protostellar collapse in cores in the L1641 cloud is dominated by gravity while this process is dominated by magnetic fields in Taurus-Auriga. 20 refs

Form Characteristics of Regional Security Organizations - The Missing Link in the Explanation of the Democratic Peace

OpenAIRE

Dembinski, Matthias; Freistein, Katja; Weiffen, Brigitte

2006-01-01

This paper contributes both to the debate on the effects of regional security organizations and to the debate on democratic peace. It argues that even if international organizations as such may not be able to influence the conflict behavior of their member states, the subgroup of interdemocratic institutions is well suited to do so. The form of interdemocratic institutions differs in two significant respects from the form of traditional institutions: they are more densely connected via transn...

THE EFFECTS OF EPISODIC STAR FORMATION ON THE FUV-NUV COLORS OF STAR FORMING REGIONS IN OUTER DISKS

Energy Technology Data Exchange (ETDEWEB)

Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Dowell, Jayce D., E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: jdowell@unm.edu [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States)

2013-09-20

We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersion in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling chemical

The life forms of lichens on different substrates in Yelanetsko-Ingulskiy region (Mikolayivska and Kirovogradska oblast, Ukraine

Directory of Open Access Journals (Sweden)

Tatyana O. Boiko

2012-03-01

Full Text Available The article reveals the issue of distribution of lichens life forms on different substrates, which are present in the Yelanetsko- Ingulskiy region. The largest number of life forms of the lichens is characteristic for granite outcrops, and the lowest – for gneisses. This fact is associated with features of substrate morphostructure and density, microclimatic conditions of different ecotopes in which lichens grow.

«Goroda-bliznecy»: novaja forma prigranichnogo sotrudnichestva v Baltijskom regione? [Twin cities: a new form of cross-border cooperation in the Baltic Sea Region?

Directory of Open Access Journals (Sweden)

Anishenko Anatoly

2012-01-01

Full Text Available The paper demonstrates the first attempt in Russian political studies to conduct a comprehensive analysis of the “twin city” movement as a form of cross-border cooperation in the Baltic region. This phenomenon emerged as a result of a global tendency towards more active involvement of municipal units in international cooperation, on the one hand, and aspirations of frontier cities and towns in the Baltic region to solve common problems together, on the other hand. This work is based on a comparative analysis method and a case study methodology. The authors consider four examples (city pairs: Tornio — Haparanda, Valga — Valka, Narva — Ivangorod and Imatra — Svetogorsk. The article specifies the terminological framework used in this field of research. The authors analyse achievements and failures of this type of international inter-municipal cooperation and emphasise that for twin cities it served not only as a means of survival in the difficult situation of the 1990s, but also as an experimental ground for new forms of crossborder cooperation. The authors arrive at the conclusion that this model proves to be promising for further development of integration processes in the Baltic region. This practice can be applied by Russian municipal, regional and federal authorities in promotion of cross-border cooperation not only in the Baltic region, but also in other regions of the country. Thus, influenced by the successful experience of Baltic frontier cities and towns, the Russian city of Nikel and the Norwegian city of Kirkenes decided to adopt this model for further development of their cooperation.

Tianma 65-m telescope detection of new OH maser features towards the water fountain source IRAS 18286-0959

Science.gov (United States)

Chen, Xi; Shen, Zhi-Qiang; Li, Xiao-Qiong; Yang, Kai; Nakashima, Jun-ichi; Wu, Ya-Jun; Zhao, Rong-Bin; Li, Juan; Wang, Jun-Zhi; Jiang, Dong-Rong; Wang, Jin-Qing; Li, Bin; Zhong, Wei-Ye; Yung, Bosco H. K.

2017-07-01

We report the results of the OH maser observation towards the water fountain source IRAS 18286-0959 using the newly built Shanghai Tianma 65-m Radio Telescope. We observed the three OH ground state transition lines at frequencies of 1612, 1665 and 1667 MHz. Comparing with the spectra of previous observations, we find new maser spectral components at velocity channels largely shifted from the systemic velocity: the velocity offsets of the newly found components lie in the range 20-40 km s-1 with respect to the systemic velocity. Besides maser variability, another possible interpretation for the newly detected maser features is that part of the molecular gas in the circumstellar envelope is accelerated. The acceleration is probably caused by the passage of a high-velocity molecular jet, which has been detected in previous Very Long Baseline Interferometry observations in the H2O maser line.

Galaxy evolution and large-scale structure in the far-infrared. II. The IRAS faint source survey

International Nuclear Information System (INIS)

Lonsdale, C.J.; Hacking, P.B.; Conrow, T.P.; Rowan-Robinson, M.

1990-01-01

The new IRAS Faint Source Survey data base is used to confirm the conclusion of Hacking et al. (1987) that the 60 micron source counts fainter than about 0.5 Jy lie in excess of predictions based on nonevolving model populations. The existence of an anisotropy between the northern and southern Galactic caps discovered by Rowan-Robinson et al. (1986) and Needham and Rowan-Robinson (1988) is confirmed, and it is found to extend below their sensitivity limit to about 0.3 Jy in 60 micron flux density. The count anisotropy at f(60) greater than 0.3 can be interpreted reasonably as due to the Local Supercluster; however, no one structure accounting for the fainter anisotropy can be easily identified in either optical or far-IR two-dimensional sky distributions. The far-IR galaxy sky distributions are considerably smoother than distributions from the published optical galaxy catalogs. It is likely that structure of the large size discussed here have been discriminated against in earlier studies due to insufficient volume sampling. 105 refs

Central regions of LIRGs: rings, hidden starbursts, Supernovae and star clusters

International Nuclear Information System (INIS)

Väisänen, Petri; Randriamanakoto, Zara; Escala, Andres; Kankare, Erkki; Mattila, Seppo; Reunanen, Juha; Kotilainen, Jari; Rajpaul, Vinesh; Ryder, Stuart; Zijlstra, Albert

2012-01-01

We study star formation (SF) in very active environments, in luminous IR galaxies, which are often interacting. A variety of phenomena are detected, such as central starbursts, circumnuclear SF, obscured SNe tracing the history of recent SF, massive super star clusters, and sites of strong off-nuclear SF. All of these can be ultimately used to define the sequence of triggering and propagation of star-formation and interplay with nuclear activity in the lives of gas rich galaxy interactions and mergers. In this paper we present analysis of high-spatial resolution integral field spectroscopy of central regions of two interacting LIRGs. We detect a nuclear 3.3 μm PAH ring around the core of NGC 1614 with thermal-IR IFU observations. The ring's characteristics and relation to the strong star-forming ring detected in recombination lines are presented, as well as a scenario of an outward expanding starburst likely initiated with a (minor) companion detected within a tidal feature. We then present NIR IFU observations of IRAS 19115-2124, aka the Bird, which is an intriguing triple encounter. The third component is a minor one, but, nevertheless, is the source of 3/4 of the SFR of the whole system. Gas inflows and outflows are detected in their nuclei locations. Finally, we briefly report on our on-going NIR adaptive optics imaging survey of several dozen LIRGs. We have detected highly obscured core-collapse SNe in the central kpc, and discuss the statistics of 'missing SNe' due to dust extinction. We are also determining the characteristics of hundreds of super star clusters in and around the core regions of LIRGs, as a function of host-galaxy properties.

Preferential Pathway for Glycine Formation in Star-Forming Regions

Science.gov (United States)

Pilling, S.; Boechat-Roberty, H. M.; Baptista, L.; Santos A. C., F.

Interstellar clouds, similar to that from which the solar system was formed, contain many organic molecules including aldehydes, acids, ketones, and sugars Ehrenfreund & Charnley (2000). Those organic compounds have important functions in terrestrial biochemistry and could also have been important in prebiotic synthesis. The simplest amino acid, glycine (NH2CH2COOH), was recently detected in the hot molecular cores Sgr B2(N-LMH), Orion KL, and W51 e1/e2 Kuan et al. (2003). The formic acid (HCOOH) and acetic acid(CH3COOH) have also been detected in those regions Liu et al. (2002), Remijan et al. (2004). The goal of this work is to study experimentally photoionization and photodissociation processes of glycine precursor molecules, acetic acid and formic acid to elucidate a possible preferentially in the glycine synthesis between ice and gas phase. The measurements were taken at the Brazilian Synchrotron Light Laboratory (LNLS), employing soft X-ray photons from a toroidal grating monochromator TGM) beamline (100 - 310 eV). The experimental set up consists of a high vacuum chamber with a Time-Of-Flight Mass Spectrometer (TOF-MS). Mass spectra were obtained using PhotoElectron PhotoIon Coincidence (PEPICO) technique. Kinetic energy distributions and abundances for each ionic fragment have been obtained from the analysis of the corresponding peak shapes in the mass spectra. Dissociative and non-dissociative photoionization cross sections for both molecules were also determined Boechat-Roberty, Pilling & Santos (2005). Due to the high photodissociation cross section of formic acid it is possible that in PDRs regions, just after molecules evaporation from the grains surface, it is almost destructed by soft X-rays, justifying the observed low abundance of HCOOH in gaseous phase Ehrenfreund et al. (2001). Acetic acid have shown to be more stable to the ionizing field, and its main outcomes from dissociation process were the reactive ionic fragments COOH+ and CH3CO+. To

A high-significance measurement of correlation between unresolved IRAS sources and optically-selected galaxy clusters

Energy Technology Data Exchange (ETDEWEB)

Hincks, Adam D.; Hajian, Amir [Canadian Institute for Theoretical Astrophysics, University of Toronto, Toronto, ON M5S 3H8 (Canada); Addison, Graeme E., E-mail: hincks@cita.utoronto.ca, E-mail: ahajian@cita.utoronto.ca, E-mail: gaddison@phas.ubc.ca [Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)

2013-05-01

We cross-correlate the 100 μm Improved Reprocessing of the IRAS Survey (IRIS) map and galaxy clusters at 0.1 < z < 0.3 in the maxBCG catalogue taken from the Sloan Digital Sky Survey, measuring an angular cross-power spectrum over multipole moments 150 < l < 3000 at a total significance of over 40σ. The cross-spectrum, which arises from the spatial correlation between unresolved dusty galaxies that make up the cosmic infrared background (CIB) in the IRIS map and the galaxy clusters, is well-fit by a single power law with an index of −1.28±0.12, similar to the clustering of unresolved galaxies from cross-correlating far-infrared and submillimetre maps at longer wavelengths. Using a recent, phenomenological model for the spectral and clustering properties of the IRIS galaxies, we constrain the large-scale bias of the maxBCG clusters to be 2.6±1.4, consistent with existing analyses of the real-space cluster correlation function. The success of our method suggests that future CIB-optical cross-correlations using Planck and Herschel data will significantly improve our understanding of the clustering and redshift distribution of the faint CIB sources.

CHEMICAL SEGREGATION TOWARD MASSIVE HOT CORES: THE AFGL2591 STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Jimenez-Serra, I.; Zhang, Q. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Viti, S. [Department of Physics and Astronomy, University College London, Gower Place, London WC1E 6BT (United Kingdom); Martin-Pintado, J. [Centro de Astrobiologia (CSIC/INTA), Ctra. de Torrejon a Ajalvir km 4, E-28850 Torrejon de Ardoz, Madrid (Spain); De Wit, W.-J., E-mail: ijimenez-serra@cfa.harvard.edu, E-mail: qzhang@cfa.harvard.edu, E-mail: sv@star.ucl.ac.uk, E-mail: jmartin@cab.inta-csic.es, E-mail: wdewit@eso.org [European Southern Observatory, Alonso de Cordova 3107, Vitacura, Santiago (Chile)

2012-07-01

We present high angular resolution observations (0.''5 Multiplication-Sign 0.''3) carried out with the Submillimeter Array (SMA) toward the AFGL2591 high-mass star-forming region. Our SMA images reveal a clear chemical segregation within the AFGL2591 VLA 3 hot core, where different molecular species (Types I, II, and III) appear distributed in three concentric shells. This is the first time that such a chemical segregation is ever reported at linear scales {<=}3000 AU within a hot core. While Type I species (H{sub 2}S and {sup 13}CS) peak at the AFGL2591 VLA 3 protostar, Type II molecules (HC{sub 3}N, OCS, SO, and SO{sub 2}) show a double-peaked structure circumventing the continuum peak. Type III species, represented by CH{sub 3}OH, form a ring-like structure surrounding the continuum emission. The excitation temperatures of SO{sub 2}, HC{sub 3}N, and CH{sub 3}OH (185 {+-} 11 K, 150 {+-} 20 K, and 124 {+-} 12 K, respectively) show a temperature gradient within the AFGL2591 VLA 3 envelope, consistent with previous observations and modeling of the source. By combining the H{sub 2}S, SO{sub 2}, and CH{sub 3}OH images, representative of the three concentric shells, we find that the global kinematics of the molecular gas follow Keplerian-like rotation around a 40 M{sub Sun} star. The chemical segregation observed toward AFGL2591 VLA 3 is explained by the combination of molecular UV photodissociation and a high-temperature ({approx}1000 K) gas-phase chemistry within the low extinction innermost region in the AFGL2591 VLA 3 hot core.

Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

International Nuclear Information System (INIS)

De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.

2000-01-01

Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

Optical polarization maps of star-forming regions in Perseus, Taurus, and Ophiuchus

International Nuclear Information System (INIS)

Goodman, A.A.; Bastien, P.; Menard, F.; Myers, P.C.

1990-01-01

New optical linear polarization maps are presented of the star-forming regions near L1506 in Taurus, L1755 in Ophiuchus, and the complex of dark cloud which extends from L1448 in B5 in Perseus. The former two show a well-defined peak magnetic field direction in the plane of the sky with a finite dispersion about that peak which is smaller than would be expected for a random distribution of field distributions. The dispersion in the position angle of filamentary clouds within these complexes implies that clouds which appear elongated on the plane of the sky are not all associated with a pattern of polarization vectors particularly parallel or perpendicular to their geometry. Instead, clouds tend to be oriented at the angle formed by their axis and the mean direction of the local large-scale field. For the dark cloud complex, a bimodal distribution of the polarization vector angle is taken to result from at least two distributions of gas along the line of sight which appear as a complex in projection. 55 refs

Unbiased water and methanol maser surveys of NGC 1333

Energy Technology Data Exchange (ETDEWEB)

Lyo, A-Ran; Kim, Jongsoo; Byun, Do-Young; Lee, Ho-Gyu, E-mail: arl@kasi.re.kr [Korea Astronomy and Space Science Institute, 776, Daedeokdae-ro Yuseong-gu, Daejeon 305-348 (Korea, Republic of)

2014-11-01

We present the results of unbiased 22 GHz H{sub 2}O water and 44 GHz class I CH{sub 3}OH methanol maser surveys in the central 7' × 10' area of NGC 1333 and two additional mapping observations of a 22 GHz water maser in a ∼3' × 3' area of the IRAS4A region. In the 22 GHz water maser survey of NGC 1333 with a sensitivity of σ ∼ 0.3 Jy, we confirmed the detection of masers toward H{sub 2}O(B) in the region of HH 7-11 and IRAS4B. We also detected new water masers located ∼20'' away in the western direction of IRAS4B or ∼25'' away in the southern direction of IRAS4A. We could not, however, find young stellar objects or molecular outflows associated with them. They showed two different velocity components of ∼0 and ∼16 km s{sup –1}, which are blue- and redshifted relative to the adopted systemic velocity of ∼7 km s{sup –1} for NGC 1333. They also showed time variabilities in both intensity and velocity from multi-epoch observations and an anti-correlation between the intensities of the blue- and redshifted velocity components. We suggest that the unidentified power source of these masers might be found in the earliest evolutionary stage of star formation, before the onset of molecular outflows. Finding this kind of water maser is only possible through an unbiased blind survey. In the 44 GHz methanol maser survey with a sensitivity of σ ∼ 0.5 Jy, we confirmed masers toward IRAS4A2 and the eastern shock region of IRAS2A. Both sources are also detected in 95 and 132 GHz methanol maser lines. In addition, we had new detections of methanol masers at 95 and 132 GHz toward IRAS4B. In terms of the isotropic luminosity, we detected methanol maser sources brighter than ∼5 × 10{sup 25} erg s{sup –1} from our unbiased survey.

Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions

Science.gov (United States)

Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina

2017-09-01

Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http

Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

International Nuclear Information System (INIS)

Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier; Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab; Zhang, Qizhou; Qiu, Keping

2017-01-01

We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s −1 , converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

Crystallization and preliminary X-ray analysis of the complexes between a Fab and two forms of human insulin-like growth factor II

International Nuclear Information System (INIS)

Newman, Janet; Cohen, Edward H.; Cosgrove, Leah; Kopacz, Kris; Dransfield, Daniel T.; Adams, Timothy E.; Peat, Thomas S.

2009-01-01

Complexes of both hIGF-II and hIGF-IIE with a Fab have been crystallized and investigated by X-ray analysis. Elevated expression of insulin-like growth factor II (IGF-II) is frequently observed in a variety of human malignancies, including breast, colon and liver cancer. As IGF-II can deliver a mitogenic signal through both the type 1 insulin-like growth factor receptor (IGF-IR) and an alternately spliced form of the insulin receptor (IR-A), neutralizing the biological activity of this growth factor directly is an attractive therapeutic option. One method of doing this would be to find antibodies that bind tightly and specifically to the peptide, which could be used as protein therapeutics to lower the peptide levels in vivo and/or to block the peptide from binding to the IGF-IR or IR-A. To address this, Fabs were selected from a phage-display library using a biotinylated precursor form of the growth factor known as IGF-IIE as a target. Fabs were isolated that were specific for the E-domain C-terminal extension and for mature IGF-II. Four Fabs selected from the library were produced, complexed with IGF-II and set up in crystallization trials. One of the Fab–IGF-II complexes (M64-F02–IGF-II) crystallized readily, yielding crystals that diffracted to 2.2 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 50.7, b = 106.9, c = 110.7 Å. There was one molecule of the complete complex in the asymmetric unit. The same Fab was also crystallized with a longer form of the growth factor, IGF-IIE. This complex crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 50.7, b = 107, c = 111.5 Å, and also diffracted X-rays to 2.2 Å resolution

Broca's region and Visual Word Form Area activation differ during a predictive Stroop task

DEFF Research Database (Denmark)

Wallentin, Mikkel; Gravholt, Claus Højbjerg; Skakkebæk, Anne

2015-01-01

displayed in green or red (incongruent vs congruent colors). One of the colors, however, was presented three times as often as the other, making it possible to study both congruency and frequency effects independently. Auditory stimuli saying “GREEN” or “RED” had the same distribution, making it possible...... to study frequency effects across modalities. We found significant behavioral effects of both incongruency and frequency. A significant effect (p effect of frequency was observed and no interaction. Conjoined effects of incongruency...... and frequency were found in parietal regions as well as in the Visual Word Form Area (VWFA). No interaction between perceptual modality and frequency was found in VWFA suggesting that the region is not strictly visual. These findings speak against a strong version of the prediction error processing hypothesis...

Radiocarbon ages of pedogenic calcic nodules formed within vertisols, Coimbatore region, Tamil Nadu, India

International Nuclear Information System (INIS)

Achyuthan, H.; Flora, O.; Braida, M.; Stenni, B.; Shankar, N.

2009-05-01

In this paper we discuss the limitation of radiocarbon dates on the pedogenic calcic nodules formed in situ within the vertisols in the upland region of Coimbatore, Tamil Nadu. The radiocarbon ages were obtained using low level scintillation counters and the ages range from ∼24 Ka to ∼31 Ka. The ages correlate well with the marine isotope stage of Late MIS3. Since the calcic nodules are pedogenised and formed in a terrestrial open system we express caution in the interpretation of the radiocarbon ages obtained on pedogenic carbonate nodules. The radiocarbon dates represent maximum ages and hence the ages measured should only be considered as age estimates and not absolute geologic ages. Multiple sub-mm size subsamples could provide more reliable estimates of soil chronology. (author)

Periodic auroral forms and geomagnetic field oscillations in the 1400 MLT region

International Nuclear Information System (INIS)

Potemra, T.A.; Vo, H.; Venkatesan, D.; Cogger, L.L.; Erlandson, R.E.; Zanetti, L.J.; Bythrow, P.F.; Anderson, B.J.

1990-01-01

The UV images obtained with the Viking satellite often show bright features which resemble beads or pearls aligned in the east-west direction between noon and 1800 MLT. Viking acquired a series of 25 UV images during a 28-min period on July 29, 1986, which showed a distinct series of periodic bright features in this region. Magnetic field and hot plasma measurements obtained by Viking confirm that the UV emissions are colocated with the field line projection of an upward-flowing region 1 Birkeland current and precipitating energetic (∼200 eV) electrons. The magnetic field and electric field measurements show transverse oscillations with a nearly constant period of about 3.5 min from 67 degree invariant latitude equatorward up to the location of the large-scale Birkeland current system near 76 degree invariant latitude. The electric field oscillations lead the magnetic field oscillations by about a quarter-period. The authors interpret the observed oscillations as standing Alfven waves driven at a frequency near the local resonance frequency by a large-scale wave in the boundary layer. They propose that the energy flux of the precipitating low-energy electrons in this afternoon region is modulated by this boundary wave and produces the periodic UV emission features. The results of this study support the view that large-scale oscillations of magnetospheric boundaries, possibly associated with the Kelvin-Helmholtz instability, can modulate currents, particles, and auroral forms

Injúria renal aguda: um alerta global

Directory of Open Access Journals (Sweden)

Philip Kam Tao Li

2013-03-01

Full Text Available A Injúria Renal Aguda (IRA é cada vez mais prevalente nos países desenvolvidos e nos em desenvolvimento, e está associada com morbidade e mortalidade severas. A maioria das causas da IRA pode ser evitada por meio de intervenções em nível individual, comunitário, regional e intra-hospitalar. Medidas efetivas devem incluir, em toda a comunidade, os esforços para aumentar a consciência dos efeitos devastadores do IRA e fornecer orientações sobre as estratégias de prevenção, bem como o reconhecimento e tratamento precoces. Os esforços devem ser focados em minimizar as causas de IRA, aumentando a consciência da importância de medidas seriadas de creatinina sérica em pacientes de alto risco para IRA, e documentar o volume de urina em pessoas gravemente doentes para obtenção de diagnóstico precoce; até o momento, não há ainda um papel definitivo para outros biomarcadores. Há a necessidade de protocolos para sistematizar a conduta em condições de IRA pré-renal e em infecções específicas. Dados mais precisos sobre a verdadeira incidência e o impacto clínico da IRA ajudarão a melhor conhecer a importância desta doença, a aumentar o conhecimento de IRA por parte dos governantes, dos médicos em geral e de outros profissionais de saúde para ajudar na prevenção da doença. A prevenção é a chave para evitar a pesado ônus de mortalidade e morbidade associada com IRA.

Injúria renal aguda: um alerta global Acute kidney injury: a global alert

Directory of Open Access Journals (Sweden)

Philip Kam Tao Li

2013-03-01

Full Text Available A Injúria Renal Aguda (IRA é cada vez mais prevalente nos países desenvolvidos e nos em desenvolvimento, e está associada com morbidade e mortalidade severas. A maioria das causas da IRA pode ser evitada por meio de intervenções em nível individual, comunitário, regional e intra-hospitalar. Medidas efetivas devem incluir, em toda a comunidade, os esforços para aumentar a consciência dos efeitos devastadores do IRA e fornecer orientações sobre as estratégias de prevenção, bem como o reconhecimento e tratamento precoces. Os esforços devem ser focados em minimizar as causas de IRA, aumentando a consciência da importância de medidas seriadas de creatinina sérica em pacientes de alto risco para IRA, e documentar o volume de urina em pessoas gravemente doentes para obtenção de diagnóstico precoce; até o momento, não há ainda um papel definitivo para outros biomarcadores. Há a necessidade de protocolos para sistematizar a conduta em condições de IRA pré-renal e em infecções específicas. Dados mais precisos sobre a verdadeira incidência e o impacto clínico da IRA ajudarão a melhor conhecer a importância desta doença, a aumentar o conhecimento de IRA por parte dos governantes, dos médicos em geral e de outros profissionais de saúde para ajudar na prevenção da doença. A prevenção é a chave para evitar a pesado ônus de mortalidade e morbidade associada com IRA.

Hot water in the Inner 100 AU of the Class 0 protostar NGC 1333 IRAS2A

DEFF Research Database (Denmark)

Visser, Ruud; Jørgensen, Jes Kristian; Kristensen, Lars E.

2013-01-01

-303 lines of H_2^{16}O and H_2^{18}O (1097 GHz, E u/k = 249 K) in the low-mass Class 0 protostar NGC 1333 IRAS2A. A spherical radiative transfer model with a power-law density profile is unable to reproduce both the HIFI data and existing interferometric data on the H_2^{18}O 313-220 line (203 GHz, E u....../k = 204 K). Instead, the HIFI spectra likely show optically thick emission from a hot core with a radius of about 100 AU. The mass of the hot core is estimated from the C18O J = 9-8 and 10-9 lines. We derive a lower limit to the hot water abundance of 2 × 10-5, consistent with the theoretical predictions...... of ~10-4. The revised HDO/H2O abundance ratio is 1 × 10-3, an order of magnitude lower than previously estimated. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA....

Long-term Variability of H2CO Masers in Star-forming Regions

Science.gov (United States)

Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

2017-10-01

We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds

Science.gov (United States)

Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.

2011-01-01

The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

The Formation of Massive Stars: from Herschel to Near-Infrared

Directory of Open Access Journals (Sweden)

Paolo Persi

2014-12-01

Full Text Available We have studied a number of selected high mass star forming regions, including high resolution near-infrared broad- and narrow-band imaging, Herschel (70, 160, 250, 350 and 500 μm and Spitzer (3.6, 4.5, 5.8 and 8.0 m images. The preliminary results of one of this region, IRAS 19388+2357(MOL110 are discussed. In this region a dense core has been detected in the far-infrared, and a young stellar cluster has been found around this core. Combining near-IR data with Spitzer and Herschel photometry we have derived the spectral energy distribution of Mol110. Finally comparing our H2 and Kc narrow-band images, we have found an H2 jet in this region.

Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

Energy Technology Data Exchange (ETDEWEB)

Juárez, Carmen; Girart, Josep M. [Institut de Ciències de l’Espai, (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193 Cerdanyola del Vallès, Catalonia (Spain); Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090, Morelia, Michoacán (Mexico); Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei, 10617, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping, E-mail: juarez@ice.cat [School of Astronomy and Space Science, Nanjing University, 163 Xianlin Avenue, Nanjing 210023 (China)

2017-07-20

We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

Simulation study of the chemical forms of neptunium and plutonium in groundwater from a borehole in the northwest region

International Nuclear Information System (INIS)

Ma Yingming; Jin Yuren; Wang Zhiqiang; Liu Dongxu; Liu Wei; Liu Yan

2009-01-01

According to physics-chymistry characteristic of groundwater from a borehole in the northwest region, we performed simulation study of the chemical forms of neptunium and plutonium by the geochemistry modeling program EQ3/6. The main conclusions are as follows: the main chemical form of neptunium in the groundwater is Np(V)'s NpO 2 + , subordination chemical forms are NpO 2 Cl, NpO 2 CO 3 - , NpO 2 OH, NpO 2 SO 4 - ; the main existing form of plutonium in the groundwater is Pu(IV)'s Pu(OH)5-and subordination chemical form is Pu(V)'s PuO 2 + . In addition,the temperature, pH and Eh also have different impacts on the chemical form of neptunium and plutonium. (authors)

The Features of Forming and Using the Finansial and Material Resources of Socially Oriented Non-Profit Organizations of Volgograd Region

Directory of Open Access Journals (Sweden)

Oleynik Olga Stepanovna

2014-12-01

Full Text Available The article deals with the problem of interaction of regional authorities and the institute of socially oriented non-profit organizations that carry out the activity aimed at solving social problems, the development of civil society in Russia. The forms and activities of socially oriented non-profit organizations are systematically presented. The authors reveal the directions and tools for supporting the activities of socially oriented non-profit organizations by public authorities and local self-government bodies. The authors aimed at fixing the peculiarities of organization and conduct of statistical observation over the activity of socially-oriented organizations in Volgograd region. The organizational events were arranged. They were necessary for the conduct of qualitative statistical analysis of the activity of socially oriented organizations. For the first time the official data on the activity of socially oriented non-profit organizations in Volgograd region, including the information on formation and use of money and other property, was received as a result of the statistical observation. The authors focus on the analysis of the sources of money and other property, reveal the composition of income in non-profit organizations of various organizational and legal forms. The forms of work in socially oriented non-profit organizations of Volgograd region and its results as of 2013 are thoroughly studied. The conducted statistical analysis showed that the significant public sector has been established in the region. It provides the necessary public social services, financial or social assistance to the most vulnerable members of society.

Recovery of gold from ammonia-thiosulfate media with amberlite IRA-410 ionic exchange resin; Recuperacion de oro desde un medio amoniaco-tiosulfato con resina de intercambio ionico Amberlite IRA-410

Energy Technology Data Exchange (ETDEWEB)

Navarro, P.; Vargas, C.; Reveco, V.; Orellana, J.

2006-07-01

The absorption and elution of gold in thiosulfate-ammonia media were studied at laboratory level using the Amberlite IRA-410 ionic exchange resin. Tests were carried out in a stirred reactor, maintaining constant temperature (25 degree centigree), with a volume of solution/mass of resin ratio of 833,3 ml/g and during 3 h. The variables tested were the following: pH (9-11), thio sufate concentration (0-0,5 M), ammonia concentration (0-0,5 M) and selectivity in the presence of cupric ion. The obtained results indicate that gold adsorption was quick; the presence of thiosulfate decreased strongly the adsorption; and the presence of ammonia did not affect the adsorption mostly. The copper was in a certain measure a competitor of the gold, but its biggest negative effect was that acted as catalyst of the oxidizing reaction of thiosulfate (S{sub 2}O{sub 3}''2-) to tetrathionate (S{sub 4}O{sub 6}''2), which can cause a partial elution of gold during the load stage. Also, the behavior of CLO-''-{sub 4}; SO{sub 3}''2- and CLO''- as effluents was studied in both gold and copper elution. These tests were also carried out in a stirred reactor, to constant temperature (25 degree centigree) with a volume of aqueous solution/mass of resin ratio of 200 ml/g and for 3 h. Results demonstrated that the copper was eluted more quickly that the gold in all the cases. (Author) 34 refs.

New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region

Science.gov (United States)

van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.

2018-02-01

Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

Lower solar chromosphere-corona transition region. II - Wave pressure effects for a specific form of the heating function

Science.gov (United States)

Woods, D. Tod; Holzer, Thomas E.; Macgregor, Keith B.

1990-01-01

Lower transition region models with a balance between mechanical heating and radiative losses are expanded to include wave pressure effects. The models are used to study the simple damping length form of the heating function. The results are compared to the results obtained by Woods et al. (1990) for solutions in the lower transition region. The results suggest that a mixture of fast-mode and slow-mode waves may provide the appropriate heating mechanism in the lower transition region, with the decline in effective vertical wave speed caused by the refraction and eventual total reflection of the fast-mode wave resulting from the decreasing atmospheric density.

USDA Forest Service Roadless Areas: Potential Biodiversity Conservation Reserves

Directory of Open Access Journals (Sweden)

Colby Loucks

2003-12-01

Full Text Available In January 2001, approximately 23 x 106 ha of land in the U.S. National Forest System were slated to remain roadless and protected from timber extraction under the Final Roadless Conservation Rule. We examined the potential contributions of these areas to the conservation of biodiversity. Using GIS, we analyzed the concordance of inventoried roadless areas (IRAs with ecoregion-scale biological importance and endangered and imperiled species distributions on a scale of 1:24,000. We found that more than 25% of IRAs are located in globally or regionally outstanding ecoregions and that 77% of inventoried roadless areas have the potential to conserve threatened, endangered, or imperiled species. IRAs would increase the conservation reserve network containing these species by 156%. We further illustrate the conservation potential of IRAs by highlighting their contribution to the conservation of the grizzly bear (Ursos arctos, a wide-ranging carnivore. The area created by the addition of IRAs to the existing system of conservation reserves shows a strong concordance with grizzly bear recovery zones and habitat range. Based on these findings, we conclude that IRAs belonging to the U.S. Forest Service are one of the most important biotic areas in the nation, and that their status as roadless areas could have lasting and far-reaching effects for biodiversity conservation.

Shutting down or powering up a (U)LIRG? Merger components in distinctly different evolutionary states in IRAS 19115-2124 (the Bird)

Science.gov (United States)

Väisänen, Petri; Reunanen, Juha; Kotilainen, Jari; Mattila, Seppo; Johansson, Peter H.; Ramphul, Rajin; Romero-Cañizales, Cristina; Kuncarayakti, Hanindyo

2017-10-01

We present new SINFONI near-infrared (NIR) integral field unit (IFU) spectroscopy and Southern African Large Telescope (SALT) optical long-slit spectroscopy characterizing the history of a nearby merging luminous infrared galaxy, dubbed the Bird (IRAS19115-2124). The NIR line-ratio maps of the IFU data cubes and stellar population fitting of the SALT spectra now allow dating of the star formation (SF) over the triple system uncovered from our previous adaptive optics data. The distinct components separate clearly in line-ratio diagnostic diagrams, both thermal and non-thermal excitation is present. An off-nuclear starburst dominates the current SF of the Bird with 60-70 per cent of the total, with a 4-7 Myr age. The most massive nucleus, in contrast, is quenched with a starburst age of >40 Myr and shows hints of budding active galactic nucleus (AGN) activity. The secondary massive nucleus is at an intermediate stage. The two major components have signs of an older stellar population, consistent with a starburst triggered 1 Gyr ago in a first encounter. The simplest explanation of the history is that of a triple merger, where the strongly star-forming component has joined later. We detect multiple gas flows. The Bird offers an opportunity to witness multiple stages of galaxy evolution in the same system; triggering as well as very recent quenching of SF, and, perhaps, an early appearance of AGN activity. It also serves as a cautionary note on interpretations of observations with lower spatial resolution and/or without infrared data. At high redshift the system would look like a clumpy starburst with crucial pieces of its puzzle hidden in danger of misinterpretations.

HIGH-VELOCITY LINE FORMING REGIONS IN THE TYPE Ia SUPERNOVA 2009ig

International Nuclear Information System (INIS)

Marion, G. H.; Foley, Ryan J.; Challis, Peter; Kirshner, Robert P.; Vinko, Jozsef; Wheeler, J. Craig; Silverman, Jeffrey M.; Hsiao, Eric Y.; Brown, Peter J.; Filippenko, Alexei V.; Garnavich, Peter; Landsman, Wayne B.; Parrent, Jerod T.; Pritchard, Tyler A.; Roming, Peter W. A.; Wang, Xiaofeng

2013-01-01

We report measurements and analysis of high-velocity (HVF) (>20,000 km s –1 ) and photospheric absorption features in a series of spectra of the Type Ia supernova (SN) 2009ig obtained between –14 days and +13 days with respect to the time of maximum B-band luminosity (B-max). We identify lines of Si II, Si III, S II, Ca II, and Fe II that produce both HVF and photospheric-velocity (PVF) absorption features. SN 2009ig is unusual for the large number of lines with detectable HVF in the spectra, but the light-curve parameters correspond to a slightly overluminous but unexceptional SN Ia (M B = –19.46 mag and Δm 15 (B) = 0.90 mag). Similarly, the Si II λ6355 velocity at the time of B-max is greater than 'normal' for an SN Ia, but it is not extreme (v Si = 13,400 km s –1 ). The –14 days and –13 days spectra clearly resolve HVF from Si II λ6355 as separate absorptions from a detached line forming region. At these very early phases, detached HVF are prevalent in all lines. From –12 days to –6 days, HVF and PVF are detected simultaneously, and the two line forming regions maintain a constant separation of about 8000 km s –1 . After –6 days all absorption features are PVF. The observations of SN 2009ig provide a complete picture of the transition from HVF to PVF. Most SNe Ia show evidence for HVF from multiple lines in spectra obtained before –10 days, and we compare the spectra of SN 2009ig to observations of other SNe. We show that each of the unusual line profiles for Si II λ6355 found in early-time spectra of SNe Ia correlate to a specific phase in a common development sequence from HVF to PVF

The reactivity of anion-exchange resins by applying OT-for-OH exchange reaction in the equilibrium state

International Nuclear Information System (INIS)

Kano, Naoki; Nihei, Makoto; Imaizumi, Hiroshi

1996-01-01

In order to reveal the behavior of hydroxyl group in isotope exchange reaction, OT-for-OH exchange reaction between each anion-exchange resin (OH - form) and tritiated water (abbreviated as HTO water below) was observed at 80degC under the equilibrium. Anion-exchange resins used were Amberlite IRA-400, IRA-410 (both strongly basic), and IRA-94S (weakly basic). It can be thought that an HTO molecule dissociates into H + +OT - (or T + +OH - ). The activity of each resin based on OT-for-OH exchange reaction was measured with a liquid scintillation counter. From the above-mentioned, the following five were found. Isotope exchange reaction as 'atomic group' occurred between the OH group in each anion-exchange resin and the OT group in HTO water. The reactivity of strongly basic anion-exchange resin is larger than that of weakly basic one. The ratio of the reactivity of these resins can roughly be expressed as follows: (IRA-410): (IRA-400): (IRA-94S)=42: 7: 1. The degree of OT-for-OH exchange reaction may be smaller than that of T-for-H exchange reaction. The method used and results obtained in this work may be helpful to obtain the data for the prevention of T-contamination, especially to obtain the data from certain atomic groups including T. (author)

Young Stellar Objects in the Massive Star-forming Regions W51 and W43

Energy Technology Data Exchange (ETDEWEB)

Saral, G.; Audard, M. [Department of Astronomy, University of Geneva, Ch. d’Ecogia 16, 1290 Versoix (Switzerland); Hora, J. L.; Martínez-Galarza, J. R.; Smith, H. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Motte, F. [Institut de Plantologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes—CNRS-INSU, BP 53, F-38041 Grenoble Cedex 9 (France); Nguyen-Luong, Q. [National Astronomical Observatory of Japan, Chile Observatory, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Saygac, A. T. [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

2017-04-20

We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities in both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.

Diffuse Matter from Star Forming Regions to Active Galaxies A Volume Honouring John Dyson

CERN Document Server

Hartquist, T W

2006-01-01

John Dyson has contributed to the study of the hydrodynamic processes that govern a wide variety of astrophysical sources which he has helped explain. In this volume dedicated to him, introductory reviews to a number of the key processes and to the sources themselves are given by leading experts. The mechanisms in which the multi-component natures of media affect their dynamics receive particular attention, but the roles of hydromagnetic effects are also highlighted. The importance of cosmic ray moderation and mass transfer between different thermal phases for cosmic ray moderation and mass transfer between different thermal phases for the evolution of flows are amongst the topics treated. The main types of regions considered include those where stars form, the circumstellar environments of evolved stars, the larger scale interstellar structures caused by the mass loss of stars, and those where the lines of AGNs form. The reviews complement one another and together provide a coherent introduction to the astro...

A relationship of polycyclic aromatic hydrocarbon features with galaxy merger in star-forming galaxies at z < 0.2

Science.gov (United States)

Murata, Katsuhiro L.; Yamada, Rika; Oyabu, Shinki; Kaneda, Hidehiro; Ishihara, Daisuke; Yamagishi, Mitsuyoshi; Kokusho, Takuma; Takeuchi, Tsutomu T.

2017-11-01

Using the AKARI, Wide-field Infrared Survey Explorer (WISE), Infrared Astronomical Satellite (IRAS), Sloan Digital Sky Survey (SDSS) and Hubble Space Telescope (HST) data, we investigated the relation of polycyclic aromatic hydrocarbon (PAH) mass (MPAH), very small grain mass (MVSG), big grain mass (MBG) and stellar mass (Mstar) with galaxy merger for 55 star-forming galaxies at redshift z 0.1, we divided the galaxies into merger galaxies and non-merger galaxies with the morphological parameter asymmetry A, and quantified merging stages of galaxies based on the morphological indicators, the second-order momentum of the brightest 20 per cent region M20 and the Gini coefficient. We find that MPAH/MBG of merger galaxies tend to be lower than that of non-merger galaxies and there are no systematic differences of MVSG/MBG and MBG/Mstar between merger galaxies and non-merger galaxies. We find that galaxies with very low MPAH/MBG seem to be merger galaxies at late stages. These results suggest that PAHs are partly destroyed at late stages of merging processes. Furthermore, we investigated MPAH/MBG variations in radiation field intensity strength G0 and the emission line ratio of [O I] λ 6300/Hα that is a shock tracer for merger galaxies and find that MPAH/MBG decreases with increasing both G0 and [O I]/Hα. PAH destruction is likely to be caused by two processes: strong radiation fields and large-scale shocks during merging processes of galaxies.

HIGHLY VARIABLE EXTINCTION AND ACCRETION IN THE JET-DRIVING CLASS I-TYPE YOUNG STAR PTF 10nvg (V2492 Cyg, IRAS 20496+4354)

Energy Technology Data Exchange (ETDEWEB)

Hillenbrand, Lynne A.; Carpenter, John M.; Muirhead, Philip S.; Crepp, Justin R. [Astronomy Department, California Institute of Technology, Pasadena, CA 91125 (United States); Miller, Adam A.; Cenko, S. Bradley; Silverman, Jeffrey M.; Bloom, Joshua S.; Filippenko, Alexei V. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Covey, Kevin R. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Fischer, William J. [Department of Physics and Astronomy, University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606 (United States)

2013-03-15

We report extensive new photometry and spectroscopy of the highly variable young stellar object PTF 10nvg (also known as IRAS 20496+4354 and V2492 Cyg), including optical and near-infrared time-series data as well as mid-infrared and millimeter data. Following the previously reported 2010 rise to R{sub PTF} {approx}<13.{sup m}5 and subsequent fade, during 2011 and 2012 the source underwent additional episodes of brightening, followed by several magnitude dimming events including prolonged faint states at R{sub PTF} {approx}> 20{sup m}. The observed high-amplitude variations are largely consistent with extinction changes ({Delta}A{sub V} up to 30 mag) having a {approx}220 day quasi-periodic signal. However, photometry measured when the source was near maximum brightness in mid-2010 as well as in late-2012 does not phase well to this period. Spectral evolution includes not only changes in the spectral slope but also correlated variation in the prominence of TiO/VO/CO bands and atomic line emission, as well as anti-correlated variation in forbidden line emission which, along with H{sub 2}, dominates optical and infrared spectra at faint epochs. Notably, night-to-night variations in several forbidden doublet strengths and ratios are observed. High-dispersion spectra were obtained in a variety of photometric states and reveal time-variable line profiles. Neutral and singly ionized atomic species are likely formed in an accretion flow and/or impact while the origin of zero-velocity atomic Li I {lambda}6707 in emission is unknown. Forbidden lines, including several rare species, exhibit blueshifted emission profiles and likely arise from an outflow/jet. Several of these lines are also seen spatially offset from the continuum source position, presumably in a shocked region of an extended jet. Blueshifted absorption components of the Na I D doublet, K I {lambda}{lambda}7665, 7669 doublet, and the O I 7774 triplet, as well as blueshifted absorption components seen against

AN INFRARED/X-RAY SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Luhman, K. L.; Allen, P. R.; Mamajek, E. E.; Cruz, K. L.

2009-01-01

We present the results of a search for new members of the Taurus star-forming region using data from the Spitzer Space Telescope and the XMM-Newton Observatory. We have obtained optical and near-infrared spectra of 44 sources that exhibit red Spitzer colors that are indicative of stars with circumstellar disks and 51 candidate young stars that were identified by Scelsi and coworkers using XMM-Newton. We also performed spectroscopy on four possible companions to members of Taurus that were reported by Kraus and Hillenbrand. Through these spectra, we have demonstrated the youth and membership of 41 sources, 10 of which were independently confirmed as young stars by Scelsi and coworkers. Five of the new Taurus members are likely to be brown dwarfs based on their late spectral types (>M6). One of the brown dwarfs has a spectral type of L0, making it the first known L-type member of Taurus and the least massive known member of the region (M ∼ 4-7 M Jup ). Another brown dwarf exhibits a flat infrared spectral energy distribution, which indicates that it could be in the protostellar class I stage (star+disk+envelope). Upon inspection of archival images from various observatories, we find that one of the new young stars has a large edge-on disk (r = 2.''5 = 350 AU). The scattered light from this disk has undergone significant variability on a timescale of days in optical images from the Canada-France-Hawaii Telescope. Using the updated census of Taurus, we have measured the initial mass function for the fields observed by XMM-Newton. The resulting mass function is similar to previous ones that we have reported for Taurus, showing a surplus of stars at spectral types of K7-M1 (0.6-0.8 M sun ) relative to other nearby star-forming regions, such as IC 348, Chamaeleon I, and the Orion Nebula Cluster.

VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

Energy Technology Data Exchange (ETDEWEB)

Sarma, A. P.; Eftimova, M. [Physics Department, DePaul University, 2219 N. Kenmore Ave., Byrne Hall 211, Chicago, IL 60614 (United States); Brogan, C. L. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Troland, T. H., E-mail: asarma@depaul.edu [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)

2013-04-10

We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 {mu}G, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

International Nuclear Information System (INIS)

Sarma, A. P.; Eftimova, M.; Brogan, C. L.; Bourke, T. L.; Troland, T. H.

2013-01-01

We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

ALMA Compact Array observations of the Fried Egg nebula: Evidence for large-scale asymmetric mass-loss from the yellow hypergiant IRAS 17163-3907.

Science.gov (United States)

Wallström, S H J; Lagadec, E; Muller, S; Black, J H; Cox, N L J; Galván-Madrid, R; Justtanont, K; Longmore, S; Olofsson, H; Oudmaijer, R D; Quintana-Lacaci, G; Szczerba, R; Vlemmings, W; van Winckel, H; Zijlstra, A

2017-01-10

Yellow hypergiants are rare and represent a fast evolutionary stage of massive evolved stars. That evolutionary phase is characterised by a very intense mass loss, the understanding of which is still very limited. Here we report ALMA Compact Array observations of a 50″-mosaic toward the Fried Egg nebula, around one of the few Galactic yellow hypergiants IRAS 17163-3907. The emission from the 12 CO J=2-1 line, H30 α recombination line, and continuum is imaged at a resolution of ~8″, revealing the morphology of the molecular environment around the star. The continuum emission is unresolved and peaks at the position of the star. The radio recombination line H30 α shows unresolved emission at the star, with an approximately gaussian spectrum centered on a velocity of 21±3 km s -1 with a width of 57±6 km s -1 . In contrast, the CO 2-1 emission is complex and decomposes into several components beyond the contamination from interstellar gas in the line of sight. The CO spectrum toward the star is a broad plateau, centered at the systemic velocity of +18 km s -1 and with an expansion velocity of 100±10 km s -1 . Assuming isotropic and constant mass-loss, we estimate a mass-loss rate of 8±1.5 ×10 -5 M ⊙ yr -1 . At a radius of 25″ from the star, we detect CO emission associated with the dust ring previously imaged by Herschel . The kinematics of this ring, however, is not consistent with an expanding shell, but show a velocity gradient of v sys ±20 km s -1 . In addition, we find a puzzling bright feature radially connecting the star to the CO ring, at a velocity of +40 km s -1 relative to the star. This spur feature may trace a unidirectional ejection event from the star. Our ACA observations reveal the complex morphology around IRAS 17163 and illustrate the breakthroughs that ALMA will bring to the field of massive stellar evolution.

Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring

Science.gov (United States)

Giroux, Mark; Smith, B.; Struck, C.

2011-05-01

Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.

Fast digital 4πβ-4πγ coincidence counting with offline analysis at IRA.

Science.gov (United States)

Teresa Durán, M; Nedjadi, Youcef; Juget, Frédéric; Bochud, François; Bailat, Claude

2018-04-01

IRA recently launched a project to digitize all the data acquisition systems it uses for primary radionuclide standardizations. It is well-known that the digital approach presents numerous advantages over the traditional analog electronics such as information losslessness, scalability, online and/or offline data processing, and it is also a solution to the growing difficulties to repair or renew ageing modules. As a first step in this wider program, our institute set-up a 4πβ-4πγ digital coincidence counting system, with FPGA (Field Programmable Gate Array)-based commercial boards from National Instruments (NI), to perform data acquisition and offline data analysis. Choosing all components and software from the same supplier provides a full compact and consistent electronic system. To demonstrate and validate the capacity of this system to standardize the activity of radioisotopes, we compare its predictions for the activity concentration of 133 Ba, 166m Ho and 18 F solutions with the results from a coincidence counting system with analog electronics, as well as with the results from other primary methods and a secondary measurement performed with an IG11 ionization chamber (CIR, chambre d'ionization de référence) with an equivalent activity traceable to the Système International de Référence. Copyright © 2017 Elsevier Ltd. All rights reserved.

A UKIDSS-based search for low-mass stars and small stellar clumps in off-cloud parts of young star-forming regions* **

Directory of Open Access Journals (Sweden)

Barrado y Navascués D.

2011-07-01

Full Text Available The form and universality of the mass function of young and nearby star-forming regions is still under debate. Its relation to the stellar density, its mass peak and the dependency on most recent models shows significant differencies for the various regions and remains unclear up to date. We aim to get a more complete census of two of such regions. We investigate yet unexplored areas of Orion and Taurus-Auriga, observed by the UKIDSS survey. In the latter, we search for low-mass stars via photometric and proper motion criteria and signs for variability. In Orion, we search for small stellar clumps via nearest-neighbor methods. Highlights in Taurus would be the finding of the missing low-mass stars and the detection of a young cluster T dwarf. In Orion, we discovered small stellar associations of its OB1b and OB1c populations. Combined with what is known in literature, we will provide by this investigations a general picture of the results of the star-forming processes in large areas of Taurus and Orion and probe the most recent models.

ON THE ORIGIN OF THE MOLECULAR OUTFLOWS IN IRAS 16293–2422

Energy Technology Data Exchange (ETDEWEB)

Girart, Josep M.; Palau, Aina; Torrelles, José M. [Institut de Ciències de l' Espai, (CSIC-IEEC), Campus UAB, Facultat de Ciències, C5p 2, E-08193 Bellaterra, Catalonia (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia, Institut de Ciències del Cosmos (UB-IEEC), Martí i Franquès, Universitat de Barcelona, E-08028 Barcelona, Catalonia (Spain); Rao, Ramprasad, E-mail: girart@ice.cat [Institute of Astronomy and Astrophysics, Academia Sinica, 645 N. Aohoku Pl., Hilo, HI 96720 (United States)

2014-01-01

We present CO 3-2, SiO 8-7, C{sup 34}S 7-6, and 878 μm dust continuum subarcsecond angular resolution observations with the Submillimeter Array (SMA) toward the IRAS 16293–2422 (I16293) multiple low-mass protostellar system. The C{sup 34}S emission traces the 878 μm dust continuum well, and in addition clearly shows a smooth velocity gradient along the major axis of component I16293A. CO shows emission at moderate high velocities arising from two bipolar outflows, which appear to be perpendicular with respect to each other. The high sensitivity and higher angular resolution of these observations allows us to pinpoint well the origin of these two outflows at the center of component I16293A. Interestingly, the most compact outflow appears to point toward I16293B. Our data show that the previously reported monopolar blueshifted CO outflow associated with component I16293B seems to be part of the compact outflow arising from component I16293A. In addition, the SiO emission is also tracing this compact outflow: on the one hand, the SiO emission appears to have a jet-like morphology along the southern redshifted lobe; on the other hand, the SiO emission associated with the blueshifted northern lobe traces a well-defined arc on the border of component I16293B facing I16293A. The blueshifted CO lobe of the compact outflow splits into two lobes around the position of this SiO arc. All these results lead us to propose that the compact outflow from component I16293A is impacting on the circumstellar gas around component I16293B, possibly being diverged as a consequence of the interaction.

B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

International Nuclear Information System (INIS)

Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

2013-01-01

We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

Plastid phylogenomics and adaptive evolution of Gaultheria series Trichophyllae (Ericaceae), a clade from sky islands of the Himalaya-Hengduan Mountains.

Science.gov (United States)

Zhang, Ming-Ying; Fritsch, Peter W; Ma, Peng-Fei; Wang, Hong; Lu, Lu; Li, De-Zhu

2017-05-01

Gaultheria series Trichophyllae Airy Shaw is an angiosperm clade of high-alpine shrublets endemic to the Himalaya-Hengduan Mountains and characterized by recent species divergence and convergent character evolution that has until recently caused much confusion in species circumscription. Although multiple DNA sequence regions have been employed previously, phylogenetic relationships among species in the group have remained largely unresolved. Here we examined the effectiveness of the plastid genome for improving phylogenetic resolution within the G. series Trichophyllae clade. Plastid genomes of 31 samples representing all 19 recognized species of the series and three outgroup species were sequenced with Illumina Sequencing technology. Maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) phylogenetic analyses were performed with various datasets, i.e., that from the whole plastid genome, coding regions, noncoding regions, large single-copy region (LSC) and inverted-repeat region a (IRa). The partitioned whole plastid genome with inverted-repeat region b (IRb) excluded was also analyzed with ML and BI. Tree topologies based on the whole plastid genome, noncoding regions, and LSC region datasets across all analyses, and that based on the partitioned dataset with ML and BI analyses, are identical and generally strongly supported. Gaultheria series Trichophyllae form a clade with three species and one variety that is sister to a clade of the remaining 16 species; the latter comprises seven main subclades. Interspecific relationships within the series are strongly supported except for those based on the coding-region and IRa-region datasets. Eight divergence hotspot regions, each possessing >5% percent variable sites, were screened across the whole plastid genome of the 28 individuals sampled in the series. Results of morphological character evolution reconstruction diagnose several clades, and a hypothesis of adaptive evolution for plant habit is

Star-Formation in Free-Floating Evaporating Gaseous Globules

Science.gov (United States)

Sahai, Raghvendra

2017-08-01

We propose to study the stellar embryos in select members of a newly recognized class of Free-floating Evaporating Gaseous Globules (frEGGS) embedded in HII regions and having head-tail shapes. We discovered two of these in the Cygnus massive star-forming region (MSFR) with HST, including one of the most prominent members of this class (IRAS20324). Subsequent archival searches of Spitzer imaging of MSFRs has allowed us to build a statistical sample of frEGGs. Our molecular-line observations show the presence of dense molecular cores with total gas masses of (0.5-few) Msun in these objects, and our radio continuum images and Halpha images (from the IPHAS survey) reveal bright photo-ionized peripheries around these objects. We hypothesize that frEGGs are density concentrations originating in giant molecular clouds, that, when subject to the sculpting and compression by strong winds and UV radiation from massive stars, become active star-forming cores. For the 4 frEGGs with HST or near-IR AO images showing young stars and bipolar cavities produced by their jets or collimated outflows, the symmetry axis points roughly toward the external ionizing star or star cluster - exciting new evidence for our overpressure-induced star formation hypothesis. We propose to test this hypothesis by imaging 24 frEGGs in two nearby MSFRs that represent different radiation-dominated environments. Using ACS imaging with filters F606W, F814W, & F658N (Ha+[NII]), we will search for jets and outflow-excavated cavities, investigate the stellar nurseries inside frEGGs, and determine whether the globules are generally forming multiple star systems or small clusters, as in IRAS20324.

Short forms of the Utrecht-Management of Identity Commitments Scale (U-MICS) with the domains of job, romantic relationship, and region.

Science.gov (United States)

Schubach, Elisabeth; Zimmermann, Julia; Noack, Peter; Neyer, Franz J

2017-01-01

The U-MICS is a self-report questionnaire designed to assess the identity dimensions from a domain-specific perspective. The present study reports on the development of a short-form version for the domains of job and romantic relationship in young adults from Germany and extends this scale to include the domain of region (n Sample1  = 95, 84% female, mean age 22.45 years; n Sample2  = 1,795, 71% female, mean age 24.53 years). We found the short form to possess adequate psychometric properties and to demonstrate a factor structure congruent to the long-form version. Regarding validity, the small correlations across domains within dimensions support a domain-specific approach to identity. The associations between the different identity domains with personality traits are similar, indicating a consistent pattern of convergent validity for all domains. We conclude that "region" provides a valuable complement to the established domains that can all be reliably assessed with the U-MICS-Short Form. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

VizieR Online Data Catalog: Molecular clouds with GLIMPSE/MIPSGAL data (Retes-Romero+, 2017)

Science.gov (United States)

Retes-Romero, R.; Mayya, Y. D.; Luna, A.; Carrasco, L.

2017-11-01

All of the 12 selected molecular clouds have GLIMPSE and MIPSGAL public data available. Typical Spitzer RGB images (3.6um, 8.0um, and 24um) of the resulting sample of clouds are shown in Figure 1, where the position of the IRAS source is identified. In order to define the parent molecular cloud that harbors the high-mass star-forming regions, we used 13CO(J=1-0) emission data from the Galactic Ring Survey (GRS) database (Jackson+ 2006ApJS..163..145J). The survey data have a velocity resolution of 0.21km/s, a typical (1σ) rms sensitivity of ~0.13K, a main beam efficiency of {eta}mb=0.48, and a beam of 46". The 13CO emission spectra for the line of sight (LOS) to the selected IRAS sources are shown in Figure 2, where the observed velocity of the CS(J=2-1) emission line (Bronfman+ 1996, J/A+AS/115/81) is also marked. (3 data files).

NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

International Nuclear Information System (INIS)

Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

2009-01-01

Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

A Study of THT Cold Cores Population in the Star-Forming Region in Serpens

Science.gov (United States)

Fiorellino, Eleonora

2017-11-01

The purpose of this work is to produce the Core Mass Function (CMF) of the Serpens star-forming region and confront it with the Initial Mass Function (IMF), the statistical distribution of initial star mass. As Testi & Sergent (1998) discovered, the power-law index of the slope of the CMF is very close to the one of the Salpeter's IMF (Salpeter, 1955): dN/dM / M2.35. This strongly suggests that the stellar IMF results from the fragmentation process in turbulent cloud cores rather than from stellar accretion mechanisms and gives a huge contribute to undestanding the star formation. For this work, we started from the data delivered by the European satellite Herschel and produced the maps of the Serpens with Unimap code (Piazzo et al, 2015). Hence we obtained a core catalogue with two different softwares getsources (Men'shchikov et al, 2012) and CuTEx (Molinari et al, 2011) and we eliminated from it any source that is not a core. A full discussion of the cores physical propreties as well as the whole region is under preparation.

CHEMICAL EVOLUTION IN HIGH-MASS STAR-FORMING REGIONS: RESULTS FROM THE MALT90 SURVEY

Energy Technology Data Exchange (ETDEWEB)

Hoq, Sadia; Jackson, James M.; Foster, Jonathan B.; Sanhueza, Patricio; Claysmith, Christopher [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Guzmán, Andrés [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Whitaker, J. Scott [Physics Department, Boston University, Boston, MA 02215 (United States); Rathborne, Jill M. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Epping, NSW (Australia); Vasyunina, Tatiana; Vasyunin, Anton, E-mail: shoq@bu.edu, E-mail: jackson@bu.edu, E-mail: patricio@bu.edu, E-mail: claysmit@bu.edu, E-mail: jonathan.b.foster@yale.edu, E-mail: aguzmanf@cfa.harvard.edu, E-mail: scott@bu.edu, E-mail: rathborne@csiro.au, E-mail: tv3h@virginia.edu, E-mail: aiv3f@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

2013-11-10

The chemical changes of high-mass star-forming regions provide a potential method for classifying their evolutionary stages and, ultimately, ages. In this study, we search for correlations between molecular abundances and the evolutionary stages of dense molecular clumps associated with high-mass star formation. We use the molecular line maps from Year 1 of the Millimetre Astronomy Legacy Team 90 GHz (MALT90) Survey. The survey mapped several hundred individual star-forming clumps chosen from the ATLASGAL survey to span the complete range of evolution, from prestellar to protostellar to H II regions. The evolutionary stage of each clump is classified using the Spitzer GLIMPSE/MIPSGAL mid-IR surveys. Where possible, we determine the dust temperatures and H{sub 2} column densities for each clump from Herschel/Hi-GAL continuum data. From MALT90 data, we measure the integrated intensities of the N{sub 2}H{sup +}, HCO{sup +}, HCN and HNC (1-0) lines, and derive the column densities and abundances of N{sub 2}H{sup +} and HCO{sup +}. The Herschel dust temperatures increase as a function of the IR-based Spitzer evolutionary classification scheme, with the youngest clumps being the coldest, which gives confidence that this classification method provides a reliable way to assign evolutionary stages to clumps. Both N{sub 2}H{sup +} and HCO{sup +} abundances increase as a function of evolutionary stage, whereas the N{sub 2}H{sup +} (1-0) to HCO{sup +} (1-0) integrated intensity ratios show no discernable trend. The HCN (1-0) to HNC(1-0) integrated intensity ratios show marginal evidence of an increase as the clumps evolve.

Millimetre wavelength methanol masers survey towards massive star forming regions

Science.gov (United States)

Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.

2007-03-01

We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

Star Formation in Taurus: Preliminary Results from 2MASS

Science.gov (United States)

Beichman, C. A.; Jarrett, T.

1993-01-01

Data with the 2MASS prototype camera were obtained in a 2.3 sq. deg region in Taurus containing Heiles Cloud 2, a region known from IRAS observations to contain a number of very young solar type stars.

The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form.

Science.gov (United States)

Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio

2018-05-01

Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

CH+(1-0) and 13CH+(1-0) absorption lines in the direction of massive star-forming regions

NARCIS (Netherlands)

Falgarone, E.; Godard, B.; Cernicharo, J.; de Luca, M.; Gerin, M.; Phillips, T. G.; Black, J. H.; Lis, D. C.; Bell, T. A.; Boulanger, F.; Coutens, A.; Dartois, E.; Encrenaz, P.; Giesen, T.; Goicoechea, J. R.; Goldsmith, P. F.; Gupta, H.; Gry, C.; Hennebelle, P.; Herbst, E.; Hily-Blant, P.; Joblin, C.; Kaźmierczak, M.; Kołos, R.; Krełowski, J.; Martin-Pintado, J.; Monje, R.; Mookerjea, B.; Neufeld, D. A.; Perault, M.; Pearson, J. C.; Persson, C.; Plume, R.; Salez, M.; Schmidt, M.; Sonnentrucker, P.; Stutzki, J.; Teyssier, D.; Vastel, C.; Yu, S.; Menten, K.; Geballe, T. R.; Schlemmer, S.; Shipman, R.; Tielens, A. G. G. M.; Philipp, S.; Cros, A.; Zmuidzinas, J.; Samoska, L. A.; Klein, K.; Lorenzani, A.; Szczerba, R.; Péron, I.; Cais, P.; Gaufre, P.; Ravera, L.; Morris, P.; Lord, S.; Planesas, P.

2010-01-01

We report the detection of the ground-state rotational transition of the methylidyne cation CH+ and its isotopologue 13CH+ toward the remote massive star-forming regions W33A, W49N, and W51 with the HIFI instrument onboard the Herschel satellite. Both lines are seen only in absorption against the

Developing a Zebrafish Model of NF1 for Structure-Function Analysis and Identification of Modifier Genes

Science.gov (United States)

2012-04-01

protein of 2,800 aa. It contains a small region homologous to yeast IRA proteins that includes a Ras-GTPase-activating domain (GAP) capable of...NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell 63, 851–859. 6. Xu, G.F., O’Connell, P., Viskochil, D...J.W., Glass, J.O., Brewer , V.R., Reddick, W.E., Mages, R. and Pivnick, E.K. (2001) Prospective evaluation of the brain in asymptomatic children with

DISK EVOLUTION IN THE THREE NEARBY STAR-FORMING REGIONS OF TAURUS, CHAMAELEON, AND OPHIUCHUS

International Nuclear Information System (INIS)

Furlan, E.; Watson, Dan M.; McClure, M. K.

2009-01-01

We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

Infall and outflow motions towards a sample of massive star-forming regions from the RMS survey

Science.gov (United States)

Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.

2018-06-01

We present the results of an outflow and infall survey towards a distance-limited sample of 31 massive star-forming regions drawn from the Red MSX source (RMS) survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum-driven, `fossil' outflows. SiO emission is detected towards approximately 46 per cent of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows, respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22 μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.

TRIGONOMETRIC PARALLAXES OF MASSIVE STAR-FORMING REGIONS. II. CEP A AND NGC 7538

International Nuclear Information System (INIS)

Moscadelli, L.; Reid, M. J.; Menten, K. M.; Brunthaler, A.; Xu, Y.; Zheng, X. W.

2009-01-01

We report trigonometric parallaxes for the sources NGC 7538 and Cep A, corresponding to distances of 2.65 +0.12 -0.11 and 0.70 +0.04 -0.04 kpc, respectively. The distance to NGC 7538 is considerably smaller than its kinematic distance and places it in the Perseus spiral arm. The distance to Cep A is also smaller than its kinematic distance and places it in the L ocalarm or spur. Combining the distance and proper motions with observed radial velocities gives the location and full space motion of the star-forming regions. We find significant deviations from circular galactic orbits for these sources: both sources show large peculiar motions (greater than 10 km s -1 ) counter to galactic rotation and NGC 7538 has a comparable peculiar motion toward the Galactic center.

Influence of university network structures on forming the network environment of regional economy (on the example of national research universities of Tatarstan Republic

Directory of Open Access Journals (Sweden)

Darya-Anna Alekseevna Kaibiyainen

2015-03-01

Full Text Available Objective to elaborate theoretical and applied aspects of the processes of forming the new network institutional environment of the Russian regional economy under the influence of the developing integral educational network structures basing on the study of the experience of national research universities of Tatarstan Republic Methods general scientific logical methods of analysis and synthesis induction and deduction scientific abstraction as well as the method of systemicfunctional analysis. Results the practical examples are revealed and analyzed of introducing the new network integral principles into the functioning of national research universities which have a real economic effect and influencing such indicators of regional economy as the growth of employment reduction of unemployment etc. Scientific novelty problems of network structures development in the Russian education have not been thoroughly studied yet. The article analyzes the experience reveals and describes the methods and techniques of forming the network educational structures in the functioning of national research universities in Tatarstan Republic Practical value the author shows the ability of network university structures not only to play a significant role forming the new institutional environment of the regional economy but also to influence the macro and microeconomic indicators of development of the region and the country. nbsp

The Depletion of Water During Dispersal of Planet-forming Disk Regions

Science.gov (United States)

Banzatti, A.; Pontoppidan, K. M.; Salyk, C.; Herczeg, G. J.; van Dishoeck, E. F.; Blake, G. A.

2017-01-01

We present a new velocity-resolved survey of 2.9 μm spectra of hot H2O and OH gas emission from protoplanetary disks, obtained with the Cryogenic Infrared Echelle Spectrometer at the VLT (R ˜ 96,000). With the addition of archival Spitzer-IRS spectra, this is the most comprehensive spectral data set of water vapor emission from disks ever assembled. We provide line fluxes at 2.9-33 μm that probe from the dust sublimation radius at ˜0.05 au out to the region of the water snow line. With a combined data set for 55 disks, we find a new correlation between H2O line fluxes and the radius of CO gas emission, as measured in velocity-resolved 4.7 μm spectra (R {}{co}), which probes molecular gaps in inner disks. We find that H2O emission disappears from 2.9 μm (hotter water) to 33 μm (colder water) as {R}{co} increases and expands out to the snow line radius. These results suggest that the infrared water spectrum is a tracer of inside-out water depletion within the snow line. It also helps clarify an unsolved discrepancy between water observations and models by finding that disks around stars of {M}\\star > 1.5 {M}⊙ generally have inner gaps with depleted molecular gas content. We measure radial trends in H2O, OH, and CO line fluxes that can be used as benchmarks for models to study the chemical composition and evolution of planet-forming disk regions at 0.05-20 au. We propose that JWST spectroscopy of molecular gas may be used as a probe of inner disk gas depletion, complementary to the larger gaps and holes detected by direct imaging and by ALMA.

Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization.

Science.gov (United States)

Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João

2013-04-11

Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

Extreme Variables in Star Forming Regions

Science.gov (United States)

Contreras Peña, Carlos Eduardo

2015-01-01

in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

SEQUENTIAL STAR FORMATION IN RCW 34: A SPECTROSCOPIC CENSUS OF THE STELLAR CONTENT OF HIGH-MASS STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Bik, A.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Puga, E.; Waters, L.B.F.M.; Waelkens, Ch.; Horrobin, M.; Kaper, L.; De Koter, A.; Van den Ancker, M.; Comeron, F.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; Thi, W. F.

2010-01-01

In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is found. At the northern edge of this bubble, an H II region is located, ionized by 3 OB stars, of which the most massive star has spectral type O8.5V. Intermediate-mass stars (2-3 M sun ) are detected of G- and K-spectral type. These stars are still in the pre-main-sequence (PMS) phase. North of the H II region, a photon-dominated region is present, marking the edge of a dense molecular cloud traced by H 2 emission. Several class 0/I objects are associated with this cloud, indicating that star formation is still taking place. The distance to RCW 34 is revised to 2.5 ± 0.2 kpc and an age estimate of 2 ± 1 Myr is derived from the properties of the PMS stars inside the H II region. Between the class II sources in the bubble and the PMS stars in the H II region, no age difference could be detected with the present data. The presence of the class 0/I sources in the molecular cloud, however, suggests that the objects inside the molecular cloud are significantly younger. The most likely scenario for the formation of the three regions is that star formation propagated from south to north. First the bubble is formed, produced by intermediate- and low-mass stars only, after that, the H II region is formed from a dense core at the edge of the molecular cloud, resulting in the expansion similar to a champagne flow. More recently, star formation occurred in the rest of the molecular cloud. Two different formation scenarios are possible. (1) The bubble with the cluster of low- and intermediate-mass stars triggered the formation of the O star at the edge of the molecular cloud, which in its turn induces the current star formation in the molecular cloud. (2) An external triggering is

Trigonometric parallaxes of star forming regions in the Scutum spiral arm

International Nuclear Information System (INIS)

Sato, M.; Wu, Y. W.; Immer, K.; Zhang, B.; Sanna, A.; Brunthaler, A.; Menten, K. M.; Reid, M. J.; Dame, T. M.

2014-01-01

We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due to the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s –1 slower than the Galactic rotation and 8 km s –1 toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.

Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

International Nuclear Information System (INIS)

Kim, Kyungsik

2011-01-01

We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

Water in star-forming regions with Herschel (WISH) : IV. A survey of low-J H2O line profiles toward high-mass protostars

NARCIS (Netherlands)

van der Tak, F. F. S.; Chavarria, L.; Herpin, F.; Wyrowski, F.; Walmsley, C. M.; van Dishoeck, E. F.; Benz, A. O.; Bergin, E. A.; Caselli, P.; Hogerheijde, M. R.; Johnstone, D.; Kristensen, L. E.; Liseau, R.; Nisini, B.; Tafalla, M.

Context. Water is a key constituent of star-forming matter, but the origin of its line emission and absorption during high-mass star formation is not well understood. Aims. We study the velocity profiles of low-excitation H2O lines toward 19 high-mass star-forming regions and search for trends with

Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

International Nuclear Information System (INIS)

Kobushkin, A.P.; Syamtomov, A.I.

1994-01-01

Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.

OpenAIRE

Kato, J; Ito, K; Nakamura, A; Watanabe, H

1989-01-01

Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...

Travel and urban form in the Greater Copenhagen region

DEFF Research Database (Denmark)

Nielsen, Thomas Alexander Sick

of the economic upturn – with a later point in time where the financial crisis had radically changed the economic climate. It follows from the specificity of the historical events that an analysis of what happened to urban form and transport over the financial crisis is to be seen as a case study......Research into the associations between urban form and travel in the capital areal has focussed on subcenters and the stability of urban form correlates over time. A trend towards de-concentration and formation of subcenters in metropolitan areas has been acknowledged for decades. Studies have...... analyzed the new urban structure by identifying subcenters and their land value impacts. Others have focused on subcenters as a location attribute or ‘intervention’ that affects travel patterns and therefore may be employed in the context of urban and transportation demand management. The research has...

Acceptance of alternative forms of family life by students of the Bialskie region [Akceptacja alternatywnych form życia rodzinnego przez studentów powiatu bialskiego

Directory of Open Access Journals (Sweden)

Marzena RUSZKOWSKA

2017-11-01

Full Text Available The article describes the popularity of alternative forms of family life among young people living in urban and rural settings of the Bialski region. It contains a discussion of the results of a survey conducted at the turn of 2013/2014, and an attempt to answer the question whether and, if so how, informal relationships are an alternative to marriage and family, whether young people are aware of the legal consequences of staying in socalled free relationships, and whether they have an impact on a child if it results from such a relationship.

Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions

Science.gov (United States)

Kulesa, Craig A.

Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us

YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

Energy Technology Data Exchange (ETDEWEB)

Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

2014-12-01

The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

Chemical and Physical Picture of IRAS 16293–2422 Source B at a Sub-arcsecond Scale Studied with ALMA

Science.gov (United States)

Oya, Yoko; Moriwaki, Kana; Onishi, Shusuke; Sakai, Nami; López–Sepulcre, Ana; Favre, Cécile; Watanabe, Yoshimasa; Ceccarelli, Cecilia; Lefloch, Bertrand; Yamamoto, Satoshi

2018-02-01

We have analyzed the OCS, H2CS, CH3OH, and HCOOCH3 data observed toward the low-mass protostar IRAS 16293–2422 Source B at a sub-arcsecond resolution with ALMA. A clear chemical differentiation is seen in their distributions; OCS and H2CS are extended with a slight rotation signature, while CH3OH and HCOOCH3 are concentrated near the protostar. Such a chemical change in the vicinity of the protostar is similar to the companion (Source A) case. The extended component is interpreted by the infalling-rotating envelope model with a nearly face-on configuration. The radius of the centrifugal barrier of the infalling-rotating envelope is roughly evaluated to be (30–50) au. The observed lines show the inverse P-Cygni profile, indicating the infall motion within a few 10 au from the protostar. The nearly pole-on geometry of the outflow lobes is inferred from the SiO distribution, and thus, the infalling and outflowing motions should coexist along the line of sight to the protostar. This implies that the infalling gas is localized near the protostar and the current launching points of the outflow have an offset from the protostar. A possible mechanism for this configuration is discussed.

CONDITION OF DECENTRALIZATION AND ORGANIZATIONAL LEGAL FORMS OF SUSTAINABLE DEVELOPMENT OF REGIONS OF UKRAINE IN THE CONTEXT OF THE GLOBAL EXPERIENCE

Directory of Open Access Journals (Sweden)

Nadiia Kulchytska

2016-06-01

Full Text Available In the article the modern condition of decentralization and organizational legal forms of sustainable development of regions of Ukraine in the context of the global experience are analyzed, possible ways to overcome regional disparities are proved. A special place in scientific research article takes a significant number of modern researchers analyzed the theoretical and methodological foundations of a system of financial support of local authorities in the transition to decentralization of public administration. In this regard, particular relevance is the problem of defining the role of decentralization principles in forming the financial support of local government. The importance of decentralization in the process of local government reform is proved. The ways implementing decentralization in modern Ukraine are shown. The scientific approaches to determining the meaning and role of decentralization in a market economy are analyzed and summarized. Key words: decentralization, deconcentration of power, the territorial organization of government, local communities, dotatsiynist, sustainable development. JEL: H 70, R 58

Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

International Nuclear Information System (INIS)

Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

2015-01-01

Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

Influence of urban form on landscape pattern and connectivity in metropolitan regions: a comparative case study of Phoenix, AZ, USA, and Izmir, Turkey.

Science.gov (United States)

Park, Sohyun; Hepcan, Çiğdem C; Hepcan, Şerif; Cook, Edward A

2014-10-01

Although ecological connectivity conservation in urban areas has recently been recognized as an important issue, less is known about its relationship to urban form and landscape pattern. This study investigates how urban morphology influences regional ecosystem pattern and landscape connectivity. Two metropolitan landscapes, Phoenix, AZ, USA, and Izmir, Turkey, were compared, both of which are fast-growing regions in their national context. A wide range of variables were considered for identifying natural and urban properties. The natural characteristics include typology of urban ecosystems, urban to natural cover ratio, dominant habitat type, urban biodiversity, landscape context, and connectivity conservation efforts. Urban parameters examine urban form, urban extent, urban cover proportion, growth rate, populations, urban gradient, major drivers of urbanization, urban density, and mode/approach of urban development. Twelve landscape metrics were measured and compared across the natural patches. Results show that there is little difference in landscape connectivity in the rural zones of Phoenix and Izmir, although Phoenix has slightly higher connectivity values. The connectivity variance in urbanized areas, however, is significantly dependent on the region. For example, Phoenix urban zones have substantially lower connectivity than either urban or suburban zones in Izmir. Findings demonstrate that small and compact urban settlements with more dense populations are more likely to conserve landscape connectivity compared to multiple-concentric but amalgamated urban form spreading all over the landscape (aka urban sprawl).

Infrared emission from dust in the Coma cluster of galaxies

International Nuclear Information System (INIS)

Dwek, E.; Rephaeli, Y.; Mather, J.C.

1990-01-01

Detailed calculations of the infrared emission from collisionally heated dust in the Coma cluster are presented. The proposed model includes continuous dust injection from galaxies, grain destruction by sputtering, and transient grain heating by the hot plasma. The computed infrared fluxes are in agreement with the upper limits obtained from the IRAS. The calculations, and constraints implied by the IRAS observations, suggest that the intracluster dust in the central region of the cluster must be significantly depleted compared to interstellar abundances. The observed visual extinction can therefore not be attributed to the presence of dust in that region. Extinction due to cluster galaxies or their haloes is ruled out as well. The only alternative explanation is that the extinction is caused by dust at great distances from the cluster center. 30 refs

Escape of ionizing radiation from star-forming regions in Young galaxies

DEFF Research Database (Denmark)

Razoumov, A; Sommer-Larsen, Jesper

2006-01-01

Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10......Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10...

Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

Directory of Open Access Journals (Sweden)

Bolychev Oleg

2013-12-01

Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

Directory of Open Access Journals (Sweden)

Bolychev Oleg

2013-11-01

Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

Unequal-thickness billet optimization in transitional region during isothermal local loading forming of Ti-alloy rib-web component using response surface method

Directory of Open Access Journals (Sweden)

Ke WEI

2018-04-01

Full Text Available Avoiding the folding defect and improving the die filling capability in the transitional region are desired in isothermal local loading forming of a large-scale Ti-alloy rib-web component (LTRC. To achieve a high-precision LTRC, the folding evolution and die filling process in the transitional region were investigated by 3D finite element simulation and experiment using an equal-thickness billet (ETB. It is found that the initial volume distribution in the second-loading region can greatly affect the amount of material transferred into the first-loading region during the second-loading step, and thus lead to the folding defect. Besides, an improper initial volume distribution results in non-concurrent die filling in the cavities of ribs after the second-loading step, and then causes die underfilling. To this end, an unequal-thickness billet (UTB was employed with the initial volume distribution optimized by the response surface method (RSM. For a certain eigenstructure, the critical value of the percentage of transferred material determined by the ETB was taken as a constraint condition for avoiding the folding defect in the UTB optimization process, and the die underfilling rate was considered as the optimization objective. Then, based on the RSM models of the percentage of transferred material and the die underfilling rate, non-folding parameter combinations and optimum die filling were achieved. Lastly, an optimized UTB was obtained and verified by the simulation and experiment. Keywords: Die filling, Folding defect, Isothermal local loading forming, Transitional region, Unequal-thickness billet optimization

ALMA INVESTIGATION OF VIBRATIONALLY EXCITED HCN/HCO{sup +}/HNC EMISSION LINES IN THE AGN-HOSTING ULTRALUMINOUS INFRARED GALAXY IRAS 20551−4250

Energy Technology Data Exchange (ETDEWEB)

Imanishi, Masatoshi [Subaru Telescope, 650 North A’ohoku Place, Hilo, HI 96720 (United States); Nakanishi, Kouichiro [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Izumi, Takuma, E-mail: masa.imanishi@nao.ac.jp [Institute of Astronomy, School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan)

2016-07-01

We present the results of ALMA Cycle 2 observations of the ultraluminous infrared galaxy IRAS 20551−4250 at HCN/HCO{sup +}/HNC J = 3–2 lines at both vibrational ground ( v = 0) and vibrationally excited ( v {sub 2} = 1) levels. This galaxy contains a luminous buried active galactic nucleus (AGN), in addition to starburst activity, and our ALMA Cycle 0 data revealed a tentatively detected vibrationally excited HCN v {sub 2} = 1f J = 4–3 emission line. In our ALMA Cycle 2 data, the HCN/HCO{sup +}/HNC J = 3–2 emission lines at v = 0 are clearly detected. The HCN and HNC v {sub 2} = 1f J = 3–2 emission lines are also detected, but the HCO{sup +} v {sub 2} = 1f J = 3–2 emission line is not. Given the high energy level of v {sub 2} = 1 and the resulting difficulty of collisional excitation, we compared these results with those of the calculation of infrared radiative pumping, using the available infrared 5–35 μ m spectrum. We found that all of the observational results were reproduced if the HCN abundance was significantly higher than that of HCO{sup +} and HNC. The flux ratio and excitation temperature between v {sub 2} = 1f and v = 0, after correction for possible line opacity, suggests that infrared radiative pumping affects rotational ( J -level) excitation at v = 0 at least for HCN and HNC. The HCN-to-HCO{sup +} v = 0 flux ratio is higher than those of starburst-dominated regions, and will increase even more when the derived high HCN opacity is corrected. The enhanced HCN-to-HCO{sup +} flux ratio in this AGN-hosting galaxy can be explained by the high HCN-to-HCO{sup +} abundance ratio and sufficient HCN excitation at up to J = 4, rather than the significantly higher efficiency of infrared radiative pumping for HCN than HCO{sup +}.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Age gradients in the stellar populations of massive star forming regions based on a new stellar chronometer

Energy Technology Data Exchange (ETDEWEB)

Getman, Konstantin V.; Feigelson, Eric D.; Kuhn, Michael A.; Broos, Patrick S.; Townsley, Leisa K.; Luhman, Kevin L. [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Naylor, Tim [School of Physics and Astronomy, University of Exeter, Stocker Road, Exeter, EX4 4QL (United Kingdom); Povich, Matthew S. [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Avenue, Pomona, CA 91768 (United States); Garmire, Gordon P. [Huntingdon Institute for X-ray Astronomy, LLC, 10677 Franks Road, Huntingdon, PA 16652 (United States)

2014-06-01

A major impediment to understanding star formation in massive star-forming regions (MSFRs) is the absence of a reliable stellar chronometer to unravel their complex star formation histories. We present a new estimation of stellar ages using a new method that employs near-infrared (NIR) and X-ray photometry, Age {sub JX} . Stellar masses are derived from X-ray luminosities using the L{sub X} -M relation from the Taurus cloud. J-band luminosities are compared to mass-dependent pre-main-sequence (PMS) evolutionary models to estimate ages. Age {sub JX} is sensitive to a wide range of evolutionary stages, from disk-bearing stars embedded in a cloud to widely dispersed older PMS stars. The Massive Young Star-Forming Complex Study in Infrared and X-ray (MYStIX) project characterizes 20 OB-dominated MSFRs using X-ray, mid-infrared, and NIR catalogs. The Age {sub JX} method has been applied to 5525 out of 31,784 MYStIX Probable Complex Members. We provide a homogeneous set of median ages for over 100 subclusters in 15 MSFRs; median subcluster ages range between 0.5 Myr and 5 Myr. The important science result is the discovery of age gradients across MYStIX regions. The wide MSFR age distribution appears as spatially segregated structures with different ages. The Age {sub JX} ages are youngest in obscured locations in molecular clouds, intermediate in revealed stellar clusters, and oldest in distributed populations. The NIR color index J – H, a surrogate measure of extinction, can serve as an approximate age predictor for young embedded clusters.

The role of near infrared radiation in photoaging of the skin.

Science.gov (United States)

Schroeder, Peter; Haendeler, Judith; Krutmann, Jean

2008-07-01

Infrared (IR) radiation is non-ionizing, electromagnetic radiation with wavelengths between 760 nm and 1 mm, which is further divided into IRA, IRB and IRC. IR accounts for more than half of the solar energy that reaches the human skin. While IRB and IRC do not penetrate deeply into the skin, more than 65% of IRA reaches the dermis. Human skin is increasingly exposed to IRA-radiation; most relevant sources are (i) natural solar radiation consisting of over 30% IRA, (ii) artificial IRA sources used for therapeutic or wellness purposes and (iii) artificial UV sources contaminated with IRA. As part of natural sunlight, IRA significantly contributes to extrinsic skin aging. This article reviews the cutaneous effects of IRA-radiation, the underlying molecular mechanisms and the available protective strategies.

A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

International Nuclear Information System (INIS)

Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.; McLeod, K. K.; Apai, D.; Pascucci, I.; Ghez, A. M.; Robberto, M.

2014-01-01

We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M ☉ ). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15 −0.03 +0.05 for M4-M6 (M ∼ 0.1-0.3 M ☉ ) and 4/108 = 0.04 −0.01 +0.03 for >M6 (M ≲ 0.1 M ☉ ) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

Energy Technology Data Exchange (ETDEWEB)

Todorov, K. O.; Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Konopacky, Q. M. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); McLeod, K. K. [Whitin Observatory, Wellesley College, Wellesley, MA 02481 (United States); Apai, D.; Pascucci, I. [Department of Astronomy, University of Arizona, 933 N. Cherry Avenue, Tucson, AZ 85721 (United States); Ghez, A. M. [Division of Astronomy and Astrophysics, University of California, Los Angeles, CA 90095 (United States); Robberto, M., E-mail: todorovk@phys.ethz.ch [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

2014-06-10

We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

The spatial distribution of infrared radiation from visible reflection nebulae

Science.gov (United States)

Luan, Ling; Werner, Michael W.; Dwek, Eli; Sellgren, Kris

1989-01-01

The emission at IRAS 12 and 25 micron bands of reflection nebulae is far in excess of that expected from the longer wavelength equilibrium thermal emission. The excess emission in the IRAS 12 micron band is a general phenomenon, seen in various components of interstellar medium such as IR cirrus clouds, H II regions, atomic and molecular clouds, and also normal spiral galaxies. This excess emission has been attributed to UV excited fluorescence in polycyclic aromatic hydrocarbon (PAH) molecules or to the effect of temperature fluctuations in very small grains. Results are presented of studies of IRAS data on reflection nebulae selected from the van den Bergh reflection nebulae sample. Detailed scans of flux ratio and color temperature across the nebulae were obtained in order to study the spatial distribution of IR emission. A model was used to predict the spatial distribution of IR emission from dust grains illuminated by a B type star. The model was also used to explore the excitation of the IRAS 12 micron band emission as a function of stellar temperature. The model predictions are in good agreement with the analysis of reflection nebulae, illuminated by stars with stellar temperature ranging from 21,000 down to 3,000 K.

Transformation of the Zagreb urban region

Directory of Open Access Journals (Sweden)

Milan Ilić

2004-01-01

Full Text Available Several aspects of the transformation of theZagreb urban region are considered in this work: change in the regionćssize and form, socio-economic transformation, functional transformation andphysiognomic or morphological transformation. It was established that theregionćs form has changed: it is moving from the classic star-like form,characteristic of the early developmental phase of the urban region, to acircular form. The region has experienced evolution in the developmentalsense and reached a phase of absolute decentralization. The process oftransformation in the region is continuing at full pace, while onlyperipheral, mainly small and poorly linked settlements with an unfavorabledemographic balance and processes are lagging behind.

Infrared analysis of LMC superbubbles

International Nuclear Information System (INIS)

Verter, F.; Dwek, E.

1990-01-01

Researchers are analyzing three superbubbles in the Large Magellanic Cloud (LMC), cataloged by Meaburn (1980) as LMC-1, LMC-4 (a.k.a. Shapley Constellation III), and LMC-5. Superbubbles are the largest infrared sources in the disks of external galaxies. Their expansion requires multiple supernovae from successive generations of star formation. In LMC superbubbles, the grains swept up by shocks and winds represent an interstellar medium (ISM) whose abundances are quite different from the Galaxy. By applying the Dwek (1986) grain model, we can derive the composition and size spectrum of the grains. The inputs to this model are the dust emission in the four Infrared Astronomy Satellite (IRAS) bands and the interstellar radiation field (ISRF) that provides the heating. The first step in the project is to derive the ISRF for star-forming regions on the periphery of superbubbles. Researchers are doing this by combining observations at several wavelengths to determine the energy budget of the region. They will use a UV image to trace the ionizing stellar radiation that escapes, an H alpha image to trace the ionizing stellar radiation that is absorbed by gas, and the four IRAS images to trace the stellar radiation, both ionizing and non-ionizing, that is absorbed by dust. This multi-wavelength approach has the advantages that we do not have to assume the shape of the IMF or the extinction of the source

Forming Spirals From Shadows

Science.gov (United States)

Kohler, Susanna

2016-07-01

What causes the large-scale spiral structures found in some protoplanetary disks? Most models assume theyre created by newly-forming planets, but a new study suggests that planets might have nothing to do with it.Perturbations from Planets?In some transition disks protoplanetary disks with gaps in their inner regions weve directly imaged large-scale spiral arms. Many theories currently attribute the formation of these structures to young planets: either the direct perturbations of a planet embedded in the disk cause the spirals, or theyre indirectly caused by the orbit of a planetary body outside of the arms.Another example of spiral arms detected in a protoplanetary disk, MWC 758. [NASA/ESA/ESO/M. Benisty et al.]But what if you could get spirals without any planets? A team of scientists led by Matas Montesinos (University of Chile) have recently published a study in which they examine what happens to a shadowed protoplanetary disk.Casting Shadows with WarpsIn the teams setup, they envision a protoplanetary disk that is warped: the inner region is slightly tilted relative to the outer region. As the central star casts light out over its protoplanetary disk, this disk warping would cause some regions of the disk to be shaded in a way that isnt axially symmetric with potentially interesting implications.Montesinos and collaborators ran 2D hydrodynamics simulations to determine what happens to the motion of particles within the disk when they pass in and out of the shadowed regions. Since the shadowed regions are significantly colder than the illuminated disk, the pressure in these regions is much lower. Particles are therefore accelerated and decelerated as they pass through these regions, and the lack of axial symmetry causes spiral density waves to form in the disk as a result.Initial profile for the stellar heating rate per unit area for one of the authors simulations. The regions shadowed as a result of the disk warp subtend 0.5 radians each (shown on the left

DETECTION OF FORMAMIDE, THE SIMPLEST BUT CRUCIAL AMIDE, IN A SOLAR-TYPE PROTOSTAR

International Nuclear Information System (INIS)

Kahane, C.; Ceccarelli, C.; Faure, A.; Caux, E.

2013-01-01

Formamide (NH 2 CHO), the simplest possible amide, has recently been suggested to be a central species in the synthesis of metabolic and genetic molecules, the chemical basis of life. In this Letter, we report the first detection of formamide in a protostar, IRAS 16293–2422, which may be similar to the Sun and solar system progenitor. The data combine spectra from the millimeter and submillimeter TIMASSS survey with recent, more sensitive observations at the IRAM 30 m telescope. With an abundance relative to H 2 of ∼10 –10 , formamide appears as abundant in this solar-type protostar as in the two high-mass star-forming regions, Orion-KL and SgrB2, where this species has previously been detected. Given the largely different UV-illuminated environments of the three sources, the relevance of UV photolysis of interstellar ices in the synthesis of formamide is therefore questionable. Assuming that this species is formed in the gas phase via the neutral-neutral reaction between the radical NH 2 and H 2 CO, we predict an abundance in good agreement with the value derived from our observations. The comparison of the relative abundance [NH 2 CHO]/[H 2 O] in IRAS 16293–2422 and in the coma of the comet Hale-Bopp supports the similarity between interstellar and cometary chemistry. Our results thus suggest that the abundance of some cometary organic volatiles could reflect gas phase rather than grain-surface interstellar chemistry.

Recent records of birds of conservation concern in the extreme north of Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Marcelo Fischer Barcellos dos Santos

2010-03-01

Full Text Available Our goal is to communicate the occurrence of conservation concern bird species in an Atlantic Forest area of Rio Grande do Sul, in the town of Iraí (27°11’49”S, 53°14’32”W. Compositional data was collected from September 2006 to September 2008 through 364h of field work effort. We registered 23 bird species of conservation interest: sixteen are threatened with extinction in the state of Rio Grande do Sul, four are Near Threatened worldwide (including two regionally threatened, other four are near threatened regionally, and one species is uncommon in the state with poor records. Bird composition in the area shows the importance of conservation and restoration of forests in Iraí, as well as others located in the extreme north of Rio Grande do Sul, since these areas could represent one of the last remaining refuges for a great number of threatened bird species in that region.

Electromagnetic form factors of hadrons

International Nuclear Information System (INIS)

Zidell, V.S.

1976-01-01

A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

Energy Technology Data Exchange (ETDEWEB)

Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: katsuta@hep01.hepl.hiroshima-u.ac.jp [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)

2017-04-20

We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.

TIMASSS: the IRAS 16293-2422 millimeter and submillimeter spectral survey. I. Observations, calibration, and analysis of the line kinematics

NARCIS (Netherlands)

Caux, E.; Kahane, C.; Castets, A.; Coutens, A.; Ceccarelli, C.; Bacmann, A.; Bisschop, S.; Bottinelli, S.; Comito, C.; Helmich, F. P.; Lefloch, B.; Parise, B.; Schilke, P.; Tielens, A. G. G. M.; van Dishoeck, E.; Vastel, C.; Wakelam, V.; Walters, A.

Context. Unbiased spectral surveys are powerful tools to study the chemistry and the physics of star forming regions, because they can provide a complete census of the molecular content and the observed lines probe the physical structure of the source. Aims. While unbiased surveys at the millimeter

The HDO/H2O Ratio in Gas in the Inner Regions of a Low-mass Protostar

DEFF Research Database (Denmark)

Jørgensen, Jes Kristian; van Dishoeck, Ewine F.

2010-01-01

The HDO/H2O abundance ratio is thought to be a key diagnostic for the evolution of water during the star and planet formation process and thus for its origin on Earth. We here present millimeter-wavelength high angular resolution observations of the deeply embedded protostar NGC 1333-IRAS4B from...

Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

CERN Multimedia

2002-01-01

The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

Modelling the IRAS colors of galaxies

International Nuclear Information System (INIS)

Helou, G.

1987-01-01

A physical interpretation is proposed for the color-color diagram of galaxies which are powered only by star formation. The colors of each galaxy result from the combination of two components: cirrus-like emission from the neutral disk, and warmer emission from regions directly involved in on-going star formation. This approach to modelling the emission is based on dust properties, but independent evidence for it is found in the relation between the color sequence and the luminosity sequence. Implications of data and interpretations are discussed and possible tests mentioned for the model

Article, component, and method of forming an article

Science.gov (United States)

Lacy, Benjamin Paul; Itzel, Gary Michael; Kottilingam, Srikanth Chandrudu; Dutta, Sandip; Schick, David Edward

2018-05-22

An article and method of forming an article are provided. The article includes a body portion separating an inner region and an outer region, an aperture in the body portion, the aperture fluidly connecting the inner region to the outer region, and a conduit extending from an outer surface of the body portion at the aperture and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The method includes providing a body portion separating an inner region and an outer region, providing an aperture in the body portion, and forming a conduit over the aperture, the conduit extending from an outer surface of the body portion and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The article is arranged and disposed for insertion within a hot gas path component.

Broad Paschen-alpha emission in two extremely infrared luminous Seyfert 2 galaxies

International Nuclear Information System (INIS)

Hines, D.C.

1991-01-01

The Paschen-alpha emission line in the extremely luminous IRAS-selected galaxies IRAS 20460 + 1925 and IRAS 23060 + 0505 is observed. The observed width of H-α of Pa-α in IRAS 20460 + 1925 is 3300 km/s, with a possible broader component of about 3860 km/s, while the observed width of H-α of Pa-α in IRAS 23060 + 0505 is 3270 km/s, with a possible broader component of about 4780 km/s. Considering these results as well as their bolometric luminosities, IRAS 20460 + 1925 and IRAS 23060 + 0505 are proposed to be classified as QSO's. It is suggested that there is a population of obscured QSO's, and that they can be selected by their warmth infrared energy distributions and QSO-like luminosities. 17 refs

Delineating Partnerships from other Forms of Collaboration in Regional Development Planning

DEFF Research Database (Denmark)

Larsen, Peter Wilgaard

2017-01-01

The idea of an all-encompassing partnership has vindicated all sorts of collaboration models to be articulated as partnerships although not occurring as ones, leaving practitioners and politicians of regional development planning with suboptimal ways of collaborating. Reviewing the partnership...... of regional planning and development, this paper defines a partnership to be a promise of a promise denoting other collaborative models such as network, cluster and governance-partnership as a promise only. Based on qualitative interviews, discursive analyses and strategic documents, the comparative case...... analysis of two Danish regional development agencies shows how one remained as a governance-partnership while the other turned into a partnership by continuously creating possibilities for the groups of actors involved. This transformation from a promise only into a promise of a promise displays how...

MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Carrasco-Gonzalez, Carlos [Max-Planck-Institut fuer Radioastronomie (MPIfR), Auf dem Huegel 69, 53121 Bonn (Germany); Osorio, Mayra; Anglada, Guillem; Gomez, Jose F. [Instituto de Astrofisica de Andalucia, CSIC, Camino Bajo de Huetor 50, E-18008 Granada (Spain); D' Alessio, Paola; Rodriguez, Luis F. [Centro de Radioastronomia y Astrofisica UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacan (Mexico); Torrelles, Jose M., E-mail: carrasco@mpifr-bonn.mpg.de [Instituto de Ciencias del Espacio (CSIC)-UB/IEEC, Universitat de Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain)

2012-02-10

We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

International Nuclear Information System (INIS)

Carrasco-González, Carlos; Osorio, Mayra; Anglada, Guillem; Gómez, José F.; D'Alessio, Paola; Rodríguez, Luis F.; Torrelles, José M.

2012-01-01

We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of ∼120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

Atomic hydrogen in the Orion star-forming region

International Nuclear Information System (INIS)

Chromey, F.R.; Elmegreen, B.G.; Elmegreen, D.M.

1989-01-01

A large-scale survey of atomic hydrogen in Orion reveals low-density material with a total mass comparable to that in dense molecular clouds. The atomic gas is sufficiently dense that it can shield the molecular material from photodissociative radiation and provide a pressure link to the low-density intercloud medium. An excess of H I emission comes from photodissociation fronts near the bright stars and from a giant shell in the Orion Belt region. This shell may have caused the apparent bifurcation between the Orion A and B clouds, and the associated pressures may have induced peculiar motions and star formation in NGC 2023 and 2024. 49 refs

Regional planning without means - search for regional leadership

DEFF Research Database (Denmark)

Groth, Niels Boje; Fertner, Christian

and stakeholders, not least due to its polycentric urban structure with several medium-sized towns. Besides the regional authority and the regions 22 municipalities, sub-regional collaboration is gaining momentum. Furthermore, different fora, councils and associations are engaging in regional issues. However......, collaboration is often focused on specific sectors or sub-regions, while the joint development of the region is left behind. The regional authority has changed its focus from planning to the provision of knowledge, suitable to kick-off joint action with regional stakeholders, while municipalities keep focus...... on their own territories, eventually in the context of one of the new sub-regional collaborations. Based on an empirical analysis of the regional interplay in Southern Denmark and results from the ESPON ReSSI project, we go through these new settings of regional collaboration in the search for new forms...

GALACTIC-SCALE ABSORPTION OUTFLOW IN THE LOW-LUMINOSITY QUASAR IRAS F04250-5718: HUBBLE SPACE TELESCOPE/COSMIC ORIGINS SPECTROGRAPH OBSERVATIONS

International Nuclear Information System (INIS)

Edmonds, Doug; Borguet, Benoit; Arav, Nahum; Dunn, Jay P.; Penton, Steve; Kriss, Gerard A.; Korista, Kirk; Bautista, Manuel; Costantini, Elisa; Kaastra, Jelle; Steenbrugge, Katrien; Ignacio Gonzalez-Serrano, J.; Benn, Chris; Aoki, Kentaro; Behar, Ehud; Micheal Crenshaw, D.; Everett, John; Gabel, Jack; Moe, Maxwell; Scott, Jennifer

2011-01-01

We present absorption line analysis of the outflow in the quasar IRAS F04250-5718. Far-ultraviolet data from the Cosmic Origins Spectrograph on board the Hubble Space Telescope reveal intrinsic narrow absorption lines from high ionization ions (e.g., C IV, N V, and O VI) as well as low ionization ions (e.g., C II and Si III). We identify three kinematic components with central velocities ranging from ∼-50 to ∼-230 km s -1 . Velocity-dependent, non-black saturation is evident from the line profiles of the high ionization ions. From the non-detection of absorption from a metastable level of C II, we are able to determine that the electron number density in the main component of the outflow is ∼ -3 . Photoionization analysis yields an ionization parameter log U H ∼ -1.6 ± 0.2, which accounts for changes in the metallicity of the outflow and the shape of the incident spectrum. We also consider solutions with two ionization parameters. If the ionization structure of the outflow is due to photoionization by the active galactic nucleus, we determine that the distance to this component from the central source is ∼>3 kpc. Due to the large distance determined for the main kinematic component, we discuss the possibility that this outflow is part of a galactic wind.

Laços entre animais e humanos em As Vinhas da Ira de John E. Steinbeck, Vidas secas de Graciliano Ramos e Porteira Fechada de Cyro Martins = Bounds between animals and humans in The Grapes of Wrath by John E. Steinbeck, Vidas Secas by Graciliano Ramos and Porteira Fechada by Cyro Martins

Directory of Open Access Journals (Sweden)

Devincenzi, Isabel Speggiorin

2013-01-01

Full Text Available A relação entre animais e seres humanos foi analisada em três romances – Vidas Secas (1938 de Graciliano Ramos, As Vinhas da Ira (1939 de John E. Steinbeck e Porteira Fechada (1944 de Cyro Martins – como possíveis reflexos de transformações sociais e econômicas no meio rural durante as décadas de 30 e 40. As Vinhas da Ira retrata o período da Grande Depressão nos Estados Unidos, e Vidas Secas e Porteira Fechada, o período do Estado Novo (1937-1945 no Brasil. Primeiramente, foi analisada a caracterização animal dos personagens dos romances; segundamente, como os animais estão presentes na ordem de trabalho no campo; terceiramente, a relação entre os personagens e os animais nos romances. Este estudo pode indicar que a relação entre os personagens e os animais nos romances analisados é marcada pela ruptura, assim como determinados grupos da sociedade brasileira e americana experimentavam uma ruptura de valores naquele período

A substellar-mass protostar and its outflow of IRAS 15398–3359 revealed by subarcsecond-resolution observations of H2CO and CCH

International Nuclear Information System (INIS)

Oya, Yoko; Sakai, Nami; Watanabe, Yoshimasa; Yamamoto, Satoshi; Sakai, Takeshi; Hirota, Tomoya; Lindberg, Johan E.; Bisschop, Suzanne E.; Jørgensen, Jes K.; Van Dishoeck, Ewine F.

2014-01-01

Subarcsecond (0.''5) images of H 2 CO and CCH line emission have been obtained in the 0.8 mm band toward the low-mass protostar IRAS 15398–3359 in the Lupus 1 cloud as one of the Cycle 0 projects of the Atacama Large Millimeter/Submillimeter Array. We have detected a compact component concentrated in the vicinity of the protostar and a well-collimated outflow cavity extending along the northeast-southwest axis. The inclination angle of the outflow is found to be about 20°, or almost edge-on, based on the kinematic structure of the outflow cavity. This is in contrast to previous suggestions of a more pole-on geometry. The centrally concentrated component is interpreted by use of a model of the infalling rotating envelope with the estimated inclination angle and the mass of the protostar is estimated to be less than 0.09 M ☉ . Higher spatial resolution data are needed to infer the presence of a rotationally supported disk for this source, hinted at by a weak high-velocity H 2 CO emission associated with the protostar.

STAR-FORMING OR STARBURSTING? THE ULTRAVIOLET CONUNDRUM

International Nuclear Information System (INIS)

Boquien, M.; Calzetti, D.; Hong, S.; Kennicutt, R.; Dale, D.; Engelbracht, C.; Portouw, J.; Gordon, K. D.; Lee, J. C.

2009-01-01

Compared to starburst galaxies, normal star-forming galaxies have been shown to display a much larger dispersion of the dust attenuation at fixed reddening through studies of the IRX-β diagram (the IR/UV ratio 'IRX' versus the UV color 'β'). To investigate the causes of this larger dispersion and attempt to isolate second parameters, we have used GALEX UV, ground-based optical, and Spitzer infrared imaging of eight nearby galaxies, and examined the properties of individual UV and 24 μm selected star-forming regions. We concentrated on star-forming regions, in order to isolate simpler star formation histories than those that characterize whole galaxies. We find that (1) the dispersion is not correlated with the mean age of the stellar populations; (2) a range of dust geometries and dust extinction curves are the most likely causes for the observed dispersion in the IRX-β diagram, (3) together with some potential dilution of the most recent star-forming population by older unrelated bursts, at least in the case of star-forming regions within galaxies; and (4) we also recover some general characteristics of the regions, including a tight positive correlation between the amount of dust attenuation and the metal content. Although generalizing our results to whole galaxies may not be immediate, the possibility of a range of dust extinction laws and geometries should be accounted for in the latter systems as well.

Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA

Science.gov (United States)

Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa

2018-03-01

We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

An Overview of Interrater Agreement on Likert Scales for Researchers and Practitioners

Directory of Open Access Journals (Sweden)

Thomas A. O'Neill

2017-05-01

Full Text Available Applications of interrater agreement (IRA statistics for Likert scales are plentiful in research and practice. IRA may be implicated in job analysis, performance appraisal, panel interviews, and any other approach to gathering systematic observations. Any rating system involving subject-matter experts can also benefit from IRA as a measure of consensus. Further, IRA is fundamental to aggregation in multilevel research, which is becoming increasingly common in order to address nesting. Although, several technical descriptions of a few specific IRA statistics exist, this paper aims to provide a tractable orientation to common IRA indices to support application. The introductory overview is written with the intent of facilitating contrasts among IRA statistics by critically reviewing equations, interpretations, strengths, and weaknesses. Statistics considered include rwg, rwg*, r′wg, rwg(p, average deviation (AD, awg, standard deviation (Swg, and the coefficient of variation (CVwg. Equations support quick calculation and contrasting of different agreement indices. The article also includes a “quick reference” table and three figures in order to help readers identify how IRA statistics differ and how interpretations of IRA will depend strongly on the statistic employed. A brief consideration of recommended practices involving statistical and practical cutoff standards is presented, and conclusions are offered in light of the current literature.

Radio continuum interferometry of dark clouds: A search for newly formed HII regions

International Nuclear Information System (INIS)

Gilmore, W.S.

1978-01-01

A search for compact HII regions embedded in dark clouds has been carried out in an effort to study local massive star formation. Approximately 20% of the total area of opaque dark cloud material in the sky with Av greater than or equal to 6 mag was surveyed with the NRAO three-element interferometer at 2695 MHz, and at least 5% more was surveyed with the NRAO 300-foot telescope at 4750 MHz. The regions surveyed include the dark cloud complexes in Perseus, Taurus, Orion, and Ophiuchus, as well as several smaller cloud complexes and individual clouds. No hidden compact HII regions embedded inside dark clouds were detected with certainty in the radio continuum. However, eleven HII regions with associated visible emission and eighteen other possible HII regions were detected. Five infrared sources thought to have the luminosities of early B stars were not detected in the radio continuum. These five sources showed high correlation with the presence of CO self-absorption, CO emission over a wide range of velocities, and type I OH masers, but an absence of coincident visible nebulosity and detectable radio continuum emission. Therefore, it is suggested that they represent an earlier evolutionary stage than those HII region detected in the radio continuum. This first evolutionary state marks the presence of ''pre-emergent'' (with respect to the molecular cloud) cocoon stars. HII regions in the second evolutionary state are marked by the presence of detectable radio continuum emission, i.e., they are stronger than 10 mJy at 2695 MHz. They have associated visible nebulosity, are relatively large, and appear to be located at the edges of molecular clouds. These are designated as ''emergent edge'' HII regions. The fact that many young HII regions are edge HII regions implies that massive stars are born near the edges of clouds, a phenomenon previously suggested by several other investigators

Preconcentration determination of arsenic species by sorption of As(V) on Amberlite IRA-410 coupled with fluorescence quenching of L-cysteine capped CdS nanoparticles.

Science.gov (United States)

Hosseini, Mohammad Saeid; Nazemi, Sahar

2013-10-07

A simple and accurate method for arsenic speciation analysis in natural and drinking water samples is described in which preconcentration of arsenic as As(V) was coupled with spectrofluorometric determination. The extracted As(V) species with a column containing Amberlite IRA-410 were subjected to L-cysteine capped CdS quantum dots (QDs) and the fluorescence quenching of the QDs due to reduction of As(V) by L-cysteine was considered as a signal relevant to As(V) concentration. The As(III) species were also determined after oxidation of As(III) ions to As(V) with H2O2 and measurement of the total arsenic content. In treatment with 400 mL portions of water samples containing 30 μg L(-1) As(V), the relative standard deviation was 2.8%. The detection limit of arsenic was also found to be 0.75 μg L(-1) (1 × 10(-8) M). The reliability of proposed method was confirmed using certified reference materials. The trace amounts of arsenic species were then determined in different water samples, satisfactorily.

Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

International Nuclear Information System (INIS)

Quenzer, A.

1977-01-01

The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

Water deuterium fractionation in the high-mass star-forming region G34.26+0.15 based on Herschel/HIFI data

DEFF Research Database (Denmark)

Coutens, Audrey; Vastel, C.; Hincelin, U.

2014-01-01

Understanding water deuterium fractionation is important for constraining the mechanisms of water formation in interstellar clouds. Observations of HDO and H_2^{18}O transitions were carried out towards the high-mass star-forming region G34.26+0.15 with the Heterodyne Instrument for the Far...... to an age of ˜105 yr after the infrared dark cloud stage....

A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

International Nuclear Information System (INIS)

Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez; De Castro, Elisa; Cornide, Manuel

2015-01-01

In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions

A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)

2015-02-01

In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

Asymptotics of Heavy-Meson Form Factors

CERN Document Server

Grozin, A.G.; Grozin, Andrey G.; Neubert, Matthias

1997-01-01

Using methods developed for hard exclusive QCD processes, we calculate the asymptotic behaviour of heavy-meson form factors at large recoil. It is determined by the leading- and subleading-twist meson wave functions. For $1\\ll |v\\cdot v'|\\ll m_Q/\\Lambda$, the form factors are dominated by the Isgur--Wise function, which is determined by the interference between the wave functions of leading and subleading twist. At $|v\\cdot v'|\\gg m_Q/\\Lambda$, they are dominated by two functions arising at order $1/m_Q$ in the heavy-quark expansion, which are determined by the leading-twist wave function alone. The sum of these contributions describes the form factors in the whole region $|v\\cdot v'|\\gg 1$. As a consequence, there is an exact zero in the form factor for the scattering of longitudinally polarized $B^*$ mesons at some value $v\\cdot v'\\sim m_b/\\Lambda$, and an approximate zero in the form factor of $B$ mesons in the timelike region ($v\\cdot v'\\sim -m_b/\\Lambda$). We obtain the evolution equations and sum rules ...

Reversible Stress Cardiomyopathy Presenting as Acute Coronary Syndrome with Elevated Troponin in the Absence of Regional Wall Motion Abnormalities: A Forme Fruste of Stress Cardiomyopathy?

Directory of Open Access Journals (Sweden)

Mahesh Anantha Narayanan

2014-01-01

Full Text Available We present a case of reversible stress cardiomyopathy in a surgical patient, described here as a forme fruste due to its atypical features. It is important to recognize such unusual presentation of stress cardiomyopathy that mimics acute coronary syndrome. Stress cardiomyopathy commonly presents as acute coronary syndrome and is characterized by typical or atypical variants of regional wall motion abnormalities. We report a 60-year-old Caucasian male with reversible stress cardiomyopathy following a sternal fracture fixation. Although the patient had several typical features of stress cardiomyopathy including physical stress, ST-segment elevation, elevated cardiac biomarkers and normal epicardial coronaries, there were few features that were atypical, including unusual age, gender, absence of regional wall motion abnormalities, high lateral ST elevation, and high troponin-ejection fraction product. In conclusion, this could represent a forme fruste of stress cardiomyopathy.

Adsorption behaviour of scandium, yttrium, cerium and uranium from xylenol orange solutions onto anion-exchange resins

Energy Technology Data Exchange (ETDEWEB)

Chao, H E; Suzuki, N [Tohoku Univ., Sendai (Japan). Faculty of Science

1981-04-01

The effects of concentration, pH and anions on the adsorption behaviour of xylenol orange (XO) on the strong anion exchangers, Amberlite IRA-400 and Hitachi 2632 are described. The adsorption behaviour of the XO complexes of Ce(III), Y(III), Sc(III) and U(VI) on the Amberlite IRA-400 resin as a function of XO concentration and pH is reported. A continuous-flow radiometric detector is used to investigate the separations of the Ce(III)-Sc(III), Y(III)-Sc(III), and Ce(III)-Y(III) pairs on the XO-form Hitachi 2632 resin column by pH control. Satisfactory separations of the Ce(III)-Sc(III) and Y(III)-Sc(III) pairs are achieved.

Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

Science.gov (United States)

Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

2014-10-01

Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

Patterns of onset and resolution of immune-related adverse events of special interest with ipilimumab: detailed safety analysis from a phase 3 trial in patients with advanced melanoma.

Science.gov (United States)

Weber, Jeffrey S; Dummer, Reinhard; de Pril, Veerle; Lebbé, Celeste; Hodi, F Stephen

2013-05-01

Ipilimumab 3 mg/kg was the first agent to demonstrate improved survival in previously treated patients with metastatic melanoma in a phase 3 trial (MDX010-20). Ipilimumab produced a characteristic spectrum of immune-related adverse events (irAEs) of special interest, consistent with its immune-based mechanism of action. In MDX010-20, 676 previously treated patients were randomized 3:1:1 to receive ipilimumab 3 mg/kg plus the glycoprotein 100 melanoma antigen vaccine (gp100), ipilimumab 3 mg/kg + placebo, or gp100 vaccine + placebo. For the current report, the authors conducted a detailed analysis of the time to onset and resolution of irAEs associated with ipilimumab therapy. Grade 2 through 5 irAEs generally developed during the induction phase of treatment (0-12 weeks). Most, including grade 3/4 irAEs, were reversible when managed with treatment guidelines using vigilant monitoring and corticosteroids. The median time to resolution (to grade 1 or 0 or to the grade at baseline) of irAEs that had an onset during the induction phase was approximately 6 weeks for grade 2 through 4 irAEs and 8 weeks for grade 3 and 4 irAEs. Across the entire study duration, most grade 2 through 4 irAEs resolved within 12 weeks. Most ipilimumab-associated irAEs, including grade 3/4 symptoms, developed within 12 weeks of initial dosing and resolved within 12 weeks of onset. IrAEs were well characterized in their evolution and could be managed using published algorithms. Copyright © 2013 American Cancer Society.

Dispersive analysis of the pion transition form factor

Science.gov (United States)

Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.

2014-11-01

We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

YOUNG STELLAR OBJECTS IN THE LARGE MAGELLANIC CLOUD STAR-FORMING REGION N206

International Nuclear Information System (INIS)

Romita, Krista Alexandra; Meixner, M.; Sewilo, M.; Shiao, B.; Carlson, Lynn Redding; Whitney, B.; Babler, B.; Meade, M.; Indebetouw, R.; Hora, J. L.

2010-01-01

We present analysis of the energetic star-forming region Henize 206 (N206) located near the southern edge of the Large Magellanic Cloud (LMC) based on photometric data from the Spitzer Surveying the Agents of Galaxy Evolution (SAGE-LMC; IRAC 3.6, 4.5, 5.8, 8.0 μm and MIPS 24 μm), Infrared Survey Facility near-infrared survey (J, H, K s ), and the Magellanic Clouds Photometric Survey (MCPS UBVI) covering a wavelength range of 0.36-24 μm. Young stellar object (YSO) candidates are identified based upon their location in infrared color-magnitude space and classified by the shapes of their spectral energy distributions in comparison with a pre-computed grid of YSO models. We identify 116 YSO candidates: 102 are well characterized by the YSO models, predominately Stage I, and 14 may be multiple sources or young sources with transition disks. Careful examination of the individual sources and their surrounding environment allows us to identify a factor of ∼14.5 more YSO candidates than have already been identified. The total mass of these well-fit YSO candidates is ∼520 M sun . We calculate a current star formation rate of 0.27 x 10 -1 M sun yr -1 kpc -2 . The distribution of YSO candidates appears to follow shells of neutral material in the interstellar medium.

A substellar-mass protostar and its outflow of IRAS 15398–3359 revealed by subarcsecond-resolution observations of H{sub 2}CO and CCH

Energy Technology Data Exchange (ETDEWEB)

Oya, Yoko; Sakai, Nami; Watanabe, Yoshimasa; Yamamoto, Satoshi [Department of Physics, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sakai, Takeshi [Department of Communication Engineering and Informatics, Graduate School of Informatics and Engineering, The University of Electro-Communications, Chofugaoka, Chofu, Tokyo 182-8585 (Japan); Hirota, Tomoya [National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan); Lindberg, Johan E.; Bisschop, Suzanne E.; Jørgensen, Jes K. [Center for Star and Planet Formation, Natural History Museum of Denmark, University of Copenhagen, Østeer Voldgade 5-7, DK-1350 Copenhagen K. (Denmark); Van Dishoeck, Ewine F., E-mail: nami@taurus.phys.s.u-tokyo.ac.jp [Leiden Observatory, Leiden University, P.O. Box 9513, 2300-RA Leiden, The Netherland (Netherlands)

2014-11-10

Subarcsecond (0.''5) images of H{sub 2}CO and CCH line emission have been obtained in the 0.8 mm band toward the low-mass protostar IRAS 15398–3359 in the Lupus 1 cloud as one of the Cycle 0 projects of the Atacama Large Millimeter/Submillimeter Array. We have detected a compact component concentrated in the vicinity of the protostar and a well-collimated outflow cavity extending along the northeast-southwest axis. The inclination angle of the outflow is found to be about 20°, or almost edge-on, based on the kinematic structure of the outflow cavity. This is in contrast to previous suggestions of a more pole-on geometry. The centrally concentrated component is interpreted by use of a model of the infalling rotating envelope with the estimated inclination angle and the mass of the protostar is estimated to be less than 0.09 M {sub ☉}. Higher spatial resolution data are needed to infer the presence of a rotationally supported disk for this source, hinted at by a weak high-velocity H{sub 2}CO emission associated with the protostar.

El así, la ira y la indigencia: la recuperación filosófica del símbolo religioso en el pensamiento de Rodolfo Kusch

Directory of Open Access Journals (Sweden)

Damián J. Burgardt

2010-01-01

Full Text Available Rodolfo Kusch pertenece a esa generación de pensadores argentinos —y latinoamericanos— que se atrevió a abordar filosóficamente el problema de lo humano desde el pensamiento popular de nuestro subcontinente. Estas páginas proponen una breve presentación de su recuperación filosófica del saber contenido en los símbolos religiosos populares y del modo en que estos operan, centrándose en el análisis de dos obras tempranas: América profunda y El pensamiento indígena y popular en América . En estos escritos, Kusch elabora una primera aproximación al símbolo religioso popular como puesta en juego de una determinada configuración de la totalidad, es decir, de un horizonte de ultimidad en que se despliegan y reúnen las posibilidades de la existencia: el mundo, el dios y el hombre aparecen —en el mutuo darse de su “mero estar”— como el así , la ira y la indigencia.

Proton electromagnetic form factors: present status and future perspectives at PANDA

Directory of Open Access Journals (Sweden)

Tomasi-Gustafsson E.

2015-01-01

Full Text Available Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt. Measurements of the reaction p̅ + p → e+ + e− by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold, through the reaction p̅ + p → e+ + e− + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

International Nuclear Information System (INIS)

Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.

1995-01-01

A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

Regional and non-regional cults of affliction in Western Zambia

NARCIS (Netherlands)

Binsbergen, W.M.J.; Werbner, R.P.

1977-01-01

A generic relation holds between two types of cult of affliction in formerly Barotseland. Cults of one type, the non-regional, form a substratum out of which cults of the other type, the regional, may spring forth under certain conditions, and into which they submerge again under different

Dynamic positional fate map of the primary heart-forming region.

Science.gov (United States)

Cui, Cheng; Cheuvront, Tracey J; Lansford, Rusty D; Moreno-Rodriguez, Ricardo A; Schultheiss, Thomas M; Rongish, Brenda J

2009-08-15

Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate mapping data regarding the primary heart-forming field(s). We determined the positional fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a "continuous" circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH Stages 5-7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate - i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to "migration" (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals.

Effective photoprotection of human skin against infrared A radiation by topically applied antioxidants: results from a vehicle controlled, double-blind, randomized study.

Science.gov (United States)

Grether-Beck, Susanne; Marini, Alessandra; Jaenicke, Thomas; Krutmann, Jean

2015-01-01

Infrared A radiation (IRA) from solar sunlight contributes to photoaging of human skin, e.g. by upregulating MMP-1 expression in dermal fibroblasts, indicating the need for photoprotection of human skin against IRA. Up to now, however, there has been no controlled study to show that effective protection of human skin against IRA radiation is possible. Here, we have conducted a randomized, controlled, double-blinded prospective study in 30 healthy volunteers to assess the capacity of an SPF 30 sunscreen versus the same sunscreen supplemented with an antioxidant cocktail containing grape seed extract, vitamin E, ubiquinone and vitamin C to protect human skin against IRA radiation-induced MMP-1 upregulation. As expected, exposure to IRA radiation significantly upregulated MMP-1 expression, as compared to unirradiated skin, and this response was significantly reduced, if the SPF30 sunscreen plus the antioxidant cocktail had been applied prior to IRA radiation. In contrast, treatment of human skin with the SPF30 sunscreen alone did not provide significant protection. These results indicate that topically applied antioxidants effectively protect human skin against IRA radiation and that regular sunscreens need to be supplemented with specific antioxidants in order to achieve IRA photoprotection. © 2014 The American Society of Photobiology.

ALMA DETECTION OF THE VIBRATIONALLY EXCITED HCN J = 4-3 EMISSION LINE IN THE AGN-HOSTING LUMINOUS INFRARED GALAXY IRAS 20551–4250

Energy Technology Data Exchange (ETDEWEB)

Imanishi, Masatoshi [Subaru Telescope, 650 North A' ohoku Place, Hilo, Hawaii, 96720 (United States); Nakanishi, Kouichiro, E-mail: masa.imanishi@nao.ac.jp [Joint ALMA Observatory, Alonso de Córdova 3107, Vitacura 763-0355, Santiago de Chile (Chile)

2013-10-01

We present results from our ALMA Cycle 0 observations, at the frequencies around the HCN, HCO{sup +}, and HNC J = 4-3 transition lines, of the luminous infrared galaxy IRAS 20551–4250 at z = 0.043, which is known to host an energetically important obscured active galactic nucleus (AGN). In addition to the targeted HCN, HCO{sup +}, and HNC J = 4-3 emission lines, two additional strong emission lines are seen, which we attribute to H{sub 2}S and CH{sub 3}CN(+CCH). The HCN-to-HCO{sup +} J = 4-3 flux ratio (∼0.7) is higher than in the other starburst-dominated galaxy (∼0.2) observed in our ALMA Cycle 0 program. We tentatively (∼5σ) detected the vibrationally excited (v {sub 2} = 1) HCN J = 4-3 (l = 1f) emission line, which is important for testing an infrared radiative pumping scenario for HCN. This is the second detection of this molecular transition in external galaxies. The most likely reason for this detection is not only the high flux of this emission line, but also the small molecular line widths observed in this galaxy, suggesting that vibrational excitation of HCN may be relatively common in AGN-hosting galaxies.

Diode having trenches in a semiconductor region

Energy Technology Data Exchange (ETDEWEB)

Palacios, Tomas Apostol; Lu, Bin; Matioli, Elison de Nazareth

2016-03-22

An electrode structure is described in which conductive regions are recessed into a semiconductor region. Trenches may be formed in a semiconductor region, such that conductive regions can be formed in the trenches. The electrode structure may be used in semiconductor devices such as field effect transistors or diodes. Nitride-based power semiconductor devices are described including such an electrode structure, which can reduce leakage current and otherwise improve performance.

Measurements of the millimeter-wave spectrum of interstellar dust emission

Science.gov (United States)

Fischer, M. L.; Clapp, A.; Devlin, M.; Gundersen, J. O.; Lange, A. E.; Lubin, P. M.; Meinhold, P. R.; Richards, P. L.; Smoot, G. F.

1995-01-01

We report measurements of the differential brightness of interstellar dust emission near the Galactic plane and at high Galactic latitudes. The data were obtained as part of a program to measure anisotropy in the cosmic microwave background (CMB). The measurements were made with a 0.5 deg beam size and a 1.3 deg sinusoidal chop, in broad bands (Delta nu/nu approximately 0.3) centered near frequencies of 6, 9, and 12 cm(exp -1). A measurement made toward the Galactic plane, at longitude 1 = 23.7 deg, is compared with the contrast observed in the 100 micrometers IRAS data. Assuming the dust emission has a brightness I(sub nu) proportional to nu(sup n)B(sub nu)(T(sub d)), where B(sub nu) is the Planck function, a best fit yields n = 1.6 +/- 0.4, T(sub d) = 24 +/- 5 K. In a region near the star mu Pegasi (mu PEG l = 91 deg, b = -31 deg), the comparison of our data with the 100 micrometers IRAS data yields n = 1.4 +/- 0.4, and T(sub d) = 18 +/- 3 K. In a second region near the star gamma Ursa Minoris (GUM l = 108 deg, b = 41 deg), an upper limit is placed on contrast in dust emission. This upper limit is consistent with spectrum measured at mu PEG and the IRAS 100 micrometer emission contrast at GUM, which is approximately 8 times lower than mu PEG.

17 CFR 259.0-1 - Availability of forms.

Science.gov (United States)

2010-04-01

... may inspect the forms at this address and at the Commission's regional and district offices. (See... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Availability of forms. 259.0-1 Section 259.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) FORMS...

Insuficiencia renal aguda relacionada con medicamentos en pacientes hospitalizados

Directory of Open Access Journals (Sweden)

Lujan Iavecchia

2015-11-01

Conclusiones: La mitad de los episodios de IRA intrahospitalaria se relacionaron con medicamentos. Los pacientes con IRA relacionada con medicamentos presentaron más antecedentes patológicos cardiovasculares, pero menos factores de riesgo de IRA y una menor mortalidad.

Measurement of weak meson form factors in spacelike regions

CERN Document Server

Brene, N

1973-01-01

With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

NuSTAR View of the Black Hole Wind in the Galaxy Merger IRAS F11119+3257

Science.gov (United States)

Tombesi, F.; Veilleux, S.; Meléndez, M.; Lohfink, A.; Reeves, J. N.; Piconcelli, E.; Fiore, F.; Feruglio, C.

2017-12-01

Galactic winds driven by active galactic nuclei (AGNs) have been invoked to play a fundamental role in the co-evolution between supermassive black holes and their host galaxies. Finding observational evidence of such feedback mechanisms is of crucial importance and it requires a multi-wavelength approach in order to compare winds at different scales and phases. In Tombesi et al., we reported the detection of a powerful ultra-fast outflow (UFO) in the Suzaku X-ray spectrum of the ultra-luminous infrared galaxy IRAS F11119+3257. The comparison with a galaxy-scale OH molecular outflow observed with Herschel in the same source supported the energy-conserving scenario for AGN feedback. The main objective of this work is to perform an independent check of the Suzaku results using the higher sensitivity and wider X-ray continuum coverage of NuSTAR. We clearly detect a highly ionized Fe K UFO in the 100 ks NuSTAR spectrum with parameters N H = (3.2 ± 1.5) × 1024 cm-2, log ξ = {4.0}-0.3+1.2 erg s-1 cm, and {v}{out}={0.253}-0.118+0.061c. The launching radius is likely at a distance of r ≥ 16r s from the black hole. The mass outflow rate is in the range of {\\dot{M}}{out} ≃ 0.5-2 M ⊙ yr-1. The UFO momentum rate and power are {\\dot{P}}{out} ≃ 0.5-2 L AGN/c and {\\dot{E}}{out} ≃ 7%-27% L AGN, respectively. The UFO parameters are consistent between the 2013 Suzaku and the 2015 NuSTAR observations. Only the column density is found to be variable, possibly suggesting a clumpy wind. The comparison with the energetics of molecular outflows estimated in infrared and millimeter wavelengths support a connection between the nuclear and galaxy-scale winds in luminous AGNs.

A high resolution atlas of the galactic plane at 12 microns and 25 microns

Science.gov (United States)

Price, Stephan D.; Korte, Rose M.; Sample, Rebecca S.; Kennealy, John P.; Gonsalves, Robert A.

1994-01-01

High resolution images of the 12 micron and 25 micron IRAS survey data from each HCON crossing the Galactic Plane are being created for those regions that the original IRAS processing labeled as confused. This encompasses the area within 100 deg longitude of the Galactic Center and within 3 deg to 10 deg of the Plane. The procedures used to create the images preserve the spatial resolution inherent in the IRAS instrument. The images are separated into diffuse and point source components and candidate sources are extracted from the point source image after non-linear spatial sharpening. Fluxes are estimated by convolving the candidate sources with the point response function and cross-correlating with the original point source image. A source is considered real if it is seen on at least two HCON's with a rather generous flux match but a stringent position criterion. A number of fields spanning a range of source densities from low to high have been examined. Initial analysis indicates that the imaging and extraction works quite well up to a source density of about 100 sources per square degree or down to roughly 0.8 Janskys.

Physical and chemical differentiation of the luminous star-forming region W49A. Results from the JCMT Spectral Legacy Survey

Science.gov (United States)

Nagy, Z.; van der Tak, F. F. S.; Fuller, G. A.; Plume, R.

2015-05-01

Context. The massive and luminous star-forming region W49A is a well-known Galactic candidate to probe the physical conditions and chemistry similar to those expected in external starburst galaxies. Aims: We aim to probe the physical and chemical structure of W49A on a spatial scale of ~0.8 pc based on the JCMT Spectral Legacy Survey, which covers the frequency range between 330 and 373 GHz. Methods: The wide 2 × 2 arcmin field and the high spectral resolution of the HARP instrument on JCMT provides information on the spatial structure and kinematics of the cloud traced by the observed molecular lines. For species where multiple transitions are available, we estimate excitation temperatures and column densities using a population diagram method that takes beam dilution and optical depth corrections into account. Results: We detected 255 transitions corresponding to 63 species in the 330-373 GHz range at the center position of W49A. Excitation conditions can be probed for 14 molecules, including the complex organic molecules CH3CCH, CH3CN, and CH3OH. The chemical composition suggests the importance of shock, photon-dominated region (PDR), and hot core chemistry. Many molecular lines show a significant spatial extent across the maps including CO and its isotopologues, high density tracers (e.g., HCN, HNC, CS, HCO+), and tracers of UV irradiation (e.g., CN and C2H). The spatially extended species reveal a complex velocity-structure of W49A with possible infall and outflow motions. Large variations are seen between the subregions with mostly blue-shifted emission toward the eastern tail, mostly red-shifted emission toward the northern clump, and emission peaking around the expected source velocity toward the southwest clump. Conclusions: A comparison of column density ratios of characteristic species observed toward W49A to Galactic PDRs suggests that while the chemistry toward the W49A center is driven by a combination of UV irradiation and shocks, UV irradiation

Effect of infrared radiation A on photoaged hairless mice harboring eumelanin and pheomelanin in the epidermis.

Science.gov (United States)

Okazaki, Shizuka; Funasaka, Yoko; Wakamatsu, Kazumasa; Kawana, Seiji; Saeki, Hidehisa

2015-04-01

Infrared radiation A (IRA) is absorbed by melanin and generates heat. Therefore, the effect of IRA could be well analyzed using skin, which contains melanin in the epidermis. Hairless mice harboring epidermal melanocytes that produce eumelanin, pheomelanin, or non-melanin were generated by backcrossing K14-stem cell factor mice, recessive yellow mice, and then albino hairless mice. High-dose IRA was irradiated over 18 weeks after the establishment of photoaged mice by irradiation with ultraviolet B (UVB) three times a week for 14 weeks. Tumor formation was assessed every week. The formation of cyclobutane pyrimidine dimer and apoptotic cells by the irradiation of IRA and UVB was evaluated. Repetitive irradiation of IRA did not promote tumor formation in all types of mice. Pre-irradiation of IRA to UVB, but not post-irradiation, accelerated the elimination of cyclobutane pyrimidine dimers and enhanced apoptosis; these effects were most obvious in eumelanin-producing mice. Real-time polymerase chain reaction analysis showed downregulation of FLICE (cellular caspase 8)-like inhibitory protein and B-cell lymphoma-extra large and upregulation of Bcl-2-associated X protein by UVB, but further enhancement of these molecules by pre-irradiation of IRA was not observed. These results indicate that IRA does not confer the promotion of UVB-induced carcinogenesis in photoaged mice harboring epidermal melanocytes and that photochemical reaction between IRA and melanin might be involved in the induction of apoptosis and the elimination of cyclobutane pyrimidine dimers by UVB. The enhancement of apoptosis by pre-irradiation of IRA to UVB might be induced by mechanisms other than the modification of the mRNA expression of FLICE (cellular caspase 8)-like inhibitory protein, B-cell lymphoma-extra large, and Bcl-2-associated X. © 2015 Japanese Dermatological Association.

Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

Energy Technology Data Exchange (ETDEWEB)

Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Martínez-Delgado, David [Max Planck Institut fur Astronomie, D-69117 Heidelberg (Germany); D' Onghia, Elena [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States); Zibetti, Stefano [INAF-Osservatorio Astrofisico di Arcetri, I-50125 Firenze (Italy); Gabany, R. Jay [Black Bird II Observatory, Alder Springs, CA 93602 (United States); Blanton, Michael, E-mail: rbeaton@virginia.edu [Department of Physics, New York University, New York, NY 10003 (United States)

2014-08-01

We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10{sup 8} M{sub ☉}, which implies a 1:50 merger ratio, has a circular radius, R{sub circ} ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10{sup 10} M{sub ☉}. Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M{sub ☉} yr{sup –1}). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

International Nuclear Information System (INIS)

Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne; Martínez-Delgado, David; D'Onghia, Elena; Zibetti, Stefano; Gabany, R. Jay; Blanton, Michael

2014-01-01

We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10 8 M ☉ , which implies a 1:50 merger ratio, has a circular radius, R circ ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10 10 M ☉ . Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M ☉ yr –1 ). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

TADPOL: A 1.3 mm SURVEY OF DUST POLARIZATION IN STAR-FORMING CORES AND REGIONS

International Nuclear Information System (INIS)

Hull, Charles L. H.; Plambeck, Richard L.; Bower, Geoffrey C.; Heiles, Carl; Kwon, Woojin; Carpenter, John M.; Lamb, James W.; Pillai, Thushara; Crutcher, Richard M.; Hakobian, Nicholas S.; Looney, Leslie W.; Fiege, Jason D.; Franzmann, Erica; Houde, Martin; Hughes, A. Meredith; Marrone, Daniel P.; Matthews, Brenda C.; Pound, Marc W.; Rahman, Nurur; Sandell, Göran

2014-01-01

We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ∼2.''5 resolution TADPOL maps with ∼20'' resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusions in a statistical sense from the ensemble of sources, bearing in mind that these average orientations can be quite uncertain. We discuss three main findings. (1) A subset of the sources have consistent magnetic field (B-field) orientations between large (∼20'') and small (∼2.''5) scales. Those same sources also tend to have higher fractional polarizations than the sources with inconsistent large-to-small-scale fields. We interpret this to mean that in at least some cases B-fields play a role in regulating the infall of material all the way down to the ∼1000 AU scales of protostellar envelopes. (2) Outflows appear to be randomly aligned with B-fields; although, in sources with low polarization fractions there is a hint that outflows are preferentially perpendicular to small-scale B-fields, which suggests that in these sources the fields have been wrapped up by envelope rotation. (3) Finally, even at ∼2.''5 resolution we see the so-called polarization hole effect, where the fractional polarization drops significantly near the total intensity peak. All data are publicly available in the electronic edition of this article

Discontinuous drainage systems formed by highland precipitation and ground-water outflow in the Navua Valles and southwest Hadriacus Mons regions, Mars

Science.gov (United States)

Hargitai, H. I.; Gulick, V. C.; Glines, N. H.

2017-09-01

The Navua Valles are systems of paleodrainages located north of Dao Vallis, which empty into Hellas Planitia, the largest impact basin on Mars. In this study, we mapped and characterized the Navua Valles Region's individual drainage systems, including drainages along the southwestern flank of Hadriacus Mons, and one valley network from the same source as Navua Valles but flowing in the opposite direction. The major drainage systems share morphological characteristics common to both outflow channels and valley networks. The slopes in this region are dissected by two major Navua drainage systems (here Navua A* and B*) and several shorter, sub-parallel valleys formed on the highest gradient (approximately 20 m/km [1.15°]) slopes, at the lowest part of Hellas Basin's rim. The two major drainage systems originate in the highlands, and empty into the basin. Our mapping suggests that water in Navua Valles reached the basin floor in a complicated descent and included several episodes of surface ponding, surface runoff, infiltration, subsurface flow and subsequent outflow. The most prominent channel system, Navua A, forms a repetitive sequence of deep incision into bedrock, followed by a transition into broad channels in erodible materials, and then into unconfined deposits. This successive erosion-transport-deposition sequence continues to repeat along the valley's entire length forming a discontinuous pattern that is consistent with classical fluvial process models. The channels cut into volcanic plains likely emplaced from the formation of Tyrrhenus and Hadriacus Montes. The dendritic source valleys of Navua A originate from the rim of a highland crater while the rest of this subsystem consists of a single, discontinuous channel which is consistent with a single water source zone that likely supplied water for all channels downslope. These drainages may have formed as discontinuous channels, revealing the potential existence of subsurface drainage pathways located

17 CFR 209.0-1 - Availability of forms.

Science.gov (United States)

2010-04-01

... may inspect the forms at this address and at the Commission's regional offices. (See § 200.11 of this... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Availability of forms. 209.0-1 Section 209.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORMS PRESCRIBED...

Conducta agresiva e inteligencia emocional en la adolescencia

Directory of Open Access Journals (Sweden)

Cándido J. Inglés

2014-06-01

Full Text Available Son escasos los estudios que analizan la relación entre conducta agresiva e inteligencia emocional. Este estudio examina la relación entre inteligencia emocional rasgo y los componentes motor (agresividad física y agresividad verbal, cognitivo (hostilidad y afectivo/emocional (ira de la conducta agresiva. El Trait Emotional Intelligence Questionnaire-Adolescents Short Form (TEIQue-ASF y el Aggression Questionnaire Short version (AQ-S fueron administrados a una muestra de 314 adolescentes (52.5% chicos de 12 a 17 años. Los resultados indicaron que los adolescentes con altas puntuaciones en conducta agresiva física, verbal, hostilidad e ira presentaron puntuaciones significativamente más bajas en inteligencia emocional rasgo que sus iguales con puntuaciones bajas en conducta agresiva física, verbal, hostilidad e ira. Este patrón de resultados fue el mismo tanto para la muestra total como para chicos, chicas y los grupos de edad de 12-14 años y 15-17 años. Además, en la mayoría de los casos se hallaron tamaños del efecto grandes apoyando la relevancia empírica de estas diferencias

Genesis of dwarf galaxies in interacting system

International Nuclear Information System (INIS)

Duc, Pierre-Alain

1995-01-01

This research thesis addresses the study of interacting and merging galaxies, and more particularly the associated stellar formation episodes. The author first reports an analysis of the central regions of these objects by studying a specific class among them, i.e. galaxies discovered by the IRAS satellite which are ultra-luminous in the far infrared. The author presents results obtained by optical and infrared imagery and spectroscopy of a complete sample of objects located in the southern hemisphere. In the second part, the author focusses on outside regions of interacting galaxies, discusses the observation of filaments formed under the influence of tidal forces acting during galactic collisions, and of condensations which are as luminous as dwarf galaxies. Then a multi-wavelength study of several neighbouring systems revealed the existence of a specific class of objects, the tidal dwarf galaxies, which are formed from stellar and gaseous material snatched from the disk of interacting galaxies. Gas-rich tidal dwarf galaxies contain, like dwarf irregular galaxies or blue compact galaxies, newly formed stars. But, in opposition with these ones, they are richer in heavy elements: this is one of the consequences of a specific mode of galactic formation based on a cosmic recycling [fr

SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray; Lafrenière, David; Janson, Markus

2015-01-01

We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M ☉ and low-mass stars at ∼0.2 M ☉ . We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M Jup . The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3 −4.9 +6.6 %. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M ☉ appear to be multiple. Higher order multiples were found in 1.8 −1.5 +4.2 % of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively

SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: daemgen@astro.utoronto.ca [Department of Astronomy, Stockholm University, Stockholm (Sweden)

2015-02-01

We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.

Photoprotection beyond ultraviolet radiation--effective sun protection has to include protection against infrared A radiation-induced skin damage.

Science.gov (United States)

Schroeder, P; Calles, C; Benesova, T; Macaluso, F; Krutmann, J

2010-01-01

Solar radiation is well known to damage human skin, for example by causing premature skin ageing (i.e. photoageing). We have recently learned that this damage does not result from ultraviolet (UV) radiation alone, but also from longer wavelengths, in particular near-infrared radiation (IRA radiation, 760-1,440 nm). IRA radiation accounts for more than one third of the solar energy that reaches human skin. While infrared radiation of longer wavelengths (IRB and IRC) does not penetrate deeply into the skin, more than 65% of the shorter wavelength (IRA) reaches the dermis. IRA radiation has been demonstrated to alter the collagen equilibrium of the dermal extracellular matrix in at least two ways: (a) by leading to an increased expression of the collagen-degrading enzyme matrix metalloproteinase 1, and (b) by decreasing the de novo synthesis of the collagen itself. IRA radiation exposure therefore induces similar biological effects to UV radiation, but the underlying mechanisms are substantially different, specifically, the cellular response to IRA irradiation involves the mitochondrial electron transport chain. Effective sun protection requires specific strategies to prevent IRA radiation-induced skin damage. 2010 S. Karger AG, Basel.

A STRING OF RADIO EMISSION ASSOCIATED WITH IRAS 16562-3959: A COLLIMATED JET EMANATING FROM A LUMINOUS MASSIVE YOUNG STELLAR OBJECT

International Nuclear Information System (INIS)

Guzman, Andres E.; Garay, Guido; Brooks, Kate J.

2010-01-01

We report the discovery, made using the Australia Telescope Compact Array, of a remarkable string of radio emission toward IRAS 16562-3959, a luminous infrared source with a bolometric luminosity of 7.0 x 10 4 L sun . The radio emission arises from a compact, bright central component, two inner lobes which are separated by about 7'' and symmetrically offset from the central source, and two outer lobes which are separated by about 45''. The emission from the central object has a spectral index between 1.4 and 8.6 GHz of 0.85 ± 0.15, consistent with free-free emission from a thermal jet. The radio emission from the lobes has spectral indices in the range characteristic of thermal emission. We suggest that the emission from the lobes arises in shocks resulting from the interaction of a collimated wind with the surrounding medium. The radio string is located within a massive dense molecular core, and is associated with extended green emission (Spitzer three-color), Herbig-Haro-type emission (2MASS K s band), and OH maser sites-all phenomena readily observed toward sites of massive star formation. We conclude that the massive core hosts a high-mass star in an early stage of evolution in which it is undergoing the ejection of a powerful collimated stellar wind, showing that jets found in the formation of low-mass stars are also produced in high-mass stars.

Problems forming innovative-technological image of russian regions

Directory of Open Access Journals (Sweden)

Irina Markovna Golova

2012-06-01

Full Text Available In this paper, actual problems of innovative-technological image as a key element of the mechanism of the healing sources of socioeconomic development of the Russian regionsare considered. The author gives an assessment of the level of differentiation of subjects of the Russian Federation on the potential for innovative development. Trends in spatial transformations of thescientific and technical and innovation capacities of the country are analyzedand reasons of low innovational activity of Russian enterprises are disclosed. Basic conditions for the success of actions to create an attractive image of innovative-technological territory are formulated. Special attention is paid to the position of regions as participants in the innovational processes, creating preconditions for creativity, harmonization of spatial priorities of innovation, technological and socio-economic development, support for the development of new high-tech industries, improvement of inter-budgetary relations. There are proved priority areas of state policy to reduce barriers to the realization of an innovative paradigm for development of Russian society and effective inclusion of local communities in the implementation of innovative changes.

SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G.; Lada, Elizabeth A.

2014-01-01

The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H 2 and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H 2 emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster

SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

Energy Technology Data Exchange (ETDEWEB)

Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexíco, Unidad Académica en Ensenada, Km 103 Carr. Tijuana-Ensenada, 22860 Ensenada BC (Mexico); Lada, Elizabeth A., E-mail: jybarra@astro.unam.mx [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States)

2014-10-20

The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H{sub 2} and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H{sub 2} emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster.

MODEL EVALUATION OF THE SPATIAL DEVELOPMENT OF THE REGION THROUGH THE DEVELOPMENT OF REGIONAL ECONOMIC CLUSTERS

Directory of Open Access Journals (Sweden)

Чингис Дашидалаевич Дашицыренов

2013-12-01

Full Text Available The article describes a model of evaluation of effectiveness of spatial development of a region. Main approaches and criteria to assess effectiveness of socio-economic development of a region based on use of regional economic cluster are identified.The author believes that clusterization allows to eliminate or localize mentioned above restrictions which are characteristic of specific activity of entities. Effect in this case can be measured by increase in productivity obtained from cluster’s resources use  in regard to specific form of enterprises’ existence.The article also focused on definition of idea of synergic effect and the model of effectiveness of clusters. Cluster integration’s essence is considered – it is pointed out that a new structure is formed, which has emergent characteristics.Thus, main approach to spatial socio-economic development of a region proposed by the author is diversification of organizational and economic forms into regional economic clusters.Proposed by the author model allows to assess effectiveness of clusterization for spatial socio-economic development of any region. DOI: http://dx.doi.org/10.12731/2218-7405-2013-10-14

Young Stars in the Camelopardalis Dust and Molecular Clouds. VI. YSOs Verified by Spitzer and Akari Infrared Photometry

Directory of Open Access Journals (Sweden)

Straižys V.

2010-06-01

Full Text Available Using photometric data of infrared surveys, young stellar object (YSO status is verified for 141 objects selected in our previous papers in the Cassiopeia and Camelopardalis segment of the Milky Way bounded by Galactic coordinates (l, b = (132-158°, ±12°. The area includes the known star- forming regions in the emission nebulae W3, W4 and W5 and the massive YSO AFGL490. Spectral energy distribution (SED curves between 700 nm and 160 μm, constructed from the GSC 2, 2MASS, IRAS, MSX, Spitzer and AKARI data, are used to estimate the evolutionary stages of these stars. We confirm the YSO status for most of the objects. If all of the investigated objects were YSOs, 45% of them should belong to Class I, 41% to class II and 14% to Class III. However, SEDs of some of these objects can be affected by nearby extended infrared sources, like compact H II regions, infrared clusters or dusty galaxies.

VizieR Online Data Catalog: SEAMBHs. I. Mrk 142, Mrk 335, and IRAS F12397+3333 (Du+, 2014)

Science.gov (United States)

Du, P.; Hu, C.; Lu, K.-X.; Wang, F.; Qiu, J.; Li, Y.-R.; Bai, J.-M.; Kaspi, S.; Netzer, H.; Wang, J.-M.; SEAMBH Collaboration

2016-03-01

All the spectroscopy and imaging observations reported here were obtained with the Shangri-La telescope (SLT: IAU site code O44) at the Lijiang Station of the Yunnan Observatory of the Chinese Academy of Sciences. The SLT started its operation in 2008. This is a 2.4m alt-azimuth mounted Ritchey-Chretien telescope. The rms pointing error is about 2arcsec rms, and the tracking accuracy with autoguiding is better than 0.5''/hr. The longitude of the station is 100°01'51''E, the latitude 26°42'32''N, and the altitude 3193m. The annually averaged seeing is ~1.5'' in terms of the FWHM of stars (measured with Yunnan Faint Object Spectrograph and Camera, YFOSC), ranging from 0.7'' to 2.0''. The YFOSC, built in 2010 by the astronomical instrumentation team at the Niels Bohr Institute, is similar to the ESO Faint Object Spectrograph and Camera, but with an additional focal reducer. It started its operation in 2011. YFOSC is a versatile instrument for low resolution spectroscopy and imaging, working at the Cassegrain focus. The CCD chip is an e2v CCD42-90 Back Illuminated Deep Depletion 2048*4608 pixel Scientific CCD Sensor whose pixel size is 13.5mm, pixel scale 0.283''/pixel, covering a 10'*10' field of view (FOV). Our Reverberation Mapping (RM) campaign started in 2012 October. All the spectra were obtained using YFOSC with Grism 14 which provides a resolution of 92Å/mm (1.8Å/pixel) and covers the wavelength range of 3800-7200Å. In this first paper of the series we report the observations of three objects: Mrk 142, Mrk 335, and IRAS F12397+3333. (3 data files).

Conceptual Approach to Forming the Basic Code of Neo-Industrial Development of a Region

Directory of Open Access Journals (Sweden)

Elena Leonidovna Andreeva

2017-09-01

Full Text Available In the article, the authors propose the conceptual fundamentals of the “code approach” to the regional neo-industrial development. The purpose of the research is to reveal the essence of the transition to a new type of industrial and economic relations through a prism of “genetic codes” of the region. We consider these codes as a system of the “racial memory” of a territory, which determines the specificity and features of neo-industrialization realization. We substantiated the hypothesis about the influence of the “genetic codes” of the region on the effectiveness of the neo-industrialization. We have defined the participants, or else the carriers of the codes in the transformation of regional inheritance for the stimulation of the neoindustrial development of region’s economy. The subject matter of the research is the distinctive features of the functioning of the determinative region’s codes. Their content determines the socio-economic specificity of the region and the features of innovative, informational, value-based and competence-based development of the territory. The determinative codes generate the dynamic codes of the region, which are understood as their derivatives. They have a high probability of occurrence, higher speed of development and distribution, internal forces that make possible the self-development of the region. The scientific contribution is the substantiation of the basic code of the regional neo-industrial development. It represents the evolutionary accumulation of the rapid changes of its innovative, informational, value-based and competence-based codes stimulating the generation and implementation of new ideas regarding to economic entities adapted to the historical and cultural conditions. The article presents the code model of neo-industrial development of the region described by formulas. We applied the system analysis methods, historical and civilization approaches, evolutionary and

Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements With Modified Blackbody Fitting

Energy Technology Data Exchange (ETDEWEB)

Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

2017-11-01

We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; −13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ {sup 2} values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; −7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect

Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting

Science.gov (United States)

Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.

2017-11-01

We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

Energy Technology Data Exchange (ETDEWEB)

Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

2017-11-01

Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.

Current correlators and form factors in the resonance region

Energy Technology Data Exchange (ETDEWEB)

Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)

2009-01-15

Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

"Mature Regionalism" and the Genesis of "Functional Projects": "Educational Regionalism" in Small (and Micro-States)

Science.gov (United States)

Jules, Tavis D.

2017-01-01

This article advances that the movement towards "deeper" Caribbean integration has generated a shift from "immature" regionalism to a "mature" form of regionalism. Thus, mature regionalism, a new governance mechanism, in regulating the institutional and legal framework of Caribbean Single Market and Economy is…

Pion form factor

Energy Technology Data Exchange (ETDEWEB)

Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

1994-04-01

It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

Atomoxetine, a norepinephrine reuptake inhibitor, reduces seizure-induced respiratory arrest.

Science.gov (United States)

Zhang, Honghai; Zhao, Haiting; Feng, Hua-Jun

2017-08-01

Sudden unexpected death in epilepsy (SUDEP) is a devastating epilepsy complication, and no effective preventive strategies are currently available for this fatal disorder. Clinical and animal studies of SUDEP demonstrate that seizure-induced respiratory arrest (S-IRA) is the primary event leading to death after generalized seizures in many cases. Enhancing brain levels of serotonin reduces S-IRA in animal models relevant to SUDEP, including the DBA/1 mouse. Given that serotonin in the brain plays an important role in modulating respiration and arousal, these findings suggest that deficits in respiration and/or arousal may contribute to S-IRA. It is well known that norepinephrine is an important neurotransmitter that modulates respiration and arousal in the brain as well. Therefore, we hypothesized that enhancing noradrenergic neurotransmission suppresses S-IRA. To test this hypothesis, we examined the effect of atomoxetine, a norepinephrine reuptake inhibitor (NRI), on S-IRA evoked by either acoustic stimulation or pentylenetetrazole in DBA/1 mice. We report the original observation that atomoxetine specifically suppresses S-IRA without altering the susceptibility to seizures evoked by acoustic stimulation, and atomoxetine also reduces S-IRA evoked by pentylenetetrazole in DBA/1 mice. Our data suggest that the noradrenergic signaling is importantly involved in S-IRA, and that atomoxetine, a medication widely used to treat attention deficit hyperactivity disorder (ADHD), is potentially useful to prevent SUDEP. Copyright © 2017 Elsevier Inc. All rights reserved.

Increasing the Robustness of the Sheet Metal Forming Simulation by the Prediction of the Forming Limit Band

Science.gov (United States)

Banabic, D.; Vos, M.; Paraianu, L.; Jurco, P.

2007-05-01

The experimental research on the formability of metal sheets has shown that there is a significant dispersion of the limit strains in an area delimited by two curves: a lower curve (LFLC) and an upper one (UFLC). The region between the two curves defines the so-called Forming Limit Band (FLB). So far, this forming band has only been determined experimentally. In this paper the authors suggested a method to predict the Forming Limit Band. The proposed method is illustrated on the AA6111-T43 aluminium alloy.

Increasing the Robustness of the Sheet Metal Forming Simulation by the Prediction of the Forming Limit Band

International Nuclear Information System (INIS)

Banabic, D.; Paraianu, L.; Vos, M.; Jurco, P.

2007-01-01

The experimental research on the formability of metal sheets has shown that there is a significant dispersion of the limit strains in an area delimited by two curves: a lower curve (LFLC) and an upper one (UFLC). The region between the two curves defines the so-called Forming Limit Band (FLB). So far, this forming band has only been determined experimentally. In this paper the authors suggested a method to predict the Forming Limit Band. The proposed method is illustrated on the AA6111-T43 aluminium alloy

MODERN FORMS OF PARTNERSHIP IN BUSINESS

OpenAIRE

Markova V. D.; Trapeznikov I. S.

2016-01-01

The article examines tendencies of the development of new organizational forms of partnership and marks several problems of their usage in Russian conditions by the example of the Novosibirsk region. Modern forms of networking and partnership of commercial companies and universities, research institutes and other organizations, such as clusters, strategic alliances, technology platforms, business ecosystems and other, are focused on the development of new market opportunities and gaining comp...

Mapping jet-ISM interactions in X-ray binaries with ALMA: a GRS 1915+105 case study

Science.gov (United States)

Tetarenko, A. J.; Freeman, P.; Rosolowsky, E. W.; Miller-Jones, J. C. A.; Sivakoff, G. R.

2018-03-01

We present Atacama Large Millimetre/Sub-Millimetre Array (ALMA) observations of IRAS 19132+1035, a candidate jet-interstellar medium (ISM) interaction zone near the black hole X-ray binary (BHXB) GRS 1915+105. With these ALMA observations (combining data from the 12 m array and the Atacama Compact Array), we map the molecular line emission across the IRAS 19132+1035 region. We detect emission from the 12CO [J = 2 - 1], 13CO [ν = 0, J = 2 - 1], C18O [J = 2 - 1], H2CO [J = 30, 3 - 20, 2], H2CO [J = 32, 2 - 22, 1], H2CO [J = 32, 1 - 22, 0], SiO [ν = 0, J = 5 - 4], CH3OH [J = 42, 2 - 31, 2], and CS [ν = 0, J = 5 - 4] transitions. Given the morphological, spectral, and kinematic properties of this molecular emission, we present several lines of evidence that support the presence of a jet-ISM interaction at this site, including a jet-blown cavity in the molecular gas. This compelling new evidence identifies this site as a jet-ISM interaction zone, making GRS 1915+105, the third Galactic BHXB with at least one conclusive jet-ISM interaction zone. However, we find that this interaction occurs on much smaller scales than was postulated by previous work, where the BHXB jet does not appear to be dominantly powering the entire IRAS 19132+1035 region. Using estimates of the ISM conditions in the region, we utilize the detected cavity as a calorimeter to estimate the time-averaged power carried in the GRS 1915+105 jets of (8.4^{+7.7}_{-8.1})× 10^{32} erg s^{-1}. Overall, our analysis demonstrates that molecular lines are excellent diagnostic tools to identify and probe jet-ISM interaction zones near Galactic BHXBs.

Spectropolarimetry, variability, and the taxonomy of active galactic nuclei

International Nuclear Information System (INIS)

Goodrich, R.W.

1988-01-01

Two subclasses of active galactic nuclei (AGN) are studied using spectropolarimetry, with the intent of defining the relationships of the subclasses to other classes of AGNs, and to study the physics of the objects themselves. In the Seyfert 1.8/1.9 class there is good evidence for dust just outside of the broad-line regions in two objects, IRAS 1958-183 and NGC 2622. Spectropolarimetry of the latter object reveals the presence of dust moving at ∼ -800 s -1 along the our line-of-sight, and causing much of the polarization in the object. In addition, three of these objects have undergone extreme variability. Combining IDS data from Osterbrock and collaborators with the more recent CCD data it is shown that in all three cases the changes in both broad emission line fluxes and featureless continuum are consistent with changes in the line-of-sight reddening to the broad-line region. Together with the polarimetric evidence for dust and IRAS photometry this strongly suggests that the Seyfert 1.8/1.9 character is caused by dust and the consequent reddening and extinction. Variability occurs when dust clouds evaporate or move out of line-of-sight, and the extinction then changes. In the so-called narrow line Seyfert 1s spectropolarimetry reveals seven highly-polarized objects. In Mrk 1239 there is evidence for at least two components of polarization, one probably due to dust reflection. In two other objects, Mrk 766 and IRAS 1509-211, the polarization also appears to indicate dust reflection as the polarigenic mechanism. There is a weak circumstantial evidence for an association of the low-density region and the polarizing source, provided by comparison of the radio axes and polarization position angles in Mrk 766 and Mrk 1126

Nebulae and interstellar matter

International Nuclear Information System (INIS)

1987-01-01

The South African Astronomical Observatory (SAAO) has investigated the IRAS source 1912+172. This source appears to be a young planetary nebula with a binary central star. During 1986 SAAO has also studied the following: hydrogen deficient planetary nebulae; high speed flows in HII regions, and the wavelength dependence of interstellar polarization. 2 figs